#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
NOL12	79159	genome.wustl.edu	37	22	38084916	38084916	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr22:38084916C>T	ENST00000359114.4	+	4	368	c.298C>T	c.(298-300)Cac>Tac	p.H100Y	NOL12_ENST00000493862.1_3'UTR	NM_024313.2	NP_077289.1	Q9UGY1	NOL12_HUMAN	nucleolar protein 12	100						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	8	Melanoma(58;0.0574)					GCAGTATGACCACCCCAACCA	0.637													ENSG00000100101																																					0													208.0	179.0	189.0					22																	38084916		2203	4300	6503	SO:0001583	missense	0			-	Z83844	CCDS13955.1	22q13.1	2012-05-02			ENSG00000256872	ENSG00000273899			28585	protein-coding gene	gene with protein product						12477932	Standard	NM_024313		Approved	MGC3731, Nop25, RRP17	uc003atp.3	Q9UGY1	OTTHUMG00000150660	ENST00000359114.4:c.298C>T	22.37:g.38084916C>T	ENSP00000352021:p.His100Tyr			Missense_Mutation	SNP	pfam_Nucleolar_protein_12	p.H100Y	ENST00000359114.4	37	c.298	CCDS13955.1	22	.	.	.	.	.	.	.	.	.	.	C	34	5.299617	0.95574	.	.	ENSG00000256872	ENST00000359114	D	0.83837	-1.77	5.66	5.66	0.87406	.	0.085997	0.85682	D	0.000000	D	0.89185	0.6643	L	0.48986	1.54	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89616	0.3845	10	0.72032	D	0.01	-33.6398	17.9188	0.88960	0.0:1.0:0.0:0.0	.	100	Q9UGY1	NOL12_HUMAN	Y	100	ENSP00000352021:H100Y	ENSP00000352021:H100Y	H	+	1	0	Z83844.2	36414862	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.143000	0.77348	2.675000	0.91044	0.655000	0.94253	CAC	-	NOL12	-	pfam_Nucleolar_protein_12		0.637	NOL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL12	HGNC	protein_coding	OTTHUMT00000319476.1	0	0	0	37	37	53	0.00	0.00	C	NM_024313		38084916	+1	12	18	25	22	tier1	no_errors	ENST00000359114	ensembl	human	known	74_37	missense	32.43	43.90	SNP	1.000	T	12	25
MED12L	116931	genome.wustl.edu	37	3	151083705	151083705	+	Silent	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr3:151083705C>T	ENST00000474524.1	+	21	3186	c.3148C>T	c.(3148-3150)Ctg>Ttg	p.L1050L	P2RY12_ENST00000302632.3_Intron|MED12L_ENST00000273432.4_Silent_p.L910L	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1050						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTCAGAATGGCTGGGGGTTCT	0.388													ENSG00000144893																																					0													127.0	132.0	130.0					3																	151083705		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.3148C>T	3.37:g.151083705C>T			Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.L1050	ENST00000474524.1	37	c.3148	CCDS33876.1	3																																																																																			-	MED12L	-	NULL		0.388	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	0	0	1	96	96	75	0.00	1.32	C	NM_053002		151083705	+1	27	16	89	40	tier1	no_errors	ENST00000474524	ensembl	human	known	74_37	silent	23.28	28.57	SNP	1.000	T	27	89
SNAP91	9892	genome.wustl.edu	37	6	84290167	84290167	+	Splice_Site	SNP	A	A	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr6:84290167A>T	ENST00000439399.2	-	24	2616		c.e24+1		SNAP91_ENST00000519133.1_Splice_Site|SNAP91_ENST00000195649.6_Splice_Site|SNAP91_ENST00000428679.2_Splice_Site|SNAP91_ENST00000521743.1_Splice_Site|SNAP91_ENST00000520213.1_Splice_Site|SNAP91_ENST00000520302.1_Splice_Site|SNAP91_ENST00000369694.2_Splice_Site|SNAP91_ENST00000521485.1_Splice_Site|SNAP91_ENST00000437520.1_Splice_Site	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa						clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TAGATTACTCACTGCCTACTA	0.408													ENSG00000065609																																					0													84.0	86.0	86.0					6																	84290167		1908	4106	6014	SO:0001630	splice_region_variant	0			-	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2299+1T>A	6.37:g.84290167A>T			A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Splice_Site	SNP	-	e23+2	ENST00000439399.2	37	c.2299+2	CCDS47455.1	6	.	.	.	.	.	.	.	.	.	.	A	18.76	3.693049	0.68271	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000523448;ENST00000521931	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6409	0.77001	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SNAP91	84346886	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.778000	0.75043	2.093000	0.63338	0.533000	0.62120	.	-	SP91	-	-		0.408	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SP91	HGNC	protein_coding	OTTHUMT00000375296.1	0	0	0	45	45	33	0.00	0.00	A		Intron	84290167	-1	17	10	35	26	tier1	no_errors	ENST00000369694	ensembl	human	known	74_37	splice_site	32.69	27.78	SNP	1.000	T	17	35
ZNF768	79724	genome.wustl.edu	37	16	30536059	30536059	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr16:30536059G>A	ENST00000380412.5	-	2	1577	c.1402C>T	c.(1402-1404)Cgc>Tgc	p.R468C	ZNF768_ENST00000562803.1_Missense_Mutation_p.R437C	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	468					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						GTGGAGGAGCGATTGAAGGTC	0.687													ENSG00000169957																																					0													36.0	31.0	33.0					16																	30536059		2196	4298	6494	SO:0001583	missense	0			-	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.1402C>T	16.37:g.30536059G>A	ENSP00000369777:p.Arg468Cys		Q569L7|Q96CX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_R_pol_II_repeat_euk,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R468C	ENST00000380412.5	37	c.1402	CCDS10681.2	16	.	.	.	.	.	.	.	.	.	.	G	17.20	3.328715	0.60743	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.07567	3.18	4.72	4.72	0.59763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38778	N	0.001579	T	0.20129	0.0484	L	0.41906	1.305	0.42872	D	0.994145	D	0.89917	1.0	D	0.81914	0.995	T	0.00503	-1.1701	10	0.48119	T	0.1	-14.9663	14.689	0.69070	0.0:0.0:1.0:0.0	.	468	Q9H5H4	ZN768_HUMAN	C	468;381	ENSP00000369777:R468C	ENSP00000369777:R468C	R	-	1	0	ZNF768	30443560	0.047000	0.20315	0.999000	0.59377	0.978000	0.69477	2.391000	0.44424	2.470000	0.83445	0.436000	0.28706	CGC	-	ZNF768	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.687	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF768	HGNC	protein_coding	OTTHUMT00000255522.2	0	0	0	62	62	15	0.00	0.00	G	NM_024671		30536059	-1	28	9	72	21	tier1	no_errors	ENST00000380412	ensembl	human	known	74_37	missense	27.72	30.00	SNP	0.955	A	28	72
DCLK2	166614	genome.wustl.edu	37	4	151141922	151141922	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr4:151141922G>A	ENST00000296550.7	+	6	1878	c.1124G>A	c.(1123-1125)aGt>aAt	p.S375N	DCLK2_ENST00000302176.8_Missense_Mutation_p.S392N|DCLK2_ENST00000506325.1_Missense_Mutation_p.S374N	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	375					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					CGTTGCATAAGTCCTGAAGGT	0.418													ENSG00000170390																									GBM(195;186 2215 13375 16801 37459)												0													129.0	103.0	112.0					4																	151141922		2203	4300	6503	SO:0001583	missense	0			-	BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1124G>A	4.37:g.151141922G>A	ENSP00000296550:p.Ser375Asn		C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.S392N	ENST00000296550.7	37	c.1175	CCDS34076.1	4	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121680	0.37436	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	T;T;T	0.68331	0.79;0.79;-0.32	5.49	5.49	0.81192	.	0.160337	0.64402	D	0.000010	T	0.62245	0.2412	L	0.45051	1.395	0.45183	D	0.998198	B;B;B	0.28584	0.216;0.006;0.002	B;B;B	0.34242	0.178;0.005;0.002	T	0.56245	-0.8011	10	0.18710	T	0.47	.	17.5037	0.87739	0.0:0.0:1.0:0.0	.	392;374;375	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	N	375;374;392	ENSP00000296550:S375N;ENSP00000427235:S374N;ENSP00000303887:S392N	ENSP00000296550:S375N	S	+	2	0	DCLK2	151361372	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	6.152000	0.71812	2.733000	0.93635	0.655000	0.94253	AGT	-	DCLK2	-	NULL		0.418	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	HGNC	protein_coding	OTTHUMT00000364952.1	0	0	0	45	45	84	0.00	0.00	G	NM_001040260		151141922	+1	6	18	30	63	tier1	no_errors	ENST00000302176	ensembl	human	known	74_37	missense	16.67	22.22	SNP	1.000	A	6	30
DCAF8L1	139425	genome.wustl.edu	37	X	27997691	27997691	+	Silent	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chrX:27997691G>A	ENST00000441525.1	-	1	1875	c.1761C>T	c.(1759-1761)tcC>tcT	p.S587S		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	587										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						CCTCCTCCTCGGATGTATCTG	0.502													ENSG00000226372	g|||	1	0.000264901	0.0008	0.0	3775	,	,		13163	0.0		0.0	False		,,,				2504	0.0																0													113.0	87.0	96.0					X																	27997691		2202	4300	6502	SO:0001819	synonymous_variant	0			-		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1761C>T	X.37:g.27997691G>A			B3KXX1	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S587	ENST00000441525.1	37	c.1761	CCDS35222.1	X																																																																																			-	DCAF8L1	-	NULL		0.502	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	HGNC	protein_coding	OTTHUMT00000056150.2	0	0	0	35	35	55	0.00	0.00	G	XM_066690		27997691	-1	24	33	51	77	tier1	no_errors	ENST00000441525	ensembl	human	known	74_37	silent	32.00	30.00	SNP	0.782	A	24	51
MS4A2	2206	genome.wustl.edu	37	11	59857896	59857896	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr11:59857896A>C	ENST00000278888.3	+	3	376	c.274A>C	c.(274-276)Att>Ctt	p.I92L		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	92					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	TGAGGGAGACATTTTTTCATC	0.333													ENSG00000149534																																					0													206.0	198.0	201.0					11																	59857896		2201	4294	6495	SO:0001583	missense	0			-	M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.274A>C	11.37:g.59857896A>C	ENSP00000278888:p.Ile92Leu		Q54A81	Missense_Mutation	SNP	pfam_CD20-like	p.I92L	ENST00000278888.3	37	c.274	CCDS7980.1	11	.	.	.	.	.	.	.	.	.	.	A	8.077	0.771495	0.16051	.	.	ENSG00000149534	ENST00000278888	T	0.19394	2.15	4.68	-9.36	0.00629	.	2.115250	0.02606	N	0.101545	T	0.11793	0.0287	N	0.25992	0.78	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.15052	0.012;0.012	T	0.12477	-1.0546	10	0.16896	T	0.51	-0.02	7.1368	0.25533	0.3117:0.0:0.4038:0.2845	.	22;92	Q14298;Q01362	.;FCERB_HUMAN	L	92	ENSP00000278888:I92L	ENSP00000278888:I92L	I	+	1	0	MS4A2	59614472	0.000000	0.05858	0.000000	0.03702	0.336000	0.28762	-1.953000	0.01526	-3.448000	0.00161	-0.263000	0.10527	ATT	-	MS4A2	-	pfam_CD20-like		0.333	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A2	HGNC	protein_coding	OTTHUMT00000393844.1	0	0	1	79	79	116	0.00	0.85	A			59857896	+1	13	18	49	64	tier1	no_errors	ENST00000278888	ensembl	human	known	74_37	missense	20.97	21.95	SNP	0.000	C	13	49
ARHGEF26	26084	genome.wustl.edu	37	3	153909093	153909093	+	Silent	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr3:153909093C>A	ENST00000356448.4	+	8	1940	c.1656C>A	c.(1654-1656)tcC>tcA	p.S552S	ARHGEF26_ENST00000465093.1_Silent_p.S552S|ARHGEF26_ENST00000465817.1_Intron	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	552	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						CCAATCCATCCTTTAAGGAAG	0.393													ENSG00000114790																									GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)												0													102.0	90.0	94.0					3																	153909093		1853	4097	5950	SO:0001819	synonymous_variant	0			-	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1656C>A	3.37:g.153909093C>A			B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Silent	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.S552	ENST00000356448.4	37	c.1656	CCDS46938.1	3																																																																																			-	ARHGEF26	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.393	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF26	HGNC	protein_coding	OTTHUMT00000353287.3	0	0	0	82	82	98	0.00	0.00	C	NM_015595		153909093	+1	16	14	68	95	tier1	no_errors	ENST00000356448	ensembl	human	known	74_37	silent	19.05	12.84	SNP	0.138	A	16	68
PSMC2	5701	genome.wustl.edu	37	7	102988198	102988198	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr7:102988198G>T	ENST00000435765.1	+	2	451	c.40G>T	c.(40-42)Gag>Tag	p.E14*	PSMC2_ENST00000544811.1_5'UTR|PSMC2_ENST00000292644.3_Nonsense_Mutation_p.E14*|DNAJC2_ENST00000412522.1_5'Flank|DNAJC2_ENST00000379263.3_5'Flank	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	14					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						GAAGACCAAAGAGGATGAGAA	0.587													ENSG00000161057																																					0													137.0	117.0	124.0					7																	102988198		2203	4300	6503	SO:0001587	stop_gained	0			-	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.40G>T	7.37:g.102988198G>T	ENSP00000391211:p.Glu14*		A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Nonsense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.E14*	ENST00000435765.1	37	c.40	CCDS5731.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.918274	0.99002	.	.	ENSG00000161057	ENST00000457587;ENST00000425206;ENST00000435765;ENST00000292644	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-12.5788	17.9582	0.89076	0.0:0.0:1.0:0.0	.	.	.	.	X	14	.	ENSP00000292644:E14X	E	+	1	0	PSMC2	102775434	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.131000	0.89601	2.407000	0.81776	0.655000	0.94253	GAG	-	PSMC2	-	NULL		0.587	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC2	HGNC	protein_coding	OTTHUMT00000347922.1	0	0	0	31	31	91	0.00	0.00	G	NM_002803		102988198	+1	4	22	29	61	tier1	no_errors	ENST00000292644	ensembl	human	known	74_37	nonsense	12.12	26.51	SNP	1.000	T	4	29
GREM2	64388	genome.wustl.edu	37	1	240656641	240656641	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:240656641C>A	ENST00000318160.4	-	2	401	c.135G>T	c.(133-135)tgG>tgT	p.W45C		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	45					BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			TCTGGTGCTGCCATCTCTCCG	0.657													ENSG00000180875																																					0													31.0	33.0	32.0					1																	240656641		2203	4299	6502	SO:0001583	missense	0			-	AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.135G>T	1.37:g.240656641C>A	ENSP00000318650:p.Trp45Cys		Q86UD9	Missense_Mutation	SNP	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C,pirsf_Gremlin_precursor,pfscan_Cys_knot_C	p.W45C	ENST00000318160.4	37	c.135	CCDS31070.1	1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.952685	0.53293	.	.	ENSG00000180875	ENST00000318160	T	0.02579	4.24	5.03	5.03	0.67393	.	0.610114	0.16715	U	0.202499	T	0.03434	0.0099	N	0.08118	0	0.53688	D	0.999979	P	0.47677	0.899	P	0.50537	0.643	T	0.65092	-0.6252	10	0.42905	T	0.14	-20.1738	12.7816	0.57480	0.0:0.9203:0.0:0.0797	.	45	Q9H772	GREM2_HUMAN	C	45	ENSP00000318650:W45C	ENSP00000318650:W45C	W	-	3	0	GREM2	238723264	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.874000	0.39568	2.327000	0.79052	0.557000	0.71058	TGG	-	GREM2	-	pirsf_Gremlin_precursor		0.657	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREM2	HGNC	protein_coding	OTTHUMT00000096286.1	0	0	0	86	86	14	0.00	0.00	C	NM_022469		240656641	-1	35	7	60	13	tier1	no_errors	ENST00000318160	ensembl	human	known	74_37	missense	36.84	33.33	SNP	1.000	A	35	60
CLYBL	171425	genome.wustl.edu	37	13	100518604	100518604	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr13:100518604C>T	ENST00000376360.1	+	6	772	c.745C>T	c.(745-747)Cga>Tga	p.R249*	CLYBL_ENST00000339105.4_Nonsense_Mutation_p.R249*|CLYBL_ENST00000376354.1_Nonsense_Mutation_p.R215*|CLYBL_ENST00000376355.3_Nonsense_Mutation_p.R215*|CLYBL_ENST00000444838.2_Nonsense_Mutation_p.R215*			Q8N0X4	CLYBL_HUMAN	citrate lyase beta like	249						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|metal ion binding (GO:0046872)			NS(1)|kidney(6)|large_intestine(6)|lung(10)|skin(2)	25	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CATTGACTTTCGAGATGGAGC	0.468													ENSG00000125246																																					0													94.0	92.0	93.0					13																	100518604		2203	4300	6503	SO:0001587	stop_gained	0			-	AF428253	CCDS32002.1	13q32.3	2011-04-08			ENSG00000125246	ENSG00000125246			18355	protein-coding gene	gene with protein product		609686					Standard	XM_005254030		Approved	CLB	uc001vok.3	Q8N0X4	OTTHUMG00000017278	ENST00000376360.1:c.745C>T	13.37:g.100518604C>T	ENSP00000365538:p.Arg249*		Q5W0F7|Q8TDH8	Nonsense_Mutation	SNP	pfam_Aldehyde-lyase_domain,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,pirsf_Citrate_lyase_beta	p.R249*	ENST00000376360.1	37	c.745	CCDS32002.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.850090	0.97023	.	.	ENSG00000125246	ENST00000376355;ENST00000376360;ENST00000444838;ENST00000376354;ENST00000339105;ENST00000419700	.	.	.	5.66	3.86	0.44501	.	0.332005	0.34223	N	0.004156	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-20.5317	10.6039	0.45384	0.2692:0.601:0.1298:0.0	.	.	.	.	X	215;249;215;215;249;12	.	ENSP00000342991:R249X	R	+	1	2	CLYBL	99316605	0.981000	0.34729	0.111000	0.21465	0.685000	0.39939	2.834000	0.48167	0.781000	0.33589	-0.291000	0.09656	CGA	-	CLYBL	-	pfam_Aldehyde-lyase_domain,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,pirsf_Citrate_lyase_beta		0.468	CLYBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLYBL	HGNC	protein_coding	OTTHUMT00000045611.1	0	0	0	93	93	84	0.00	0.00	C			100518604	+1	46	31	28	26	tier1	no_errors	ENST00000339105	ensembl	human	known	74_37	nonsense	62.16	54.39	SNP	0.387	T	46	28
CHD8	57680	genome.wustl.edu	37	14	21894403	21894403	+	Splice_Site	SNP	T	T	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr14:21894403T>G	ENST00000557364.1	-	5	1865		c.e5-2		CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Splice_Site|CHD8_ENST00000399982.2_Splice_Site			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8						ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTGATGGTGCTAAAAAGGAAA	0.358													ENSG00000100888																																					0													75.0	63.0	66.0					14																	21894403		1837	4092	5929	SO:0001630	splice_region_variant	0			-	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.1602-2A>C	14.37:g.21894403T>G			Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Splice_Site	SNP	-	e4-2	ENST00000557364.1	37	c.1602-2	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	T	20.5	3.993817	0.74703	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7386	0.69437	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CHD8	20964243	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	5.676000	0.68131	2.122000	0.65172	0.482000	0.46254	.	-	CHD8	-	-		0.358	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	0	0	0	18	18	111	0.00	0.00	T	NM_020920	Intron	21894403	-1	7	19	34	134	tier1	no_errors	ENST00000399982	ensembl	human	known	74_37	splice_site	17.07	12.42	SNP	1.000	G	7	34
PCDHA6	56142	genome.wustl.edu	37	5	140208144	140208144	+	Silent	SNP	C	C	T	rs373076921		TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr5:140208144C>T	ENST00000529310.1	+	1	582	c.468C>T	c.(466-468)ggC>ggT	p.G156G	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Silent_p.G156G|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	156					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACTGGAGGGCGCGTCCGATG	0.458													ENSG00000081842																																					0													86.0	91.0	89.0					5																	140208144		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.468C>T	5.37:g.140208144C>T			O75283|Q9NRT8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G156	ENST00000529310.1	37	c.468	CCDS47281.1	5																																																																																			-	PCDHA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin		0.458	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	0	0	0	51	51	96	0.00	0.00	C	NM_018909		140208144	+1	9	18	40	80	tier1	no_errors	ENST00000529310	ensembl	human	known	74_37	silent	18.37	18.37	SNP	0.996	T	9	40
