#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
NLRP9	338321	genome.wustl.edu	37	19	56243494	56243494	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:56243494A>T	ENST00000332836.2	-	2	1730	c.1703T>A	c.(1702-1704)gTt>gAt	p.V568D		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	568						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		ATAAATGAAAACTTCTTCAAA	0.353													ENSG00000185792																																					0													64.0	64.0	64.0					19																	56243494		2203	4300	6503	SO:0001583	missense	0			-	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1703T>A	19.37:g.56243494A>T	ENSP00000331857:p.Val568Asp		B2RN12|Q86W27	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.V568D	ENST00000332836.2	37	c.1703	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	A	12.20	1.867979	0.32977	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.55052	0.54	2.23	2.23	0.28157	.	.	.	.	.	T	0.64972	0.2647	M	0.78049	2.395	0.09310	N	0.999998	D	0.60575	0.988	P	0.59703	0.862	T	0.52917	-0.8511	9	0.87932	D	0	.	6.4848	0.22083	1.0:0.0:0.0:0.0	.	568	Q7RTR0	NALP9_HUMAN	D	568	ENSP00000331857:V568D	ENSP00000331857:V568D	V	-	2	0	NLRP9	60935306	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.524000	0.22940	1.302000	0.44855	0.524000	0.50904	GTT	-	NLRP9	-	NULL		0.353	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1	0	0		38	38		0.00		A	NM_176820		56243494	-1	16		66		tier1	no_errors	ENST00000332836	ensembl	human	known	74_37	missense	19.51		SNP	0.001	T	16	66
CBFA2T2	9139	genome.wustl.edu	37	20	32217653	32217653	+	Silent	SNP	G	G	C			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr20:32217653G>C	ENST00000346541.3	+	9	1725	c.1188G>C	c.(1186-1188)ctG>ctC	p.L396L	CBFA2T2_ENST00000397800.1_Silent_p.L367L|CBFA2T2_ENST00000375279.2_Silent_p.L396L|CBFA2T2_ENST00000359606.3_Silent_p.L406L|CBFA2T2_ENST00000491618.1_3'UTR|CBFA2T2_ENST00000492345.1_Silent_p.L367L|CBFA2T2_ENST00000342704.6_Silent_p.L387L	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	396					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						ACACAGAGCTGAGGAAAACGG	0.507													ENSG00000078699																									Esophageal Squamous(174;142 1955 14837 21276 28041)												0													68.0	65.0	66.0					20																	32217653		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.1188G>C	20.37:g.32217653G>C			B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Silent	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTGR1	p.L396	ENST00000346541.3	37	c.1188	CCDS13221.1	20																																																																																			-	CBFA2T2	-	pfam_NHR2		0.507	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	CBFA2T2	HGNC	protein_coding	OTTHUMT00000078708.2	0	0		24	24		0.00		G	NM_001032999		32217653	+1	19		49		tier1	no_errors	ENST00000346541	ensembl	human	known	74_37	silent	27.94		SNP	0.991	C	19	49
DOC2A	8448	genome.wustl.edu	37	16	30017947	30017947	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr16:30017947C>G	ENST00000350119.4	-	9	1120	c.930G>C	c.(928-930)aaG>aaC	p.K310N	DOC2A_ENST00000564944.1_Missense_Mutation_p.K310N|DOC2A_ENST00000564979.1_Missense_Mutation_p.K310N	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	310	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Interaction with UNC13D.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						GAGTCTTCTTCTTCACACACG	0.607													ENSG00000149927																																					0													207.0	175.0	186.0					16																	30017947		2197	4300	6497	SO:0001583	missense	0			-	D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.930G>C	16.37:g.30017947C>G	ENSP00000340017:p.Lys310Asn		B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pirsf_Doc2,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.K310N	ENST00000350119.4	37	c.930	CCDS10666.1	16	.	.	.	.	.	.	.	.	.	.	c	12.75	2.031708	0.35797	.	.	ENSG00000149927	ENST00000350119	T	0.73469	-0.75	5.94	5.94	0.96194	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.56097	D	0.000024	D	0.88433	0.6435	M	0.89214	3.015	0.42803	D	0.993937	D	0.69078	0.997	D	0.70716	0.97	D	0.89870	0.4022	10	0.72032	D	0.01	.	17.8643	0.88791	0.0:1.0:0.0:0.0	.	310	Q14183	DOC2A_HUMAN	N	310	ENSP00000340017:K310N	ENSP00000340017:K310N	K	-	3	2	DOC2A	29925448	0.999000	0.42202	1.000000	0.80357	0.078000	0.17371	0.691000	0.25467	2.821000	0.97095	0.651000	0.88453	AAG	-	DOC2A	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pirsf_Doc2,pfscan_C2_dom		0.607	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOC2A	HGNC	protein_coding	OTTHUMT00000255148.2	0	0		27	27		0.00		C	NM_003586		30017947	-1	7		64		tier1	no_errors	ENST00000350119	ensembl	human	known	74_37	missense	9.86		SNP	1.000	G	7	64
GPRC6A	222545	genome.wustl.edu	37	6	117113915	117113915	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr6:117113915A>G	ENST00000310357.3	-	6	2192	c.2171T>C	c.(2170-2172)aTc>aCc	p.I724T	GPRC6A_ENST00000368549.3_Missense_Mutation_p.I653T|GPRC6A_ENST00000530250.1_Missense_Mutation_p.I549T	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	724					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TGCTGCAAAGATTAGCCAGAG	0.478													ENSG00000173612																																					0													77.0	72.0	74.0					6																	117113915		2203	4300	6503	SO:0001583	missense	0			-	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.2171T>C	6.37:g.117113915A>G	ENSP00000309493:p.Ile724Thr		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_vmron_rcpt_2	p.I724T	ENST00000310357.3	37	c.2171	CCDS5112.1	6	.	.	.	.	.	.	.	.	.	.	A	0.268	-0.994632	0.02145	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.89196	-2.48;-2.48;-2.48	4.37	3.21	0.36854	GPCR, family 3, C-terminal (2);	0.692519	0.12698	N	0.446581	T	0.62221	0.2410	N	0.16708	0.43	0.09310	N	1	B;B;B	0.20550	0.046;0.019;0.003	B;B;B	0.20184	0.025;0.028;0.026	T	0.52124	-0.8617	10	0.20046	T	0.44	.	7.9474	0.29995	0.8308:0.0:0.1692:0.0	.	653;549;724	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	T	724;653;549	ENSP00000309493:I724T;ENSP00000357537:I653T;ENSP00000433465:I549T	ENSP00000309493:I724T	I	-	2	0	GPRC6A	117220608	0.019000	0.18553	0.004000	0.12327	0.236000	0.25371	2.452000	0.44961	0.733000	0.32492	-0.326000	0.08463	ATC	-	GPRC6A	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3		0.478	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	HGNC	protein_coding	OTTHUMT00000041966.2	0	0		30	30		0.00		A			117113915	-1	6		23		tier1	no_errors	ENST00000310357	ensembl	human	known	74_37	missense	20.69		SNP	0.001	G	6	23
ZNF99	7652	genome.wustl.edu	37	19	22942486	22942486	+	Splice_Site	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:22942486T>A	ENST00000596209.1	-	4	317		c.e4-2		ZNF99_ENST00000397104.3_Splice_Site	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AACTAATAACTGGAAGAAATG	0.299													ENSG00000213973																																					0													33.0	29.0	30.0					19																	22942486		1823	4091	5914	SO:0001630	splice_region_variant	0			-	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.227-2A>T	19.37:g.22942486T>A			M0R335	Splice_Site	SNP	-	e4-2	ENST00000596209.1	37	c.290-2	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	.	3.641	-0.073430	0.07184	.	.	ENSG00000213973	ENST00000397104	.	.	.	0.937	0.937	0.19494	.	.	.	.	.	.	.	.	.	.	.	0.32245	N	0.572224	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.0135	0.09632	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF99	22734326	0.265000	0.24102	0.011000	0.14972	0.011000	0.07611	0.852000	0.27764	0.334000	0.23590	0.325000	0.21440	.	-	ZNF99	-	-		0.299	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	0	0		17	17		0.00		T	XM_065124	Intron	22942486	-1	14		38		tier1	no_errors	ENST00000397104	ensembl	human	known	74_37	splice_site	26.92		SNP	0.163	A	14	38
OR5AS1	219447	genome.wustl.edu	37	11	55798716	55798716	+	Silent	SNP	G	G	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr11:55798716G>T	ENST00000313555.1	+	1	822	c.822G>T	c.(820-822)gtG>gtT	p.V274V		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					ATAAGGTGGTGGCAGTGTTTT	0.388													ENSG00000181785																																					0													81.0	73.0	76.0					11																	55798716		2201	4296	6497	SO:0001819	synonymous_variant	0			-	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.822G>T	11.37:g.55798716G>T			Q6IFB8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V274	ENST00000313555.1	37	c.822	CCDS31516.1	11																																																																																			-	OR5AS1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.388	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	HGNC	protein_coding	OTTHUMT00000391538.1	0	0		34	34		0.00		G	NM_001001921		55798716	+1	8		70		tier1	no_errors	ENST00000313555	ensembl	human	known	74_37	silent	10.26		SNP	0.000	T	8	70
COL6A5	256076	genome.wustl.edu	37	3	130113771	130113771	+	Missense_Mutation	SNP	G	G	T	rs190666668	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr3:130113771G>T	ENST00000432398.2	+	8	3525	c.3031G>T	c.(3031-3033)Gat>Tat	p.D1011Y	COL6A5_ENST00000265379.6_Missense_Mutation_p.D1011Y	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1011	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TTTCCTTTGCGATGGCTCTGA	0.338													ENSG00000172752																																					0													88.0	71.0	76.0					3																	130113771		692	1591	2283	SO:0001583	missense	0			-	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.3031G>T	3.37:g.130113771G>T	ENSP00000390895:p.Asp1011Tyr		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D1011Y	ENST00000432398.2	37	c.3031		3	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263623	0.59431	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.97994	-4.65;-4.65	5.53	5.53	0.82687	.	.	.	.	.	D	0.98648	0.9547	M	0.81942	2.565	0.46336	D	0.998993	D	0.89917	1.0	D	0.97110	1.0	D	0.99690	1.1001	9	0.87932	D	0	.	16.3798	0.83452	0.0:0.0:1.0:0.0	.	1011	A8TX70-2	.	Y	1011	ENSP00000390895:D1011Y;ENSP00000265379:D1011Y	ENSP00000265379:D1011Y	D	+	1	0	COL6A5	131596461	1.000000	0.71417	0.997000	0.53966	0.916000	0.54674	7.875000	0.87205	2.611000	0.88343	0.491000	0.48974	GAT	-	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.338	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		0	0		29	29		0.00		G	NM_153264		130113771	+1	5		39		tier1	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	11.36		SNP	0.999	T	5	39
CBFA2T2	9139	genome.wustl.edu	37	20	32216176	32216176	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr20:32216176G>A	ENST00000346541.3	+	8	1531	c.994G>A	c.(994-996)Gat>Aat	p.D332N	CBFA2T2_ENST00000397800.1_Missense_Mutation_p.D303N|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.D332N|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.D342N|CBFA2T2_ENST00000491618.1_3'UTR|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.D303N|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.D323N	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	332					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						AGGCTATCAAGATGAGTTGGT	0.353													ENSG00000078699																									Esophageal Squamous(174;142 1955 14837 21276 28041)												0													194.0	186.0	189.0					20																	32216176		2203	4300	6503	SO:0001583	missense	0			-	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.994G>A	20.37:g.32216176G>A	ENSP00000262653:p.Asp332Asn		B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTGR1	p.D332N	ENST00000346541.3	37	c.994	CCDS13221.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.338911	0.95783	.	.	ENSG00000078699	ENST00000397803;ENST00000375279;ENST00000342704;ENST00000346541;ENST00000397800;ENST00000359606	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.31	5.31	0.75309	NHR2-like (1);	0.098719	0.64402	D	0.000001	T	0.33702	0.0872	N	0.08118	0	0.80722	D	1	P;P	0.47484	0.896;0.873	P;B	0.46510	0.519;0.298	T	0.32134	-0.9918	10	0.49607	T	0.09	-11.361	19.3352	0.94314	0.0:0.0:1.0:0.0	.	332;323	O43439;F8W6D7	MTG8R_HUMAN;.	N	106;332;323;332;303;342	ENSP00000364428:D332N;ENSP00000345810:D323N;ENSP00000262653:D332N;ENSP00000380902:D303N;ENSP00000352622:D342N	ENSP00000345810:D323N	D	+	1	0	CBFA2T2	31679837	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.651000	0.90000	0.655000	0.94253	GAT	-	CBFA2T2	-	pfam_NHR2		0.353	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	CBFA2T2	HGNC	protein_coding	OTTHUMT00000078708.2	0	0		33	33		0.00		G	NM_001032999		32216176	+1	24		63		tier1	no_errors	ENST00000346541	ensembl	human	known	74_37	missense	27.59		SNP	1.000	A	24	63
