#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ACTL9	284382	genome.wustl.edu	37	19	8807881	8807881	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr19:8807881G>A	ENST00000324436.3	-	1	1291	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	391						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R391C(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TGGAAGGCGCGCAGGGAGGCC	0.652													ENSG00000181786																																					1	Substitution - Missense(1)	large_intestine(1)											37.0	39.0	38.0					19																	8807881		2203	4299	6502	SO:0001583	missense	0			-		CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1171C>T	19.37:g.8807881G>A	ENSP00000316674:p.Arg391Cys		A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R391C	ENST00000324436.3	37	c.1171	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	g	10.61	1.399657	0.25291	.	.	ENSG00000181786	ENST00000324436	T	0.08193	3.12	4.51	2.23	0.28157	.	0.317190	0.22565	N	0.058402	T	0.12220	0.0297	L	0.29908	0.895	0.35755	D	0.81972	D	0.76494	0.999	P	0.60886	0.88	T	0.17684	-1.0361	10	0.87932	D	0	.	6.1475	0.20293	0.0884:0.0:0.5749:0.3367	.	391	Q8TC94	ACTL9_HUMAN	C	391	ENSP00000316674:R391C	ENSP00000316674:R391C	R	-	1	0	ACTL9	8668881	0.013000	0.17824	0.431000	0.26735	0.759000	0.43091	0.742000	0.26216	0.564000	0.29238	0.457000	0.33378	CGC	-	ACTL9	-	pfam_Actin-related,smart_Actin-related		0.652	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	0	0	0	52	52	33	0.00	0.00	G	NM_178525		8807881	-1	19	30	35	31	tier1	no_errors	ENST00000324436	ensembl	human	known	74_37	missense	35.19	49.18	SNP	0.994	A	19	35
ZNF430	80264	genome.wustl.edu	37	19	21216935	21216935	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr19:21216935G>C	ENST00000261560.5	+	4	448	c.267G>C	c.(265-267)gaG>gaC	p.E89D	ZNF430_ENST00000599548.1_Missense_Mutation_p.E89D|ZNF430_ENST00000595401.1_Missense_Mutation_p.E88D	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	89	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						CCTGTCTAGAGCAAGGAAAAG	0.418													ENSG00000118620																																					0													125.0	123.0	124.0					19																	21216935		2203	4300	6503	SO:0001583	missense	0			-	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.267G>C	19.37:g.21216935G>C	ENSP00000261560:p.Glu89Asp		Q86V70	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E89D	ENST00000261560.5	37	c.267	CCDS32978.1	19	.	.	.	.	.	.	.	.	.	.	.	9.402	1.078273	0.20227	.	.	ENSG00000118620	ENST00000261560	T	0.01113	5.32	0.195	0.195	0.15151	Krueppel-associated box (3);	.	.	.	.	T	0.03564	0.0102	M	0.84219	2.685	0.09310	N	1	P;P	0.51449	0.945;0.859	B;P	0.51453	0.388;0.67	T	0.28202	-1.0051	8	0.87932	D	0	.	.	.	.	.	88;89	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	D	89	ENSP00000261560:E89D	ENSP00000261560:E89D	E	+	3	2	ZNF430	21008775	0.005000	0.15991	0.185000	0.23176	0.189000	0.23516	-0.665000	0.05286	0.300000	0.22699	0.306000	0.20318	GAG	-	ZNF430	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.418	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF430	HGNC	protein_coding	OTTHUMT00000463539.1	0	0	0	70	70	42	0.00	0.00	G	NM_025189		21216935	+1	23	20	31	27	tier1	no_errors	ENST00000261560	ensembl	human	known	74_37	missense	42.59	42.55	SNP	0.225	C	23	31
C4orf22	255119	genome.wustl.edu	37	4	81504291	81504291	+	Missense_Mutation	SNP	C	C	T	rs142731425		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr4:81504291C>T	ENST00000358105.3	+	3	336	c.287C>T	c.(286-288)aCg>aTg	p.T96M	C4orf22_ENST00000508675.1_Missense_Mutation_p.T96M|C4orf22_ENST00000512931.1_3'UTR	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22	96										NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						AATTTTCTGACGGCCCTGGCA	0.353													ENSG00000197826	C|||	1	0.000199681	0.0	0.0014	5008	,	,		13447	0.0		0.0	False		,,,				2504	0.0																0								C	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	81.0	80.0	80.0		287,287	1.8	1.0	4	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	C4orf22	NM_001206997.1,NM_152770.2	81,81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging	96/251,96/234	81504291	2,13004	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.287C>T	4.37:g.81504291C>T	ENSP00000350818:p.Thr96Met		E7EQ13|Q6ZQY4|Q8N4G9	Missense_Mutation	SNP	NULL	p.T96M	ENST00000358105.3	37	c.287	CCDS3587.1	4	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	3.828	-0.036334	0.07497	2.27E-4	1.16E-4	ENSG00000197826	ENST00000358105;ENST00000508675	T;T	0.30448	1.53;1.53	5.55	1.79	0.24919	.	0.190189	0.43110	N	0.000604	T	0.12092	0.0294	N	0.08118	0	0.26925	N	0.966598	B;B	0.20887	0.039;0.049	B;B	0.19391	0.021;0.025	T	0.16188	-1.0411	10	0.27082	T	0.32	.	3.2936	0.06958	0.5331:0.2648:0.0705:0.1316	.	96;96	E7EQ13;Q6V702	.;CD022_HUMAN	M	96	ENSP00000350818:T96M;ENSP00000425786:T96M	ENSP00000350818:T96M	T	+	2	0	C4orf22	81723315	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	1.547000	0.36190	0.171000	0.19730	-2.610000	0.00160	ACG	rs142731425	C4orf22	-	NULL		0.353	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf22	HGNC	protein_coding	OTTHUMT00000252629.2	0	0	0	44	44	103	0.00	0.00	C	NM_152770		81504291	+1	11	40	6	37	tier1	no_errors	ENST00000508675	ensembl	human	known	74_37	missense	61.11	51.95	SNP	1.000	T	11	6
CCDC22	28952	genome.wustl.edu	37	X	49106184	49106184	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:49106184C>A	ENST00000376227.3	+	16	1938	c.1768C>A	c.(1768-1770)Cag>Aag	p.Q590K		NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	590										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						CCTCGAGGAGCAGGTGAGGCC	0.637													ENSG00000101997																																					0													34.0	28.0	30.0					X																	49106184		2203	4300	6503	SO:0001583	missense	0			-	BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.1768C>A	X.37:g.49106184C>A	ENSP00000365401:p.Gln590Lys		A8K7G1	Missense_Mutation	SNP	pfam_DUF812	p.Q590K	ENST00000376227.3	37	c.1768	CCDS14322.1	X	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430492	0.83776	.	.	ENSG00000101997	ENST00000376227	.	.	.	5.24	5.24	0.73138	.	0.055533	0.64402	D	0.000001	T	0.75072	0.3800	L	0.60957	1.885	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.71794	-0.4485	9	0.25106	T	0.35	-19.5507	16.5457	0.84445	0.0:1.0:0.0:0.0	.	590	O60826	CCD22_HUMAN	K	590	.	ENSP00000365401:Q590K	Q	+	1	0	CCDC22	48993128	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	6.897000	0.75671	2.163000	0.67991	0.436000	0.28706	CAG	-	CCDC22	-	pfam_DUF812		0.637	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC22	HGNC	protein_coding	OTTHUMT00000060822.1	0	0	0	81	81	17	0.00	0.00	C	NM_014008		49106184	+1	31	4	49	13	tier1	no_errors	ENST00000376227	ensembl	human	known	74_37	missense	38.75	23.53	SNP	1.000	A	31	49
ANGEL2	90806	genome.wustl.edu	37	1	213168525	213168525	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:213168525A>G	ENST00000366962.3	-	9	1647	c.1493T>C	c.(1492-1494)gTt>gCt	p.V498A	ANGEL2_ENST00000540642.1_Missense_Mutation_p.V372A|ANGEL2_ENST00000544555.1_Missense_Mutation_p.V329A|ANGEL2_ENST00000360506.2_Missense_Mutation_p.V329A|ANGEL2_ENST00000535388.1_3'UTR|ANGEL2_ENST00000473303.1_5'UTR	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	498										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		AACCAAAGCAACTTCAGCTCC	0.343													ENSG00000174606																																					0													107.0	107.0	107.0					1																	213168525		2203	4300	6503	SO:0001583	missense	0			-	AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.1493T>C	1.37:g.213168525A>G	ENSP00000355929:p.Val498Ala		B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.V498A	ENST00000366962.3	37	c.1493	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	A	6.616	0.482042	0.12581	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642	T;D;D;T	0.95137	1.95;-3.62;-3.62;1.58	5.75	3.43	0.39272	Endonuclease/exonuclease/phosphatase (2);	0.376505	0.28442	N	0.015334	D	0.85687	0.5754	N	0.19112	0.55	0.09310	N	0.999998	B;B	0.16802	0.004;0.019	B;B	0.22152	0.012;0.038	T	0.69143	-0.5223	10	0.06625	T	0.88	-10.9649	6.1939	0.20540	0.6269:0.0:0.0714:0.3016	.	372;498	F5H476;Q5VTE6	.;ANGE2_HUMAN	A	498;329;329;372	ENSP00000355929:V498A;ENSP00000353696:V329A;ENSP00000443193:V329A;ENSP00000446124:V372A	ENSP00000353696:V329A	V	-	2	0	ANGEL2	211235148	0.001000	0.12720	0.977000	0.42913	0.935000	0.57460	0.728000	0.26013	0.446000	0.26666	-0.757000	0.03467	GTT	-	ANGEL2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase		0.343	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1	0	0	0	29	29	129	0.00	0.00	A	NM_144567		213168525	-1	12	51	29	103	tier1	no_errors	ENST00000366962	ensembl	human	known	74_37	missense	29.27	33.12	SNP	0.015	G	12	29
