#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SSPO	23145	genome.wustl.edu	37	7	149506541	149506541	+	RNA	SNP	T	T	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr7:149506541T>A	ENST00000378016.2	+	0	9315							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCTGCCTCTTGTGCAGAGC	0.647													ENSG00000197558																																					0													15.0	20.0	18.0					7																	149506541		1966	4099	6065			0			-	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149506541T>A			Q76B61	R	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	SSPO	-	-		0.647	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		0	0		40	40		0.00		T			149506541	+1	9		58		tier1	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	13.43		SNP	1.000	A	9	58
ENOSF1	55556	genome.wustl.edu	37	18	690702	690703	+	Intron	INS	-	-	AGCTGTTTCCCCTGGAGAGTCC	rs145372402|rs3217715	byFrequency	TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr18:690702_690703insAGCTGTTTCCCCTGGAGAGTCC	ENST00000251101.7	-	8	624				ENOSF1_ENST00000580982.1_Intron|ENOSF1_ENST00000340116.7_Intron|ENOSF1_ENST00000383578.3_Intron|ENOSF1_ENST00000319815.6_5'Flank|ENOSF1_ENST00000583973.1_5'Flank	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1						cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						GCCTGTAGCTAAGCTGTTTCCC	0.52													ENSG00000132199		1644	0.328275	0.2995	0.2305	5008	,	,		24177	0.5704		0.1988	False		,,,				2504	0.32																0																																										SO:0001627	intron_variant	0				X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.536-71->GGACTCTCCAGGGGAAACAGCT	18.37:g.690702_690703insAGCTGTTTCCCCTGGAGAGTCC			A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Frame_Shift_Ins	INS	pfam_Mandelate_racemase_N	p.L156fs	ENST00000251101.7	37	c.467_466	CCDS11822.1	18																																																																																				ENOSF1	-	NULL		0.520	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOSF1	HGNC	protein_coding	OTTHUMT00000254312.2									-	NM_017512		690703	-1					tier1	no_errors	ENST00000581475	ensembl	human	known	74_37	frame_shift_ins			INS	0.000:0.000	AGCTGTTTCCCCTGGAGAGTCC		
TCHHL1	126637	genome.wustl.edu	37	1	152059969	152059969	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:152059969G>C	ENST00000368806.1	-	3	253	c.189C>G	c.(187-189)gaC>gaG	p.D63E		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	63	EF-hand.						calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TGCCATTACTGTCAATATTCA	0.343													ENSG00000182898																																					0													63.0	59.0	61.0					1																	152059969		2203	4300	6503	SO:0001583	missense	0			-		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.189C>G	1.37:g.152059969G>C	ENSP00000357796:p.Asp63Glu		B2RPK8|Q5VTJ9	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.D63E	ENST00000368806.1	37	c.189	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	10.41	1.342369	0.24339	.	.	ENSG00000182898	ENST00000368806	T	0.17528	2.27	5.3	2.01	0.26516	EF-hand-like domain (1);	0.376138	0.19302	N	0.117610	T	0.09247	0.0228	L	0.34521	1.04	0.09310	N	1	D	0.65815	0.995	P	0.57152	0.814	T	0.08700	-1.0709	10	0.51188	T	0.08	-5.6773	5.1961	0.15239	0.4192:0.0:0.5808:0.0	.	63	Q5QJ38	TCHL1_HUMAN	E	63	ENSP00000357796:D63E	ENSP00000357796:D63E	D	-	3	2	TCHHL1	150326593	0.009000	0.17119	0.661000	0.29709	0.040000	0.13550	0.364000	0.20325	0.617000	0.30160	0.453000	0.30009	GAC	-	TCHHL1	-	NULL		0.343	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2	0	0		26	26		0.00		G	XM_060104		152059969	-1	7		52		tier1	no_errors	ENST00000368806	ensembl	human	known	74_37	missense	11.86		SNP	0.079	C	7	52
AASS	10157	genome.wustl.edu	37	7	121733109	121733109	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr7:121733109C>A	ENST00000393376.1	-	15	1854	c.1759G>T	c.(1759-1761)Gaa>Taa	p.E587*	AASS_ENST00000417368.2_Nonsense_Mutation_p.E587*|AASS_ENST00000473553.1_5'UTR			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	587	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						TACCTCTTTTCCAATTCTTTT	0.388													ENSG00000008311																																					0													167.0	172.0	170.0					7																	121733109		2203	4300	6503	SO:0001587	stop_gained	0			-	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.1759G>T	7.37:g.121733109C>A	ENSP00000377040:p.Glu587*		O95462	Nonsense_Mutation	SNP	pfam_Saccharopine_DH/HSpermid_syn,pfam_AlaDH/PNT_D(H)-bd,pfam_AlaDH/PNT_N	p.E587*	ENST00000393376.1	37	c.1759	CCDS5783.1	7	.	.	.	.	.	.	.	.	.	.	C	38	6.919362	0.97936	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	6.07	6.07	0.98685	.	0.046377	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-30.2508	14.7483	0.69505	0.0:0.7513:0.2487:0.0	.	.	.	.	X	587	.	ENSP00000351834:E587X	E	-	1	0	AASS	121520345	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.312000	0.59154	2.885000	0.99019	0.655000	0.94253	GAA	-	AASS	-	pfam_Saccharopine_DH/HSpermid_syn		0.388	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AASS	HGNC	protein_coding	OTTHUMT00000347300.1	0	0		63	63		0.00		C	NM_005763		121733109	-1	6		69		tier1	no_errors	ENST00000393376	ensembl	human	known	74_37	nonsense	8.00		SNP	1.000	A	6	69
PDX1	3651	genome.wustl.edu	37	13	28498562	28498562	+	Silent	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr13:28498562C>A	ENST00000381033.4	+	2	695	c.576C>A	c.(574-576)atC>atA	p.I192I		NM_000209.3	NP_000200.1	O00330	ODPX_HUMAN	pancreatic and duodenal homeobox 1	0	Interaction with DLD.				cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)					all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		ACATCAAGATCTGGTTCCAAA	0.592													ENSG00000139515																																					0													51.0	54.0	53.0					13																	28498562		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF035260	CCDS9327.1	13q12.1	2012-03-09	2006-12-01	2006-12-01	ENSG00000139515	ENSG00000139515		"""Homeoboxes / ANTP class : HOXL subclass"""	6107	protein-coding gene	gene with protein product	"""somatostatin transcription factor 1"""	600733	"""insulin promoter factor 1, homeodomain transcription factor"""	IPF1		7590740	Standard	NM_000209		Approved	IDX-1, STF-1, PDX-1, MODY4	uc001urt.2	P52945	OTTHUMG00000016638	ENST00000381033.4:c.576C>A	13.37:g.28498562C>A			B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.I192	ENST00000381033.4	37	c.576	CCDS9327.1	13																																																																																			-	PDX1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa		0.592	PDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDX1	HGNC	protein_coding	OTTHUMT00000044310.2	0	0		61	61		0.00		C	NM_000209		28498562	+1	12		50		tier1	no_errors	ENST00000381033	ensembl	human	known	74_37	silent	19.35		SNP	1.000	A	12	50
FMN2	56776	genome.wustl.edu	37	1	240492670	240492670	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:240492670T>A	ENST00000319653.9	+	10	4569	c.4339T>A	c.(4339-4341)Ttt>Att	p.F1447I	FMN2_ENST00000545751.1_Missense_Mutation_p.F43I	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1447	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AATCCCCAACTTTTCAGAGCG	0.363													ENSG00000155816																																					0													159.0	149.0	152.0					1																	240492670		2203	4300	6503	SO:0001583	missense	0			-	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4339T>A	1.37:g.240492670T>A	ENSP00000318884:p.Phe1447Ile		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.F1447I	ENST00000319653.9	37	c.4339	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	T	35	5.453262	0.96223	.	.	ENSG00000155816	ENST00000319653;ENST00000441342;ENST00000545751;ENST00000537355	T;T;T	0.16073	2.37;2.37;2.37	5.65	5.65	0.86999	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000009	T	0.40791	0.1131	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.996;0.999;0.998	T	0.22138	-1.0225	10	0.72032	D	0.01	.	15.8761	0.79162	0.0:0.0:0.0:1.0	.	43;93;76;1447	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	I	1447;93;43;74	ENSP00000318884:F1447I;ENSP00000388922:F93I;ENSP00000437918:F43I	ENSP00000318884:F1447I	F	+	1	0	FMN2	238559293	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.139000	0.66308	0.533000	0.62120	TTT	-	FMN2	-	pfam_FH2_Formin,smart_FH2_Formin		0.363	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	0	0		26	26		0.00		T	XM_371352		240492670	+1	6		25		tier1	no_errors	ENST00000319653	ensembl	human	known	74_37	missense	19.35		SNP	1.000	A	6	25
CEACAM8	1088	genome.wustl.edu	37	19	43093685	43093685	+	Silent	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr19:43093685G>A	ENST00000244336.5	-	3	728	c.627C>T	c.(625-627)gaC>gaT	p.D209D	LIPE-AS1_ENST00000594688.1_RNA|CEACAM8_ENST00000599005.1_Intron|LIPE-AS1_ENST00000594624.2_RNA	NM_001816.3	NP_001807.2	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 8	209	Ig-like C2-type 1.				immune response (GO:0006955)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	16		Prostate(69;0.00899)				AGGGTCCTACGTCATTCCTTG	0.517													ENSG00000124469																																					0													275.0	247.0	256.0					19																	43093685		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D90064	CCDS12610.1	19q13.2	2013-01-29			ENSG00000124469	ENSG00000124469		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1820	protein-coding gene	gene with protein product		615747		CGM6		2208113, 2306228	Standard	NM_001816		Approved	CD66b	uc002oud.2	P31997	OTTHUMG00000151124	ENST00000244336.5:c.627C>T	19.37:g.43093685G>A			O60399|Q16574	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D209	ENST00000244336.5	37	c.627	CCDS12610.1	19																																																																																			-	CEACAM8	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.517	CEACAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM8	HGNC	protein_coding	OTTHUMT00000321430.1	0	0		84	84		0.00		G			43093685	-1	33		82		tier1	no_errors	ENST00000244336	ensembl	human	known	74_37	silent	28.70		SNP	0.062	A	33	82
CNTNAP3	79937	genome.wustl.edu	37	9	39099994	39099994	+	Missense_Mutation	SNP	C	C	T	rs528416073		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr9:39099994C>T	ENST00000297668.6	-	18	2982	c.2909G>A	c.(2908-2910)cGc>cAc	p.R970H	CNTNAP3_ENST00000377656.2_Intron|CNTNAP3_ENST00000358144.2_Missense_Mutation_p.R882H	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	970	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CCCTCCATTGCGACACAAGTG	0.572													ENSG00000106714	C|||	1	0.000199681	0.0	0.0	5008	,	,		17441	0.0		0.001	False		,,,				2504	0.0																0													9.0	8.0	9.0					9																	39099994		2179	4254	6433	SO:0001583	missense	0			-	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2909G>A	9.37:g.39099994C>T	ENSP00000297668:p.Arg970His		B1AMA0|Q9C0E9	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R970H	ENST00000297668.6	37	c.2909	CCDS6616.1	9	.	.	.	.	.	.	.	.	.	.	c	3.151	-0.174185	0.06421	.	.	ENSG00000106714	ENST00000297668;ENST00000358144	T;T	0.76448	-1.02;-1.02	3.68	-7.35	0.01422	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.54663	0.1872	N	0.19112	0.55	0.80722	D	1	B;B	0.20368	0.044;0.001	B;B	0.12837	0.008;0.001	T	0.05550	-1.0878	9	0.22109	T	0.4	.	8.488	0.33082	0.2127:0.1198:0.0:0.6676	.	970;970	Q9BZ76-2;Q9BZ76	.;CNTP3_HUMAN	H	970;882	ENSP00000297668:R970H;ENSP00000350863:R882H	ENSP00000297668:R970H	R	-	2	0	CNTNAP3	39089994	0.103000	0.21917	0.019000	0.16419	0.795000	0.44927	0.056000	0.14256	-2.069000	0.00882	-1.166000	0.01754	CGC	-	CNTP3	-	superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,pfscan_EG-like_dom		0.572	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTP3	HGNC	protein_coding	OTTHUMT00000052511.1	0	0		58	58		0.00		C	NM_033655		39099994	-1	11		61		tier1	no_errors	ENST00000297668	ensembl	human	known	74_37	missense	15.28		SNP	0.314	T	11	61
DPY19L4	286148	genome.wustl.edu	37	8	95801976	95801976	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr8:95801976G>T	ENST00000414645.2	+	19	2109	c.2010G>T	c.(2008-2010)atG>atT	p.M670I	KB-1608C10.2_ENST00000521706.1_RNA|KB-1608C10.2_ENST00000510185.2_RNA	NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	670						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					TTTAATAGATGGTTTGTGAAG	0.274													ENSG00000156162																																					0													63.0	72.0	69.0					8																	95801976		2203	4299	6502	SO:0001583	missense	0			-		CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.2010G>T	8.37:g.95801976G>T	ENSP00000389630:p.Met670Ile		Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	pfam_Dpy-19	p.M670I	ENST00000414645.2	37	c.2010	CCDS34924.1	8	.	.	.	.	.	.	.	.	.	.	G	9.325	1.059038	0.19987	.	.	ENSG00000156162	ENST00000414645	T	0.54279	0.58	5.2	2.34	0.29019	.	0.057194	0.64402	D	0.000002	T	0.25865	0.0630	N	0.04203	-0.255	0.26416	N	0.976184	B	0.02656	0.0	B	0.06405	0.002	T	0.14364	-1.0475	10	0.29301	T	0.29	-10.5803	7.7969	0.29152	0.1412:0.0:0.7268:0.132	.	670	Q7Z388	D19L4_HUMAN	I	670	ENSP00000389630:M670I	ENSP00000389630:M670I	M	+	3	0	DPY19L4	95871152	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	1.461000	0.35255	0.245000	0.21373	0.563000	0.77884	ATG	-	DPY19L4	-	pfam_Dpy-19		0.274	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L4	HGNC	protein_coding	OTTHUMT00000379339.1	0	0		81	81		0.00		G	NM_181787		95801976	+1	10		77		tier1	no_errors	ENST00000414645	ensembl	human	known	74_37	missense	11.49		SNP	1.000	T	10	77
ODF3B	440836	genome.wustl.edu	37	22	50969671	50969671	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr22:50969671G>T	ENST00000428989.2	-	3	366	c.367C>A	c.(367-369)Cac>Aac	p.H123N	TYMP_ENST00000395681.1_5'Flank|TYMP_ENST00000252029.3_5'Flank|ODF3B_ENST00000401779.1_Missense_Mutation_p.A99E|TYMP_ENST00000395678.3_5'Flank|TYMP_ENST00000395680.1_5'Flank|ODF3B_ENST00000329363.4_Missense_Mutation_p.H123N|ODF3B_ENST00000403326.1_Missense_Mutation_p.H55N|ODF3B_ENST00000405135.1_Missense_Mutation_p.A138E			A8MYP8	ODF3B_HUMAN	outer dense fiber of sperm tails 3B	123										lung(2)	2						GCAATGGTGTGCCGAGGCGCA	0.667													ENSG00000177989																																					0													32.0	37.0	35.0					22																	50969671		2036	4167	6203	SO:0001583	missense	0			-		CCDS43039.1	22q13.33	2008-10-24			ENSG00000177989	ENSG00000177989			34388	protein-coding gene	gene with protein product							Standard	NM_001014440		Approved		uc003bmh.2	A8MYP8	OTTHUMG00000150334	ENST00000428989.2:c.367C>A	22.37:g.50969671G>T	ENSP00000390712:p.His123Asn		A0PK18	Missense_Mutation	SNP	pfam_SHIPPO-rpt	p.H123N	ENST00000428989.2	37	c.367	CCDS43039.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.86|13.86	2.363795|2.363795	0.41902|0.41902	.|.	.|.	ENSG00000177989|ENSG00000177989	ENST00000401779;ENST00000405135|ENST00000329363;ENST00000403326;ENST00000428989	T|T;T;T	0.35789|0.30448	1.29|1.53;1.54;1.53	4.38|4.38	2.27|2.27	0.28462|0.28462	.|.	.|.	.|.	.|.	.|.	T|T	0.29491|0.29491	0.0735|0.0735	L|L	0.41710|0.41710	1.295|1.295	0.26779|0.26779	N|N	0.969633|0.969633	P|P	0.51351|0.42620	0.944|0.785	P|P	0.56042|0.46585	0.79|0.521	T|T	0.11397|0.11397	-1.0589|-1.0589	9|9	0.72032|0.56958	D|D	0.01|0.05	-1.0287|-1.0287	6.5358|6.5358	0.22352|0.22352	0.2213:0.0:0.7787:0.0|0.2213:0.0:0.7787:0.0	.|.	99|123	B5MD02|A8MYP8	.|ODF3B_HUMAN	E|N	99;138|123;55;123	ENSP00000384012:A138E|ENSP00000382804:H123N;ENSP00000385123:H55N;ENSP00000390712:H123N	ENSP00000384310:A99E|ENSP00000382804:H123N	A|H	-|-	2|1	0|0	ODF3B|ODF3B	49316537|49316537	0.936000|0.936000	0.31750|0.31750	0.997000|0.997000	0.53966|0.53966	0.411000|0.411000	0.31082|0.31082	1.362000|1.362000	0.34148|0.34148	0.573000|0.573000	0.29400|0.29400	0.561000|0.561000	0.74099|0.74099	GCA|CAC	-	ODF3B	-	NULL		0.667	ODF3B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF3B	HGNC	protein_coding	OTTHUMT00000317626.2	0	0		32	32		0.00		G			50969671	-1	4		34		tier1	no_errors	ENST00000329363	ensembl	human	known	74_37	missense	10.53		SNP	0.999	T	4	34
PSME4	23198	genome.wustl.edu	37	2	54153144	54153144	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr2:54153144C>T	ENST00000404125.1	-	13	1665	c.1610G>A	c.(1609-1611)tGt>tAt	p.C537Y	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	537					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGTGGCTGAACAAAGTTCTCG	0.373													ENSG00000068878																																					0													126.0	125.0	125.0					2																	54153144		2203	4300	6503	SO:0001583	missense	0			-	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.1610G>A	2.37:g.54153144C>T	ENSP00000384211:p.Cys537Tyr		Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	pfam_DUF3437,superfamily_ARM-type_fold	p.C537Y	ENST00000404125.1	37	c.1610	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905087	0.72868	.	.	ENSG00000068878	ENST00000404125	T	0.04917	3.53	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.21718	0.0523	M	0.81497	2.545	0.80722	D	1	D	0.69078	0.997	P	0.55965	0.788	T	0.03354	-1.1045	10	0.21014	T	0.42	.	19.1666	0.93560	0.0:1.0:0.0:0.0	.	537	Q14997	PSME4_HUMAN	Y	537	ENSP00000384211:C537Y	ENSP00000374643:C537Y	C	-	2	0	PSME4	54006648	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.676000	0.84012	2.608000	0.88229	0.557000	0.71058	TGT	-	PSME4	-	superfamily_ARM-type_fold		0.373	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1	0	0		30	30		0.00		C	XM_040158		54153144	-1	12		46		tier1	no_errors	ENST00000404125	ensembl	human	known	74_37	missense	20.69		SNP	1.000	T	12	46
FGG	2266	genome.wustl.edu	37	4	155526181	155526181	+	Nonsense_Mutation	SNP	A	A	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr4:155526181A>C	ENST00000336098.3	-	9	1205	c.1167T>G	c.(1165-1167)taT>taG	p.Y389*	FGG_ENST00000407946.1_Nonsense_Mutation_p.Y397*|FGG_ENST00000404648.3_Nonsense_Mutation_p.Y389*|FGG_ENST00000405164.1_Nonsense_Mutation_p.Y397*	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	389	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TGCCATTATCATAACCATTAG	0.383													ENSG00000171557																																					0													128.0	120.0	123.0					4																	155526181		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.1167T>G	4.37:g.155526181A>C	ENSP00000336829:p.Tyr389*		A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Nonsense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.Y389*	ENST00000336098.3	37	c.1167	CCDS3788.1	4	.	.	.	.	.	.	.	.	.	.	A	33	5.203035	0.95033	.	.	ENSG00000171557	ENST00000404648;ENST00000405164;ENST00000336098;ENST00000407946	.	.	.	6.17	3.68	0.42216	.	0.214072	0.50627	D	0.000112	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0821	0.48066	0.8738:0.0:0.1262:0.0	.	.	.	.	X	389;397;389;397	.	ENSP00000336829:Y389X	Y	-	3	2	FGG	155745631	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	1.930000	0.40124	0.527000	0.28560	-0.274000	0.10170	TAT	-	FGG	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom		0.383	FGG-002	KNOWN	basic|CCDS	protein_coding	FGG	HGNC	protein_coding	OTTHUMT00000317581.1	0	0		79	79		0.00		A	NM_021870		155526181	-1	8		56		tier1	no_errors	ENST00000336098	ensembl	human	known	74_37	nonsense	12.50		SNP	1.000	C	8	56