ZNF81	347344	genome.wustl.edu	37	X	47775958	47775958	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chrX:47775958A>G	ENST00000376954.1	+	6	2281	c.1913A>G	c.(1912-1914)tAt>tGt	p.Y638C	ZNF81_ENST00000338637.7_Missense_Mutation_p.Y638C			P51508	ZNF81_HUMAN	zinc finger protein 81	638					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				GATAAACCGTATAAATGCAGC	0.383													ENSG00000197779																																					0													42.0	43.0	42.0					X																	47775958		2090	4232	6322	SO:0001583	missense	0			-	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.1913A>G	X.37:g.47775958A>G	ENSP00000366153:p.Tyr638Cys		Q6RX22|Q96QH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y638C	ENST00000376954.1	37	c.1913	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	A	13.34	2.208719	0.39003	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.25414	1.8;1.8	4.21	4.21	0.49690	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36665	N	0.002467	T	0.46347	0.1388	M	0.78049	2.395	0.25269	N	0.989534	D	0.89917	1.0	D	0.76071	0.987	T	0.37126	-0.9719	10	0.72032	D	0.01	.	6.279	0.20997	0.7753:0.0:0.0:0.2247	.	638	P51508	ZNF81_HUMAN	C	638	ENSP00000366153:Y638C;ENSP00000341151:Y638C	ENSP00000341151:Y638C	Y	+	2	0	ZNF81	47660902	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	0.200000	0.17257	1.881000	0.54492	0.417000	0.27973	TAT	-	ZNF81	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	0	0	0	39	39	73	0.00	0.00	A	NM_007137		47775958	+1	15	18	79	124	tier1	no_errors	ENST00000338637	ensembl	human	known	74_37	missense	15.96	12.68	SNP	1.000	G	15	79
C4BPA	722	genome.wustl.edu	37	1	207304944	207304944	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:207304944A>T	ENST00000367070.3	+	8	1137	c.943A>T	c.(943-945)Agg>Tgg	p.R315W		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	315	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						AACATATCCTAGGCCGACAAA	0.423													ENSG00000123838																																					0													166.0	119.0	135.0					1																	207304944		2203	4300	6503	SO:0001583	missense	0			-	M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.943A>T	1.37:g.207304944A>T	ENSP00000356037:p.Arg315Trp		Q5VVQ8	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R315W	ENST00000367070.3	37	c.943	CCDS1477.1	1	.	.	.	.	.	.	.	.	.	.	A	9.068	0.996137	0.19043	.	.	ENSG00000123838	ENST00000367070	T	0.50277	0.75	3.96	-3.31	0.04988	Complement control module (2);Sushi/SCR/CCP (3);	2.237040	0.01762	N	0.030615	T	0.33323	0.0859	L	0.36672	1.1	0.09310	N	1	B	0.12630	0.006	B	0.16722	0.016	T	0.07558	-1.0766	10	0.37606	T	0.19	.	1.0025	0.01480	0.2821:0.2939:0.0961:0.3279	.	315	P04003	C4BPA_HUMAN	W	315	ENSP00000356037:R315W	ENSP00000356037:R315W	R	+	1	2	C4BPA	205371567	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.041000	0.01415	-0.648000	0.05437	-0.316000	0.08728	AGG	-	C4BPA	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.423	C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4BPA	HGNC	protein_coding	OTTHUMT00000088089.3	0	0	0	66	66	117	0.00	0.00	A			207304944	+1	25	17	53	80	tier1	no_errors	ENST00000367070	ensembl	human	known	74_37	missense	32.05	17.53	SNP	0.000	T	25	53
GREM2	64388	genome.wustl.edu	37	1	240656642	240656642	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:240656642C>A	ENST00000318160.4	-	2	400	c.134G>T	c.(133-135)tGg>tTg	p.W45L		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	45					BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			CTGGTGCTGCCATCTCTCCGA	0.657													ENSG00000180875																																					0													31.0	33.0	32.0					1																	240656642		2203	4299	6502	SO:0001583	missense	0			-	AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.134G>T	1.37:g.240656642C>A	ENSP00000318650:p.Trp45Leu		Q86UD9	Missense_Mutation	SNP	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C,pirsf_Gremlin_precursor,pfscan_Cys_knot_C	p.W45L	ENST00000318160.4	37	c.134	CCDS31070.1	1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.009980	0.35415	.	.	ENSG00000180875	ENST00000318160	T	0.02158	4.42	5.03	5.03	0.67393	.	0.610114	0.16715	U	0.202499	T	0.01905	0.0060	N	0.08118	0	0.36575	D	0.873238	B	0.22414	0.069	B	0.24006	0.05	T	0.58148	-0.7687	10	0.13470	T	0.59	-20.1738	18.3609	0.90374	0.0:1.0:0.0:0.0	.	45	Q9H772	GREM2_HUMAN	L	45	ENSP00000318650:W45L	ENSP00000318650:W45L	W	-	2	0	GREM2	238723265	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.518000	0.53451	2.327000	0.79052	0.557000	0.71058	TGG	-	GREM2	-	pirsf_Gremlin_precursor		0.657	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREM2	HGNC	protein_coding	OTTHUMT00000096286.1	0	0	0	89	89	14	0.00	0.00	C	NM_022469		240656642	-1	35	6	61	14	tier1	no_errors	ENST00000318160	ensembl	human	known	74_37	missense	36.46	28.57	SNP	1.000	A	35	61
RP11-1166P10.1	0	genome.wustl.edu	37	16	31995067	31995067	+	RNA	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr16:31995067C>T	ENST00000568570.1	+	0	334																											CCCGGCTGTGCCAACCAAGCT	0.587													ENSG00000260628																																					0																																												0			-																													16.37:g.31995067C>T				R	SNP	-	NULL	ENST00000568570.1	37	NULL		16																																																																																			-	RP11-1166P10.1	-	-		0.587	RP11-1166P10.1-002	KNOWN	basic	processed_transcript	ENSG00000260628	Clone_based_vega_gene	pseudogene	OTTHUMT00000432457.1	0	0	0	45	45	16	0.00	0.00	C			31995067	+1	15	6	45	28	tier1	no_errors	ENST00000568570	ensembl	human	known	74_37	rna	25.00	17.65	SNP	1.000	T	15	45
DSG4	147409	genome.wustl.edu	37	18	28993106	28993106	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr18:28993106C>T	ENST00000308128.4	+	16	2806	c.2671C>T	c.(2671-2673)Caa>Taa	p.Q891*	RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Nonsense_Mutation_p.Q910*	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	891					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AGTTGAATTCCAAGAAGAAAT	0.433													ENSG00000175065																																					0													131.0	125.0	127.0					18																	28993106		2203	4300	6503	SO:0001587	stop_gained	0			-	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2671C>T	18.37:g.28993106C>T	ENSP00000311859:p.Gln891*		A2RUI1|Q6Y9L9|Q8IXV4	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.Q910*	ENST00000308128.4	37	c.2728	CCDS11897.1	18	.	.	.	.	.	.	.	.	.	.	C	39	7.602530	0.98384	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	.	.	.	5.65	4.77	0.60923	.	0.000000	0.33382	N	0.004967	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	15.582	0.76452	0.1391:0.8609:0.0:0.0	.	.	.	.	X	891;910	.	ENSP00000311859:Q891X	Q	+	1	0	DSG4	27247104	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	2.155000	0.42301	1.357000	0.45904	0.655000	0.94253	CAA	-	DSG4	-	NULL		0.433	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	HGNC	protein_coding	OTTHUMT00000254941.1	0	0	0	32	32	91	0.00	0.00	C	NM_177986		28993106	+1	6	16	29	61	tier1	no_errors	ENST00000359747	ensembl	human	known	74_37	nonsense	17.14	20.78	SNP	1.000	T	6	29
PTPRO	5800	genome.wustl.edu	37	12	15654724	15654724	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr12:15654724A>T	ENST00000281171.4	+	5	1162	c.832A>T	c.(832-834)Aac>Tac	p.N278Y	PTPRO_ENST00000348962.2_Missense_Mutation_p.N278Y|PTPRO_ENST00000543886.1_Missense_Mutation_p.N278Y	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	278	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TCCCTCGGGCAACATTTCTTC	0.423													ENSG00000151490																																					0													67.0	65.0	66.0					12																	15654724		2203	4300	6503	SO:0001583	missense	0			-	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.832A>T	12.37:g.15654724A>T	ENSP00000281171:p.Asn278Tyr		A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.N278Y	ENST00000281171.4	37	c.832	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	A	8.600	0.886629	0.17540	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.03982	3.75;3.74	4.49	4.49	0.54785	.	0.000000	0.47852	D	0.000204	T	0.08044	0.0201	N	0.14661	0.345	0.80722	D	1	B;D;D	0.71674	0.11;0.991;0.998	B;P;D	0.80764	0.031;0.687;0.994	T	0.50127	-0.8864	10	0.26408	T	0.33	.	9.4326	0.38620	0.8416:0.0:0.0:0.1584	.	278;278;278	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	Y	278	ENSP00000281171:N278Y;ENSP00000343434:N278Y	ENSP00000281171:N278Y	N	+	1	0	PTPRO	15545991	0.991000	0.36638	0.997000	0.53966	0.596000	0.36781	3.498000	0.53302	1.888000	0.54679	0.529000	0.55759	AAC	-	PTPRO	-	NULL		0.423	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	0	0	0	75	75	114	0.00	0.00	A			15654724	+1	18	23	52	62	tier1	no_errors	ENST00000281171	ensembl	human	known	74_37	missense	25.71	27.06	SNP	0.958	T	18	52
SERPINB13	5275	genome.wustl.edu	37	18	61260203	61260203	+	Missense_Mutation	SNP	A	A	T	rs149477887		TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr18:61260203A>T	ENST00000344731.5	+	5	572	c.470A>T	c.(469-471)aAt>aTt	p.N157I	SERPINB13_ENST00000269489.5_Missense_Mutation_p.N157I	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	157					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						AGCAAAACAAATGGTAGAGTA	0.363													ENSG00000197641																																					0													94.0	104.0	100.0					18																	61260203		2202	4300	6502	SO:0001583	missense	0			-	AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.470A>T	18.37:g.61260203A>T	ENSP00000341584:p.Asn157Ile		A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.N157I	ENST00000344731.5	37	c.470	CCDS11985.1	18	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527055	0.85706	.	.	ENSG00000197641	ENST00000269489;ENST00000344731	T;D	0.84442	2.57;-1.85	5.63	5.63	0.86233	Serpin domain (3);	.	.	.	.	D	0.94032	0.8088	H	0.94306	3.52	0.38754	D	0.954177	D;P	0.63046	0.992;0.938	D;P	0.65010	0.931;0.565	D	0.96348	0.9256	8	.	.	.	.	15.3133	0.74053	1.0:0.0:0.0:0.0	.	166;157	B7ZKV6;Q9UIV8	.;SPB13_HUMAN	I	157	ENSP00000269489:N157I;ENSP00000341584:N157I	.	N	+	2	0	SERPINB13	59411183	0.902000	0.30710	0.941000	0.38009	0.832000	0.47134	8.208000	0.89748	2.269000	0.75478	0.454000	0.30748	AAT	-	SERPINB13	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.363	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB13	HGNC	protein_coding	OTTHUMT00000133798.1	0	0	0	57	57	82	0.00	0.00	A	NM_012397		61260203	+1	8	25	57	72	tier1	no_errors	ENST00000344731	ensembl	human	known	74_37	missense	12.31	25.77	SNP	0.955	T	8	57
CEACAM20	125931	genome.wustl.edu	37	19	45029236	45029236	+	RNA	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:45029236G>A	ENST00000454753.1	-	0	372							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				TTGAGGGTGAGCTGGGCTGCA	0.587													ENSG00000176395																																					0													109.0	117.0	114.0					19																	45029236		2100	4224	6324			0			-	AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45029236G>A				R	SNP	-	NULL	ENST00000454753.1	37	NULL		19																																																																																			-	CEACAM20	-	-		0.587	CEACAM20-001	KNOWN	basic	processed_transcript	CEACAM20	HGNC	processed_transcript	OTTHUMT00000323032.1	0	0	0	16	16	102	0.00	0.00	G	NM_198444		45029236	-1	24	167	32	100	tier1	no_errors	ENST00000316962	ensembl	human	known	74_37	rna	42.86	62.55	SNP	0.003	A	24	32
HMCN1	83872	genome.wustl.edu	37	1	186086748	186086748	+	Silent	SNP	G	G	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:186086748G>C	ENST00000271588.4	+	77	12070	c.11841G>C	c.(11839-11841)ctG>ctC	p.L3947L	HMCN1_ENST00000367492.2_Silent_p.L3947L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3947	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATAGAATTCTGTCCTCAGGTA	0.403													ENSG00000143341																																					0													92.0	91.0	91.0					1																	186086748		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11841G>C	1.37:g.186086748G>C			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.L3947	ENST00000271588.4	37	c.11841	CCDS30956.1	1																																																																																			-	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	0	0	0	37	37	115	0.00	0.00	G	NM_031935		186086748	+1	12	18	18	60	tier1	no_errors	ENST00000271588	ensembl	human	known	74_37	silent	40.00	23.08	SNP	0.983	C	12	18
OR2T12	127064	genome.wustl.edu	37	1	248458375	248458375	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:248458375G>A	ENST00000317996.1	-	1	505	c.506C>T	c.(505-507)gCa>gTa	p.A169V		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GATCTCGTGTGCACCGCAATA	0.577													ENSG00000177201																																					0													108.0	96.0	100.0					1																	248458375		2201	4298	6499	SO:0001583	missense	0			-	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.506C>T	1.37:g.248458375G>A	ENSP00000324583:p.Ala169Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A169V	ENST00000317996.1	37	c.506	CCDS31110.1	1	.	.	.	.	.	.	.	.	.	.	g	13.27	2.186082	0.38609	.	.	ENSG00000177201	ENST00000317996	T	0.36340	1.26	1.55	0.316	0.15857	GPCR, rhodopsin-like superfamily (1);	0.796012	0.10231	U	0.699582	T	0.35038	0.0918	L	0.46947	1.48	0.09310	N	1	P	0.41848	0.763	P	0.46208	0.507	T	0.29941	-0.9995	10	0.87932	D	0	.	5.5848	0.17269	0.0:0.2836:0.536:0.1805	.	169	Q8NG77	O2T12_HUMAN	V	169	ENSP00000324583:A169V	ENSP00000324583:A169V	A	-	2	0	OR2T12	246524998	0.012000	0.17670	0.001000	0.08648	0.027000	0.11550	1.338000	0.33873	0.645000	0.30675	0.175000	0.17021	GCA	-	OR2T12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.577	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T12	HGNC	protein_coding	OTTHUMT00000097353.1	0	0	0	76	76	93	0.00	0.00	G	NM_001004692		248458375	-1	8	23	46	70	tier1	no_errors	ENST00000317996	ensembl	human	known	74_37	missense	14.81	24.73	SNP	0.000	A	8	46
PRNT	149830	genome.wustl.edu	37	20	4713202	4713202	+	Missense_Mutation	SNP	G	G	C	rs548572091		TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr20:4713202G>C	ENST00000326539.2	-	2	1058	c.121C>G	c.(121-123)Ccc>Gcc	p.P41A	PRNT_ENST00000423718.2_Missense_Mutation_p.P41A|PRNT_ENST00000418528.1_Missense_Mutation_p.P41A			Q86SH4	PRNT_HUMAN	prion protein (testis specific)	41						extracellular region (GO:0005576)				endometrium(2)|lung(5)	7						ttagacatgggaattagcaag	0.458													ENSG00000180259																																					0													174.0	149.0	158.0					20																	4713202		2203	4300	6503	SO:0001583	missense	0			-	AL137296, AJ427539		20p13	2013-04-02			ENSG00000180259	ENSG00000180259			18046	other	unknown	"""M8 protein"""					12514748	Standard	NR_024267		Approved	M8	uc010zqq.2	Q86SH4	OTTHUMG00000031785	ENST00000326539.2:c.121C>G	20.37:g.4713202G>C	ENSP00000321242:p.Pro41Ala		B2RPD9|B7ZBI9	Missense_Mutation	SNP	NULL	p.P41A	ENST00000326539.2	37	c.121		20	.	.	.	.	.	.	.	.	.	.	G	8.463	0.855750	0.17106	.	.	ENSG00000180259	ENST00000418528;ENST00000326539;ENST00000423718	T;T;T	0.56776	0.44;0.44;0.44	1.65	1.65	0.23941	.	.	.	.	.	T	0.49745	0.1575	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.46871	-0.9160	6	0.87932	D	0	.	6.7525	0.23495	0.0:0.0:1.0:0.0	.	.	.	.	A	41	ENSP00000409280:P41A;ENSP00000321242:P41A;ENSP00000404306:P41A	ENSP00000321242:P41A	P	-	1	0	PRNT	4661202	0.048000	0.20356	0.014000	0.15608	0.048000	0.14542	1.071000	0.30666	1.220000	0.43490	0.514000	0.50259	CCC	-	PRNT	-	NULL		0.458	PRNT-002	KNOWN	basic|appris_principal	protein_coding	PRNT	HGNC	protein_coding	OTTHUMT00000253006.2	0	0	0	40	40	118	0.00	0.00	G	NM_177549		4713202	-1	3	4	17	30	tier1	no_errors	ENST00000326539	ensembl	human	known	74_37	missense	15.00	11.76	SNP	0.015	C	3	17
FER1L6	654463	genome.wustl.edu	37	8	125061960	125061960	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr8:125061960C>G	ENST00000522917.1	+	22	3043	c.2837C>G	c.(2836-2838)tCt>tGt	p.S946C	FER1L6_ENST00000399018.1_Missense_Mutation_p.S946C|FER1L6-AS2_ENST00000601180.1_RNA|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	946						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GGGAATCTCTCTGGAGGGGAT	0.532													ENSG00000214814																																					0													117.0	117.0	117.0					8																	125061960		1941	4148	6089	SO:0001583	missense	0			-	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2837C>G	8.37:g.125061960C>G	ENSP00000428280:p.Ser946Cys			Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.S946C	ENST00000522917.1	37	c.2837	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034115	0.75617	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.81821	-1.54;-1.54	5.91	4.95	0.65309	C2 calcium/lipid-binding domain, CaLB (1);	0.232564	0.36854	U	0.002367	D	0.83110	0.5183	L	0.39898	1.24	0.53688	D	0.999971	D	0.67145	0.996	P	0.57502	0.822	T	0.82890	-0.0233	10	0.45353	T	0.12	.	17.4767	0.87661	0.1325:0.8675:0.0:0.0	.	946	Q2WGJ9	FR1L6_HUMAN	C	946	ENSP00000428280:S946C;ENSP00000381982:S946C	ENSP00000381982:S946C	S	+	2	0	FER1L6	125131141	0.115000	0.22152	1.000000	0.80357	0.964000	0.63967	3.581000	0.53914	2.793000	0.96121	0.655000	0.94253	TCT	-	FER1L6	-	superfamily_C2_dom		0.532	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	0	0	0	51	51	81	0.00	0.00	C	NM_001039112		125061960	+1	13	11	71	96	tier1	no_errors	ENST00000399018	ensembl	human	known	74_37	missense	15.29	10.19	SNP	0.999	G	13	71
IGF2R	3482	genome.wustl.edu	37	6	160461743	160461743	+	Silent	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr6:160461743G>T	ENST00000356956.1	+	11	1615	c.1467G>T	c.(1465-1467)ctG>ctT	p.L489L		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	489					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TGTCCGCGCTGGTCCGCCATG	0.532													ENSG00000197081																																					0													124.0	109.0	114.0					6																	160461743		2203	4300	6503	SO:0001819	synonymous_variant	0			-	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1467G>T	6.37:g.160461743G>T			Q7Z7G9|Q96PT5	Silent	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.L489	ENST00000356956.1	37	c.1467	CCDS5273.1	6																																																																																			-	IGF2R	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom		0.532	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	0	0	0	63	63	43	0.00	0.00	G	NM_000876		160461743	+1	9	15	43	35	tier1	no_errors	ENST00000356956	ensembl	human	known	74_37	silent	17.31	30.00	SNP	1.000	T	9	43
CYP2C18	1562	genome.wustl.edu	37	10	96484253	96484253	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr10:96484253C>A	ENST00000285979.6	+	7	1311	c.1112C>A	c.(1111-1113)aCc>aAc	p.T371N	CYP2C18_ENST00000339022.5_Missense_Mutation_p.T312N|CYP2C19_ENST00000464755.1_3'UTR	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	371					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	CATGCAGTGACCTGTGATGTT	0.473													ENSG00000108242																																					0													216.0	184.0	195.0					10																	96484253		2203	4300	6503	SO:0001583	missense	0			-	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.1112C>A	10.37:g.96484253C>A	ENSP00000285979:p.Thr371Asn		B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.T371N	ENST00000285979.6	37	c.1112	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	c	6.178	0.400932	0.11696	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	T;T	0.69926	-0.44;-0.44	4.15	1.19	0.21007	.	0.356476	0.25780	U	0.028349	T	0.71771	0.3379	M	0.79805	2.47	0.09310	N	1	P;B	0.52061	0.95;0.049	P;B	0.53224	0.721;0.063	T	0.63033	-0.6727	10	0.51188	T	0.08	.	6.6338	0.22872	0.0:0.5867:0.0:0.4133	.	312;371	Q4VAT5;P33260	.;CP2CI_HUMAN	N	312;371	ENSP00000341293:T312N;ENSP00000285979:T371N	ENSP00000285979:T371N	T	+	2	0	CYP2C18	96474243	0.000000	0.05858	0.006000	0.13384	0.393000	0.30537	-0.025000	0.12413	0.050000	0.15949	0.313000	0.20887	ACC	-	CYP2C18	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_B		0.473	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	HGNC	protein_coding	OTTHUMT00000049486.1	0	0	0	62	62	90	0.00	0.00	C	NM_000772		96484253	+1	11	27	54	59	tier1	no_errors	ENST00000285979	ensembl	human	known	74_37	missense	16.92	31.40	SNP	0.000	A	11	54
AKAP1	8165	genome.wustl.edu	37	17	55189859	55189859	+	Silent	SNP	A	A	G	rs562043469		TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr17:55189859A>G	ENST00000337714.3	+	5	2216	c.1983A>G	c.(1981-1983)caA>caG	p.Q661Q	AKAP1_ENST00000572557.1_Silent_p.Q661Q|AKAP1_ENST00000571629.1_Silent_p.Q661Q|AKAP1_ENST00000539273.1_Silent_p.Q661Q	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	661	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					TAGGCTCTCAACATCATGTAG	0.493													ENSG00000121057																																					0													106.0	81.0	89.0					17																	55189859		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.1983A>G	17.37:g.55189859A>G			A8K8Q1|D3DTZ0|Q13320|Q9BW14	Silent	SNP	pfam_Tudor,pfam_KH_dom_type_1,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.Q661	ENST00000337714.3	37	c.1983	CCDS11594.1	17																																																																																			-	AKAP1	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.493	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP1	HGNC	protein_coding	OTTHUMT00000277069.1	0	0	0	49	49	132	0.00	0.00	A			55189859	+1	9	13	37	75	tier1	no_errors	ENST00000337714	ensembl	human	known	74_37	silent	19.57	14.77	SNP	1.000	G	9	37