FXR2	9513	genome.wustl.edu	37	17	7496167	7496167	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr17:7496167G>A	ENST00000250113.7	-	14	1908	c.1574C>T	c.(1573-1575)tCt>tTt	p.S525F	SOX15_ENST00000570788.1_5'Flank|SOX15_ENST00000250055.2_5'Flank|SOX15_ENST00000538513.2_5'Flank|FXR2_ENST00000573057.1_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	525						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CTCTGGTTCAGACGTGTCCAA	0.602													ENSG00000129245																																					0													37.0	37.0	37.0					17																	7496167		1866	4118	5984	SO:0001583	missense	0			-	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1574C>T	17.37:g.7496167G>A	ENSP00000250113:p.Ser525Phe		B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,smart_KH_dom,pfscan_KH_dom_type_1	p.S525F	ENST00000250113.7	37	c.1574	CCDS45604.1	17	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803734	0.70682	.	.	ENSG00000129245	ENST00000250113	T	0.33438	1.41	5.57	5.57	0.84162	.	0.199418	0.44688	D	0.000437	T	0.36799	0.0980	N	0.19112	0.55	0.43364	D	0.995443	D	0.56746	0.977	P	0.56343	0.796	T	0.17137	-1.0379	10	0.72032	D	0.01	-0.0218	17.3985	0.87453	0.0:0.0:1.0:0.0	.	525	P51116	FXR2_HUMAN	F	525	ENSP00000250113:S525F	ENSP00000250113:S525F	S	-	2	0	FXR2	7436892	0.998000	0.40836	0.991000	0.47740	0.993000	0.82548	4.173000	0.58249	2.785000	0.95823	0.655000	0.94253	TCT	-	FXR2	-	pfam_Frag_X_MRP_fam		0.602	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	HGNC	protein_coding	OTTHUMT00000441084.1	0	0	0	22	22	58	0.00	0.00	G			7496167	-1	32	36	10	12	tier1	no_errors	ENST00000250113	ensembl	human	known	74_37	missense	76.19	75.00	SNP	0.997	A	32	10
PARL	55486	genome.wustl.edu	37	3	183551567	183551567	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr3:183551567G>A	ENST00000317096.4	-	8	935	c.875C>T	c.(874-876)cCa>cTa	p.P292L	PARL_ENST00000435888.1_Intron|PARL_ENST00000311101.5_Missense_Mutation_p.P242L	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	292					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.P292Q(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CCTCCCTTCTGGGATCTTAGT	0.468													ENSG00000175193																																					1	Substitution - Missense(1)	lung(1)											93.0	87.0	89.0					3																	183551567		2203	4300	6503	SO:0001583	missense	0			-	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.875C>T	3.37:g.183551567G>A	ENSP00000325421:p.Pro292Leu		Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	pfam_Peptidase_S54_rhomboid_dom	p.P292L	ENST00000317096.4	37	c.875	CCDS3248.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.296686	0.95574	.	.	ENSG00000175193	ENST00000317096;ENST00000311101	T;T	0.12984	2.63;2.63	5.54	5.54	0.83059	Peptidase S54, rhomboid domain (1);	0.000000	0.85682	D	0.000000	T	0.55401	0.1918	H	0.96576	3.845	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.998	T	0.70985	-0.4723	10	0.87932	D	0	-12.9779	19.8379	0.96666	0.0:0.0:1.0:0.0	.	242;292	Q9H300-2;Q9H300	.;PARL_HUMAN	L	292;242	ENSP00000325421:P292L;ENSP00000310676:P242L	ENSP00000310676:P242L	P	-	2	0	PARL	185034261	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.765000	0.95021	0.655000	0.94253	CCA	-	PARL	-	pfam_Peptidase_S54_rhomboid_dom		0.468	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARL	HGNC	protein_coding	OTTHUMT00000346465.1	0	0	0	30	30	73	0.00	0.00	G	NM_018622		183551567	-1	5	28	12	37	tier1	no_errors	ENST00000317096	ensembl	human	known	74_37	missense	29.41	43.08	SNP	1.000	A	5	12
ABCB10	23456	genome.wustl.edu	37	1	229667402	229667402	+	Silent	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:229667402C>T	ENST00000344517.4	-	7	1458	c.1416G>A	c.(1414-1416)gaG>gaA	p.E472E		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	472					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				GCAGCTTGGGCTCTCTCTCCA	0.517													ENSG00000135776																																					0													92.0	99.0	97.0					1																	229667402		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1416G>A	1.37:g.229667402C>T			Q13040|Q6P1Q8|Q9H3V0	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.E472	ENST00000344517.4	37	c.1416	CCDS1580.1	1																																																																																			-	ABCB10	-	superfamily_ABC1_TM_dom		0.517	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	HGNC	protein_coding	OTTHUMT00000095240.1	0	0	0	55	55	45	0.00	0.00	C	NM_012089		229667402	-1	23	12	35	32	tier1	no_errors	ENST00000344517	ensembl	human	known	74_37	silent	39.66	27.27	SNP	0.996	T	23	35
TRPV6	55503	genome.wustl.edu	37	7	142571440	142571440	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:142571440G>T	ENST00000359396.3	-	13	1794	c.1549C>A	c.(1549-1551)Ccc>Acc	p.P517T	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	517					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					AGCTCCTCGGGGTCCTCTGTC	0.587													ENSG00000165125																																					0													189.0	174.0	179.0					7																	142571440		2203	4300	6503	SO:0001583	missense	0			-	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1549C>A	7.37:g.142571440G>T	ENSP00000352358:p.Pro517Thr		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.P517T	ENST00000359396.3	37	c.1549	CCDS5874.1	7	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622553	0.46840	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	D	0.88818	-2.43	5.43	4.55	0.56014	Ion transport (1);	0.185881	0.47852	D	0.000203	D	0.90998	0.7169	M	0.76002	2.32	0.58432	D	0.999998	B	0.34349	0.45	P	0.45712	0.491	D	0.89031	0.3442	10	0.33940	T	0.23	-26.1853	13.4611	0.61227	0.0757:0.0:0.9243:0.0	.	517	Q9H1D0	TRPV6_HUMAN	T	517;349	ENSP00000352358:P517T	ENSP00000310825:P349T	P	-	1	0	TRPV6	142281562	1.000000	0.71417	0.990000	0.47175	0.347000	0.29111	5.406000	0.66357	1.273000	0.44346	0.655000	0.94253	CCC	-	TRPV6	-	pfam_Ion_trans_dom,tigrfam_TRP_channel		0.587	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	HGNC	protein_coding	OTTHUMT00000347662.1	0	0	0	26	26	91	0.00	0.00	G	NM_014274		142571440	-1	14	46	15	59	tier1	no_errors	ENST00000359396	ensembl	human	known	74_37	missense	48.28	43.81	SNP	1.000	T	14	15
MYO1E	4643	genome.wustl.edu	37	15	59470648	59470648	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr15:59470648C>A	ENST00000288235.4	-	19	2392	c.1993G>T	c.(1993-1995)Gac>Tac	p.D665Y		NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	665	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TGGTCGCTGTCCATGTTGACC	0.597													ENSG00000157483																																					0													110.0	88.0	95.0					15																	59470648		2191	4291	6482	SO:0001583	missense	0			-	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.1993G>T	15.37:g.59470648C>A	ENSP00000288235:p.Asp665Tyr		Q14778	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.D665Y	ENST00000288235.4	37	c.1993	CCDS32254.1	15	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795063	0.90453	.	.	ENSG00000157483	ENST00000288235	D	0.90444	-2.67	4.92	4.92	0.64577	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.97012	0.9024	H	0.97659	4.05	0.80722	D	1	D	0.61080	0.989	D	0.64595	0.927	D	0.98335	1.0535	10	0.72032	D	0.01	.	18.3153	0.90218	0.0:1.0:0.0:0.0	.	665	Q12965	MYO1E_HUMAN	Y	665	ENSP00000288235:D665Y	ENSP00000288235:D665Y	D	-	1	0	MYO1E	57257940	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.651000	0.83577	2.563000	0.86464	0.655000	0.94253	GAC	-	MYO1E	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.597	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1E	HGNC	protein_coding	OTTHUMT00000416024.1	0	0	0	53	53	64	0.00	0.00	C	NM_004998		59470648	-1	18	34	44	60	tier1	no_errors	ENST00000288235	ensembl	human	known	74_37	missense	29.03	36.17	SNP	1.000	A	18	44
MIB1	57534	genome.wustl.edu	37	18	19292022	19292022	+	Intron	SNP	A	A	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr18:19292022A>C	ENST00000578646.1	+	1	167				SNORA81_ENST00000516868.1_RNA			Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1						blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			GCATTATCACAAAAACCAAGA	0.398													ENSG00000252677																																					0																																										SO:0001627	intron_variant	0			-	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000578646.1:c.167+6938A>C	18.37:g.19292022A>C			B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	R	SNP	-	NULL	ENST00000578646.1	37	NULL		18																																																																																			-	SNORA81	-	-		0.398	MIB1-004	KNOWN	basic	processed_transcript	ENSG00000252677	RFAM	protein_coding	OTTHUMT00000445642.1	0	0	0	32	32	106	0.00	0.00	A	NM_020774		19292022	-1	9	47	16	82	tier1	no_errors	ENST00000516868	ensembl	human	novel	74_37	rna	36.00	36.43	SNP	0.991	C	9	16