SPINK5	11005	genome.wustl.edu	37	5	147506574	147506574	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr5:147506574C>T	ENST00000256084.7	+	30	2938	c.2896C>T	c.(2896-2898)Ctt>Ttt	p.L966F	SPINK5_ENST00000359874.3_Missense_Mutation_p.L996F	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	966	Kazal-like 14. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGGCAAAGCTTCAAGAAAA	0.363													ENSG00000133710																																					0													56.0	53.0	54.0					5																	147506574		1799	4072	5871	SO:0001583	missense	0			-	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.2896C>T	5.37:g.147506574C>T	ENSP00000256084:p.Leu966Phe		A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal_dom,smart_Kazal_dom	p.L996F	ENST00000256084.7	37	c.2986	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	C	1.648	-0.514618	0.04200	.	.	ENSG00000133710	ENST00000359874;ENST00000256084	T;T	0.45668	0.89;0.9	3.89	-4.64	0.03349	Proteinase inhibitor I1, Kazal (1);	1.985540	0.02341	N	0.074848	T	0.20861	0.0502	N	0.16478	0.41	0.09310	N	1	B;B	0.19445	0.036;0.006	B;B	0.21151	0.02;0.033	T	0.09707	-1.0662	10	0.10111	T	0.7	1.214	2.5504	0.04747	0.1612:0.5434:0.1041:0.1913	.	996;966	Q9NQ38-3;Q9NQ38	.;ISK5_HUMAN	F	996;966	ENSP00000352936:L996F;ENSP00000256084:L966F	ENSP00000256084:L966F	L	+	1	0	SPINK5	147486767	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-0.849000	0.04322	-0.975000	0.03546	0.650000	0.86243	CTT	-	SPINK5	-	smart_Kazal_dom		0.363	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	0	0		18	18		0.00		C	NM_001127698		147506574	+1	24		26		tier1	no_errors	ENST00000359874	ensembl	human	known	74_37	missense	48.00		SNP	0.000	T	24	26
FAM157B	100132403	genome.wustl.edu	37	9	141107563	141107563	+	lincRNA	SNP	A	A	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr9:141107563A>T	ENST00000446912.2	+	0	46							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		cagcagcagcagcagcagcaA	0.547													ENSG00000233013																																					0													3.0	8.0	7.0					9																	141107563		369	1036	1405			0			-			9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107563A>T				R	SNP	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			-	FAM157B	-	-		0.547	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2	0	0		42	42		0.00		A	NM_001145249		141107563	+1	9		24		tier1	no_errors	ENST00000446912	ensembl	human	known	74_37	rna	27.27		SNP	0.171	T	9	24
HSPG2	3339	genome.wustl.edu	37	1	22156635	22156635	+	Intron	SNP	G	G	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:22156635G>A	ENST00000374695.3	-	86	11751				HSPG2_ENST00000486901.1_5'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2						angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TCTGGAGGGAGGGGGGTCCTG	0.682													ENSG00000142798																																					0													5.0	7.0	6.0					1																	22156635		2114	4210	6324	SO:0001627	intron_variant	0			-	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.11672-51C>T	1.37:g.22156635G>A			Q16287|Q5SZI3|Q9H3V5	R	SNP	-	NULL	ENST00000374695.3	37	NULL	CCDS30625.1	1																																																																																			-	HSPG2	-	-		0.682	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	0	0		49	49		0.00		G	NM_005529		22156635	-1	22		52		tier1	no_errors	ENST00000486901	ensembl	human	known	74_37	rna	29.33		SNP	0.000	A	22	52
FERD3L	222894	genome.wustl.edu	37	7	19184906	19184906	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr7:19184906C>T	ENST00000275461.3	-	1	138	c.80G>A	c.(79-81)cGc>cAc	p.R27H	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	27					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						GAGGAGAGGGCGTCTCGGGGA	0.677													ENSG00000146618																																					0													37.0	36.0	36.0					7																	19184906		2203	4300	6503	SO:0001583	missense	0			-	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.80G>A	7.37:g.19184906C>T	ENSP00000275461:p.Arg27His		Q495K0	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R27H	ENST00000275461.3	37	c.80	CCDS5368.1	7	.	.	.	.	.	.	.	.	.	.	C	9.649	1.141071	0.21205	.	.	ENSG00000146618	ENST00000275461	D	0.96200	-3.94	5.66	-3.06	0.05379	.	0.931729	0.09018	N	0.860560	T	0.81819	0.4903	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.73953	-0.3820	10	0.14656	T	0.56	-4.9157	4.4391	0.11564	0.1132:0.4656:0.1152:0.306	.	27	Q96RJ6	FER3L_HUMAN	H	27	ENSP00000275461:R27H	ENSP00000275461:R27H	R	-	2	0	FERD3L	19151431	0.003000	0.15002	0.768000	0.31515	0.698000	0.40448	-0.394000	0.07296	-0.408000	0.07565	-0.312000	0.09012	CGC	-	FERD3L	-	NULL		0.677	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	HGNC	protein_coding	OTTHUMT00000207627.1	0	0		37	37		0.00		C			19184906	-1	8		89		tier1	no_errors	ENST00000275461	ensembl	human	known	74_37	missense	8.25		SNP	0.027	T	8	89
GRAMD1A	57655	genome.wustl.edu	37	19	35491326	35491327	+	5'UTR	INS	-	-	GCCCT	rs71165697|rs3072398|rs34397853	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:35491326_35491327insGCCCT	ENST00000317991.5	+	0	136_137				GRAMD1A_ENST00000424536.2_5'Flank|GRAMD1A_ENST00000411896.2_5'Flank|GRAMD1A_ENST00000504615.2_5'UTR|GRAMD1A_ENST00000599564.1_Intron|CTD-2527I21.7_ENST00000600959.1_RNA	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A							integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			cgcgcagcccagccctgccctg	0.782													ENSG00000089351		4907	0.979832	0.9561	0.9885	5008	,	,		4111	0.998		0.994	False		,,,				2504	0.9724																0									,	616,100		305,6,47					,	0.6	1.0		dbSNP_102	1	1569,189		780,9,90	no	utr-5,utr-5	GRAMD1A	NM_020895.3,NM_001136199.1	,	1085,15,137	A1A1,A1R,RR		10.7509,13.9665,11.6815	,	,		2185,289				SO:0001623	5_prime_UTR_variant	0				AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.-56->GCCCT	19.37:g.35491332_35491336dupGCCCT			A6NKY7|Q8NC77|Q9P1Z5	R	INS	-	NULL	ENST00000317991.5	37	NULL	CCDS42546.1	19																																																																																				GRAMD1A	-	-		0.782	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	GRAMD1A	HGNC	protein_coding	OTTHUMT00000461557.1									-	NM_020895		35491327	+1					tier1	no_errors	ENST00000603669	ensembl	human	known	74_37	rna			INS	0.780:0.776	GCCCT		
YTHDF2	51441	genome.wustl.edu	37	1	29063572	29063574	+	5'UTR	DEL	GCC	GCC	-			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	GCC	GCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:29063572_29063574delGCC	ENST00000373812.3	+	0	302_304				YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000541996.1_5'UTR|YTHDF2_ENST00000542507.1_5'UTR	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2						humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCTCATCTGCCGCCGCCGCCG	0.729													ENSG00000198492																																					0									,,	31,2743		3,25,1359					,,	0.2	1.0			5	117,6501		4,109,3196	no	utr-5,utr-5,utr-5	YTHDF2	NM_016258.2,NM_001173128.1,NM_001172828.1	,,	7,134,4555	A1A1,A1R,RR		1.7679,1.1175,1.5758	,,	,,		148,9244				SO:0001623	5_prime_UTR_variant	0				AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.-59GCC>-	1.37:g.29063581_29063583delGCC			A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	R	DEL	-	NULL	ENST00000373812.3	37	NULL	CCDS41296.1	1																																																																																				YTHDF2	-	-		0.729	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF2	HGNC	protein_coding	OTTHUMT00000010335.1	0	0		10	10		0.00		GCC	NM_016258		29063574	+1	2		13		tier1	no_errors	ENST00000478283	ensembl	human	known	74_37	rna	13.33		DEL	1.000:0.999:0.990	-	2	13
COX11	1353	genome.wustl.edu	37	17	53045891	53045891	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr17:53045891C>A	ENST00000299335.3	-	1	255	c.117G>T	c.(115-117)gaG>gaT	p.E39D	COX11_ENST00000571584.1_Missense_Mutation_p.E39D|STXBP4_ENST00000299341.4_5'Flank|STXBP4_ENST00000434978.2_5'Flank|STXBP4_ENST00000376352.2_5'Flank|STXBP4_ENST00000398391.2_5'Flank|STXBP4_ENST00000405898.1_5'Flank	NM_004375.3	NP_004366.1	Q9Y6N1	COX11_HUMAN	cytochrome c oxidase assembly homolog 11 (yeast)	39					hydrogen ion transmembrane transport (GO:1902600)|negative regulation of glucokinase activity (GO:0033132)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|prostate(1)	9						TCCCACTCCACTCTGGCCTAA	0.642													ENSG00000166260																																					0													68.0	57.0	61.0					17																	53045891		2197	4286	6483	SO:0001583	missense	0			-	AF044321	CCDS11583.1, CCDS58579.1	17q22	2012-10-15	2012-10-15			ENSG00000166260		"""Mitochondrial respiratory chain complex assembly factors"""	2261	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit 11"", ""cytochrome c oxidase assembly protein COX11"""	603648	"""COX11 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX11 cytochrome c oxidase assembly homolog (yeast)"""			9878253	Standard	NM_004375		Approved	COX11P	uc010wng.1	Q9Y6N1		ENST00000299335.3:c.117G>T	17.37:g.53045891C>A	ENSP00000299335:p.Glu39Asp		D3DTY5|I3L220|Q6FHB7|Q9BRX0|Q9UME8	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_assmbl_CtaG,superfamily_CtaG/Cox11_dom	p.E39D	ENST00000299335.3	37	c.117	CCDS11583.1	17	.	.	.	.	.	.	.	.	.	.	C	9.364	1.068671	0.20147	.	.	ENSG00000166260	ENST00000299335	T	0.43294	0.95	4.57	-6.52	0.01872	.	1.242440	0.05278	N	0.518847	T	0.20414	0.0491	N	0.22421	0.69	0.09310	N	1	B;B	0.14012	0.009;0.003	B;B	0.12837	0.008;0.008	T	0.16305	-1.0407	10	0.14656	T	0.56	-8.7738	2.6591	0.05021	0.0982:0.274:0.1944:0.4333	.	39;39	B4DI26;Q9Y6N1	.;COX11_HUMAN	D	39	ENSP00000299335:E39D	ENSP00000299335:E39D	E	-	3	2	COX11	50400890	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.459000	0.06728	-0.927000	0.03766	-0.251000	0.11542	GAG	-	COX11	-	NULL		0.642	COX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX11	HGNC	protein_coding	OTTHUMT00000439182.1	0	0		60	60		0.00		C	NM_004375		53045891	-1	24		95		tier1	no_errors	ENST00000299335	ensembl	human	known	74_37	missense	20.17		SNP	0.000	A	24	95
CD3G	917	genome.wustl.edu	37	11	118221340	118221340	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr11:118221340C>A	ENST00000532917.1	+	4	449	c.381C>A	c.(379-381)ttC>ttA	p.F127L	CD3G_ENST00000392883.2_Intron|CD3G_ENST00000532903.1_3'UTR	NM_000073.2	NP_000064.1	P09693	CD3G_HUMAN	CD3g molecule, gamma (CD3-TCR complex)	127					cell surface receptor signaling pathway (GO:0007166)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|regulation of immune response (GO:0050776)|regulation of lymphocyte apoptotic process (GO:0070228)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	alpha-beta T cell receptor complex (GO:0042105)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|receptor signaling complex scaffold activity (GO:0030159)|T cell receptor binding (GO:0042608)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|kidney(1)|large_intestine(2)|skin(1)	6	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)	Muromonab(DB00075)	TCAGCATTTTCGTCCTTGCTG	0.468													ENSG00000160654																																					0													196.0	169.0	178.0					11																	118221340		2200	4296	6496	SO:0001583	missense	0			-	X60491	CCDS8395.1	11q23	2014-09-17	2006-03-28		ENSG00000160654	ENSG00000160654		"""CD molecules"""	1675	protein-coding gene	gene with protein product		186740	"""CD3g antigen, gamma polypeptide (TiT3 complex)"""				Standard	NM_000073		Approved		uc001psu.2	P09693	OTTHUMG00000166971	ENST00000532917.1:c.381C>A	11.37:g.118221340C>A	ENSP00000431445:p.Phe127Leu		Q2HIZ6	Missense_Mutation	SNP	pfam_Phos_immunorcpt_sig_ITAM,smart_Ig_sub2,smart_Phos_immunorcpt_sig_ITAM,pfscan_Phos_immunorcpt_sig_ITAM	p.F127L	ENST00000532917.1	37	c.381	CCDS8395.1	11	.	.	.	.	.	.	.	.	.	.	C	8.042	0.764092	0.15914	.	.	ENSG00000160654	ENST00000532917	T	0.49720	0.77	5.76	1.79	0.24919	.	0.313613	0.33057	N	0.005328	T	0.27559	0.0677	L	0.42581	1.335	0.80722	D	1	B	0.30033	0.266	B	0.26416	0.069	T	0.21621	-1.0240	10	0.02654	T	1	.	4.2688	0.10776	0.1689:0.5783:0.0:0.2528	.	127	P09693	CD3G_HUMAN	L	127	ENSP00000431445:F127L	ENSP00000431445:F127L	F	+	3	2	CD3G	117726550	0.108000	0.22018	0.985000	0.45067	0.968000	0.65278	-0.119000	0.10676	0.074000	0.16767	0.655000	0.94253	TTC	-	CD3G	-	NULL		0.468	CD3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD3G	HGNC	protein_coding	OTTHUMT00000392135.1	0	0		42	42		0.00		C	NM_000073		118221340	+1	4		43		tier1	no_errors	ENST00000532917	ensembl	human	known	74_37	missense	8.51		SNP	0.980	A	4	43
