#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
HSP90AB1	3326	genome.wustl.edu	37	6	44221273	44221273	+	Missense_Mutation	SNP	C	C	G	rs559392885		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr6:44221273C>G	ENST00000371554.1	+	12	2327	c.2113C>G	c.(2113-2115)Cct>Gct	p.P705A	SLC35B2_ENST00000495706.1_5'Flank|HSP90AB1_ENST00000353801.3_Missense_Mutation_p.P705A|MIR4647_ENST00000583964.1_RNA|HSP90AB1_ENST00000371646.5_Missense_Mutation_p.P705A			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	705					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGCTGCAGTTCCTGATGAGAT	0.453											OREG0017471	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000096384																																					0													78.0	79.0	79.0					6																	44221273		2203	4300	6503	SO:0001583	missense	0			-	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.2113C>G	6.37:g.44221273C>G	ENSP00000360609:p.Pro705Ala	922	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	pfam_Hsp90_fam,pfam_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pirsf_Hsp90_fam,prints_Hsp90_N	p.P705A	ENST00000371554.1	37	c.2113	CCDS4909.1	6	.	.	.	.	.	.	.	.	.	.	C	9.258	1.042520	0.19748	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.08193	3.12;3.12;3.12	3.91	3.91	0.45181	.	0.082718	0.49916	U	0.000126	T	0.01029	0.0034	N	0.02751	-0.505	0.58432	D	0.999993	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.004;0.004	T	0.46911	-0.9157	10	0.12766	T	0.61	-14.7569	7.2382	0.26082	0.0:0.733:0.1736:0.0933	.	667;695;705	B4DMA2;B4DGL0;P08238	.;.;HS90B_HUMAN	A	705	ENSP00000360709:P705A;ENSP00000325875:P705A;ENSP00000360609:P705A	ENSP00000325875:P705A	P	+	1	0	HSP90AB1	44329251	0.996000	0.38824	1.000000	0.80357	0.825000	0.46686	1.855000	0.39378	2.188000	0.69820	0.609000	0.83330	CCT	-	HSP90AB1	-	pfam_Hsp90_fam,pirsf_Hsp90_fam		0.453	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSP90AB1	HGNC	protein_coding	OTTHUMT00000040730.1	0	0	0	49	49	45	0.00	0.00	C	NM_007355		44221273	+1	5	4	25	22	tier1	no_errors	ENST00000353801	ensembl	human	known	74_37	missense	16.67	15.38	SNP	1.000	G	5	25
PRSS35	167681	genome.wustl.edu	37	6	84234189	84234189	+	Silent	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr6:84234189G>A	ENST00000369700.3	+	2	1206	c.1029G>A	c.(1027-1029)tcG>tcA	p.S343S	PRSS35_ENST00000536636.1_Silent_p.S343S	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	343	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		ATGCTGAGTCGGGCTCCACCG	0.502													ENSG00000146250																																					0													102.0	103.0	102.0					6																	84234189		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.1029G>A	6.37:g.84234189G>A			A8K7B3|Q9BQP6	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	p.S343	ENST00000369700.3	37	c.1029	CCDS4999.1	6																																																																																			-	PRSS35	-	superfamily_Trypsin-like_Pept_dom		0.502	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	HGNC	protein_coding	OTTHUMT00000041352.1	0	0	0	51	51	121	0.00	0.00	G	NM_153362		84234189	+1	6	29	13	34	tier1	no_errors	ENST00000369700	ensembl	human	known	74_37	silent	31.58	46.03	SNP	0.111	A	6	13
BZRAP1	9256	genome.wustl.edu	37	17	56382430	56382430	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr17:56382430C>A	ENST00000343736.4	-	30	5699	c.5536G>T	c.(5536-5538)Gag>Tag	p.E1846*	BZRAP1_ENST00000268893.6_Nonsense_Mutation_p.E1786*|BZRAP1_ENST00000355701.3_Nonsense_Mutation_p.E1846*			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1846						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ACCTGACTCTCAGCCTGGGGT	0.647													ENSG00000005379																																					0													41.0	46.0	44.0					17																	56382430		2203	4300	6503	SO:0001587	stop_gained	0			-	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.5536G>T	17.37:g.56382430C>A	ENSP00000345824:p.Glu1846*		O75111|Q8N5W3	Nonsense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.E1846*	ENST00000343736.4	37	c.5536	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659148	0.67586	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	.	.	.	5.42	4.45	0.53987	.	0.645746	0.16081	N	0.230483	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	10.6242	0.45497	0.0:0.9108:0.0:0.0892	.	.	.	.	X	1846;1846;1786	.	ENSP00000268893:E1786X	E	-	1	0	BZRAP1	53737429	0.988000	0.35896	0.628000	0.29241	0.579000	0.36224	2.914000	0.48797	2.575000	0.86900	0.449000	0.29647	GAG	-	BZRAP1	-	NULL		0.647	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	0	0	0	60	60	31	0.00	0.00	C	NM_004758		56382430	-1	19	3	40	17	tier1	no_errors	ENST00000355701	ensembl	human	known	74_37	nonsense	32.20	15.00	SNP	0.533	A	19	40
TENM3	55714	genome.wustl.edu	37	4	183522238	183522238	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr4:183522238G>A	ENST00000511685.1	+	4	796	c.673G>A	c.(673-675)Gag>Aag	p.E225K	TENM3_ENST00000406950.2_Missense_Mutation_p.E225K			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	225	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTTGCCCGCCGAGCTGCAAAC	0.532													ENSG00000218336																																					0													71.0	80.0	77.0					4																	183522238		1874	4104	5978	SO:0001583	missense	0			-	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.673G>A	4.37:g.183522238G>A	ENSP00000424226:p.Glu225Lys		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.E225K	ENST00000511685.1	37	c.673	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750736	0.69533	.	.	ENSG00000218336	ENST00000511685;ENST00000406950;ENST00000510504	T;T;T	0.41758	0.99;0.99;0.99	5.78	5.78	0.91487	Teneurin intracellular, N-terminal (2);	.	.	.	.	T	0.33440	0.0863	L	0.29908	0.895	0.58432	D	0.999999	P	0.52061	0.95	B	0.37550	0.253	T	0.13308	-1.0514	9	0.44086	T	0.13	.	20.0015	0.97412	0.0:0.0:1.0:0.0	.	225	Q9P273	TEN3_HUMAN	K	225;225;83	ENSP00000424226:E225K;ENSP00000385276:E225K;ENSP00000426914:E83K	ENSP00000385276:E225K	E	+	1	0	ODZ3	183759232	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.471000	0.97696	2.718000	0.92993	0.557000	0.71058	GAG	-	TENM3	-	pfam_Ten_N		0.532	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	0	0	0	88	88	46	0.00	0.00	G			183522238	+1	119	53	38	14	tier1	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	75.80	79.10	SNP	1.000	A	119	38
CCDC13	152206	genome.wustl.edu	37	3	42781189	42781189	+	Silent	SNP	C	C	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr3:42781189C>T	ENST00000310232.6	-	9	1184	c.1101G>A	c.(1099-1101)aaG>aaA	p.K367K	CCDC13-AS1_ENST00000418161.1_RNA|CCDC13-AS1_ENST00000446950.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	367										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						CCATCTGACTCTTGAGGGTCT	0.567													ENSG00000244607																																					0													171.0	150.0	157.0					3																	42781189		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1101G>A	3.37:g.42781189C>T				Silent	SNP	superfamily_Prefoldin	p.K367	ENST00000310232.6	37	c.1101	CCDS2705.1	3																																																																																			-	CCDC13	-	superfamily_Prefoldin		0.567	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	HGNC	protein_coding	OTTHUMT00000256652.1	0	0	0	59	59	103	0.00	0.00	C	NM_144719		42781189	-1	16	48	11	31	tier1	no_errors	ENST00000310232	ensembl	human	known	74_37	silent	59.26	60.76	SNP	0.944	T	16	11
COPB2	9276	genome.wustl.edu	37	3	139087001	139087001	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr3:139087001C>G	ENST00000333188.5	-	13	1712	c.1531G>C	c.(1531-1533)Gaa>Caa	p.E511Q	COPB2_ENST00000507777.1_Missense_Mutation_p.E482Q	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	511					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						AAGGCATCTTCAATGCCATCT	0.348													ENSG00000184432																																					0													130.0	122.0	125.0					3																	139087001		2203	4300	6503	SO:0001583	missense	0			-	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.1531G>C	3.37:g.139087001C>G	ENSP00000329419:p.Glu511Gln		B4DZI8	Missense_Mutation	SNP	pirsf_COPB2,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E511Q	ENST00000333188.5	37	c.1531	CCDS3108.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.317116	0.95682	.	.	ENSG00000184432	ENST00000333188;ENST00000507777;ENST00000512309	T;D	0.90133	-0.31;-2.62	5.97	5.97	0.96955	Coatomer, WD associated region (1);	0.000000	0.85682	D	0.000000	D	0.97046	0.9035	H	0.95437	3.67	0.80722	D	1	D	0.60575	0.988	D	0.71656	0.974	D	0.97392	0.9990	10	0.87932	D	0	-17.4844	20.4062	0.99009	0.0:1.0:0.0:0.0	.	511	P35606	COPB2_HUMAN	Q	511;482;134	ENSP00000329419:E511Q;ENSP00000422295:E482Q	ENSP00000329419:E511Q	E	-	1	0	COPB2	140569691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.682000	0.84083	2.831000	0.97527	0.655000	0.94253	GAA	-	COPB2	-	pirsf_COPB2,pfam_Coatomer_WD-assoc_reg		0.348	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB2	HGNC	protein_coding	OTTHUMT00000358495.2	0	0	0	58	58	131	0.00	0.00	C	NM_004766		139087001	-1	16	21	59	90	tier1	no_errors	ENST00000333188	ensembl	human	known	74_37	missense	21.05	18.92	SNP	1.000	G	16	59
AIM1	202	genome.wustl.edu	37	6	106967940	106967940	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr6:106967940G>C	ENST00000369066.3	+	2	2120	c.1633G>C	c.(1633-1635)Gtc>Ctc	p.V545L		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TCCATCCAGAGTCCTCGTCCA	0.532													ENSG00000112297																																					0													63.0	65.0	65.0					6																	106967940		2203	4300	6503	SO:0001583	missense	0			-	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1633G>C	6.37:g.106967940G>C	ENSP00000358062:p.Val545Leu		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.V545L	ENST00000369066.3	37	c.1633	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478075	0.84747	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.78481	-1.18	6.17	6.17	0.99709	.	0.575334	0.14526	N	0.314173	D	0.83344	0.5234	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.79264	-0.1875	10	0.36615	T	0.2	.	16.3795	0.83443	0.0:0.0:1.0:0.0	.	545	Q9Y4K1	AIM1_HUMAN	L	953;545	ENSP00000358062:V545L	ENSP00000285105:V953L	V	+	1	0	AIM1	107074633	1.000000	0.71417	0.995000	0.50966	0.668000	0.39293	2.143000	0.42187	2.941000	0.99782	0.655000	0.94253	GTC	-	AIM1	-	NULL		0.532	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	0	0	0	62	62	118	0.00	0.00	G			106967940	+1	9	32	39	44	tier1	no_errors	ENST00000369066	ensembl	human	known	74_37	missense	18.75	42.11	SNP	0.994	C	9	39