PYGM	5837	genome.wustl.edu	37	11	64518806	64518806	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:64518806C>T	ENST00000164139.3	-	16	2358	c.1960G>A	c.(1960-1962)Gcc>Acc	p.A654T	PYGM_ENST00000462303.1_5'UTR|PYGM_ENST00000377432.3_Missense_Mutation_p.A566T	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	654					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTTTCTCGGCCAGTGAGACT	0.567													ENSG00000068976																																					0													76.0	72.0	73.0					11																	64518806		2201	4297	6498	SO:0001583	missense	0			-		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1960G>A	11.37:g.64518806C>T	ENSP00000164139:p.Ala654Thr		A0AVK1|A6NDY6	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.A654T	ENST00000164139.3	37	c.1960	CCDS8079.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.462864	0.96257	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.96334	-3.82;-3.98	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000019	D	0.98532	0.9510	M	0.93507	3.425	0.80722	D	1	P;D	0.71674	0.87;0.998	P;D	0.74023	0.885;0.982	D	0.99364	1.0918	10	0.87932	D	0	-15.6311	16.1723	0.81825	0.0:1.0:0.0:0.0	.	566;654	A6NDY6;P11217	.;PYGM_HUMAN	T	566;654;635	ENSP00000366650:A566T;ENSP00000164139:A654T	ENSP00000164139:A654T	A	-	1	0	PYGM	64275382	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.545000	0.82128	2.692000	0.91855	0.561000	0.74099	GCC	-	PYGM	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas		0.567	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	HGNC	protein_coding	OTTHUMT00000143254.2	0	0	0	23	23	100	0.00	0.00	C	NM_005609		64518806	-1	10	31	12	28	tier1	no_errors	ENST00000164139	ensembl	human	known	74_37	missense	45.45	52.54	SNP	1.000	T	10	12
NRP2	8828	genome.wustl.edu	37	2	206588537	206588537	+	Silent	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr2:206588537G>T	ENST00000357785.5	+	5	724	c.693G>T	c.(691-693)ggG>ggT	p.G231G	NRP2_ENST00000540841.1_Silent_p.G231G|NRP2_ENST00000412873.2_Silent_p.G231G|NRP2_ENST00000357118.4_Silent_p.G231G|NRP2_ENST00000355117.4_Silent_p.G231G|NRP2_ENST00000540178.1_Silent_p.G231G|NRP2_ENST00000417189.1_Silent_p.G231G|NRP2_ENST00000272849.3_Silent_p.G231G|NRP2_ENST00000360409.3_Silent_p.G231G			Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						AGTACTGTGGGACCAAAACAC	0.502													ENSG00000118257																																					0													108.0	94.0	99.0					2																	206588537		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.693G>T	2.37:g.206588537G>T			B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	pirsf_Neuropilin,pfam_CUB_dom,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.G231	ENST00000357785.5	37	c.693	CCDS46496.1	2																																																																																			-	NRP2	-	pirsf_Neuropilin,pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.502	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1	0	0	0	60	60	134	0.00	0.00	G			206588537	+1	11	58	25	69	tier1	no_errors	ENST00000360409	ensembl	human	known	74_37	silent	30.56	45.67	SNP	0.962	T	11	25
IL2RG	3561	genome.wustl.edu	37	X	70328508	70328508	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:70328508G>C	ENST00000374202.2	-	6	886	c.795C>G	c.(793-795)atC>atG	p.I265M	IL2RG_ENST00000456850.2_Missense_Mutation_p.I75M|IL2RG_ENST00000374188.3_Intron|CXorf65_ENST00000374251.5_5'Flank	NM_000206.2	NP_000197.1	P31785	IL2RG_HUMAN	interleukin 2 receptor, gamma	265					immune response (GO:0006955)|interleukin-2-mediated signaling pathway (GO:0038110)|interleukin-4-mediated signaling pathway (GO:0035771)|interleukin-7-mediated signaling pathway (GO:0038111)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|interleukin-2 binding (GO:0019976)			breast(1)|endometrium(3)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	15	Renal(35;0.156)				Aldesleukin(DB00041)|Denileukin diftitox(DB00004)	AGCCAACAGAGATAACCACGG	0.448									Severe Combined Immunodeficiency, X-linked				ENSG00000147168																																					0													52.0	42.0	46.0					X																	70328508		2201	4292	6493	SO:0001583	missense	0	Familial Cancer Database	Agammaglobulinemia, Swiss Type	-	D11086	CCDS14406.1	Xq13	2014-09-17	2010-06-24		ENSG00000147168	ENSG00000147168		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6010	protein-coding gene	gene with protein product		308380	"""severe combined immunodeficiency"", ""combined immunodeficiency, X-linked"""	SCIDX1, IMD4, CIDX		1631559, 7883965	Standard	NM_000206		Approved	CD132	uc004dyw.2	P31785	OTTHUMG00000021787	ENST00000374202.2:c.795C>G	X.37:g.70328508G>C	ENSP00000363318:p.Ile265Met		Q5FC12	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.I265M	ENST00000374202.2	37	c.795	CCDS14406.1	X	.	.	.	.	.	.	.	.	.	.	G	13.46	2.242340	0.39598	.	.	ENSG00000147168	ENST00000374202;ENST00000456850	D;D	0.98075	-4.05;-4.7	4.87	3.01	0.34805	.	0.359502	0.29572	N	0.011771	D	0.97365	0.9138	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.99;0.999	P;D	0.63488	0.901;0.915	D	0.95762	0.8801	10	0.46703	T	0.11	-5.1941	4.3208	0.11016	0.1178:0.0:0.6555:0.2267	.	75;265	Q5FC12;P31785	.;IL2RG_HUMAN	M	265;75	ENSP00000363318:I265M;ENSP00000388967:I75M	ENSP00000363318:I265M	I	-	3	3	IL2RG	70245233	0.420000	0.25457	0.987000	0.45799	0.342000	0.28953	-0.147000	0.10234	2.240000	0.73641	0.600000	0.82982	ATC	-	IL2RG	-	NULL		0.448	IL2RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RG	HGNC	protein_coding	OTTHUMT00000057102.2	0	0	0	20	20	152	0.00	0.00	G			70328508	-1	9	52	17	98	tier1	no_errors	ENST00000374202	ensembl	human	known	74_37	missense	34.62	34.44	SNP	0.918	C	9	17
PAPOLB	56903	genome.wustl.edu	37	7	4901098	4901098	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:4901098A>G	ENST00000404991.1	-	1	527	c.341T>C	c.(340-342)aTt>aCt	p.I114T	RADIL_ENST00000399583.3_Intron|RADIL_ENST00000536091.1_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	114					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		CAAGGCGTCAATATCTGCGCC	0.423													ENSG00000218823																																					0													85.0	85.0	85.0					7																	4901098		2091	4258	6349	SO:0001583	missense	0			-	AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.341T>C	7.37:g.4901098A>G	ENSP00000384700:p.Ile114Thr		Q75LH1|Q8NE14	Missense_Mutation	SNP	pfam_PolA_pol_cen_dom,pfam_PolA_pol_R-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.I114T	ENST00000404991.1	37	c.341		7	.	.	.	.	.	.	.	.	.	.	A	12.21	1.870839	0.33069	.	.	ENSG00000218823	ENST00000404991	.	.	.	3.98	3.98	0.46160	.	.	.	.	.	D	0.85353	0.5677	H	0.97635	4.045	0.80722	D	1	D	0.59357	0.985	P	0.61132	0.884	D	0.89466	0.3740	8	0.87932	D	0	.	11.4944	0.50400	1.0:0.0:0.0:0.0	.	115	A4D1Z6	.	T	114	.	ENSP00000384700:I114T	I	-	2	0	PAPOLB	4867624	1.000000	0.71417	0.883000	0.34634	0.091000	0.18340	8.925000	0.92832	2.044000	0.60594	0.477000	0.44152	ATT	-	PAPOLB	-	pfam_PolA_pol_cen_dom,pfam_Nucleotidyltransferase,pirsf_PolyA_polymerase		0.423	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	PAPOLB	HGNC	protein_coding	OTTHUMT00000323797.1	0	0	0	35	35	96	0.00	0.00	A	NM_020144		4901098	-1	5	43	10	52	tier1	no_errors	ENST00000404991	ensembl	human	known	74_37	missense	33.33	45.26	SNP	1.000	G	5	10
ATRX	546	genome.wustl.edu	37	X	76939577	76939577	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:76939577G>A	ENST00000373344.5	-	9	1385	c.1171C>T	c.(1171-1173)Cag>Tag	p.Q391*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.Q353*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	391					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GCCTTAAGCTGACGTAATTTT	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											198.0	205.0	203.0					X																	76939577		2203	4296	6499	SO:0001587	stop_gained	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1171C>T	X.37:g.76939577G>A	ENSP00000362441:p.Gln391*		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q391*	ENST00000373344.5	37	c.1171	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	g	38	6.843642	0.97881	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	4.91	4.91	0.64330	.	0.139211	0.49305	D	0.000143	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-2.3421	17.355	0.87333	0.0:0.0:1.0:0.0	.	.	.	.	X	391;353;347	.	ENSP00000362441:Q391X	Q	-	1	0	ATRX	76826233	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.152000	0.71812	2.022000	0.59522	0.509000	0.49947	CAG	-	ATRX	-	NULL		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	51	51	155	0.00	0.00	G	NM_000489		76939577	-1	12	60	16	51	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	42.86	54.05	SNP	1.000	A	12	16