PEG3	5178	genome.wustl.edu	37	19	57327276	57327276	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:57327276C>A	ENST00000326441.9	-	10	2897	c.2534G>T	c.(2533-2535)aGa>aTa	p.R845I	PEG3_ENST00000423103.2_Missense_Mutation_p.R845I|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R719I|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.R721I|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000593711.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	845					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ATTGTGACTTCTTGGAGGTTT	0.438													ENSG00000198300																																					0													94.0	91.0	92.0					19																	57327276		2203	4300	6503	SO:0001583	missense	0			-	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2534G>T	19.37:g.57327276C>A	ENSP00000326581:p.Arg845Ile		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R845I	ENST00000326441.9	37	c.2534	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	11.92	1.782107	0.31502	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02787	4.16;4.16	3.78	-1.07	0.09968	.	0.420853	0.20429	N	0.092518	T	0.02533	0.0077	L	0.29908	0.895	.	.	.	P;P;P	0.40050	0.7;0.668;0.668	B;B;B	0.38985	0.287;0.122;0.132	T	0.33369	-0.9871	9	0.66056	D	0.02	-6.2196	9.1764	0.37114	0.0:0.5755:0.0:0.4245	.	721;845;780	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	I	845	ENSP00000326581:R845I;ENSP00000403051:R845I	ENSP00000326581:R845I	R	-	2	0	ZIM2	62019088	0.001000	0.12720	0.000000	0.03702	0.128000	0.20619	0.564000	0.23563	-0.230000	0.09840	-0.423000	0.05987	AGA	-	PEG3	-	NULL		0.438	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	0	0		15	15		0.00		C			57327276	-1	10		48		tier1	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	17.24		SNP	0.014	A	10	48
MYBPH	4608	genome.wustl.edu	37	1	203141135	203141135	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:203141135C>T	ENST00000255416.4	-	4	599	c.542G>A	c.(541-543)cGt>cAt	p.R181H		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	181	Ig-like C2-type 1.				cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		GTAGGTCTGACGGAGGTGGCG	0.602													ENSG00000133055																									NSCLC(32;174 1025 14462 23899 42933)												0													32.0	31.0	31.0					1																	203141135		2203	4300	6503	SO:0001583	missense	0			-	BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.542G>A	1.37:g.203141135C>T	ENSP00000255416:p.Arg181His		Q16886|Q86YC5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R181H	ENST00000255416.4	37	c.542	CCDS30975.1	1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.848311	0.91277	.	.	ENSG00000133055	ENST00000255416	T	0.54071	0.59	4.84	4.84	0.62591	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000042	T	0.78155	0.4239	M	0.90650	3.135	0.53688	D	0.999974	D	0.89917	1.0	D	0.79784	0.993	T	0.83129	-0.0114	10	0.87932	D	0	.	18.1051	0.89517	0.0:1.0:0.0:0.0	.	181	Q13203	MYBPH_HUMAN	H	181	ENSP00000255416:R181H	ENSP00000255416:R181H	R	-	2	0	MYBPH	201407758	0.792000	0.28813	1.000000	0.80357	0.992000	0.81027	2.137000	0.42130	2.666000	0.90696	0.561000	0.74099	CGT	-	MYBPH	-	superfamily_Fibronectin_type3,smart_Ig_sub,pfscan_Ig-like_dom		0.602	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPH	HGNC	protein_coding	OTTHUMT00000100264.1	0	0		30	30		0.00		C	NM_004997		203141135	-1	27		21		tier1	no_errors	ENST00000255416	ensembl	human	known	74_37	missense	56.25		SNP	1.000	T	27	21
GOLGA6L4	643707	genome.wustl.edu	37	15	82932257	82932288	+	5'UTR	DEL	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC	-	rs555363824	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr15:82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC	ENST00000560844.1	-	0	2502_2533																				NS(1)	1						taaattagaaacacaaataaatttaaactataaattagaaacacaaataaat	0.207													ENSG00000215749																																					0																																										SO:0001623	5_prime_UTR_variant	0																															ENST00000560844.1:c.-1851GTTTCTAATTTATAGTTTAAATTTATTTGTGT>-	15.37:g.82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC				R	DEL	-	NULL	ENST00000560844.1	37	NULL		15																																																																																				RP13-996F3.5	-	-		0.207	RP13-996F3.5-002	KNOWN	basic	processed_transcript	GOLGA6L4	Clone_based_vega_gene	protein_coding	OTTHUMT00000419267.1									ACACAAATAAATTTAAACTATAAATTAGAAAC			82932288	-1					tier1	no_errors	ENST00000560844	ensembl	human	known	74_37	rna			DEL	0.140:0.148:0.154:0.160:0.165:0.169:0.172:0.175:0.177:0.178:0.179:0.179:0.180:0.179:0.135:0.131:0.126:0.121:0.112:0.097:0.077:0.050:0.041:0.040:0.045:0.047:0.048:0.046:0.049:0.052:0.050:0.046	-		
AC026700.1	0	genome.wustl.edu	37	5	84823864	84823864	+	RNA	SNP	A	A	G	rs371937583|rs201146846|rs199705000|rs145369997		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr5:84823864A>G	ENST00000401134.1	-	0	88																											TTATAtgtatatgtgtgtgtg	0.338													ENSG00000215953																																					0																																												0			-																													5.37:g.84823864A>G				R	SNP	-	NULL	ENST00000401134.1	37	NULL		5																																																																																			rs199705000	AC026700.1	-	-		0.338	AC026700.1-201	NOVEL	basic	miRNA	ENSG00000215953	Clone_based_ensembl_gene	miRNA		0	0		22	22		0.00		A			84823864	-1	6		18		tier1	no_errors	ENST00000401134	ensembl	human	novel	74_37	rna	25.00		SNP	0.005	G	6	18
CDYL	9425	genome.wustl.edu	37	6	4935802	4935802	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr6:4935802A>G	ENST00000328908.5	+	5	1038	c.907A>G	c.(907-909)Aca>Gca	p.T303A	CDYL_ENST00000343762.5_Missense_Mutation_p.T117A|CDYL_ENST00000472453.1_3'UTR|CDYL_ENST00000449732.2_Missense_Mutation_p.T117A|CDYL_ENST00000397588.3_Missense_Mutation_p.T249A			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	303	Interaction with EZH2.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		CAACATACAGACATCTGTTAC	0.468													ENSG00000153046																																					0													92.0	88.0	90.0					6																	4935802		2203	4300	6503	SO:0001583	missense	0			-	AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.907A>G	6.37:g.4935802A>G	ENSP00000330512:p.Thr303Ala		A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	pfam_Crotonase_core_superfam,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.T303A	ENST00000328908.5	37	c.907		6	.	.	.	.	.	.	.	.	.	.	A	19.85	3.903676	0.72754	.	.	ENSG00000153046	ENST00000328908;ENST00000440139;ENST00000397588;ENST00000449732;ENST00000343762	T;T;T;T	0.55930	0.87;0.5;0.49;0.49	6.03	4.86	0.63082	.	0.110178	0.64402	D	0.000011	T	0.45875	0.1364	M	0.68952	2.095	0.47547	D	0.999457	P;P	0.39903	0.694;0.638	P;B	0.46237	0.508;0.387	T	0.52518	-0.8565	10	0.66056	D	0.02	.	10.7736	0.46338	0.9234:0.0:0.0766:0.0	.	249;303	Q9Y232-2;Q9Y232	.;CDYL1_HUMAN	A	303;29;249;117;117	ENSP00000330512:T303A;ENSP00000380718:T249A;ENSP00000394076:T117A;ENSP00000340908:T117A	ENSP00000330512:T303A	T	+	1	0	CDYL	4880801	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	4.322000	0.59215	1.090000	0.41315	0.529000	0.55759	ACA	-	CDYL	-	NULL		0.468	CDYL-001	KNOWN	basic	protein_coding	CDYL	HGNC	protein_coding	OTTHUMT00000039736.1	0	0		41	41		0.00		A	NM_004824		4935802	+1	20		45		tier1	no_errors	ENST00000328908	ensembl	human	known	74_37	missense	30.77		SNP	1.000	G	20	45
PHACTR1	221692	genome.wustl.edu	37	6	12934035	12934035	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr6:12934035C>A	ENST00000379348.2	+	4	598	c.421C>A	c.(421-423)Caa>Aaa	p.Q141K	PHACTR1_ENST00000379350.1_Intron|PHACTR1_ENST00000332995.7_Intron			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	0					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TACAGGTGGACAATTCTCTAC	0.532													ENSG00000112137																																					0													62.0	57.0	59.0					6																	12934035		876	1991	2867	SO:0001583	missense	0			-	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379348.2:c.421C>A	6.37:g.12934035C>A	ENSP00000368653:p.Gln141Lys		A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	NULL	p.Q141K	ENST00000379348.2	37	c.421		6	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353976	0.24512	.	.	ENSG00000112137	ENST00000379348	T	0.44482	0.92	2.02	2.02	0.26589	.	.	.	.	.	T	0.34861	0.0912	.	.	.	0.21782	N	0.999546	P	0.46395	0.877	P	0.53518	0.728	T	0.08597	-1.0714	8	0.87932	D	0	.	7.582	0.27970	0.0:1.0:0.0:0.0	.	141	Q5R356	.	K	141	ENSP00000368653:Q141K	ENSP00000368653:Q141K	Q	+	1	0	PHACTR1	13042021	0.022000	0.18835	0.012000	0.15200	0.034000	0.12701	1.744000	0.38268	1.441000	0.47550	0.603000	0.83216	CAA	-	PHACTR1	-	NULL		0.532	PHACTR1-010	KNOWN	basic|appris_candidate	protein_coding	PHACTR1	HGNC	protein_coding	OTTHUMT00000039885.1	0	0		53	53		0.00		C	XM_166420		12934035	+1	10		79		tier1	no_errors	ENST00000379348	ensembl	human	known	74_37	missense	11.24		SNP	0.013	A	10	79
COL27A1	85301	genome.wustl.edu	37	9	117031280	117031281	+	Intron	INS	-	-	TGGTGT	rs71492772|rs74965078|rs112255284	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr9:117031280_117031281insTGGTGT	ENST00000356083.3	+	35	3892				COL27A1_ENST00000477421.2_3'UTR	NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1						extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						taataggatgatggtGTTGGTG	0.441													ENSG00000196739		2505	0.5002	0.8669	0.3804	5008	,	,		20945	0.2331		0.4354	False		,,,				2504	0.4315																0																																										SO:0001627	intron_variant	0				AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3502-240->TGGTGT	9.37:g.117031281_117031286dupTGGTGT			Q66K43|Q96JF7	R	INS	-	NULL	ENST00000356083.3	37	NULL	CCDS6802.1	9																																																																																				COL27A1	-	-		0.441	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1									-	NM_032888		117031281	+1					tier1	no_errors	ENST00000477421	ensembl	human	known	74_37	rna			INS	0.010:0.009	TGGTGT		
CXorf23	256643	genome.wustl.edu	37	X	19955616	19955616	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chrX:19955616T>A	ENST00000379682.4	-	8	1813	c.1780A>T	c.(1780-1782)Aat>Tat	p.N594Y	CXorf23_ENST00000379687.3_Intron|CXorf23_ENST00000356980.3_Intron			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	594						mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						GTATGAACATTCTTTACCTTT	0.269													ENSG00000173681																																					0													41.0	42.0	41.0					X																	19955616		2201	4283	6484	SO:0001583	missense	0			-	AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.1780A>T	X.37:g.19955616T>A	ENSP00000369004:p.Asn594Tyr		A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Missense_Mutation	SNP	NULL	p.N594Y	ENST00000379682.4	37	c.1780		X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.18|10.18	1.280396|1.280396	0.23392|0.23392	.|.	.|.	ENSG00000173681|ENSG00000173681	ENST00000539038|ENST00000379682	.|T	.|0.15139	.|2.45	5.49|5.49	3.1|3.1	0.35709|0.35709	.|.	.|.	.|.	.|.	.|.	.|T	.|0.29749	.|0.0743	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999999|0.999999	.|D	.|0.58620	.|0.983	.|P	.|0.58873	.|0.847	.|T	.|0.07693	.|-1.0759	.|7	.|.	.|.	.|.	.|.	7.8117|7.8117	0.29234|0.29234	0.0:0.1691:0.0:0.8309|0.0:0.1691:0.0:0.8309	.|.	.|594	.|A2AJT9	.|CX023_HUMAN	.|Y	-1|594	.|ENSP00000369004:N594Y	.|.	.|N	-|-	.|1	.|0	CXorf23|CXorf23	19865537|19865537	0.410000|0.410000	0.25376|0.25376	0.001000|0.001000	0.08648|0.08648	0.036000|0.036000	0.12997|0.12997	1.538000|1.538000	0.36094|0.36094	0.246000|0.246000	0.21394|0.21394	0.437000|0.437000	0.28790|0.28790	.|AAT	-	CXorf23	-	NULL		0.269	CXorf23-006	NOVEL	basic	protein_coding	CXorf23	HGNC	protein_coding	OTTHUMT00000055991.2	0	0		100	100		0.00		T	NM_198279		19955616	-1	47		183		tier1	no_errors	ENST00000379682	ensembl	human	novel	74_37	missense	20.43		SNP	0.007	A	47	183
AHNAK2	113146	genome.wustl.edu	37	14	105410494	105410494	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr14:105410494G>C	ENST00000333244.5	-	7	11413	c.11294C>G	c.(11293-11295)tCt>tGt	p.S3765C	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3765						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGGGCAGAGACACCTCCAC	0.622													ENSG00000185567																																					0													151.0	158.0	156.0					14																	105410494		1958	4140	6098	SO:0001583	missense	0			-	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11294C>G	14.37:g.105410494G>C	ENSP00000353114:p.Ser3765Cys		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S3765C	ENST00000333244.5	37	c.11294	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	15.30	2.791233	0.50102	.	.	ENSG00000185567	ENST00000333244	T	0.00745	5.75	4.26	1.18	0.20946	.	.	.	.	.	T	0.01387	0.0045	M	0.88775	2.98	0.09310	N	1	P	0.42941	0.794	B	0.35770	0.21	T	0.41928	-0.9481	9	0.62326	D	0.03	.	3.4975	0.07661	0.0845:0.1454:0.4712:0.2989	.	3765	Q8IVF2	AHNK2_HUMAN	C	3765	ENSP00000353114:S3765C	ENSP00000353114:S3765C	S	-	2	0	AHNAK2	104481539	0.038000	0.19896	0.000000	0.03702	0.024000	0.10985	2.188000	0.42612	-0.060000	0.13132	0.485000	0.47835	TCT	-	AHK2	-	NULL		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK2	HGNC	protein_coding	OTTHUMT00000410300.1	0	0		78	78		0.00		G	NM_138420		105410494	-1	74		44		tier1	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	62.71		SNP	0.001	C	74	44