ZNF711	7552	genome.wustl.edu	37	X	84520144	84520144	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chrX:84520144G>A	ENST00000373165.3	+	6	1105	c.799G>A	c.(799-801)Gag>Aag	p.E267K	ZNF711_ENST00000276123.3_Missense_Mutation_p.E267K|ZNF711_ENST00000360700.4_Missense_Mutation_p.E267K|ZNF711_ENST00000395402.1_Missense_Mutation_p.E245K|ZNF711_ENST00000542798.1_Missense_Mutation_p.E63K	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	267					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						AATTGTCACAGAGAGTGAGTA	0.373													ENSG00000147180																																					0													74.0	71.0	72.0					X																	84520144		2202	4300	6502	SO:0001583	missense	0			-	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.799G>A	X.37:g.84520144G>A	ENSP00000362260:p.Glu267Lys		B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E245K	ENST00000373165.3	37	c.733	CCDS35344.1	X	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960476	0.92791	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18	5.12	5.12	0.69794	Transcriptional activator, Zfx / Zfy domain (1);	0.177280	0.26481	U	0.024123	T	0.65533	0.2700	M	0.70595	2.14	0.80722	D	1	P;P	0.49559	0.925;0.762	P;B	0.47162	0.54;0.381	T	0.71481	-0.4580	10	0.62326	D	0.03	-12.16	17.6722	0.88221	0.0:0.0:1.0:0.0	.	267;267	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	K	245;267;267;267;63	ENSP00000378798:E245K;ENSP00000362260:E267K;ENSP00000276123:E267K;ENSP00000353922:E267K;ENSP00000442071:E63K	ENSP00000276123:E267K	E	+	1	0	ZNF711	84406800	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.222000	0.95196	2.101000	0.63845	0.506000	0.49869	GAG	-	ZNF711	-	pfam_Transcrp_activ_Zfx/Zfy-dom		0.373	ZNF711-001	KNOWN	basic|CCDS	protein_coding	ZNF711	HGNC	protein_coding	OTTHUMT00000057388.2	0	0	0	147	147	97	0.00	0.00	G	NM_021998		84520144	+1	47	23	66	38	tier1	no_errors	ENST00000395402	ensembl	human	known	74_37	missense	41.59	37.70	SNP	1.000	A	47	66
ACSL6	23305	genome.wustl.edu	37	5	131307262	131307262	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr5:131307262C>T	ENST00000379240.1	-	14	1493	c.1340G>A	c.(1339-1341)cGg>cAg	p.R447Q	ACSL6_ENST00000543479.1_Missense_Mutation_p.R447Q|ACSL6_ENST00000379272.2_Missense_Mutation_p.R462Q|ACSL6_ENST00000296869.4_Missense_Mutation_p.R472Q|ACSL6_ENST00000379244.1_Missense_Mutation_p.R447Q|ACSL6_ENST00000544770.1_Missense_Mutation_p.R356Q|ACSL6_ENST00000379255.1_Missense_Mutation_p.R372Q|ACSL6_ENST00000379249.3_Missense_Mutation_p.R447Q|ACSL6_ENST00000357096.1_Missense_Mutation_p.R372Q|ACSL6_ENST00000431707.1_Missense_Mutation_p.R427Q|ACSL6_ENST00000379246.1_Missense_Mutation_p.R458Q|ACSL6_ENST00000379264.2_Missense_Mutation_p.R472Q			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	447					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAGAGCTGCCCGGAGAAATCC	0.532													ENSG00000164398																																					0													49.0	43.0	45.0					5																	131307262		2203	4300	6503	SO:0001583	missense	0			-	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1340G>A	5.37:g.131307262C>T	ENSP00000368542:p.Arg447Gln		J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R472Q	ENST00000379240.1	37	c.1415		5	.	.	.	.	.	.	.	.	.	.	C	37	6.177548	0.97352	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479	T;T;T;T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.94	5.94	0.96194	AMP-dependent synthetase/ligase (1);	0.047916	0.85682	N	0.000000	T	0.61540	0.2355	M	0.72118	2.19	0.80722	D	1	P;D;D;P;D;D;D	0.61697	0.749;0.987;0.99;0.905;0.968;0.987;0.987	P;P;P;P;P;P;P	0.56088	0.469;0.791;0.723;0.604;0.556;0.791;0.697	T	0.63102	-0.6712	10	0.87932	D	0	.	20.4237	0.99064	0.0:1.0:0.0:0.0	.	447;462;437;447;372;472;472	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	Q	447;472;462;372;372;472;458;447;356;447;427;447	ENSP00000368551:R447Q;ENSP00000368566:R472Q;ENSP00000368574:R462Q;ENSP00000349608:R372Q;ENSP00000368557:R372Q;ENSP00000296869:R472Q;ENSP00000368548:R458Q;ENSP00000368546:R447Q;ENSP00000445154:R356Q;ENSP00000368542:R447Q;ENSP00000413329:R427Q;ENSP00000442124:R447Q	ENSP00000296869:R472Q	R	-	2	0	ACSL6	131335161	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.750000	0.85110	2.834000	0.97654	0.650000	0.86243	CGG	-	ACSL6	-	pfam_AMP-dep_Synth/Lig		0.532	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	ACSL6	HGNC	protein_coding	OTTHUMT00000132622.1	0	0	0	38	38	188	0.00	0.00	C	NM_015256		131307262	-1	9	38	16	83	tier1	no_errors	ENST00000296869	ensembl	human	known	74_37	missense	36.00	31.40	SNP	1.000	T	9	16
MIR146A	406938	genome.wustl.edu	37	5	159912453	159912453	+	lincRNA	SNP	A	A	C			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr5:159912453A>C	ENST00000385201.1	+	0	95					NR_029701.1				microRNA 146a																		TATCTCTGTCATCGTGGGCTT	0.478													ENSG00000253522																																					0													50.0	46.0	47.0					5																	159912453		1568	3582	5150			0			-			5q34	2011-09-12	2005-06-30	2008-12-18	ENSG00000207936			"""ncRNAs / Micro RNAs"""	31533	non-coding RNA	RNA, micro		610566	"""microRNA 146"""	MIRN146, MIRN146A			Standard	NR_029701		Approved	hsa-mir-146, hsa-mir-146a					5.37:g.159912453A>C				R	SNP	-	NULL	ENST00000385201.1	37	NULL		5																																																																																			-	MIR146A	-	-		0.478	MIR146A-201	KNOWN	basic	miRNA	MIR146A	HGNC	lincRNA		0	0	0	50	50	112	0.00	0.00	A	NR_029701		159912453	+1	12	8	20	56	tier1	no_errors	ENST00000385201	ensembl	human	known	74_37	rna	37.50	12.50	SNP	0.000	C	12	20
NEURL1	9148	genome.wustl.edu	37	10	105349291	105349291	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr10:105349291C>T	ENST00000369780.4	+	5	1769	c.1360C>T	c.(1360-1362)Cgg>Tgg	p.R454W	NEURL_ENST00000369777.2_Missense_Mutation_p.R437W|SH3PXD2A_ENST00000427662.2_Intron	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		454					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CCTGGCCGAGCGGGGTATCCC	0.652													ENSG00000107954																																					0													51.0	53.0	53.0					10																	105349291		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000369780.4:c.1360C>T	10.37:g.105349291C>T	ENSP00000358795:p.Arg454Trp		Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	pfam_Neu_Z,smart_Neu_Z,pfscan_Neu_Z,pfscan_Znf_RING	p.R454W	ENST00000369780.4	37	c.1360	CCDS7551.1	10	.	.	.	.	.	.	.	.	.	.	C	17.87	3.494298	0.64186	.	.	ENSG00000107954	ENST00000369780;ENST00000369777	.	.	.	4.94	4.04	0.47022	.	0.432209	0.25416	N	0.030840	T	0.47710	0.1460	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	B	0.43575	0.424	T	0.45687	-0.9244	9	0.38643	T	0.18	-17.9193	12.6368	0.56687	0.3011:0.6989:0.0:0.0	.	454	O76050	NEU1A_HUMAN	W	454;437	.	ENSP00000358792:R437W	R	+	1	2	NEURL	105339281	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	1.945000	0.40273	1.093000	0.41377	-0.226000	0.12346	CGG	-	NEURL	-	NULL		0.652	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEURL	HGNC	protein_coding	OTTHUMT00000050170.1	0	0	0	74	74	38	0.00	0.00	C			105349291	+1	22	17	70	47	tier1	no_errors	ENST00000369780	ensembl	human	known	74_37	missense	23.66	26.56	SNP	1.000	T	22	70
ABI3	51225	genome.wustl.edu	37	17	47295202	47295202	+	Silent	SNP	C	C	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr17:47295202C>T	ENST00000225941.1	+	3	885	c.387C>T	c.(385-387)aaC>aaT	p.N129N	ABI3_ENST00000419580.2_Silent_p.N123N	NM_001135186.1|NM_016428.2	NP_001128658.1|NP_057512	Q9P2A4	ABI3_HUMAN	ABI family, member 3	129					cellular component movement (GO:0006928)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	12			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			CCCCAGAGAACCTACCCCCTC	0.612										HNSCC(55;0.14)			ENSG00000108798																																					0													135.0	131.0	132.0					17																	47295202		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB037886	CCDS11546.1, CCDS45725.1	17q21.3	2011-03-04	2008-09-12		ENSG00000108798	ENSG00000108798			29859	protein-coding gene	gene with protein product		606363				10978530, 11956071	Standard	NM_001135186		Approved	NESH, SSH3BP3	uc002iop.1	Q9P2A4	OTTHUMG00000161306	ENST00000225941.1:c.387C>T	17.37:g.47295202C>T			C9IZN8|Q9H0P6	Silent	SNP	pfam_Abl-interactor_HHR_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.N129	ENST00000225941.1	37	c.387	CCDS11546.1	17																																																																																			-	ABI3	-	pfam_Abl-interactor_HHR_dom		0.612	ABI3-001	KNOWN	basic|CCDS	protein_coding	ABI3	HGNC	protein_coding	OTTHUMT00000364475.1	0	0	0	41	41	66	0.00	0.00	C	NM_016428		47295202	+1	11	25	19	37	tier1	no_errors	ENST00000225941	ensembl	human	known	74_37	silent	36.67	40.32	SNP	1.000	T	11	19
CNPPD1	27013	genome.wustl.edu	37	2	220041005	220041005	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr2:220041005A>C	ENST00000409789.1	-	3	545	c.118T>G	c.(118-120)Tac>Gac	p.Y40D	CNPPD1_ENST00000360507.5_Missense_Mutation_p.Y40D|FAM134A_ENST00000430297.2_5'Flank			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	40					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						CAGCCATAGTAGAGCCTCCTT	0.597													ENSG00000115649																																					0													54.0	55.0	55.0					2																	220041005		2203	4300	6503	SO:0001583	missense	0			-	AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.118T>G	2.37:g.220041005A>C	ENSP00000386277:p.Tyr40Asp		B2RC77|O75548|Q9H4N0|Q9UQN0	Missense_Mutation	SNP	pfam_Cyclin_PHO80-like,superfamily_Cyclin-like	p.Y40D	ENST00000409789.1	37	c.118	CCDS2433.1	2	.	.	.	.	.	.	.	.	.	.	A	27.0	4.792514	0.90453	.	.	ENSG00000115649	ENST00000360507;ENST00000409789;ENST00000453038;ENST00000451647	T;T;T	0.47177	1.74;1.74;0.85	4.54	4.54	0.55810	.	0.061550	0.64402	D	0.000002	T	0.57695	0.2071	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62053	-0.6935	10	0.72032	D	0.01	-15.589	14.3173	0.66460	1.0:0.0:0.0:0.0	.	40	Q9BV87	CNPD1_HUMAN	D	40	ENSP00000353698:Y40D;ENSP00000386277:Y40D;ENSP00000410109:Y40D	ENSP00000353698:Y40D	Y	-	1	0	CNPPD1	219749249	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	7.812000	0.86109	2.018000	0.59344	0.533000	0.62120	TAC	-	CNPPD1	-	NULL		0.597	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CNPPD1	HGNC	protein_coding	OTTHUMT00000336220.1	0	0	0	46	46	90	0.00	0.00	A	NM_015680		220041005	-1	9	28	32	60	tier1	no_errors	ENST00000360507	ensembl	human	known	74_37	missense	21.95	31.82	SNP	1.000	C	9	32