INTS5	80789	genome.wustl.edu	37	11	62415487	62415487	+	Silent	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:62415487G>A	ENST00000330574.2	-	2	2117	c.2065C>T	c.(2065-2067)Ctg>Ttg	p.L689L	GANAB_ENST00000356638.3_5'Flank|GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000346178.4_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	689					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						AGCAGCTGCAGGACAGCCTTG	0.567													ENSG00000185085																																					0													73.0	75.0	74.0					11																	62415487		2202	4299	6501	SO:0001819	synonymous_variant	0			-	AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.2065C>T	11.37:g.62415487G>A			Q8N6W5|Q9C0G5	Silent	SNP	NULL	p.L689	ENST00000330574.2	37	c.2065	CCDS8027.1	11																																																																																			-	INTS5	-	NULL		0.567	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS5	HGNC	protein_coding	OTTHUMT00000395327.1	0	0	0	40	40	64	0.00	0.00	G	NM_030628		62415487	-1	8	20	26	38	tier1	no_errors	ENST00000330574	ensembl	human	known	74_37	silent	23.53	34.48	SNP	0.999	A	8	26
XKR4	114786	genome.wustl.edu	37	8	56436473	56436473	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr8:56436473G>A	ENST00000327381.6	+	3	1740	c.1640G>A	c.(1639-1641)cGg>cAg	p.R547Q	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	547						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			AGCACCCTACGGTCCATCTCC	0.587													ENSG00000206579																																					0													67.0	68.0	67.0					8																	56436473		2203	4300	6503	SO:0001583	missense	0			-	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1640G>A	8.37:g.56436473G>A	ENSP00000328326:p.Arg547Gln		Q96PZ8	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.R547Q	ENST00000327381.6	37	c.1640	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289843	0.59976	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.85258	-1.96	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.90130	0.6916	L	0.42245	1.32	0.58432	D	0.999996	D	0.89917	1.0	D	0.71656	0.974	D	0.89496	0.3760	10	0.54805	T	0.06	-0.557	20.3931	0.98965	0.0:0.0:1.0:0.0	.	547	Q5GH76	XKR4_HUMAN	Q	547	ENSP00000328326:R547Q	ENSP00000328326:R547Q	R	+	2	0	XKR4	56599027	1.000000	0.71417	0.954000	0.39281	0.018000	0.09664	8.062000	0.89475	2.824000	0.97209	0.655000	0.94253	CGG	-	XKR4	-	NULL		0.587	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	0	0	0	44	44	44	0.00	0.00	G	NM_052898		56436473	+1	9	15	25	37	tier1	no_errors	ENST00000327381	ensembl	human	known	74_37	missense	26.47	28.85	SNP	1.000	A	9	25
PPP2R3A	5523	genome.wustl.edu	37	3	135806749	135806749	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr3:135806749G>T	ENST00000264977.3	+	9	3430	c.2813G>T	c.(2812-2814)aGg>aTg	p.R938M	PPP2R3A_ENST00000334546.2_Missense_Mutation_p.R317M|RP11-305O4.3_ENST00000608883.1_RNA|PPP2R3A_ENST00000490467.1_Missense_Mutation_p.R202M	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	938					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ATTATTGAAAGGATATTCTCT	0.313													ENSG00000073711																																					0													153.0	153.0	153.0					3																	135806749		2203	4300	6503	SO:0001583	missense	0			-	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.2813G>T	3.37:g.135806749G>T	ENSP00000264977:p.Arg938Met		A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.R938M	ENST00000264977.3	37	c.2813	CCDS3087.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.110229	0.94292	.	.	ENSG00000073711	ENST00000264977;ENST00000490467;ENST00000334546	T;T;T	0.56611	0.45;0.45;0.45	5.98	5.98	0.97165	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83078	0.5176	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.87890	0.2683	10	0.87932	D	0	.	19.4402	0.94817	0.0:0.0:1.0:0.0	.	317;938	Q06190-2;Q06190	.;P2R3A_HUMAN	M	938;202;317	ENSP00000264977:R938M;ENSP00000419344:R202M;ENSP00000334748:R317M	ENSP00000264977:R938M	R	+	2	0	PPP2R3A	137289439	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.543000	0.98089	2.838000	0.97847	0.591000	0.81541	AGG	-	PPP2R3A	-	NULL		0.313	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3A	HGNC	protein_coding	OTTHUMT00000357232.1	0	0	0	46	46	97	0.00	0.00	G	NM_002718		135806749	+1	17	41	21	63	tier1	no_errors	ENST00000264977	ensembl	human	known	74_37	missense	44.74	39.42	SNP	1.000	T	17	21
PEX5L	51555	genome.wustl.edu	37	3	179525571	179525571	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr3:179525571G>A	ENST00000467460.1	-	14	1897	c.1567C>T	c.(1567-1569)Cgc>Tgc	p.R523C	PEX5L_ENST00000465751.1_Missense_Mutation_p.R499C|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000485199.1_Missense_Mutation_p.R488C|PEX5L_ENST00000263962.8_Missense_Mutation_p.R521C|PEX5L_ENST00000472994.1_Missense_Mutation_p.R464C|PEX5L_ENST00000464614.1_Missense_Mutation_p.R415C|PEX5L_ENST00000392649.3_Missense_Mutation_p.R415C|PEX5L_ENST00000468741.1_Missense_Mutation_p.R331C|PEX5L_ENST00000476138.1_Missense_Mutation_p.R480C	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	523					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCCTCGCTGCGGTCTCCGTTC	0.532													ENSG00000114757																																					0													122.0	128.0	126.0					3																	179525571		2203	4300	6503	SO:0001583	missense	0			-	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1567C>T	3.37:g.179525571G>A	ENSP00000419975:p.Arg523Cys		B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R523C	ENST00000467460.1	37	c.1567	CCDS3236.1	3	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937309	0.92458	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	T;T;T;T;T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43	6.07	6.07	0.98685	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.92064	0.7485	M	0.92784	3.345	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.91;0.91;0.997;0.998;0.997;0.999	D	0.93172	0.6567	10	0.87932	D	0	-13.8905	16.059	0.80826	0.0:0.1332:0.8668:0.0	.	464;499;415;521;488;523	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	C	523;521;488;521;415;331;480;411;464;415;499	ENSP00000419975:R523C;ENSP00000263962:R521C;ENSP00000418440:R488C;ENSP00000376420:R415C;ENSP00000418665:R331C;ENSP00000420555:R480C;ENSP00000418054:R464C;ENSP00000417270:R415C;ENSP00000419348:R499C	ENSP00000263962:R521C	R	-	1	0	PEX5L	181008265	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.929000	0.87595	2.890000	0.99128	0.585000	0.79938	CGC	-	PEX5L	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.532	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	HGNC	protein_coding	OTTHUMT00000348577.1	0	0	0	27	27	38	0.00	0.00	G	NM_016559		179525571	-1	7	9	29	44	tier1	no_errors	ENST00000467460	ensembl	human	known	74_37	missense	19.44	16.98	SNP	1.000	A	7	29
C2orf74	339804	genome.wustl.edu	37	2	61391639	61391639	+	Nonsense_Mutation	SNP	C	C	T	rs376938479		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr2:61391639C>T	ENST00000432605.1	+	4	562	c.562C>T	c.(562-564)Cga>Tga	p.R188*	C2orf74_ENST00000426997.1_Nonsense_Mutation_p.R109*|RP11-493E12.1_ENST00000605902.1_lincRNA	NM_001143959.1	NP_001137431.1	A8MZ97	CB074_HUMAN	chromosome 2 open reading frame 74	188						integral component of membrane (GO:0016021)				endometrium(1)	1						AAGCTATACTCGAGAACATAA	0.373													ENSG00000237651																																					0													110.0	87.0	94.0					2																	61391639		692	1591	2283	SO:0001587	stop_gained	0			-			2p15	2012-08-06			ENSG00000237651	ENSG00000237651			34439	protein-coding gene	gene with protein product							Standard	NM_001143959		Approved	LOC339804	uc010ypm.1	A8MZ97		ENST00000432605.1:c.562C>T	2.37:g.61391639C>T	ENSP00000402915:p.Arg188*		C9JP62	Nonsense_Mutation	SNP	NULL	p.R188*	ENST00000432605.1	37	c.562		2	.	.	.	.	.	.	.	.	.	.	C	5.261	0.233666	0.09969	.	.	ENSG00000237651	ENST00000426997;ENST00000432605	.	.	.	4.83	-0.768	0.11013	.	.	.	.	.	.	.	.	.	.	.	0.20764	N	0.999856	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9965	3.2633	0.06856	0.4698:0.3044:0.1386:0.0872	.	.	.	.	X	109;188	.	ENSP00000398725:R109X	R	+	1	2	C2orf74	61245143	0.008000	0.16893	0.001000	0.08648	0.535000	0.34838	-0.084000	0.11268	0.014000	0.14944	-1.409000	0.01127	CGA	-	C2orf74	-	NULL		0.373	C2orf74-202	KNOWN	basic|appris_principal	protein_coding	C2orf74	HGNC	protein_coding		0	0	0	39	39	124	0.00	0.00	C	NM_001143959		61391639	+1	7	55	21	105	tier1	no_errors	ENST00000432605	ensembl	human	known	74_37	nonsense	25.00	34.38	SNP	0.001	T	7	21