KIF7	374654	genome.wustl.edu	37	15	90176221	90176221	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:90176221C>G	ENST00000394412.3	-	14	2801	c.2725G>C	c.(2725-2727)Gag>Cag	p.E909Q		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	909					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			TTCTGCTCCTCAATCTTCTAA	0.622													ENSG00000166813																																					0													27.0	25.0	26.0					15																	90176221		2200	4299	6499	SO:0001583	missense	0			-	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2725G>C	15.37:g.90176221C>G	ENSP00000377934:p.Glu909Gln		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E909Q	ENST00000394412.3	37	c.2725	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552408	0.65311	.	.	ENSG00000166813	ENST00000394412	T	0.48522	0.81	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.67135	0.2861	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.83275	0.811;0.996	T	0.63514	-0.6620	10	0.22109	T	0.4	.	17.9147	0.88945	0.0:1.0:0.0:0.0	.	395;909	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	Q	909	ENSP00000377934:E909Q	ENSP00000377934:E909Q	E	-	1	0	KIF7	87977225	1.000000	0.71417	0.999000	0.59377	0.895000	0.52256	5.985000	0.70556	2.306000	0.77630	0.462000	0.41574	GAG	-	KIF7	-	NULL		0.622	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	0	0		20	20		0.00		C	NM_198525		90176221	-1	6		34		tier1	no_errors	ENST00000394412	ensembl	human	known	74_37	missense	15.00		SNP	1.000	G	6	34
NHSL2	340527	genome.wustl.edu	37	X	71359470	71359470	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chrX:71359470C>G	ENST00000373677.1	+	2	2236	c.974C>G	c.(973-975)tCc>tGc	p.S325C	NHSL2_ENST00000535692.1_Missense_Mutation_p.S325C|NHSL2_ENST00000510661.1_Missense_Mutation_p.S460C|NHSL2_ENST00000540800.1_Missense_Mutation_p.S691C			Q5HYW2	NHSL2_HUMAN	NHS-like 2	325	Ser-rich.									NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					TCCCAACTCTCCATTGAAGTG	0.587													ENSG00000204131																																					0													49.0	42.0	45.0					X																	71359470		2203	4300	6503	SO:0001583	missense	0			-			Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.974C>G	X.37:g.71359470C>G	ENSP00000362781:p.Ser325Cys		B2RN94	Missense_Mutation	SNP	NULL	p.S691C	ENST00000373677.1	37	c.2072		X	.	.	.	.	.	.	.	.	.	.	C	13.74	2.328715	0.41197	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.60299	1.08;0.2;0.4;0.2	5.87	5.87	0.94306	.	0.059866	0.64402	D	0.000002	T	0.71626	0.3362	M	0.76170	2.325	0.45899	D	0.998748	D;D;P	0.56521	0.976;0.976;0.933	P;P;P	0.55391	0.775;0.775;0.775	T	0.75470	-0.3306	10	0.87932	D	0	-12.8259	16.4108	0.83712	0.0:1.0:0.0:0.0	.	691;460;325	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	C	691;325;460;325	ENSP00000444617:S691C;ENSP00000362781:S325C;ENSP00000424079:S460C;ENSP00000444914:S325C	ENSP00000362781:S325C	S	+	2	0	NHSL2	71276195	1.000000	0.71417	0.999000	0.59377	0.737000	0.42083	5.961000	0.70356	2.481000	0.83766	0.600000	0.82982	TCC	-	NHSL2	-	NULL		0.587	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	0	0		33	33		0.00		C	NM_001013627		71359470	+1	7		60		tier1	no_errors	ENST00000540800	ensembl	human	known	74_37	missense	10.45		SNP	1.000	G	7	60
GOLGA6L2	283685	genome.wustl.edu	37	15	23685017	23685017	+	Missense_Mutation	SNP	C	C	G	rs190025566		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:23685017C>G	ENST00000567107.1	-	8	2657	c.2605G>C	c.(2605-2607)Gca>Cca	p.A869P	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Missense_Mutation_p.A274P			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						tctcctcctgcccccacatct	0.607													ENSG00000174450																																					0																																										SO:0001583	missense	0			-	AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2605G>C	15.37:g.23685017C>G	ENSP00000454407:p.Ala869Pro		A1L301	Missense_Mutation	SNP	prints_Tropomyosin	p.A274P	ENST00000567107.1	37	c.820		15	.	.	.	.	.	.	.	.	.	.	N	1.613	-0.523604	0.04141	.	.	ENSG00000174450	ENST00000345070	T	0.55930	0.49	0.476	0.476	0.16779	.	.	.	.	.	T	0.41351	0.1155	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33240	-0.9876	5	0.30854	T	0.27	.	.	.	.	.	.	.	.	P	274	ENSP00000344626:A274P	ENSP00000344626:A274P	A	-	1	0	GOLGA6L2	21236458	0.126000	0.22350	0.003000	0.11579	0.010000	0.07245	0.991000	0.29654	0.501000	0.28013	0.165000	0.16767	GCA	rs190025566	GOLGA6L2	-	NULL		0.607	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	0	0		32	32		0.00		C	NM_182561		23685017	-1	5		38		tier1	no_errors	ENST00000345070	ensembl	human	known	74_37	missense	11.63		SNP	0.003	G	5	38
MYH13	8735	genome.wustl.edu	37	17	10216011	10216011	+	Silent	SNP	G	G	A	rs368930513		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr17:10216011G>A	ENST00000418404.3	-	30	4408	c.4245C>T	c.(4243-4245)tgC>tgT	p.C1415C	MYH13_ENST00000252172.4_Silent_p.C1415C|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1415					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.C1415C(4)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CCAACGATGCGCACTTGGAGT	0.552													ENSG00000006788																																					4	Substitution - coding silent(4)	large_intestine(2)|endometrium(2)											50.0	54.0	53.0					17																	10216011		2195	4298	6493	SO:0001819	synonymous_variant	0			-	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4245C>T	17.37:g.10216011G>A			O95252|Q9P0U8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.C1415	ENST00000418404.3	37	c.4245	CCDS45613.1	17																																																																																			-	MYH13	-	pfam_Myosin_tail		0.552	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	0	0		27	27		0.00		G	NM_003802		10216011	-1	5		44		tier1	no_errors	ENST00000252172	ensembl	human	known	74_37	silent	10.20		SNP	0.993	A	5	44
RB1	5925	genome.wustl.edu	37	13	48953787	48953787	+	Splice_Site	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr13:48953787G>A	ENST00000267163.4	+	14	1527		c.e14+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GCTTAAATCAGTAAGTTAAAA	0.428		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	25	Whole gene deletion(15)|Unknown(10)	bone(11)|breast(5)|eye(2)|central_nervous_system(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)	GRCh37	CS030554|CS040291	RB1	S							19.0	20.0	20.0					13																	48953787		2200	4300	6500	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1389+1G>A	13.37:g.48953787G>A			A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	-	e14+1	ENST00000267163.4	37	c.1389+1	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392897	0.83011	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7359	0.88392	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47851788	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.575000	0.82447	2.182000	0.69389	0.460000	0.39030	.	-	RB1	-	-		0.428	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0		272	272		0.00		G		Intron	48953787	+1	89		191		tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	splice_site	31.79		SNP	1.000	A	89	191
PRRC2A	7916	genome.wustl.edu	37	6	31605306	31605306	+	Silent	SNP	G	G	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr6:31605306G>T	ENST00000376033.2	+	31	6651	c.6417G>T	c.(6415-6417)cgG>cgT	p.R2139R	PRRC2A_ENST00000376007.4_Silent_p.R2139R	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	2139						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CCTCCCGACGGGCAGAGGAGC	0.672													ENSG00000204469																																					0													47.0	59.0	55.0					6																	31605306		1510	2708	4218	SO:0001819	synonymous_variant	0			-	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.6417G>T	6.37:g.31605306G>T			B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	pfam_BAT2_N	p.R2139	ENST00000376033.2	37	c.6417	CCDS4708.1	6																																																																																			-	PRRC2A	-	NULL		0.672	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	0	0		97	97		0.00		G	NM_080686		31605306	+1	16		139		tier1	no_errors	ENST00000376007	ensembl	human	known	74_37	silent	10.32		SNP	0.964	T	16	139
WDR76	79968	genome.wustl.edu	37	15	44158334	44158334	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:44158334C>T	ENST00000263795.6	+	13	1695	c.1625C>T	c.(1624-1626)aCt>aTt	p.T542I	WDR76_ENST00000381246.2_Missense_Mutation_p.T478I|WDR76_ENST00000478130.1_3'UTR|Y_RNA_ENST00000363521.1_RNA	NM_001167941.1|NM_024908.3	NP_001161413.1|NP_079184.2	Q9H967	WDR76_HUMAN	WD repeat domain 76	542										breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)	20		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		AGGCACAACACTTTCACTGGG	0.453													ENSG00000092470																																					0													92.0	85.0	87.0					15																	44158334		2198	4298	6496	SO:0001583	missense	0			-	AK023035	CCDS10106.1, CCDS53938.1	15q15.3	2013-01-09			ENSG00000092470	ENSG00000092470		"""WD repeat domain containing"""	25773	protein-coding gene	gene with protein product						12860291	Standard	NM_024908		Approved	FLJ12973	uc001zti.2	Q9H967	OTTHUMG00000060143	ENST00000263795.6:c.1625C>T	15.37:g.44158334C>T	ENSP00000263795:p.Thr542Ile		A0MNP5|Q05CI4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.T542I	ENST00000263795.6	37	c.1625	CCDS10106.1	15	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101726	0.56183	.	.	ENSG00000092470	ENST00000263795;ENST00000381246	T;T	0.65916	-0.18;-0.18	5.97	2.8	0.32819	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.197522	0.51477	D	0.000098	T	0.60753	0.2293	M	0.68317	2.08	0.35608	D	0.808446	P	0.46395	0.877	P	0.45881	0.496	T	0.70385	-0.4886	10	0.52906	T	0.07	-7.664	7.9232	0.29859	0.2914:0.6261:0.0:0.0825	.	542	Q9H967	WDR76_HUMAN	I	542;478	ENSP00000263795:T542I;ENSP00000370645:T478I	ENSP00000263795:T542I	T	+	2	0	WDR76	41945626	0.994000	0.37717	0.992000	0.48379	0.812000	0.45895	1.402000	0.34600	1.531000	0.49152	0.655000	0.94253	ACT	-	WDR76	-	superfamily_WD40_repeat_dom		0.453	WDR76-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR76	HGNC	protein_coding	OTTHUMT00000133482.2	0	0		35	35		0.00		C	NM_024908		44158334	+1	4		46		tier1	no_errors	ENST00000263795	ensembl	human	known	74_37	missense	8.00		SNP	0.993	T	4	46
NAV1	89796	genome.wustl.edu	37	1	201618518	201618518	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:201618518G>A	ENST00000367296.4	+	1	1142	c.722G>A	c.(721-723)gGa>gAa	p.G241E	NAV1_ENST00000367297.4_Missense_Mutation_p.G241E|NAV1_ENST00000367300.3_Missense_Mutation_p.G241E|NAV1_ENST00000295624.6_Missense_Mutation_p.G241E|NAV1_ENST00000367302.1_Missense_Mutation_p.G254E	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	241					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						ACCGTGCTGGGAGACCTGGAG	0.677													ENSG00000134369																																					0													11.0	13.0	13.0					1																	201618518		2192	4283	6475	SO:0001583	missense	0			-	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.722G>A	1.37:g.201618518G>A	ENSP00000356265:p.Gly241Glu		A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G241E	ENST00000367296.4	37	c.722	CCDS1414.2	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575456	0.86645	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	M	0.72118	2.19	0.54753	D	0.999985	D	0.89917	1.0	D	0.97110	1.0	T	0.73607	-0.3929	10	0.87932	D	0	-18.4711	17.3345	0.87276	0.0:0.0:1.0:0.0	.	241	Q8NEY1-3	.	E	254;241;241;241;241	ENSP00000356271:G254E;ENSP00000356265:G241E;ENSP00000295624:G241E;ENSP00000356266:G241E;ENSP00000356269:G241E	ENSP00000295624:G241E	G	+	2	0	NAV1	199885141	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	8.829000	0.92055	2.180000	0.69256	0.313000	0.20887	GGA	-	V1	-	NULL		0.677	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	V1	HGNC	protein_coding	OTTHUMT00000087013.1	0	0		44	44		0.00		G	NM_020443		201618518	+1	7		74		tier1	no_errors	ENST00000367296	ensembl	human	known	74_37	missense	8.64		SNP	1.000	A	7	74
CHRNA7	1139	genome.wustl.edu	37	15	32393542	32393542	+	Silent	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:32393542C>T	ENST00000306901.3	+	3	329	c.232C>T	c.(232-234)Ctg>Ttg	p.L78L	CHRNA7_ENST00000455693.2_5'UTR|CHRNA7_ENST00000454250.3_Silent_p.L107L	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	78					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CAACATTTGGCTGCAAATGGT	0.373													ENSG00000175344																									Esophageal Squamous(193;529 2900 40232 43193)												0													142.0	137.0	139.0					15																	32393542		2201	4300	6501	SO:0001819	synonymous_variant	0			-	Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.232C>T	15.37:g.32393542C>T			A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.L107	ENST00000306901.3	37	c.319	CCDS10027.1	15																																																																																			-	CHR7	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel		0.373	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHR7	HGNC	protein_coding	OTTHUMT00000251410.2	0	0		36	36		0.00		C			32393542	+1	19		25		tier1	no_errors	ENST00000454250	ensembl	human	known	74_37	silent	43.18		SNP	1.000	T	19	25
SPATS1	221409	genome.wustl.edu	37	6	44336210	44336210	+	Silent	SNP	A	A	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr6:44336210A>C	ENST00000288390.2	+	5	1016	c.669A>C	c.(667-669)tcA>tcC	p.S223S	SPATS1_ENST00000323108.8_Silent_p.S223S|RP11-444E17.6_ENST00000505802.1_3'UTR			Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	223										NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(5)|skin(1)|urinary_tract(1)	14	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AAGCAGGATCAATGCTCCCAC	0.373													ENSG00000249481																																					0													110.0	107.0	108.0					6																	44336210		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK058171	CCDS4911.1	6p21.1	2003-08-08			ENSG00000249481	ENSG00000249481			22957	protein-coding gene	gene with protein product							Standard	NM_145026		Approved	SPATA8, FLJ25442, SRSP1	uc021yzz.1	Q496A3	OTTHUMG00000014764	ENST00000288390.2:c.669A>C	6.37:g.44336210A>C			Q496A2|Q496A5|Q96LJ0	Silent	SNP	NULL	p.S223	ENST00000288390.2	37	c.669	CCDS4911.1	6																																																																																			-	SPATS1	-	NULL		0.373	SPATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATS1	HGNC	protein_coding	OTTHUMT00000040738.2	0	0		51	51		0.00		A	NM_145026		44336210	+1	7		67		tier1	no_errors	ENST00000288390	ensembl	human	known	74_37	silent	9.46		SNP	0.988	C	7	67
NR1I3	9970	genome.wustl.edu	37	1	161202645	161202645	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:161202645A>G	ENST00000367982.4	-	5	655	c.500T>C	c.(499-501)tTc>tCc	p.F167S	NR1I3_ENST00000367979.2_Missense_Mutation_p.F167S|NR1I3_ENST00000508740.1_Missense_Mutation_p.F138S|NR1I3_ENST00000412844.2_Missense_Mutation_p.F138S|NR1I3_ENST00000515452.1_Missense_Mutation_p.F167S|NR1I3_ENST00000515621.1_Missense_Mutation_p.F92S|NR1I3_ENST00000502985.1_Intron|NR1I3_ENST00000511676.1_Missense_Mutation_p.F138S|NR1I3_ENST00000367981.3_Missense_Mutation_p.F138S|NR1I3_ENST00000504010.1_Missense_Mutation_p.F138S|NR1I3_ENST00000508387.1_Intron|NR1I3_ENST00000512372.1_Missense_Mutation_p.F138S|NR1I3_ENST00000437437.2_Missense_Mutation_p.F138S|NR1I3_ENST00000511748.1_Intron|NR1I3_ENST00000479324.1_5'Flank|NR1I3_ENST00000367983.4_Missense_Mutation_p.F167S|NR1I3_ENST00000428574.2_Missense_Mutation_p.F167S|NR1I3_ENST00000511944.1_Intron|NR1I3_ENST00000367985.3_Missense_Mutation_p.F167S|NR1I3_ENST00000442691.2_Missense_Mutation_p.F167S|NR1I3_ENST00000367980.2_Missense_Mutation_p.F167S|NR1I3_ENST00000505005.1_Missense_Mutation_p.F167S|NR1I3_ENST00000506209.1_Missense_Mutation_p.F138S|NR1I3_ENST00000367984.4_Missense_Mutation_p.F167S			Q14994	NR1I3_HUMAN	nuclear receptor subfamily 1, group I, member 3	167					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	15	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CAGTACCATGAAAGTGTTGAT	0.517													ENSG00000143257																																					0													146.0	146.0	146.0					1																	161202645		2203	4300	6503	SO:0001583	missense	0			-	Z30425	CCDS1228.1, CCDS41427.1, CCDS41428.1, CCDS41429.1, CCDS41430.1, CCDS44260.1, CCDS44261.1, CCDS44262.1, CCDS53405.1, CCDS53406.1, CCDS53407.1, CCDS53408.1, CCDS53409.1, CCDS53410.1, CCDS53411.1	1q23.3	2013-01-16			ENSG00000143257	ENSG00000143257		"""Nuclear hormone receptors"""	7969	protein-coding gene	gene with protein product	"""constitutive androstane receptor"""	603881				8114692	Standard	NM_001077480		Approved	MB67, CAR1, CAR	uc001fzp.3	Q14994	OTTHUMG00000034347	ENST00000367982.4:c.500T>C	1.37:g.161202645A>G	ENSP00000356961:p.Phe167Ser		E9PB75|E9PC13|E9PDU3|E9PGH6|E9PH10|E9PHC8|E9PHN4|F1D8Q0|F1D8Q1|Q0VAC9|Q4U0F0|Q5VTW5|Q5VTW6|Q6GZ68|Q6GZ76|Q6GZ77|Q6GZ78|Q6GZ79|Q6GZ82|Q6GZ83|Q6GZ84|Q6GZ85|Q6GZ87|Q6GZ89	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.F167S	ENST00000367982.4	37	c.500	CCDS41430.1	1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.647184	0.67358	.	.	ENSG00000143257	ENST00000512372;ENST00000367983;ENST00000367980;ENST00000437437;ENST00000442691;ENST00000412844;ENST00000428574;ENST00000505005;ENST00000508740;ENST00000367982;ENST00000504010;ENST00000511676;ENST00000367981;ENST00000515621;ENST00000367984;ENST00000367985;ENST00000367979;ENST00000506209;ENST00000515452	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04	5.4	4.25	0.50352	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.165699	0.56097	D	0.000034	D	0.94857	0.8338	L	0.42245	1.32	0.38270	D	0.942121	P;P;D;B;D;B;P;P;D;P;D;P;D;P;P;D;D;D	0.76494	0.954;0.95;0.999;0.161;0.987;0.161;0.928;0.851;0.999;0.928;0.989;0.922;0.994;0.851;0.95;0.997;0.999;0.999	P;P;D;B;P;B;P;P;D;P;D;P;P;P;P;D;D;D	0.74674	0.727;0.857;0.977;0.129;0.776;0.184;0.895;0.818;0.977;0.86;0.956;0.701;0.902;0.802;0.708;0.977;0.984;0.977	D	0.93761	0.7067	9	0.39692	T	0.17	.	7.9888	0.30229	0.6395:0.0:0.0:0.3605	.	167;138;138;167;167;167;167;167;167;167;92;138;138;138;138;138;138;167	B7Z8R7;E9PCF2;E9PHN4;Q6GZ85;E9PHC8;Q0VAC9;F1D8Q1;Q14994;E9PC13;Q4U0F0;D6REZ7;Q6GZ87;E9PDU3;Q6GZ68;E9PH10;Q6GZ84;E9PGH6;E9PB75	.;.;.;.;.;.;.;NR1I3_HUMAN;.;.;.;.;.;.;.;.;.;.	S	138;167;167;138;167;138;167;167;138;167;138;138;138;92;167;167;167;138;167	ENSP00000425417:F138S;ENSP00000356962:F167S;ENSP00000356959:F167S;ENSP00000407446:F138S;ENSP00000406493:F167S;ENSP00000399361:F138S;ENSP00000412672:F167S;ENSP00000424934:F167S;ENSP00000423666:F138S;ENSP00000356961:F167S;ENSP00000424345:F138S;ENSP00000427175:F138S;ENSP00000356960:F138S;ENSP00000421588:F92S;ENSP00000356963:F167S;ENSP00000356965:F167S;ENSP00000356958:F167S;ENSP00000423089:F138S;ENSP00000427034:F167S	ENSP00000356958:F167S	F	-	2	0	NR1I3	159469269	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	2.560000	0.45896	1.025000	0.39708	0.459000	0.35465	TTC	-	NR1I3	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt		0.517	NR1I3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR1I3	HGNC	protein_coding	OTTHUMT00000083048.2	0	0		30	30		0.00		A			161202645	-1	16		31		tier1	no_errors	ENST00000367979	ensembl	human	known	74_37	missense	34.04		SNP	0.998	G	16	31