AIM1	202	genome.wustl.edu	37	6	106967377	106967377	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr6:106967377G>C	ENST00000369066.3	+	2	1557	c.1070G>C	c.(1069-1071)aGa>aCa	p.R357T		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CCAGCAACCAGAGGAATGAAT	0.448													ENSG00000112297																																					0													85.0	96.0	92.0					6																	106967377		2203	4300	6503	SO:0001583	missense	0			-	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1070G>C	6.37:g.106967377G>C	ENSP00000358062:p.Arg357Thr		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.R357T	ENST00000369066.3	37	c.1070	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254913	0.22965	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.71341	-0.56	3.21	2.33	0.28932	.	1.915270	0.02875	N	0.132160	T	0.34454	0.0898	L	0.29908	0.895	0.25480	N	0.987746	P	0.37466	0.596	B	0.31869	0.137	T	0.20009	-1.0288	10	0.14252	T	0.57	.	9.1448	0.36925	0.1068:0.0:0.8932:0.0	.	357	Q9Y4K1	AIM1_HUMAN	T	765;357	ENSP00000358062:R357T	ENSP00000285105:R765T	R	+	2	0	AIM1	107074070	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.070000	0.11523	0.920000	0.36970	0.655000	0.94253	AGA	-	AIM1	-	NULL		0.448	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	0	0	0	16	16	122	0.00	0.00	G			106967377	+1	5	35	8	54	tier1	no_errors	ENST00000369066	ensembl	human	known	74_37	missense	38.46	39.33	SNP	0.003	C	5	8
LAMA2	3908	genome.wustl.edu	37	6	129833555	129833555	+	Missense_Mutation	SNP	C	C	T	rs374888837		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr6:129833555C>T	ENST00000421865.2	+	63	8954	c.8905C>T	c.(8905-8907)Cgc>Tgc	p.R2969C		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2969	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.			R -> A (in Ref. 1; CAA81394 and 2; AAB18388). {ECO:0000305}.	axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATTTGAATTCCGCACAACTAC	0.373													ENSG00000196569	C|||	1	0.000199681	0.0008	0.0	5008	,	,		18846	0.0		0.0	False		,,,				2504	0.0																0								C	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	142.0	139.0	140.0		8905,8893	4.9	1.0	6		140	0,8600		0,0,4300	no	missense,missense	LAMA2	NM_000426.3,NM_001079823.1	180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	2969/3123,2965/3119	129833555	1,13005	2203	4300	6503	SO:0001583	missense	0			-	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.8905C>T	6.37:g.129833555C>T	ENSP00000400365:p.Arg2969Cys		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SRE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.R2969C	ENST00000421865.2	37	c.8905	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938126	0.73557	2.27E-4	0.0	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.55930	0.49	5.73	4.87	0.63330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.75339	0.3836	H	0.94503	3.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83883	0.0280	9	.	.	.	.	14.7432	0.69472	0.0:0.9308:0.0:0.0692	.	2970;2969	A6NF00;P24043	.;LAMA2_HUMAN	C	2969;2968;2969;987	ENSP00000400365:R2969C	.	R	+	1	0	LAMA2	129875248	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	6.811000	0.75221	1.439000	0.47511	0.655000	0.94253	CGC	-	LAMA2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.373	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	0	0	0	114	114	155	0.00	0.00	C			129833555	+1	38	41	59	75	tier1	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	39.18	35.34	SNP	1.000	T	38	59
DNAH5	1767	genome.wustl.edu	37	5	13793644	13793644	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr5:13793644G>A	ENST00000265104.4	-	49	8308	c.8204C>T	c.(8203-8205)gCt>gTt	p.A2735V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2735	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTCCACAGAAGCTTCAGAGGG	0.468									Kartagener syndrome				ENSG00000039139																																					0													121.0	125.0	124.0					5																	13793644		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8204C>T	5.37:g.13793644G>A	ENSP00000265104:p.Ala2735Val		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A2735V	ENST00000265104.4	37	c.8204	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333297	0.60853	.	.	ENSG00000039139	ENST00000265104	T	0.42131	0.98	5.88	5.88	0.94601	ATPase, AAA+ type, core (1);	0.106406	0.64402	D	0.000005	T	0.41719	0.1171	L	0.43923	1.385	0.80722	D	1	B	0.24576	0.106	B	0.27715	0.082	T	0.12192	-1.0557	10	0.33141	T	0.24	.	20.2366	0.98359	0.0:0.0:1.0:0.0	.	2735	Q8TE73	DYH5_HUMAN	V	2735	ENSP00000265104:A2735V	ENSP00000265104:A2735V	A	-	2	0	DNAH5	13846644	1.000000	0.71417	0.921000	0.36526	0.435000	0.31806	7.857000	0.86963	2.792000	0.96026	0.557000	0.71058	GCT	-	DH5	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0	0	62	62	119	0.00	0.00	G	NM_001369		13793644	-1	11	15	18	54	tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	37.93	21.74	SNP	1.000	A	11	18
RUVBL2	10856	genome.wustl.edu	37	19	49514351	49514351	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr19:49514351G>T	ENST00000595090.1	+	10	1346		c.e10+1		RUVBL2_ENST00000413176.2_Splice_Site|RUVBL2_ENST00000601968.1_Splice_Site	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2						ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		CATCCCTGGAGTGAGGACCCA	0.637													ENSG00000183207																																					0													36.0	41.0	39.0					19																	49514351		2054	4189	6243	SO:0001630	splice_region_variant	0			-	AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.882+1G>T	19.37:g.49514351G>T			B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Splice_Site	SNP	-	e10+1	ENST00000595090.1	37	c.882+1	CCDS42588.1	19	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050147	0.75846	.	.	ENSG00000183207	ENST00000221413;ENST00000413176	.	.	.	4.47	4.47	0.54385	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0153	0.71578	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RUVBL2	54206163	1.000000	0.71417	0.999000	0.59377	0.845000	0.48019	8.679000	0.91220	2.483000	0.83821	0.561000	0.74099	.	-	RUVBL2	-	-		0.637	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUVBL2	HGNC	protein_coding	OTTHUMT00000466235.1	0	0	0	41	41	32	0.00	0.00	G		Intron	49514351	+1	13	9	36	11	tier1	no_errors	ENST00000595090	ensembl	human	known	74_37	splice_site	26.53	45.00	SNP	1.000	T	13	36
LAIR1	3903	genome.wustl.edu	37	19	54866934	54866934	+	Silent	SNP	T	T	C			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr19:54866934T>C	ENST00000391742.2	-	10	959	c.807A>G	c.(805-807)ccA>ccG	p.P269P	LAIR1_ENST00000313038.6_Silent_p.P262P|LAIR1_ENST00000474878.1_Silent_p.P251P|LAIR1_ENST00000434277.2_Silent_p.P268P|LAIR1_ENST00000348231.4_Silent_p.P252P|LAIR1_ENST00000391743.3_Silent_p.P251P|CTD-2587H19.1_ENST00000596234.1_lincRNA|LAIR1_ENST00000463489.1_5'Flank			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	269					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		TTGTGGACTGTGGGGACACAG	0.622													ENSG00000167613																																					0													116.0	107.0	110.0					19																	54866934		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.807A>G	19.37:g.54866934T>C				Silent	SNP	smart_Ig_sub	p.P269	ENST00000391742.2	37	c.807	CCDS12891.1	19																																																																																			-	LAIR1	-	NULL		0.622	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR1	HGNC	protein_coding	OTTHUMT00000140506.1	0	0	0	18	18	97	0.00	0.00	T			54866934	-1	10	26	15	43	tier1	no_errors	ENST00000391742	ensembl	human	known	74_37	silent	40.00	37.68	SNP	0.000	C	10	15
OR1F1	4992	genome.wustl.edu	37	16	3254752	3254752	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr16:3254752G>C	ENST00000304646.2	+	1	506	c.506G>C	c.(505-507)tGt>tCt	p.C169S	AJ003147.9_ENST00000576468.1_RNA	NM_012360.1	NP_036492.1	O43749	OR1F1_HUMAN	olfactory receptor, family 1, subfamily F, member 1	169					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(2)|lung(7)	11						CTCTCATTCTGTGCAGACAAT	0.512													ENSG00000168124																																					0													133.0	111.0	118.0					16																	3254752		2197	4300	6497	SO:0001583	missense	0			-	Y14442	CCDS10496.1	16p13.3	2012-08-09			ENSG00000168124	ENSG00000168124		"""GPCR / Class A : Olfactory receptors"""	8194	protein-coding gene	gene with protein product		603232		OR1F4, OR1F6, OR1F7, OR1F8, OR1F9, OR1F5, OR1F10, OR1F13P		9288094, 9500546	Standard	NM_012360		Approved	Olfmf, OR16-36, OR16-37, OR16-88, OR16-89, OR16-90, OLFMF, OR3-145	uc010uwu.2	O43749	OTTHUMG00000133153	ENST00000304646.2:c.506G>C	16.37:g.3254752G>C	ENSP00000305424:p.Cys169Ser		O15246|Q6IFL5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C169S	ENST00000304646.2	37	c.506	CCDS10496.1	16	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713210	0.48517	.	.	ENSG00000168124	ENST00000304646	T	0.00211	8.54	5.16	5.16	0.70880	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000008	T	0.00845	0.0028	M	0.93854	3.465	0.50039	D	0.999841	D	0.67145	0.996	D	0.72075	0.976	T	0.61520	-0.7046	10	0.66056	D	0.02	.	16.114	0.81289	0.0:0.0:1.0:0.0	.	169	O43749	OR1F1_HUMAN	S	169	ENSP00000305424:C169S	ENSP00000305424:C169S	C	+	2	0	OR1F1	3194753	1.000000	0.71417	0.889000	0.34880	0.357000	0.29423	7.310000	0.78947	2.384000	0.81235	0.393000	0.25936	TGT	-	OR1F1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.512	OR1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1F1	HGNC	protein_coding	OTTHUMT00000206985.1	0	0	0	30	30	55	0.00	0.00	G			3254752	+1	6	13	11	24	tier1	no_errors	ENST00000304646	ensembl	human	known	74_37	missense	35.29	34.21	SNP	1.000	C	6	11