SPEG	10290	genome.wustl.edu	37	2	220330668	220330669	+	Intron	INS	-	-	GT	rs554914793		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr2:220330668_220330669insGT	ENST00000312358.7	+	10	3013				SPEG_ENST00000396695.2_Intron|SPEG_ENST00000485813.1_Intron|SPEG_ENST00000396686.1_Intron|SPEG_ENST00000396698.1_Intron|SPEG_ENST00000396689.2_Intron|SPEG_ENST00000396688.1_Intron	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus						cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		tgcacgtgtgcgtgcatgtgtg	0.589													ENSG00000072195																																					0																																										SO:0001627	intron_variant	0				BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2882-1227->GT	2.37:g.220330669_220330670dupGT			A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	R	INS	-	NULL	ENST00000312358.7	37	NULL	CCDS42824.1	2																																																																																				SPEG	-	-		0.589	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	0	0		25	25		0.00		-	NM_005876		220330669	+1	4		22		tier1	no_errors	ENST00000462545	ensembl	human	known	74_37	rna	15.38		INS	0.000:0.003	GT	4	22
SHISA2	387914	genome.wustl.edu	37	13	26620919	26620919	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr13:26620919C>G	ENST00000319420.3	-	2	675	c.620G>C	c.(619-621)tGc>tCc	p.C207S		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	207					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.C207F(2)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						TTCCGGCAAGCAACAGTTGGT	0.602													ENSG00000180730																																					2	Substitution - Missense(2)	lung(1)|endometrium(1)											137.0	129.0	132.0					13																	26620919		2203	4300	6503	SO:0001583	missense	0			-		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.620G>C	13.37:g.26620919C>G	ENSP00000313079:p.Cys207Ser		B9EH70|Q5W0G8	Missense_Mutation	SNP	NULL	p.C207S	ENST00000319420.3	37	c.620	CCDS31951.1	13	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378034	0.82682	.	.	ENSG00000180730	ENST00000319420	T	0.43688	0.94	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.37812	0.1017	L	0.34521	1.04	0.80722	D	1	P	0.39094	0.659	B	0.40534	0.332	T	0.08452	-1.0721	10	0.23891	T	0.37	-43.8161	18.8611	0.92271	0.0:1.0:0.0:0.0	.	207	Q6UWI4	SHSA2_HUMAN	S	207	ENSP00000313079:C207S	ENSP00000313079:C207S	C	-	2	0	SHISA2	25518919	1.000000	0.71417	0.999000	0.59377	0.868000	0.49771	7.435000	0.80391	2.447000	0.82792	0.555000	0.69702	TGC	-	SHISA2	-	NULL		0.602	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA2	HGNC	protein_coding	OTTHUMT00000044239.2	0	0		31	31		0.00		C	NM_001007538		26620919	-1	53		56		tier1	no_errors	ENST00000319420	ensembl	human	known	74_37	missense	48.18		SNP	1.000	G	53	56
ACSM5	54988	genome.wustl.edu	37	16	20442562	20442562	+	Silent	SNP	C	C	T	rs78006992	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr16:20442562C>T	ENST00000331849.4	+	10	1374	c.1227C>T	c.(1225-1227)aaC>aaT	p.N409N		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	409					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.N409N(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						ATGAGGGCAACGTCCTGCCTC	0.557													ENSG00000183549																																					1	Substitution - coding silent(1)	kidney(1)											157.0	135.0	142.0					16																	20442562		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1227C>T	16.37:g.20442562C>T			Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.N409	ENST00000331849.4	37	c.1227	CCDS10585.1	16																																																																																			rs78006992	ACSM5	-	pfam_AMP-dep_Synth/Lig		0.557	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	0	0		29	29		0.00		C	NM_017888		20442562	+1	8		80		tier1	no_errors	ENST00000331849	ensembl	human	known	74_37	silent	9.09		SNP	0.043	T	8	80
MIR137HG	400765	genome.wustl.edu	37	1	98511733	98511733	+	lincRNA	SNP	G	G	A	rs75853046|rs58335419		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:98511733G>A	ENST00000580305.1	-	0	0				MIR137HG_ENST00000385223.1_lincRNA	NR_039604.1				MIR137 host gene (non-protein coding)																		GGACCAAgctgccgctgccgc	0.607													ENSG00000225206																																					0													6.0	10.0	9.0					1																	98511733		1136	2693	3829			0			-	AK094607		1p21.3	2013-05-22			ENSG00000225206	ENSG00000225206		"""Long non-coding RNAs"""	42871	non-coding RNA	RNA, long non-coding							Standard	NR_046105		Approved		uc001drx.2		OTTHUMG00000010680		1.37:g.98511733G>A				R	SNP	-	NULL	ENST00000580305.1	37	NULL		1																																																																																			rs75853046	MIR137HG	-	-		0.607	MIR137HG-203	KNOWN	basic	miRNA	MIR137HG	HGNC	lincRNA		0	0		33	33		0.00		G	NR_046105		98511733	-1	21		106		tier1	no_errors	ENST00000424528	ensembl	human	known	74_37	rna	16.15		SNP	1.000	A	21	106
PRAMEF22	653606	genome.wustl.edu	37	1	13038327	13038327	+	Silent	SNP	G	G	T	rs199598633		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:13038327G>T	ENST00000376187.1	+	3	1392	c.1392G>T	c.(1390-1392)acG>acT	p.T464T	PRAMEF6_ENST00000376192.5_Intron	NM_001100631.1	NP_001094101.1	A3QJZ6	PRA22_HUMAN	PRAME family member 22	464					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|large_intestine(2)|lung(1)|skin(1)	5						GCTGTGGCACGTCGCCCACTG	0.527													ENSG00000204508																																					0													1.0	1.0	1.0					1																	13038327		265	525	790	SO:0001819	synonymous_variant	0			-			1p36.21	2013-01-17			ENSG00000204508			"""-"""	34393	protein-coding gene	gene with protein product							Standard	NM_001100631		Approved	PRAMEF3L	uc009vnq.1	A3QJZ6	OTTHUMG00000074726	ENST00000376187.1:c.1392G>T	1.37:g.13038327G>T			A6NMM3	Silent	SNP	NULL	p.T464	ENST00000376187.1	37	c.1392	CCDS41256.1	1																																																																																			rs199598633	PRAMEF22	-	NULL		0.527	PRAMEF22-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	PRAMEF22	HGNC	protein_coding	OTTHUMT00000158511.1	0	0		8	8		0.00		G	NM_001100631		13038327	+1	5		7		tier1	no_errors	ENST00000376187	ensembl	human	known	74_37	silent	41.67		SNP	0.000	T	5	7
ERICH3	127254	genome.wustl.edu	37	1	75072348	75072348	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:75072348T>C	ENST00000326665.5	-	10	1644	c.1426A>G	c.(1426-1428)Aca>Gca	p.T476A	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Missense_Mutation_p.T279A	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		476	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCTTTACTTGTCATTTCCTCC	0.373													ENSG00000178965																																					0													201.0	197.0	198.0					1																	75072348		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000326665.5:c.1426A>G	1.37:g.75072348T>C	ENSP00000322609:p.Thr476Ala		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.T476A	ENST00000326665.5	37	c.1426	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	T	11.81	1.750490	0.30955	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.16743	2.8;2.32	5.15	0.643	0.17770	.	.	.	.	.	T	0.01940	0.0061	N	0.14661	0.345	0.09310	N	0.999997	B;B	0.19706	0.015;0.038	B;B	0.16289	0.015;0.015	T	0.47071	-0.9145	9	0.17832	T	0.49	-8.5043	1.9572	0.03378	0.1359:0.459:0.1328:0.2722	.	279;476	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	A	476;279	ENSP00000322609:T476A;ENSP00000398581:T279A	ENSP00000322609:T476A	T	-	1	0	C1orf173	74844936	0.474000	0.25886	0.755000	0.31263	0.178000	0.23041	1.030000	0.30153	0.265000	0.21872	-0.177000	0.13119	ACA	-	C1orf173	-	NULL		0.373	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	0	0		28	28		0.00		T			75072348	-1	18		48		tier1	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	27.27		SNP	0.131	C	18	48
SPTA1	6708	genome.wustl.edu	37	1	158636128	158636128	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:158636128T>A	ENST00000368147.4	-	16	2378	c.2198A>T	c.(2197-2199)gAg>gTg	p.E733V		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	733					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CACAGCCGACTCCAGGAGGCC	0.517													ENSG00000163554																																					0													40.0	43.0	42.0					1																	158636128		1965	4163	6128	SO:0001583	missense	0			-	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2198A>T	1.37:g.158636128T>A	ENSP00000357129:p.Glu733Val		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E733V	ENST00000368147.4	37	c.2198	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380756	0.61845	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.57752	0.38;0.38	4.55	4.55	0.56014	.	0.000000	0.32518	N	0.005984	T	0.71409	0.3336	M	0.91038	3.17	0.54753	D	0.999982	D	0.71674	0.998	D	0.73380	0.98	T	0.79240	-0.1885	10	0.87932	D	0	.	12.8806	0.58014	0.0:0.0:0.0:1.0	.	733	P02549	SPTA1_HUMAN	V	733	ENSP00000357130:E733V;ENSP00000357129:E733V	ENSP00000357129:E733V	E	-	2	0	SPTA1	156902752	1.000000	0.71417	0.968000	0.41197	0.285000	0.27093	6.801000	0.75170	1.903000	0.55091	0.528000	0.53228	GAG	-	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.517	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	0	0		54	54		0.00		T	NM_003126		158636128	-1	37		104		tier1	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	26.24		SNP	1.000	A	37	104
CCDC138	165055	genome.wustl.edu	37	2	109408168	109408168	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr2:109408168A>G	ENST00000295124.4	+	4	364	c.304A>G	c.(304-306)Aaa>Gaa	p.K102E	CCDC138_ENST00000412964.2_Missense_Mutation_p.K102E|CCDC138_ENST00000470608.1_3'UTR	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	102										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						TGATTTGAAGAAACAGGAAAC	0.274													ENSG00000163006																																					0													84.0	101.0	95.0					2																	109408168		2198	4281	6479	SO:0001583	missense	0			-	AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.304A>G	2.37:g.109408168A>G	ENSP00000295124:p.Lys102Glu		Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	NULL	p.K102E	ENST00000295124.4	37	c.304	CCDS2080.1	2	.	.	.	.	.	.	.	.	.	.	A	9.006	0.981199	0.18812	.	.	ENSG00000163006	ENST00000412964;ENST00000295124	D;D	0.89875	-2.58;-2.58	5.77	2.66	0.31614	.	0.616794	0.15393	N	0.264697	T	0.69602	0.3129	N	0.08118	0	0.22317	N	0.999205	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.56854	-0.7910	10	0.05525	T	0.97	2.122	3.3665	0.07206	0.2568:0.5313:0.113:0.099	.	102;102	Q96M89-2;Q96M89	.;CC138_HUMAN	E	102	ENSP00000411800:K102E;ENSP00000295124:K102E	ENSP00000295124:K102E	K	+	1	0	CCDC138	108774600	0.916000	0.31088	0.962000	0.40283	0.897000	0.52465	1.308000	0.33528	0.608000	0.30000	0.533000	0.62120	AAA	-	CCDC138	-	NULL		0.274	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC138	HGNC	protein_coding	OTTHUMT00000253593.1	0	0		68	68		0.00		A	NM_144978		109408168	+1	28		25		tier1	no_errors	ENST00000295124	ensembl	human	known	74_37	missense	52.83		SNP	0.627	G	28	25
TRIOBP	11078	genome.wustl.edu	37	22	38121164	38121164	+	Silent	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr22:38121164C>T	ENST00000406386.3	+	7	2856	c.2601C>T	c.(2599-2601)tcC>tcT	p.S867S		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	867					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CTGGAACCTCCTCATCTCAAT	0.498													ENSG00000100106																																					0													136.0	146.0	143.0					22																	38121164		2034	4169	6203	SO:0001819	synonymous_variant	0			-	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2601C>T	22.37:g.38121164C>T			B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S867	ENST00000406386.3	37	c.2601	CCDS43015.1	22																																																																																			-	TRIOBP	-	NULL		0.498	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	0	0		22	22		0.00		C			38121164	+1	29		32		tier1	no_errors	ENST00000406386	ensembl	human	known	74_37	silent	47.54		SNP	0.003	T	29	32