RLTPR	146206	genome.wustl.edu	37	16	67685131	67685131	+	Silent	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr16:67685131G>A	ENST00000334583.6	+	23	2554	c.2226G>A	c.(2224-2226)gaG>gaA	p.E742E	RLTPR_ENST00000545661.1_Silent_p.E706E	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	742					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		AGCATGTGGAGCTGCTGGGCT	0.622													ENSG00000159753																																					0													45.0	52.0	50.0					16																	67685131		2136	4252	6388	SO:0001819	synonymous_variant	0			-	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.2226G>A	16.37:g.67685131G>A			B8X2Z3	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E742	ENST00000334583.6	37	c.2226	CCDS45513.1	16																																																																																			-	RLTPR	-	NULL		0.622	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1	0	0		50	50		0.00		G	NM_001013838		67685131	+1	11		51		tier1	no_errors	ENST00000334583	ensembl	human	known	74_37	silent	17.74		SNP	1.000	A	11	51
POU2F1	5451	genome.wustl.edu	37	1	167381214	167381214	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:167381214C>T	ENST00000541643.3	+	15	1667	c.1505C>T	c.(1504-1506)tCc>tTc	p.S502F	POU2F1_ENST00000420254.3_Missense_Mutation_p.S502F|POU2F1_ENST00000429375.2_Missense_Mutation_p.S462F|POU2F1_ENST00000367862.5_Missense_Mutation_p.S514F|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367866.2_Missense_Mutation_p.S525F			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	502					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						GACACCACCTCCAACAACACA	0.502													ENSG00000143190																																					0													78.0	77.0	77.0					1																	167381214		2203	4300	6503	SO:0001583	missense	0			-	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.1505C>T	1.37:g.167381214C>T	ENSP00000441285:p.Ser502Phe		B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.S525F	ENST00000541643.3	37	c.1574		1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307100	0.60305	.	.	ENSG00000143190	ENST00000367866;ENST00000429375;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	D;D;T;T;T;T;T	0.86627	-2.15;-2.15;0.95;0.95;0.95;0.95;0.95	5.5	5.5	0.81552	.	0.000000	0.53938	D	0.000052	T	0.78566	0.4303	N	0.14661	0.345	0.29450	N	0.8585309999999999	P;P;P;B;P	0.42620	0.679;0.545;0.785;0.115;0.679	B;B;P;B;B	0.44990	0.276;0.371;0.466;0.143;0.276	D	0.83422	0.0033	9	0.72032	D	0.01	.	19.7622	0.96325	0.0:1.0:0.0:0.0	.	462;502;514;500;502	B4E029;P14859-4;P14859-2;P14859-3;P14859	.;.;.;.;PO2F1_HUMAN	F	525;462;500;502;502;514;410	ENSP00000356840:S525F;ENSP00000401217:S462F;ENSP00000356839:S500F;ENSP00000414660:S502F;ENSP00000441285:S502F;ENSP00000356836:S514F;ENSP00000415993:S410F	ENSP00000356836:S514F	S	+	2	0	POU2F1	165647838	0.999000	0.42202	1.000000	0.80357	0.986000	0.74619	2.821000	0.48065	2.732000	0.93576	0.650000	0.86243	TCC	-	POU2F1	-	NULL		0.502	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		0	0		25	25		0.00		C	NM_002697		167381214	+1	7		38		tier1	no_errors	ENST00000367866	ensembl	human	known	74_37	missense	15.56		SNP	1.000	T	7	38
URM1	81605	genome.wustl.edu	37	9	131152123	131152123	+	3'UTR	SNP	G	G	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr9:131152123G>T	ENST00000372853.4	+	0	478				URM1_ENST00000483206.1_3'UTR|RP11-339B21.11_ENST00000609303.1_lincRNA|URM1_ENST00000372850.1_3'UTR|MIR219-2_ENST00000385220.1_lincRNA|URM1_ENST00000452446.1_3'UTR	NM_001265582.1|NM_030914.3	NP_001252511.1|NP_112176.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						CTTCTTCCCTGCTCTGTCCCC	0.602													ENSG00000167118																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000372853.4:c.*110G>T	9.37:g.131152123G>T				R	SNP	-	NULL	ENST00000372853.4	37	NULL	CCDS6900.1	9																																																																																			-	URM1	-	-		0.602	URM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URM1	HGNC	protein_coding	OTTHUMT00000054422.1	0	0		36	36		0.00		G	NM_030914		131152123	+1	7		53		tier1	no_errors	ENST00000483206	ensembl	human	known	74_37	rna	11.67		SNP	0.982	T	7	53
PRRC2A	7916	genome.wustl.edu	37	6	31603240	31603240	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr6:31603240G>A	ENST00000376033.2	+	23	5605	c.5371G>A	c.(5371-5373)Gag>Aag	p.E1791K	PRRC2A_ENST00000376007.4_Missense_Mutation_p.E1791K	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1791	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						ATCAGTCACTGAGGTAAGTGG	0.522													ENSG00000204469																																					0													113.0	111.0	112.0					6																	31603240		1511	2709	4220	SO:0001583	missense	0			-	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.5371G>A	6.37:g.31603240G>A	ENSP00000365201:p.Glu1791Lys		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.E1791K	ENST00000376033.2	37	c.5371	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628901	0.46944	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01854	4.6;4.6	4.94	4.94	0.65067	.	0.207947	0.34268	N	0.004101	T	0.00845	0.0028	N	0.14661	0.345	0.37687	D	0.92369	P	0.37466	0.596	B	0.29077	0.098	T	0.64313	-0.6437	10	0.87932	D	0	-6.4453	15.578	0.76408	0.0:0.0:1.0:0.0	.	1791	P48634	PRC2A_HUMAN	K	1785;1774;1791;1791;1016	ENSP00000365175:E1791K;ENSP00000365201:E1791K	ENSP00000365175:E1791K	E	+	1	0	PRRC2A	31711219	1.000000	0.71417	0.998000	0.56505	0.890000	0.51754	4.776000	0.62354	2.758000	0.94735	0.561000	0.74099	GAG	-	PRRC2A	-	NULL		0.522	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	0	0		33	33		0.00		G	NM_080686		31603240	+1	6		47		tier1	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	11.32		SNP	0.995	A	6	47
TENM2	57451	genome.wustl.edu	37	5	167654985	167654985	+	Silent	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr5:167654985C>T	ENST00000518659.1	+	25	5409	c.5370C>T	c.(5368-5370)agC>agT	p.S1790S	TENM2_ENST00000403607.2_Silent_p.S1614S|TENM2_ENST00000545108.1_Silent_p.S1789S|TENM2_ENST00000520394.1_Silent_p.S1551S|TENM2_ENST00000519204.1_Silent_p.S1669S|CTB-178M22.2_ENST00000519795.1_RNA	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1790					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GCTTCCACAGCGAGCCCCATG	0.512													ENSG00000145934																																					0													61.0	63.0	62.0					5																	167654985		2020	4183	6203	SO:0001819	synonymous_variant	0			-	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5370C>T	5.37:g.167654985C>T			Q9ULU2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.S1790	ENST00000518659.1	37	c.5370		5																																																																																			-	TENM2	-	superfamily_ConA-like_lec_gl_sf		0.512	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	0	0		26	26		0.00		C	NM_001122679		167654985	+1	4		27		tier1	no_errors	ENST00000518659	ensembl	human	known	74_37	silent	12.90		SNP	0.218	T	4	27
GRIN2A	2903	genome.wustl.edu	37	16	10274089	10274089	+	Silent	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr16:10274089C>T	ENST00000396573.2	-	3	489	c.180G>A	c.(178-180)gcG>gcA	p.A60A	GRIN2A_ENST00000404927.2_Silent_p.A60A|GRIN2A_ENST00000330684.3_Silent_p.A60A|GRIN2A_ENST00000396575.2_Silent_p.A60A|GRIN2A_ENST00000562109.1_Silent_p.A60A	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	60					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCAGCCCCGCCGCCTGCTCGG	0.652													ENSG00000183454																																					0													60.0	65.0	64.0					16																	10274089		2197	4299	6496	SO:0001819	synonymous_variant	0			-		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.180G>A	16.37:g.10274089C>T			O00669|Q17RZ6	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A60	ENST00000396573.2	37	c.180	CCDS10539.1	16																																																																																			-	GRIN2A	-	superfamily_Peripla_BP_I		0.652	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	0	0		34	34		0.00		C			10274089	-1	19		46		tier1	no_errors	ENST00000330684	ensembl	human	known	74_37	silent	29.23		SNP	0.000	T	19	46
BTN3A2	11118	genome.wustl.edu	37	6	26365703	26365722	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTG	TGTGTGTGTGTGTGTGTGTG	-	rs574443632|rs373293877|rs55949951|rs60975232		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	TGTGTGTGTGTGTGTGTGTG	TGTGTGTGTGTGTGTGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr6:26365703_26365722delTGTGTGTGTGTGTGTGTGTG	ENST00000356386.2	+	1	122				BTN3A2_ENST00000396948.1_Intron|AL021917.1_ENST00000401160.1_RNA|BTN3A2_ENST00000532994.1_Intron|BTN3A2_ENST00000377708.2_Intron|BTN3A2_ENST00000508906.2_Intron|BTN3A2_ENST00000396934.3_Intron|BTN3A2_ENST00000527422.1_Intron	NM_001197246.2|NM_001197247.1|NM_007047.3	NP_001184175.1|NP_001184176.1|NP_008978.2	P78410	BT3A2_HUMAN	butyrophilin, subfamily 3, member A2						interferon-gamma secretion (GO:0072643)|T cell mediated immunity (GO:0002456)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)	10						GTGCAGTGCCtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg	0.55													ENSG00000215979																																					0																																										SO:0001627	intron_variant	0				U90546	CCDS4605.1, CCDS56399.1, CCDS56400.1	6p22.1	2014-01-14			ENSG00000186470	ENSG00000186470		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1139	protein-coding gene	gene with protein product		613594				9149941	Standard	NM_007047		Approved	BTN3.2	uc010jqi.2	P78410	OTTHUMG00000014450	ENST00000356386.2:c.-67+123TGTGTGTGTGTGTGTGTGTG>-	6.37:g.26365703_26365722delTGTGTGTGTGTGTGTGTGTG			B4DRT7|B4E103|F5H791|F8W6E0|O00477|O15338|O75658|Q76PA0|Q9BU81|Q9NR44	R	DEL	-	NULL	ENST00000356386.2	37	NULL	CCDS4605.1	6																																																																																				AL021917.1	-	-		0.550	BTN3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215979	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000040113.2									TGTGTGTGTGTGTGTGTGTG			26365722	-1					tier1	no_errors	ENST00000401160	ensembl	human	novel	74_37	rna			DEL	0.000:0.001:0.003:0.035:0.047:0.052:0.060:0.076:0.083:0.101:0.112:0.118:0.122:0.123:0.119:0.112:0.098:0.077:0.044:0.031	-		
CDKL5	6792	genome.wustl.edu	37	X	18616676	18616676	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chrX:18616676C>G	ENST00000379989.3	+	12	1205	c.920C>G	c.(919-921)cCt>cGt	p.P307R	CDKL5_ENST00000379996.3_Missense_Mutation_p.P307R	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	307					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GATCGTTCTCCTTCAAGGTCA	0.403													ENSG00000008086																																					0													100.0	87.0	91.0					X																	18616676		2203	4300	6503	SO:0001583	missense	0			-	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.920C>G	X.37:g.18616676C>G	ENSP00000369325:p.Pro307Arg		G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P307R	ENST00000379989.3	37	c.920	CCDS14186.1	X	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188915	0.78789	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.71341	-0.56;-0.56	5.52	5.52	0.82312	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.78805	0.4341	L	0.34521	1.04	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.81104	-0.1084	10	0.72032	D	0.01	-18.4952	18.4608	0.90737	0.0:1.0:0.0:0.0	.	307	O76039	CDKL5_HUMAN	R	307	ENSP00000369332:P307R;ENSP00000369325:P307R	ENSP00000369325:P307R	P	+	2	0	CDKL5	18526597	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.294000	0.78760	2.301000	0.77427	0.600000	0.82982	CCT	-	CDKL5	-	superfamily_Kinase-like_dom		0.403	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKL5	HGNC	protein_coding	OTTHUMT00000055945.2	0	0		96	96		0.00		C	NM_003159		18616676	+1	20		132		tier1	no_errors	ENST00000379989	ensembl	human	known	74_37	missense	13.16		SNP	1.000	G	20	132
GPRIN2	9721	genome.wustl.edu	37	10	46999608	46999608	+	Frame_Shift_Del	DEL	C	C	-	rs374420863		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr10:46999608delC	ENST00000374317.1	+	3	1001	c.728delC	c.(727-729)gctfs	p.A243fs	GPRIN2_ENST00000374314.4_Frame_Shift_Del_p.A243fs	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	243										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GAGGTGAGGGCTGGTGGCTGC	0.632													ENSG00000204175																																					0													53.0	57.0	56.0					10																	46999608		2203	4300	6503	SO:0001589	frameshift_variant	0				BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.728delC	10.37:g.46999608delC	ENSP00000363436:p.Ala243fs		Q5SVF0	Frame_Shift_Del	DEL	NULL	p.A243fs	ENST00000374317.1	37	c.728	CCDS31192.1	10																																																																																				GPRIN2	-	NULL		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN2	HGNC	protein_coding	OTTHUMT00000047836.1	0	0		37	37		0.00		C	NM_014696		46999608	+1	7		61		tier1	no_errors	ENST00000374314	ensembl	human	known	74_37	frame_shift_del	10.29		DEL	0.001	-	7	61
RRN3P1	730092	genome.wustl.edu	37	16	21821976	21821977	+	RNA	INS	-	-	AA	rs148768203		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr16:21821976_21821977insAA	ENST00000546471.1	-	0	0							Q2M238	RN3P1_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 1																		CAAGTGGATACAAAAAAAAAAA	0.252													ENSG00000248124																																					0																																												0						16p12.2	2012-10-16			ENSG00000248124	ENSG00000248124			30548	pseudogene	pseudogene						12477932	Standard	NR_003370		Approved		uc010vbl.1	Q2M238	OTTHUMG00000170417		16.37:g.21821985_21821986dupAA			A8K6T4|B3KWX9|O75704	R	INS	-	NULL	ENST00000546471.1	37	NULL		16																																																																																				RRN3P1	-	-		0.252	RRN3P1-002	KNOWN	basic	processed_transcript	RRN3P1	HGNC	pseudogene	OTTHUMT00000409035.1	0	0		19	19		0.00		-	NR_003370		21821977	-1	7		26		tier1	no_errors	ENST00000551681	ensembl	human	known	74_37	rna	21.21		INS	0.002:0.003	AA	7	26
COA6	388753	genome.wustl.edu	37	1	234519493	234519493	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:234519493G>A	ENST00000366613.1	+	3	343	c.307G>A	c.(307-309)Gac>Aac	p.D103N	COA6_ENST00000366615.4_Missense_Mutation_p.D133N|COA6_ENST00000366612.1_Missense_Mutation_p.D57N	NM_001012985.2	NP_001013003.1	Q5JTJ3	COA6_HUMAN	cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)	103						mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|poly(A) RNA binding (GO:0044822)										TAAAAGAAGAGACTACTTAAA	0.294													ENSG00000168275																																					0													35.0	39.0	38.0					1																	234519493		2198	4294	6492	SO:0001583	missense	0			-		CCDS31059.1, CCDS55690.1	1q42.2	2012-10-15	2012-10-15	2012-10-15	ENSG00000168275	ENSG00000168275		"""Mitochondrial respiratory chain complex assembly factors"""	18025	protein-coding gene	gene with protein product		614772	"""chromosome 1 open reading frame 31"""	C1orf31		22984289	Standard	NM_001012985		Approved		uc001hwc.3	Q5JTJ3	OTTHUMG00000037945	ENST00000366613.1:c.307G>A	1.37:g.234519493G>A	ENSP00000355572:p.Asp103Asn		Q5JTJ2|Q5JTJ4|Q8TA88	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su6B,superfamily_Cyt_c_oxidase_su6B	p.D133N	ENST00000366613.1	37	c.397	CCDS31059.1	1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607824	0.87258	.	.	ENSG00000168275	ENST00000366615;ENST00000424237;ENST00000366613;ENST00000366612	D;D;D	0.82711	-1.64;-1.64;-1.64	5.78	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.88265	0.6390	L	0.55481	1.735	0.47374	D	0.9994	D	0.89917	1.0	D	0.91635	0.999	D	0.85874	0.1418	10	0.22109	T	0.4	.	16.1258	0.81395	0.0:0.0:0.8649:0.135	.	103	Q5JTJ3	CA031_HUMAN	N	133;134;103;57	ENSP00000355574:D133N;ENSP00000355572:D103N;ENSP00000355571:D57N	ENSP00000355571:D57N	D	+	1	0	C1orf31	232586116	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.244000	0.72391	1.556000	0.49512	0.655000	0.94253	GAC	-	COA6	-	pfam_Cyt_c_oxidase_su6B,superfamily_Cyt_c_oxidase_su6B		0.294	COA6-002	NOVEL	basic|CCDS	protein_coding	COA6	HGNC	protein_coding	OTTHUMT00000092613.1	0	0		101	101		0.00		G	NM_001012985		234519493	+1	16		102		tier1	no_errors	ENST00000366615	ensembl	human	novel	74_37	missense	13.45		SNP	1.000	A	16	102