FANCB	2187	genome.wustl.edu	37	X	14862776	14862776	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:14862776T>A	ENST00000324138.3	-	8	2167	c.2014A>T	c.(2014-2016)Atg>Ttg	p.M672L	FANCB_ENST00000398334.1_Missense_Mutation_p.M672L	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	672					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					CACACCTTCATTGAATTCAGG	0.378								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				ENSG00000181544																																					0													77.0	76.0	76.0					X																	14862776		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.2014A>T	X.37:g.14862776T>A	ENSP00000326819:p.Met672Leu		B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	NULL	p.M672L	ENST00000324138.3	37	c.2014	CCDS14161.1	X	.	.	.	.	.	.	.	.	.	.	T	6.287	0.420975	0.11928	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.5	-6.54	0.01860	.	1.054140	0.07306	N	0.874936	T	0.36248	0.0960	L	0.40543	1.245	0.09310	N	1	B	0.24920	0.114	B	0.20955	0.032	T	0.30736	-0.9968	9	0.51188	T	0.08	0.1749	13.0205	0.58784	0.1083:0.672:0.0:0.2197	.	672	Q8NB91	FANCB_HUMAN	L	672	.	ENSP00000326819:M672L	M	-	1	0	FANCB	14772697	0.318000	0.24598	0.000000	0.03702	0.015000	0.08874	-0.280000	0.08468	-1.543000	0.01723	-0.368000	0.07277	ATG	-	FANCB	-	NULL		0.378	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	0	0	0	64	64	97	0.00	0.00	T	NM_152633		14862776	-1	14	31	36	76	tier1	no_errors	ENST00000324138	ensembl	human	known	74_37	missense	28.00	28.97	SNP	0.000	A	14	36
MTHFSD	64779	genome.wustl.edu	37	16	86575760	86575760	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr16:86575760T>A	ENST00000360900.6	-	6	527	c.502A>T	c.(502-504)Atg>Ttg	p.M168L	MTHFSD_ENST00000546093.1_Missense_Mutation_p.M5L|MTHFSD_ENST00000381214.5_Missense_Mutation_p.M168L|MTHFSD_ENST00000543303.2_Missense_Mutation_p.M167L|MTHFSD_ENST00000322911.6_Missense_Mutation_p.M167L	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	168							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						ACGGCGCCCATGGATACCATC	0.577													ENSG00000103248																																					0													77.0	76.0	76.0					16																	86575760		1994	4175	6169	SO:0001583	missense	0			-	AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.502A>T	16.37:g.86575760T>A	ENSP00000354152:p.Met168Leu		A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Missense_Mutation	SNP	pfam_FTHF_cligase,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.M168L	ENST00000360900.6	37	c.502	CCDS54047.1	16	.	.	.	.	.	.	.	.	.	.	T	11.06	1.526910	0.27299	.	.	ENSG00000103248	ENST00000543303;ENST00000381214;ENST00000360900;ENST00000322911;ENST00000546093	T;T;T;T	0.17528	2.67;2.67;2.67;2.27	5.6	4.44	0.53790	5-formyltetrahydrofolate cyclo-ligase-like domain (1);	0.069984	0.85682	D	0.000000	T	0.11836	0.0288	N	0.20986	0.625	0.37426	D	0.913827	B;B;B;B;B	0.17465	0.002;0.022;0.007;0.002;0.002	B;B;B;B;B	0.21708	0.022;0.036;0.009;0.011;0.007	T	0.14090	-1.0485	10	0.29301	T	0.29	-12.0177	10.8492	0.46761	0.1411:0.0:0.0:0.8589	.	168;167;5;168;167	E9PAM1;B7ZLC0;B3KUB0;Q2M296;Q2M296-2	.;.;.;MTHSD_HUMAN;.	L	166;168;168;167;5	ENSP00000370612:M168L;ENSP00000354152:M168L;ENSP00000326777:M167L;ENSP00000438761:M5L	ENSP00000326777:M167L	M	-	1	0	MTHFSD	85133261	1.000000	0.71417	0.981000	0.43875	0.341000	0.28922	5.484000	0.66844	2.111000	0.64477	0.533000	0.62120	ATG	-	MTHFSD	-	pfam_FTHF_cligase		0.577	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTHFSD	HGNC	protein_coding	OTTHUMT00000432182.1	0	0	0	15	15	37	0.00	0.00	T	NM_022764		86575760	-1	10	18	8	21	tier1	no_errors	ENST00000360900	ensembl	human	known	74_37	missense	55.56	46.15	SNP	0.994	A	10	8
TPTE2P5	100616668	genome.wustl.edu	37	13	41429945	41429945	+	RNA	SNP	C	C	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr13:41429945C>A	ENST00000432905.1	-	0	0									transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 5																		AGAAACTGCACGACTTCCTAA	0.348													ENSG00000168852																																					0																																												0			-			13q14.11	2012-06-20			ENSG00000168852	ENSG00000168852			42356	pseudogene	pseudogene							Standard	NR_038258		Approved		uc001uxo.2		OTTHUMG00000016779		13.37:g.41429945C>A				R	SNP	-	NULL	ENST00000432905.1	37	NULL		13																																																																																			-	TPTE2P5	-	-		0.348	TPTE2P5-003	KNOWN	basic	processed_transcript	TPTE2P5	HGNC	pseudogene	OTTHUMT00000044650.1	0	0	0	53	53	94	0.00	0.00	C			41429945	-1	35	75	80	161	tier1	no_errors	ENST00000379515	ensembl	human	known	74_37	rna	30.43	31.65	SNP	0.334	A	35	80
SND1	27044	genome.wustl.edu	37	7	127721533	127721533	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:127721533A>C	ENST00000354725.3	+	18	2284	c.2090A>C	c.(2089-2091)tAc>tCc	p.Y697S	MIR593_ENST00000384856.1_RNA	NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	697					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						CTGCACTTCTACGTGCAGGAT	0.622													ENSG00000197157																																					0													117.0	82.0	94.0					7																	127721533		2203	4300	6503	SO:0001583	missense	0			-		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2090A>C	7.37:g.127721533A>C	ENSP00000346762:p.Tyr697Ser		Q13122|Q96AG0	Missense_Mutation	SNP	pfam_Staphylococal_nuclease_OB-fold,pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Staphylococal_nuclease_OB-fold,smart_Tudor,pirsf_Silence_cplx_Nase-comp_TudorSN,pfscan_Tudor,pfscan_Staphylococal_nuclease_OB-fold	p.Y697S	ENST00000354725.3	37	c.2090	CCDS34747.1	7	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002016	0.74932	.	.	ENSG00000197157	ENST00000354725;ENST00000438400;ENST00000486037	T;T	0.13089	2.62;2.62	5.54	5.54	0.83059	Maternal tudor protein (1);	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	M	0.70275	2.135	0.58432	D	0.999999	D	0.62365	0.991	D	0.76071	0.987	T	0.03278	-1.1053	10	0.39692	T	0.17	-12.9419	13.9049	0.63828	1.0:0.0:0.0:0.0	.	697	Q7KZF4	SND1_HUMAN	S	697;687;183	ENSP00000346762:Y697S;ENSP00000419327:Y183S	ENSP00000346762:Y697S	Y	+	2	0	SND1	127508769	1.000000	0.71417	0.962000	0.40283	0.991000	0.79684	6.740000	0.74832	2.234000	0.73211	0.459000	0.35465	TAC	-	SND1	-	pfam_Tudor,pirsf_Silence_cplx_Nase-comp_TudorSN		0.622	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SND1	HGNC	protein_coding	OTTHUMT00000349148.1	0	0	0	32	32	64	0.00	0.00	A	NM_014390		127721533	+1	10	24	15	47	tier1	no_errors	ENST00000354725	ensembl	human	known	74_37	missense	40.00	33.80	SNP	0.997	C	10	15
SERPINF2	5345	genome.wustl.edu	37	17	1657814	1657814	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr17:1657814G>A	ENST00000324015.3	+	10	1539	c.1462G>A	c.(1462-1464)Ggc>Agc	p.G488S	SERPINF2_ENST00000450523.2_Missense_Mutation_p.G424S|SERPINF2_ENST00000382061.4_Missense_Mutation_p.G488S	NM_000934.3	NP_000925.2	P08697	A2AP_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2	488					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of proteolysis (GO:0030162)|response to organic substance (GO:0010033)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Ocriplasmin(DB08888)	CCCCCAGTTTGGCAGCCCCAA	0.602													ENSG00000167711																																					0													42.0	48.0	46.0					17																	1657814		2203	4300	6503	SO:0001583	missense	0			-	D00174	CCDS11011.1, CCDS54064.1	17p13.3	2014-02-18	2005-08-18		ENSG00000167711	ENSG00000167711		"""Serine (or cysteine) peptidase inhibitors"""	9075	protein-coding gene	gene with protein product	"""alpha-2-plasmin inhibitor"", ""alpha-2-antiplasmin"""	613168	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2"""	PLI		3416655, 24172014	Standard	NM_000934		Approved	API, ALPHA-2-PI, A2AP, AAP	uc002ftk.1	P08697	OTTHUMG00000090552	ENST00000324015.3:c.1462G>A	17.37:g.1657814G>A	ENSP00000321853:p.Gly488Ser		B4E1B7|Q8N5U7|Q9UCG2|Q9UCG3	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.G488S	ENST00000324015.3	37	c.1462	CCDS11011.1	17	.	.	.	.	.	.	.	.	.	.	G	0.960	-0.703642	0.03255	.	.	ENSG00000167711	ENST00000324015;ENST00000450523;ENST00000382061	D;D;D	0.83914	-1.75;-1.78;-1.75	5.5	-1.51	0.08664	.	0.894418	0.09736	N	0.762503	T	0.52629	0.1746	N	0.01705	-0.755	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.06405	0.002;0.002	T	0.42916	-0.9423	9	.	.	.	.	2.5552	0.04758	0.3777:0.3601:0.1536:0.1087	.	424;488	B4E1B7;P08697	.;A2AP_HUMAN	S	488;424;488	ENSP00000321853:G488S;ENSP00000403877:G424S;ENSP00000371493:G488S	.	G	+	1	0	SERPINF2	1604564	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.152000	0.16302	-0.154000	0.11118	-1.240000	0.01540	GGC	-	SERPINF2	-	NULL		0.602	SERPINF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINF2	HGNC	protein_coding	OTTHUMT00000207078.3	0	0	1	18	18	105	0.00	0.93	G	NM_000934		1657814	+1	11	60	2	25	tier1	no_errors	ENST00000324015	ensembl	human	known	74_37	missense	84.62	70.59	SNP	0.000	A	11	2