MYL6	4637	genome.wustl.edu	37	12	56553915	56553915	+	Missense_Mutation	SNP	A	A	G	rs1804001		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr12:56553915A>G	ENST00000550697.1	+	4	573	c.332A>G	c.(331-333)cAt>cGt	p.H111R	MYL6_ENST00000547649.1_Missense_Mutation_p.H111R|MYL6_ENST00000348108.4_Missense_Mutation_p.H112R|MYL6_ENST00000536128.1_Missense_Mutation_p.H204R|MYL6_ENST00000549017.1_Missense_Mutation_p.H7R|MYL6_ENST00000293422.5_Missense_Mutation_p.H112R|MYL6_ENST00000548293.1_Missense_Mutation_p.H111R|MYL6_ENST00000548580.1_Missense_Mutation_p.H63R|MYL6_ENST00000551589.1_Missense_Mutation_p.H111R|RP11-603J24.14_ENST00000548731.1_RNA|MYL6_ENST00000547408.1_Missense_Mutation_p.H111R|MYL6_ENST00000548400.1_Missense_Mutation_p.H75R|RP11-977G19.5_ENST00000553176.1_RNA|MYL6_ENST00000549566.1_Missense_Mutation_p.H156R	NM_021019.4	NP_066299.2	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and non-muscle	111	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)|vesicle (GO:0031982)	actin-dependent ATPase activity (GO:0030898)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			large_intestine(1)|lung(1)|ovary(1)|prostate(3)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			GAAATCCGGCATGTTCTTGTC	0.498													ENSG00000092841																																					0													76.0	72.0	74.0					12																	56553915		2203	4300	6503	SO:0001583	missense	0			-	AB046613	CCDS8906.1, CCDS31834.1	12q13.13	2013-01-10	2006-09-29			ENSG00000092841		"""Myosins / Light chain"", ""EF-hand domain containing"""	7587	protein-coding gene	gene with protein product		609931	"""myosin, light polypeptide 6, alkali, smooth muscle and non-muscle"""			8188229, 2304459, 2722814	Standard	NM_021019		Approved	ESMLC, MLC3NM, MLC1SM	uc001sjx.2	P60660		ENST00000550697.1:c.332A>G	12.37:g.56553915A>G	ENSP00000446955:p.His111Arg		P16475|P24572|P24573|Q12790|Q561V9|Q6IAZ0|Q6IPY5	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.H111R	ENST00000550697.1	37	c.332	CCDS8906.1	12	.	.	.	.	.	.	.	.	.	.	A	18.58	3.655185	0.67472	.	.	ENSG00000092841	ENST00000550697;ENST00000548580;ENST00000293422;ENST00000348108;ENST00000549017;ENST00000549566;ENST00000536128;ENST00000547649;ENST00000547408;ENST00000551589;ENST00000553056;ENST00000549392;ENST00000548400;ENST00000548293	D;D;D;D;T;D;D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;1.07;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	4.19	4.19	0.49359	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89178	0.6641	M	0.68317	2.08	0.80722	D	1	D;P;D;D	0.62365	0.99;0.879;0.991;0.971	P;P;P;P	0.58873	0.691;0.609;0.847;0.809	D	0.90368	0.4378	10	0.87932	D	0	.	12.662	0.56820	1.0:0.0:0.0:0.0	.	204;111;111;111	B7Z6Z4;P60660-2;P60660;F8W1R7	.;.;MYL6_HUMAN;.	R	111;63;112;112;7;156;204;111;111;111;111;99;75;111	ENSP00000446955:H111R;ENSP00000446640:H63R;ENSP00000293422:H112R;ENSP00000301540:H112R;ENSP00000449086:H7R;ENSP00000446709:H156R;ENSP00000441750:H204R;ENSP00000446714:H111R;ENSP00000446721:H111R;ENSP00000446687:H111R;ENSP00000450116:H99R;ENSP00000448859:H75R;ENSP00000448101:H111R	ENSP00000293422:H112R	H	+	2	0	MYL6	54840182	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	9.125000	0.94402	1.898000	0.54952	0.379000	0.24179	CAT	-	MYL6	-	smart_EF_hand_dom,pfscan_EF_hand_dom		0.498	MYL6-003	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	MYL6	HGNC	protein_coding	OTTHUMT00000407928.3	0	0	0	71	71	77	0.00	0.00	A			56553915	+1	6	15	8	36	tier1	no_errors	ENST00000547649	ensembl	human	known	74_37	missense	42.86	29.41	SNP	1.000	G	6	8
PDGFRB	5159	genome.wustl.edu	37	5	149501616	149501616	+	Intron	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr5:149501616G>A	ENST00000261799.4	-	16	2653					NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide						adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGGGGTAAAGGAGCATCACAG	0.567			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""								ENSG00000113721																												Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	0													104.0	87.0	93.0					5																	149501616		2203	4300	6503	SO:0001627	intron_variant	0			-	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.2184-13C>T	5.37:g.149501616G>A			B5A957|Q8N5L4	R	SNP	-	NULL	ENST00000261799.4	37	NULL	CCDS4303.1	5																																																																																			-	PDGFRB	-	-		0.567	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	HGNC	protein_coding	OTTHUMT00000252332.1	0	0	0	30	30	51	0.00	0.00	G	NM_002609		149501616	-1	5	12	19	28	tier1	no_errors	ENST00000519575	ensembl	human	known	74_37	rna	20.83	29.27	SNP	0.078	A	5	19
ITIH5	80760	genome.wustl.edu	37	10	7657968	7657968	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr10:7657968T>C	ENST00000256861.6	-	7	994	c.916A>G	c.(916-918)Atg>Gtg	p.M306V	ITIH5_ENST00000298441.6_Missense_Mutation_p.M92V|ITIH5_ENST00000397145.2_Missense_Mutation_p.M306V|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397146.2_Missense_Mutation_p.M306V|ITIH5_ENST00000446830.2_Missense_Mutation_p.M88V	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	306	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GTTCCCACCATAGAAGCACTG	0.478													ENSG00000123243																																					0													124.0	116.0	119.0					10																	7657968		2203	4300	6503	SO:0001583	missense	0			-			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.916A>G	10.37:g.7657968T>C	ENSP00000256861:p.Met306Val		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.M306V	ENST00000256861.6	37	c.916		10	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216075	0.79352	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	6.08	6.08	0.98989	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.91479	0.7310	.	.	.	0.54753	D	0.999985	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.987;0.957	D	0.92399	0.5928	9	0.87932	D	0	-58.5449	16.3164	0.82930	0.0:0.0:0.0:1.0	.	306;306;92	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	V	306;306;92;88;306	ENSP00000256861:M306V;ENSP00000380333:M306V;ENSP00000298441:M92V;ENSP00000387969:M88V;ENSP00000380332:M306V	ENSP00000256861:M306V	M	-	1	0	ITIH5	7697974	1.000000	0.71417	0.998000	0.56505	0.746000	0.42486	7.477000	0.81069	2.330000	0.79161	0.533000	0.62120	ATG	-	ITIH5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.478	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	0	0	0	95	95	159	0.00	0.00	T	NM_030569		7657968	-1	25	40	22	48	tier1	no_errors	ENST00000256861	ensembl	human	known	74_37	missense	53.19	45.45	SNP	1.000	C	25	22
HIST1H2AC	8334	genome.wustl.edu	37	6	26124497	26124497	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr6:26124497G>A	ENST00000602637.1	+	1	67	c.37G>A	c.(37-39)Gcc>Acc	p.A13T	HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2AC_ENST00000377791.2_Missense_Mutation_p.A13T			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	13						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						CAAAGCTCGCGCCAAAGCGAA	0.557													ENSG00000180573																																					0													54.0	54.0	54.0					6																	26124497		2203	4300	6503	SO:0001583	missense	0			-	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.37G>A	6.37:g.26124497G>A	ENSP00000473534:p.Ala13Thr		B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.A13T	ENST00000602637.1	37	c.37	CCDS4585.1	6	.	.	.	.	.	.	.	.	.	.	.	21.3	4.131684	0.77662	.	.	ENSG00000180573	ENST00000377791;ENST00000314088	T;T	0.44083	0.93;0.93	5.78	5.78	0.91487	Histone-fold (2);Histone H2A (1);	0.000000	0.44285	D	0.000478	T	0.17365	0.0417	N	0.21545	0.675	0.53005	D	0.999963	P	0.41546	0.754	B	0.28916	0.096	T	0.03555	-1.1025	10	0.40728	T	0.16	.	19.3632	0.94451	0.0:0.0:1.0:0.0	.	13	Q93077	H2A1C_HUMAN	T	13	ENSP00000367022:A13T;ENSP00000321389:A13T	ENSP00000321389:A13T	A	+	1	0	HIST1H2AC	26232476	1.000000	0.71417	0.332000	0.25469	0.097000	0.18754	9.565000	0.98154	2.894000	0.99253	0.591000	0.81541	GCC	-	HIST1H2AC	-	superfamily_Histone-fold,smart_Histone_H2A		0.557	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AC	HGNC	protein_coding	OTTHUMT00000468023.1	0	0	0	61	61	61	0.00	0.00	G	NM_003512		26124497	+1	20	23	38	34	tier1	no_errors	ENST00000314088	ensembl	human	known	74_37	missense	34.48	40.35	SNP	1.000	A	20	38
C4orf22	255119	genome.wustl.edu	37	4	81791167	81791167	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr4:81791167C>G	ENST00000358105.3	+	4	403	c.354C>G	c.(352-354)gaC>gaG	p.D118E	C4orf22_ENST00000508675.1_Missense_Mutation_p.D135E	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22	118										NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						TTATTCGTGACAGAAATTCTC	0.363													ENSG00000197826																																					0													106.0	108.0	108.0					4																	81791167		2203	4300	6503	SO:0001583	missense	0			-	BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.354C>G	4.37:g.81791167C>G	ENSP00000350818:p.Asp118Glu		E7EQ13|Q6ZQY4|Q8N4G9	Missense_Mutation	SNP	NULL	p.D135E	ENST00000358105.3	37	c.405	CCDS3587.1	4	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104416	0.37145	.	.	ENSG00000197826	ENST00000358105;ENST00000508675	T;T	0.31510	1.49;1.49	4.77	3.93	0.45458	.	0.000000	0.85682	D	0.000000	T	0.56992	0.2023	M	0.91090	3.175	0.31966	N	0.607824	D;D	0.89917	1.0;0.997	D;D	0.79784	0.993;0.948	T	0.65096	-0.6251	10	0.34782	T	0.22	-14.6608	6.9769	0.24681	0.0:0.725:0.0:0.275	.	135;118	E7EQ13;Q6V702	.;CD022_HUMAN	E	118;135	ENSP00000350818:D118E;ENSP00000425786:D135E	ENSP00000350818:D118E	D	+	3	2	C4orf22	82010191	0.996000	0.38824	0.998000	0.56505	0.120000	0.20174	1.129000	0.31381	1.120000	0.41904	0.585000	0.79938	GAC	-	C4orf22	-	NULL		0.363	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf22	HGNC	protein_coding	OTTHUMT00000252629.2	0	0	0	62	62	123	0.00	0.00	C	NM_152770		81791167	+1	15	20	18	68	tier1	no_errors	ENST00000508675	ensembl	human	known	74_37	missense	45.45	22.73	SNP	0.999	G	15	18
COPB2	9276	genome.wustl.edu	37	3	139085946	139085946	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr3:139085946C>G	ENST00000333188.5	-	14	1768	c.1587G>C	c.(1585-1587)tgG>tgC	p.W529C	COPB2_ENST00000507777.1_Missense_Mutation_p.W500C	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	529					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						AATCGCCTACCCAAAGCCCTG	0.368													ENSG00000184432																																					0													88.0	93.0	91.0					3																	139085946		2203	4300	6503	SO:0001583	missense	0			-	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.1587G>C	3.37:g.139085946C>G	ENSP00000329419:p.Trp529Cys		B4DZI8	Missense_Mutation	SNP	pirsf_COPB2,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W529C	ENST00000333188.5	37	c.1587	CCDS3108.1	3	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117026	0.77323	.	.	ENSG00000184432	ENST00000333188;ENST00000507777;ENST00000512309	T;D	0.89875	-1.19;-2.58	5.73	5.73	0.89815	Coatomer, WD associated region (1);	0.106321	0.64402	D	0.000001	D	0.96670	0.8913	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97424	1.0011	10	0.87932	D	0	-17.5309	19.8804	0.96895	0.0:1.0:0.0:0.0	.	529	P35606	COPB2_HUMAN	C	529;500;152	ENSP00000329419:W529C;ENSP00000422295:W500C	ENSP00000329419:W529C	W	-	3	0	COPB2	140568636	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.743000	0.85020	2.702000	0.92279	0.467000	0.42956	TGG	-	COPB2	-	pirsf_COPB2,pfam_Coatomer_WD-assoc_reg		0.368	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB2	HGNC	protein_coding	OTTHUMT00000358495.2	0	0	0	122	122	152	0.00	0.00	C	NM_004766		139085946	-1	25	23	80	113	tier1	no_errors	ENST00000333188	ensembl	human	known	74_37	missense	23.81	16.79	SNP	1.000	G	25	80