HBG2	3048	genome.wustl.edu	37	11	5275523	5275523	+	Splice_Site	SNP	T	T	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr11:5275523T>C	ENST00000380259.2	-	7	1554	c.314A>G	c.(313-315)aAg>aGg	p.K105R	HBG2_ENST00000336906.4_Splice_Site_p.K105R|HBG2_ENST00000380252.1_Splice_Site_p.K95R			P69892	HBG2_HUMAN	hemoglobin, gamma G	105			K -> N (in Macedonia-II). {ECO:0000269|PubMed:7713741}.		blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	13		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGACTCACCTTGAAGTTCTC	0.493													ENSG00000196565																																					0													161.0	125.0	137.0					11																	5275523		2201	4298	6499	SO:0001630	splice_region_variant	0			-	BC029387	CCDS7755.1	11p15.5	2014-05-19			ENSG00000196565	ENSG00000196565			4832	protein-coding gene	gene with protein product		142250				2649166	Standard	NM_000184		Approved	HBG-T1		P69892	OTTHUMG00000066673	ENST00000380259.2:c.315+1A>G	11.37:g.5275523T>C			A8MZE0|P02096|P62027|Q14491|Q68NH9|Q96FH6|Q96FH7	Missense_Mutation	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b,prints_Myoglobin	p.K105R	ENST00000380259.2	37	c.314	CCDS7755.1	11	.	.	.	.	.	.	.	.	.	.	C	0.827	-0.746710	0.03065	.	.	ENSG00000196565	ENST00000380252;ENST00000380259;ENST00000336906;ENST00000380247	D;D;D	0.93547	-3.24;-3.24;-3.24	4.08	0.253	0.15551	Globin-like (2);Globin, structural domain (2);	0.316663	0.33253	N	0.005101	T	0.80914	0.4715	N	0.11927	0.2	0.29269	N	0.870817	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.004	T	0.66685	-0.5861	10	0.02654	T	1	.	8.57	0.33563	0.0:0.4263:0.0:0.5737	.	105;105	P69892;P69891	HBG2_HUMAN;HBG1_HUMAN	R	95;105;105;105	ENSP00000369602:K95R;ENSP00000369609:K105R;ENSP00000338082:K105R	ENSP00000338082:K105R	K	-	2	0	HBG2	5232099	0.651000	0.27340	0.665000	0.29768	0.645000	0.38454	-0.109000	0.10840	-0.328000	0.08539	-0.790000	0.03334	AAG	-	HBG2	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin		0.493	HBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBG2	HGNC	protein_coding	OTTHUMT00000142967.2	0	0		70	70		0.00		T	NM_000184	Missense_Mutation	5275523	-1	10		45		tier1	no_errors	ENST00000336906	ensembl	human	known	74_37	missense	18.18		SNP	0.998	C	10	45
LRIG2	9860	genome.wustl.edu	37	1	113667282	113667283	+	3'UTR	INS	-	-	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:113667282_113667283insT	ENST00000361127.5	+	0	3955_3956				LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2						innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		ATTCTTGTGAATTTTTTTTTTT	0.366													ENSG00000198799																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.*560->T	1.37:g.113667293_113667293dupT			Q9NSN2	R	INS	-	NULL	ENST00000361127.5	37	NULL	CCDS30808.1	1																																																																																				LRIG2	-	-		0.366	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2	0	0		9	9		0.00		-	NM_014813		113667283	+1	4		22		tier1	no_errors	ENST00000466161	ensembl	human	known	74_37	rna	15.38		INS	0.029:0.014	T	4	22
ARID3B	10620	genome.wustl.edu	37	15	74883555	74883555	+	Silent	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:74883555C>T	ENST00000346246.5	+	6	1176	c.945C>T	c.(943-945)ctC>ctT	p.L315L		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	315	Interaction with RB1.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						CAGCCGAGCTCCAGGCAGCAA	0.567													ENSG00000179361																																					0													96.0	110.0	105.0					15																	74883555		2197	4296	6493	SO:0001819	synonymous_variant	0			-		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.945C>T	15.37:g.74883555C>T			O95443|Q59HC9|Q6P9C9	Silent	SNP	pfam_ARID/BRIGHT_D-bd,superfamily_ARID/BRIGHT_D-bd,smart_ARID/BRIGHT_D-bd,pfscan_ARID/BRIGHT_D-bd	p.L315	ENST00000346246.5	37	c.945	CCDS10264.1	15																																																																																			-	ARID3B	-	superfamily_ARID/BRIGHT_D-bd		0.567	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3B	HGNC	protein_coding	OTTHUMT00000280688.2	0	0		60	60		0.00		C	NM_006465		74883555	+1	7		54		tier1	no_errors	ENST00000346246	ensembl	human	known	74_37	silent	11.48		SNP	0.958	T	7	54
NAALAD2	10003	genome.wustl.edu	37	11	89880650	89880650	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr11:89880650A>T	ENST00000534061.1	+	3	577	c.347A>T	c.(346-348)aAc>aTc	p.N116I	NAALAD2_ENST00000321955.4_Missense_Mutation_p.N116I|NAALAD2_ENST00000375944.3_Missense_Mutation_p.N116I|NAALAD2_ENST00000525171.1_Missense_Mutation_p.N116I	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	116					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				ACAAATGCCAACTATATATCG	0.368													ENSG00000077616																																					0													94.0	93.0	94.0					11																	89880650		2201	4299	6500	SO:0001583	missense	0			-	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.347A>T	11.37:g.89880650A>T	ENSP00000432481:p.Asn116Ile		B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.N116I	ENST00000534061.1	37	c.347	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	A	21.1	4.097387	0.76870	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171;ENST00000375944;ENST00000526637	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.03	3.91	0.45181	.	0.067885	0.64402	D	0.000014	T	0.68677	0.3027	M	0.86268	2.805	0.80722	D	1	D;D;D;D;P	0.89917	1.0;1.0;0.996;0.999;0.942	D;D;D;D;P	0.75484	0.976;0.986;0.961;0.945;0.551	T	0.70938	-0.4736	9	.	.	.	-14.0936	10.5172	0.44896	0.9237:0.0:0.0763:0.0	.	116;116;116;116;116	Q4KKV4;E9PJV2;Q9Y3Q0;E9PKX5;Q8IUX3	.;.;NALD2_HUMAN;.;.	I	116;116;116;116;62	ENSP00000432481:N116I;ENSP00000320083:N116I;ENSP00000435249:N116I;ENSP00000365111:N116I;ENSP00000435670:N62I	.	N	+	2	0	NAALAD2	89520298	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	5.730000	0.68546	0.882000	0.36016	0.524000	0.50904	AAC	-	ALAD2	-	NULL		0.368	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	0	0		63	63		0.00		A	NM_005467		89880650	+1	11		61		tier1	no_errors	ENST00000534061	ensembl	human	known	74_37	missense	15.28		SNP	1.000	T	11	61
SNTG1	54212	genome.wustl.edu	37	8	51621506	51621506	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr8:51621506A>G	ENST00000522124.1	+	17	1913	c.1252A>G	c.(1252-1254)Aca>Gca	p.T418A	SNTG1_ENST00000276467.5_Missense_Mutation_p.T418A|SNTG1_ENST00000517473.1_Missense_Mutation_p.T418A|SNTG1_ENST00000518864.1_Missense_Mutation_p.T418A	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	418					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TGATTTCAGCACAGGATTTAT	0.368													ENSG00000147481																																					0													186.0	159.0	168.0					8																	51621506		2203	4300	6503	SO:0001583	missense	0			-	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1252A>G	8.37:g.51621506A>G	ENSP00000429842:p.Thr418Ala		Q2M3Q0|Q9NY98	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.T418A	ENST00000522124.1	37	c.1252	CCDS6147.1	8	.	.	.	.	.	.	.	.	.	.	A	7.798	0.712972	0.15306	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66	5.69	1.97	0.26223	.	0.161752	0.64402	D	0.000004	T	0.41143	0.1146	N	0.08118	0	0.28277	N	0.924169	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.23154	-1.0196	10	0.08837	T	0.75	-9.3309	5.6682	0.17707	0.7351:0.0:0.1391:0.1259	.	418;418	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	A	418	ENSP00000429276:T418A;ENSP00000429842:T418A;ENSP00000431123:T418A;ENSP00000276467:T418A	ENSP00000276467:T418A	T	+	1	0	SNTG1	51784059	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	3.657000	0.54474	0.095000	0.17434	0.528000	0.53228	ACA	-	SNTG1	-	NULL		0.368	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	0	0		31	31		0.00		A			51621506	+1	5		43		tier1	no_errors	ENST00000518864	ensembl	human	known	74_37	missense	10.42		SNP	1.000	G	5	43
ACSF2	80221	genome.wustl.edu	37	17	48538718	48538718	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr17:48538718C>T	ENST00000300441.4	+	3	544	c.440C>T	c.(439-441)gCg>gTg	p.A147V	ACSF2_ENST00000427954.2_Missense_Mutation_p.A172V|ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000502667.1_Splice_Site|ACSF2_ENST00000541920.1_Intron	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	147					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			ACCGCCCAGGCGGGCATCATT	0.622													ENSG00000167107																																					0													40.0	33.0	36.0					17																	48538718		2203	4300	6503	SO:0001583	missense	0			-	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.440C>T	17.37:g.48538718C>T	ENSP00000300441:p.Ala147Val		B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Splice_Site	SNP	-	e3+2	ENST00000300441.4	37	c.438+2	CCDS11567.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.005571|4.005571	0.74932|0.74932	.|.	.|.	ENSG00000167107|ENSG00000167107	ENST00000502667|ENST00000300441;ENST00000427954	.|T;T	.|0.52057	.|0.68;0.68	5.28|5.28	5.28|5.28	0.74379|0.74379	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.57577	.|0.2063	L|L	0.60904|0.60904	1.88|1.88	0.80722|0.80722	D|D	1|1	.|D;D	.|0.60575	.|0.988;0.976	.|P;P	.|0.57846	.|0.828;0.721	.|T	.|0.53408	.|-0.8443	.|10	.|0.30078	.|T	.|0.28	.|-20.274	12.9444|12.9444	0.58364|0.58364	0.0:0.9213:0.0:0.0787|0.0:0.9213:0.0:0.0787	.|.	.|172;147	.|B4DFQ6;Q96CM8	.|.;ACSF2_HUMAN	.|V	-1|147;172	.|ENSP00000300441:A147V;ENSP00000401831:A172V	.|ENSP00000300441:A147V	.|A	+|+	.|2	.|0	ACSF2|ACSF2	45893717|45893717	1.000000|1.000000	0.71417|0.71417	0.909000|0.909000	0.35828|0.35828	0.976000|0.976000	0.68499|0.68499	4.359000|4.359000	0.59449|0.59449	2.467000|2.467000	0.83353|0.83353	0.655000|0.655000	0.94253|0.94253	.|GCG	-	ACSF2	-	-		0.622	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3	0	0		14	14		0.00		C	NM_025149		48538718	+1	11		23		tier1	no_errors	ENST00000502667	ensembl	human	novel	74_37	splice_site	32.35		SNP	0.998	T	11	23
OR2M7	391196	genome.wustl.edu	37	1	248487708	248487708	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:248487708G>C	ENST00000317965.2	-	1	191	c.163C>G	c.(163-165)Ctc>Gtc	p.L55V		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGGTGTGGAGCTGGGTATCC	0.537													ENSG00000177186																																					0													301.0	285.0	291.0					1																	248487708		2203	4300	6503	SO:0001583	missense	0			-	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.163C>G	1.37:g.248487708G>C	ENSP00000324557:p.Leu55Val		B2RNL0|Q6IEX6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L55V	ENST00000317965.2	37	c.163	CCDS31111.1	1	.	.	.	.	.	.	.	.	.	.	G	6.399	0.441780	0.12164	.	.	ENSG00000177186	ENST00000317965	T	0.14022	2.54	1.54	-0.832	0.10785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.29501	U	0.011972	T	0.46756	0.1409	H	0.98487	4.245	0.09310	N	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.40942	-0.9536	10	0.87932	D	0	.	6.7207	0.23328	0.3571:0.0:0.6429:0.0	.	55	Q8NG81	OR2M7_HUMAN	V	55	ENSP00000324557:L55V	ENSP00000324557:L55V	L	-	1	0	OR2M7	246554331	1.000000	0.71417	0.394000	0.26270	0.039000	0.13416	3.615000	0.54167	-0.703000	0.05049	-1.109000	0.02080	CTC	-	OR2M7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.537	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M7	HGNC	protein_coding	OTTHUMT00000097357.1	0	0		85	85		0.00		G	NM_001004691		248487708	-1	8		80		tier1	no_errors	ENST00000317965	ensembl	human	known	74_37	missense	9.09		SNP	0.336	C	8	80
KLHL30	377007	genome.wustl.edu	37	2	239054412	239054412	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr2:239054412G>A	ENST00000409223.1	+	5	1196	c.1089G>A	c.(1087-1089)atG>atA	p.M363I	KLHL30_ENST00000305959.4_Missense_Mutation_p.M345I			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	363										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		TGGCGCCCATGCTGAAGCCCC	0.667													ENSG00000168427																																					0													24.0	32.0	30.0					2																	239054412		2037	4178	6215	SO:0001583	missense	0			-		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1089G>A	2.37:g.239054412G>A	ENSP00000386389:p.Met363Ile		Q6ZUS1	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.M363I	ENST00000409223.1	37	c.1089	CCDS46555.2	2	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935744	0.92458	.	.	ENSG00000168427	ENST00000409223;ENST00000305959	T;T	0.71103	-0.54;-0.54	4.62	4.62	0.57501	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.87188	0.6115	M	0.91140	3.18	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.90551	0.4509	10	0.87932	D	0	.	16.2395	0.82399	0.0:0.0:1.0:0.0	.	363	Q0D2K2	KLH30_HUMAN	I	363;345	ENSP00000386389:M363I;ENSP00000302386:M345I	ENSP00000302386:M345I	M	+	3	0	KLHL30	238719151	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.781000	0.99029	2.113000	0.64589	0.542000	0.68232	ATG	-	KLHL30	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.667	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL30	HGNC	protein_coding	OTTHUMT00000328518.1	0	0		65	65		0.00		G	NM_198582		239054412	+1	6		51		tier1	no_errors	ENST00000409223	ensembl	human	known	74_37	missense	10.53		SNP	1.000	A	6	51
MBNL1	4154	genome.wustl.edu	37	3	152017897	152017898	+	5'UTR	INS	-	-	T	rs368507124		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr3:152017897_152017898insT	ENST00000463374.1	+	0	426_427				MBNL1_ENST00000282488.7_5'UTR|MBNL1_ENST00000485509.1_5'Flank|MBNL1_ENST00000461436.1_3'UTR|MBNL1_ENST00000498502.1_5'UTR|MBNL1_ENST00000493459.1_Intron|MBNL1_ENST00000492948.1_5'Flank|MBNL1_ENST00000545754.1_5'UTR|MBNL1_ENST00000324210.5_5'UTR|MBNL1_ENST00000485910.1_5'UTR|MBNL1_ENST00000355460.2_5'UTR|MBNL1_ENST00000282486.6_5'UTR|MBNL1_ENST00000324196.5_5'UTR|MBNL1_ENST00000357472.3_5'UTR	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1						alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ATCAGTTCAGCTTTTTTTTTTT	0.371													ENSG00000152601																																					0																																										SO:0001623	5_prime_UTR_variant	0				Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.-85->T	3.37:g.152017908_152017908dupT			E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	R	INS	-	NULL	ENST00000463374.1	37	NULL	CCDS3165.1	3																																																																																				MBNL1	-	-		0.371	MBNL1-006	KNOWN	basic|CCDS	protein_coding	MBNL1	HGNC	protein_coding	OTTHUMT00000353604.1	0	0		47	47		0.00		-	NM_021038		152017898	+1	12		57		tier1	no_errors	ENST00000461436	ensembl	human	putative	74_37	rna	17.39		INS	0.829:0.026	T	12	57
SCML2	10389	genome.wustl.edu	37	X	18257826	18257826	+	3'UTR	SNP	A	A	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chrX:18257826A>C	ENST00000251900.4	-	0	3807				SCML2_ENST00000491988.1_5'UTR	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)						anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					TCTAACTTATAAAATAAAGCC	0.398													ENSG00000102098																									Esophageal Squamous(100;1252 1965 19021 35517)												0																																										SO:0001624	3_prime_UTR_variant	0			-	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.*1545T>G	X.37:g.18257826A>C			Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	R	SNP	-	NULL	ENST00000251900.4	37	NULL	CCDS14185.1	X																																																																																			-	SCML2	-	-		0.398	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	HGNC	protein_coding	OTTHUMT00000055941.1	0	0		75	75		0.00		A	NM_006089		18257826	-1	13		109		tier1	no_errors	ENST00000491988	ensembl	human	known	74_37	rna	10.66		SNP	0.118	C	13	109
PDIA4	9601	genome.wustl.edu	37	7	148705263	148705263	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr7:148705263C>A	ENST00000286091.4	-	7	1351	c.1119G>T	c.(1117-1119)atG>atT	p.M373I		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	373					cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			GGACGTCCATCATGTGGCTCC	0.557													ENSG00000155660																																					0													73.0	75.0	74.0					7																	148705263		2203	4300	6503	SO:0001583	missense	0			-	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1119G>T	7.37:g.148705263C>A	ENSP00000286091:p.Met373Ile		A8K4K6|Q549T6	Missense_Mutation	SNP	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,prints_Calsequestrin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.M373I	ENST00000286091.4	37	c.1119	CCDS5893.1	7	.	.	.	.	.	.	.	.	.	.	C	9.642	1.139199	0.21205	.	.	ENSG00000155660	ENST00000286091	T	0.75821	-0.97	5.32	3.21	0.36854	Thioredoxin-like fold (2);	0.627745	0.17589	N	0.168846	T	0.42471	0.1204	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30238	-0.9985	10	0.25106	T	0.35	.	7.8596	0.29501	0.3904:0.4946:0.1149:0.0	.	373	P13667	PDIA4_HUMAN	I	373	ENSP00000286091:M373I	ENSP00000286091:M373I	M	-	3	0	PDIA4	148336196	0.002000	0.14202	0.170000	0.22879	0.820000	0.46376	0.062000	0.14389	1.361000	0.45981	0.650000	0.86243	ATG	-	PDIA4	-	pirsf_Protein_diS-isomerase_A4,superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase		0.557	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	HGNC	protein_coding	OTTHUMT00000317077.1	0	0		62	62		0.00		C	NM_004911		148705263	-1	18		100		tier1	no_errors	ENST00000286091	ensembl	human	known	74_37	missense	15.25		SNP	0.047	A	18	100
SAMD8	142891	genome.wustl.edu	37	10	76936171	76936171	+	Silent	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr10:76936171G>A	ENST00000542569.1	+	6	1072	c.969G>A	c.(967-969)ttG>ttA	p.L323L	SAMD8_ENST00000372687.4_3'UTR|SAMD8_ENST00000372690.3_Silent_p.L386L	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	323					ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GGAATTTCTTGCACACTTTAT	0.378													ENSG00000156671																																					0																																										SO:0001819	synonymous_variant	0			-	AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515	ENST00000542569.1:c.969G>A	10.37:g.76936171G>A			Q5JSC5|Q5JSC8|Q66K52	Silent	SNP	pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.L386	ENST00000542569.1	37	c.1158	CCDS53543.1	10																																																																																			-	SAMD8	-	NULL		0.378	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD8	HGNC	protein_coding		0	0		51	51		0.00		G	NM_144660		76936171	+1	4		46		tier1	no_errors	ENST00000372690	ensembl	human	known	74_37	silent	8.00		SNP	1.000	A	4	46
HOOK1	51361	genome.wustl.edu	37	1	60302603	60302603	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:60302603A>C	ENST00000371208.3	+	7	790	c.533A>C	c.(532-534)cAa>cCa	p.Q178P	HOOK1_ENST00000395561.2_Missense_Mutation_p.Q136P|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	178	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					GAATTGGAGCAACAGGTGAGT	0.318													ENSG00000134709																																					0													90.0	101.0	97.0					1																	60302603		2203	4300	6503	SO:0001583	missense	0			-	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.533A>C	1.37:g.60302603A>C	ENSP00000360252:p.Gln178Pro		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin	p.Q178P	ENST00000371208.3	37	c.533	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	A	13.59	2.283995	0.40394	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.18960	2.18;2.18	5.71	5.71	0.89125	.	0.363249	0.33290	N	0.005062	T	0.21427	0.0516	L	0.47716	1.5	0.46222	D	0.998932	P	0.35527	0.507	B	0.40038	0.317	T	0.04635	-1.0937	10	0.24483	T	0.36	.	10.0721	0.42339	0.9245:0.0:0.0755:0.0	.	178	Q9UJC3	HOOK1_HUMAN	P	178;136	ENSP00000360252:Q178P;ENSP00000378928:Q136P	ENSP00000360252:Q178P	Q	+	2	0	HOOK1	60075191	0.738000	0.28186	0.994000	0.49952	0.947000	0.59692	3.151000	0.50670	2.185000	0.69588	0.528000	0.53228	CAA	-	HOOK1	-	pfam_Hook-related_fam		0.318	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	0	0		137	137		0.00		A	NM_015888		60302603	+1	20		159		tier1	no_errors	ENST00000371208	ensembl	human	known	74_37	missense	11.17		SNP	0.802	C	20	159