CYSLTR1	10800	genome.wustl.edu	37	X	77528983	77528983	+	Silent	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chrX:77528983G>T	ENST00000373304.3	-	3	553	c.261C>A	c.(259-261)ggC>ggA	p.G87G		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	87					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	AGAGCCAAATGCCTTTGTGAA	0.433													ENSG00000173198																																					0													68.0	53.0	58.0					X																	77528983		2202	4300	6502	SO:0001819	synonymous_variant	0			-	AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.261C>A	X.37:g.77528983G>T			B2R954|D3DTE4|Q5JS94|Q8IV19	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Cyst_leuk_rcpt,prints_CLT1_recept,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.G87	ENST00000373304.3	37	c.261	CCDS14439.1	X																																																																																			-	CYSLTR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Cyst_leuk_rcpt,pfscan_GPCR_Rhodpsn_7TM		0.433	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSLTR1	HGNC	protein_coding	OTTHUMT00000057315.1	0	0	0	26	26	46	0.00	0.00	G			77528983	-1	6	7	17	29	tier1	no_errors	ENST00000373304	ensembl	human	known	74_37	silent	26.09	19.44	SNP	0.823	T	6	17
BEND7	222389	genome.wustl.edu	37	10	13541962	13541962	+	Silent	SNP	G	G	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr10:13541962G>C	ENST00000396900.2	-	3	263	c.264C>G	c.(262-264)ccC>ccG	p.P88P	BEND7_ENST00000378605.3_Silent_p.P36P|BEND7_ENST00000396898.2_Silent_p.P88P|BEND7_ENST00000341083.3_Silent_p.P36P			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	88						extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						CCAGGTCCTGGGGCTCTTCTT	0.517													ENSG00000165626																																					0													104.0	106.0	105.0					10																	13541962		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.264C>G	10.37:g.13541962G>C			Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Silent	SNP	pfam_BEN_domain	p.P88	ENST00000396900.2	37	c.264		10																																																																																			-	BEND7	-	NULL		0.517	BEND7-202	KNOWN	basic	protein_coding	BEND7	HGNC	protein_coding		0	0	0	56	56	111	0.00	0.00	G	NM_152751		13541962	-1	15	21	65	97	tier1	no_errors	ENST00000396900	ensembl	human	known	74_37	silent	18.75	17.80	SNP	1.000	C	15	65
ZNF507	22847	genome.wustl.edu	37	19	32873817	32873817	+	Missense_Mutation	SNP	C	C	G	rs144208852		TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:32873817C>G	ENST00000311921.4	+	6	2882	c.2690C>G	c.(2689-2691)tCc>tGc	p.S897C	ZNF507_ENST00000544431.1_Missense_Mutation_p.S901C|ZNF507_ENST00000355898.5_Missense_Mutation_p.S897C	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	897					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S897F(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					GAAAAAATCTCCAGTCTGGCC	0.428													ENSG00000168813																																					1	Substitution - Missense(1)	skin(1)											54.0	52.0	53.0					19																	32873817		2203	4300	6503	SO:0001583	missense	0			-	AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.2690C>G	19.37:g.32873817C>G	ENSP00000312277:p.Ser897Cys		A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S897C	ENST00000311921.4	37	c.2690	CCDS32985.1	19	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647787	0.47258	.	.	ENSG00000168813	ENST00000355898;ENST00000311921;ENST00000544431	T;T;T	0.06528	3.59;3.59;3.29	5.87	3.59	0.41128	.	0.458171	0.27513	N	0.019038	T	0.06280	0.0162	L	0.35723	1.085	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.25152	-1.0140	10	0.49607	T	0.09	-2.8264	10.9469	0.47306	0.133:0.5949:0.2722:0.0	.	897	Q8TCN5	ZN507_HUMAN	C	897;897;901	ENSP00000348162:S897C;ENSP00000312277:S897C;ENSP00000441549:S901C	ENSP00000312277:S897C	S	+	2	0	ZNF507	37565657	0.044000	0.20184	0.472000	0.27241	0.992000	0.81027	0.615000	0.24329	1.452000	0.47756	0.655000	0.94253	TCC	-	ZNF507	-	NULL		0.428	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF507	HGNC	protein_coding	OTTHUMT00000450301.3	0	0	0	35	35	80	0.00	0.00	C	NM_014910		32873817	+1	4	21	33	86	tier1	no_errors	ENST00000311921	ensembl	human	known	74_37	missense	10.81	19.63	SNP	0.022	G	4	33
PRDM11	56981	genome.wustl.edu	37	11	45203362	45203362	+	Silent	SNP	C	C	T	rs373948099		TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr11:45203362C>T	ENST00000530656.1	+	2	147	c.147C>T	c.(145-147)gcC>gcT	p.A49A	PRDM11_ENST00000263765.4_Silent_p.A49A|PRDM11_ENST00000424263.2_Silent_p.A15A			Q9NQV5	PRD11_HUMAN	PR domain containing 11	49							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						CCAATGCAGCCGTGGGGGATA	0.597													ENSG00000019485																									NSCLC(118;1511 1736 6472 36603 43224)												0													98.0	84.0	89.0					11																	45203362		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.147C>T	11.37:g.45203362C>T			Q8N9F1	Silent	SNP	pfscan_SET_dom	p.A49	ENST00000530656.1	37	c.147		11																																																																																			-	PRDM11	-	NULL		0.597	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	PRDM11	HGNC	protein_coding	OTTHUMT00000389928.1	0	0	0	24	24	63	0.00	0.00	C	NM_020229		45203362	+1	16	24	22	83	tier1	no_errors	ENST00000263765	ensembl	human	known	74_37	silent	42.11	22.43	SNP	0.628	T	16	22
PCDHA8	56140	genome.wustl.edu	37	5	140221827	140221827	+	Silent	SNP	T	T	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr5:140221827T>C	ENST00000531613.1	+	1	921	c.921T>C	c.(919-921)aaT>aaC	p.N307N	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.N307N|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	307	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGGGGTAATTTGGATTTTG	0.393													ENSG00000204962																																					0													36.0	40.0	38.0					5																	140221827		2190	4294	6484	SO:0001819	synonymous_variant	0			-	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.921T>C	5.37:g.140221827T>C			B9EGT7|O75281	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.N307	ENST00000531613.1	37	c.921	CCDS54919.1	5																																																																																			-	PCDHA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.393	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	0	0	0	92	92	84	0.00	0.00	T	NM_018911		140221827	+1	15	9	89	63	tier1	no_errors	ENST00000531613	ensembl	human	known	74_37	silent	14.42	12.50	SNP	0.000	C	15	89
ADAM3A	1587	genome.wustl.edu	37	8	39363347	39363347	+	RNA	SNP	T	T	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr8:39363347T>A	ENST00000490268.2	-	0	274					NR_073423.1				ADAM metallopeptidase domain 3A (pseudogene)																		GTGCCACAACTGATTTTGGAA	0.368													ENSG00000197475																																					0																																												0			-	X89657		8p11.22	2012-06-11	2012-06-11		ENSG00000197475	ENSG00000197475		"""ADAM metallopeptidase domain containing"""	209	pseudogene	pseudogene			"""cyritestin 1"", ""a disintegrin and metalloproteinase domain 3a (cyritestin 1)"", ""ADAM metallopeptidase domain 3A, pseudogene"", ""ADAM metallopeptidase domain 3A"""	CYRN1		9502432, 11439107	Standard	NR_024107		Approved	ADAM3, tMDCI	uc003xnf.4		OTTHUMG00000154991		8.37:g.39363347T>A				R	SNP	-	NULL	ENST00000490268.2	37	NULL		8																																																																																			-	ADAM3A	-	-		0.368	ADAM3A-005	KNOWN	basic	processed_transcript	ADAM3A	HGNC	pseudogene	OTTHUMT00000337953.1	0	0	0	70	70	59	0.00	0.00	T	NR_001569		39363347	-1	15	6	24	22	tier1	no_errors	ENST00000424066	ensembl	human	known	74_37	rna	38.46	20.69	SNP	0.002	A	15	24
SLC22A25	387601	genome.wustl.edu	37	11	62996923	62996923	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr11:62996923T>A	ENST00000306494.6	-	1	201	c.202A>T	c.(202-204)Agc>Tgc	p.S68C	SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron|SLC22A25_ENST00000403374.2_5'Flank	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						GCATCCTGGCTGAGGGTCCCA	0.507													ENSG00000196600																																					0													141.0	130.0	134.0					11																	62996923		2201	4298	6499	SO:0001583	missense	0			-	AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.202A>T	11.37:g.62996923T>A	ENSP00000307443:p.Ser68Cys			Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S68C	ENST00000306494.6	37	c.202	CCDS31592.1	11	.	.	.	.	.	.	.	.	.	.	T	12.57	1.976533	0.34848	.	.	ENSG00000196600	ENST00000306494;ENST00000451441	T	0.37752	1.18	3.81	3.81	0.43845	Major facilitator superfamily domain (1);	7739.210000	0.00166	N	0.000002	T	0.66386	0.2784	M	0.88031	2.925	0.30846	N	0.735106	D;D	0.89917	0.997;1.0	D;D	0.67231	0.928;0.95	T	0.29852	-0.9998	10	0.87932	D	0	.	6.8227	0.23866	0.2079:0.0:0.0:0.7921	.	66;68	A4IF29;Q6T423	.;S22AP_HUMAN	C	68	ENSP00000307443:S68C	ENSP00000307443:S68C	S	-	1	0	SLC22A25	62753499	0.000000	0.05858	0.214000	0.23707	0.364000	0.29643	-0.209000	0.09358	1.507000	0.48752	0.386000	0.25728	AGC	-	SLC22A25	-	pfscan_MFS_dom		0.507	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	HGNC	protein_coding	OTTHUMT00000383519.3	0	0	0	54	54	90	0.00	0.00	T	NM_199352		62996923	-1	11	16	34	59	tier1	no_errors	ENST00000306494	ensembl	human	known	74_37	missense	24.44	21.33	SNP	0.364	A	11	34
TRPM6	140803	genome.wustl.edu	37	9	77377199	77377199	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr9:77377199G>A	ENST00000360774.1	-	26	4625	c.4388C>T	c.(4387-4389)aCt>aTt	p.T1463I	TRPM6_ENST00000451710.3_Missense_Mutation_p.T1463I|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.T1463I|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.T1458I|TRPM6_ENST00000449912.2_Missense_Mutation_p.T1458I	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1463					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AAACACACCAGTTTCATCACC	0.493													ENSG00000119121																																					0													121.0	120.0	120.0					9																	77377199		2203	4300	6503	SO:0001583	missense	0			-	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4388C>T	9.37:g.77377199G>A	ENSP00000354006:p.Thr1463Ile		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.T1463I	ENST00000360774.1	37	c.4388	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	9.525	1.109328	0.20714	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T	0.54866	0.64;0.64;0.64;0.64;0.55	5.81	2.94	0.34122	.	0.801075	0.11828	N	0.525526	T	0.31670	0.0804	N	0.08118	0	0.20638	N	0.999871	P;P;P	0.41524	0.638;0.465;0.753	B;B;B	0.40534	0.178;0.165;0.332	T	0.10520	-1.0626	10	0.72032	D	0.01	.	6.4442	0.21867	0.2048:0.0:0.6269:0.1683	.	1463;1458;1458	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	I	1463;1463;1458;1458;1463	ENSP00000354006:T1463I;ENSP00000407341:T1463I;ENSP00000396672:T1458I;ENSP00000354962:T1458I;ENSP00000366060:T1463I	ENSP00000354006:T1463I	T	-	2	0	TRPM6	76567019	0.891000	0.30450	0.433000	0.26760	0.091000	0.18340	1.184000	0.32053	1.451000	0.47736	0.655000	0.94253	ACT	-	TRPM6	-	NULL		0.493	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	0	0	1	31	31	116	0.00	0.85	G	NM_017662		77377199	-1	13	57	32	63	tier1	no_errors	ENST00000451710	ensembl	human	known	74_37	missense	28.89	47.11	SNP	0.227	A	13	32
PAPPA	5069	genome.wustl.edu	37	9	118997486	118997486	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr9:118997486C>T	ENST00000328252.3	+	7	2671	c.2302C>T	c.(2302-2304)Cca>Tca	p.P768S	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	768					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						AGCTGTCAACCCACACACGGT	0.552													ENSG00000182752																																					0													118.0	96.0	103.0					9																	118997486		2203	4300	6503	SO:0001583	missense	0			-		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2302C>T	9.37:g.118997486C>T	ENSP00000330658:p.Pro768Ser		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.P768S	ENST00000328252.3	37	c.2302	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	C	9.289	1.050027	0.19827	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.01613	4.73	6.04	6.04	0.98038	.	0.456470	0.26673	N	0.023094	T	0.01765	0.0056	N	0.12182	0.205	0.80722	D	1	B;B	0.21821	0.061;0.02	B;B	0.19946	0.027;0.008	T	0.67288	-0.5708	10	0.19147	T	0.46	-2.5994	19.583	0.95478	0.0:1.0:0.0:0.0	.	212;768	E7EMD3;Q13219	.;PAPP1_HUMAN	S	768;212	ENSP00000330658:P768S	ENSP00000330658:P768S	P	+	1	0	PAPPA	118037307	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.579000	0.53900	2.873000	0.98535	0.563000	0.77884	CCA	-	PAPPA	-	superfamily_Fibronectin_type3		0.552	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	0	0	0	34	34	91	0.00	0.00	C	NM_002581		118997486	+1	11	23	34	53	tier1	no_errors	ENST00000328252	ensembl	human	known	74_37	missense	24.44	30.26	SNP	0.996	T	11	34
IL23A	51561	genome.wustl.edu	37	12	56732989	56732989	+	Splice_Site	SNP	T	T	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr12:56732989T>A	ENST00000228534.4	+	1	327	c.161T>A	c.(160-162)aTg>aAg	p.M54K	STAT2_ENST00000556539.1_5'Flank	NM_016584.2	NP_057668.1	Q9NPF7	IL23A_HUMAN	interleukin 23, alpha subunit p19	54					defense response to Gram-negative bacterium (GO:0050829)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|T cell proliferation (GO:0042098)|tissue remodeling (GO:0048771)	interleukin-23 complex (GO:0070743)				kidney(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	5						GTGGGACACATGGTGAGTGGC	0.607													ENSG00000110944																																					0													32.0	30.0	31.0					12																	56732989		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB030000	CCDS8916.1	12q13.13	2011-07-15				ENSG00000110944		"""Interleukins and interleukin receptors"""	15488	protein-coding gene	gene with protein product	"""interleukin-six, G-CSF related factor"""	605580				11114383	Standard	NM_016584		Approved	SGRF, IL23P19, IL-23, IL-23A, P19	uc001sla.3	Q9NPF7		ENST00000228534.4:c.162+1T>A	12.37:g.56732989T>A			Q6NZ80|Q6NZ82|Q9H2A5	Missense_Mutation	SNP	pfam_IL-6/IL-23/GCSF/MGF,superfamily_4_helix_cytokine-like_core	p.M54K	ENST00000228534.4	37	c.161	CCDS8916.1	12	.	.	.	.	.	.	.	.	.	.	T	11.71	1.718506	0.30503	.	.	ENSG00000110944	ENST00000228534	.	.	.	5.11	2.77	0.32553	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.699917	0.13289	N	0.399122	T	0.29524	0.0736	L	0.38175	1.15	0.29857	N	0.827972	B	0.32731	0.382	B	0.27608	0.081	T	0.23013	-1.0200	9	0.66056	D	0.02	-0.0764	6.7901	0.23695	0.0:0.2701:0.0:0.7299	.	54	Q9NPF7	IL23A_HUMAN	K	54	.	ENSP00000228534:M54K	M	+	2	0	IL23A	55019256	0.639000	0.27234	0.548000	0.28192	0.930000	0.56654	0.651000	0.24873	0.392000	0.25172	-0.256000	0.11100	ATG	-	IL23A	-	superfamily_4_helix_cytokine-like_core		0.607	IL23A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	IL23A	HGNC	protein_coding		0	0	0	26	26	44	0.00	0.00	T	NM_016584	Missense_Mutation	56732989	+1	5	10	23	42	tier1	no_errors	ENST00000228534	ensembl	human	known	74_37	missense	17.86	19.23	SNP	0.542	A	5	23
KIF20B	9585	genome.wustl.edu	37	10	91492692	91492692	+	Missense_Mutation	SNP	C	C	G	rs189443463	byFrequency	TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr10:91492692C>G	ENST00000371728.3	+	19	2489	c.2424C>G	c.(2422-2424)aaC>aaG	p.N808K	KIF20B_ENST00000416354.1_Missense_Mutation_p.N808K|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Missense_Mutation_p.N768K|KIF20B_ENST00000394289.2_Missense_Mutation_p.N808K	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	808					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)	p.N768N(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TAATAATAAACAATAAATTGA	0.264													ENSG00000138182																																					1	Substitution - coding silent(1)	kidney(1)											47.0	52.0	50.0					10																	91492692		2202	4286	6488	SO:0001583	missense	0			-	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.2424C>G	10.37:g.91492692C>G	ENSP00000360793:p.Asn808Lys		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.N808K	ENST00000371728.3	37	c.2424		10	.	.	.	.	.	.	.	.	.	.	C	0.106	-1.144655	0.01714	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	5.08	0.868	0.19090	.	0.116371	0.38605	N	0.001633	T	0.10165	0.0249	L	0.57536	1.79	0.09310	N	1	B;B	0.27853	0.191;0.002	B;B	0.26770	0.073;0.005	T	0.31752	-0.9932	10	0.02654	T	1	-1.0075	1.0938	0.01668	0.1543:0.3695:0.1347:0.3414	.	808;768	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	K	768;808;808;808	ENSP00000260753:N768K;ENSP00000411545:N808K;ENSP00000377830:N808K;ENSP00000360793:N808K	ENSP00000260753:N768K	N	+	3	2	KIF20B	91482672	0.000000	0.05858	0.020000	0.16555	0.004000	0.04260	-0.881000	0.04179	0.331000	0.23511	-0.812000	0.03155	AAC	-	KIF20B	-	NULL		0.264	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	0	0	0	79	79	58	0.00	0.00	C	NM_016195		91492692	+1	17	8	74	48	tier1	no_errors	ENST00000416354	ensembl	human	known	74_37	missense	18.68	14.29	SNP	0.004	G	17	74
PADI2	11240	genome.wustl.edu	37	1	17395742	17395742	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:17395742C>T	ENST00000375486.4	-	16	1858	c.1795G>A	c.(1795-1797)Ggc>Agc	p.G599S	PADI2_ENST00000444885.2_Missense_Mutation_p.G483S|PADI2_ENST00000466151.1_5'UTR	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	599					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TTGGGGATGCCCAGGTCCTTG	0.572													ENSG00000117115																																					0													69.0	62.0	64.0					1																	17395742		2203	4300	6503	SO:0001583	missense	0			-	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1795G>A	1.37:g.17395742C>T	ENSP00000364635:p.Gly599Ser		Q96DA7|Q9UPN2	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.G599S	ENST00000375486.4	37	c.1795	CCDS177.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.318480	0.95682	.	.	ENSG00000117115	ENST00000375486;ENST00000444885	T;T	0.38560	1.13;1.13	5.4	4.43	0.53597	Protein-arginine deiminase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66909	-0.5804	10	0.36615	T	0.2	-33.6548	13.6389	0.62237	0.1554:0.8446:0.0:0.0	.	483;599	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	S	599;483	ENSP00000364635:G599S;ENSP00000405894:G483S	ENSP00000364635:G599S	G	-	1	0	PADI2	17268329	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.774000	0.68906	2.542000	0.85734	0.655000	0.94253	GGC	-	PADI2	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub		0.572	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI2	HGNC	protein_coding	OTTHUMT00000006624.1	0	0	0	31	31	55	0.00	0.00	C			17395742	-1	9	18	54	77	tier1	no_errors	ENST00000375486	ensembl	human	known	74_37	missense	14.29	18.95	SNP	1.000	T	9	54
EYS	346007	genome.wustl.edu	37	6	65707520	65707520	+	Silent	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr6:65707520G>A	ENST00000370621.3	-	14	2740	c.2214C>T	c.(2212-2214)atC>atT	p.I738I	EYS_ENST00000370616.2_Silent_p.I738I|EYS_ENST00000503581.1_Silent_p.I738I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	738	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AGGCATTCAGGATGCAGTCAT	0.398													ENSG00000188107																																					0													152.0	125.0	133.0					6																	65707520		692	1591	2283	SO:0001819	synonymous_variant	0			-		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2214C>T	6.37:g.65707520G>A			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.I738	ENST00000370621.3	37	c.2214		6																																																																																			-	EYS	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.398	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	0	0	0	49	49	92	0.00	0.00	G	XM_294050		65707520	-1	14	26	58	87	tier1	no_errors	ENST00000370616	ensembl	human	known	74_37	silent	19.44	23.01	SNP	0.136	A	14	58
EPHA8	2046	genome.wustl.edu	37	1	22915658	22915658	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:22915658C>A	ENST00000166244.3	+	5	1346	c.1274C>A	c.(1273-1275)cCc>cAc	p.P425H	EPHA8_ENST00000538803.1_Missense_Mutation_p.P425H|EPHA8_ENST00000374644.4_Missense_Mutation_p.P425H	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	425	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGCCCCGAGCCCCGCCGGGCC	0.667													ENSG00000070886																																					0													29.0	29.0	29.0					1																	22915658		2203	4298	6501	SO:0001583	missense	0			-	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1274C>A	1.37:g.22915658C>A	ENSP00000166244:p.Pro425His		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.P425H	ENST00000166244.3	37	c.1274	CCDS225.1	1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049354	0.55218	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.75050	-0.9;0.86;0.86	4.52	4.52	0.55395	Fibronectin, type III (2);	0.329787	0.27831	N	0.017680	T	0.82162	0.4977	M	0.66297	2.02	0.44603	D	0.997571	B;D	0.63880	0.004;0.993	B;D	0.63877	0.003;0.919	D	0.83520	0.0085	10	0.72032	D	0.01	.	11.5401	0.50661	0.1792:0.8208:0.0:0.0	.	425;425	P29322;P29322-2	EPHA8_HUMAN;.	H	425	ENSP00000166244:P425H;ENSP00000363775:P425H;ENSP00000440274:P425H	ENSP00000166244:P425H	P	+	2	0	EPHA8	22788245	0.991000	0.36638	1.000000	0.80357	0.779000	0.44077	2.879000	0.48522	2.498000	0.84270	0.436000	0.28706	CCC	-	EPHA8	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.667	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA8	HGNC	protein_coding	OTTHUMT00000008085.1	0	0	0	60	60	37	0.00	0.00	C	NM_020526		22915658	+1	17	13	82	36	tier1	no_errors	ENST00000166244	ensembl	human	known	74_37	missense	17.17	26.53	SNP	0.993	A	17	82