BMS1P17	101101776	genome.wustl.edu	37	14	19670720	19670720	+	lincRNA	SNP	A	A	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr14:19670720A>T	ENST00000418499.3	+	0	711				BMS1P17_ENST00000550512.1_lincRNA																							TAAAAAGAAAAGTTTGTCTTC	0.294													ENSG00000228294																																					0																																												0			-																													14.37:g.19670720A>T				R	SNP	-	NULL	ENST00000418499.3	37	NULL		14																																																																																			-	BMS1P17	-	-		0.294	AL589743.1-003	KNOWN	basic	lincRNA	BMS1P17	HGNC	lincRNA	OTTHUMT00000317887.3	0	0	0	19	19	45	0.00	0.00	A			19670720	-1	6	16	9	26	tier1	no_errors	ENST00000550512	ensembl	human	known	74_37	rna	40.00	38.10	SNP	0.051	T	6	9
AHCTF1	25909	genome.wustl.edu	37	1	247063653	247063653	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr1:247063653C>A	ENST00000391829.2	-	9	1359	c.1236G>T	c.(1234-1236)atG>atT	p.M412I	AHCTF1_ENST00000470300.1_5'Flank|AHCTF1_ENST00000326225.3_Missense_Mutation_p.M421I|AHCTF1_ENST00000366508.1_Missense_Mutation_p.M447I			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	412	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ACGAATCTGGCATTTGTGCAT	0.343													ENSG00000153207																									Colon(145;197 1800 4745 15099 26333)												0													67.0	73.0	71.0					1																	247063653		2203	4300	6503	SO:0001583	missense	0			-		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.1236G>T	1.37:g.247063653C>A	ENSP00000375705:p.Met412Ile		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.M421I	ENST00000391829.2	37	c.1263		1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491310	0.84962	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.54479	0.57;0.57;0.58	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.64483	0.2602	L	0.34521	1.04	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.75484	0.986;0.986	T	0.68059	-0.5509	10	0.72032	D	0.01	-20.0011	18.667	0.91493	0.0:1.0:0.0:0.0	.	447;412	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	I	447;421;412	ENSP00000355464:M447I;ENSP00000355465:M421I;ENSP00000375705:M412I	ENSP00000355465:M421I	M	-	3	0	AHCTF1	245130276	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.256000	0.78350	2.483000	0.83821	0.455000	0.32223	ATG	-	AHCTF1	-	NULL		0.343	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		0	0	0	102	102	102	0.00	0.00	C	NM_015446		247063653	-1	27	31	16	16	tier1	no_errors	ENST00000326225	ensembl	human	known	74_37	missense	62.79	65.96	SNP	1.000	A	27	16
ZNF90	7643	genome.wustl.edu	37	19	20229235	20229235	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr19:20229235G>A	ENST00000418063.2	+	4	984	c.872G>A	c.(871-873)gGc>gAc	p.G291D	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	291					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						GATAAATGTGGCAGAGCATTT	0.373													ENSG00000213988																																					0													74.0	76.0	75.0					19																	20229235		692	1591	2283	SO:0001583	missense	0			-	M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.872G>A	19.37:g.20229235G>A	ENSP00000410466:p.Gly291Asp		B9EH87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G291D	ENST00000418063.2	37	c.872	CCDS46028.1	19	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920918	0.33908	.	.	ENSG00000213988	ENST00000418063	T	0.07021	3.23	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19046	0.0457	L	0.54323	1.7	0.33182	D	0.549733	D	0.89917	1.0	D	0.97110	1.0	T	0.15636	-1.0430	8	.	.	.	.	7.3123	0.26481	0.0:0.0:1.0:0.0	.	291	Q03938	ZNF90_HUMAN	D	291	ENSP00000410466:G291D	.	G	+	2	0	ZNF90	20090235	1.000000	0.71417	0.009000	0.14445	0.009000	0.06853	3.003000	0.49505	0.181000	0.19994	0.184000	0.17185	GGC	-	ZNF90	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.373	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	0	0	0	65	65	17	0.00	0.00	G	NM_007138		20229235	+1	20	7	33	11	tier1	no_errors	ENST00000418063	ensembl	human	known	74_37	missense	37.74	38.89	SNP	0.989	A	20	33
WDR63	126820	genome.wustl.edu	37	1	85555896	85555896	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr1:85555896C>T	ENST00000294664.6	+	8	1018	c.838C>T	c.(838-840)Ctt>Ttt	p.L280F	WDR63_ENST00000370596.1_Intron|WDR63_ENST00000326813.8_Intron	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	280										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		GGTTGATTTTCTTAACAATGC	0.269													ENSG00000162643																																					0													38.0	40.0	40.0					1																	85555896		2199	4292	6491	SO:0001583	missense	0			-		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.838C>T	1.37:g.85555896C>T	ENSP00000294664:p.Leu280Phe		A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.L280F	ENST00000294664.6	37	c.838	CCDS702.1	1	.	.	.	.	.	.	.	.	.	.	C	3.472	-0.107654	0.06924	.	.	ENSG00000162643	ENST00000294664	T	0.45276	0.9	5.6	3.73	0.42828	.	0.514246	0.21736	N	0.069881	T	0.12263	0.0298	L	0.39085	1.19	0.28061	N	0.932953	B	0.12013	0.005	B	0.09377	0.004	T	0.18524	-1.0334	10	0.29301	T	0.29	-20.1337	6.4425	0.21856	0.0:0.6885:0.1497:0.1618	.	280	Q8IWG1	WDR63_HUMAN	F	280	ENSP00000294664:L280F	ENSP00000294664:L280F	L	+	1	0	WDR63	85328484	0.998000	0.40836	0.989000	0.46669	0.075000	0.17131	0.535000	0.23114	0.712000	0.32039	-0.218000	0.12543	CTT	-	WDR63	-	NULL		0.269	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR63	HGNC	protein_coding	OTTHUMT00000027565.2	0	0	0	99	99	77	0.00	0.00	C	NM_145172		85555896	+1	20	22	58	34	tier1	no_errors	ENST00000294664	ensembl	human	known	74_37	missense	25.64	39.29	SNP	0.999	T	20	58
LAMTOR1	55004	genome.wustl.edu	37	11	71809346	71809346	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr11:71809346C>T	ENST00000278671.5	-	4	544	c.382G>A	c.(382-384)Gat>Aat	p.D128N	LRTOMT_ENST00000439209.1_Intron|LAMTOR1_ENST00000538404.1_Missense_Mutation_p.D128N|LRTOMT_ENST00000307198.7_Intron|LAMTOR1_ENST00000545249.1_Missense_Mutation_p.D128N|LAMTOR1_ENST00000535107.1_Intron|LRTOMT_ENST00000419228.1_Intron|LAMTOR1_ENST00000539797.1_5'UTR|LRTOMT_ENST00000435085.1_Intron	NM_017907.2	NP_060377.1	Q6IAA8	LTOR1_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1	128	Interaction with LAMTOR2 and LAMTOR3. {ECO:0000250}.				cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|cholesterol homeostasis (GO:0042632)|endosome localization (GO:0032439)|endosome organization (GO:0007032)|lysosome localization (GO:0032418)|lysosome organization (GO:0007040)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of TOR signaling (GO:0032008)|regulation of cholesterol efflux (GO:0010874)|regulation of cholesterol esterification (GO:0010872)|regulation of cholesterol import (GO:0060620)|regulation of receptor recycling (GO:0001919)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|Ragulator complex (GO:0071986)				cervix(1)	1						TGCTGCAAATCAGAGAACGGG	0.622													ENSG00000149357																																					0													53.0	50.0	51.0					11																	71809346		2200	4293	6493	SO:0001583	missense	0			-	AK000632	CCDS8209.1	11q13.4	2011-05-18	2011-02-15	2011-02-15	ENSG00000149357	ENSG00000149357			26068	protein-coding gene	gene with protein product	"""p27kip1 releasing factor from RhoA"", ""protein associated with DRMs and endosomes"""	613510	"""chromosome 11 open reading frame 59"""	C11orf59		12358155	Standard	NM_017907		Approved	FLJ20625, p18, p27RF-Rho, Pdro, Ragulator1	uc001ort.3	Q6IAA8	OTTHUMG00000167869	ENST00000278671.5:c.382G>A	11.37:g.71809346C>T	ENSP00000278671:p.Asp128Asn		Q8WZ09|Q9NWT0	Missense_Mutation	SNP	NULL	p.D128N	ENST00000278671.5	37	c.382	CCDS8209.1	11	.	.	.	.	.	.	.	.	.	.	C	19.82	3.897981	0.72639	.	.	ENSG00000149357	ENST00000545249;ENST00000278671;ENST00000538404	T;T;T	0.61158	0.23;0.57;0.13	5.67	4.76	0.60689	.	0.109244	0.64402	N	0.000011	T	0.66906	0.2837	L	0.60455	1.87	0.80722	D	1	B;D	0.56521	0.197;0.976	B;P	0.56398	0.119;0.797	T	0.68372	-0.5426	10	0.48119	T	0.1	.	14.172	0.65514	0.0:0.9271:0.0:0.0729	.	128;128	F5H3Y3;Q6IAA8	.;LTOR1_HUMAN	N	128	ENSP00000440738:D128N;ENSP00000278671:D128N;ENSP00000439011:D128N	ENSP00000278671:D128N	D	-	1	0	LAMTOR1	71486994	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	6.991000	0.76232	1.398000	0.46701	0.563000	0.77884	GAT	-	LAMTOR1	-	NULL		0.622	LAMTOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMTOR1	HGNC	protein_coding	OTTHUMT00000396733.1	0	0	0	36	36	29	0.00	0.00	C	NM_017907		71809346	-1	9	5	16	25	tier1	no_errors	ENST00000278671	ensembl	human	known	74_37	missense	36.00	16.67	SNP	1.000	T	9	16
PDE1C	5137	genome.wustl.edu	37	7	31864525	31864525	+	Silent	SNP	G	G	A	rs564932801		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr7:31864525G>A	ENST00000396191.1	-	13	1817	c.1362C>T	c.(1360-1362)atC>atT	p.I454I	PDE1C_ENST00000396184.3_Silent_p.I454I|PDE1C_ENST00000396182.2_Silent_p.I454I|PDE1C_ENST00000321453.7_Silent_p.I454I|PDE1C_ENST00000396193.1_Silent_p.I514I	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	454	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	AGGTTTCATCGATTAATGGAC	0.498													ENSG00000154678	G|||	1	0.000199681	0.0	0.0	5008	,	,		20028	0.0		0.0	False		,,,				2504	0.001																0													185.0	155.0	165.0					7																	31864525		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1362C>T	7.37:g.31864525G>A			B3KPC6|E9PE92|Q14124|Q8NB10	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.I454	ENST00000396191.1	37	c.1362	CCDS55099.1	7																																																																																			-	PDE1C	-	pfam_PDEase_catalytic_dom		0.498	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	0	0	0	56	56	124	0.00	0.00	G			31864525	-1	19	29	15	28	tier1	no_errors	ENST00000321453	ensembl	human	known	74_37	silent	55.88	50.88	SNP	0.834	A	19	15
MYH11	4629	genome.wustl.edu	37	16	15832545	15832545	+	Splice_Site	SNP	C	C	G			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr16:15832545C>G	ENST00000300036.5	-	24	3107	c.2998G>C	c.(2998-3000)Gaa>Caa	p.E1000Q	MYH11_ENST00000396324.3_Splice_Site_p.E1007Q|MYH11_ENST00000576790.2_Splice_Site_p.E1000Q|MYH11_ENST00000452625.2_Splice_Site_p.E1007Q|AF001548.6_ENST00000577048.1_RNA	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1000					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AGTTTTCGTTCCTTTTTGGGG	0.353			T	CBFB	AML								ENSG00000133392																												Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													113.0	106.0	108.0					16																	15832545		2197	4300	6497	SO:0001630	splice_region_variant	0			-	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2998-1G>C	16.37:g.15832545C>G			D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SRE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.E1007Q	ENST00000300036.5	37	c.3019	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249919	0.59212	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99	4.3	4.3	0.51218	.	0.117593	0.56097	D	0.000029	D	0.90246	0.6950	M	0.93283	3.4	0.80722	D	1	B;B;B;B;B	0.24882	0.113;0.008;0.008;0.008;0.003	B;B;B;B;B	0.33454	0.164;0.063;0.105;0.063;0.03	D	0.91133	0.4939	10	0.87932	D	0	.	16.1203	0.81346	0.0:1.0:0.0:0.0	.	1007;1000;1007;1000;1007	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	Q	1000;1000;1007;1007;1007	ENSP00000300036:E1000Q;ENSP00000345136:E1000Q;ENSP00000379616:E1007Q;ENSP00000407821:E1007Q	ENSP00000300036:E1000Q	E	-	1	0	MYH11	15740046	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.587000	0.82613	2.117000	0.64856	0.555000	0.69702	GAA	-	MYH11	-	superfamily_Prefoldin		0.353	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	0	0	0	88	88	117	0.00	0.00	C	NM_001040113	Missense_Mutation	15832545	-1	22	24	47	79	tier1	no_errors	ENST00000396324	ensembl	human	known	74_37	missense	31.88	23.08	SNP	1.000	G	22	47