MYH7	4625	genome.wustl.edu	37	14	23895280	23895280	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr14:23895280G>T	ENST00000355349.3	-	19	2217	c.2055C>A	c.(2053-2055)gaC>gaA	p.D685E		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	685	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CCAGGGGGTTGTCCATCACCC	0.557													ENSG00000092054																																					0													38.0	35.0	36.0					14																	23895280		2203	4300	6503	SO:0001583	missense	0			-	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2055C>A	14.37:g.23895280G>T	ENSP00000347507:p.Asp685Glu		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D685E	ENST00000355349.3	37	c.2055	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	6.261	0.416333	0.11870	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.89196	-2.48	4.75	4.75	0.60458	Myosin head, motor domain (2);	.	.	.	.	T	0.81446	0.4824	L	0.33137	0.985	0.40457	D	0.9802	B	0.06786	0.001	B	0.17722	0.019	T	0.74822	-0.3534	9	0.23891	T	0.37	.	8.8388	0.35129	0.0801:0.1512:0.7688:0.0	.	685	P12883	MYH7_HUMAN	E	685	ENSP00000347507:D685E	ENSP00000347507:D685E	D	-	3	2	MYH7	22965120	0.999000	0.42202	1.000000	0.80357	0.990000	0.78478	0.491000	0.22419	2.471000	0.83476	0.655000	0.94253	GAC	-	MYH7	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.557	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	0	0		37	37		0.00		G	NM_000257		23895280	-1	10		47		tier1	no_errors	ENST00000355349	ensembl	human	known	74_37	missense	17.54		SNP	1.000	T	10	47
MAGI2	9863	genome.wustl.edu	37	7	77764399	77764399	+	Silent	SNP	G	G	A	rs151185251		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr7:77764399G>A	ENST00000354212.4	-	17	3223	c.2970C>T	c.(2968-2970)gaC>gaT	p.D990D	MAGI2_ENST00000522391.1_Silent_p.D990D|MAGI2_ENST00000419488.1_Silent_p.D976D	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	990	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GCTTCACGATGTCAGCGTGAG	0.532													ENSG00000187391																																					0								G		0,4406		0,0,2203	270.0	200.0	223.0		2970	5.2	1.0	7	dbSNP_134	223	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MAGI2	NM_012301.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		990/1456	77764399	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2970C>T	7.37:g.77764399G>A			A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.D990	ENST00000354212.4	37	c.2970	CCDS5594.1	7																																																																																			rs151185251	MAGI2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.532	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	0	0		19	19		0.00		G	NM_012301		77764399	-1	7		28		tier1	no_errors	ENST00000354212	ensembl	human	known	74_37	silent	20.00		SNP	1.000	A	7	28
PRRC2A	7916	genome.wustl.edu	37	6	31602954	31602954	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr6:31602954G>A	ENST00000376033.2	+	22	5440	c.5206G>A	c.(5206-5208)Gaa>Aaa	p.E1736K	PRRC2A_ENST00000376007.4_Missense_Mutation_p.E1736K	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1736	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CATTGGCACAGAACGATCACA	0.602													ENSG00000204469																																					0													75.0	74.0	74.0					6																	31602954		2203	4300	6503	SO:0001583	missense	0			-	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.5206G>A	6.37:g.31602954G>A	ENSP00000365201:p.Glu1736Lys		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.E1736K	ENST00000376033.2	37	c.5206	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	16.28	3.078887	0.55753	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.05717	3.4;3.4	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000012	T	0.15046	0.0363	L	0.57536	1.79	0.46499	D	0.999078	D	0.63880	0.993	D	0.70935	0.971	T	0.00073	-1.2127	10	0.87932	D	0	-13.9841	16.4508	0.83990	0.0:0.0:1.0:0.0	.	1736	P48634	PRC2A_HUMAN	K	1730;1719;1736;1736;961	ENSP00000365175:E1736K;ENSP00000365201:E1736K	ENSP00000365175:E1736K	E	+	1	0	PRRC2A	31710933	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.880000	0.63107	2.873000	0.98535	0.561000	0.74099	GAA	-	PRRC2A	-	NULL		0.602	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	0	0		22	22		0.00		G	NM_080686		31602954	+1	6		30		tier1	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	15.79		SNP	1.000	A	6	30
PDIA4	9601	genome.wustl.edu	37	7	148705272	148705272	+	Silent	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr7:148705272C>A	ENST00000286091.4	-	7	1342	c.1110G>T	c.(1108-1110)cgG>cgT	p.R370R		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	370					cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			TCATGTGGCTCCGGGGCTCAT	0.552													ENSG00000155660																																					0													77.0	79.0	78.0					7																	148705272		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1110G>T	7.37:g.148705272C>A			A8K4K6|Q549T6	Silent	SNP	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,prints_Calsequestrin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.R370	ENST00000286091.4	37	c.1110	CCDS5893.1	7																																																																																			-	PDIA4	-	pirsf_Protein_diS-isomerase_A4,superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase		0.552	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	HGNC	protein_coding	OTTHUMT00000317077.1	0	0		64	64		0.00		C	NM_004911		148705272	-1	17		97		tier1	no_errors	ENST00000286091	ensembl	human	known	74_37	silent	14.91		SNP	0.345	A	17	97
CCNYL2	414194	genome.wustl.edu	37	10	42907248	42907248	+	RNA	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr10:42907248C>T	ENST00000483242.3	-	0	1183					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					breast(2)|endometrium(1)|lung(3)|ovary(1)	7						CTGCTATAAACACTGTTAGTA	0.403													ENSG00000182632																																					0																																												0			-	BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42907248C>T				R	SNP	-	NULL	ENST00000483242.3	37	NULL		10	.	.	.	.	.	.	.	.	.	.	.	5.259	0.233214	0.09969	.	.	ENSG00000182632	ENST00000426433	.	.	.	1.85	1.85	0.25348	.	0.000000	0.85682	U	0.000000	T	0.60766	0.2294	.	.	.	0.48571	D	0.999676	.	.	.	.	.	.	T	0.62196	-0.6905	6	0.59425	D	0.04	.	7.2613	0.26205	0.0:1.0:0.0:0.0	.	.	.	.	I	292	.	ENSP00000395902:V292I	V	-	1	0	CCNYL2	42227254	1.000000	0.71417	0.909000	0.35828	0.006000	0.05464	4.238000	0.58688	1.351000	0.45789	0.298000	0.19748	GTT	-	CCNYL2	-	-		0.403	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	HGNC	pseudogene	OTTHUMT00000047670.5	0	0		77	77		0.00		C	XM_936368		42907248	-1	9		100		tier1	no_errors	ENST00000483242	ensembl	human	known	74_37	rna	8.26		SNP	1.000	T	9	100
URM1	81605	genome.wustl.edu	37	9	131151745	131151745	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr9:131151745G>A	ENST00000452446.1	+	4	456	c.394G>A	c.(394-396)Gag>Aag	p.E132K	URM1_ENST00000372853.4_Intron|URM1_ENST00000483206.1_3'UTR|RP11-339B21.11_ENST00000609303.1_lincRNA|URM1_ENST00000372850.1_3'UTR	NM_001135947.2	NP_001129419.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						CACTCCAGGTGAGGAAGGGAT	0.552													ENSG00000167118																																					0													26.0	34.0	32.0					9																	131151745		692	1591	2283	SO:0001583	missense	0			-	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000452446.1:c.394G>A	9.37:g.131151745G>A	ENSP00000412922:p.Glu132Lys			Missense_Mutation	SNP	pfam_Urm1,superfamily_Mopterin_synth/thiamin_S_b	p.E132K	ENST00000452446.1	37	c.394	CCDS48035.1	9	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212983	0.39102	.	.	ENSG00000167118	ENST00000452446	.	.	.	4.24	-0.38	0.12490	.	.	.	.	.	T	0.17916	0.0430	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.24693	-1.0153	6	.	.	.	.	3.1711	0.06552	0.3807:0.0:0.4347:0.1846	.	132	Q9BTM9-2	.	K	132	.	.	E	+	1	0	URM1	130191566	0.001000	0.12720	0.001000	0.08648	0.025000	0.11179	-0.102000	0.10956	-0.063000	0.13065	-0.140000	0.14226	GAG	-	URM1	-	NULL		0.552	URM1-201	KNOWN	basic|CCDS	protein_coding	URM1	HGNC	protein_coding		0	0		58	58		0.00		G	NM_030914		131151745	+1	8		65		tier1	no_errors	ENST00000452446	ensembl	human	known	74_37	missense	10.96		SNP	0.001	A	8	65
ACACB	32	genome.wustl.edu	37	12	109680379	109680379	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr12:109680379C>A	ENST00000338432.7	+	37	5279	c.5160C>A	c.(5158-5160)ttC>ttA	p.F1720L	ACACB_ENST00000543201.1_Missense_Mutation_p.F386L|ACACB_ENST00000377854.5_Missense_Mutation_p.F1650L|ACACB_ENST00000377848.3_Missense_Mutation_p.F1720L			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1720					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TCTATGACTTCCCGGAAATGT	0.582													ENSG00000076555																																					0													82.0	82.0	82.0					12																	109680379		2203	4300	6503	SO:0001583	missense	0			-	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.5160C>A	12.37:g.109680379C>A	ENSP00000341044:p.Phe1720Leu		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.F1720L	ENST00000338432.7	37	c.5160	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102056	0.37048	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201;ENST00000537347	D;D;D;D	0.97811	-4.55;-4.55;-4.55;-4.3	4.95	1.57	0.23409	.	0.044864	0.85682	N	0.000000	D	0.96343	0.8807	M	0.79926	2.475	0.58432	D	0.999999	B	0.09022	0.002	B	0.12837	0.008	D	0.93874	0.7165	10	0.51188	T	0.08	.	10.5504	0.45085	0.0:0.7298:0.0:0.2702	.	1720	O00763	ACACB_HUMAN	L	1720;1720;1650;951;386;45	ENSP00000341044:F1720L;ENSP00000367079:F1720L;ENSP00000367085:F1650L;ENSP00000444075:F386L	ENSP00000341044:F1720L	F	+	3	2	ACACB	108164762	1.000000	0.71417	1.000000	0.80357	0.374000	0.29953	0.911000	0.28584	0.612000	0.30071	-0.143000	0.13931	TTC	-	ACACB	-	NULL		0.582	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	0	0		28	28		0.00		C	NM_001093		109680379	+1	4		23		tier1	no_errors	ENST00000338432	ensembl	human	known	74_37	missense	14.81		SNP	1.000	A	4	23
ZNF284	342909	genome.wustl.edu	37	19	44591144	44591144	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr19:44591144C>T	ENST00000421176.3	+	5	1729	c.1513C>T	c.(1513-1515)Cac>Tac	p.H505Y	RNU6-902P_ENST00000517212.1_RNA|ZNF223_ENST00000591793.1_3'UTR	NM_001037813.2	NP_001032902.1	Q2VY69	ZN284_HUMAN	zinc finger protein 284	505					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0435)				TCAAAGAATTCACACTGGAGA	0.413													ENSG00000186026																																					0													42.0	45.0	44.0					19																	44591144		2145	4283	6428	SO:0001583	missense	0			-	AY166789	CCDS46099.1	19q13.32	2013-01-08				ENSG00000186026		"""Zinc fingers, C2H2-type"", ""-"""	13078	protein-coding gene	gene with protein product						12743021	Standard	NM_001037813		Approved	DKFZp781F1775	uc002oyg.1	Q2VY69		ENST00000421176.3:c.1513C>T	19.37:g.44591144C>T	ENSP00000411032:p.His505Tyr		Q86WM1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H505Y	ENST00000421176.3	37	c.1513	CCDS46099.1	19	.	.	.	.	.	.	.	.	.	.	C	16.02	3.002987	0.54254	.	.	ENSG00000186026	ENST00000421176	T	0.67523	-0.27	2.37	2.37	0.29283	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75162	0.3812	H	0.94264	3.515	0.25805	N	0.98446	B	0.26672	0.156	B	0.27796	0.083	T	0.72144	-0.4379	9	0.87932	D	0	.	11.8212	0.52238	0.0:1.0:0.0:0.0	.	505	Q2VY69	ZN284_HUMAN	Y	505	ENSP00000411032:H505Y	ENSP00000411032:H505Y	H	+	1	0	ZNF284	49282984	1.000000	0.71417	0.015000	0.15790	0.790000	0.44656	4.141000	0.58038	1.311000	0.45024	0.462000	0.41574	CAC	-	ZNF284	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZNF284-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF284	HGNC	protein_coding	OTTHUMT00000460473.1	0	0		48	48		0.00		C	NM_001037813		44591144	+1	7		69		tier1	no_errors	ENST00000421176	ensembl	human	known	74_37	missense	9.21		SNP	0.984	T	7	69
ZNF74	7625	genome.wustl.edu	37	22	20759979	20759979	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr22:20759979C>A	ENST00000400451.2	+	5	1170	c.656C>A	c.(655-657)gCa>gAa	p.A219E	ZNF74_ENST00000403682.3_3'UTR|ZNF74_ENST00000405993.1_Missense_Mutation_p.A187E|ZNF74_ENST00000357502.5_3'UTR|ZNF74_ENST00000356671.5_Missense_Mutation_p.A219E	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	219					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			AGACTGTGTGCAGGGGAAAAC	0.692													ENSG00000185252																																					0													19.0	27.0	24.0					22																	20759979		2025	4166	6191	SO:0001583	missense	0			-	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.656C>A	22.37:g.20759979C>A	ENSP00000383301:p.Ala219Glu		B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A219E	ENST00000400451.2	37	c.656	CCDS42982.1	22	.	.	.	.	.	.	.	.	.	.	C	8.079	0.771965	0.16051	.	.	ENSG00000185252	ENST00000400451;ENST00000356671;ENST00000405993	T;T;T	0.05717	3.45;3.45;3.4	3.67	-1.1	0.09872	.	1.340890	0.05443	N	0.547966	T	0.04588	0.0125	N	0.25332	0.735	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44967	-0.9293	10	0.25751	T	0.34	-0.7341	4.1083	0.10047	0.3179:0.4881:0.0:0.194	.	219	Q16587	ZNF74_HUMAN	E	219;219;187	ENSP00000383301:A219E;ENSP00000349098:A219E;ENSP00000385855:A187E	ENSP00000349098:A219E	A	+	2	0	ZNF74	19089979	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	1.245000	0.32790	-0.089000	0.12484	0.655000	0.94253	GCA	-	ZNF74	-	NULL		0.692	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF74	HGNC	protein_coding	OTTHUMT00000319648.2	0	0		31	31		0.00		C	NM_003426		20759979	+1	6		31		tier1	no_errors	ENST00000356671	ensembl	human	known	74_37	missense	16.22		SNP	0.001	A	6	31
PRRC2A	7916	genome.wustl.edu	37	6	31605238	31605238	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr6:31605238G>A	ENST00000376033.2	+	31	6583	c.6349G>A	c.(6349-6351)Gcc>Acc	p.A2117T	PRRC2A_ENST00000376007.4_Missense_Mutation_p.A2117T	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	2117						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CCCACCAGATGCCCTGCGCTG	0.627													ENSG00000204469																																					0													150.0	174.0	166.0					6																	31605238		1509	2708	4217	SO:0001583	missense	0			-	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.6349G>A	6.37:g.31605238G>A	ENSP00000365201:p.Ala2117Thr		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.A2117T	ENST00000376033.2	37	c.6349	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536147	0.27475	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.02395	4.31;4.31	5.93	3.25	0.37280	.	0.115763	0.39341	N	0.001400	T	0.00998	0.0033	L	0.29908	0.895	0.38957	D	0.958467	B	0.06786	0.001	B	0.06405	0.002	T	0.48031	-0.9070	10	0.87932	D	0	-3.1837	8.219	0.31530	0.2444:0.0:0.7556:0.0	.	2117	P48634	PRC2A_HUMAN	T	2109;2098;2117;2117;1342	ENSP00000365175:A2117T;ENSP00000365201:A2117T	ENSP00000365175:A2117T	A	+	1	0	PRRC2A	31713217	1.000000	0.71417	0.998000	0.56505	0.928000	0.56348	2.127000	0.42035	0.438000	0.26450	-0.136000	0.14681	GCC	-	PRRC2A	-	NULL		0.627	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	0	0		61	61		0.00		G	NM_080686		31605238	+1	10		71		tier1	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	12.35		SNP	1.000	A	10	71
AC104441.1	0	genome.wustl.edu	37	3	21179806	21179806	+	RNA	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr3:21179806G>A	ENST00000408732.1	-	0	27																											actttcaatggcaaaaaccac	0.353													ENSG00000221659																																					0																																												0			-																													3.37:g.21179806G>A				R	SNP	-	NULL	ENST00000408732.1	37	NULL		3																																																																																			-	AC104441.1	-	-		0.353	AC104441.1-201	NOVEL	basic	miRNA	ENSG00000221659	Clone_based_ensembl_gene	miRNA		0	0		32	32		0.00		G			21179806	-1	4		43		tier1	no_errors	ENST00000408732	ensembl	human	novel	74_37	rna	8.51		SNP	0.040	A	4	43
GCNT2	2651	genome.wustl.edu	37	6	10586804	10586804	+	Intron	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr6:10586804C>A	ENST00000379597.3	+	2	1481				GCNT2_ENST00000265012.4_Missense_Mutation_p.D194E|GCNT2_ENST00000495262.1_Intron|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000316170.3_Intron|GCNT2_ENST00000397423.2_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		GTGGACAAGACTTCCCCCTGA	0.502													ENSG00000111846																																					0													94.0	93.0	93.0					6																	10586804		2203	4300	6503	SO:0001627	intron_variant	0			-	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.926-34780C>A	6.37:g.10586804C>A				Missense_Mutation	SNP	pfam_Glyco_trans_14	p.D194E	ENST00000379597.3	37	c.582	CCDS34338.1	6	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819185	0.71028	.	.	ENSG00000111846	ENST00000265012	T	0.23147	1.92	5.47	-6.48	0.01896	.	.	.	.	.	T	0.33294	0.0858	M	0.79805	2.47	0.39429	D	0.967046	D	0.55800	0.973	P	0.61477	0.889	T	0.59053	-0.7526	9	0.52906	T	0.07	.	16.9538	0.86252	0.0:0.6089:0.0:0.3911	.	194	Q8NFS9	GNT2C_HUMAN	E	194	ENSP00000265012:D194E	ENSP00000265012:D194E	D	+	3	2	GCNT2	10694790	0.474000	0.25886	0.528000	0.27938	0.983000	0.72400	-0.307000	0.08167	-1.697000	0.01420	-0.768000	0.03414	GAC	-	GCNT2	-	pfam_Glyco_trans_14		0.502	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GCNT2	HGNC	protein_coding	OTTHUMT00000327912.3	0	0		26	26		0.00		C	NM_145649		10586804	+1	13		37		tier1	no_errors	ENST00000265012	ensembl	human	known	74_37	missense	26.00		SNP	0.929	A	13	37