WNK1	65125	genome.wustl.edu	37	12	1009691	1009691	+	Silent	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr12:1009691C>T	ENST00000315939.6	+	26	7141	c.6498C>T	c.(6496-6498)acC>acT	p.T2166T	WNK1_ENST00000530271.2_Silent_p.T2664T|WNK1_ENST00000537687.1_Silent_p.T2426T|WNK1_ENST00000340908.4_Silent_p.T1759T|WNK1_ENST00000535572.1_Silent_p.T1918T	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2166					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CCCAGCAGACCCTCCACCCTC	0.542													ENSG00000060237																									Colon(19;451 567 6672 12618 28860)												0													161.0	153.0	155.0					12																	1009691		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.6498C>T	12.37:g.1009691C>T			A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T2664	ENST00000315939.6	37	c.7992	CCDS8506.1	12																																																																																			-	WNK1	-	NULL		0.542	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	0	0	0	23	23	65	0.00	0.00	C	NM_018979		1009691	+1	53	114	64	135	tier1	no_errors	ENST00000530271	ensembl	human	known	74_37	silent	45.30	45.78	SNP	1.000	T	53	64
AXDND1	126859	genome.wustl.edu	37	1	179380379	179380379	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:179380379C>G	ENST00000367618.3	+	12	1595	c.1208C>G	c.(1207-1209)gCc>gGc	p.A403G	AXDND1_ENST00000457238.2_Missense_Mutation_p.A403G|AXDND1_ENST00000461179.2_3'UTR	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	403										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						TGGAGCTCAGCCACATATGAA	0.328													ENSG00000162779																																					0													86.0	101.0	96.0					1																	179380379		2203	4300	6503	SO:0001583	missense	0			-	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.1208C>G	1.37:g.179380379C>G	ENSP00000356590:p.Ala403Gly		Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	pfam_Axonemal_dynein_light_chain	p.A403G	ENST00000367618.3	37	c.1208	CCDS30948.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229450	0.79688	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000457238;ENST00000434088	T;T;T	0.55234	1.81;0.53;1.85	5.18	5.18	0.71444	.	0.197958	0.41712	D	0.000827	T	0.66877	0.2834	M	0.69823	2.125	0.35625	D	0.809731	D;D;P	0.61697	0.99;0.978;0.944	P;P;P	0.57720	0.826;0.714;0.572	T	0.77083	-0.2719	10	0.72032	D	0.01	-6.1134	14.5509	0.68065	0.0:1.0:0.0:0.0	.	361;403;403	E9PCJ4;Q5T1B0;F5GWM2	.;AXDN1_HUMAN;.	G	403;361;403;337	ENSP00000356590:A403G;ENSP00000416712:A403G;ENSP00000391716:A337G	ENSP00000353471:A361G	A	+	2	0	AXDND1	177647002	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.749000	0.55150	2.552000	0.86080	0.585000	0.79938	GCC	-	AXDND1	-	NULL		0.328	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AXDND1	HGNC	protein_coding	OTTHUMT00000085312.1	0	0	0	142	142	105	0.00	0.00	C	NM_144696		179380379	+1	28	22	134	81	tier1	no_errors	ENST00000367618	ensembl	human	known	74_37	missense	17.28	21.36	SNP	1.000	G	28	134
ANKRD31	256006	genome.wustl.edu	37	5	74408388	74408388	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr5:74408388T>C	ENST00000274361.3	-	19	4213	c.4022A>G	c.(4021-4023)gAa>gGa	p.E1341G	ANKRD31_ENST00000506364.2_Missense_Mutation_p.E1398G|ANKRD31_ENST00000504022.1_5'UTR	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	1341										endometrium(1)|kidney(4)	5						TTCTTGTTTTTCTTCTATATC	0.323													ENSG00000145700																																					0													206.0	171.0	182.0					5																	74408388		692	1590	2282	SO:0001583	missense	0			-	AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.4022A>G	5.37:g.74408388T>C	ENSP00000274361:p.Glu1341Gly			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E1341G	ENST00000274361.3	37	c.4022		5	.	.	.	.	.	.	.	.	.	.	T	18.30	3.592594	0.66219	.	.	ENSG00000145700	ENST00000274361	T	0.63913	-0.07	5.3	5.3	0.74995	.	.	.	.	.	T	0.73032	0.3535	M	0.72118	2.19	0.25326	N	0.989073	.	.	.	.	.	.	T	0.67776	-0.5583	7	0.62326	D	0.03	.	15.2189	0.73296	0.0:0.0:0.0:1.0	.	.	.	.	G	1341	ENSP00000274361:E1341G	ENSP00000274361:E1341G	E	-	2	0	ANKRD31	74444144	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.124000	0.64709	2.130000	0.65690	0.482000	0.46254	GAA	-	ANKRD31	-	NULL		0.323	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	HGNC	protein_coding		0	0	0	50	50	44	0.00	0.00	T	NM_001164443		74408388	-1	13	11	42	46	tier1	no_errors	ENST00000274361	ensembl	human	known	74_37	missense	23.64	18.97	SNP	1.000	C	13	42
OR6C75	390323	genome.wustl.edu	37	12	55759380	55759380	+	Silent	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr12:55759380G>T	ENST00000343399.3	+	1	486	c.486G>T	c.(484-486)ctG>ctT	p.L162L		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TGCTTCTGCTGCAGTTGGATT	0.433													ENSG00000187857																																					0													168.0	139.0	149.0					12																	55759380		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.486G>T	12.37:g.55759380G>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L162	ENST00000343399.3	37	c.486	CCDS31820.1	12																																																																																			-	OR6C75	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.433	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C75	HGNC	protein_coding	OTTHUMT00000406418.1	0	0	0	21	21	86	0.00	0.00	G			55759380	+1	7	16	24	75	tier1	no_errors	ENST00000343399	ensembl	human	known	74_37	silent	22.58	17.58	SNP	0.000	T	7	24
PKHD1L1	93035	genome.wustl.edu	37	8	110527530	110527530	+	Silent	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr8:110527530C>T	ENST00000378402.5	+	72	11789	c.11685C>T	c.(11683-11685)taC>taT	p.Y3895Y		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3895					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACCATCTGTACAAAGGTATTG	0.303										HNSCC(38;0.096)			ENSG00000205038																																					0													76.0	65.0	68.0					8																	110527530		1831	4078	5909	SO:0001819	synonymous_variant	0			-	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11685C>T	8.37:g.110527530C>T			Q567P2|Q9UF27	Silent	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.Y3895	ENST00000378402.5	37	c.11685	CCDS47911.1	8																																																																																			-	PKHD1L1	-	NULL		0.303	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	0	0	0	83	83	109	0.00	0.00	C	NM_177531		110527530	+1	16	21	93	106	tier1	no_errors	ENST00000378402	ensembl	human	known	74_37	silent	14.68	16.54	SNP	0.000	T	16	93
RAB27A	5873	genome.wustl.edu	37	15	55497751	55497751	+	Missense_Mutation	SNP	G	G	A	rs151048993		TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr15:55497751G>A	ENST00000396307.2	-	6	871	c.620C>T	c.(619-621)aCg>aTg	p.T207M	RAB27A_ENST00000336787.1_Missense_Mutation_p.T207M|RAB27A_ENST00000564609.1_Missense_Mutation_p.T207M|RAB27A_ENST00000569493.1_Missense_Mutation_p.T207M	NM_004580.4	NP_004571.2	P51159	RB27A_HUMAN	RAB27A, member RAS oncogene family	207					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cytotoxic T cell degranulation (GO:0043316)|exocytosis (GO:0006887)|exosomal secretion (GO:1990182)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|multivesicular body organization (GO:0036257)|multivesicular body sorting pathway (GO:0071985)|natural killer cell degranulation (GO:0043320)|positive regulation of exocytosis (GO:0045921)|positive regulation of gene expression (GO:0010628)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle transport (GO:0048489)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|photoreceptor outer segment (GO:0001750)|secretory granule membrane (GO:0030667)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)|skin(1)	9				all cancers(107;0.0273)|GBM - Glioblastoma multiforme(80;0.0993)		TAACTGATCCGTAGAGGCATG	0.483													ENSG00000069974																																					0								G	MET/THR,MET/THR,MET/THR,MET/THR	0,4386		0,0,2193	351.0	302.0	318.0		620,620,620,620	1.0	0.0	15	dbSNP_134	318	1,8583	1.2+/-3.3	0,1,4291	no	missense,missense,missense,missense	RAB27A	NM_004580.4,NM_183234.2,NM_183235.2,NM_183236.2	81,81,81,81	0,1,6484	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign	207/222,207/222,207/222,207/222	55497751	1,12969	2193	4292	6485	SO:0001583	missense	0			-	U38654	CCDS10153.1	15q15-q21.1	2014-09-17			ENSG00000069974	ENSG00000069974		"""RAB, member RAS oncogene"""	9766	protein-coding gene	gene with protein product		603868				7592656	Standard	NM_183235		Approved	RAB27, RAM, GS2, HsT18676	uc002acq.3	P51159	OTTHUMG00000131959	ENST00000396307.2:c.620C>T	15.37:g.55497751G>A	ENSP00000379601:p.Thr207Met		O00195|Q6FI40|Q9UIR9|Q9Y5U3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Ras,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.T207M	ENST00000396307.2	37	c.620	CCDS10153.1	15	.	.	.	.	.	.	.	.	.	.	G	9.745	1.166027	0.21538	0.0	1.16E-4	ENSG00000069974	ENST00000396307;ENST00000396304;ENST00000336787	T;T	0.69306	-0.39;-0.39	4.96	0.985	0.19779	.	1.552830	0.03580	N	0.230030	T	0.49389	0.1554	N	0.08118	0	0.09310	N	1	B	0.28439	0.212	B	0.28784	0.094	T	0.44390	-0.9331	10	0.44086	T	0.13	-21.5822	10.014	0.42003	0.1153:0.0:0.7662:0.1184	.	207	P51159	RB27A_HUMAN	M	207;199;207	ENSP00000379601:T207M;ENSP00000337761:T207M	ENSP00000337761:T207M	T	-	2	0	RAB27A	53285043	0.057000	0.20700	0.000000	0.03702	0.003000	0.03518	2.371000	0.44248	0.032000	0.15435	-1.916000	0.00518	ACG	rs151048993	RAB27A	-	superfamily_P-loop_NTPase,smart_Ran_GTPase		0.483	RAB27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB27A	HGNC	protein_coding	OTTHUMT00000254918.1	0	0	0	41	41	75	0.00	0.00	G	NM_004580, NM_183236		55497751	-1	7	22	26	63	tier1	no_errors	ENST00000336787	ensembl	human	known	74_37	missense	21.21	25.88	SNP	0.000	A	7	26
PEG3	5178	genome.wustl.edu	37	19	57335828	57335828	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:57335828T>C	ENST00000326441.9	-	4	559	c.196A>G	c.(196-198)Aaa>Gaa	p.K66E	ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.K66E|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000594706.1_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000593931.1_5'Flank|PEG3_ENST00000598410.1_Intron|ZIM2_ENST00000391708.3_5'UTR|ZIM2_ENST00000599935.1_5'UTR|PEG3_ENST00000593695.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	66	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTTCGGAGTTTGATCAGGGTC	0.507													ENSG00000198300																																					0													87.0	86.0	86.0					19																	57335828		2203	4300	6503	SO:0001583	missense	0			-	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.196A>G	19.37:g.57335828T>C	ENSP00000326581:p.Lys66Glu		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.K66E	ENST00000326441.9	37	c.196	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	T	21.2	4.111880	0.77210	.	.	ENSG00000198300	ENST00000326441;ENST00000423103;ENST00000292074	T;T	0.04603	3.59;3.59	5.05	4.02	0.46733	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.343513	0.21286	N	0.077065	T	0.06188	0.0160	L	0.39397	1.21	.	.	.	B	0.29481	0.245	B	0.35182	0.197	T	0.05954	-1.0854	9	0.72032	D	0.01	-17.0867	8.704	0.34343	0.0:0.0:0.3406:0.6594	.	66	Q9GZU2	PEG3_HUMAN	E	66	ENSP00000326581:K66E;ENSP00000403051:K66E	ENSP00000292074:K66E	K	-	1	0	ZIM2	62027640	0.239000	0.23836	0.964000	0.40570	0.993000	0.82548	1.154000	0.31688	1.046000	0.40249	0.533000	0.62120	AAA	-	PEG3	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.507	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	0	0	0	25	25	120	0.00	0.00	T			57335828	-1	6	9	28	81	tier1	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	17.65	10.00	SNP	0.993	C	6	28
BTBD16	118663	genome.wustl.edu	37	10	124089035	124089035	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr10:124089035C>T	ENST00000260723.4	+	11	1203	c.952C>T	c.(952-954)Cgg>Tgg	p.R318W	BTBD16_ENST00000368994.2_Missense_Mutation_p.R319W	NM_144587.2	NP_653188.2	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	318			R -> Q (in dbSNP:rs2421013).							breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(3)|skin(2)|stomach(1)|urinary_tract(1)	15		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				GGACATAGGACGGAGCTTGAG	0.547													ENSG00000138152																																					0													155.0	139.0	144.0					10																	124089035		2203	4300	6503	SO:0001583	missense	0			-	AK058088	CCDS31301.1	10q26.13	2013-01-24	2006-07-04	2006-07-04	ENSG00000138152	ENSG00000138152		"""BTB/POZ domain containing"""	26340	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 87"""	C10orf87			Standard	NM_144587		Approved	FLJ25359, Em:AC061711.1	uc001lgc.1	Q32M84	OTTHUMG00000019182	ENST00000260723.4:c.952C>T	10.37:g.124089035C>T	ENSP00000260723:p.Arg318Trp		A6NM63|Q4VXL1|Q96LN0	Missense_Mutation	SNP	superfamily_BTB/POZ_fold	p.R319W	ENST00000260723.4	37	c.955	CCDS31301.1	10	.	.	.	.	.	.	.	.	.	.	C	10.59	1.393856	0.25205	.	.	ENSG00000138152	ENST00000260723;ENST00000368994	T;T	0.18810	2.2;2.19	5.77	4.87	0.63330	.	0.528955	0.17254	N	0.181049	T	0.10423	0.0255	N	0.08118	0	0.09310	N	0.999997	B;B	0.31125	0.309;0.309	B;B	0.15870	0.014;0.014	T	0.16837	-1.0389	10	0.66056	D	0.02	-2.4355	10.7789	0.46367	0.0:0.9132:0.0:0.0868	.	319;318	Q32M84-2;Q32M84	.;BTBDG_HUMAN	W	318;319	ENSP00000260723:R318W;ENSP00000357990:R319W	ENSP00000260723:R318W	R	+	1	2	BTBD16	124079025	0.812000	0.29077	0.469000	0.27204	0.033000	0.12548	0.646000	0.24797	1.440000	0.47531	0.655000	0.94253	CGG	-	BTBD16	-	NULL		0.547	BTBD16-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BTBD16	HGNC	protein_coding	OTTHUMT00000050780.3	0	0	0	45	45	72	0.00	0.00	C	NM_144587		124089035	+1	7	23	54	68	tier1	no_errors	ENST00000368994	ensembl	human	known	74_37	missense	11.48	25.27	SNP	0.969	T	7	54
KIAA1109	84162	genome.wustl.edu	37	4	123128768	123128768	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr4:123128768C>T	ENST00000264501.4	+	17	2100	c.1727C>T	c.(1726-1728)aCa>aTa	p.T576I	KIAA1109_ENST00000455637.1_Missense_Mutation_p.T576I|KIAA1109_ENST00000388738.3_Missense_Mutation_p.T576I|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	576					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GTTCCAGCTACATGTAATACC	0.318													ENSG00000138688																																					0													131.0	121.0	124.0					4																	123128768		1832	4082	5914	SO:0001583	missense	0			-	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.1727C>T	4.37:g.123128768C>T	ENSP00000264501:p.Thr576Ile		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.T576I	ENST00000264501.4	37	c.1727	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316264	0.60524	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637	T;T;T	0.25250	2.39;2.39;1.81	5.66	5.66	0.87406	.	0.406531	0.20751	U	0.086341	T	0.52613	0.1745	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.49872	-0.8893	10	0.59425	D	0.04	.	19.7461	0.96252	0.0:1.0:0.0:0.0	.	576	Q2LD37	K1109_HUMAN	I	576	ENSP00000264501:T576I;ENSP00000373390:T576I;ENSP00000389925:T576I	ENSP00000264501:T576I	T	+	2	0	KIAA1109	123348218	0.999000	0.42202	0.934000	0.37439	0.133000	0.20885	4.015000	0.57152	2.645000	0.89757	0.650000	0.86243	ACA	-	KIAA1109	-	NULL		0.318	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	0	0	0	78	78	92	0.00	0.00	C	NM_020797		123128768	+1	43	22	87	57	tier1	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	32.82	27.50	SNP	1.000	T	43	87
TSIX	9383	genome.wustl.edu	37	X	73040985	73040985	+	lincRNA	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chrX:73040985C>T	ENST00000604411.1	+	0	28946				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		GAAAGGTAAACATTAATATTT	0.373													ENSG00000229807																																					0													30.0	30.0	30.0					X																	73040985		876	1989	2865			0			-			Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73040985C>T				R	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			-	XIST	-	-		0.373	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	0	0	0	41	41	60	0.00	0.00	C	NR_003255		73040985	-1	42	32	16	20	tier1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	72.41	61.54	SNP	0.005	T	42	16
PROSER3	148137	genome.wustl.edu	37	19	36259390	36259390	+	Silent	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:36259390G>A	ENST00000396908.4	+	12	1456	c.1383G>A	c.(1381-1383)agG>agA	p.R461R	C19orf55_ENST00000536037.1_3'UTR|AC002398.13_ENST00000589397.1_RNA|C19orf55_ENST00000544099.1_3'UTR	NM_001039887.2	NP_001034976.2	Q2NL68	PRSR3_HUMAN		462										cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGCCCCCTAGGTCCCCAAGGA	0.542													ENSG00000167595																																					0													93.0	100.0	98.0					19																	36259390		876	1991	2867	SO:0001819	synonymous_variant	0			-																												ENST00000396908.4:c.1383G>A	19.37:g.36259390G>A			Q8NDI3|Q8WWC8|Q96NL4	Silent	SNP	NULL	p.R461	ENST00000396908.4	37	c.1383		19																																																																																			-	C19orf55	-	NULL		0.542	C19orf55-201	KNOWN	basic|appris_principal	protein_coding	C19orf55	HGNC	protein_coding		0	0	0	74	74	62	0.00	0.00	G			36259390	+1	24	14	166	110	tier1	no_errors	ENST00000396908	ensembl	human	known	74_37	silent	12.63	11.02	SNP	0.204	A	24	166
KNDC1	85442	genome.wustl.edu	37	10	135013927	135013927	+	Silent	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr10:135013927C>A	ENST00000304613.3	+	16	2973	c.2952C>A	c.(2950-2952)cgC>cgA	p.R984R	KNDC1_ENST00000368572.2_Silent_p.R986R|KNDC1_ENST00000368571.2_Silent_p.R919R			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	984					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		AAAGCCCCCGCTCCCCGTCCA	0.706													ENSG00000171798																																					0													22.0	22.0	22.0					10																	135013927		2177	4289	6466	SO:0001819	synonymous_variant	0			-	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2952C>A	10.37:g.135013927C>A			B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R986	ENST00000304613.3	37	c.2958	CCDS7674.1	10																																																																																			-	KNDC1	-	NULL		0.706	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	0	0	0	129	129	3	0.00	0.00	C	NM_152643		135013927	+1	27	2	126	11	tier1	no_errors	ENST00000368572	ensembl	human	known	74_37	silent	17.65	15.38	SNP	0.021	A	27	126
RNF222	643904	genome.wustl.edu	37	17	8296735	8296735	+	Silent	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr17:8296735G>T	ENST00000399398.2	-	3	353	c.45C>A	c.(43-45)ccC>ccA	p.P15P	RNF222_ENST00000344001.3_Silent_p.P15P	NM_001146684.2	NP_001140156.1	A6NCQ9	RN222_HUMAN	ring finger protein 222	15						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)	1						CATAGCACACGGGGCACTCAC	0.612													ENSG00000189051																																					0													91.0	80.0	83.0					17																	8296735		692	1591	2283	SO:0001819	synonymous_variant	0			-		CCDS45608.1	17p13.1	2013-01-09			ENSG00000189051	ENSG00000189051		"""RING-type (C3HC4) zinc fingers"""	34517	protein-coding gene	gene with protein product							Standard	NM_001146684		Approved		uc010vuy.1	A6NCQ9	OTTHUMG00000132049	ENST00000399398.2:c.45C>A	17.37:g.8296735G>T				Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P15	ENST00000399398.2	37	c.45	CCDS45608.1	17																																																																																			-	RNF222	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.612	RNF222-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF222	HGNC	protein_coding	OTTHUMT00000255072.2	0	0	0	19	19	35	0.00	0.00	G	NM_001146684.2		8296735	-1	4	8	17	25	tier1	no_errors	ENST00000344001	ensembl	human	known	74_37	silent	19.05	23.53	SNP	0.935	T	4	17