AIM1	202	genome.wustl.edu	37	6	106968274	106968274	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr6:106968274G>A	ENST00000369066.3	+	2	2454	c.1967G>A	c.(1966-1968)gGa>gAa	p.G656E		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CCCAGCAGCGGAAATCACTTA	0.517													ENSG00000112297																																					0													51.0	49.0	50.0					6																	106968274		2203	4300	6503	SO:0001583	missense	0			-	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1967G>A	6.37:g.106968274G>A	ENSP00000358062:p.Gly656Glu		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.G656E	ENST00000369066.3	37	c.1967	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	10.33	1.319058	0.23994	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.70282	-0.47	5.45	3.34	0.38264	.	1.007710	0.07983	N	0.985969	T	0.30510	0.0767	L	0.29908	0.895	0.09310	N	0.999994	B	0.20261	0.043	B	0.19946	0.027	T	0.31888	-0.9927	10	0.02654	T	1	.	8.5241	0.33293	0.205:0.0:0.795:0.0	.	656	Q9Y4K1	AIM1_HUMAN	E	1064;656	ENSP00000358062:G656E	ENSP00000285105:G1064E	G	+	2	0	AIM1	107074967	0.000000	0.05858	0.003000	0.11579	0.031000	0.12232	0.040000	0.13905	1.309000	0.44985	0.655000	0.94253	GGA	-	AIM1	-	NULL		0.517	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	0	0	0	21	21	97	0.00	0.00	G			106968274	+1	8	28	19	61	tier1	no_errors	ENST00000369066	ensembl	human	known	74_37	missense	29.63	31.11	SNP	0.001	A	8	19
CSPG5	10675	genome.wustl.edu	37	3	47610660	47610660	+	Silent	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr3:47610660G>A	ENST00000383738.2	-	4	3538	c.1440C>T	c.(1438-1440)gcC>gcT	p.A480A	CSPG5_ENST00000456150.1_Silent_p.A342A|CSPG5_ENST00000264723.4_Silent_p.A480A	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	480					axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GAGAGCCCTCGGCAATGGTGG	0.498													ENSG00000114646																																					0													141.0	120.0	127.0					3																	47610660		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.1440C>T	3.37:g.47610660G>A			Q71M39|Q71M40	Silent	SNP	pfam_Chon_Sulph_att,pfam_Neural_ProG_Cyt	p.A480	ENST00000383738.2	37	c.1440	CCDS56253.1	3																																																																																			-	CSPG5	-	pfam_Neural_ProG_Cyt		0.498	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG5	HGNC	protein_coding	OTTHUMT00000257489.1	0	0	0	90	90	122	0.00	0.00	G	NM_006574		47610660	-1	31	33	13	34	tier1	no_errors	ENST00000383738	ensembl	human	known	74_37	silent	70.45	49.25	SNP	0.959	A	31	13
PCDHA7	56141	genome.wustl.edu	37	5	140214124	140214124	+	Silent	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr5:140214124G>A	ENST00000525929.1	+	1	156	c.156G>A	c.(154-156)ctG>ctA	p.L52L	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000378125.3_Silent_p.L52L|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	52	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCAGGACCTGGGGCTGGAGC	0.602													ENSG00000204963																									NSCLC(160;258 2013 5070 22440 28951)												0													61.0	76.0	71.0					5																	140214124		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.156G>A	5.37:g.140214124G>A			O75282	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L52	ENST00000525929.1	37	c.156	CCDS54918.1	5																																																																																			-	PCDHA7	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin		0.602	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	0	0	0	100	100	41	0.00	0.00	G	NM_018910		140214124	+1	21	15	48	14	tier1	no_errors	ENST00000525929	ensembl	human	known	74_37	silent	30.43	51.72	SNP	0.998	A	21	48
CDH4	1002	genome.wustl.edu	37	20	60511837	60511837	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr20:60511837G>T	ENST00000360469.5	+	16	2675	c.2587G>T	c.(2587-2589)Gac>Tac	p.D863Y	CDH4_ENST00000543233.1_Missense_Mutation_p.D789Y	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	863					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ACCCCCCTATGACTCCCTGCT	0.632													ENSG00000179242																																					0													45.0	44.0	44.0					20																	60511837		2202	4300	6502	SO:0001583	missense	0			-	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.2587G>T	20.37:g.60511837G>T	ENSP00000353656:p.Asp863Tyr		B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.D863Y	ENST00000360469.5	37	c.2587	CCDS13488.1	20	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010290	0.75046	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	D;D	0.89681	-2.55;-2.55	4.49	4.49	0.54785	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.96355	0.8811	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98041	1.0382	9	.	.	.	.	17.1925	0.86883	0.0:0.0:1.0:0.0	.	863	P55283	CADH4_HUMAN	Y	863;771;789	ENSP00000353656:D863Y;ENSP00000443301:D789Y	.	D	+	1	0	CDH4	59945232	1.000000	0.71417	0.985000	0.45067	0.510000	0.34073	9.580000	0.98207	2.068000	0.61886	0.467000	0.42956	GAC	-	CDH4	-	pfam_Cadherin_cytoplasmic-dom		0.632	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	0	0	0	39	39	45	0.00	0.00	G	NM_001794		60511837	+1	11	17	15	22	tier1	no_errors	ENST00000360469	ensembl	human	known	74_37	missense	42.31	43.59	SNP	1.000	T	11	15
MUC21	394263	genome.wustl.edu	37	6	30954828	30954828	+	Silent	SNP	A	A	C	rs41318569		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr6:30954828A>C	ENST00000376296.3	+	2	1117	c.876A>C	c.(874-876)acA>acC	p.T292T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	292	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AGTCCAGCACACCCTCCAGTG	0.602													ENSG00000204544																																					0													199.0	191.0	193.0					6																	30954828		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.876A>C	6.37:g.30954828A>C			B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	NULL	p.T292	ENST00000376296.3	37	c.876	CCDS34388.1	6																																																																																			-	MUC21	-	NULL		0.602	MUC21-001	KNOWN	basic|CCDS	protein_coding	MUC21	HGNC	protein_coding	OTTHUMT00000128579.3	0	0	0	63	63	26	0.00	0.00	A	NM_001010909		30954828	+1	13	9	24	12	tier1	no_errors	ENST00000376296	ensembl	human	known	74_37	silent	35.14	42.86	SNP	0.000	C	13	24
ALPL	249	genome.wustl.edu	37	1	21903986	21903986	+	Missense_Mutation	SNP	G	G	C	rs376354718		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr1:21903986G>C	ENST00000374840.3	+	12	1670	c.1420G>C	c.(1420-1422)Gtc>Ctc	p.V474L	ALPL_ENST00000540617.1_Missense_Mutation_p.V419L|ALPL_ENST00000425315.2_Missense_Mutation_p.V474L|ALPL_ENST00000374830.1_Missense_Mutation_p.V120L|ALPL_ENST00000374829.1_Missense_Mutation_p.V120L|ALPL_ENST00000374832.1_Missense_Mutation_p.V474L|ALPL_ENST00000539907.1_Missense_Mutation_p.V397L	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	474					cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	GCTGCACGGCGTCCACGAGCA	0.692													ENSG00000162551																																					0													53.0	48.0	50.0					1																	21903986		2203	4299	6502	SO:0001583	missense	0			-	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.1420G>C	1.37:g.21903986G>C	ENSP00000363973:p.Val474Leu		A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.V474L	ENST00000374840.3	37	c.1420	CCDS217.1	1	.	.	.	.	.	.	.	.	.	.	g	17.02	3.281989	0.59867	.	.	ENSG00000162551	ENST00000539907;ENST00000540617;ENST00000374840;ENST00000374832;ENST00000425315;ENST00000374830;ENST00000374829	D;D;D;D;D;D;D	0.95980	-3.87;-3.87;-3.87;-3.87;-3.87;-3.87;-3.87	4.91	4.0	0.46444	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.95010	0.8385	L	0.60845	1.875	0.51233	D	0.999915	B;P;P	0.48350	0.404;0.909;0.84	B;P;B	0.51385	0.385;0.668;0.422	D	0.93948	0.7229	10	0.48119	T	0.1	-44.3759	10.5861	0.45284	0.093:0.0:0.907:0.0	.	397;422;474	B7Z387;B7Z1D1;P05186	.;.;PPBT_HUMAN	L	397;419;474;474;474;120;120	ENSP00000437674:V397L;ENSP00000442672:V419L;ENSP00000363973:V474L;ENSP00000363965:V474L;ENSP00000394765:V474L;ENSP00000363963:V120L;ENSP00000363962:V120L	ENSP00000363962:V120L	V	+	1	0	ALPL	21776573	1.000000	0.71417	0.996000	0.52242	0.908000	0.53690	9.204000	0.95041	1.306000	0.44926	0.556000	0.70494	GTC	-	ALPL	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase		0.692	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALPL	HGNC	protein_coding	OTTHUMT00000008202.1	0	0	0	65	65	20	0.00	0.00	G	NM_000478		21903986	+1	19	10	31	11	tier1	no_errors	ENST00000374832	ensembl	human	known	74_37	missense	38.00	45.45	SNP	1.000	C	19	31
PIGB	9488	genome.wustl.edu	37	15	55647016	55647016	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr15:55647016C>T	ENST00000164305.5	+	11	1649	c.1358C>T	c.(1357-1359)cCc>cTc	p.P453L	PIGB_ENST00000539642.1_Missense_Mutation_p.P258L|DYX1C1-CCPG1_ENST00000565113.1_RNA	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	453					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		TGCCCACTTCCCATGAGATTT	0.348													ENSG00000069943																																					0													67.0	61.0	63.0					15																	55647016		1863	4095	5958	SO:0001583	missense	0			-	D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.1358C>T	15.37:g.55647016C>T	ENSP00000164305:p.Pro453Leu		Q53FF9|Q8WVN7	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.P453L	ENST00000164305.5	37	c.1358		15	.	.	.	.	.	.	.	.	.	.	C	10.91	1.483824	0.26598	.	.	ENSG00000069943	ENST00000164305;ENST00000539642	T;T	0.59906	0.54;0.23	5.87	5.87	0.94306	.	0.230190	0.43919	D	0.000518	T	0.54983	0.1892	M	0.68593	2.085	0.80722	D	1	B	0.12013	0.005	B	0.14578	0.011	T	0.48980	-0.8986	10	0.28530	T	0.3	-4.2926	12.7486	0.57296	0.257:0.743:0.0:0.0	.	453	Q92521	PIGB_HUMAN	L	453;258	ENSP00000164305:P453L;ENSP00000438963:P258L	ENSP00000164305:P453L	P	+	2	0	PIGB	53434308	0.976000	0.34144	0.366000	0.25914	0.502000	0.33828	2.753000	0.47524	2.785000	0.95823	0.591000	0.81541	CCC	-	PIGB	-	NULL		0.348	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	PIGB	HGNC	protein_coding	OTTHUMT00000419687.1	0	0	0	37	37	116	0.00	0.00	C	NM_004855		55647016	+1	16	23	21	42	tier1	no_errors	ENST00000164305	ensembl	human	known	74_37	missense	43.24	35.38	SNP	0.930	T	16	21