MED23	9439	genome.wustl.edu	37	6	131941854	131941857	+	Frame_Shift_Del	DEL	AGAT	AGAT	-	rs377538332		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	AGAT	AGAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr6:131941854_131941857delAGAT	ENST00000368068.3	-	7	687_690	c.508_511delATCT	c.(508-513)atcttgfs	p.IL170fs	MED23_ENST00000368058.1_Frame_Shift_Del_p.IL170fs|MED23_ENST00000368060.3_Frame_Shift_Del_p.IL170fs|MED23_ENST00000540546.1_Frame_Shift_Del_p.IL170fs|MED23_ENST00000354577.4_Frame_Shift_Del_p.IL170fs|MED23_ENST00000368053.4_Frame_Shift_Del_p.IL170fs|MED23_ENST00000403834.3_Frame_Shift_Del_p.IL170fs|MED23_ENST00000539158.1_Frame_Shift_Del_p.IL170fs	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	170					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		TTTCTTTCCAAGATATATGCTATA	0.319													ENSG00000112282																																					0																																										SO:0001589	frameshift_variant	0				AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.508_511delATCT	6.37:g.131941854_131941857delAGAT	ENSP00000357047:p.Ile170fs		B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Frame_Shift_Del	DEL	pfam_Mediator_Med23	p.I170fs	ENST00000368068.3	37	c.511_508	CCDS5147.1	6																																																																																				MED23	-	pfam_Mediator_Med23		0.319	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED23	HGNC	protein_coding	OTTHUMT00000042215.1	0	0		24	24		0.00		AGAT			131941857	-1	22		47		tier1	no_errors	ENST00000368058	ensembl	human	known	74_37	frame_shift_del	31.88		DEL	0.970:0.963:1.000:1.000	-	22	47
DCHS2	54798	genome.wustl.edu	37	4	155254432	155254432	+	Silent	SNP	G	G	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr4:155254432G>A	ENST00000357232.4	-	9	1430	c.1431C>T	c.(1429-1431)caC>caT	p.H477H	DCHS2_ENST00000339452.1_Silent_p.H976H|DCHS2_ENST00000507542.1_5'UTR	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	477	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GGAACGCTGGGTGGTTGTCAT	0.607													ENSG00000197410																																					0													120.0	104.0	109.0					4																	155254432		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1431C>T	4.37:g.155254432G>A			B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_D-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H477	ENST00000357232.4	37	c.1431	CCDS3785.1	4																																																																																			-	DCHS2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.607	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	0	0		21	21		0.00		G	NM_001142552		155254432	-1	6		23		tier1	no_errors	ENST00000357232	ensembl	human	known	74_37	silent	20.69		SNP	0.560	A	6	23
GIMAP1	170575	genome.wustl.edu	37	7	150417384	150417384	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr7:150417384T>A	ENST00000307194.5	+	3	432	c.292T>A	c.(292-294)Tgt>Agt	p.C98S		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	98	AIG1-type G.				B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGATCCTGGCTGTGAGGAGAG	0.652													ENSG00000213203																																					0													51.0	46.0	48.0					7																	150417384		2203	4300	6503	SO:0001583	missense	0			-	AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.292T>A	7.37:g.150417384T>A	ENSP00000302833:p.Cys98Ser		B2RCI3|Q8NAZ0	Missense_Mutation	SNP	pfam_AIG1,superfamily_P-loop_NTPase	p.C98S	ENST00000307194.5	37	c.292	CCDS5906.1	7	.	.	.	.	.	.	.	.	.	.	T	7.133	0.580352	0.13686	.	.	ENSG00000213203	ENST00000307194	T	0.60171	0.21	4.5	0.662	0.17880	AIG1 (1);	1.648980	0.03703	U	0.248939	T	0.46190	0.1380	L	0.31526	0.94	0.09310	N	1	B	0.11235	0.004	B	0.31101	0.124	T	0.26360	-1.0105	10	0.22109	T	0.4	.	4.0011	0.09580	0.0:0.2092:0.2054:0.5855	.	98	Q8WWP7	GIMA1_HUMAN	S	98	ENSP00000302833:C98S	ENSP00000302833:C98S	C	+	1	0	GIMAP1	150048317	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.269000	0.08596	0.264000	0.21851	-0.290000	0.09829	TGT	-	GIMAP1	-	pfam_AIG1,superfamily_P-loop_NTPase		0.652	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP1	HGNC	protein_coding	OTTHUMT00000348951.2	0	0		30	30		0.00		T	NM_130759		150417384	+1	31		40		tier1	no_errors	ENST00000307194	ensembl	human	known	74_37	missense	43.66		SNP	0.000	A	31	40
LRRCC1	85444	genome.wustl.edu	37	8	86041607	86041607	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr8:86041607C>T	ENST00000360375.3	+	10	1768	c.1619C>T	c.(1618-1620)gCa>gTa	p.A540V	LRRCC1_ENST00000414626.2_Missense_Mutation_p.A520V	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	540					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						CAGCAGCAGGCAGCACAGGTA	0.333													ENSG00000133739																																					0													77.0	82.0	80.0					8																	86041607		1856	4102	5958	SO:0001583	missense	0			-	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.1619C>T	8.37:g.86041607C>T	ENSP00000353538:p.Ala540Val		B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin	p.A540V	ENST00000360375.3	37	c.1619	CCDS43750.1	8	.	.	.	.	.	.	.	.	.	.	C	6.467	0.454317	0.12283	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.35048	1.33;1.34	5.58	0.657	0.17850	.	0.907335	0.09073	N	0.852545	T	0.35098	0.0920	M	0.72118	2.19	0.19300	N	0.999978	B;B;B;B	0.10296	0.001;0.001;0.003;0.002	B;B;B;B	0.11329	0.004;0.004;0.004;0.006	T	0.33497	-0.9866	10	0.30854	T	0.27	0.0308	7.165	0.25685	0.1113:0.6355:0.0:0.2532	.	447;520;447;540	B4DV06;Q9C099-2;E9PE41;Q9C099	.;.;.;LRCC1_HUMAN	V	540;520	ENSP00000353538:A540V;ENSP00000394695:A520V	ENSP00000353538:A540V	A	+	2	0	LRRCC1	86228859	0.152000	0.22762	0.011000	0.14972	0.482000	0.33219	1.065000	0.30592	0.120000	0.18254	-0.143000	0.13931	GCA	-	LRRCC1	-	NULL		0.333	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRCC1	HGNC	protein_coding	OTTHUMT00000380267.1	0	0		31	31		0.00		C	NM_033402		86041607	+1	21		36		tier1	no_errors	ENST00000360375	ensembl	human	known	74_37	missense	36.84		SNP	0.033	T	21	36
CXorf30	645090	genome.wustl.edu	37	X	36319258	36319258	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chrX:36319258C>A	ENST00000378657.4	+	7	920	c.272C>A	c.(271-273)cCa>cAa	p.P91Q		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	91										breast(1)|lung(2)|stomach(1)	4						TTACCAAAACCAACCACAATG	0.328													ENSG00000205081																																					0													163.0	134.0	142.0					X																	36319258		692	1591	2283	SO:0001583	missense	0			-		CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.272C>A	X.37:g.36319258C>A	ENSP00000367926:p.Pro91Gln			Missense_Mutation	SNP	NULL	p.P91Q	ENST00000378657.4	37	c.272	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110434	0.56398	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.25912	1.77;1.8	5.61	4.74	0.60224	.	.	.	.	.	T	0.32763	0.0840	N	0.24115	0.695	0.09310	N	1	D	0.69078	0.997	P	0.62382	0.901	T	0.11690	-1.0577	9	0.66056	D	0.02	.	10.4938	0.44766	0.0:0.9075:0.0:0.0925	.	91	A6PW82	CX030_HUMAN	Q	376;91	ENSP00000367922:P376Q;ENSP00000367926:P91Q	ENSP00000367922:P376Q	P	+	2	0	CXorf30	36229179	0.895000	0.30542	0.015000	0.15790	0.004000	0.04260	2.198000	0.42705	1.113000	0.41760	0.594000	0.82650	CCA	-	CXorf30	-	NULL		0.328	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding		0	0		80	80		0.00		C	NP_001092313		36319258	+1	62		98		tier1	no_errors	ENST00000378657	ensembl	human	known	74_37	missense	38.75		SNP	0.259	A	62	98
GGA2	23062	genome.wustl.edu	37	16	23478708	23478709	+	3'UTR	INS	-	-	AC	rs57255054|rs71722726|rs199927740|rs139277715|rs61552681		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr16:23478708_23478709insAC	ENST00000309859.4	-	0	2126_2127				GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		CCTCTCCCCGAacacacacaca	0.505													ENSG00000103365																																					0																																										SO:0001624	3_prime_UTR_variant	0				AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.*203->GT	16.37:g.23478717_23478718dupAC			D3DWF0|O14564|Q9NYN2|Q9UPS2	R	INS	-	NULL	ENST00000309859.4	37	NULL	CCDS10611.1	16																																																																																				GGA2	-	-		0.505	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA2	HGNC	protein_coding	OTTHUMT00000214019.1	0	0		11	11		0.00		-			23478709	-1	2		12		tier1	no_errors	ENST00000566685	ensembl	human	putative	74_37	rna	14.29		INS	0.000:0.000	AC	2	12
HLA-DOA	3111	genome.wustl.edu	37	6	32976071	32976072	+	Intron	INS	-	-	A	rs376186013|rs41541916|rs41556014|rs41544020|rs41556712|rs41559515|rs41561113|rs41555920|rs41553520|rs41549313|rs368822182	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr6:32976071_32976072insA	ENST00000229829.5	-	2	158				HLA-DOA_ENST00000495532.1_5'Flank|HLA-DOA_ENST00000450833.2_5'UTR	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						CAAGGAGAGAGAAAAAAATGTG	0.554													ENSG00000204252	|||unknown(STR3?)	62	0.0123802	0.0454	0.0029	5008	,	,		18724	0.0		0.0	False		,,,				2504	0.0																0										118,3384		8,102,1641						0.4	0.0		dbSNP_134	38	7,6785		0,7,3389	no	intron	HLA-DOA	NM_002119.3		8,109,5030	A1A1,A1R,RR		0.1031,3.3695,1.2143				125,10169				SO:0001627	intron_variant	0				M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.83-33->T	6.37:g.32976078_32976078dupA			Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	R	INS	-	NULL	ENST00000229829.5	37	NULL	CCDS4763.1	6																																																																																				HLA-DOA	-	-		0.554	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DOA	HGNC	protein_coding	OTTHUMT00000076426.2	0	0		8	8		0.00		-	NM_002119		32976072	-1	3		8		tier1	no_errors	ENST00000467465	ensembl	human	known	74_37	rna	27.27		INS	0.001:0.004	A	3	8
LOC101927648	101927648	genome.wustl.edu	37	1	143355405	143355405	+	lincRNA	SNP	T	T	C	rs9329476		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:143355405T>C	ENST00000423249.1	-	0	1346				RP11-435B5.3_ENST00000430699.1_lincRNA																							gttctatgcatttatcatctc	0.303													ENSG00000185044																																					0																																												0			-																													1.37:g.143355405T>C				R	SNP	-	NULL	ENST00000423249.1	37	NULL		1																																																																																			-	RP11-435B5.4	-	-		0.303	RP11-435B5.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927648	Clone_based_vega_gene	lincRNA	OTTHUMT00000037552.1	0	0		10	10		0.00		T			143355405	-1	4		4		tier1	no_errors	ENST00000423249	ensembl	human	known	74_37	rna	50.00		SNP	0.006	C	4	4
UNC80	285175	genome.wustl.edu	37	2	210791620	210791620	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr2:210791620C>G	ENST00000439458.1	+	35	5598	c.5518C>G	c.(5518-5520)Caa>Gaa	p.Q1840E	UNC80_ENST00000272845.6_Missense_Mutation_p.Q1835E	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1840					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TCAGCCCCCACAAGCAGTGTT	0.493													ENSG00000144406																																					0													185.0	156.0	165.0					2																	210791620		692	1591	2283	SO:0001583	missense	0			-	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.5518C>G	2.37:g.210791620C>G	ENSP00000391088:p.Gln1840Glu		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.Q1840E	ENST00000439458.1	37	c.5518	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022672	0.93462	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.34667	1.35;1.35	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.52581	0.1743	L	0.43923	1.385	0.80722	D	1	P	0.43578	0.811	P	0.57960	0.83	T	0.47636	-0.9102	10	0.59425	D	0.04	-17.6203	19.7657	0.96340	0.0:1.0:0.0:0.0	.	1840	Q8N2C7	UNC80_HUMAN	E	1840;1835	ENSP00000391088:Q1840E;ENSP00000272845:Q1835E	ENSP00000272845:Q1835E	Q	+	1	0	UNC80	210499865	1.000000	0.71417	0.971000	0.41717	0.988000	0.76386	7.487000	0.81328	2.649000	0.89929	0.655000	0.94253	CAA	-	UNC80	-	NULL		0.493	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		0	0		21	21		0.00		C	NM_182587		210791620	+1	16		17		tier1	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	48.48		SNP	1.000	G	16	17
PCDHGB1	56104	genome.wustl.edu	37	5	140730100	140730100	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr5:140730100G>T	ENST00000523390.1	+	1	273	c.273G>T	c.(271-273)aaG>aaT	p.K91N	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	91	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCGAGAGAAGATTTGCGGAA	0.428											OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000254221																																					0													89.0	85.0	86.0					5																	140730100		1862	4104	5966	SO:0001583	missense	0			-	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.273G>T	5.37:g.140730100G>T	ENSP00000429273:p.Lys91Asn	1658	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K91N	ENST00000523390.1	37	c.273	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	13.14	2.148278	0.37923	.	.	ENSG00000254221	ENST00000523390	T	0.28069	1.63	5.46	2.58	0.30949	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.29716	0.0742	L	0.49640	1.575	0.22401	N	0.999139	B;B	0.33345	0.143;0.409	B;B	0.36030	0.133;0.216	T	0.21586	-1.0241	9	0.66056	D	0.02	.	8.9962	0.36055	0.317:0.0:0.683:0.0	.	91;91	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	N	91	ENSP00000429273:K91N	ENSP00000429273:K91N	K	+	3	2	PCDHGB1	140710284	0.007000	0.16637	0.998000	0.56505	0.793000	0.44817	0.730000	0.26043	0.735000	0.32537	0.563000	0.77884	AAG	-	PCDHGB1	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.428	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	0	0		29	29		0.00		G	NM_018922		140730100	+1	23		16		tier1	no_errors	ENST00000523390	ensembl	human	known	74_37	missense	58.97		SNP	0.994	T	23	16