ADCK5	203054	genome.wustl.edu	37	8	145617202	145617202	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr8:145617202C>G	ENST00000308860.6	+	10	1120	c.1076C>G	c.(1075-1077)tCg>tGg	p.S359W	MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'Flank	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	359	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TTCATCCACTCGGACCCACAT	0.577													ENSG00000173137																																					0													73.0	75.0	74.0					8																	145617202		2202	4300	6502	SO:0001583	missense	0			-	BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.1076C>G	8.37:g.145617202C>G	ENSP00000310547:p.Ser359Trp		B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.S359W	ENST00000308860.6	37	c.1076	CCDS34965.1	8	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275859	0.59649	.	.	ENSG00000173137	ENST00000308860	T	0.51071	0.72	5.54	5.54	0.83059	Protein kinase-like domain (1);	0.127000	0.52532	D	0.000068	T	0.67116	0.2859	M	0.72479	2.2	0.80722	D	1	D	0.67145	0.996	D	0.65323	0.934	T	0.70107	-0.4963	10	0.87932	D	0	-17.6427	16.9685	0.86293	0.0:1.0:0.0:0.0	.	359	Q3MIX3	ADCK5_HUMAN	W	359	ENSP00000310547:S359W	ENSP00000310547:S359W	S	+	2	0	ADCK5	145588010	1.000000	0.71417	0.972000	0.41901	0.189000	0.23516	5.102000	0.64572	2.617000	0.88574	0.555000	0.69702	TCG	-	ADCK5	-	superfamily_Kinase-like_dom		0.577	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	HGNC	protein_coding	OTTHUMT00000382556.2	0	0		13	13		0.00		C	NM_174922		145617202	+1	5		4		tier1	no_errors	ENST00000308860	ensembl	human	known	74_37	missense	55.56		SNP	1.000	G	5	4
TICRR	90381	genome.wustl.edu	37	15	90152192	90152192	+	Intron	SNP	C	C	T	rs570797887		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:90152192C>T	ENST00000268138.7	+	15	2974				KIF7_ENST00000558928.1_5'UTR|TICRR_ENST00000560985.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator						cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										TACCACATTTCAGAATAGCTA	0.393													ENSG00000166813	C|||	1	0.000199681	0.0	0.0	5008	,	,		15134	0.0		0.0	False		,,,				2504	0.001																0													53.0	55.0	54.0					15																	90152192		1865	4114	5979	SO:0001627	intron_variant	0			-	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2869+12C>T	15.37:g.90152192C>T			B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	R	SNP	-	NULL	ENST00000268138.7	37	NULL	CCDS10352.2	15																																																																																			-	KIF7	-	-		0.393	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000312856.1	0	0		93	93		0.00		C	NM_152259		90152192	-1	40		104		tier1	no_errors	ENST00000558928	ensembl	human	known	74_37	rna	27.78		SNP	0.000	T	40	104
GPR114	221188	genome.wustl.edu	37	16	57601387	57601387	+	Silent	SNP	C	C	T	rs116286411		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr16:57601387C>T	ENST00000340339.4	+	8	1228	c.705C>T	c.(703-705)ctC>ctT	p.L235L	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Silent_p.L235L	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	235	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						TGCAGCAACTCTCCCCAGCCC	0.617													ENSG00000159618																																					0													78.0	65.0	69.0					16																	57601387		2198	4300	6498	SO:0001819	synonymous_variant	0			-	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.705C>T	16.37:g.57601387C>T			B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.L235	ENST00000340339.4	37	c.705	CCDS10785.1	16																																																																																			-	GPR114	-	smart_GPS_dom,pfscan_GPS_dom		0.617	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR114	HGNC	protein_coding	OTTHUMT00000257336.3	0	0		25	25		0.00		C	NM_153837		57601387	+1	17		21		tier1	no_errors	ENST00000340339	ensembl	human	known	74_37	silent	44.74		SNP	0.990	T	17	21
CSF2RB	1439	genome.wustl.edu	37	22	37334252	37334252	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr22:37334252C>G	ENST00000403662.3	+	14	2624	c.2402C>G	c.(2401-2403)gCa>gGa	p.A801G	CSF2RB_ENST00000536485.1_Missense_Mutation_p.A748G|CSF2RB_ENST00000262825.5_Missense_Mutation_p.A807G|CSF2RB_ENST00000406230.1_Missense_Mutation_p.A807G			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	801					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	GAACGCCCGGCAGATGTGTCC	0.662													ENSG00000100368																																					0													65.0	69.0	67.0					22																	37334252		2203	4300	6503	SO:0001583	missense	0			-	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2402C>G	22.37:g.37334252C>G	ENSP00000384053:p.Ala801Gly		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A807G	ENST00000403662.3	37	c.2420	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	C	10.40	1.338881	0.24253	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.92099	-2.46;-2.97;-2.97;-2.97	5.4	-7.21	0.01490	.	0.777720	0.10890	N	0.622791	T	0.81559	0.4848	L	0.46157	1.445	0.09310	N	1	B;B	0.15141	0.012;0.007	B;B	0.11329	0.006;0.003	T	0.68021	-0.5519	10	0.16420	T	0.52	-2.2166	0.2917	0.00259	0.3202:0.1836:0.1457:0.3505	.	807;801	P32927-2;P32927	.;IL3RB_HUMAN	G	801;801;807;807;748	ENSP00000384053:A801G;ENSP00000262825:A807G;ENSP00000385271:A807G;ENSP00000440003:A748G	ENSP00000262825:A807G	A	+	2	0	CSF2RB	35664198	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.728000	0.04925	-0.846000	0.04174	-0.300000	0.09419	GCA	-	CSF2RB	-	pirsf_IL3_rcpt_beta		0.662	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	0	0		58	58		0.00		C	NM_000395		37334252	+1	12		69		tier1	no_errors	ENST00000262825	ensembl	human	known	74_37	missense	14.81		SNP	0.000	G	12	69
PACSIN3	29763	genome.wustl.edu	37	11	47199923	47199923	+	Nonsense_Mutation	SNP	G	G	A	rs369095922		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr11:47199923G>A	ENST00000539589.1	-	10	1495	c.1153C>T	c.(1153-1155)Cga>Tga	p.R385*	ARFGAP2_ENST00000395449.3_5'Flank|PACSIN3_ENST00000298838.6_Nonsense_Mutation_p.R385*|ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000524782.1_5'Flank|ARFGAP2_ENST00000319543.6_5'Flank|ARFGAP2_ENST00000419701.2_5'Flank	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	385	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						GTACCTGCTCGGAAGCTCAGC	0.587													ENSG00000165912																																					0								G	stop/ARG,stop/ARG,stop/ARG	0,4402		0,0,2201	99.0	88.0	92.0		1153,1153,1153	1.3	1.0	11		92	1,8595	1.2+/-3.3	0,1,4297	no	stop-gained,stop-gained,stop-gained	PACSIN3	NM_001184974.1,NM_001184975.1,NM_016223.4	,,	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	,,	385/425,385/425,385/425	47199923	1,12997	2201	4298	6499	SO:0001587	stop_gained	0			-	AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.1153C>T	11.37:g.47199923G>A	ENSP00000440945:p.Arg385*		A6NH84|Q9H331|Q9NWV9	Nonsense_Mutation	SNP	pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,prints_SH3_domain	p.R385*	ENST00000539589.1	37	c.1153	CCDS31481.1	11	.	.	.	.	.	.	.	.	.	.	G	37	6.095560	0.97276	0.0	1.16E-4	ENSG00000165912	ENST00000298838;ENST00000539589;ENST00000528462	.	.	.	4.56	1.27	0.21489	.	0.286587	0.32028	N	0.006683	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-0.814	13.3213	0.60434	0.0:0.0:0.4172:0.5828	.	.	.	.	X	385	.	ENSP00000298838:R385X	R	-	1	2	PACSIN3	47156499	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.440000	0.44855	0.435000	0.26365	0.462000	0.41574	CGA	-	PACSIN3	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain		0.587	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN3	HGNC	protein_coding	OTTHUMT00000391632.1	0	0		26	26		0.00		G	NM_016223		47199923	-1	5		52		tier1	no_errors	ENST00000298838	ensembl	human	known	74_37	nonsense	8.77		SNP	1.000	A	5	52
CHMP7	91782	genome.wustl.edu	37	8	23115547	23115547	+	Splice_Site	SNP	T	T	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr8:23115547T>A	ENST00000397677.1	+	6	1441	c.793T>A	c.(793-795)Tgt>Agt	p.C265S	CHMP7_ENST00000520102.1_3'UTR|CHMP7_ENST00000313219.7_Splice_Site_p.C265S	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	265					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		TGTTTCCAGGTGTAAAGAAGA	0.557													ENSG00000147457																																					0													77.0	88.0	84.0					8																	23115547		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.792-1T>A	8.37:g.23115547T>A			B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Missense_Mutation	SNP	pfam_Snf7	p.C265S	ENST00000397677.1	37	c.793	CCDS6040.1	8	.	.	.	.	.	.	.	.	.	.	T	23.2	4.393224	0.83011	.	.	ENSG00000147457	ENST00000397677;ENST00000313219	T;T	0.70986	-0.53;-0.53	5.75	4.58	0.56647	.	0.209841	0.64402	D	0.000010	T	0.73140	0.3549	L	0.43152	1.355	0.40231	D	0.977847	D;D	0.61697	0.99;0.979	P;P	0.62491	0.903;0.76	T	0.69015	-0.5257	10	0.21014	T	0.42	0.1363	9.9789	0.41802	0.151:0.0:0.0:0.849	.	155;265	B3KRZ9;Q8WUX9	.;CHMP7_HUMAN	S	265	ENSP00000380794:C265S;ENSP00000324491:C265S	ENSP00000324491:C265S	C	+	1	0	CHMP7	23171492	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.384000	0.52478	0.982000	0.38575	0.533000	0.62120	TGT	-	CHMP7	-	pfam_Snf7		0.557	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP7	HGNC	protein_coding	OTTHUMT00000254717.1	0	0		18	18		0.00		T	NM_152272	Missense_Mutation	23115547	+1	13		24		tier1	no_errors	ENST00000313219	ensembl	human	known	74_37	missense	35.14		SNP	1.000	A	13	24
DNM1P47	100216544	genome.wustl.edu	37	15	102294423	102294423	+	RNA	SNP	C	C	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:102294423C>G	ENST00000561463.1	+	0	2469									DNM1 pseudogene 47																		CGCGTGGGAACGAGAAGACAC	0.602													ENSG00000259660																																					0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294423C>G				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.602	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0		48	48		0.00		C	NG_009149		102294423	+1	8		20		tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	28.57		SNP	0.998	G	8	20
FGFR2	2263	genome.wustl.edu	37	10	123279550	123279550	+	Silent	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr10:123279550C>T	ENST00000358487.5	-	7	1154	c.882G>A	c.(880-882)gtG>gtA	p.V294V	FGFR2_ENST00000478859.1_Silent_p.V66V|FGFR2_ENST00000351936.6_Silent_p.V294V|FGFR2_ENST00000360144.3_Silent_p.V205V|FGFR2_ENST00000357555.5_Silent_p.V205V|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000346997.2_Silent_p.V294V|FGFR2_ENST00000369059.1_Silent_p.V179V|FGFR2_ENST00000369060.4_Silent_p.V294V|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000356226.4_Silent_p.V179V|FGFR2_ENST00000457416.2_Silent_p.V294V|FGFR2_ENST00000369056.1_Silent_p.V294V	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	294	Ig-like C2-type 3.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	CGTTCTTTTCCACGTGCTTGA	0.547		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome				ENSG00000066468																												Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	0													129.0	121.0	124.0					10																	123279550		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	-	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.882G>A	10.37:g.123279550C>T			B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Silent	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V294	ENST00000358487.5	37	c.882	CCDS31298.1	10																																																																																			-	FGFR2	-	pirsf_FGF_rcpt_fam,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.547	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	HGNC	protein_coding	OTTHUMT00000050715.1	0	0		51	51		0.00		C	NM_022976, NM_000141		123279550	-1	4		38		tier1	no_errors	ENST00000457416	ensembl	human	known	74_37	silent	9.52		SNP	0.537	T	4	38
CLK4	57396	genome.wustl.edu	37	5	178046734	178046734	+	Intron	SNP	G	G	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr5:178046734G>T	ENST00000316308.4	-	3	330				RN7SKP70_ENST00000516655.1_RNA|CLK4_ENST00000522749.1_Intron	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4						protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		aatttcaaaggtcatgggcct	0.433													ENSG00000252464																																					0																																										SO:0001627	intron_variant	0			-	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.162-955C>A	5.37:g.178046734G>T				R	SNP	-	NULL	ENST00000316308.4	37	NULL	CCDS4437.1	5																																																																																			-	RN7SKP70	-	-		0.433	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RN7SKP70	HGNC	protein_coding	OTTHUMT00000253479.2	0	0		31	31		0.00		G			178046734	-1	4		34		tier1	no_errors	ENST00000516655	ensembl	human	known	74_37	rna	10.53		SNP	0.002	T	4	34
RPS6KL1	83694	genome.wustl.edu	37	14	75375803	75375803	+	Splice_Site	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr14:75375803C>T	ENST00000555647.1	-	9	1648		c.e9+1		RPS6KL1_ENST00000557413.1_Splice_Site|RPS6KL1_ENST00000354625.2_Splice_Site|RPS6KL1_ENST00000358328.4_Splice_Site|RPS6KL1_ENST00000554900.1_5'Flank			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1							ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		CCCCTTCTTGCCTGGGGCGCT	0.627													ENSG00000198208																																					0													56.0	59.0	58.0					14																	75375803		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.1360+1G>A	14.37:g.75375803C>T			A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Splice_Site	SNP	-	e7+1	ENST00000555647.1	37	c.1360+1	CCDS9834.2	14	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202115	0.79127	.	.	ENSG00000198208	ENST00000555647;ENST00000556848;ENST00000354625;ENST00000553971;ENST00000553789;ENST00000557413;ENST00000358328	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5087	0.75764	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPS6KL1	74445556	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.965000	0.76067	2.383000	0.81215	0.655000	0.94253	.	-	RPS6KL1	-	-		0.627	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	RPS6KL1	HGNC	protein_coding	OTTHUMT00000413732.1	0	0		30	30		0.00		C		Intron	75375803	-1	5		55		tier1	no_errors	ENST00000358328	ensembl	human	known	74_37	splice_site	8.33		SNP	1.000	T	5	55
GVINP1	387751	genome.wustl.edu	37	11	6740896	6740896	+	RNA	SNP	T	T	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr11:6740896T>C	ENST00000526769.3	-	0	2308					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TAGCTGCAAATATTCTTAAGC	0.438													ENSG00000254838																																					0																																												0			-	BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6740896T>C			A6NFL2|Q9H8N5	R	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			-	GVINP1	-	-		0.438	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	0	0		54	54		0.00		T	NR_003945		6740896	-1	7		32		tier1	no_errors	ENST00000526769	ensembl	human	known	74_37	rna	17.95		SNP	0.000	C	7	32
TCOF1	6949	genome.wustl.edu	37	5	149755997	149755997	+	Silent	SNP	G	G	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr5:149755997G>T	ENST00000504761.2	+	14	2154	c.2154G>T	c.(2152-2154)gtG>gtT	p.V718V	TCOF1_ENST00000394269.3_Silent_p.V718V|TCOF1_ENST00000513346.1_Silent_p.V718V|TCOF1_ENST00000377797.3_Silent_p.V718V|TCOF1_ENST00000323668.7_Silent_p.V641V|TCOF1_ENST00000439160.2_Silent_p.V718V|TCOF1_ENST00000445265.2_Silent_p.V641V|TCOF1_ENST00000451292.1_Silent_p.V718V			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	718					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAAAGTCTGTGGGGAAAGGCC	0.617													ENSG00000070814																																					0													49.0	53.0	51.0					5																	149755997		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.2154G>T	5.37:g.149755997G>T			A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Silent	SNP	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.V718	ENST00000504761.2	37	c.2154	CCDS54936.1	5																																																																																			-	TCOF1	-	pfam_TCS_treacle		0.617	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	HGNC	protein_coding	OTTHUMT00000380552.1	0	0		35	35		0.00		G	NM_001008656		149755997	+1	4		31		tier1	no_errors	ENST00000451292	ensembl	human	known	74_37	silent	11.43		SNP	0.212	T	4	31
RYR2	6262	genome.wustl.edu	37	1	237527674	237527674	+	Splice_Site	SNP	T	T	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:237527674T>A	ENST00000366574.2	+	5	626		c.e5+2		RYR2_ENST00000360064.6_Intron|RYR2_ENST00000542537.1_Splice_Site	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)						BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGATGAAGGTAAGACATCTT	0.264													ENSG00000198626																																					0													52.0	45.0	47.0					1																	237527674		1777	4042	5819	SO:0001630	splice_region_variant	0			-	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.309+2T>A	1.37:g.237527674T>A			Q15411|Q546N8|Q5T3P2	Splice_Site	SNP	-	e5+2	ENST00000366574.2	37	c.309+2	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.807228	0.70797	.	.	ENSG00000198626	ENST00000366574;ENST00000542537	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.017	0.58764	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR2	235594297	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	4.947000	0.63583	2.120000	0.65058	0.533000	0.62120	.	-	RYR2	-	-		0.264	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	0	0		26	26		0.00		T	NM_001035	Intron	237527674	+1	6		29		tier1	no_errors	ENST00000366574	ensembl	human	known	74_37	splice_site	17.14		SNP	1.000	A	6	29
PRRC2A	7916	genome.wustl.edu	37	6	31604868	31604868	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr6:31604868G>T	ENST00000376033.2	+	29	6431	c.6197G>T	c.(6196-6198)aGc>aTc	p.S2066I	PRRC2A_ENST00000376007.4_Missense_Mutation_p.S2066I	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	2066	3 X 50 AA type C repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						AAACTGAGCAGCAACCTTGGG	0.488													ENSG00000204469																																					0													82.0	87.0	85.0					6																	31604868		1509	2709	4218	SO:0001583	missense	0			-	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.6197G>T	6.37:g.31604868G>T	ENSP00000365201:p.Ser2066Ile		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.S2066I	ENST00000376033.2	37	c.6197	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	9.605	1.129812	0.21041	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01838	4.61;4.61	4.64	3.78	0.43462	.	0.082224	0.53938	D	0.000054	T	0.00875	0.0029	N	0.14661	0.345	0.37084	D	0.899121	B	0.23249	0.082	B	0.27887	0.084	T	0.52764	-0.8532	10	0.87932	D	0	-13.7224	13.0524	0.58962	0.0:0.1624:0.8376:0.0	.	2066	P48634	PRC2A_HUMAN	I	2058;2047;2066;2066;1291	ENSP00000365175:S2066I;ENSP00000365201:S2066I	ENSP00000365175:S2066I	S	+	2	0	PRRC2A	31712847	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.103000	0.31062	1.570000	0.49709	-0.127000	0.14921	AGC	-	PRRC2A	-	NULL		0.488	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	0	0		52	52		0.00		G	NM_080686		31604868	+1	8		68		tier1	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	10.53		SNP	1.000	T	8	68