CRAT	1384	genome.wustl.edu	37	9	131871486	131871486	+	Intron	SNP	T	T	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr9:131871486T>A	ENST00000318080.2	-	2	322				PPP2R4_ENST00000357197.4_5'Flank|CRAT_ENST00000464290.1_Intron|PPP2R4_ENST00000393370.2_5'Flank|PPP2R4_ENST00000337738.1_5'Flank|PPP2R4_ENST00000348141.5_5'Flank|CRAT_ENST00000393384.3_Intron|AL158151.2_ENST00000408594.1_RNA|PPP2R4_ENST00000358994.4_5'Flank|PPP2R4_ENST00000347048.4_5'Flank|PPP2R4_ENST00000355007.3_5'Flank|PPP2R4_ENST00000452489.2_5'Flank	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase						carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	ATCGTTTTGATGAGGGAAAAC	0.502											OREG0003931	type=REGULATORY REGION|Gene=CRAT|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	ENSG00000095321																																					0																																										SO:0001627	intron_variant	0			-	X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.28-1130A>T	9.37:g.131871486T>A		1591	Q5T952|Q9BW16	Missense_Mutation	SNP	NULL	p.H33L	ENST00000318080.2	37	c.98	CCDS6919.1	9																																																																																			-	CRAT	-	NULL		0.502	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	HGNC	protein_coding	OTTHUMT00000253700.1	0	0	0	17	17	108	0.00	0.00	T			131871486	-1	10	38	24	77	tier1	no_errors	ENST00000441796	ensembl	human	known	74_37	missense	29.41	32.76	SNP	0.001	A	10	24
IGDCC3	9543	genome.wustl.edu	37	15	65628224	65628224	+	Silent	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr15:65628224G>A	ENST00000327987.4	-	3	731	c.480C>T	c.(478-480)tgC>tgT	p.C160C	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	160	Ig-like C2-type 2.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CATGGATTTGGCACTGGAAGC	0.577													ENSG00000174498																																					0													137.0	121.0	127.0					15																	65628224		2201	4299	6500	SO:0001819	synonymous_variant	0			-	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.480C>T	15.37:g.65628224G>A			O95215	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C160	ENST00000327987.4	37	c.480	CCDS10205.1	15																																																																																			-	IGDCC3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.577	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	0	0	0	33	33	104	0.00	0.00	G	NM_004884		65628224	-1	12	26	19	57	tier1	no_errors	ENST00000327987	ensembl	human	known	74_37	silent	38.71	31.33	SNP	1.000	A	12	19
TMTC3	160418	genome.wustl.edu	37	12	88589095	88589095	+	Frame_Shift_Del	DEL	A	A	-	rs533472310		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr12:88589095delA	ENST00000266712.6	+	14	2634	c.2414delA	c.(2413-2415)gaafs	p.E805fs		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	806					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						CCACATGAAGAATATATTCAG	0.348													ENSG00000139324																																					0													75.0	79.0	77.0					12																	88589095		2203	4298	6501	SO:0001589	frameshift_variant	0					CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.2414delA	12.37:g.88589095delA	ENSP00000266712:p.Glu805fs		Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Frame_Shift_Del	DEL	pfam_TPR_2,pfam_TPR_1,pfam_DUF1736,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E805fs	ENST00000266712.6	37	c.2414	CCDS9032.1	12																																																																																				TMTC3	-	NULL		0.348	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC3	HGNC	protein_coding	OTTHUMT00000406421.1	0	0	0	33	33	57	0.00	0.00	A	NM_181783		88589095	+1	4	9	15	59	tier1	no_errors	ENST00000266712	ensembl	human	known	74_37	frame_shift_del	21.05	13.24	DEL	1.000	-	4	15
TNXB	7148	genome.wustl.edu	37	6	32023775	32023775	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr6:32023775C>T	ENST00000375244.3	-	24	8521	c.8320G>A	c.(8320-8322)Gac>Aac	p.D2774N	TNXB_ENST00000375247.2_Missense_Mutation_p.D2774N			P22105	TENX_HUMAN	tenascin XB	2832	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGCCGCCCGTCCCTGTCCTTG	0.657													ENSG00000168477																																					0													65.0	71.0	69.0					6																	32023775		1284	2558	3842	SO:0001583	missense	0			-	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8320G>A	6.37:g.32023775C>T	ENSP00000364393:p.Asp2774Asn		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.D2774N	ENST00000375244.3	37	c.8320		6	.	.	.	.	.	.	.	.	.	.	C	15.90	2.968721	0.53614	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.56103	0.48;0.48	5.0	3.11	0.35812	.	.	.	.	.	T	0.25382	0.0617	L	0.59967	1.855	0.23309	N	0.997933	B	0.14805	0.011	B	0.15052	0.012	T	0.17319	-1.0373	9	0.26408	T	0.33	.	7.7348	0.28808	0.1593:0.7535:0.0:0.0873	.	2774	P22105-3	.	N	2774	ENSP00000364393:D2774N;ENSP00000364396:D2774N	ENSP00000364393:D2774N	D	-	1	0	TNXB	32131753	0.012000	0.17670	0.988000	0.46212	0.958000	0.62258	1.021000	0.30040	1.070000	0.40811	0.456000	0.33151	GAC	-	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.657	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	0	0	0	55	55	19	0.00	0.00	C	NM_019105		32023775	-1	67	2	42	5	tier1	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	61.47	28.57	SNP	0.925	T	67	42
CTPS2	56474	genome.wustl.edu	37	X	16609019	16609020	+	Intron	INS	-	-	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:16609019_16609020insA	ENST00000443824.1	-	18	2435				CTPS2_ENST00000359276.4_Intron|CTPS2_ENST00000380241.3_Intron|CTPS2_ENST00000483053.1_5'UTR	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2						'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					TAGCAAGGTATAAAAAAAAAAC	0.327													ENSG00000047230																																					0																																										SO:0001627	intron_variant	0				AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.1692-34->T	X.37:g.16609029_16609029dupA			B3KWM2|Q9BRI0|Q9H809|Q9H8K9	R	INS	-	NULL	ENST00000443824.1	37	NULL	CCDS14175.1	X																																																																																				CTPS2	-	-		0.327	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	HGNC	protein_coding	OTTHUMT00000055906.1	0	0	1	25	25	135	0.00	0.74	-	NM_019857		16609020	-1	3	9	22	121	tier1	no_errors	ENST00000483053	ensembl	human	known	74_37	rna	12.00	6.92	INS	0.000:0.000	A	3	22
HSPG2	3339	genome.wustl.edu	37	1	22149775	22149775	+	3'UTR	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:22149775G>A	ENST00000374695.3	-	0	13289				LDLRAD2_ENST00000543870.1_Intron|HSPG2_ENST00000486901.1_5'UTR|LDLRAD2_ENST00000344642.2_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2						angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGGCTGGGGCGTGGCCCGGGA	0.607													ENSG00000142798																																					0													2.0	3.0	2.0					1																	22149775		1403	3201	4604	SO:0001624	3_prime_UTR_variant	0			-	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.*34C>T	1.37:g.22149775G>A			Q16287|Q5SZI3|Q9H3V5	R	SNP	-	NULL	ENST00000374695.3	37	NULL	CCDS30625.1	1																																																																																			-	HSPG2	-	-		0.607	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	0	0	0	26	26	8	0.00	0.00	G	NM_005529		22149775	-1	5	0	38	6	tier1	no_errors	ENST00000486901	ensembl	human	known	74_37	rna	11.63	0.00	SNP	0.001	A	5	38
KRTAP5-5	439915	genome.wustl.edu	37	11	1651597	1651597	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:1651597C>T	ENST00000399676.2	+	1	565	c.527C>T	c.(526-528)tCc>tTc	p.S176F		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	176	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.Y192_P201delYCCQSSCCKP(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCTGCCAGTCCAGCTGCTGT	0.617													ENSG00000185940																																					1	Deletion - In frame(1)	ovary(1)											79.0	94.0	89.0					11																	1651597		2201	4298	6499	SO:0001583	missense	0			-	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.527C>T	11.37:g.1651597C>T	ENSP00000382584:p.Ser176Phe		A8MWN2	Missense_Mutation	SNP	NULL	p.S176F	ENST00000399676.2	37	c.527	CCDS41592.1	11	.	.	.	.	.	.	.	.	.	.	c	2.923	-0.222699	0.06061	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01538	4.79	3.78	2.86	0.33363	.	.	.	.	.	T	0.05364	0.0142	M	0.90759	3.145	0.09310	N	1	B	0.18166	0.026	B	0.19391	0.025	T	0.10154	-1.0642	9	0.59425	D	0.04	.	11.064	0.47964	0.0:0.8095:0.1904:0.0	.	176	Q701N2	KRA55_HUMAN	F	176;147	ENSP00000382584:S176F	ENSP00000382584:S176F	S	+	2	0	KRTAP5-5	1608173	0.001000	0.12720	0.434000	0.26772	0.031000	0.12232	0.209000	0.17435	0.583000	0.29574	-0.243000	0.11985	TCC	-	KRTAP5-5	-	NULL		0.617	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	0	0	0	116	116	5	0.00	0.00	C			1651597	+1	22	1	95	3	tier1	no_errors	ENST00000399676	ensembl	human	known	74_37	missense	18.80	25.00	SNP	0.192	T	22	95