LOC645752	645752	genome.wustl.edu	37	15	78211432	78211432	+	lincRNA	SNP	T	T	G	rs71145882		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr15:78211432T>G	ENST00000565869.1	+	0	111				RP11-114H24.2_ENST00000567226.1_RNA|RN7SL214P_ENST00000487317.2_RNA																							TCGGAGCATCTCCTCCTGCTC	0.577													ENSG00000260776																																					0																																												0			-																													15.37:g.78211432T>G				R	SNP	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			-	RP11-114H24.2	-	-		0.577	RP11-114H24.7-001	KNOWN	basic	lincRNA	LOC645752	Clone_based_vega_gene	lincRNA	OTTHUMT00000421587.1	0	0		51	51		0.00		T			78211432	-1	5		47		tier1	no_errors	ENST00000567226	ensembl	human	known	74_37	rna	9.62		SNP	0.401	G	5	47
ALOX5	240	genome.wustl.edu	37	10	45939376	45939376	+	Intron	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr10:45939376C>T	ENST00000374391.2	+	12	1727				RP11-67C2.2_ENST00000435635.1_RNA|ALOX5_ENST00000542434.1_Intron	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase						arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	CGGACAGCCTCGGGGCCTGGC	0.716													ENSG00000012779																																					0																																										SO:0001627	intron_variant	0			-	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1674+100C>T	10.37:g.45939376C>T			B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	R	SNP	-	NULL	ENST00000374391.2	37	NULL	CCDS7212.1	10																																																																																			-	ALOX5	-	-		0.716	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	HGNC	protein_coding	OTTHUMT00000047780.1	0	0		15	15		0.00		C			45939376	+1	19		10		tier1	no_errors	ENST00000498461	ensembl	human	known	74_37	rna	65.52		SNP	0.000	T	19	10
SIGLEC6	946	genome.wustl.edu	37	19	52031485	52031485	+	Silent	SNP	A	A	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:52031485A>G	ENST00000425629.3	-	6	1189	c.1035T>C	c.(1033-1035)ggT>ggC	p.G345G	SIGLEC6_ENST00000474054.1_5'UTR|SIGLEC6_ENST00000343300.4_Intron|SIGLEC6_ENST00000391797.3_Intron|SIGLEC6_ENST00000346477.3_Silent_p.G329G|SIGLEC6_ENST00000359982.4_Silent_p.G356G|SIGLEC6_ENST00000436458.1_Silent_p.G293G	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	345					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		CCAGGACACCACCAGCCCTGC	0.512													ENSG00000105492																																					0													82.0	89.0	87.0					19																	52031485		1969	4141	6110	SO:0001819	synonymous_variant	0			-	D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1035T>C	19.37:g.52031485A>G			A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G345	ENST00000425629.3	37	c.1035	CCDS12834.3	19																																																																																			-	SIGLEC6	-	NULL		0.512	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	0	0		30	30		0.00		A	NM_001245		52031485	-1	12		21		tier1	no_errors	ENST00000425629	ensembl	human	known	74_37	silent	35.29		SNP	0.000	G	12	21
MUC19	283463	genome.wustl.edu	37	12	40938791	40938791	+	Intron	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr12:40938791T>A	ENST00000454784.4	+	56	17711							Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						AATACTAGTGTTTCACTCTAA	0.368													ENSG00000205592																																					0																																										SO:0001627	intron_variant	0			-	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.10891-61T>A	12.37:g.40938791T>A			Q8NA85	R	SNP	-	NULL	ENST00000454784.4	37	NULL		12																																																																																			-	MUC19	-	-		0.368	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	0	0		30	30		0.00		T	XM_003403524		40938791	+1	8		28		tier1	no_errors	ENST00000492952	ensembl	human	known	74_37	rna	21.62		SNP	0.000	A	8	28
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147847	+	3'UTR	DEL	GTGTGTGTGTGT	GTGTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs200666696|rs200969250|rs66612444		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	GTGTGTGTGTGT	GTGTGTGTGTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr2:50147836_50147847delGTGTGTGTGTGT	ENST00000406316.2	-	0	7145_7156				NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgtgt	0.392													ENSG00000179915																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACACAC>-	2.37:g.50147836_50147847delGTGTGTGTGTGT			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	R	DEL	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																				NRXN1	-	-		0.392	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2									GTGTGTGTGTGT			50147847	-1					tier1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna			DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096:0.025:0.055	-		
MVB12B	89853	genome.wustl.edu	37	9	129269245	129269245	+	3'UTR	SNP	G	G	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr9:129269245G>A	ENST00000361171.3	+	0	4744				MVB12B_ENST00000485886.1_3'UTR	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B						protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										CTTGTACTTGGCAAGGGAAGT	0.458													ENSG00000196814																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.*3703G>A	9.37:g.129269245G>A			Q8N6S7	R	SNP	-	NULL	ENST00000361171.3	37	NULL	CCDS35142.1	9																																																																																			-	MVB12B	-	-		0.458	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVB12B	HGNC	protein_coding	OTTHUMT00000054110.1	0	0		28	28		0.00		G	XM_088525		129269245	+1	31		49		tier1	no_errors	ENST00000485886	ensembl	human	known	74_37	rna	38.27		SNP	1.000	A	31	49
COL18A1	80781	genome.wustl.edu	37	21	46888376	46888376	+	Silent	SNP	C	C	T	rs564820524		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr21:46888376C>T	ENST00000359759.4	+	2	1593	c.1572C>T	c.(1570-1572)ttC>ttT	p.F524F	COL18A1_ENST00000355480.5_Silent_p.F289F|COL18A1_ENST00000400337.2_Silent_p.F109F			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	524	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGGTGCTGTTCGCCATCACGG	0.637													ENSG00000182871																																					0													70.0	83.0	79.0					21																	46888376		2131	4246	6377	SO:0001819	synonymous_variant	0			-		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1572C>T	21.37:g.46888376C>T			A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.F524	ENST00000359759.4	37	c.1572		21																																																																																			-	COL18A1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.637	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	0	0		40	40		0.00		C			46888376	+1	8		46		tier1	no_errors	ENST00000359759	ensembl	human	known	74_37	silent	14.81		SNP	0.908	T	8	46
OR5AK2	390181	genome.wustl.edu	37	11	56756816	56756816	+	Missense_Mutation	SNP	G	G	A	rs200727671		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr11:56756816G>A	ENST00000326855.2	+	1	470	c.428G>A	c.(427-429)cGt>cAt	p.R143H		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						GTCTGCATCCGTTTGGTAGCT	0.443													ENSG00000181273																																					0								A	HIS/ARG	0,4402		0,0,2201	200.0	170.0	180.0		428	1.4	0.0	11		180	1,8591	818.8+/-406.8	0,1,4295	no	missense	OR5AK2	NM_001005323.1	29	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	143/310	56756816	1,12993	2201	4296	6497	SO:0001583	missense	0			-	AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.428G>A	11.37:g.56756816G>A	ENSP00000322784:p.Arg143His		B2RNZ9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R143H	ENST00000326855.2	37	c.428	CCDS31538.1	11	.	.	.	.	.	.	.	.	.	.	A	0.059	-1.228296	0.01518	0.0	1.16E-4	ENSG00000181273	ENST00000326855	T	0.00130	8.69	3.85	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	0.905149	0.09098	N	0.848868	T	0.00073	0.0002	N	0.16903	0.455	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.02075	-1.1218	10	0.14656	T	0.56	2.8692	4.5631	0.12170	0.6374:0.1636:0.199:0.0	.	143	Q8NH90	O5AK2_HUMAN	H	143	ENSP00000322784:R143H	ENSP00000322784:R143H	R	+	2	0	OR5AK2	56513392	0.000000	0.05858	0.001000	0.08648	0.114000	0.19823	-1.009000	0.03660	-0.111000	0.12001	-1.220000	0.01600	CGT	rs200727671	OR5AK2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.443	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AK2	HGNC	protein_coding	OTTHUMT00000392446.1	0	0		24	24		0.00		G	NM_001005323		56756816	+1	14		21		tier1	no_errors	ENST00000326855	ensembl	human	known	74_37	missense	40.00		SNP	0.002	A	14	21
ANKRD44	91526	genome.wustl.edu	37	2	197870436	197870436	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr2:197870436G>A	ENST00000328737.2	-	21	2330	c.2254C>T	c.(2254-2256)Cac>Tac	p.H752Y	ANKRD44_ENST00000450567.1_Missense_Mutation_p.H752Y|ANKRD44_ENST00000337207.5_Missense_Mutation_p.H752Y|ANKRD44_ENST00000282272.8_Missense_Mutation_p.H769Y			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	777										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CAAGCCCAGTGCAGCGGCGTG	0.527													ENSG00000065413																																					0													99.0	89.0	93.0					2																	197870436		2203	4300	6503	SO:0001583	missense	0			-	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.2254C>T	2.37:g.197870436G>A	ENSP00000331516:p.His752Tyr		Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.H752Y	ENST00000328737.2	37	c.2254		2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605488	0.87157	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207	T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.88437	0.6436	M	0.77313	2.365	0.80722	D	1	D	0.56521	0.976	D	0.73380	0.98	D	0.88380	0.3001	10	0.54805	T	0.06	.	19.1301	0.93402	0.0:0.0:1.0:0.0	.	795	Q8N8A2-2	.	Y	592;769;752;752;752	ENSP00000403415:H592Y;ENSP00000282272:H769Y;ENSP00000331516:H752Y;ENSP00000402420:H752Y;ENSP00000338794:H752Y	ENSP00000282272:H769Y	H	-	1	0	ANKRD44	197578681	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.657000	0.98554	2.767000	0.95098	0.655000	0.94253	CAC	-	ANKRD44	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.527	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	ANKRD44	HGNC	protein_coding	OTTHUMT00000335113.1	0	0		16	16		0.00		G	NM_153697		197870436	-1	5		11		tier1	no_errors	ENST00000328737	ensembl	human	known	74_37	missense	31.25		SNP	1.000	A	5	11
TNRC18	84629	genome.wustl.edu	37	7	5429990	5429992	+	Intron	DEL	AAA	AAA	-	rs571047546|rs11295332|rs79796107	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	AAA	AAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr7:5429990_5429992delAAA	ENST00000430969.1	-	4	836				TNRC18_ENST00000399434.2_Stop_Codon_Del|TNRC18_ENST00000399537.4_Intron	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		accctgtctcaaaaaaaaaaaaa	0.547													ENSG00000182095		2523	0.503794	0.798	0.4323	5008	,	,		13859	0.4861		0.2863	False		,,,				2504	0.3988																0																																										SO:0001627	intron_variant	0				U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.487+123TTT>-	7.37:g.5429999_5430001delAAA			A8MX41|Q96JH1|Q96K91	In_Frame_Del	DEL	NULL	p.F130in_frame_del	ENST00000430969.1	37	c.391_389	CCDS47534.1	7																																																																																				TNRC18	-	NULL		0.547	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		0	0		23	23		0.00		AAA			5429992	-1	6		25		tier1	no_errors	ENST00000399434	ensembl	human	putative	74_37	in_frame_del	19.35		DEL	0.706:0.708:0.711	-	6	25
SENP3	26168	genome.wustl.edu	37	17	7475224	7475224	+	Intron	SNP	T	T	A	rs397962859|rs573267191		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr17:7475224T>A	ENST00000429205.2	+	13	2161				EIF4A1_ENST00000577269.1_5'Flank|SENP3_ENST00000578868.1_3'UTR|SENP3-EIF4A1_ENST00000579777.1_RNA|EIF4A1_ENST00000293831.8_5'Flank|SNORA48_ENST00000386847.1_RNA|EIF4A1_ENST00000582746.1_5'Flank|EIF4A1_ENST00000380512.5_5'Flank			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3							cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				tatatatatatataaaaatat	0.264													ENSG00000161956																																					0																																										SO:0001627	intron_variant	0			-	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.1723-3T>A	17.37:g.7475224T>A			Q66K15|Q86VS7|Q96PS4|Q9Y3W9	R	SNP	-	NULL	ENST00000429205.2	37	NULL		17																																																																																			rs71361407	SENP3	-	-		0.264	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	SENP3	HGNC	protein_coding		0	0		9	9		0.00		T	NM_015670		7475224	+1	9		5		tier1	no_errors	ENST00000578868	ensembl	human	known	74_37	rna	64.29		SNP	0.904	A	9	5