ALDH9A1	223	genome.wustl.edu	37	1	165649861	165649861	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr1:165649861C>A	ENST00000354775.4	-	5	956	c.652G>T	c.(652-654)Gaa>Taa	p.E218*	ALDH9A1_ENST00000461664.1_5'UTR|ALDH9A1_ENST00000538148.1_Nonsense_Mutation_p.E124*	NM_000696.3	NP_000687.3	P49189	AL9A1_HUMAN	aldehyde dehydrogenase 9 family, member A1	194					carnitine biosynthetic process (GO:0045329)|cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|hormone metabolic process (GO:0042445)|kidney development (GO:0001822)|liver development (GO:0001889)|neurotransmitter biosynthetic process (GO:0042136)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	1-pyrroline dehydrogenase activity (GO:0033737)|3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|4-trimethylammoniobutyraldehyde dehydrogenase activity (GO:0047105)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|amine binding (GO:0043176)|aminobutyraldehyde dehydrogenase activity (GO:0019145)|NAD binding (GO:0051287)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	21	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					CTGTAGATTTCAGCCAGTAGC	0.488													ENSG00000143149																									Ovarian(179;1583 2014 18106 33801 42447)												0													107.0	109.0	108.0					1																	165649861		2203	4300	6503	SO:0001587	stop_gained	0			-	U34252	CCDS1250.2	1q22-q23	2008-02-05			ENSG00000143149	ENSG00000143149		"""Aldehyde dehydrogenases"""	412	protein-coding gene	gene with protein product		602733		ALDH7, ALDH4, ALDH9		8112751, 8786138	Standard	NM_000696		Approved	E3	uc001gdh.1	P49189	OTTHUMG00000034677	ENST00000354775.4:c.652G>T	1.37:g.165649861C>A	ENSP00000346827:p.Glu218*		B2R6X1|B4DXY7|Q5VV90|Q6LCL1|Q9NZT7	Nonsense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.E218*	ENST00000354775.4	37	c.652	CCDS1250.2	1	.	.	.	.	.	.	.	.	.	.	C	41	8.761812	0.98943	.	.	ENSG00000143149	ENST00000354775;ENST00000538148	.	.	.	5.63	4.7	0.59300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	12.8189	0.57681	0.0:0.9187:0.0:0.0813	.	.	.	.	X	218;124	.	ENSP00000346827:E218X	E	-	1	0	ALDH9A1	163916485	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	7.619000	0.83057	2.644000	0.89710	0.655000	0.94253	GAA	-	ALDH9A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH		0.488	ALDH9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH9A1	HGNC	protein_coding	OTTHUMT00000083899.1	0	0	0	74	74	156	0.00	0.00	C			165649861	-1	22	28	59	184	tier1	no_errors	ENST00000354775	ensembl	human	known	74_37	nonsense	27.16	13.15	SNP	1.000	A	22	59
USP44	84101	genome.wustl.edu	37	12	95927128	95927128	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr12:95927128delA	ENST00000258499.3	-	2	1193	c.905delT	c.(904-906)ttafs	p.L302fs	USP44_ENST00000393091.2_Frame_Shift_Del_p.L302fs|USP44_ENST00000537435.2_Frame_Shift_Del_p.L302fs|USP44_ENST00000552440.1_Frame_Shift_Del_p.L302fs	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	302	USP.				mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						ATCAAGCTTTAAAAAACATTG	0.368													ENSG00000136014																																					0													56.0	58.0	57.0					12																	95927128		2203	4300	6503	SO:0001589	frameshift_variant	0				AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.905delT	12.37:g.95927128delA	ENSP00000258499:p.Leu302fs		B2RDW3	Frame_Shift_Del	DEL	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.L302fs	ENST00000258499.3	37	c.905	CCDS9053.1	12																																																																																				USP44	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.368	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP44	HGNC	protein_coding	OTTHUMT00000408312.1	0	0	0	36	36	121	0.00	0.00	A	NM_032147		95927128	-1	6	10	23	51	tier1	no_errors	ENST00000258499	ensembl	human	known	74_37	frame_shift_del	20.69	16.39	DEL	1.000	-	6	23
BMS1	9790	genome.wustl.edu	37	10	43285807	43285807	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr10:43285807A>G	ENST00000374518.5	+	5	547	c.484A>G	c.(484-486)Atg>Gtg	p.M162V		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	162	Bms1-type G.				ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGGGTTTGAAATGGAAACGTT	0.393													ENSG00000165733																																					0													144.0	144.0	144.0					10																	43285807		2203	4298	6501	SO:0001583	missense	0			-	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.484A>G	10.37:g.43285807A>G	ENSP00000363642:p.Met162Val		Q5QPT5|Q86XJ9	Missense_Mutation	SNP	pfam_BMS1_TSR1_C,pfam_AARP2CN,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_AARP2CN	p.M162V	ENST00000374518.5	37	c.484	CCDS7199.1	10	.	.	.	.	.	.	.	.	.	.	a	22.2	4.253865	0.80135	.	.	ENSG00000165733	ENST00000374518	T	0.10763	2.84	5.28	5.28	0.74379	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.30135	0.0755	M	0.74258	2.255	0.54753	D	0.999985	D	0.54772	0.968	P	0.60886	0.88	T	0.01839	-1.1263	10	0.42905	T	0.14	.	15.3524	0.74399	1.0:0.0:0.0:0.0	.	162	Q14692	BMS1_HUMAN	V	162	ENSP00000363642:M162V	ENSP00000363642:M162V	M	+	1	0	BMS1	42605813	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.125000	0.94402	2.030000	0.59900	0.402000	0.26972	ATG	-	BMS1	-	pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase		0.393	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMS1	HGNC	protein_coding	OTTHUMT00000047690.2	0	0	0	349	349	26	0.00	0.00	A	NM_014753		43285807	+1	81	6	178	9	tier1	no_errors	ENST00000374518	ensembl	human	known	74_37	missense	31.27	40.00	SNP	1.000	G	81	178
DYRK4	8798	genome.wustl.edu	37	12	4705324	4705324	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr12:4705324G>A	ENST00000540757.2	+	5	452	c.292G>A	c.(292-294)Gat>Aat	p.D98N	DYRK4_ENST00000543431.1_Missense_Mutation_p.D98N|DYRK4_ENST00000010132.5_Missense_Mutation_p.D98N	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	98						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			GGTCCTGCATGATCACATTGC	0.557													ENSG00000010219																																					0													127.0	131.0	130.0					12																	4705324		2203	4300	6503	SO:0001583	missense	0			-	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.292G>A	12.37:g.4705324G>A	ENSP00000441755:p.Asp98Asn		A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D98N	ENST00000540757.2	37	c.292	CCDS8530.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.532578	0.96446	.	.	ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	5.58	5.58	0.84498	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.59046	0.2165	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.69176	-0.5214	10	0.87932	D	0	.	19.1806	0.93622	0.0:0.0:1.0:0.0	.	213;98;98	F5H6L9;Q9NR20-2;Q9NR20	.;.;DYRK4_HUMAN	N	213;98;98;98	ENSP00000437534:D213N;ENSP00000441755:D98N;ENSP00000010132:D98N;ENSP00000439697:D98N	ENSP00000010132:D98N	D	+	1	0	DYRK4	4575585	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	9.566000	0.98157	2.629000	0.89072	0.655000	0.94253	GAT	-	DYRK4	-	superfamily_Kinase-like_dom		0.557	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK4	HGNC	protein_coding	OTTHUMT00000398780.2	0	0	0	45	45	103	0.00	0.00	G			4705324	+1	5	20	11	9	tier1	no_errors	ENST00000010132	ensembl	human	known	74_37	missense	31.25	68.97	SNP	1.000	A	5	11
MTCL1	23255	genome.wustl.edu	37	18	8831766	8831766	+	Silent	SNP	C	C	T	rs547391897		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr18:8831766C>T	ENST00000518815.1	+	10	2953	c.2859C>T	c.(2857-2859)ggC>ggT	p.G953G	SOGA2_ENST00000306285.7_Silent_p.G953G|SOGA2_ENST00000581670.1_3'UTR|SOGA2_ENST00000359865.3_3'UTR|SOGA2_ENST00000400050.3_3'UTR|SOGA2_ENST00000517570.1_3'UTR																							AGCATGGTGGCGAGGAGCCGC	0.582													ENSG00000168502	C|||	1	0.000199681	0.0	0.0	5008	,	,		16308	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001819	synonymous_variant	0			-																												ENST00000518815.1:c.2859C>T	18.37:g.8831766C>T				Silent	SNP	NULL	p.G953	ENST00000518815.1	37	c.2859		18																																																																																			-	SOGA2	-	NULL		0.582	SOGA2-006	KNOWN	upstream_ATG|basic	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000379407.5	0	0	0	32	32	10	0.00	0.00	C			8831766	+1	6	4	19	5	tier1	no_errors	ENST00000306285	ensembl	human	known	74_37	silent	24.00	44.44	SNP	0.000	T	6	19
IFT46	56912	genome.wustl.edu	37	11	118427683	118427685	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	ATC	ATC	ATC	-	ATC	ATC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr11:118427683_118427685delATC	ENST00000264021.3	-	4	539_541	c.121_123delGAT	c.(121-123)gatdel	p.D41del	IFT46_ENST00000530872.1_In_Frame_Del_p.D92del|IFT46_ENST00000264020.2_In_Frame_Del_p.D92del	NM_001168618.1	NP_001162089.1	Q9NQC8	IFT46_HUMAN	intraflagellar transport 46	41	Asp/Glu-rich (highly acidic).				cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|protein stabilization (GO:0050821)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)	protein C-terminus binding (GO:0008022)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9						TTTCAGATGAatcatcatcatca	0.478													ENSG00000118096																																					0																																										SO:0001651	inframe_deletion	0				AL136934	CCDS8399.1, CCDS53718.1	11q23.3	2014-07-18	2014-07-03	2010-04-22	ENSG00000118096	ENSG00000118096		"""Intraflagellar transport homologs"""	26146	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 32"""		"""chromosome 11 open reading frame 60"", ""intraflagellar transport 46 homolog (Chlamydomonas)"""	C11orf60		10873569, 19253336	Standard	NM_020153		Approved	C11orf2, FLJ21827, CFAP32	uc001pto.2	Q9NQC8	OTTHUMG00000166408	ENST00000264021.3:c.121_123delGAT	11.37:g.118427692_118427694delATC	ENSP00000264021:p.Asp41del		A8K0F6|Q9H6V5	In_Frame_Del	DEL	pfam_Intraflagellar_transp_cmplxB	p.D92in_frame_del	ENST00000264021.3	37	c.276_274	CCDS53718.1	11																																																																																				IFT46	-	NULL		0.478	IFT46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT46	HGNC	protein_coding	OTTHUMT00000389627.1	0	0	0	47	47	90	0.00	0.00	ATC	NM_020153		118427685	-1	3	6	30	87	tier1	no_errors	ENST00000264020	ensembl	human	known	74_37	in_frame_del	9.09	6.45	DEL	1.000:1.000:0.999	-	3	30