SKIDA1	387640	genome.wustl.edu	37	10	21805720	21805720	+	Silent	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr10:21805720A>G	ENST00000449193.2	-	4	3284	c.1032T>C	c.(1030-1032)caT>caC	p.H344H	SKIDA1_ENST00000444772.3_Silent_p.H265H|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	263	Glu-rich.|Ser-rich.					nucleus (GO:0005634)											ggtggtggtgatggtggtggt	0.716													ENSG00000180592																																					0													4.0	6.0	5.0					10																	21805720		1658	3602	5260	SO:0001819	synonymous_variant	0			-	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1032T>C	10.37:g.21805720A>G			B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_D-bd_dom_put	p.H344	ENST00000449193.2	37	c.1032	CCDS44363.1	10																																																																																			-	SKIDA1	-	NULL		0.716	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2	0	0	0	32	32	10	0.00	0.00	A	NM_207371		21805720	-1	6	0	63	7	tier1	no_errors	ENST00000449193	ensembl	human	known	74_37	silent	8.70	0.00	SNP	0.972	G	6	63
CENPB	1059	genome.wustl.edu	37	20	3767122	3767184	+	Start_Codon_Del	DEL	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	-	rs537544733|rs200157177|rs567385184|rs370139399|rs267605931	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr20:3767122_3767184delGGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	ENST00000379751.4	-	0	153_215				CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa						regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						GTCGCCTCTTGGGGCCCATcccggcgcgccccccgccccggggcccggcgccgccgccgccgccccggggcggggggcccggg	0.798													ENSG00000125817																																					0																																										SO:0001582	initiator_codon_variant	0				X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761		20.37:g.3767122_3767184delGGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG			Q96EI4	In_Frame_Del	DEL	pfam_Centromere_CenpB_dimerisation,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,pfam_HTH_CenpB_D-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_D-bd_dom,pfscan_HTH_Psq	p.MGP1in_frame_del	ENST00000379751.4	37	c.9_1	CCDS13064.1	20																																																																																				CENPB	-	superfamily_Homeodomain-like,pfscan_HTH_Psq		0.798	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPB	HGNC	protein_coding	OTTHUMT00000077772.2	0	0	0	0	0	0	0.00	0.00	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	NM_001810		3767184	-1	0	0	0	0	tier1	no_errors	ENST00000379751	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	0	0
DNM1P34	729809	genome.wustl.edu	37	15	75592881	75592908	+	RNA	DEL	CGGGCTTCCCTCTTCTCTGGTCACCCTC	CGGGCTTCCCTCTTCTCTGGTCACCCTC	-	rs34982072|rs560156590	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	CGGGCTTCCCTCTTCTCTGGTCACCCTC	CGGGCTTCCCTCTTCTCTGGTCACCCTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr15:75592881_75592908delCGGGCTTCCCTCTTCTCTGGTCACCCTC	ENST00000567292.1	-	0	1661_1688							Q6PK57	DMP34_HUMAN	DNM1 pseudogene 34							microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										TCAGCCCCCTCGGGCTTCCCTCTTCTCTGGTCACCCTCCCCTTCCAAC	0.658													ENSG00000260357																																					0																																												0				AJ576251		15q24.2	2013-04-25			ENSG00000260357	ENSG00000260357			35181	pseudogene	pseudogene				DNM1DN8@			Standard	NG_009143		Approved	DNM1DN8-1, DNM1DN8-5	uc002azx.1	Q6PK57	OTTHUMG00000172673		15.37:g.75592881_75592908delCGGGCTTCCCTCTTCTCTGGTCACCCTC				R	DEL	-	NULL	ENST00000567292.1	37	NULL		15																																																																																				DNM1P34	-	-		0.658	DNM1P34-001	KNOWN	basic	processed_transcript	DNM1P34	HGNC	pseudogene	OTTHUMT00000419799.1	0	0	0	0	0	0	0.00	0.00	CGGGCTTCCCTCTTCTCTGGTCACCCTC	NG_009143		75592908	-1	1	1	0	0	tier1	no_errors	ENST00000567292	ensembl	human	known	74_37	rna	100.00	100.00	DEL	0.000:0.001:0.002:0.003:0.016:0.019:0.542:0.707:0.754:0.765:0.759:0.735:0.645:0.577:0.391:0.379:0.371:0.364:0.334:0.225:0.038:0.019:0.014:0.015:0.015:0.021:0.029:0.030	-	1	0
FAM120C	54954	genome.wustl.edu	37	X	54209302	54209303	+	In_Frame_Ins	INS	-	-	GGCGGC			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:54209302_54209303insGGCGGC	ENST00000375180.2	-	1	385_386	c.329_330insGCCGCC	c.(328-330)ccc>ccGCCGCCc	p.110_110P>PPP	FAM120C_ENST00000497680.1_5'Flank|FAM120C_ENST00000477084.1_In_Frame_Ins_p.110_110P>PPP|FAM120C_ENST00000328235.4_In_Frame_Ins_p.110_110P>PPP	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	110							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCAGCTGAGGGGGCGGCGGCGG	0.748													ENSG00000184083		77	0.0203974	0.0045	0.0159	3775	,	,		9228	0.0		0.0467	False		,,,				2504	0.0133																0																																										SO:0001652	inframe_insertion	0				AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.324_329dupGCCGCC	X.37:g.54209303_54209308dupGGCGGC	ENSP00000364324:p.ProPro110dup		B2RMT7	In_Frame_Ins	INS	NULL	p.112in_frame_insPP	ENST00000375180.2	37	c.330_329	CCDS14356.1	X																																																																																				FAM120C	-	NULL		0.748	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	0	0	0	0	0	0	0.00	0.00	-	NM_017848		54209303	-1	0	0	2	2	tier1	no_errors	ENST00000375180	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.999:0.998	GGCGGC	0	2
GOLGA8N	643699	genome.wustl.edu	37	15	32890118	32890118	+	Silent	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr15:32890118A>G	ENST00000569659.1	+	7	426	c.426A>G	c.(424-426)aaA>aaG	p.K142K	GOLGA8N_ENST00000448387.2_Silent_p.K142K|GOLGA8N_ENST00000426622.2_Intron					golgin A8 family, member N																		TCATACAGAAAGAGGAACTAA	0.458													ENSG00000232653																																					0																																										SO:0001819	synonymous_variant	0			-			15q13.3	2014-01-02			ENSG00000232653	ENSG00000232653			44405	protein-coding gene	gene with protein product							Standard	NM_001282494		Approved			F8WBI6	OTTHUMG00000175401	ENST00000569659.1:c.426A>G	15.37:g.32890118A>G				Silent	SNP	NULL	p.K142	ENST00000569659.1	37	c.426		15																																																																																			-	GOLGA8N	-	NULL		0.458	GOLGA8N-001	NOVEL	basic|appris_candidate	protein_coding	GOLGA8N	HGNC	protein_coding	OTTHUMT00000429858.1	0	0	0	52	52	0	0.00	0.00	A	NM_001282494		32890118	+1	29	0	65	0	tier1	no_errors	ENST00000448387	ensembl	human	known	74_37	silent	30.85	0.00	SNP	0.187	G	29	65
ID4	3400	genome.wustl.edu	37	6	19838106	19838108	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr6:19838106_19838108delGCG	ENST00000378700.3	+	1	490_492	c.121_123delGCG	c.(121-123)gcgdel	p.A48del	RP1-167F1.2_ENST00000432171.2_RNA	NM_001546.3	NP_001537.1	P47928	ID4_HUMAN	inhibitor of DNA binding 4, dominant negative helix-loop-helix protein	48	Poly-Ala.				cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex neuron differentiation (GO:0021895)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|hippocampus development (GO:0021766)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast proliferation (GO:0007405)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			lung(1)	1	Ovarian(93;0.0355)|Breast(50;0.0654)|all_epithelial(95;0.12)		OV - Ovarian serous cystadenocarcinoma(7;0.00659)|all cancers(50;0.0327)|Epithelial(50;0.0621)			CTCCGCAGCCgcggcggcggcgg	0.788													ENSG00000172201																									Esophageal Squamous(13;105 518 19978 28644 46870)												0										0,152		0,0,76						-2.7	0.9			1	16,642		6,4,319	no	coding	ID4	NM_001546.2		6,4,395	A1A1,A1R,RR		2.4316,0.0,1.9753				16,794				SO:0001651	inframe_deletion	0				U16153	CCDS4544.1	6p22.3	2013-05-21			ENSG00000172201	ENSG00000172201		"""Basic helix-loop-helix proteins"""	5363	protein-coding gene	gene with protein product		600581				7665172	Standard	NM_001546		Approved	bHLHb27	uc003ncw.4	P47928	OTTHUMG00000014333	ENST00000378700.3:c.121_123delGCG	6.37:g.19838115_19838117delGCG	ENSP00000367972:p.Ala48del		Q13005	In_Frame_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,smart_bHLH_dom,pfscan_bHLH_dom	p.A44in_frame_del	ENST00000378700.3	37	c.121_123	CCDS4544.1	6																																																																																				ID4	-	superfamily_Trp_syn_b_sub_like_PLP_eny_SF		0.788	ID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ID4	HGNC	protein_coding	OTTHUMT00000039979.1	0	0	0	13	13	0	0.00	0.00	GCG	NM_001546		19838108	+1	4	0	22	0	tier1	no_errors	ENST00000378700	ensembl	human	known	74_37	in_frame_del	15.38	0.00	DEL	0.988:0.989:0.984	-	4	22