BX119917.1	0	genome.wustl.edu	37	X	71372217	71372217	+	RNA	SNP	A	A	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chrX:71372217A>G	ENST00000401114.1	-	0	47																											Gcacacacacacacacacaca	0.527													ENSG00000215933	a|||	57	0.0150993	0.0129	0.0058	3775	,	,		12676	0.0228		0.004	False		,,,				2504	0.0092																0																																												0			-																													X.37:g.71372217A>G				R	SNP	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	BX119917.1	-	-		0.527	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	Clone_based_ensembl_gene	miRNA		0	0		50	50		0.00		A			71372217	-1	10		50		tier1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	16.67		SNP	0.006	G	10	50
CHD2	1106	genome.wustl.edu	37	15	93518154	93518154	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr15:93518154G>T	ENST00000394196.4	+	20	3619	c.2551G>T	c.(2551-2553)Gac>Tac	p.D851Y	CHD2_ENST00000557381.1_Missense_Mutation_p.D851Y	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	851	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			ACAGGCACTGGACCACTTCAA	0.438													ENSG00000173575																																					0													161.0	137.0	145.0					15																	93518154		2197	4298	6495	SO:0001583	missense	0			-	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2551G>T	15.37:g.93518154G>T	ENSP00000377747:p.Asp851Tyr		C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D851Y	ENST00000394196.4	37	c.2551	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804366	0.90623	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	T;T	0.77620	-1.11;-1.11	5.48	5.48	0.80851	Helicase, C-terminal (3);	0.000000	0.35677	U	0.003042	D	0.91690	0.7373	H	0.94582	3.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.997	D	0.93689	0.7005	10	0.87932	D	0	-28.682	18.3364	0.90290	0.0:0.0:1.0:0.0	.	851;851;851	A8K9Y5;O14647;O14647-2	.;CHD2_HUMAN;.	Y	851	ENSP00000377747:D851Y;ENSP00000451366:D851Y	ENSP00000377747:D851Y	D	+	1	0	CHD2	91319158	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.825000	0.99386	2.591000	0.87537	0.478000	0.44815	GAC	-	CHD2	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.438	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	0	0		43	43		0.00		G	NM_001271		93518154	+1	4		42		tier1	no_errors	ENST00000557381	ensembl	human	putative	74_37	missense	8.70		SNP	1.000	T	4	42
FBXW7	55294	genome.wustl.edu	37	4	153271229	153271229	+	Silent	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr4:153271229C>T	ENST00000281708.4	-	3	1778	c.549G>A	c.(547-549)ttG>ttA	p.L183L	FBXW7_ENST00000603841.1_Silent_p.L183L|FBXW7_ENST00000296555.5_Silent_p.L65L|FBXW7_ENST00000263981.5_Silent_p.L103L|FBXW7_ENST00000603548.1_Silent_p.L183L|FBXW7_ENST00000393956.3_5'Flank	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	183					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)			NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GTTTCTTTCCCAAAGAAAAAG	0.299			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""								ENSG00000109670																												Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	0													28.0	29.0	28.0					4																	153271229		2191	4285	6476	SO:0001819	synonymous_variant	0			-	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.549G>A	4.37:g.153271229C>T			B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Silent	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L183	ENST00000281708.4	37	c.549	CCDS3777.1	4																																																																																			-	FBXW7	-	NULL		0.299	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	0	0		48	48		0.00		C			153271229	-1	23		65		tier1	no_errors	ENST00000281708	ensembl	human	known	74_37	silent	26.14		SNP	1.000	T	23	65
TEKT5	146279	genome.wustl.edu	37	16	10729636	10729636	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr16:10729636T>A	ENST00000283025.2	-	6	1297	c.1226A>T	c.(1225-1227)gAc>gTc	p.D409V	TEKT5_ENST00000574923.1_5'UTR	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	409						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						CTGCGGGATGTCCCTGCACAG	0.627													ENSG00000153060																																					0													95.0	99.0	98.0					16																	10729636		2197	4300	6497	SO:0001583	missense	0			-		CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1226A>T	16.37:g.10729636T>A	ENSP00000283025:p.Asp409Val		A1L3Z3	Missense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.D409V	ENST00000283025.2	37	c.1226	CCDS10542.1	16	.	.	.	.	.	.	.	.	.	.	T	19.82	3.897600	0.72639	.	.	ENSG00000153060	ENST00000283025	T	0.26957	1.7	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000010	T	0.57066	0.2028	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66803	-0.5831	10	0.87932	D	0	-30.3528	12.7601	0.57359	0.0:0.0:0.0:1.0	.	409	Q96M29	TEKT5_HUMAN	V	409	ENSP00000283025:D409V	ENSP00000283025:D409V	D	-	2	0	TEKT5	10637137	1.000000	0.71417	0.956000	0.39512	0.697000	0.40408	5.718000	0.68455	1.699000	0.51192	0.454000	0.30748	GAC	-	TEKT5	-	pfam_Tektin,prints_Tektin		0.627	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT5	HGNC	protein_coding	OTTHUMT00000251963.1	0	0		17	17		0.00		T	NM_144674		10729636	-1	12		34		tier1	no_errors	ENST00000283025	ensembl	human	known	74_37	missense	26.09		SNP	1.000	A	12	34
CCL11	6356	genome.wustl.edu	37	17	32612893	32612893	+	Silent	SNP	C	C	T	rs202189623		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr17:32612893C>T	ENST00000305869.3	+	1	207	c.66C>T	c.(64-66)ctC>ctT	p.L22L		NM_002986.2	NP_002977.1	P51671	CCL11_HUMAN	chemokine (C-C motif) ligand 11	22					actin filament organization (GO:0007015)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|chronic inflammatory response (GO:0002544)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mammary duct terminal end bud growth (GO:0060763)|mast cell chemotaxis (GO:0002551)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of Rac GTPase activity (GO:0032855)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|response to interleukin-4 (GO:0070670)|response to radiation (GO:0009314)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			breast(1)|lung(1)|prostate(1)	3	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		CCCAGGGGCTCGCTGGGCCAG	0.552													ENSG00000172156	C|||	1	0.000199681	0.0008	0.0	5008	,	,		17390	0.0		0.0	False		,,,				2504	0.0																0								C		0,4406		0,0,2203	100.0	101.0	100.0		66	-9.0	0.0	17		100	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CCL11	NM_002986.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		22/98	32612893	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB063614	CCDS11279.1	17q21.1-q21.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000172156	ENSG00000172156		"""Chemokine ligands"", ""Endogenous ligands"""	10610	protein-coding gene	gene with protein product	"""eotaxin-1"""	601156	"""small inducible cytokine subfamily A (Cys-Cys), member 11 (eotaxin)"""	SCYA11		9169149	Standard	NM_002986		Approved	eotaxin, MGC22554	uc002hia.1	P51671	OTTHUMG00000132884	ENST00000305869.3:c.66C>T	17.37:g.32612893C>T			P50877|Q92490|Q92491	Silent	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.L22	ENST00000305869.3	37	c.66	CCDS11279.1	17																																																																																			rs202189623	CCL11	-	superfamily_Chemokine_IL8-like_dom		0.552	CCL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL11	HGNC	protein_coding	OTTHUMT00000256377.2	0	0		15	15		0.00		C	NM_002986		32612893	+1	12		19		tier1	no_errors	ENST00000305869	ensembl	human	known	74_37	silent	38.71		SNP	0.007	T	12	19
SKIDA1	387640	genome.wustl.edu	37	10	21805483	21805483	+	Silent	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr10:21805483C>T	ENST00000449193.2	-	4	3521	c.1269G>A	c.(1267-1269)gaG>gaA	p.E423E	SKIDA1_ENST00000444772.3_Silent_p.E344E|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	342						nucleus (GO:0005634)											cctcctcttcctcctcctcct	0.627													ENSG00000180592																																					0													5.0	6.0	6.0					10																	21805483		2007	4123	6130	SO:0001819	synonymous_variant	0			-	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1269G>A	10.37:g.21805483C>T			B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_D-bd_dom_put	p.E423	ENST00000449193.2	37	c.1269	CCDS44363.1	10																																																																																			-	SKIDA1	-	NULL		0.627	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2	0	0		33	33		0.00		C	NM_207371		21805483	-1	4		34		tier1	no_errors	ENST00000449193	ensembl	human	known	74_37	silent	10.53		SNP	0.410	T	4	34
DIS3L	115752	genome.wustl.edu	37	15	66625180	66625180	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr15:66625180C>A	ENST00000319212.4	+	16	2838	c.2788C>A	c.(2788-2790)Caa>Aaa	p.Q930K	DIS3L_ENST00000319194.5_Missense_Mutation_p.Q847K|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	930					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCAACGATTTCAAAACAAAAT	0.358													ENSG00000166938																																					0													68.0	67.0	67.0					15																	66625180		2201	4299	6500	SO:0001583	missense	0			-		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.2788C>A	15.37:g.66625180C>A	ENSP00000321711:p.Gln930Lys		Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	NULL	p.Q930K	ENST00000319212.4	37	c.2788	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869990	0.33069	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.21031	2.03;2.03	5.64	5.64	0.86602	.	0.235845	0.44097	D	0.000483	T	0.12050	0.0293	N	0.08118	0	0.52099	D	0.999949	B	0.28233	0.204	B	0.18561	0.022	T	0.19063	-1.0317	10	0.19147	T	0.46	-2.0896	18.7027	0.91626	0.0:1.0:0.0:0.0	.	930	Q8TF46	DI3L1_HUMAN	K	847;930	ENSP00000321583:Q847K;ENSP00000321711:Q930K	ENSP00000321583:Q847K	Q	+	1	0	DIS3L	64412234	0.999000	0.42202	0.289000	0.24876	0.978000	0.69477	2.876000	0.48498	2.654000	0.90174	0.655000	0.94253	CAA	-	DIS3L	-	NULL		0.358	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	HGNC	protein_coding	OTTHUMT00000382792.2	0	0		33	33		0.00		C	NM_133375		66625180	+1	4		42		tier1	no_errors	ENST00000319212	ensembl	human	known	74_37	missense	8.70		SNP	0.269	A	4	42
ITGB7	3695	genome.wustl.edu	37	12	53589964	53589964	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr12:53589964T>A	ENST00000267082.5	-	7	1067	c.836A>T	c.(835-837)aAt>aTt	p.N279I	ITGB7_ENST00000422257.3_Missense_Mutation_p.N279I|ITGB7_ENST00000338737.4_Missense_Mutation_p.N279I|ITGB7_ENST00000550743.2_Missense_Mutation_p.N279I	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	279	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCGGGACACATTTCTCCAGCC	0.582													ENSG00000139626																																					0													67.0	64.0	65.0					12																	53589964		2203	4300	6503	SO:0001583	missense	0			-		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.836A>T	12.37:g.53589964T>A	ENSP00000267082:p.Asn279Ile		Q9UCP7|Q9UCS7	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Plexin-like_fold,superfamily_Integrin_bsu_tail,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.N279I	ENST00000267082.5	37	c.836	CCDS8849.1	12	.	.	.	.	.	.	.	.	.	.	T	23.8	4.457020	0.84317	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737;ENST00000542497	D;D;D;D	0.98105	-4.72;-4.72;-4.72;-4.72	4.55	4.55	0.56014	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.39759	N	0.001268	D	0.98729	0.9573	M	0.88181	2.935	0.58432	D	0.999995	D	0.89917	1.0	D	0.79784	0.993	D	0.99655	1.0992	10	0.87932	D	0	.	13.566	0.61819	0.0:0.0:0.0:1.0	.	279	P26010	ITB7_HUMAN	I	279	ENSP00000408741:N279I;ENSP00000267082:N279I;ENSP00000345501:N279I;ENSP00000437375:N279I	ENSP00000267082:N279I	N	-	2	0	ITGB7	51876231	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.997000	0.88414	1.975000	0.57531	0.460000	0.39030	AAT	-	ITGB7	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N		0.582	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB7	HGNC	protein_coding	OTTHUMT00000405821.2	0	0		27	27		0.00		T			53589964	-1	9		59		tier1	no_errors	ENST00000267082	ensembl	human	known	74_37	missense	13.24		SNP	1.000	A	9	59