EBPL	84650	genome.wustl.edu	37	13	50237243	50237243	+	Silent	SNP	C	C	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr13:50237243C>A	ENST00000242827.6	-	3	380	c.330G>T	c.(328-330)ggG>ggT	p.G110G	EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378270.5_Intron|EBPL_ENST00000378282.5_Silent_p.G104G|EBPL_ENST00000378284.2_Silent_p.G110G|EBPL_ENST00000378272.5_Intron	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	110					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)			endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		ATGCCAGAGACCCATCCAGGG	0.443													ENSG00000123179																									NSCLC(39;857 1083 36109 42364 51411)												0													108.0	95.0	99.0					13																	50237243		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.330G>T	13.37:g.50237243C>A			A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Silent	SNP	pfam_EBP	p.G110	ENST00000242827.6	37	c.330	CCDS9420.1	13																																																																																			-	EBPL	-	pfam_EBP		0.443	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EBPL	HGNC	protein_coding	OTTHUMT00000044932.2	0	0	0	79	79	17	0.00	0.00	C	NM_032565		50237243	-1	3	0	16	7	tier1	no_errors	ENST00000242827	ensembl	human	known	74_37	silent	15.79	0.00	SNP	0.036	A	3	16
RP11-43F13.4	0	genome.wustl.edu	37	5	1004310	1004311	+	lincRNA	INS	-	-	GGGTGTGTGT	rs3083863|rs57997780|rs60001138|rs113972325|rs201642892|rs61651856		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr5:1004310_1004311insGGGTGTGTGT	ENST00000606540.1	+	0	0				AC116351.2_ENST00000408317.1_RNA																							AGGGGACgtgggtgtgtgtgtg	0.589													ENSG00000221244																																					0																																												0																																5.37:g.1004310_1004311insGGGTGTGTGT				R	INS	-	NULL	ENST00000606540.1	37	NULL		5																																																																																				AC116351.2	-	-		0.589	RP11-43F13.4-001	KNOWN	basic	lincRNA	ENSG00000221244	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000470457.1	0	0	0	16	16	16	0.00	0.00	-			1004311	+1	0	0	3	3	tier1	no_errors	ENST00000408317	ensembl	human	novel	74_37	rna	0.00	0.00	INS	0.034:0.057	GGGTGTGTGT	0	3
RP11-469N6.1	0	genome.wustl.edu	37	11	134605777	134605777	+	lincRNA	SNP	C	C	G	rs7104522	byFrequency	TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr11:134605777C>G	ENST00000513405.1	+	0	288																											GTGAGCGACGCAGAGCTGGGG	0.642													ENSG00000251226	G|||	254	0.0507188	0.0219	0.0735	5008	,	,		13175	0.0308		0.0885	False		,,,				2504	0.0552																0																																												0			-																													11.37:g.134605777C>G				R	SNP	-	NULL	ENST00000513405.1	37	NULL		11																																																																																			rs7104522	RP11-469N6.1	-	-		0.642	RP11-469N6.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000251226	Clone_based_vega_gene	lincRNA	OTTHUMT00000382010.2	0	0	0	13	13	0	0.00	0.00	C			134605777	+1	11	0	9	0	tier1	no_errors	ENST00000513405	ensembl	human	known	74_37	rna	55.00	0.00	SNP	0.003	G	11	9
KRT1	3848	genome.wustl.edu	37	12	53069193	53069193	+	Silent	SNP	G	G	A			TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr12:53069193G>A	ENST00000252244.3	-	9	1777	c.1719C>T	c.(1717-1719)ggC>ggT	p.G573G		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	573	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						tgccatggccgccgccgccac	0.741													ENSG00000167768																																					0													4.0	5.0	5.0					12																	53069193		1750	3531	5281	SO:0001819	synonymous_variant	0			-	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1719C>T	12.37:g.53069193G>A			B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.G573	ENST00000252244.3	37	c.1719	CCDS8836.1	12																																																																																			-	KRT1	-	NULL		0.741	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1	0	0	0	43	43	1	0.00	0.00	G	NM_006121		53069193	-1	12	0	24	0	tier1	no_errors	ENST00000252244	ensembl	human	known	74_37	silent	33.33	0.00	SNP	0.811	A	12	24
SENP3	26168	genome.wustl.edu	37	17	7475163	7475198	+	3'UTR	DEL	ATATATATATATATATATATATATATATATATATAT	ATATATATATATATATATATATATATATATATATAT	-	rs56327661|rs12941164		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	ATATATATATATATATATATATATATATATATATAT	ATATATATATATATATATATATATATATATATATAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr17:7475163_7475198delATATATATATATATATATATATATATATATATATAT	ENST00000429205.2	+	0	2136_2161				SENP3_ENST00000321337.7_3'UTR|SENP3_ENST00000578868.1_3'UTR|EIF4A1_ENST00000380512.5_5'Flank|EIF4A1_ENST00000582746.1_5'Flank|SNORA48_ENST00000386847.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|EIF4A1_ENST00000577269.1_5'Flank|EIF4A1_ENST00000293831.8_5'Flank			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3							cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				TTTtatatatatatatatatatatatatatatatatatatatatatatatatatat	0.347													ENSG00000161956																																					0																																										SO:0001624	3_prime_UTR_variant	0				AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.*387ATATATATATATATATATATATATATATATATATAT>-	17.37:g.7475163_7475198delATATATATATATATATATATATATATATATATATAT			Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Splice_Site	DEL	-	e12-1	ENST00000429205.2	37	c.1725+27_62		17																																																																																				SENP3	-	-		0.347	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	SENP3	HGNC	protein_coding		0	0	0	2	2	2	0.00	0.00	ATATATATATATATATATATATATATATATATATAT	NM_015670		7475198	+1	0	0	0	0	tier1	no_errors	ENST00000429205	ensembl	human	known	74_37	splice_site_del	0.00	0.00	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.995:0.988:0.984:0.978:0.977:0.973:0.975:0.974:0.977:0.977:0.976:0.974:0.976:0.976:0.974:0.970:0.972:0.972:0.969:0.964:0.963:0.960:0.953:0.941:0.939	-	0	0
KRTAP9-9	81870	genome.wustl.edu	37	17	39411670	39411670	+	Silent	SNP	T	T	C	rs540633489	byFrequency	TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr17:39411670T>C	ENST00000394008.1	+	1	35	c.33T>C	c.(31-33)ccT>ccC	p.P11P		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	11	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCTGTCAGCCTACCTGCTGCA	0.602													ENSG00000198083																																					0																																										SO:0001819	synonymous_variant	0			-	AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.33T>C	17.37:g.39411670T>C			B5MDD6|Q9BYQ1	Silent	SNP	NULL	p.P11	ENST00000394008.1	37	c.33	CCDS54127.1	17																																																																																			-	KRTAP9-9	-	NULL		0.602	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-9	HGNC	protein_coding	OTTHUMT00000257710.1	0	0	0	37	37	0	0.00	0.00	T	NM_030975		39411670	+1	4	0	30	0	tier1	no_errors	ENST00000394008	ensembl	human	known	74_37	silent	11.76	0.00	SNP	0.053	C	4	30
SPEG	10290	genome.wustl.edu	37	2	220330668	220330669	+	Intron	INS	-	-	GT	rs554914793		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr2:220330668_220330669insGT	ENST00000312358.7	+	10	3013				SPEG_ENST00000396695.2_Intron|SPEG_ENST00000396698.1_Intron|SPEG_ENST00000396689.2_Intron|SPEG_ENST00000396686.1_Intron|SPEG_ENST00000485813.1_Intron|SPEG_ENST00000396688.1_Intron	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus						cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		tgcacgtgtgcgtgcatgtgtg	0.589													ENSG00000072195																																					0																																										SO:0001627	intron_variant	0				BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2882-1227->GT	2.37:g.220330669_220330670dupGT			A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	R	INS	-	NULL	ENST00000312358.7	37	NULL	CCDS42824.1	2																																																																																				SPEG	-	-		0.589	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	0	0	0	21	21	0	0.00	0.00	-	NM_005876		220330669	+1	4	0	13	0	tier1	no_errors	ENST00000462545	ensembl	human	known	74_37	rna	23.53	0.00	INS	0.000:0.003	GT	4	13
WNK2	65268	genome.wustl.edu	37	9	96061384	96061384	+	Missense_Mutation	SNP	G	G	A	rs147749673		TCGA-DX-A8BR-01A-11D-A417-09	TCGA-DX-A8BR-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef5e3110-5477-450e-b3b3-5d8d696b7657	8f441372-902f-471e-b032-fe958c7ea85f	g.chr9:96061384G>A	ENST00000297954.4	+	25	6067	c.6067G>A	c.(6067-6069)Gct>Act	p.A2023T	WNK2_ENST00000395477.2_Missense_Mutation_p.A1986T|WNK2_ENST00000427277.2_Missense_Mutation_p.A1598T|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000356055.3_Missense_Mutation_p.A348T|WNK2_ENST00000349097.3_Missense_Mutation_p.A1635T	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2023					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						AGGCCCTCCCGCTAAGGACCC	0.697													ENSG00000165238																																					0								G	THR/ALA	1,4391		0,1,2195	22.0	23.0	22.0		5956	3.5	1.0	9	dbSNP_134	22	0,8580		0,0,4290	no	missense	WNK2	NM_006648.3	58	0,1,6485	AA,AG,GG		0.0,0.0228,0.0077	benign	1986/2218	96061384	1,12971	2196	4290	6486	SO:0001583	missense	0			-	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.6067G>A	9.37:g.96061384G>A	ENSP00000297954:p.Ala2023Thr		Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A2023T	ENST00000297954.4	37	c.6067		9	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518380	0.44763	2.28E-4	0.0	ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277;ENST00000356055	T;T;T;T;D	0.83506	-0.54;-0.52;0.08;0.09;-1.73	5.54	3.48	0.39840	.	0.582952	0.16714	N	0.202552	T	0.71187	0.3310	L	0.50333	1.59	0.23820	N	0.996755	P;P;B;P	0.49185	0.865;0.92;0.333;0.9	B;B;B;B	0.35278	0.199;0.153;0.071;0.106	T	0.60601	-0.7231	10	0.18276	T	0.48	.	7.9022	0.29742	0.0772:0.1112:0.6864:0.1251	.	1986;1981;1986;2023	Q9Y3S1-2;A6PVR3;F8W9F9;Q9Y3S1	.;.;.;WNK2_HUMAN	T	2023;1986;1635;1598;348	ENSP00000297954:A2023T;ENSP00000378860:A1986T;ENSP00000297876:A1635T;ENSP00000411181:A1598T;ENSP00000348347:A348T	ENSP00000297954:A2023T	A	+	1	0	WNK2	95101205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.473000	0.45145	1.312000	0.45043	0.655000	0.94253	GCT	rs147749673	WNK2	-	NULL		0.697	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	HGNC	protein_coding	OTTHUMT00000317359.1	0	0	0	59	59	4	0.00	0.00	G	NM_006648		96061384	+1	15	4	43	7	tier1	no_errors	ENST00000297954	ensembl	human	known	74_37	missense	25.86	36.36	SNP	0.998	A	15	43