MLC1	23209	genome.wustl.edu	37	22	50502469	50502470	+	In_Frame_Ins	INS	-	-	GCACCCCCACCCCACAGGCCACTCACCTCCCCG	rs11568189|rs11568190	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr22:50502469_50502470insGCACCCCCACCCCACAGGCCACTCACCTCCCCG	ENST00000311597.5	-	11	1658_1659	c.1052_1053insCGGGGAGGTGAGTGGCCTGTGGGGTGGGGGTGC	c.(1051-1053)gct>gcCGGGGAGGTGAGTGGCCTGTGGGGTGGGGGTGCt	p.351_351A>AGEVSGLWGGGA	MLC1_ENST00000395876.2_In_Frame_Ins_p.351_351A>AGEVSGLWGGGA|MLC1_ENST00000450140.2_In_Frame_Ins_p.299_299A>AGEVSGLWGGGA|MLC1_ENST00000535444.1_In_Frame_Ins_p.272_272A>AGEVSGLWGGGA|MLC1_ENST00000483836.1_5'UTR|MLC1_ENST00000431262.2_In_Frame_Ins_p.321_321A>AGEVSGLWGGGA|MLC1_ENST00000538737.1_In_Frame_Ins_p.317_317A>AGEVSGLWGGGA	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	351					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		TCACCTCCCCAGCCAGGCGCTC	0.698													ENSG00000100427																																					0																																										SO:0001652	inframe_insertion	0				D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.1052_1053insCGGGGAGGTGAGTGGCCTGTGGGGTGGGGGTGC	22.37:g.50502469_50502470insGCACCCCCACCCCACAGGCCACTCACCTCCCCG	Exception_encountered		B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	In_Frame_Ins	INS	NULL	p.355in_frame_insSGLWGGGAGEV	ENST00000311597.5	37	c.1053_1052	CCDS14083.1	22																																																																																				MLC1	-	NULL		0.698	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	HGNC	protein_coding	OTTHUMT00000316979.2	0	0	0	0	0	0	0.00	0.00	-	NM_015166		50502470	-1	0	0	0	0	tier1	no_errors	ENST00000311597	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.000:0.000	GCACCCCCACCCCACAGGCCACTCACCTCCCCG	0	0
TBC1D10B	26000	genome.wustl.edu	37	16	30381257	30381268	+	In_Frame_Del	DEL	GCCGGGGCTGGG	GCCGGGGCTGGG	-	rs570394259	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GCCGGGGCTGGG	GCCGGGGCTGGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr16:30381257_30381268delGCCGGGGCTGGG	ENST00000409939.3	-	1	317_328	c.237_248delCCCAGCCCCGGC	c.(235-249)gccccagccccggct>gct	p.79_83APAPA>A		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	79	Pro-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			GCCCGTGACAgccggggctggggccggggctg	0.792													ENSG00000169221		46	0.0091853	0.0098	0.0086	5008	,	,		8323	0.001		0.0239	False		,,,				2504	0.002																0										3,471		1,1,235						-6.7	0.0			1	39,1033		17,5,514	no	coding	TBC1D10B	NM_015527.3		18,6,749	A1A1,A1R,RR		3.6381,0.6329,2.7167				42,1504				SO:0001651	inframe_deletion	0				BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.237_248delCCCAGCCCCGGC	16.37:g.30381257_30381268delGCCGGGGCTGGG	ENSP00000386538:p.Ala79_Pro82del		B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	In_Frame_Del	DEL	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.PAPA80in_frame_del	ENST00000409939.3	37	c.248_237	CCDS10676.2	16																																																																																				TBC1D10B	-	NULL		0.792	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	HGNC	protein_coding	OTTHUMT00000255527.3	0	0	0	0	0	0	0.00	0.00	GCCGGGGCTGGG	NM_015527		30381268	-1	0	0	0	0	tier1	no_errors	ENST00000409939	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001	-	0	0
KRTAP5-5	439915	genome.wustl.edu	37	11	1651627	1651627	+	Missense_Mutation	SNP	C	C	T	rs576867883|rs71025765		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:1651627C>T	ENST00000399676.2	+	1	595	c.557C>T	c.(556-558)tCc>tTc	p.S186F		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	186	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.Y182_P191delYCCQSSCCKP(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCTGCCAGTCCAGCTGCTGT	0.602													ENSG00000185940																																					1	Deletion - In frame(1)	urinary_tract(1)											67.0	72.0	70.0					11																	1651627		2200	4292	6492	SO:0001583	missense	0			-	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.557C>T	11.37:g.1651627C>T	ENSP00000382584:p.Ser186Phe		A8MWN2	Missense_Mutation	SNP	NULL	p.S186F	ENST00000399676.2	37	c.557	CCDS41592.1	11	.	.	.	.	.	.	.	.	.	.	c	6.961	0.547285	0.13312	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01505	4.82	3.51	3.51	0.40186	.	.	.	.	.	T	0.06371	0.0164	M	0.93763	3.455	0.26180	N	0.979737	B	0.25850	0.136	B	0.24394	0.053	T	0.03443	-1.1036	9	0.72032	D	0.01	.	12.5263	0.56087	0.0:1.0:0.0:0.0	.	186	Q701N2	KRA55_HUMAN	F	186;157	ENSP00000382584:S186F	ENSP00000382584:S186F	S	+	2	0	KRTAP5-5	1608203	0.609000	0.26975	0.995000	0.50966	0.160000	0.22226	0.369000	0.20416	1.491000	0.48482	0.471000	0.43371	TCC	-	KRTAP5-5	-	NULL		0.602	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	0	0	0	101	101	2	0.00	0.00	C			1651627	+1	10	2	102	5	tier1	no_errors	ENST00000399676	ensembl	human	known	74_37	missense	8.93	28.57	SNP	0.931	T	10	102
TCP11	6954	genome.wustl.edu	37	6	35109033	35109040	+	5'Flank	DEL	GCGGCCTG	GCGGCCTG	-	rs142118879|rs112303926	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GCGGCCTG	GCGGCCTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr6:35109033_35109040delGCGGCCTG	ENST00000512012.1	-	0	0				TCP11_ENST00000244645.3_5'UTR|TCP11_ENST00000510465.1_5'UTR|TCP11_ENST00000418521.2_Intron|TCP11_ENST00000444780.2_5'UTR|TCP11_ENST00000373979.2_5'UTR|TCP11_ENST00000311875.5_5'UTR|TCP11_ENST00000412155.2_5'UTR|TCP11_ENST00000373974.4_5'UTR			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						GGTGGGCCTCGCGGCCTGGCGGCCTGGA	0.769													ENSG00000124678		2193	0.437899	0.1831	0.611	5008	,	,		9765	0.3085		0.6849	False		,,,				2504	0.5389																0									,	265,1133		113,39,547					,	0.6	0.0		dbSNP_130	1	1818,1276		830,158,559	no	utr-5,utr-5	TCP11	NM_018679.4,NM_001093728.1	,	943,197,1106	A1A1,A1R,RR		41.2411,18.9557,46.3713	,	,		2083,2409				SO:0001631	upstream_gene_variant	0					CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560		6.37:g.35109041_35109048delGCGGCCTG	Exception_encountered		B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	R	DEL	-	NULL	ENST00000512012.1	37	NULL		6																																																																																				TCP11	-	-		0.769	TCP11-014	PUTATIVE	basic	protein_coding	TCP11	HGNC	protein_coding	OTTHUMT00000370354.1	0	0	0	0	0	0	0.00	0.00	GCGGCCTG	NM_001093728		35109040	-1	2	2	0	0	tier1	no_errors	ENST00000394696	ensembl	human	known	74_37	rna	100.00	100.00	DEL	0.001:0.000:0.000:0.001:0.002:0.001:0.000:0.000	-	2	0
P2RX2	22953	genome.wustl.edu	37	12	133197922	133197922	+	Silent	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr12:133197922G>A	ENST00000389110.3	+	9	1024	c.987G>A	c.(985-987)gtG>gtA	p.V329V	P2RX2_ENST00000352418.4_Silent_p.V257V|P2RX2_ENST00000350048.5_Silent_p.V305V|P2RX2_ENST00000449132.2_Silent_p.V295V|P2RX2_ENST00000351222.4_Silent_p.V237V|P2RX2_ENST00000343948.4_Silent_p.V329V|P2RX2_ENST00000348800.5_Silent_p.V329V	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	329	Pore-forming motif. {ECO:0000255}.				behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		ACGTCATTGTGCATGGACAGG	0.607													ENSG00000187848																																					0													121.0	111.0	114.0					12																	133197922		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.987G>A	12.37:g.133197922G>A			A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Silent	SNP	pfam_P2X_purnocptor,prints_P2X2_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.V329	ENST00000389110.3	37	c.987	CCDS31931.1	12																																																																																			-	P2RX2	-	pfam_P2X_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor		0.607	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX2	HGNC	protein_coding	OTTHUMT00000397542.1	0	0	0	30	30	54	0.00	0.00	G			133197922	+1	5	2	18	57	tier1	no_errors	ENST00000343948	ensembl	human	known	74_37	silent	21.74	3.39	SNP	1.000	A	5	18