PLA2G2F	64600	genome.wustl.edu	37	1	20474783	20474783	+	Silent	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:20474783C>A	ENST00000375102.3	+	5	627	c.525C>A	c.(523-525)ggC>ggA	p.G175G		NM_022819.3	NP_073730.3	Q9BZM2	PA2GF_HUMAN	phospholipase A2, group IIF	132					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		AGTACCGTGGCTTCCTCAATG	0.577													ENSG00000158786																																					0													179.0	148.0	158.0					1																	20474783		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL158172	CCDS204.2	1p35	2008-09-19			ENSG00000158786	ENSG00000158786	3.1.1.4		30040	protein-coding gene	gene with protein product						11112443	Standard	NM_022819		Approved		uc009vpp.1	Q9BZM2	OTTHUMG00000002704	ENST00000375102.3:c.525C>A	1.37:g.20474783C>A			Q5R385|Q8N217|Q9H506	Silent	SNP	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.G175	ENST00000375102.3	37	c.525	CCDS204.2	1																																																																																			-	PLA2G2F	-	superfamily_PLipase_A2_dom,smart_PLipase_A2_dom		0.577	PLA2G2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2F	HGNC	protein_coding	OTTHUMT00000007687.1	0	0		34	34		0.00		C	NM_022819		20474783	+1	16		34		tier1	no_errors	ENST00000375102	ensembl	human	known	74_37	silent	32.00		SNP	0.312	A	16	34
KNCN	148930	genome.wustl.edu	37	1	47013251	47013251	+	3'UTR	SNP	A	A	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:47013251A>T	ENST00000481882.2	-	0	837				MKNK1-AS1_ENST00000602433.1_RNA|KNCN_ENST00000524908.1_5'UTR|KNCN_ENST00000396314.3_3'UTR			A6PVL3	KNCN_HUMAN	kinocilin							apical plasma membrane (GO:0016324)|ciliary basal body (GO:0036064)|cuticular plate (GO:0032437)|integral component of membrane (GO:0016021)|kinocilium (GO:0060091)|neuronal cell body (GO:0043025)				central_nervous_system(1)|endometrium(1)|lung(1)|ovary(1)	4	Acute lymphoblastic leukemia(166;0.155)					CGAGTGCAAAAGGCCCCATTC	0.642													ENSG00000162456																																					0													23.0	28.0	27.0					1																	47013251		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			-	AK056573	CCDS44133.1	1p33	2014-02-12	2006-10-26		ENSG00000162456	ENSG00000162456			26488	protein-coding gene	gene with protein product		611455				15855039	Standard	NM_001097611		Approved	FLJ32011, KINO, L5	uc001cpy.2	A6PVL3	OTTHUMG00000007987	ENST00000481882.2:c.*151T>A	1.37:g.47013251A>T			A8MXE3	R	SNP	-	NULL	ENST00000481882.2	37	NULL		1																																																																																			-	KNCN	-	-		0.642	KNCN-002	KNOWN	not_organism_supported|basic	protein_coding	KNCN	HGNC	protein_coding	OTTHUMT00000316334.2	0	0		46	46		0.00		A	NM_182516		47013251	-1	11		66		tier1	no_errors	ENST00000524908	ensembl	human	known	74_37	rna	14.29		SNP	0.014	T	11	66
KRT71	112802	genome.wustl.edu	37	12	52946513	52946513	+	Missense_Mutation	SNP	C	C	T	rs150480717		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr12:52946513C>T	ENST00000267119.5	-	1	418	c.349G>A	c.(349-351)Gtg>Atg	p.V117M		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	117	Head.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		TCCAGCTCCACGTTGAGGGGG	0.602													ENSG00000139648																																					0								C	MET/VAL	0,4406		0,0,2203	102.0	96.0	98.0		349	4.8	1.0	12	dbSNP_134	98	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRT71	NM_033448.2	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	117/524	52946513	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.349G>A	12.37:g.52946513C>T	ENSP00000267119:p.Val117Met		B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.V117M	ENST00000267119.5	37	c.349	CCDS8831.1	12	.	.	.	.	.	.	.	.	.	.	C	13.63	2.293480	0.40594	0.0	1.16E-4	ENSG00000139648	ENST00000267119	T	0.75821	-0.97	4.82	4.82	0.62117	.	0.000000	0.40640	N	0.001041	T	0.78323	0.4265	M	0.90252	3.1	0.38086	D	0.936824	P	0.40266	0.71	B	0.36378	0.223	D	0.85524	0.1205	10	0.72032	D	0.01	.	14.7712	0.69679	0.0:0.8551:0.1449:0.0	.	117	Q3SY84	K2C71_HUMAN	M	117	ENSP00000267119:V117M	ENSP00000267119:V117M	V	-	1	0	KRT71	51232780	0.309000	0.24518	0.996000	0.52242	0.847000	0.48162	0.595000	0.24029	2.398000	0.81561	0.561000	0.74099	GTG	rs150480717	KRT71	-	NULL		0.602	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT71	HGNC	protein_coding	OTTHUMT00000396487.1	0	0		46	46		0.00		C	NM_033448		52946513	-1	11		52		tier1	no_errors	ENST00000267119	ensembl	human	known	74_37	missense	17.46		SNP	0.983	T	11	52
PAX5	5079	genome.wustl.edu	37	9	36966611	36966611	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr9:36966611G>A	ENST00000358127.4	-	6	789	c.715C>T	c.(715-717)Cgc>Tgc	p.R239C	PAX5_ENST00000377847.2_Missense_Mutation_p.R239C|PAX5_ENST00000523145.1_Missense_Mutation_p.R131C|PAX5_ENST00000377852.2_Missense_Mutation_p.R239C|PAX5_ENST00000520281.1_Missense_Mutation_p.R196C|PAX5_ENST00000523241.1_Missense_Mutation_p.R239C|PAX5_ENST00000377853.2_Missense_Mutation_p.R239C|PAX5_ENST00000446742.1_Missense_Mutation_p.R173C|PAX5_ENST00000522003.1_Missense_Mutation_p.R131C|PAX5_ENST00000414447.1_Missense_Mutation_p.R196C|PAX5_ENST00000520154.1_Missense_Mutation_p.R239C	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	239					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(41)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		TCAAACACGCGGTCCAGCACC	0.622			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""								ENSG00000196092																												Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	41	Unknown(41)	haematopoietic_and_lymphoid_tissue(41)											127.0	101.0	110.0					9																	36966611		2203	4300	6503	SO:0001583	missense	0			-		CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.715C>T	9.37:g.36966611G>A	ENSP00000350844:p.Arg239Cys		A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.R239C	ENST00000358127.4	37	c.715	CCDS6607.1	9	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549205	0.86127	.	.	ENSG00000196092	ENST00000358127;ENST00000377849;ENST00000377853;ENST00000377852;ENST00000523241;ENST00000520154;ENST00000520281;ENST00000446742;ENST00000522003;ENST00000523145;ENST00000414447;ENST00000377847;ENST00000524340	D;D;D;D;D;D;D;D;D;D;D;T	0.98207	-4.32;-4.32;-4.28;-4.79;-4.75;-4.71;-3.95;-2.12;-2.61;-4.71;-4.76;1.39	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.98570	0.9522	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;B;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.055;1.0;1.0;1.0;1.0	D;P;D;D;D;B;D;D;D;D	0.80764	0.973;0.732;0.994;0.973;0.994;0.02;0.959;0.973;0.973;0.973	D	0.98626	1.0669	10	0.33141	T	0.24	.	19.4277	0.94751	0.0:0.0:1.0:0.0	.	196;196;173;239;47;239;239;239;239;239	C0KTF8;C0KTF7;C0KTF9;C0KTF6;C0KTE2;E7ERW5;E7EQT0;Q6S730;Q6S731;Q02548	.;.;.;.;.;.;.;.;.;PAX5_HUMAN	C	239;131;239;239;239;239;196;173;131;131;196;239;47	ENSP00000350844:R239C;ENSP00000367084:R239C;ENSP00000367083:R239C;ENSP00000429637:R239C;ENSP00000429291:R239C;ENSP00000430773:R196C;ENSP00000404687:R173C;ENSP00000429359:R131C;ENSP00000429197:R131C;ENSP00000412188:R196C;ENSP00000367078:R239C;ENSP00000429404:R47C	ENSP00000350844:R239C	R	-	1	0	PAX5	36956611	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.357000	0.97099	2.568000	0.86640	0.655000	0.94253	CGC	-	PAX5	-	NULL		0.622	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX5	HGNC	protein_coding	OTTHUMT00000052433.1	0	0		28	28		0.00		G			36966611	-1	5		26		tier1	no_errors	ENST00000358127	ensembl	human	known	74_37	missense	16.13		SNP	1.000	A	5	26
CBWD6	644019	genome.wustl.edu	37	9	69205352	69205352	+	Intron	SNP	T	T	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr9:69205352T>C	ENST00000377457.5	-	14	1187				CBWD6_ENST00000382399.4_Intron|CBWD6_ENST00000468061.1_Intron|CBWD6_ENST00000377449.1_Intron	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding (GO:0005524)			lung(4)	4						GCTTATTTAGTTTTAAAAGAG	0.318													ENSG00000204790																																					0																																										SO:0001627	intron_variant	0			-		CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.1081+104A>G	9.37:g.69205352T>C				R	SNP	-	NULL	ENST00000377457.5	37	NULL	CCDS43827.1	9																																																																																			-	CBWD6	-	-		0.318	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	CBWD6	HGNC	protein_coding	OTTHUMT00000143172.2	0	0		122	122		0.00		T	XM_928822		69205352	-1	19		187		tier1	no_errors	ENST00000477430	ensembl	human	known	74_37	rna	9.22		SNP	0.000	C	19	187
HERC2P4	100289574	genome.wustl.edu	37	16	32192057	32192057	+	IGR	SNP	A	A	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr16:32192057A>T								HERC2P4 (9169 upstream) : RP11-17M15.1 (7596 downstream)																							AAGCAACAACAGGATGGCAGA	0.423													ENSG00000230267																																					0																																										SO:0001628	intergenic_variant	0			-																													16.37:g.32192057A>T				R	SNP	-	NULL		37	NULL		16	.	.	.	.	.	.	.	.	.	.	.	8.937	0.964840	0.18583	.	.	ENSG00000230267	ENST00000433784	.	.	.	2.51	2.51	0.30379	.	.	.	.	.	T	0.56277	0.1974	.	.	.	.	.	.	.	.	.	.	.	.	T	0.67795	-0.5578	4	0.87932	D	0	.	8.5488	0.33438	1.0:0.0:0.0:0.0	.	.	.	.	Q	50	.	ENSP00000402538:L50Q	L	-	2	0	AC133485.1	32099558	1.000000	0.71417	1.000000	0.80357	0.549000	0.35272	6.067000	0.71193	1.151000	0.42436	0.163000	0.16589	CTG	-	HERC2P4	-	-	0	0.423					HERC2P4	HGNC			0	0		80	80		0.00		A			32192057	-1	16		87		tier1	no_errors	ENST00000568097	ensembl	human	known	74_37	rna	15.53		SNP	1.000	T	16	87
SHROOM2	357	genome.wustl.edu	37	X	9905384	9905384	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chrX:9905384G>C	ENST00000380913.3	+	7	3888	c.3798G>C	c.(3796-3798)caG>caC	p.Q1266H	SHROOM2_ENST00000418909.2_Missense_Mutation_p.Q101H	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1266					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ACACGCGGCAGGGTGCTGAGC	0.677													ENSG00000146950																																					0													30.0	27.0	28.0					X																	9905384		2195	4298	6493	SO:0001583	missense	0			-	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3798G>C	X.37:g.9905384G>C	ENSP00000370299:p.Gln1266His		B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Q1266H	ENST00000380913.3	37	c.3798	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	G	11.04	1.520548	0.27211	.	.	ENSG00000146950	ENST00000380913;ENST00000418909;ENST00000452575;ENST00000540923	T;T;T	0.50813	2.21;1.34;0.73	4.98	2.15	0.27550	.	0.406249	0.25083	N	0.033268	T	0.53802	0.1819	L	0.61218	1.895	0.35312	D	0.783952	D;D	0.71674	0.998;0.996	P;P	0.59703	0.838;0.862	T	0.59736	-0.7398	10	0.56958	D	0.05	-4.0591	4.0466	0.09776	0.2204:0.0:0.4732:0.3065	.	101;1266	Q68DU3;Q13796	.;SHRM2_HUMAN	H	1266;101;101;101	ENSP00000370299:Q1266H;ENSP00000415229:Q101H;ENSP00000406724:Q101H	ENSP00000370299:Q1266H	Q	+	3	2	SHROOM2	9865384	0.991000	0.36638	0.010000	0.14722	0.073000	0.16967	0.319000	0.19522	0.026000	0.15269	0.594000	0.82650	CAG	-	SHROOM2	-	NULL		0.677	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	0	0		27	27		0.00		G	NM_001649		9905384	+1	6		32		tier1	no_errors	ENST00000380913	ensembl	human	known	74_37	missense	15.79		SNP	0.978	C	6	32
COA6	388753	genome.wustl.edu	37	1	234519488	234519488	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:234519488G>C	ENST00000366613.1	+	3	338	c.302G>C	c.(301-303)aGa>aCa	p.R101T	COA6_ENST00000366615.4_Missense_Mutation_p.R131T|COA6_ENST00000366612.1_Missense_Mutation_p.R55T	NM_001012985.2	NP_001013003.1	Q5JTJ3	COA6_HUMAN	cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)	101						mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|poly(A) RNA binding (GO:0044822)										TTTGATAAAAGAAGAGACTAC	0.294													ENSG00000168275																																					0													32.0	36.0	34.0					1																	234519488		2193	4291	6484	SO:0001583	missense	0			-		CCDS31059.1, CCDS55690.1	1q42.2	2012-10-15	2012-10-15	2012-10-15	ENSG00000168275	ENSG00000168275		"""Mitochondrial respiratory chain complex assembly factors"""	18025	protein-coding gene	gene with protein product		614772	"""chromosome 1 open reading frame 31"""	C1orf31		22984289	Standard	NM_001012985		Approved		uc001hwc.3	Q5JTJ3	OTTHUMG00000037945	ENST00000366613.1:c.302G>C	1.37:g.234519488G>C	ENSP00000355572:p.Arg101Thr		Q5JTJ2|Q5JTJ4|Q8TA88	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su6B,superfamily_Cyt_c_oxidase_su6B	p.R131T	ENST00000366613.1	37	c.392	CCDS31059.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344621	0.82022	.	.	ENSG00000168275	ENST00000366615;ENST00000424237;ENST00000366613;ENST00000366612	D;D;D	0.83755	-1.76;-1.76;-1.76	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.92130	0.7505	M	0.83223	2.63	0.51767	D	0.999939	D	0.89917	1.0	D	0.91635	0.999	D	0.92294	0.5844	10	0.66056	D	0.02	.	19.6405	0.95755	0.0:0.0:1.0:0.0	.	101	Q5JTJ3	CA031_HUMAN	T	131;132;101;55	ENSP00000355574:R131T;ENSP00000355572:R101T;ENSP00000355571:R55T	ENSP00000355571:R55T	R	+	2	0	C1orf31	232586111	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.244000	0.72391	2.810000	0.96702	0.655000	0.94253	AGA	-	COA6	-	pfam_Cyt_c_oxidase_su6B,superfamily_Cyt_c_oxidase_su6B		0.294	COA6-002	NOVEL	basic|CCDS	protein_coding	COA6	HGNC	protein_coding	OTTHUMT00000092613.1	0	0		95	95		0.00		G	NM_001012985		234519488	+1	14		103		tier1	no_errors	ENST00000366615	ensembl	human	novel	74_37	missense	11.86		SNP	1.000	C	14	103
ACSF2	80221	genome.wustl.edu	37	17	48539878	48539878	+	Silent	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr17:48539878C>T	ENST00000300441.4	+	6	828	c.724C>T	c.(724-726)Ctg>Ttg	p.L242L	ACSF2_ENST00000427954.2_Silent_p.L267L|ACSF2_ENST00000504392.1_Silent_p.L199L|ACSF2_ENST00000502667.1_Silent_p.L229L|ACSF2_ENST00000541920.1_Silent_p.L82L	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	242					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			ACGGCAGCATCTGGACCAGCT	0.617													ENSG00000167107																																					0													92.0	77.0	82.0					17																	48539878		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.724C>T	17.37:g.48539878C>T			B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.L242	ENST00000300441.4	37	c.724	CCDS11567.1	17																																																																																			-	ACSF2	-	pfam_AMP-dep_Synth/Lig		0.617	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3	0	0		24	24		0.00		C	NM_025149		48539878	+1	5		31		tier1	no_errors	ENST00000300441	ensembl	human	known	74_37	silent	13.89		SNP	0.066	T	5	31
STK31	56164	genome.wustl.edu	37	7	23775341	23775341	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr7:23775341delA	ENST00000355870.3	+	7	787	c.668delA	c.(667-669)gaafs	p.E223fs	STK31_ENST00000433467.2_Frame_Shift_Del_p.E223fs|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000428484.1_Frame_Shift_Del_p.E200fs|STK31_ENST00000354639.3_Frame_Shift_Del_p.E200fs	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	223						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.E223V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						ATCTGTGAGGAAAAAAAATTG	0.473													ENSG00000196335																																					1	Substitution - Missense(1)	kidney(1)							,,	10,4254		5,0,2127	102.0	100.0	101.0		,,	4.3	1.0	7		102	11,8243		5,1,4121	no	frameshift,frameshift,frameshift	STK31	NM_032944.2,NM_031414.3,NM_001122833.1	,,	10,1,6248	A1A1,A1R,RR		0.1333,0.2345,0.1678	,,	,,	23775341	21,12497	2203	4300	6503	SO:0001589	frameshift_variant	0				AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.668delA	7.37:g.23775341delA	ENSP00000348132:p.Glu223fs		B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Frame_Shift_Del	DEL	pfam_Tudor,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tudor,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Tudor,pfscan_Prot_kinase_dom	p.K225fs	ENST00000355870.3	37	c.668	CCDS5386.1	7																																																																																				STK31	-	NULL		0.473	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	HGNC	protein_coding	OTTHUMT00000214036.2	0	0		20	20		0.00		A	NM_031414		23775341	+1	3		22		tier1	no_errors	ENST00000355870	ensembl	human	known	74_37	frame_shift_del	12.00		DEL	0.996	-	3	22
PTPRZ1	5803	genome.wustl.edu	37	7	121616308	121616308	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr7:121616308T>C	ENST00000393386.2	+	5	949	c.538T>C	c.(538-540)Tcc>Ccc	p.S180P	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.S180P	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	180	Alpha-carbonic anhydrase.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AAGAGCTTTATCCATTTTGTT	0.308													ENSG00000106278																																					0													101.0	99.0	100.0					7																	121616308		2203	4297	6500	SO:0001583	missense	0			-	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.538T>C	7.37:g.121616308T>C	ENSP00000377047:p.Ser180Pro		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.S180P	ENST00000393386.2	37	c.538	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	T	19.55	3.849294	0.71603	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.56275	0.47;0.47	5.43	4.28	0.50868	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.64402	D	0.000003	T	0.68467	0.3004	M	0.69185	2.1	0.36695	D	0.87979	B;D	0.89917	0.043;1.0	B;D	0.91635	0.026;0.999	T	0.75193	-0.3404	10	0.87932	D	0	.	11.1789	0.48616	0.0:0.0725:0.0:0.9275	.	180;180	C9JFM0;P23471	.;PTPRZ_HUMAN	P	180	ENSP00000377047:S180P;ENSP00000410000:S180P	ENSP00000377047:S180P	S	+	1	0	PTPRZ1	121403544	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	5.504000	0.66968	0.907000	0.36646	0.443000	0.29094	TCC	-	PTPRZ1	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.308	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	0	0		78	78		0.00		T	NM_002851		121616308	+1	20		52		tier1	no_errors	ENST00000393386	ensembl	human	known	74_37	missense	27.78		SNP	1.000	C	20	52