CPA5	93979	genome.wustl.edu	37	7	130002370	130002370	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr7:130002370C>T	ENST00000485477.1	+	7	1755	c.626C>T	c.(625-627)aCt>aTt	p.T209I	CPA5_ENST00000431780.2_Missense_Mutation_p.T209I|CPA5_ENST00000474905.1_Missense_Mutation_p.T209I|CPA5_ENST00000461828.1_Missense_Mutation_p.T209I|CPA5_ENST00000466363.2_Missense_Mutation_p.T209I|CPA5_ENST00000393213.3_Missense_Mutation_p.T209I|CPA5_ENST00000355388.3_Missense_Mutation_p.T209I			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	209						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					GGCATCTGGACTGCCAATAAG	0.552													ENSG00000158525																																					0													41.0	38.0	39.0					7																	130002370		2203	4300	6503	SO:0001583	missense	0			-	AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.626C>T	7.37:g.130002370C>T	ENSP00000420237:p.Thr209Ile		G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.T209I	ENST00000485477.1	37	c.626	CCDS5819.1	7	.	.	.	.	.	.	.	.	.	.	C	9.723	1.160189	0.21454	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92;2.92;2.92	5.61	-0.89	0.10577	Peptidase M14, carboxypeptidase A (3);	0.593815	0.16952	N	0.192848	T	0.03220	0.0094	N	0.01535	-0.81	0.09310	N	1	B;B	0.18863	0.031;0.012	B;B	0.18561	0.013;0.022	T	0.45877	-0.9231	9	.	.	.	.	10.1531	0.42805	0.0:0.4201:0.0:0.5799	.	209;209	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	I	209	ENSP00000347549:T209I;ENSP00000418183:T209I;ENSP00000419025:T209I;ENSP00000420237:T209I;ENSP00000393045:T209I;ENSP00000417314:T209I;ENSP00000376907:T209I	.	T	+	2	0	CPA5	129789606	0.002000	0.14202	0.523000	0.27875	0.792000	0.44763	-0.002000	0.12924	-0.526000	0.06383	0.591000	0.81541	ACT	-	CPA5	-	pfam_Peptidase_M14,smart_Peptidase_M14		0.552	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA5	HGNC	protein_coding	OTTHUMT00000349712.1	0	0	0	9	9	29	0.00	0.00	C	NM_001127441		130002370	+1	5	9	4	27	tier1	no_errors	ENST00000355388	ensembl	human	known	74_37	missense	55.56	25.00	SNP	0.029	T	5	4
CHST1	8534	genome.wustl.edu	37	11	45671752	45671752	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr11:45671752G>T	ENST00000308064.2	-	4	1392	c.722C>A	c.(721-723)gCt>gAt	p.A241D	RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'Flank	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	241					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GCTGCGCGAAGCCAGAATGCC	0.662													ENSG00000175264																																					0													52.0	51.0	51.0					11																	45671752		2203	4299	6502	SO:0001583	missense	0			-	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.722C>A	11.37:g.45671752G>T	ENSP00000309270:p.Ala241Asp		D3DQP2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.A241D	ENST00000308064.2	37	c.722	CCDS7913.1	11	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289853	0.80914	.	.	ENSG00000175264	ENST00000308064	D	0.83755	-1.76	4.98	4.98	0.66077	Sulfotransferase domain (1);	0.124930	0.56097	D	0.000039	D	0.89684	0.6786	M	0.73598	2.24	0.80722	D	1	D	0.63880	0.993	D	0.65874	0.939	D	0.87255	0.2275	10	0.20046	T	0.44	-11.0122	18.2637	0.90044	0.0:0.0:1.0:0.0	.	241	O43916	CHST1_HUMAN	D	241	ENSP00000309270:A241D	ENSP00000309270:A241D	A	-	2	0	CHST1	45628328	1.000000	0.71417	0.343000	0.25615	0.974000	0.67602	9.858000	0.99539	2.310000	0.77875	0.462000	0.41574	GCT	-	CHST1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase		0.662	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	HGNC	protein_coding	OTTHUMT00000390127.1	0	0	0	48	48	40	0.00	0.00	G	NM_003654		45671752	-1	15	11	63	53	tier1	no_errors	ENST00000308064	ensembl	human	known	74_37	missense	19.23	17.19	SNP	1.000	T	15	63
CLLU1	574028	genome.wustl.edu	37	12	92818639	92818639	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr12:92818639C>A	ENST00000378485.1	+	1	905	c.183C>A	c.(181-183)agC>agA	p.S61R	RP11-693J15.4_ENST00000508671.1_RNA|CLLU1_ENST00000472839.2_Intron|CLLU1OS_ENST00000538965.1_Intron|CLLU1OS_ENST00000378487.2_Intron	NM_001025233.1	NP_001020404.1	Q5K131	CLLU1_HUMAN	chronic lymphocytic leukemia up-regulated 1	61						cytoplasm (GO:0005737)				NS(1)|breast(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	7						TACGATTTAGCAAATTACTTC	0.289													ENSG00000257127																																					0													41.0	39.0	40.0					12																	92818639		1800	4053	5853	SO:0001583	missense	0			-	AJ845162		12q22	2012-04-19			ENSG00000257127	ENSG00000257127			29841	protein-coding gene	gene with protein product						19726446	Standard	NR_027932		Approved		uc001tcg.1	Q5K131	OTTHUMG00000170103	ENST00000378485.1:c.183C>A	12.37:g.92818639C>A	ENSP00000367746:p.Ser61Arg			Missense_Mutation	SNP	NULL	p.S61R	ENST00000378485.1	37	c.183		12	.	.	.	.	.	.	.	.	.	.	C	2.082	-0.410437	0.04799	.	.	ENSG00000257127	ENST00000378485	T	0.54479	0.57	2.01	-0.117	0.13551	.	.	.	.	.	T	0.29223	0.0727	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.25047	-1.0143	7	0.87932	D	0	.	3.8866	0.09100	0.292:0.4526:0.2553:0.0	.	.	.	.	R	61	ENSP00000367746:S61R	ENSP00000367746:S61R	S	+	3	2	AC063949.1	91342770	0.012000	0.17670	0.047000	0.18901	0.012000	0.07955	-0.699000	0.05087	-0.041000	0.13558	-0.162000	0.13425	AGC	-	CLLU1	-	NULL		0.289	CLLU1-003	KNOWN	NMD_exception|basic|appris_principal	protein_coding	CLLU1	HGNC	protein_coding	OTTHUMT00000366643.1	0	0	0	74	74	82	0.00	0.00	C	NM_001025233		92818639	+1	10	9	66	47	tier1	no_errors	ENST00000378485	ensembl	human	known	74_37	missense	13.16	16.07	SNP	0.072	A	10	66
MAST2	23139	genome.wustl.edu	37	1	46493510	46493510	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:46493510A>G	ENST00000361297.2	+	17	2310	c.2027A>G	c.(2026-2028)gAt>gGt	p.D676G	MAST2_ENST00000372009.2_Missense_Mutation_p.D606G	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					ATTGAAAAGGATGCCCGGGAA	0.488													ENSG00000086015																																					0													115.0	112.0	113.0					1																	46493510		1891	4121	6012	SO:0001583	missense	0			-	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.2027A>G	1.37:g.46493510A>G	ENSP00000354671:p.Asp676Gly			Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.D676G	ENST00000361297.2	37	c.2027	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.899314	0.91962	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000432341;ENST00000372008	T;T;T	0.64991	-0.13;-0.13;-0.13	5.55	5.55	0.83447	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.054308	0.64402	D	0.000001	T	0.72787	0.3504	L	0.39397	1.21	0.80722	D	1	D;B;D;P	0.89917	0.996;0.402;1.0;0.846	D;P;D;P	0.91635	0.987;0.46;0.999;0.557	T	0.75673	-0.3236	10	0.87932	D	0	-16.2393	16.007	0.80370	1.0:0.0:0.0:0.0	.	606;350;606;676	Q6P0Q8-2;E7EWL1;E7ERL6;Q6P0Q8	.;.;.;MAST2_HUMAN	G	676;606;350;561	ENSP00000354671:D676G;ENSP00000361079:D606G;ENSP00000361078:D561G	ENSP00000354671:D676G	D	+	2	0	MAST2	46266097	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.339000	0.96797	2.244000	0.73946	0.533000	0.62120	GAT	-	MAST2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.488	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	0	0	0	43	43	122	0.00	0.00	A	NM_015112		46493510	+1	25	80	35	101	tier1	no_errors	ENST00000361297	ensembl	human	known	74_37	missense	41.67	44.20	SNP	1.000	G	25	35
CCDC54	84692	genome.wustl.edu	37	3	107096946	107096946	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr3:107096946A>G	ENST00000261058.1	+	1	759	c.512A>G	c.(511-513)tAc>tGc	p.Y171C		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	171										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						GAACTGCTTTACAAACTCATA	0.433													ENSG00000138483																																					0													83.0	74.0	77.0					3																	107096946		2203	4300	6503	SO:0001583	missense	0			-	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.512A>G	3.37:g.107096946A>G	ENSP00000261058:p.Tyr171Cys		Q96A43	Missense_Mutation	SNP	NULL	p.Y171C	ENST00000261058.1	37	c.512	CCDS2949.1	3	.	.	.	.	.	.	.	.	.	.	a	7.866	0.727057	0.15439	.	.	ENSG00000138483	ENST00000261058	T	0.43294	0.95	5.21	2.76	0.32466	.	0.561545	0.16138	N	0.227850	T	0.36936	0.0985	L	0.36672	1.1	0.09310	N	1	D	0.57257	0.979	P	0.50192	0.634	T	0.19910	-1.0291	10	0.66056	D	0.02	0.0766	4.3449	0.11127	0.7306:0.0:0.095:0.1744	.	171	Q8NEL0	CCD54_HUMAN	C	171	ENSP00000261058:Y171C	ENSP00000261058:Y171C	Y	+	2	0	CCDC54	108579636	0.031000	0.19500	0.002000	0.10522	0.014000	0.08584	2.722000	0.47269	0.292000	0.22492	0.373000	0.22412	TAC	-	CCDC54	-	NULL		0.433	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC54	HGNC	protein_coding	OTTHUMT00000353651.1	0	0	0	38	38	149	0.00	0.00	A	NM_032600		107096946	+1	15	49	16	49	tier1	no_errors	ENST00000261058	ensembl	human	known	74_37	missense	48.39	50.00	SNP	0.004	G	15	16
SAT2	112483	genome.wustl.edu	37	17	7530066	7530066	+	Intron	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr17:7530066C>T	ENST00000269298.5	-	5	565				SAT2_ENST00000573566.1_Intron|SHBG_ENST00000576478.1_Intron|SHBG_ENST00000574539.1_Intron|SHBG_ENST00000570547.1_Intron|SHBG_ENST00000575314.1_Intron|SHBG_ENST00000576728.1_Intron|SHBG_ENST00000340624.5_5'Flank|SAT2_ENST00000380466.2_Intron|SHBG_ENST00000572262.1_Intron|SHBG_ENST00000572182.1_Intron	NM_133491.3	NP_597998.1	Q96F10	SAT2_HUMAN	spermidine/spermine N1-acetyltransferase family member 2						nor-spermidine metabolic process (GO:0046204)|putrescine acetylation (GO:0032920)|putrescine catabolic process (GO:0009447)|spermidine acetylation (GO:0032918)|spermine acetylation (GO:0032919)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	diamine N-acetyltransferase activity (GO:0004145)	p.?(1)		kidney(1)|large_intestine(2)	3				READ - Rectum adenocarcinoma(115;0.166)	Spermine(DB00127)	CACCCATCTCCTCACCTCAGC	0.468													ENSG00000141504																																					1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											125.0	119.0	121.0					17																	7530066		2203	4300	6503	SO:0001627	intron_variant	0			-	AF348524	CCDS11116.1	17p13.2	2011-11-16	2008-01-07		ENSG00000141504	ENSG00000141504	2.3.1.57		23160	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 2"""	611463	"""spermidine/spermine N1-acetyltransferase 2"""			15283699, 17558023	Standard	NM_133491		Approved	SSAT2	uc002gic.2	Q96F10	OTTHUMG00000108152	ENST00000269298.5:c.345+4G>A	17.37:g.7530066C>T				R	SNP	-	NULL	ENST00000269298.5	37	NULL	CCDS11116.1	17																																																																																			-	SAT2	-	-		0.468	SAT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAT2	HGNC	protein_coding	OTTHUMT00000440078.1	0	0	0	49	49	119	0.00	0.00	C	NM_133491		7530066	-1	7	24	57	118	tier1	no_errors	ENST00000570850	ensembl	human	known	74_37	rna	10.94	16.90	SNP	0.999	T	7	57
EMR1	2015	genome.wustl.edu	37	19	6890543	6890543	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:6890543C>A	ENST00000312053.4	+	2	120	c.83C>A	c.(82-84)cCa>cAa	p.P28Q	EMR1_ENST00000450315.3_Missense_Mutation_p.P28Q|EMR1_ENST00000381407.5_Missense_Mutation_p.P28Q|EMR1_ENST00000250572.8_Missense_Mutation_p.P28Q|EMR1_ENST00000381404.4_Missense_Mutation_p.P28Q	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	28					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					ACACGGAAACCAAACACAAAG	0.458													ENSG00000174837																																					0													106.0	82.0	90.0					19																	6890543		2203	4300	6503	SO:0001583	missense	0			-	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.83C>A	19.37:g.6890543C>A	ENSP00000311545:p.Pro28Gln		A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.P28Q	ENST00000312053.4	37	c.83	CCDS12175.1	19	.	.	.	.	.	.	.	.	.	.	C	3.096	-0.185837	0.06340	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.78924	-1.19;-1.11;-1.22;0.08;0.38	2.02	2.02	0.26589	.	.	.	.	.	T	0.52581	0.1743	N	0.08118	0	0.09310	N	1	P;P;B;B;B	0.44578	0.838;0.617;0.0;0.001;0.0	B;B;B;B;B	0.39562	0.154;0.303;0.002;0.002;0.001	T	0.41770	-0.9490	9	0.11485	T	0.65	.	7.6069	0.28107	0.0:1.0:0.0:0.0	.	28;28;28;28;28	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	Q	28	ENSP00000311545:P28Q;ENSP00000370811:P28Q;ENSP00000250572:P28Q;ENSP00000370814:P28Q;ENSP00000405974:P28Q	ENSP00000250572:P28Q	P	+	2	0	EMR1	6841543	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.191000	0.17076	1.437000	0.47472	0.655000	0.94253	CCA	-	EMR1	-	NULL		0.458	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR1	HGNC	protein_coding	OTTHUMT00000458485.1	0	0	1	22	22	108	0.00	0.92	C			6890543	+1	14	46	35	114	tier1	no_errors	ENST00000312053	ensembl	human	known	74_37	missense	28.57	28.75	SNP	0.002	A	14	35
FAM151A	338094	genome.wustl.edu	37	1	55078384	55078384	+	Splice_Site	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:55078384C>A	ENST00000302250.2	-	5	736		c.e5-1		FAM151A_ENST00000371304.2_Splice_Site|ACOT11_ENST00000371316.3_Intron	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						GGCCAGGAACCTGCAAAAAAA	0.562													ENSG00000162391																																					0													54.0	47.0	50.0					1																	55078384		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.576-1G>T	1.37:g.55078384C>A			Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Splice_Site	SNP	-	e5-1	ENST00000302250.2	37	c.576-1	CCDS594.1	1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123122	0.56613	.	.	ENSG00000162391	ENST00000302250;ENST00000371304;ENST00000294370	.	.	.	4.13	4.13	0.48395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.686	0.77411	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM151A	54850972	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	5.404000	0.66344	2.298000	0.77334	0.462000	0.41574	.	-	FAM151A	-	-		0.562	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM151A	HGNC	protein_coding	OTTHUMT00000027342.1	0	0	0	27	27	80	0.00	0.00	C	NM_176782	Intron	55078384	-1	4	15	30	101	tier1	no_errors	ENST00000302250	ensembl	human	known	74_37	splice_site	11.76	12.82	SNP	1.000	A	4	30
IL18BP	10068	genome.wustl.edu	37	11	71715046	71715046	+	IGR	SNP	T	T	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr11:71715046T>G	ENST00000393703.4	+	0	1788				NUMA1_ENST00000351960.6_Missense_Mutation_p.K939Q|NUMA1_ENST00000393695.3_Missense_Mutation_p.K2075Q|NUMA1_ENST00000358965.6_Missense_Mutation_p.K2061Q	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein						cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						GGGGAAGCCTTGGACAGGGCC	0.657													ENSG00000137497																																					0													71.0	83.0	79.0					11																	71715046		2200	4293	6493	SO:0001628	intergenic_variant	0			-	AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713		11.37:g.71715046T>G			B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Missense_Mutation	SNP	superfamily_Prefoldin	p.K2075Q	ENST00000393703.4	37	c.6223	CCDS8206.2	11	.	.	.	.	.	.	.	.	.	.	T	23.4	4.415825	0.83449	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T;T	0.27557	1.66;2.13;2.13	4.94	4.94	0.65067	.	0.114873	0.39407	N	0.001369	T	0.43233	0.1238	L	0.29908	0.895	0.38585	D	0.950285	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.83275	0.994;0.976;0.994;0.996	T	0.43782	-0.9370	10	0.48119	T	0.1	.	14.4368	0.67287	0.0:0.0:0.0:1.0	.	2081;2061;2075;939	Q4LE64;Q14980-2;Q14980;Q9BTE9	.;.;NUMA1_HUMAN;.	Q	939;2061;2075;1624;1048	ENSP00000260051:K939Q;ENSP00000351851:K2061Q;ENSP00000377298:K2075Q	ENSP00000260051:K939Q	K	-	1	0	NUMA1	71392694	1.000000	0.71417	0.999000	0.59377	0.847000	0.48162	5.723000	0.68492	2.081000	0.62600	0.533000	0.62120	AAG	-	NUMA1	-	NULL		0.657	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUMA1	HGNC	protein_coding	OTTHUMT00000258012.2	0	0	0	74	74	46	0.00	0.00	T	NM_173042		71715046	-1	19	13	64	33	tier1	no_errors	ENST00000393695	ensembl	human	known	74_37	missense	22.89	28.26	SNP	1.000	G	19	64
MARK1	4139	genome.wustl.edu	37	1	220804450	220804450	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:220804450C>T	ENST00000366917.4	+	10	1249	c.983C>T	c.(982-984)cCg>cTg	p.P328L	MARK1_ENST00000402574.1_Missense_Mutation_p.P193L|MARK1_ENST00000366918.4_Missense_Mutation_p.P306L					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GAGCCTGATCCGGATTTCAAT	0.368													ENSG00000116141																																					0													107.0	103.0	104.0					1																	220804450		2203	4300	6503	SO:0001583	missense	0			-	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.983C>T	1.37:g.220804450C>T	ENSP00000355884:p.Pro328Leu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.P328L	ENST00000366917.4	37	c.983	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.929777	0.34096	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.73681	-0.64;-0.45;-0.77	5.78	4.86	0.63082	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (1);	0.121779	0.56097	N	0.000022	T	0.65396	0.2687	L	0.42487	1.325	0.53005	D	0.999961	B;B;B;B	0.20368	0.007;0.004;0.033;0.044	B;B;B;B	0.23018	0.001;0.002;0.002;0.043	T	0.59611	-0.7422	10	0.10636	T	0.68	.	14.2536	0.66035	0.0:0.9275:0.0:0.0725	.	328;193;328;306	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	L	193;306;328	ENSP00000386017:P193L;ENSP00000355885:P306L;ENSP00000355884:P328L	ENSP00000355884:P328L	P	+	2	0	MARK1	218871073	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	2.501000	0.45389	1.557000	0.49525	0.655000	0.94253	CCG	-	MARK1	-	pfscan_UBA/transl_elong_EF1B_N_euk		0.368	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	0	0	0	66	66	128	0.00	0.00	C			220804450	+1	25	26	73	93	tier1	no_errors	ENST00000366917	ensembl	human	known	74_37	missense	25.51	21.85	SNP	1.000	T	25	73
PRSS22	64063	genome.wustl.edu	37	16	2908114	2908114	+	5'UTR	SNP	G	G	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr16:2908114G>C	ENST00000161006.3	-	0	57				LA16c-325D7.1_ENST00000577140.1_RNA|PRSS22_ENST00000574768.1_5'UTR|PRSS22_ENST00000571228.1_5'UTR	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						ATGGCTGGTGGGGCGGGGGAG	0.687													ENSG00000005001																																					0													10.0	11.0	10.0					16																	2908114		1929	3756	5685	SO:0001623	5_prime_UTR_variant	0			-	AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.-9C>G	16.37:g.2908114G>C			O43342|Q6UXE0	R	SNP	-	NULL	ENST00000161006.3	37	NULL	CCDS10481.1	16																																																																																			-	PRSS22	-	-		0.687	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS22	HGNC	protein_coding	OTTHUMT00000250943.1	0	0	0	53	53	8	0.00	0.00	G	NM_022119		2908114	-1	11	2	81	18	tier1	no_errors	ENST00000574768	ensembl	human	known	74_37	rna	11.96	10.00	SNP	0.001	C	11	81
MARCH9	92979	genome.wustl.edu	37	12	58152549	58152549	+	Missense_Mutation	SNP	C	C	T	rs372403968		TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr12:58152549C>T	ENST00000266643.5	+	4	1341	c.910C>T	c.(910-912)Cgc>Tgc	p.R304C	MARCH9_ENST00000548358.1_Missense_Mutation_p.R191C	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	304					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			AGCTGCCCAGCGCATGCGGAC	0.682													ENSG00000139266																																					0								C	CYS/ARG	0,4406		0,0,2203	22.0	23.0	22.0		910	5.6	1.0	12		22	1,8597	1.2+/-3.3	0,1,4298	no	missense	MARCH9	NM_138396.5	180	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	304/347	58152549	1,13003	2203	4299	6502	SO:0001583	missense	0			-	BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.910C>T	12.37:g.58152549C>T	ENSP00000266643:p.Arg304Cys		B2R9U9|Q86VN5|Q96GG2	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.R304C	ENST00000266643.5	37	c.910	CCDS31847.1	12	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725652	0.68959	0.0	1.16E-4	ENSG00000139266	ENST00000266643;ENST00000548358	T;T	0.32988	2.42;1.43	5.56	5.56	0.83823	.	0.177293	0.37304	N	0.002150	T	0.48840	0.1522	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.69142	0.962;0.613	T	0.33954	-0.9848	10	0.54805	T	0.06	.	18.4399	0.90662	0.0:1.0:0.0:0.0	.	191;304	Q86YJ5-2;Q86YJ5	.;MARH9_HUMAN	C	304;191	ENSP00000266643:R304C;ENSP00000446758:R191C	ENSP00000266643:R304C	R	+	1	0	MARCH9	56438816	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.514000	0.35834	2.890000	0.99128	0.655000	0.94253	CGC	-	MARCH9	-	NULL		0.682	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH9	HGNC	protein_coding	OTTHUMT00000409244.1	0	0	0	20	20	21	0.00	0.00	C	NM_138396		58152549	+1	3	10	6	22	tier1	no_errors	ENST00000266643	ensembl	human	known	74_37	missense	33.33	31.25	SNP	1.000	T	3	6
GRIN3A	116443	genome.wustl.edu	37	9	104433255	104433255	+	Missense_Mutation	SNP	C	C	G	rs34755188	byFrequency	TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr9:104433255C>G	ENST00000361820.3	-	3	2039	c.1439G>C	c.(1438-1440)cGc>cCc	p.R480P		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	480			R -> H (in dbSNP:rs34755188).		calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GCTGCCCAAGCGGGTCCACAT	0.493													ENSG00000198785																																					0													156.0	158.0	157.0					9																	104433255		2203	4300	6503	SO:0001583	missense	0			-		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1439G>C	9.37:g.104433255C>G	ENSP00000355155:p.Arg480Pro		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.R480P	ENST00000361820.3	37	c.1439	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833240	0.71258	.	.	ENSG00000198785	ENST00000361820	D	0.85484	-1.99	5.76	5.76	0.90799	.	0.122006	0.56097	D	0.000028	D	0.91161	0.7216	M	0.72118	2.19	0.80722	D	1	D	0.63046	0.992	P	0.59115	0.852	D	0.90920	0.4782	10	0.62326	D	0.03	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	480	Q8TCU5	NMD3A_HUMAN	P	480	ENSP00000355155:R480P	ENSP00000355155:R480P	R	-	2	0	GRIN3A	103473076	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	4.860000	0.62961	2.882000	0.98803	0.655000	0.94253	CGC	-	GRIN3A	-	superfamily_Peripla_BP_I		0.493	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	0	0	0	36	36	111	0.00	0.00	C			104433255	-1	9	18	36	99	tier1	no_errors	ENST00000361820	ensembl	human	known	74_37	missense	20.00	15.38	SNP	1.000	G	9	36
SIDT1	54847	genome.wustl.edu	37	3	113325907	113325907	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr3:113325907A>G	ENST00000264852.4	+	15	2150	c.1424A>G	c.(1423-1425)aAc>aGc	p.N475S	SIDT1_ENST00000463226.1_Intron|SIDT1_ENST00000393830.3_Missense_Mutation_p.N475S	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	475					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						GTCACTGGCAACCAGGACATC	0.507													ENSG00000072858																																					0													158.0	125.0	136.0					3																	113325907		2203	4300	6503	SO:0001583	missense	0			-	AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1424A>G	3.37:g.113325907A>G	ENSP00000264852:p.Asn475Ser		Q17RR4	Missense_Mutation	SNP	NULL	p.N475S	ENST00000264852.4	37	c.1424	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	A	32	5.126462	0.94429	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.23147	1.92;1.92	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.46347	0.1388	L	0.58428	1.81	0.58432	D	0.99999	P;P	0.51240	0.929;0.943	P;P	0.61940	0.834;0.896	T	0.39396	-0.9616	10	0.62326	D	0.03	-25.973	15.9745	0.80049	1.0:0.0:0.0:0.0	.	475;475	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	S	475	ENSP00000264852:N475S;ENSP00000377416:N475S	ENSP00000264852:N475S	N	+	2	0	SIDT1	114808597	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.265000	0.95647	2.168000	0.68352	0.533000	0.62120	AAC	-	SIDT1	-	NULL		0.507	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	HGNC	protein_coding	OTTHUMT00000317564.1	0	0	0	42	42	120	0.00	0.00	A	NM_017699		113325907	+1	13	22	61	129	tier1	no_errors	ENST00000393830	ensembl	human	known	74_37	missense	17.57	14.57	SNP	1.000	G	13	61
KCNJ6	3763	genome.wustl.edu	37	21	38997772	38997772	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr21:38997772C>A	ENST00000609713.1	-	4	1550	c.961G>T	c.(961-963)Gct>Tct	p.A321S	KCNJ6_ENST00000288309.6_Missense_Mutation_p.A321S	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	321					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	GAGCTTCGAGCTTGGCATGTC	0.527													ENSG00000157542																									Pancreas(48;379 1118 2936 19024 28214)												0													64.0	68.0	67.0					21																	38997772		2090	4232	6322	SO:0001583	missense	0			-	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.961G>T	21.37:g.38997772C>A	ENSP00000477437:p.Ala321Ser		Q3MJ74|Q53WW6	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.2	p.A321S	ENST00000609713.1	37	c.961	CCDS42927.1	21	.	.	.	.	.	.	.	.	.	.	C	33	5.220665	0.95139	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.94650	-3.48;-3.48	5.99	5.99	0.97316	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.97564	0.9202	M	0.83223	2.63	0.80722	D	1	P	0.50710	0.938	D	0.69824	0.966	D	0.97431	1.0015	10	0.72032	D	0.01	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	321	P48051	IRK6_HUMAN	S	321	ENSP00000383330:A321S;ENSP00000288309:A321S	ENSP00000288309:A321S	A	-	1	0	KCNJ6	37919642	1.000000	0.71417	0.826000	0.32828	0.977000	0.68977	7.487000	0.81328	2.840000	0.97914	0.655000	0.94253	GCT	-	KCNJ6	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir		0.527	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ6	HGNC	protein_coding	OTTHUMT00000194828.2	0	0	0	26	26	104	0.00	0.00	C	NM_002240		38997772	-1	10	13	16	66	tier1	no_errors	ENST00000288309	ensembl	human	known	74_37	missense	35.71	16.46	SNP	1.000	A	10	16
ANO2	57101	genome.wustl.edu	37	12	5744346	5744346	+	Silent	SNP	G	G	A	rs373059086	byFrequency	TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr12:5744346G>A	ENST00000356134.5	-	18	1862	c.1791C>T	c.(1789-1791)ggC>ggT	p.G597G	ANO2_ENST00000327087.8_Silent_p.G596G|ANO2_ENST00000546188.1_Silent_p.G597G|ANO2_ENST00000538154.1_5'Flank	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	601					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						TGGCCACAGCGCCGTAGATCT	0.522													ENSG00000047617	G|||	3	0.000599042	0.0023	0.0	5008	,	,		17402	0.0		0.0	False		,,,				2504	0.0																0								G		1,4253		0,1,2126	96.0	96.0	96.0		1788	-10.4	0.0	12		96	0,8470		0,0,4235	no	coding-synonymous	ANO2	NM_020373.2		0,1,6361	AA,AG,GG		0.0,0.0235,0.0079		596/999	5744346	1,12723	2127	4235	6362	SO:0001819	synonymous_variant	0			-	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1791C>T	12.37:g.5744346G>A			C4N787|Q9H847	Silent	SNP	pfam_Anoctamin	p.G597	ENST00000356134.5	37	c.1791		12																																																																																			-	ANO2	-	pfam_Anoctamin		0.522	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	0	0	0	49	49	61	0.00	0.00	G	NM_020373		5744346	-1	19	17	28	16	tier1	no_errors	ENST00000356134	ensembl	human	known	74_37	silent	40.43	51.52	SNP	0.016	A	19	28
CALCR	799	genome.wustl.edu	37	7	93072957	93072957	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr7:93072957G>T	ENST00000394441.1	-	8	1076	c.761C>A	c.(760-762)aCt>aAt	p.T254N	CALCR_ENST00000360249.4_Missense_Mutation_p.T270N|CALCR_ENST00000359558.2_Missense_Mutation_p.T288N|CALCR_ENST00000421592.1_Missense_Mutation_p.T270N|CALCR_ENST00000426151.1_Missense_Mutation_p.T254N	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	288					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	TTGCTTCTCAGTAAACACAGC	0.433													ENSG00000004948																																					0													140.0	129.0	133.0					7																	93072957		2203	4300	6503	SO:0001583	missense	0			-	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.761C>A	7.37:g.93072957G>T	ENSP00000377959:p.Thr254Asn		A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GCPR_2_calcitonin_rcpt_fam,prints_GPCR_2_secretin-like,prints_GPCR_2_calcitonin_rcpt	p.T288N	ENST00000394441.1	37	c.863	CCDS5631.1	7	.	.	.	.	.	.	.	.	.	.	G	11.11	1.541087	0.27563	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22	4.94	-2.95	0.05564	.	.	.	.	.	T	0.18215	0.0437	N	0.17838	0.53	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.22977	-1.0201	9	0.66056	D	0.02	.	1.4764	0.02427	0.2505:0.1068:0.423:0.2197	.	288;254	F5H605;A4D1G6	.;.	N	288;270;270;254;254	ENSP00000352561:T288N;ENSP00000353385:T270N;ENSP00000399552:T270N;ENSP00000377959:T254N;ENSP00000389295:T254N	ENSP00000352561:T288N	T	-	2	0	CALCR	92910893	0.943000	0.32029	0.000000	0.03702	0.000000	0.00434	3.345000	0.52182	-0.727000	0.04888	-0.262000	0.10625	ACT	-	CALCR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.433	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CALCR	HGNC	protein_coding	OTTHUMT00000254661.2	0	0	0	36	36	101	0.00	0.00	G	NM_001742		93072957	-1	13	38	14	40	tier1	no_errors	ENST00000359558	ensembl	human	known	74_37	missense	48.15	48.72	SNP	0.000	T	13	14
SEMA4D	10507	genome.wustl.edu	37	9	92001316	92001316	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr9:92001316T>C	ENST00000450295.1	-	13	2188	c.1412A>G	c.(1411-1413)gAg>gGg	p.E471G	SEMA4D_ENST00000455551.2_Missense_Mutation_p.E471G|SEMA4D_ENST00000438547.2_Missense_Mutation_p.E471G|SEMA4D_ENST00000339861.4_Missense_Mutation_p.E471G|SEMA4D_ENST00000422704.2_Missense_Mutation_p.E471G|SEMA4D_ENST00000420987.1_Missense_Mutation_p.E471G|SEMA4D_ENST00000356444.2_Missense_Mutation_p.E471G|SEMA4D_ENST00000343780.4_Missense_Mutation_p.E471G			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	471	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						CTGGACTGGCTCAAAGTCCTG	0.582													ENSG00000187764																																					0													123.0	110.0	114.0					9																	92001316		2203	4300	6503	SO:0001583	missense	0			-	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1412A>G	9.37:g.92001316T>C	ENSP00000416523:p.Glu471Gly		B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,pfam_Immunoglobulin,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.E471G	ENST00000450295.1	37	c.1412	CCDS6685.1	9	.	.	.	.	.	.	.	.	.	.	T	13.64	2.296893	0.40594	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780;ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	4.63	4.63	0.57726	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.194237	0.53938	D	0.000048	T	0.34978	0.0916	M	0.82056	2.57	0.47245	D	0.999366	P;P	0.42078	0.77;0.534	B;B	0.34536	0.081;0.185	T	0.48151	-0.9060	10	0.72032	D	0.01	.	14.2199	0.65820	0.0:0.0:0.0:1.0	.	471;471	Q92854-2;Q92854	.;SEM4D_HUMAN	G	471	ENSP00000344923:E471G;ENSP00000391733:E471G;ENSP00000411981:E471G;ENSP00000343418:E471G;ENSP00000416523:E471G;ENSP00000405102:E471G;ENSP00000348822:E471G;ENSP00000388768:E471G	ENSP00000344923:E471G	E	-	2	0	SEMA4D	91191136	1.000000	0.71417	0.790000	0.31976	0.087000	0.18053	3.687000	0.54692	1.960000	0.56953	0.459000	0.35465	GAG	-	SEMA4D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.582	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000342411.1	0	0	0	41	41	37	0.00	0.00	T	NM_006378		92001316	-1	5	4	32	27	tier1	no_errors	ENST00000356444	ensembl	human	known	74_37	missense	13.51	12.90	SNP	1.000	C	5	32
EVC2	132884	genome.wustl.edu	37	4	5664843	5664843	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr4:5664843G>A	ENST00000344408.5	-	9	1189	c.1136C>T	c.(1135-1137)gCc>gTc	p.A379V	EVC2_ENST00000310917.2_Missense_Mutation_p.A299V|EVC2_ENST00000344938.1_Missense_Mutation_p.A379V	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	379					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CTCTTCTAAGGCTTGAAGCAT	0.423													ENSG00000173040																																					0													109.0	103.0	105.0					4																	5664843		2203	4300	6503	SO:0001583	missense	0			-	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1136C>T	4.37:g.5664843G>A	ENSP00000342144:p.Ala379Val		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.A379V	ENST00000344408.5	37	c.1136	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360345	0.61403	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.79033	-1.23;-1.23;-1.23	5.07	5.07	0.68467	.	0.064498	0.64402	D	0.000012	D	0.86293	0.5898	M	0.66939	2.045	0.42567	D	0.993166	D	0.89917	1.0	D	0.87578	0.998	D	0.87620	0.2509	10	0.72032	D	0.01	-10.7069	14.2942	0.66300	0.0:0.0:1.0:0.0	.	379	Q86UK5	LBN_HUMAN	V	379;299;379	ENSP00000339954:A379V;ENSP00000311683:A299V;ENSP00000342144:A379V	ENSP00000311683:A299V	A	-	2	0	EVC2	5715744	1.000000	0.71417	0.897000	0.35233	0.263000	0.26337	3.155000	0.50700	2.496000	0.84212	0.655000	0.94253	GCC	-	EVC2	-	pfam_Limbin		0.423	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	0	0	0	22	22	87	0.00	0.00	G	NM_147127		5664843	-1	15	35	10	45	tier1	no_errors	ENST00000344408	ensembl	human	known	74_37	missense	60.00	43.75	SNP	1.000	A	15	10
RPS15	6209	genome.wustl.edu	37	19	1438503	1438503	+	Intron	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:1438503G>T	ENST00000586686.2	+	1	42				RPS15_ENST00000591032.1_Intron|AC027307.3_ENST00000594262.1_5'Flank|RPS15_ENST00000593052.1_5'UTR|RPS15_ENST00000589656.2_Intron|RPS15_ENST00000591804.2_Intron|RPS15_ENST00000586096.2_Intron|RPS15_ENST00000233609.4_Intron|RPS15_ENST00000585665.1_5'Flank			P62841	RS15_HUMAN	ribosomal protein S15						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|osteoblast differentiation (GO:0001649)|ribosomal small subunit biogenesis (GO:0042274)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCGGGGGCCGCAGTTCGTCC	0.687											OREG0025117	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000115268																									Ovarian(170;79 2680 5719 44260)												0													21.0	19.0	20.0					19																	1438503		692	1591	2283	SO:0001627	intron_variant	0			-		CCDS12067.1	19p13.3	2012-12-20			ENSG00000115268	ENSG00000115268		"""S ribosomal proteins"""	10388	protein-coding gene	gene with protein product	"""40S ribosomal protein S15"", ""homolog of rat insulinoma"", ""insulinoma protein"""	180535				2159154	Standard	NM_001018		Approved	RIG, MGC111130, S15	uc002lsp.1	P62841	OTTHUMG00000140099	ENST00000586686.2:c.3+76G>T	19.37:g.1438503G>T		595	A5D8V9|P11174|Q3KRA1|Q9UDC2	Missense_Mutation	SNP	NULL	p.A27S	ENST00000586686.2	37	c.79	CCDS12067.1	19																																																																																			-	RPS15	-	NULL		0.687	RPS15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPS15	HGNC	protein_coding	OTTHUMT00000449609.4	0	0	0	51	51	19	0.00	0.00	G	NM_001018		1438503	+1	18	3	79	25	tier1	no_errors	ENST00000592623	ensembl	human	known	74_37	missense	18.56	10.71	SNP	0.000	T	18	79
KIAA1244	57221	genome.wustl.edu	37	6	138610965	138610965	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr6:138610965A>T	ENST00000251691.4	+	18	3073	c.2907A>T	c.(2905-2907)aaA>aaT	p.K969N		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TGAAACTAAAAGTGGAGCAGA	0.478													ENSG00000112379																																					0													55.0	47.0	50.0					6																	138610965		2203	4299	6502	SO:0001583	missense	0			-	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.2907A>T	6.37:g.138610965A>T	ENSP00000251691:p.Lys969Asn			Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold,superfamily_Sec7_dom,smart_Sec7_dom	p.K969N	ENST00000251691.4	37	c.2907	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	A	14.87	2.665382	0.47677	.	.	ENSG00000112379	ENST00000251691	T	0.19806	2.12	5.74	4.58	0.56647	.	0.168085	0.53938	D	0.000053	T	0.12263	0.0298	L	0.54323	1.7	0.40557	D	0.981179	P	0.50272	0.933	B	0.42692	0.395	T	0.02026	-1.1227	10	0.51188	T	0.08	-21.3774	11.431	0.50041	0.9298:0.0:0.0702:0.0	.	969	Q5TH69	BIG3_HUMAN	N	969	ENSP00000251691:K969N	ENSP00000251691:K969N	K	+	3	2	KIAA1244	138652658	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.930000	0.28858	1.001000	0.39076	0.533000	0.62120	AAA	-	KIAA1244	-	superfamily_ARM-type_fold		0.478	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4	0	0	0	63	63	83	0.00	0.00	A	NM_020340		138610965	+1	24	13	36	25	tier1	no_errors	ENST00000251691	ensembl	human	known	74_37	missense	40.00	34.21	SNP	1.000	T	24	36
PIK3CG	5294	genome.wustl.edu	37	7	106508826	106508826	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr7:106508826G>A	ENST00000359195.3	+	2	1130	c.820G>A	c.(820-822)Gtc>Atc	p.V274I	PIK3CG_ENST00000440650.2_Missense_Mutation_p.V274I|PIK3CG_ENST00000496166.1_Missense_Mutation_p.V274I	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	274	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V274I(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						TGTGCTGCGCGTCTGTGGCCG	0.542													ENSG00000105851																																					1	Substitution - Missense(1)	large_intestine(1)											54.0	51.0	52.0					7																	106508826		2203	4300	6503	SO:0001583	missense	0			-		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.820G>A	7.37:g.106508826G>A	ENSP00000352121:p.Val274Ile		A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.V274I	ENST00000359195.3	37	c.820	CCDS5739.1	7	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957818	0.53400	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.79749	-1.3;-1.3;-1.3	5.99	5.99	0.97316	Phosphoinositide 3-kinase, ras-binding (2);	0.053681	0.64402	D	0.000001	T	0.74921	0.3780	L	0.48642	1.525	0.80722	D	1	B	0.29909	0.261	B	0.28916	0.096	T	0.70368	-0.4891	10	0.30854	T	0.27	-35.1478	14.0585	0.64786	0.0769:0.0:0.9231:0.0	.	274	P48736	PK3CG_HUMAN	I	274	ENSP00000392258:V274I;ENSP00000419260:V274I;ENSP00000352121:V274I	ENSP00000352121:V274I	V	+	1	0	PIK3CG	106296062	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	6.694000	0.74587	2.840000	0.97914	0.655000	0.94253	GTC	-	PIK3CG	-	pfam_PI3K_Ras-bd_dom,smart_PI3K_Ras-bd_dom		0.542	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIK3CG	HGNC	protein_coding	OTTHUMT00000349294.1	0	0	0	55	55	83	0.00	0.00	G			106508826	+1	11	15	56	48	tier1	no_errors	ENST00000359195	ensembl	human	known	74_37	missense	16.18	23.81	SNP	1.000	A	11	56
LRRC9	341883	genome.wustl.edu	37	14	60468763	60468763	+	Missense_Mutation	SNP	C	C	T	rs115819353	byFrequency	TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr14:60468763C>T	ENST00000445360.1	+	20	2813	c.2609C>T	c.(2608-2610)aCg>aTg	p.T870M	RP11-16B13.1_ENST00000554123.1_RNA|RP11-16B13.1_ENST00000555432.1_RNA			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	870																	AAAATTCTGACGCAGGTTTCA	0.333													ENSG00000131951																																					0																																										SO:0001583	missense	0			-	AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.2609C>T	14.37:g.60468763C>T	ENSP00000454748:p.Thr870Met			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.T870M	ENST00000445360.1	37	c.2609		14																																																																																			-	LRRC9	-	NULL		0.333	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC9	HGNC	protein_coding	OTTHUMT00000072281.3	0	0	0	74	74	125	0.00	0.00	C			60468763	+1	9	17	50	72	tier1	no_errors	ENST00000254271	ensembl	human	known	74_37	missense	15.25	19.10	SNP	1.000	T	9	50
ETV3L	440695	genome.wustl.edu	37	1	157062565	157062565	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:157062565T>A	ENST00000454449.2	-	5	1246	c.962A>T	c.(961-963)aAg>aTg	p.K321M		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	321					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				CAGGCCTCCCTTTGCCTCCAT	0.602													ENSG00000253831																																					0													67.0	65.0	66.0					1																	157062565		2203	4300	6503	SO:0001583	missense	0			-	AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.962A>T	1.37:g.157062565T>A	ENSP00000430271:p.Lys321Met			Missense_Mutation	SNP	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.K321M	ENST00000454449.2	37	c.962	CCDS30893.1	1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291778	0.40594	.	.	ENSG00000253831	ENST00000454449	T	0.36157	1.27	3.85	2.72	0.32119	.	.	.	.	.	T	0.10337	0.0253	N	0.24115	0.695	0.09310	N	1	D	0.52996	0.957	B	0.43536	0.423	T	0.06338	-1.0832	9	0.48119	T	0.1	.	4.9247	0.13887	0.0:0.2619:0.0:0.7381	.	321	Q6ZN32	ETV3L_HUMAN	M	321	ENSP00000430271:K321M	ENSP00000430271:K321M	K	-	2	0	ETV3L	155329189	0.007000	0.16637	0.001000	0.08648	0.005000	0.04900	1.951000	0.40333	0.551000	0.29008	0.459000	0.35465	AAG	-	ETV3L	-	NULL		0.602	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	HGNC	protein_coding	OTTHUMT00000099024.2	0	0	0	49	49	61	0.00	0.00	T	NM_001004341		157062565	-1	21	20	71	97	tier1	no_errors	ENST00000454449	ensembl	human	known	74_37	missense	22.83	17.09	SNP	0.001	A	21	71
TP53	7157	genome.wustl.edu	37	17	7577129	7577131	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	AAG	AAG	AAG	-	AAG	AAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr17:7577129_7577131delAAG	ENST00000269305.4	-	8	996_998	c.807_809delCTT	c.(805-810)agcttt>agt	p.F270del	TP53_ENST00000445888.2_In_Frame_Del_p.F270del|TP53_ENST00000420246.2_In_Frame_Del_p.F270del|TP53_ENST00000359597.4_In_Frame_Del_p.F270del|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_In_Frame_Del_p.F270del|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	270	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F270L(15)|p.F270C(15)|p.F270S(8)|p.0?(8)|p.F270V(7)|p.F270Y(5)|p.F270I(5)|p.S269S(3)|p.G262_F270delGNLLGRNSF(2)|p.?(2)|p.S269_F270>I(2)|p.G266_E271delGRNSFE(2)|p.S269fs*75(1)|p.E258fs*71(1)|p.S269>XXXXX(1)|p.F270fs*72(1)|p.S269fs*21(1)|p.L265_K305del41(1)|p.S269_F270insX(1)|p.F270_D281del12(1)|p.G262_S269delGNLLGRNS(1)|p.S269fs*3(1)|p.S269R(1)|p.S269fs*34(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACGCACCTCAAAGCTGTTCCGTC	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	86	Substitution - Missense(56)|Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(5)|Substitution - coding silent(3)|Unknown(2)|Complex - deletion inframe(2)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - insertion inframe(1)	oesophagus(13)|breast(12)|large_intestine(10)|stomach(8)|upper_aerodigestive_tract(7)|lung(7)|haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(4)|urinary_tract(4)|bone(4)|ovary(3)|testis(1)|soft_tissue(1)|biliary_tract(1)|liver(1)|salivary_gland(1)|eye(1)|prostate(1)|pancreas(1)																																								SO:0001651	inframe_deletion	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.807_809delCTT	17.37:g.7577129_7577131delAAG	ENSP00000269305:p.Phe270del		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F270in_frame_del	ENST00000269305.4	37	c.809_807	CCDS11118.1	17																																																																																				TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	12	12	112	0.00	0.00	AAG	NM_000546		7577131	-1	7	77	7	48	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	in_frame_del	50.00	61.60	DEL	1.000:1.000:1.000	-	7	7