KIF7	374654	genome.wustl.edu	37	15	90176192	90176192	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:90176192C>G	ENST00000394412.3	-	14	2830	c.2754G>C	c.(2752-2754)gaG>gaC	p.E918D		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	918					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CCTTCTCCATCTCCTGGTCCA	0.627													ENSG00000166813																																					0													27.0	25.0	26.0					15																	90176192		2199	4295	6494	SO:0001583	missense	0			-	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2754G>C	15.37:g.90176192C>G	ENSP00000377934:p.Glu918Asp		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E918D	ENST00000394412.3	37	c.2754	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688726	0.48097	.	.	ENSG00000166813	ENST00000394412	T	0.36340	1.26	5.02	2.75	0.32379	.	0.000000	0.85682	D	0.000000	T	0.56016	0.1957	M	0.75777	2.31	0.43798	D	0.996349	D;D	0.76494	0.977;0.999	P;D	0.78314	0.725;0.991	T	0.56559	-0.7959	10	0.37606	T	0.19	.	12.1705	0.54155	0.0:0.8288:0.0:0.1712	.	404;918	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	D	918	ENSP00000377934:E918D	ENSP00000377934:E918D	E	-	3	2	KIF7	87977196	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.828000	0.27435	1.092000	0.41356	0.462000	0.41574	GAG	-	KIF7	-	NULL		0.627	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	0	0		21	21		0.00		C	NM_198525		90176192	-1	8		34		tier1	no_errors	ENST00000394412	ensembl	human	known	74_37	missense	19.05		SNP	1.000	G	8	34
PTP4A2	8073	genome.wustl.edu	37	1	32384716	32384717	+	5'UTR	INS	-	-	A	rs532230753|rs370536901	byFrequency	TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr1:32384716_32384717insA	ENST00000602725.1	-	0	367_368				PTP4A2_ENST00000526960.1_5'Flank|PTP4A2_ENST00000470404.1_5'UTR|RP11-84A19.4_ENST00000602889.1_lincRNA|PTP4A2_ENST00000356536.3_5'UTR|PTP4A2_ENST00000457805.2_5'UTR|PTP4A2_ENST00000344035.6_5'UTR			Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2						peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				TGGGGAAAGTGAAAAAAAAAAA	0.371													ENSG00000184007																																					0																																										SO:0001623	5_prime_UTR_variant	0				L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000602725.1:c.-51->T	1.37:g.32384727_32384727dupA			A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	R	INS	-	NULL	ENST00000602725.1	37	NULL	CCDS348.1	1																																																																																				PTP4A2	-	-		0.371	PTP4A2-019	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A2	HGNC	protein_coding	OTTHUMT00000468092.1	0	0		18	18		0.00		-	NM_080391		32384717	-1	4		28		tier1	no_errors	ENST00000532289	ensembl	human	known	74_37	rna	12.50		INS	0.006:0.000	A	4	28
SCG3	29106	genome.wustl.edu	37	15	51987959	51987960	+	Intron	INS	-	-	A	rs78233272|rs370571693		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr15:51987959_51987960insA	ENST00000220478.3	+	8	1271				SCG3_ENST00000542355.2_Intron|RP11-313P18.2_ENST00000559918.1_lincRNA	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		cctcgtctttgaaaaaaaaaaa	0.401													ENSG00000259241																																					0																																										SO:0001627	intron_variant	0				AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.869-112->A	15.37:g.51987970_51987970dupA			A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	R	INS	-	NULL	ENST00000220478.3	37	NULL	CCDS10142.1	15																																																																																				RP11-313P18.2	-	-		0.401	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259241	Clone_based_vega_gene	protein_coding	OTTHUMT00000254670.2	0	0		12	12		0.00		-	NM_013243		51987960	-1	7		21		tier1	no_errors	ENST00000559918	ensembl	human	known	74_37	rna	25.00		INS	0.003:0.006	A	7	21
CHD3	1107	genome.wustl.edu	37	17	7810447	7810447	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr17:7810447C>G	ENST00000330494.7	+	31	4820	c.4670C>G	c.(4669-4671)aCt>aGt	p.T1557S	CHD3_ENST00000358181.4_Missense_Mutation_p.T1557S|SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000380358.4_Missense_Mutation_p.T1616S	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1557					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CCTGCAGCTACTCCAGCTCCA	0.517													ENSG00000170004																																					0													92.0	95.0	94.0					17																	7810447		2203	4300	6503	SO:0001583	missense	0			-	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4670C>G	17.37:g.7810447C>G	ENSP00000332628:p.Thr1557Ser		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.T1557S	ENST00000330494.7	37	c.4670	CCDS32554.1	17	.	.	.	.	.	.	.	.	.	.	C	11.81	1.749022	0.30955	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.90133	-2.62;-2.54;-2.55	4.47	4.47	0.54385	.	0.000000	0.47852	D	0.000218	D	0.84379	0.5459	N	0.08118	0	0.47276	D	0.999379	D;P;P;P	0.61697	0.99;0.951;0.919;0.919	P;P;B;B	0.51701	0.677;0.479;0.373;0.373	D	0.83412	0.0028	10	0.29301	T	0.29	-15.0154	12.1876	0.54247	0.0:0.9139:0.0:0.0861	.	133;1557;1557;1616	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	S	1616;1557;1557	ENSP00000369716:T1616S;ENSP00000350907:T1557S;ENSP00000332628:T1557S	ENSP00000332628:T1557S	T	+	2	0	CHD3	7751172	0.143000	0.22626	1.000000	0.80357	0.962000	0.63368	1.263000	0.33004	2.471000	0.83476	0.407000	0.27541	ACT	-	CHD3	-	NULL		0.517	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	0	0		32	32		0.00		C	NM_001005273		7810447	+1	19		31		tier1	no_errors	ENST00000330494	ensembl	human	known	74_37	missense	38.00		SNP	1.000	G	19	31
ANKRD20A11P	391267	genome.wustl.edu	37	21	15290022	15290022	+	IGR	SNP	T	T	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr21:15290022T>C								CYP4F29P (69337 upstream) : ANKRD20A11P (26067 downstream)																							AACATCTTTTTATCCTTCTCA	0.303													ENSG00000215559																																					0																																										SO:0001628	intergenic_variant	0			-																													21.37:g.15290022T>C				R	SNP	-	NULL		37	NULL		21																																																																																			-	ANKRD20A11P	-	-	0	0.303					ANKRD20A11P	HGNC			0	0		204	204		0.00		T			15290022	-1	93		129		tier1	no_errors	ENST00000442192	ensembl	human	known	74_37	rna	41.89		SNP	1.000	C	93	129
UBN2	254048	genome.wustl.edu	37	7	138916591	138916591	+	Silent	SNP	C	C	A			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr7:138916591C>A	ENST00000473989.3	+	1	361	c.361C>A	c.(361-363)Cgg>Agg	p.R121R	UBN2_ENST00000288561.8_Silent_p.R38R	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	121	Pro-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						GCAGCCGCCGCGGCCGCCGAG	0.761													ENSG00000157741																																					0													9.0	11.0	10.0					7																	138916591		1903	4107	6010	SO:0001819	synonymous_variant	0			-	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.361C>A	7.37:g.138916591C>A			A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Silent	SNP	NULL	p.R121	ENST00000473989.3	37	c.361	CCDS43655.2	7																																																																																			-	UBN2	-	NULL		0.761	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBN2	HGNC	protein_coding	OTTHUMT00000349272.3	0	0		23	23		0.00		C	NM_173569		138916591	+1	4		23		tier1	no_errors	ENST00000473989	ensembl	human	known	74_37	silent	14.81		SNP	0.765	A	4	23
CHD3	1107	genome.wustl.edu	37	17	7810224	7810224	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr17:7810224T>G	ENST00000330494.7	+	30	4691	c.4541T>G	c.(4540-4542)aTg>aGg	p.M1514R	CHD3_ENST00000358181.4_Missense_Mutation_p.M1514R|SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000380358.4_Missense_Mutation_p.M1573R	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1514					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CGTTGGTCAATGCCGGAACTG	0.597													ENSG00000170004																																					0													120.0	119.0	120.0					17																	7810224		2203	4300	6503	SO:0001583	missense	0			-	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4541T>G	17.37:g.7810224T>G	ENSP00000332628:p.Met1514Arg		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.M1514R	ENST00000330494.7	37	c.4541	CCDS32554.1	17	.	.	.	.	.	.	.	.	.	.	T	10.83	1.462341	0.26248	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.91124	-2.79;-2.7;-2.73	4.52	4.52	0.55395	Domain of unknown function DUF1086 (1);	0.000000	0.56097	D	0.000028	D	0.92886	0.7737	M	0.66939	2.045	0.58432	D	0.999996	D;P;P;P	0.57571	0.98;0.531;0.586;0.784	P;B;B;B	0.61533	0.89;0.201;0.302;0.39	D	0.92999	0.6421	10	0.72032	D	0.01	-28.129	9.6375	0.39819	0.0:0.0853:0.0:0.9147	.	90;1514;1514;1573	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	R	1573;1514;1514	ENSP00000369716:M1573R;ENSP00000350907:M1514R;ENSP00000332628:M1514R	ENSP00000332628:M1514R	M	+	2	0	CHD3	7750949	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.486000	0.45259	2.018000	0.59344	0.379000	0.24179	ATG	-	CHD3	-	pfam_DUF1086		0.597	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	0	0		22	22		0.00		T	NM_001005273		7810224	+1	5		16		tier1	no_errors	ENST00000330494	ensembl	human	known	74_37	missense	23.81		SNP	1.000	G	5	16
CHD3	1107	genome.wustl.edu	37	17	7810227	7810227	+	Missense_Mutation	SNP	C	C	T	rs368103933		TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr17:7810227C>T	ENST00000330494.7	+	30	4694	c.4544C>T	c.(4543-4545)cCg>cTg	p.P1515L	CHD3_ENST00000358181.4_Missense_Mutation_p.P1515L|SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000380358.4_Missense_Mutation_p.P1574L	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1515					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P1515L(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				TGGTCAATGCCGGAACTGATG	0.592													ENSG00000170004	C|||	1	0.000199681	0.0	0.0	5008	,	,		17925	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						C	LEU/PRO,LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	122.0	122.0	122.0		4721,4544,4544	4.5	1.0	17		122	0,8600		0,0,4300	no	missense,missense,missense	CHD3	NM_001005271.2,NM_001005273.2,NM_005852.3	98,98,98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	1574/2060,1515/2001,1515/1967	7810227	1,13005	2203	4300	6503	SO:0001583	missense	0			-	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4544C>T	17.37:g.7810227C>T	ENSP00000332628:p.Pro1515Leu		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1515L	ENST00000330494.7	37	c.4544	CCDS32554.1	17	.	.	.	.	.	.	.	.	.	.	C	16.99	3.274498	0.59649	2.27E-4	0.0	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.94537	-3.45;-3.37;-3.36	4.52	4.52	0.55395	Domain of unknown function DUF1086 (1);	0.000000	0.45867	D	0.000325	D	0.97192	0.9082	M	0.80847	2.515	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	D	0.97862	1.0281	10	0.87932	D	0	-12.9622	17.3957	0.87444	0.0:1.0:0.0:0.0	.	91;1515;1515;1574	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	L	1574;1515;1515	ENSP00000369716:P1574L;ENSP00000350907:P1515L;ENSP00000332628:P1515L	ENSP00000332628:P1515L	P	+	2	0	CHD3	7750952	1.000000	0.71417	0.985000	0.45067	0.878000	0.50629	5.548000	0.67255	2.493000	0.84123	0.462000	0.41574	CCG	-	CHD3	-	pfam_DUF1086		0.592	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	0	0		22	22		0.00		C	NM_001005273		7810227	+1	6		15		tier1	no_errors	ENST00000330494	ensembl	human	known	74_37	missense	28.57		SNP	1.000	T	6	15
CHCHD6	84303	genome.wustl.edu	37	3	126633574	126633574	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr3:126633574A>G	ENST00000290913.3	+	6	640	c.547A>G	c.(547-549)Aag>Gag	p.K183E	CHCHD6_ENST00000515867.1_3'UTR|CHCHD6_ENST00000508789.1_Missense_Mutation_p.K184E	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6	183					cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(3)|lung(3)	8						GGCAGCCTCAAAGATGGAGAG	0.383													ENSG00000159685																																					0													98.0	106.0	103.0					3																	126633574		2203	4300	6503	SO:0001583	missense	0			-	BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601	ENST00000290913.3:c.547A>G	3.37:g.126633574A>G	ENSP00000290913:p.Lys183Glu		D6R9U0|D6RIB4|H8Y0Y7	Missense_Mutation	SNP	pfam_DUF737	p.K183E	ENST00000290913.3	37	c.547	CCDS3041.1	3	.	.	.	.	.	.	.	.	.	.	A	10.47	1.359204	0.24598	.	.	ENSG00000159685	ENST00000290913;ENST00000508789	T;T	0.40756	1.02;1.02	4.43	3.21	0.36854	.	0.272828	0.34362	N	0.004039	T	0.31734	0.0806	N	0.21194	0.64	0.22330	N	0.999194	D;D	0.53745	0.961;0.962	P;P	0.51701	0.626;0.677	T	0.13495	-1.0507	10	0.06757	T	0.87	-16.0023	9.4997	0.39011	0.7635:0.2365:0.0:0.0	.	184;183	D6R9U0;Q9BRQ6	.;CHCH6_HUMAN	E	183;184	ENSP00000290913:K183E;ENSP00000422912:K184E	ENSP00000290913:K183E	K	+	1	0	CHCHD6	128116264	0.489000	0.26004	0.951000	0.38953	0.214000	0.24535	1.991000	0.40727	1.777000	0.52277	0.460000	0.39030	AAG	-	CHCHD6	-	pfam_DUF737		0.383	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD6	HGNC	protein_coding	OTTHUMT00000356432.1	0	0		50	50		0.00		A	NM_032343		126633574	+1	12		78		tier1	no_errors	ENST00000290913	ensembl	human	known	74_37	missense	13.33		SNP	0.498	G	12	78
ZNF469	84627	genome.wustl.edu	37	16	88496432	88496432	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr16:88496432G>C	ENST00000437464.1	+	1	2554	c.2554G>C	c.(2554-2556)Gag>Cag	p.E852Q	ZNF469_ENST00000565624.1_Missense_Mutation_p.E852Q	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	852					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CAACGGCATGGAGTACCAGTC	0.662													ENSG00000225614																																					0													11.0	15.0	14.0					16																	88496432		689	1581	2270	SO:0001583	missense	0			-	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.2554G>C	16.37:g.88496432G>C	ENSP00000402343:p.Glu852Gln			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E852Q	ENST00000437464.1	37	c.2554	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077613	0.36662	.	.	ENSG00000225614	ENST00000437464	T	0.08634	3.07	5.0	2.93	0.34026	.	.	.	.	.	T	0.06234	0.0161	N	0.19112	0.55	0.22880	N	0.99862	P	0.39480	0.675	B	0.35413	0.202	T	0.30387	-0.9980	9	0.34782	T	0.22	.	13.659	0.62354	0.0:0.297:0.703:0.0	.	852	Q96JG9	ZN469_HUMAN	Q	852	ENSP00000402343:E852Q	ENSP00000402343:E852Q	E	+	1	0	ZNF469	87023933	1.000000	0.71417	0.964000	0.40570	0.807000	0.45602	5.315000	0.65810	0.461000	0.27071	0.467000	0.42956	GAG	-	ZNF469	-	NULL		0.662	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		0	0		32	32		0.00		G	NG_012236		88496432	+1	7		66		tier1	no_errors	ENST00000437464	ensembl	human	known	74_37	missense	9.59		SNP	1.000	C	7	66
ANKRD18B	441459	genome.wustl.edu	37	9	33548671	33548671	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr9:33548671C>T	ENST00000290943.6	+	9	1795	c.1699C>T	c.(1699-1701)Cga>Tga	p.R567*		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	567										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						CTTGCTTGAACGACAACTAGA	0.398													ENSG00000230453																																					0																																										SO:0001587	stop_gained	0			-			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.1699C>T	9.37:g.33548671C>T	ENSP00000290943:p.Arg567*			Nonsense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R567*	ENST00000290943.6	37	c.1699		9	.	.	.	.	.	.	.	.	.	.	c	34	5.383018	0.95967	.	.	ENSG00000230453	ENST00000290943	.	.	.	1.5	0.51	0.16983	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	7.3977	0.26946	0.0:0.7248:0.2752:0.0	.	.	.	.	X	567	.	ENSP00000290943:R567X	R	+	1	2	ANKRD18B	33538671	0.998000	0.40836	0.019000	0.16419	0.009000	0.06853	2.058000	0.41374	0.156000	0.19299	0.305000	0.20034	CGA	-	ANKRD18B	-	NULL		0.398	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	ANKRD18B	HGNC	protein_coding	OTTHUMT00000313729.2	0	0		63	63		0.00		C	XM_001718334		33548671	+1	7		75		tier1	no_errors	ENST00000290943	ensembl	human	known	74_37	nonsense	8.54		SNP	0.918	T	7	75
LOC100631378	100631378	genome.wustl.edu	37	19	38327603	38327603	+	lincRNA	SNP	G	G	C			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr19:38327603G>C	ENST00000592640.1	-	0	209					NR_040015.1																						TCTGGATGAAGATGATTTCCT	0.398													ENSG00000225868																																					0																																												0			-																													19.37:g.38327603G>C				R	SNP	-	NULL	ENST00000592640.1	37	NULL		19																																																																																			-	AC016582.2	-	-		0.398	AC016582.2-001	KNOWN	basic	lincRNA	LOC100631378	Clone_based_vega_gene	lincRNA	OTTHUMT00000109619.2	0	0		45	45		0.00		G			38327603	-1	7		64		tier1	no_errors	ENST00000433142	ensembl	human	known	74_37	rna	9.86		SNP	0.006	C	7	64
KRT33B	3884	genome.wustl.edu	37	17	39521801	39521801	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BG-01A-12D-A417-09	TCGA-DX-A8BG-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	80ec1e1f-5a5b-4bd5-b943-a5e7b19d52be	f98679ff-cde8-4cd6-8906-fa6534122ba7	g.chr17:39521801A>T	ENST00000251646.3	-	4	642	c.593T>A	c.(592-594)gTc>gAc	p.V198D		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	198	Coil 1B.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				CAAGGTGTTGACTTCCTAATG	0.493													ENSG00000131738																																					0													43.0	45.0	44.0					17																	39521801		2190	4300	6490	SO:0001583	missense	0			-	X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.593T>A	17.37:g.39521801A>T	ENSP00000251646:p.Val198Asp		O76010	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.V198D	ENST00000251646.3	37	c.593	CCDS11389.1	17	.	.	.	.	.	.	.	.	.	.	a	13.34	2.208149	0.39003	.	.	ENSG00000131738	ENST00000251646	D	0.91068	-2.78	4.51	3.42	0.39159	Filament (1);	0.000000	0.56097	D	0.000030	D	0.96408	0.8828	H	0.98048	4.135	0.58432	D	0.999995	D	0.56521	0.976	D	0.69654	0.965	D	0.95278	0.8383	10	0.87932	D	0	.	7.9614	0.30072	0.9038:0.0:0.0962:0.0	.	198	Q14525	KT33B_HUMAN	D	198	ENSP00000251646:V198D	ENSP00000251646:V198D	V	-	2	0	KRT33B	36775327	0.856000	0.29760	0.999000	0.59377	0.120000	0.20174	4.536000	0.60636	0.849000	0.35215	0.528000	0.53228	GTC	-	KRT33B	-	pfam_IF		0.493	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT33B	HGNC	protein_coding	OTTHUMT00000257292.1	0	0		29	29		0.00		A	NM_002279		39521801	-1	8		61		tier1	no_errors	ENST00000251646	ensembl	human	known	74_37	missense	11.59		SNP	0.999	T	8	61