SYDE1	85360	genome.wustl.edu	37	19	15224613	15224618	+	In_Frame_Del	DEL	AGCGAG	AGCGAG	-			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	AGCGAG	AGCGAG	AGCGAG	-	AGCGAG	AGCGAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:15224613_15224618delAGCGAG	ENST00000342784.2	+	8	2078_2083	c.2047_2052delAGCGAG	c.(2047-2052)agcgagdel	p.SE683del	SYDE1_ENST00000600252.1_In_Frame_Del_p.SE340del|SYDE1_ENST00000600440.1_In_Frame_Del_p.SE616del	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	683					activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						GGGCAGTGACAGCGAGGACGAGGACG	0.65													ENSG00000105137																																					0																																										SO:0001651	inframe_deletion	0				BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.2047_2052delAGCGAG	19.37:g.15224613_15224618delAGCGAG	ENSP00000341489:p.Ser683_Glu684del		Q7L2I8|Q8N6J2|Q9H8K4	In_Frame_Del	DEL	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.SE683in_frame_del	ENST00000342784.2	37	c.2047_2052	CCDS12324.1	19																																																																																				SYDE1	-	NULL		0.650	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE1	HGNC	protein_coding	OTTHUMT00000465666.1	0	0	0	25	25	25	0.00	0.00	AGCGAG	NM_033025		15224618	+1	11	11	45	45	tier1	no_errors	ENST00000342784	ensembl	human	known	74_37	in_frame_del	19.64	19.64	DEL	1.000:1.000:0.990:1.000:1.000:1.000	-	11	45
C7orf26	79034	genome.wustl.edu	37	7	6629958	6629958	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr7:6629958G>A	ENST00000344417.5	+	1	311	c.44G>A	c.(43-45)aGc>aAc	p.S15N	AC079742.4_ENST00000434951.1_RNA|C7orf26_ENST00000359073.5_Missense_Mutation_p.S15N	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	15										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		GATGCGCTGAGCGCCGCCAAG	0.726													ENSG00000146576																																					0													16.0	16.0	16.0					7																	6629958		2199	4294	6493	SO:0001583	missense	0			-	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.44G>A	7.37:g.6629958G>A	ENSP00000340220:p.Ser15Asn		Q9BQ43	Missense_Mutation	SNP	NULL	p.S15N	ENST00000344417.5	37	c.44	CCDS5353.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.648611	0.96714	.	.	ENSG00000146576	ENST00000344417;ENST00000359073	T;T	0.42900	0.96;0.96	4.25	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.59756	0.2217	L	0.57536	1.79	0.58432	D	0.999996	D;D	0.67145	0.996;0.996	D;D	0.75484	0.986;0.986	T	0.63769	-0.6562	10	0.66056	D	0.02	-16.8961	14.5352	0.67955	0.0:0.0:1.0:0.0	.	15;15	Q96N11-2;Q96N11	.;CG026_HUMAN	N	15	ENSP00000340220:S15N;ENSP00000351974:S15N	ENSP00000340220:S15N	S	+	2	0	C7orf26	6596483	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.151000	0.94674	2.077000	0.62373	0.643000	0.83706	AGC	-	C7orf26	-	NULL		0.726	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf26	HGNC	protein_coding	OTTHUMT00000246844.2	0	0	0	31	31	9	0.00	0.00	G	NM_024067		6629958	+1	11	4	17	5	tier1	no_errors	ENST00000344417	ensembl	human	known	74_37	missense	39.29	44.44	SNP	1.000	A	11	17
SLC25A47	283600	genome.wustl.edu	37	14	100795157	100795157	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr14:100795157C>T	ENST00000361529.3	+	5	500	c.422C>T	c.(421-423)cCg>cTg	p.P141L	SLC25A47_ENST00000557052.1_5'UTR	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47	141					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						GCCTCGGGGCCGTTGGCTGTG	0.692													ENSG00000140107																									GBM(11;1289 1351)												0													19.0	20.0	20.0					14																	100795157		2192	4278	6470	SO:0001583	missense	0			-		CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.422C>T	14.37:g.100795157C>T	ENSP00000354886:p.Pro141Leu		B2RP39|Q68CL2|Q6PZD8|Q86U14	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.P141L	ENST00000361529.3	37	c.422	CCDS9959.1	14	.	.	.	.	.	.	.	.	.	.	C	6.018	0.371752	0.11409	.	.	ENSG00000140107	ENST00000361529	D	0.81499	-1.5	4.89	2.94	0.34122	Mitochondrial carrier domain (2);	0.198653	0.24896	N	0.034731	T	0.63663	0.2530	N	0.19112	0.55	0.37755	D	0.926105	B	0.31879	0.344	B	0.28991	0.097	T	0.61549	-0.7040	10	0.30854	T	0.27	0.0221	8.5587	0.33498	0.2573:0.6681:0.0:0.0746	.	141	Q6Q0C1	S2547_HUMAN	L	141	ENSP00000354886:P141L	ENSP00000354886:P141L	P	+	2	0	SLC25A47	99864910	0.000000	0.05858	0.023000	0.16930	0.024000	0.10985	0.250000	0.18235	1.065000	0.40693	-0.333000	0.08304	CCG	-	SLC25A47	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.692	SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A47	HGNC	protein_coding	OTTHUMT00000414231.1	0	0	0	40	40	6	0.00	0.00	C			100795157	+1	26	5	28	2	tier1	no_errors	ENST00000361529	ensembl	human	known	74_37	missense	48.15	71.43	SNP	0.006	T	26	28
TBC1D1	23216	genome.wustl.edu	37	4	38016303	38016303	+	Silent	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr4:38016303C>T	ENST00000261439.4	+	3	946	c.591C>T	c.(589-591)atC>atT	p.I197I	TBC1D1_ENST00000508802.1_Silent_p.I197I	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	197					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						ACGAGTGCATCGAGAAGTTCA	0.672													ENSG00000065882																																					0													58.0	65.0	63.0					4																	38016303		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.591C>T	4.37:g.38016303C>T			B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.I197	ENST00000261439.4	37	c.591	CCDS33972.1	4																																																																																			-	TBC1D1	-	smart_PTB/PI_dom		0.672	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	0	0	0	26	26	23	0.00	0.00	C	NM_015173		38016303	+1	8	3	32	8	tier1	no_errors	ENST00000261439	ensembl	human	known	74_37	silent	19.51	27.27	SNP	0.996	T	8	32
LOC642426	642426	genome.wustl.edu	37	14	19412591	19412591	+	lincRNA	SNP	A	A	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr14:19412591A>T	ENST00000548050.1	-	0	0				RP11-536C10.16_ENST00000550928.1_lincRNA	NR_046104.1																						CTTTTCAGAAACCAGGGGAGA	0.527													ENSG00000258364																																					0																																												0			-																													14.37:g.19412591A>T				R	SNP	-	NULL	ENST00000548050.1	37	NULL		14																																																																																			-	RP11-536C10.16	-	-		0.527	RP11-536C10.7-001	KNOWN	basic	lincRNA	ENSG00000258364	Clone_based_vega_gene	lincRNA	OTTHUMT00000408404.1	0	0	0	53	53	67	0.00	0.00	A			19412591	+1	11	5	68	88	tier1	no_errors	ENST00000550928	ensembl	human	known	74_37	rna	13.75	5.38	SNP	0.996	T	11	68
TRIM46	80128	genome.wustl.edu	37	1	155158531	155158531	+	IGR	SNP	T	T	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:155158531T>C	ENST00000334634.4	+	0	3061				MUC1_ENST00000457295.2_3'UTR|MUC1_ENST00000368393.3_3'UTR|MUC1_ENST00000368392.3_3'UTR|MUC1_ENST00000338684.5_3'UTR|MUC1_ENST00000438413.1_3'UTR|MUC1_ENST00000368395.1_3'UTR|RP11-201K10.3_ENST00000473363.2_Intron|MUC1_ENST00000462215.1_5'UTR	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCAAACAGGGTGCAGGGGCTC	0.612													ENSG00000185499																																					0																																										SO:0001628	intergenic_variant	0			-		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680		1.37:g.155158531T>C			A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	R	SNP	-	NULL	ENST00000334634.4	37	NULL	CCDS1097.1	1																																																																																			-	MUC1	-	-		0.612	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC1	HGNC	protein_coding	OTTHUMT00000086728.1	0	0	0	51	51	27	0.00	0.00	T	NM_025058		155158531	-1	11	6	93	62	tier1	no_errors	ENST00000462215	ensembl	human	known	74_37	rna	10.48	8.70	SNP	0.000	C	11	93
FCER2	2208	genome.wustl.edu	37	19	7761923	7761923	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:7761923C>G	ENST00000346664.5	-	7	567	c.355G>C	c.(355-357)Gat>Cat	p.D119H	FCER2_ENST00000360067.4_Missense_Mutation_p.D118H|FCER2_ENST00000597921.1_Missense_Mutation_p.D119H	NM_001220500.1|NM_002002.4	NP_001207429.1|NP_001993.2	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor for (CD23)	119					Notch signaling pathway (GO:0007219)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10						CTGCTCAGATCTGCTTGAAGC	0.637													ENSG00000104921																																					0													40.0	34.0	36.0					19																	7761923		2203	4300	6503	SO:0001583	missense	0			-	M15059	CCDS12184.1	19p13.3	2011-08-30	2006-03-09			ENSG00000104921		"""C-type lectin domain containing"", ""CD molecules"""	3612	protein-coding gene	gene with protein product		151445	"""Fc fragment of IgE, low affinity II, receptor for (CD23A)"""	CD23A, FCE2			Standard	NM_002002		Approved	CLEC4J, CD23	uc002mhm.2	P06734		ENST00000346664.5:c.355G>C	19.37:g.7761923C>G	ENSP00000264072:p.Asp119His			Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.D119H	ENST00000346664.5	37	c.355	CCDS12184.1	19	.	.	.	.	.	.	.	.	.	.	C	10.44	1.349931	0.24426	.	.	ENSG00000104921	ENST00000346664;ENST00000360067	T;T	0.21361	2.01;2.01	4.98	3.91	0.45181	.	0.000000	0.38326	N	0.001733	T	0.22126	0.0533	L	0.50333	1.59	0.09310	N	1	P;P	0.43633	0.559;0.813	B;B	0.42319	0.383;0.164	T	0.07252	-1.0782	10	0.54805	T	0.06	.	11.187	0.48662	0.0:0.8137:0.1863:0.0	.	118;119	P06734-2;P06734	.;FCER2_HUMAN	H	119;118	ENSP00000264072:D119H;ENSP00000353178:D118H	ENSP00000264072:D119H	D	-	1	0	FCER2	7667923	0.118000	0.22208	0.118000	0.21660	0.012000	0.07955	0.925000	0.28791	1.047000	0.40274	0.655000	0.94253	GAT	-	FCER2	-	NULL		0.637	FCER2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCER2	HGNC	protein_coding	OTTHUMT00000461832.1	0	0	0	62	62	48	0.00	0.00	C	NM_002002		7761923	-1	10	4	98	95	tier1	no_errors	ENST00000346664	ensembl	human	known	74_37	missense	9.26	4.00	SNP	0.057	G	10	98
ZNF225	7768	genome.wustl.edu	37	19	44636550	44636550	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr19:44636550C>G	ENST00000262894.6	+	5	2063	c.1783C>G	c.(1783-1785)Cca>Gca	p.P595A	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Missense_Mutation_p.P595A	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	595					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				TGATGAAAAGCCATTCAAATG	0.428													ENSG00000256294																																					0													57.0	61.0	60.0					19																	44636550		2194	4292	6486	SO:0001583	missense	0			-	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1783C>G	19.37:g.44636550C>G	ENSP00000262894:p.Pro595Ala		A8K8S2|Q53F12|Q9NS46|Q9UID8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P595A	ENST00000262894.6	37	c.1783	CCDS46100.1	19	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587533	0.66105	.	.	ENSG00000256294	ENST00000262894;ENST00000544184	T	0.16457	2.34	2.65	2.65	0.31530	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23054	0.0557	M	0.85197	2.74	0.30818	N	0.738064	P	0.51240	0.943	B	0.37047	0.24	T	0.45659	-0.9246	9	0.72032	D	0.01	.	12.4313	0.55575	0.0:1.0:0.0:0.0	.	595	Q9UK10	ZN225_HUMAN	A	595;559	ENSP00000262894:P595A	ENSP00000262894:P595A	P	+	1	0	ZNF225	49328390	0.076000	0.21285	0.005000	0.12908	0.253000	0.25986	3.229000	0.51278	1.462000	0.47948	0.561000	0.74099	CCA	-	ZNF225	-	pfscan_Znf_C2H2		0.428	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	HGNC	protein_coding	OTTHUMT00000460581.1	0	0	0	54	54	62	0.00	0.00	C			44636550	+1	15	10	155	114	tier1	no_errors	ENST00000262894	ensembl	human	known	74_37	missense	8.82	8.06	SNP	0.999	G	15	155
MYH10	4628	genome.wustl.edu	37	17	8380278	8380278	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr17:8380278C>T	ENST00000269243.4	-	40	5840	c.5702G>A	c.(5701-5703)cGt>cAt	p.R1901H	MYH10_ENST00000396239.1_Missense_Mutation_p.R1922H|MYH10_ENST00000379980.4_Missense_Mutation_p.R1917H|NDEL1_ENST00000299734.7_Intron|MYH10_ENST00000360416.3_Missense_Mutation_p.R1932H	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1901					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CTGGAGTTTACGCCGAGATGC	0.617													ENSG00000133026																																					0													86.0	70.0	75.0					17																	8380278		2203	4300	6503	SO:0001583	missense	0			-	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5702G>A	17.37:g.8380278C>T	ENSP00000269243:p.Arg1901His		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1922H	ENST00000269243.4	37	c.5765	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.594773	0.96602	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95	4.95	4.95	0.65309	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.94827	0.8329	H	0.95611	3.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.99;0.994	D	0.96059	0.9037	10	0.87932	D	0	.	18.3182	0.90229	0.0:1.0:0.0:0.0	.	1910;1932;1901	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	H	1901;1932;1922;1917	ENSP00000269243:R1901H;ENSP00000353590:R1932H;ENSP00000379539:R1922H;ENSP00000369315:R1917H	ENSP00000269243:R1901H	R	-	2	0	MYH10	8321003	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.606000	0.82863	2.712000	0.92718	0.655000	0.94253	CGT	-	MYH10	-	pfam_Myosin_tail		0.617	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	0	0	0	26	26	55	0.00	0.00	C			8380278	-1	10	7	39	65	tier1	no_errors	ENST00000396239	ensembl	human	known	74_37	missense	20.00	9.72	SNP	1.000	T	10	39
OSTN	344901	genome.wustl.edu	37	3	190967857	190967857	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr3:190967857G>T	ENST00000339051.1	+	3	349	c.349G>T	c.(349-351)Ggt>Tgt	p.G117C	OSTN_ENST00000445281.1_Intron	NM_198184.1	NP_937827.1	P61366	OSTN_HUMAN	osteocrin	117					cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|endochondral bone growth (GO:0003416)|negative regulation of glucose import (GO:0046325)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of cGMP biosynthetic process (GO:0030828)	extracellular space (GO:0005615)				kidney(1)|large_intestine(3)|lung(6)|pancreas(1)|skin(2)	13	all_cancers(143;6.79e-09)|Ovarian(172;0.103)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000254)		AAGGCGATTTGGTATCCCCAT	0.353													ENSG00000188729																																					0													124.0	128.0	127.0					3																	190967857		2203	4300	6503	SO:0001583	missense	0			-	AY398681	CCDS3299.1	3q29	2004-01-22			ENSG00000188729	ENSG00000188729			29961	protein-coding gene	gene with protein product		610280				14523025	Standard	NM_198184		Approved		uc011bsn.2	P61366	OTTHUMG00000156190	ENST00000339051.1:c.349G>T	3.37:g.190967857G>T	ENSP00000342356:p.Gly117Cys		A1A4U3	Missense_Mutation	SNP	pfam_Osteocrin	p.G117C	ENST00000339051.1	37	c.349	CCDS3299.1	3	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582426	0.65992	.	.	ENSG00000188729	ENST00000339051	.	.	.	5.52	4.62	0.57501	.	0.186977	0.47093	D	0.000256	T	0.70806	0.3266	L	0.59436	1.845	0.39537	D	0.968767	D	0.89917	1.0	D	0.80764	0.994	T	0.74802	-0.3541	9	0.87932	D	0	-22.206	12.1496	0.54042	0.0:0.1724:0.8276:0.0	.	117	P61366	OSTN_HUMAN	C	117	.	ENSP00000342356:G117C	G	+	1	0	OSTN	192450551	1.000000	0.71417	0.945000	0.38365	0.949000	0.60115	3.170000	0.50816	1.295000	0.44724	0.655000	0.94253	GGT	-	OSTN	-	pfam_Osteocrin		0.353	OSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSTN	HGNC	protein_coding	OTTHUMT00000343350.1	0	0	2	133	133	184	0.00	1.08	G	NM_198184		190967857	+1	64	53	74	85	tier1	no_errors	ENST00000339051	ensembl	human	known	74_37	missense	46.38	38.41	SNP	0.993	T	64	74
CDK5RAP2	55755	genome.wustl.edu	37	9	123205989	123205989	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr9:123205989G>T	ENST00000349780.4	-	23	3236	c.3057C>A	c.(3055-3057)gaC>gaA	p.D1019E	CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.D987E|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.D1019E|CDK5RAP2_ENST00000359309.3_Intron	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1019	Interaction with MAPRE1.				brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CTCCTGGGCTGTCCTGGTAGG	0.453													ENSG00000136861																																					0													146.0	132.0	137.0					9																	123205989		2203	4300	6503	SO:0001583	missense	0			-	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.3057C>A	9.37:g.123205989G>T	ENSP00000343818:p.Asp1019Glu		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.D1019E	ENST00000349780.4	37	c.3057	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	G	9.006	0.981204	0.18812	.	.	ENSG00000136861	ENST00000360822;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000345313	T;T;T;T	0.18502	3.88;3.89;3.8;2.21	3.98	1.86	0.25419	.	0.748645	0.11869	N	0.521649	T	0.14013	0.0339	L	0.32530	0.975	0.43313	D	0.995328	B;B;B;B;P	0.40476	0.017;0.009;0.126;0.01;0.718	B;B;B;B;B	0.41088	0.005;0.005;0.053;0.002;0.347	T	0.13575	-1.0504	10	0.29301	T	0.29	.	9.5048	0.39040	0.0:0.4264:0.5736:0.0	.	788;987;1019;1019;413	Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8;B1AMJ5	.;.;.;CK5P2_HUMAN;.	E	987;1019;1019;413;791	ENSP00000354065:D987E;ENSP00000343818:D1019E;ENSP00000353317:D1019E;ENSP00000400395:D413E	ENSP00000341695:D791E	D	-	3	2	CDK5RAP2	122245810	0.004000	0.15560	0.503000	0.27626	0.519000	0.34347	-0.229000	0.09098	0.946000	0.37632	0.462000	0.41574	GAC	-	CDK5RAP2	-	NULL		0.453	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	0	0	1	29	29	47	0.00	2.08	G	NM_018249		123205989	-1	10	15	26	35	tier1	no_errors	ENST00000349780	ensembl	human	known	74_37	missense	27.78	30.00	SNP	0.717	T	10	26
KRTAP10-10	353333	genome.wustl.edu	37	21	46057634	46057634	+	Silent	SNP	T	T	C	rs61029972	byFrequency	TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr21:46057634T>C	ENST00000380095.1	+	1	362	c.300T>C	c.(298-300)tgT>tgC	p.C100C	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	100	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						ctgtctgctgtgtgcccgtct	0.632													ENSG00000221859	C|||	539	0.107628	0.2383	0.0591	5008	,	,		18755	0.0109		0.0557	False		,,,				2504	0.1186																0													126.0	121.0	123.0					21																	46057634		2203	4298	6501	SO:0001819	synonymous_variant	0			-	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.300T>C	21.37:g.46057634T>C				Silent	SNP	NULL	p.C100	ENST00000380095.1	37	c.300	CCDS33585.1	21																																																																																			rs61029972	KRTAP10-10	-	NULL		0.632	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-10	HGNC	protein_coding	OTTHUMT00000128034.1	0	0	0	34	34	9	0.00	0.00	T	NM_181688		46057634	+1	7	0	31	9	tier1	no_errors	ENST00000380095	ensembl	human	known	74_37	silent	18.42	0.00	SNP	0.122	C	7	31
SLC4A5	57835	genome.wustl.edu	37	2	74479414	74479416	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr2:74479414_74479416delCCA	ENST00000377634.4	-	16	1767_1769	c.1368_1370delTGG	c.(1366-1371)ggtggc>ggc	p.456_457GG>G	RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000394019.2_In_Frame_Del_p.456_457GG>G|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000423644.1_In_Frame_Del_p.456_457GG>G|SLC4A5_ENST00000377632.1_In_Frame_Del_p.456_457GG>G|SLC4A5_ENST00000358683.4_In_Frame_Del_p.392_393GG>G|SLC4A5_ENST00000346834.4_In_Frame_Del_p.456_457GG>G|SLC4A5_ENST00000357822.5_In_Frame_Del_p.456_457GG>G|SLC4A5_ENST00000359484.4_In_Frame_Del_p.392_393GG>G					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						gccgccactgccaccaccaccac	0.635													ENSG00000188687																																					0																																										SO:0001651	inframe_deletion	0				AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.1368_1370delTGG	2.37:g.74479423_74479425delCCA	ENSP00000366861:p.Gly457del			In_Frame_Del	DEL	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.G457in_frame_del	ENST00000377634.4	37	c.1370_1368	CCDS1936.1	2																																																																																				SLC4A5	-	tigrfam_HCO3_transpt_euk		0.635	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A5	HGNC	protein_coding	OTTHUMT00000206583.3	0	0	0	29	29	5	0.00	0.00	CCA			74479416	-1	2	0	15	9	tier1	no_errors	ENST00000357822	ensembl	human	known	74_37	in_frame_del	11.76	0.00	DEL	0.160:0.293:0.421	-	2	15
ANKRD20A8P	729171	genome.wustl.edu	37	2	95494939	95494939	+	RNA	SNP	A	A	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr2:95494939A>T	ENST00000432432.2	-	0	1096					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		GTTTTGCAGGAGGCCCTACAA	0.343													ENSG00000229089																																					0																																												0			-			2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95494939A>T			A6NC18	R	SNP	-	NULL	ENST00000432432.2	37	NULL		2																																																																																			-	ANKRD20A8P	-	-		0.343	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ANKRD20A8P	HGNC	pseudogene	OTTHUMT00000451404.1	0	0	0	318	318	0	0.00	0.00	A			95494939	-1	65	0	290	0	tier1	no_errors	ENST00000432432	ensembl	human	known	74_37	rna	18.31	0.00	SNP	0.278	T	65	290
DNM1P47	100216544	genome.wustl.edu	37	15	102304789	102304791	+	RNA	DEL	GAA	GAA	-			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	GAA	GAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr15:102304789_102304791delGAA	ENST00000561463.1	+	0	12835_12837									DNM1 pseudogene 47																		ACTCGCGTGGGAAGAAGAAGACA	0.586													ENSG00000259660																																					0																																												0				AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304795_102304797delGAA				R	DEL	-	NULL	ENST00000561463.1	37	NULL		15																																																																																				DNM1P47	-	-		0.586	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0	0	37	37	0	0.00	0.00	GAA	NG_009149		102304791	+1	6	0	35	0	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	14.63	0.00	DEL	0.066:0.054:0.028	-	6	35
GNAS	2778	genome.wustl.edu	37	20	57464277	57464278	+	5'Flank	INS	-	-	CGGCG	rs370277950|rs143800311	byFrequency	TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr20:57464277_57464278insCGGCG	ENST00000371085.3	+	0	0				GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Intron|GNAS_ENST00000371075.3_Intron|RP1-309F20.3_ENST00000424434.1_RNA|GNAS_ENST00000464624.2_Intron|GNAS_ENST00000371081.1_5'Flank|GNAS_ENST00000306090.10_5'Flank|RP1-309F20.3_ENST00000441270.2_RNA|GNAS_ENST00000265620.7_5'Flank|GNAS_ENST00000371095.3_5'Flank|GNAS_ENST00000354359.7_5'Flank|GNAS_ENST00000371100.4_Intron|GNAS_ENST00000371098.2_Intron	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			AGGTGGCTGGCCGGCGCGGCGC	0.792			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)			ENSG00000087460		2796	0.558307	0.4145	0.5764	5008	,	,		4078	0.6994		0.5348	False		,,,				2504	0.6186				Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0																																										SO:0001631	upstream_gene_variant	0				M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069		20.37:g.57464283_57464287dupCGGCG	Exception_encountered		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	R	INS	-	NULL	ENST00000371085.3	37	NULL	CCDS13472.1	20																																																																																				GS	-	-		0.792	GNAS-015	KNOWN	basic|CCDS	protein_coding	GS	HGNC	protein_coding	OTTHUMT00000080431.2	0	0	0	0	0	0	0.00	0.00	-	NM_000516		57464278	+1	0	0	0	0	tier1	no_errors	ENST00000469431	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.949:0.921	CGGCG	0	0
GOLGA6L1	283767	genome.wustl.edu	37	15	22743302	22743303	+	In_Frame_Ins	INS	-	-	AGG			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr15:22743302_22743303insAGG	ENST00000560659.2	+	8	1537_1538	c.1537_1538insAGG	c.(1537-1539)cag>cAGGag	p.514_515insE	GOLGA6L1_ENST00000316397.3_In_Frame_Ins_p.564_565insE			Q8N7Z2	GG6L1_HUMAN	golgin A6 family-like 1	538										NS(1)|breast(2)|endometrium(5)|large_intestine(1)|lung(1)|skin(1)	11						gatgcaagaacaggagaagatg	0.53													ENSG00000197414																																					0																																										SO:0001652	inframe_insertion	0				AK097517	CCDS73699.1	15q11.2	2012-10-05	2010-02-12		ENSG00000197414	ENSG00000277865			37444	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 1"""				Standard	NM_001001413		Approved		uc010tzx.1	Q8N7Z2	OTTHUMG00000171883	ENST00000560659.2:c.1538_1540dupAGG	15.37:g.22743303_22743305dupAGG	ENSP00000452626:p.Glu514_Glu514dup			In_Frame_Ins	INS	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.565in_frame_insE	ENST00000560659.2	37	c.1687_1688		15																																																																																				GOLGA6L1	-	NULL		0.530	GOLGA6L1-002	KNOWN	basic|appris_candidate	protein_coding	GOLGA6L1	HGNC	protein_coding	OTTHUMT00000415616.2	0	0	0	53	53	2	0.00	0.00	-	NM_001001413		22743303	+1	5	0	54	0	tier1	no_errors	ENST00000316397	ensembl	human	known	74_37	in_frame_ins	8.47	0.00	INS	0.243:0.437	AGG	5	54
GOLGA8M	653720	genome.wustl.edu	37	15	28952905	28952905	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr15:28952905T>C	ENST00000563027.1	-	8	579	c.580A>G	c.(580-582)Aag>Gag	p.K194E	GOLGA8M_ENST00000340249.3_Missense_Mutation_p.K113E|GOLGA8M_ENST00000563213.1_5'Flank					golgin A8 family, member M																		TGGTTTGCCTTCTTCTTCTGT	0.532													ENSG00000188626																																					0																																										SO:0001583	missense	0			-		CCDS61572.1	15q13.1	2014-03-21			ENSG00000188626	ENSG00000188626			44404	protein-coding gene	gene with protein product							Standard	NM_001282468		Approved			H3BSY2	OTTHUMG00000176338	ENST00000563027.1:c.580A>G	15.37:g.28952905T>C	ENSP00000456927:p.Lys194Glu			Missense_Mutation	SNP	NULL	p.K113E	ENST00000563027.1	37	c.337		15	.	.	.	.	.	.	.	.	.	.	.	0	-2.581533	0.00129	.	.	ENSG00000188626	ENST00000340249	T	0.32023	1.47	0.798	-1.6	0.08426	.	.	.	.	.	T	0.18923	0.0454	L	0.46819	1.47	0.18873	N	0.999986	.	.	.	.	.	.	T	0.39418	-0.9615	7	0.06236	T	0.91	.	4.0831	0.09935	0.0:0.2457:0.4895:0.2648	.	.	.	.	E	113	ENSP00000344295:K113E	ENSP00000344295:K113E	K	-	1	0	AC055876.1	26751946	0.983000	0.35010	0.002000	0.10522	0.002000	0.02628	1.204000	0.32296	-1.185000	0.02716	-1.386000	0.01163	AAG	-	GOLGA8M	-	NULL		0.532	GOLGA8M-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8M	HGNC	protein_coding	OTTHUMT00000431777.1	0	0	0	131	131	0	0.00	0.00	T			28952905	-1	32	0	98	0	tier1	no_errors	ENST00000340249	ensembl	human	known	74_37	missense	24.62	0.00	SNP	0.783	C	32	98
MT-ND2	4536	genome.wustl.edu	37	M	2647	2647	+	5'Flank	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chrM:2647G>T	ENST00000361453.3	+	0	0				MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						ggctccacgagggttcagctg	0.483													ENSG00000210082																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2647G>T	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	R	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	MT-RNR2	-	-		0.483	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		0	0	0	670	670	4	0.00	0.00	G	YP_003024027		2647	+1	357	1	237	0	tier1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	60.10	100.00	SNP	NULL	T	357	237
MT-ND1	4535	genome.wustl.edu	37	M	588	588	+	5'Flank	SNP	T	T	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chrM:588T>C	ENST00000361390.2	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGTTTATGTAGCTTACCTCCT	0.483													ENSG00000210049																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.588T>C	Exception_encountered		C0JKH6|Q37523	R	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	MT-TF	-	-		0.483	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-TF	HGNC	protein_coding		0	0	0	98	98	0	0.00	0.00	T	YP_003024026		588	+1	63	1	41	0	tier1	no_errors	ENST00000387314	ensembl	human	known	74_37	rna	60.58	100.00	SNP	NULL	C	63	41
MT-CO1	4512	genome.wustl.edu	37	M	5824	5824	+	5'Flank	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chrM:5824G>A	ENST00000361624.2	+	0	0				MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ATCACCTCGGAGCTGGTAAAA	0.498													ENSG00000210140																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.5824G>A	Exception_encountered		Q34770	R	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			-	MT-TC	-	-		0.498	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-TC	HGNC	protein_coding		0	0	0	112	112	0	0.00	0.00	G	YP_003024028		5824	-1	22	0	89	2	tier1	no_errors	ENST00000387405	ensembl	human	known	74_37	rna	19.82	0.00	SNP	NULL	A	22	89
PCDH8	5100	genome.wustl.edu	37	13	53421442	53421444	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr13:53421442_53421444delGCG	ENST00000377942.3	-	1	1331_1333	c.1128_1130delCGC	c.(1126-1131)gccgct>gct	p.376_377AA>A	PCDH8_ENST00000338862.4_In_Frame_Del_p.376_377AA>A	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	376					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CCCGAGTGCAGCGGCGGCGGCGG	0.759													ENSG00000136099																									GBM(36;25 841 9273 49207)												0									,	13,1651		1,11,820					,	-7.9	0.3			4	27,3629		1,25,1802	no	coding,coding	PCDH8	NM_032949.2,NM_002590.3	,	2,36,2622	A1A1,A1R,RR		0.7385,0.7812,0.7519	,	,		40,5280				SO:0001651	inframe_deletion	0				AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.1128_1130delCGC	13.37:g.53421451_53421453delGCG	ENSP00000367177:p.Ala378del		B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	In_Frame_Del	DEL	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A378in_frame_del	ENST00000377942.3	37	c.1130_1128	CCDS9438.1	13																																																																																				PCDH8	-	NULL		0.759	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH8	HGNC	protein_coding	OTTHUMT00000045108.2	0	0	0	8	8	0	0.00	0.00	GCG	NM_002590		53421444	-1	3	0	6	0	tier1	no_errors	ENST00000377942	ensembl	human	known	74_37	in_frame_del	33.33	0.00	DEL	0.903:0.923:0.916	-	3	6
PDXK	8566	genome.wustl.edu	37	21	45157549	45157590	+	Intron	DEL	GGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC	GGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC	-			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	GGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC	GGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr21:45157549_45157590delGGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC	ENST00000291565.4	+	2	325				PDXK_ENST00000398081.1_3'UTR|PDXK_ENST00000468090.1_Intron|PDXK_ENST00000327574.4_3'UTR|PDXK_ENST00000476313.1_3'UTR	NM_003681.4	NP_003672.1	O00764	PDXK_HUMAN	pyridoxal (pyridoxine, vitamin B6) kinase						cell proliferation (GO:0008283)|pyridoxal 5'-phosphate salvage (GO:0009443)|pyridoxal phosphate biosynthetic process (GO:0042823)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|protein homodimerization activity (GO:0042803)|pyridoxal kinase activity (GO:0008478)|pyridoxal phosphate binding (GO:0030170)|sodium ion binding (GO:0031402)|zinc ion binding (GO:0008270)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	GAGAAGGCCAGGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCCGGGCCAGGAG	0.723													ENSG00000160209																																					0																																										SO:0001627	intron_variant	0				U89606	CCDS13699.1	21q22.3	2007-05-10			ENSG00000160209	ENSG00000160209	2.7.1.35		8819	protein-coding gene	gene with protein product		179020	"""chromosome 21 open reading frame 97"", ""chromosome 21 open reading frame 124"""	C21orf97, C21orf124		9099727	Standard	NM_003681		Approved	PNK, PKH, FLJ21324, PRED79, FLJ31940, MGC15873	uc002zdm.4	O00764	OTTHUMG00000086870	ENST00000291565.4:c.142+3545GGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC>-	21.37:g.45157549_45157590delGGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC			Q7Z2Y0|Q9BS02	R	DEL	-	NULL	ENST00000291565.4	37	NULL	CCDS13699.1	21																																																																																				PDXK	-	-		0.723	PDXK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXK	HGNC	protein_coding	OTTHUMT00000195636.1	0	0	0	1	1	1	0.00	0.00	GGGCCAGGAGCCTGCCGACGGACACCAGCGAGGGGCCAGGCC	NM_003681		45157590	+1	0	0	2	2	tier1	no_errors	ENST00000476313	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.002:0.002:0.001:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.001:0.000:0.001:0.002:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.002:0.003:0.003:0.004:0.003:0.003:0.001:0.000:0.001:0.000:0.000:0.000	-	0	2
MT-ND1	4535	genome.wustl.edu	37	M	686	686	+	5'Flank	SNP	A	A	G			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chrM:686A>G	ENST00000361390.2	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TAGCTCTTAGTAAGATTACAC	0.438													ENSG00000211459																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.686A>G	Exception_encountered		C0JKH6|Q37523	R	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	MT-RNR1	-	-		0.438	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		0	0	0	188	188	2	0.00	0.00	A	YP_003024026		686	+1	98	2	63	2	tier1	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	60.87	50.00	SNP	NULL	G	98	63
SGK223	157285	genome.wustl.edu	37	8	8234306	8234306	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr8:8234306T>C	ENST00000520004.1	-	3	1877	c.1613A>G	c.(1612-1614)gAg>gGg	p.E538G	SGK223_ENST00000330777.4_Missense_Mutation_p.E538G			Q86YV5	SG223_HUMAN		540							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGCGGGCCTCTCCTTGGGCTT	0.637													ENSG00000182319																									GBM(34;731 755 10259 33573 33867)												0													21.0	25.0	24.0					8																	8234306		2008	4152	6160	SO:0001583	missense	0			-																												ENST00000520004.1:c.1613A>G	8.37:g.8234306T>C	ENSP00000428054:p.Glu538Gly		Q8N3N5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.E538G	ENST00000520004.1	37	c.1613	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.259653	0.00262	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.57907	0.37;0.37	5.04	2.06	0.26882	.	0.736203	0.12505	N	0.462931	T	0.21186	0.0510	N	0.01800	-0.715	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19712	-1.0297	10	0.21540	T	0.41	.	4.2908	0.10878	0.0:0.4705:0.164:0.3655	.	538	Q86YV5	SG223_HUMAN	G	538	ENSP00000330930:E538G;ENSP00000428054:E538G	ENSP00000330930:E538G	E	-	2	0	AC068353.1	8271716	0.000000	0.05858	0.131000	0.22000	0.126000	0.20510	0.256000	0.18351	0.221000	0.20879	-0.177000	0.13119	GAG	-	SGK223	-	NULL		0.637	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1	0	0	0	53	53	34	0.00	0.00	T			8234306	-1	22	2	39	24	tier1	no_errors	ENST00000330777	ensembl	human	known	74_37	missense	36.07	7.69	SNP	0.003	C	22	39
USH2A	7399	genome.wustl.edu	37	1	215848049	215848049	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr1:215848049G>T	ENST00000307340.3	-	63	13590	c.13204C>A	c.(13204-13206)Cag>Aag	p.Q4402K	USH2A_ENST00000366943.2_Missense_Mutation_p.Q4402K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4402	Fibronectin type-III 29. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CACAGGCCCTGGCCAGCAAGG	0.458										HNSCC(13;0.011)			ENSG00000042781																																					0													66.0	69.0	68.0					1																	215848049		2203	4300	6503	SO:0001583	missense	0			-	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13204C>A	1.37:g.215848049G>T	ENSP00000305941:p.Gln4402Lys		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.Q4402K	ENST00000307340.3	37	c.13204	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.489686	0.01018	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.57595	0.39;0.39	4.82	3.76	0.43208	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.394512	0.17754	U	0.163126	T	0.26991	0.0661	N	0.11064	0.09	0.20764	N	0.999852	B	0.06786	0.001	B	0.08055	0.003	T	0.14671	-1.0464	10	0.02654	T	1	.	10.3465	0.43909	0.0:0.0:0.5605:0.4395	.	4402	O75445	USH2A_HUMAN	K	4402	ENSP00000305941:Q4402K;ENSP00000355910:Q4402K	ENSP00000305941:Q4402K	Q	-	1	0	USH2A	213914672	0.919000	0.31177	0.370000	0.25965	0.234000	0.25298	4.413000	0.59795	2.384000	0.81235	0.467000	0.42956	CAG	-	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.458	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0	0	16	16	58	0.00	0.00	G	NM_007123		215848049	-1	9	2	20	60	tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	31.03	3.23	SNP	0.516	T	9	20
CLPSL1	340204	genome.wustl.edu	37	6	35754852	35754852	+	Silent	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr6:35754852G>T	ENST00000373861.5	+	2	271	c.177G>T	c.(175-177)tcG>tcT	p.S59S	CLPSL1_ENST00000542261.1_Silent_p.S58S			A2RUU4	COLL1_HUMAN	colipase-like 1	59					digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										ATTGCGAGTCGCACTGCGCGG	0.657													ENSG00000204140																																					0													24.0	33.0	30.0					6																	35754852		2156	4258	6414	SO:0001819	synonymous_variant	0			-		CCDS43456.1	6p21.31	2014-01-28	2012-02-06	2012-02-06	ENSG00000204140	ENSG00000204140			21251	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 127"""	C6orf127			Standard	NM_001010886		Approved	dJ510O8.6	uc003old.4	A2RUU4	OTTHUMG00000014582	ENST00000373861.5:c.177G>T	6.37:g.35754852G>T			A7E2T6|B2RPE2|B5G4V2|B6ZDM9|Q5T9G1	Silent	SNP	smart_Colipase,prints_Colipase	p.S59	ENST00000373861.5	37	c.177	CCDS43456.1	6																																																																																			-	CLPSL1	-	smart_Colipase,prints_Colipase		0.657	CLPSL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLPSL1	HGNC	protein_coding	OTTHUMT00000040317.2	1	1	0	214	214	28	0.47	0.00	G	NM_001010886		35754852	+1	27	2	239	34	tier1	no_errors	ENST00000373861	ensembl	human	known	74_37	silent	10.11	5.56	SNP	0.001	T	27	239
UVSSA	57654	genome.wustl.edu	37	4	1360147	1360147	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr4:1360147G>T	ENST00000389851.4	+	8	1663	c.1216G>T	c.(1216-1218)Gag>Tag	p.E406*	UVSSA_ENST00000507531.1_Nonsense_Mutation_p.E406*|UVSSA_ENST00000511216.1_Nonsense_Mutation_p.E406*|UVSSA_ENST00000511563.1_5'UTR	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	406					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										TGAGGACGATGAGGACTTTGT	0.587													ENSG00000163945																																					0													181.0	179.0	179.0					4																	1360147		2203	4300	6503	SO:0001587	stop_gained	0			-	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.1216G>T	4.37:g.1360147G>T	ENSP00000374501:p.Glu406*		A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Nonsense_Mutation	SNP	pfam_DUF2043,superfamily_ENTH_VHS	p.E406*	ENST00000389851.4	37	c.1216	CCDS33938.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.511530	0.96402	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531	.	.	.	4.96	2.17	0.27698	.	0.549135	0.17227	U	0.182105	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	9.4168	0.38525	0.0773:0.2825:0.6401:0.0	.	.	.	.	X	406	.	ENSP00000374501:E406X	E	+	1	0	KIAA1530	1350147	1.000000	0.71417	0.018000	0.16275	0.024000	0.10985	4.539000	0.60657	0.110000	0.17919	-0.499000	0.04595	GAG	-	UVSSA	-	NULL		0.587	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVSSA	HGNC	protein_coding	OTTHUMT00000359480.1	0	0	0	42	42	69	0.00	0.00	G	NM_020894		1360147	+1	4	2	35	71	tier1	no_errors	ENST00000389851	ensembl	human	known	74_37	nonsense	10.26	2.74	SNP	0.674	T	4	35
STRN	6801	genome.wustl.edu	37	2	37126759	37126759	+	Silent	SNP	G	G	A			TCGA-DX-A8BL-01A-11D-A417-09	TCGA-DX-A8BL-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7e48209f-ba06-4da0-b1d5-3e7bb00d5cba	13d21ee5-7825-41f8-a9b2-9d73657bf6c9	g.chr2:37126759G>A	ENST00000263918.4	-	6	710	c.702C>T	c.(700-702)ttC>ttT	p.F234F	STRN_ENST00000379213.2_Silent_p.F222F	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	234					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				CAAGGAATTTGAAATTATCCA	0.363													ENSG00000115808																																					0													69.0	67.0	68.0					2																	37126759		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.702C>T	2.37:g.37126759G>A			Q3KP65|Q53TQ8|Q9NP38	Silent	SNP	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.F234	ENST00000263918.4	37	c.702	CCDS1784.1	2																																																																																			-	STRN	-	NULL		0.363	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRN	HGNC	protein_coding	OTTHUMT00000218568.1	0	0	0	48	48	70	0.00	0.00	G			37126759	-1	10	3	60	62	tier1	no_errors	ENST00000263918	ensembl	human	known	74_37	silent	14.29	4.62	SNP	1.000	A	10	60