MEGF8	1954	genome.wustl.edu	37	19	42848647	42848647	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:42848647T>A	ENST00000251268.6	+	11	1843	c.1843T>A	c.(1843-1845)Tgc>Agc	p.C615S	MEGF8_ENST00000334370.4_Missense_Mutation_p.C615S	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	615					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CTGCCAGGCCTGCCTGGCCTT	0.682													ENSG00000105429																																					0													22.0	26.0	25.0					19																	42848647		2201	4297	6498	SO:0001583	missense	0			-	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.1843T>A	19.37:g.42848647T>A	ENSP00000251268:p.Cys615Ser		A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_CUB_dom,smart_EG-like_dom,smart_Plexin-like_fold,smart_EGF-like_Ca-bd_dom,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin	p.C615S	ENST00000251268.6	37	c.1843		19	.	.	.	.	.	.	.	.	.	.	T	26.1	4.704376	0.88924	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.37915	1.39;1.17	4.85	4.85	0.62838	.	0.116735	0.50627	D	0.000102	T	0.53562	0.1804	L	0.55990	1.75	0.80722	D	1	P;D	0.76494	0.473;0.999	B;D	0.78314	0.111;0.991	T	0.56774	-0.7923	10	0.87932	D	0	-17.1228	12.3759	0.55279	0.0:0.0:0.0:1.0	.	615;615	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	S	615	ENSP00000334219:C615S;ENSP00000251268:C615S	ENSP00000251268:C615S	C	+	1	0	MEGF8	47540487	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	5.516000	0.67055	1.825000	0.53177	0.255000	0.18592	TGC	-	MEGF8	-	NULL		0.682	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	0	0		14	14		0.00		T	NM_001410		42848647	+1	9		10		tier1	no_errors	ENST00000251268	ensembl	human	known	74_37	missense	47.37		SNP	1.000	A	9	10
NLRP9	338321	genome.wustl.edu	37	19	56220430	56220431	+	Intron	INS	-	-	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:56220430_56220431insT	ENST00000332836.2	-	9	2871				CTD-2611O12.6_ENST00000600582.1_RNA|CTD-2611O12.8_ENST00000596293.1_RNA|CTD-2611O12.7_ENST00000597680.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9							cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TAGAAATAAAGTTTTTTTTTTT	0.366													ENSG00000267865																																					0																																										SO:0001627	intron_variant	0				AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2844-20->A	19.37:g.56220441_56220441dupT			B2RN12|Q86W27	R	INS	-	NULL	ENST00000332836.2	37	NULL	CCDS12934.1	19																																																																																				CTD-2611O12.8	-	-		0.366	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267865	Clone_based_vega_gene	protein_coding	OTTHUMT00000453653.1	0	0		10	10		0.00		-	NM_176820		56220431	+1	6		15		tier1	no_errors	ENST00000596293	ensembl	human	known	74_37	rna	28.57		INS	0.000:0.000	T	6	15
C21orf49	54067	genome.wustl.edu	37	21	34157085	34157086	+	Intron	INS	-	-	T	rs376234765		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr21:34157085_34157086insT	ENST00000477513.1	+	2	121				C21orf49_ENST00000382375.4_Intron|C21orf49_ENST00000382377.3_Intron|C21orf49_ENST00000382378.1_Intron|C21orf49_ENST00000453404.1_Intron					chromosome 21 open reading frame 49																		gtcctcatcagttttttttttt	0.436													ENSG00000205930																																					0																																										SO:0001627	intron_variant	0						21q22.11	2013-01-15			ENSG00000205930	ENSG00000205930			1290	other	unknown							Standard	NR_024622		Approved		uc002yqu.4	Q17RA5	OTTHUMG00000064992	ENST00000477513.1:c.-81-22->T	21.37:g.34157096_34157096dupT				Splice_Site	INS	-	e1-1	ENST00000477513.1	37	c.1-1_0		21																																																																																				C21orf49	-	-		0.436	C21orf49-006	NOVEL	basic|appris_candidate|exp_conf	protein_coding	C21orf49	HGNC	protein_coding	OTTHUMT00000193339.1	0	0		16	16		0.00		-	NR_024622		34157086	+1	4		20		tier1	no_errors	ENST00000454365	ensembl	human	known	74_37	splice_site_ins	16.67		INS	0.122:0.122	T	4	20
LOC100287934	100287934	genome.wustl.edu	37	1	745347	745347	+	RNA	SNP	T	T	C	rs373594198		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:745347T>C	ENST00000435300.1	-	0	804				RP11-206L10.8_ENST00000447500.1_RNA																							GTTATTTACATATTTGTATCA	0.299													ENSG00000237491																																					0																																												0			-																													1.37:g.745347T>C				R	SNP	-	NULL	ENST00000435300.1	37	NULL		1																																																																																			-	RP11-206L10.9	-	-		0.299	RP11-206L10.10-001	KNOWN	basic	processed_transcript	LOC101930657	Clone_based_vega_gene	processed_transcript	OTTHUMT00000007014.1	0	0		15	15		0.00		T			745347	+1	7		26		tier1	no_errors	ENST00000412115	ensembl	human	known	74_37	rna	21.21		SNP	0.005	C	7	26
PTPLA	9200	genome.wustl.edu	37	10	17646048	17646049	+	Splice_Site	INS	-	-	A	rs76004443		TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr10:17646048_17646049insA	ENST00000361271.3	-	2	295		c.e2-2			NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A						fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						ACCAACCACCTAAAAAAAAAAA	0.297													ENSG00000165996																																					0																																										SO:0001630	splice_region_variant	0				AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.258-2->T	10.37:g.17646059_17646059dupA			B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Splice_Site	INS	-	e2-2	ENST00000361271.3	37	c.258-3_258-2	CCDS7121.1	10																																																																																				PTPLA	-	-		0.297	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLA	HGNC	protein_coding	OTTHUMT00000047046.1	0	0		22	22		0.00		-	NM_014241	Intron	17646049	-1	4		22		tier1	no_errors	ENST00000361271	ensembl	human	known	74_37	splice_site_ins	15.38		INS	1.000:0.005	A	4	22
CNTNAP2	26047	genome.wustl.edu	37	7	148117974	148117974	+	3'UTR	SNP	A	A	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr7:148117974A>T	ENST00000361727.3	+	0	9778				CNTNAP2_ENST00000463592.2_3'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2						adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AGAATGAAAGAAGGAAATTAT	0.279										HNSCC(39;0.1)			ENSG00000174469																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.*5266A>T	7.37:g.148117974A>T			D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	R	SNP	-	NULL	ENST00000361727.3	37	NULL	CCDS5889.1	7																																																																																			-	CNTP2	-	-		0.279	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTP2	HGNC	protein_coding	OTTHUMT00000327668.1	0	0		53	53		0.00		A			148117974	+1	29		65		tier1	no_errors	ENST00000463592	ensembl	human	known	74_37	rna	30.85		SNP	1.000	T	29	65
TRPM1	4308	genome.wustl.edu	37	15	31327838	31327838	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr15:31327838T>G	ENST00000256552.6	-	21	2758	c.2611A>C	c.(2611-2613)Atc>Ctc	p.I871L	TRPM1_ENST00000397795.2_Missense_Mutation_p.I849L|RP11-348B17.1_ENST00000558755.1_RNA|RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000542188.1_Missense_Mutation_p.I888L	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CGCACCAGGATGACGTAGTTA	0.498													ENSG00000134160																																					0													107.0	110.0	109.0					15																	31327838		2018	4185	6203	SO:0001583	missense	0			-	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.2611A>C	15.37:g.31327838T>G	ENSP00000256552:p.Ile871Leu			Missense_Mutation	SNP	pfam_Ion_trans_dom	p.I888L	ENST00000256552.6	37	c.2662	CCDS58346.1	15	.	.	.	.	.	.	.	.	.	.	T	16.42	3.119364	0.56505	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.51574	0.7;0.7;0.7	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.34803	0.0910	N	0.16098	0.37	0.49483	D	0.999792	B;B	0.25235	0.095;0.121	B;B	0.26416	0.069;0.068	T	0.24154	-1.0168	10	0.72032	D	0.01	-26.3114	15.3999	0.74830	0.0:0.0:0.0:1.0	.	843;849	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	L	849;888;871;849	ENSP00000380897:I849L;ENSP00000437849:I888L;ENSP00000256552:I871L	ENSP00000256552:I871L	I	-	1	0	TRPM1	29115130	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	4.179000	0.58290	2.043000	0.60533	0.533000	0.62120	ATC	-	TRPM1	-	NULL		0.498	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	0	0		38	38		0.00		T	NM_002420		31327838	-1	5		28		tier1	no_errors	ENST00000542188	ensembl	human	known	74_37	missense	15.15		SNP	1.000	G	5	28
MDGA2	161357	genome.wustl.edu	37	14	47426764	47426764	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr14:47426764T>A	ENST00000399232.2	-	9	2059	c.1695A>T	c.(1693-1695)agA>agT	p.R565S	SNORA25_ENST00000515926.1_RNA|MDGA2_ENST00000426342.1_Missense_Mutation_p.R336S|MDGA2_ENST00000439988.3_Missense_Mutation_p.R634S|MDGA2_ENST00000357362.3_Missense_Mutation_p.R336S	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	565	Ig-like 6.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TTGGATAGGCTCTCAGTACTC	0.473													ENSG00000272781																																					0													96.0	96.0	96.0					14																	47426764		1973	4171	6144	SO:0001583	missense	0			-	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1695A>T	14.37:g.47426764T>A	ENSP00000382178:p.Arg565Ser		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.R634S	ENST00000399232.2	37	c.1902		14	.	.	.	.	.	.	.	.	.	.	T	17.56	3.419918	0.62622	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.13307	2.6;2.6;2.6;2.6	5.32	2.99	0.34606	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	U	0.000053	T	0.18635	0.0447	L	0.56769	1.78	0.80722	D	1	P;B	0.37500	0.597;0.343	B;P	0.46389	0.381;0.515	T	0.02257	-1.1187	10	0.31617	T	0.26	.	7.3334	0.26596	0.0:0.2397:0.0:0.7603	.	336;565	F6W3S7;Q7Z553	.;MDGA2_HUMAN	S	565;336;634;336	ENSP00000400011:R565S;ENSP00000405456:R336S;ENSP00000382178:R634S;ENSP00000349925:R336S	ENSP00000349925:R336S	R	-	3	2	MDGA2	46496514	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.967000	0.29344	0.865000	0.35603	0.528000	0.53228	AGA	-	MDGA2	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.473	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	0	0		30	30		0.00		T	NM_182830		47426764	-1	27		17		tier1	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	61.36		SNP	1.000	A	27	17
PCLO	27445	genome.wustl.edu	37	7	82544871	82544871	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr7:82544871C>A	ENST00000333891.9	-	7	12768	c.12431G>T	c.(12430-12432)gGt>gTt	p.G4144V	PCLO_ENST00000423517.2_Missense_Mutation_p.G4144V|PCLO_ENST00000437081.1_Missense_Mutation_p.G864V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGAGAAAGACCAGCAAGGTG	0.398													ENSG00000186472																																					0													136.0	127.0	130.0					7																	82544871		1891	4113	6004	SO:0001583	missense	0			-	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12431G>T	7.37:g.82544871C>A	ENSP00000334319:p.Gly4144Val			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.G4144V	ENST00000333891.9	37	c.12431	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888188	0.52014	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.27890	1.64;1.65	5.57	5.57	0.84162	.	.	.	.	.	T	0.57272	0.2042	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	0.986;1.0;1.0	P;D;D	0.71656	0.796;0.974;0.974	T	0.59573	-0.7429	9	0.87932	D	0	.	19.5537	0.95331	0.0:1.0:0.0:0.0	.	4075;4144;4144	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	V	4144;4144;864	ENSP00000334319:G4144V;ENSP00000388393:G4144V	ENSP00000334319:G4144V	G	-	2	0	PCLO	82382807	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.089000	0.71384	2.614000	0.88457	0.557000	0.71058	GGT	-	PCLO	-	NULL		0.398	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	0	0		32	32		0.00		C	NM_014510		82544871	-1	19		48		tier1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	28.36		SNP	1.000	A	19	48
GRHL2	79977	genome.wustl.edu	37	8	102661670	102661670	+	Silent	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr8:102661670C>T	ENST00000251808.3	+	14	1979	c.1641C>T	c.(1639-1641)gaC>gaT	p.D547D	GRHL2_ENST00000517674.1_Intron|GRHL2_ENST00000395927.1_Silent_p.D531D	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	547					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			AGGAGACTGACGATGTGTTCG	0.537													ENSG00000083307																																					0													204.0	151.0	169.0					8																	102661670		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.1641C>T	8.37:g.102661670C>T			A1L303|Q6NT03|Q9H8B8	Silent	SNP	pfam_CP2	p.D547	ENST00000251808.3	37	c.1641	CCDS34931.1	8																																																																																			-	GRHL2	-	NULL		0.537	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL2	HGNC	protein_coding	OTTHUMT00000313882.1	0	0		30	30		0.00		C	NM_024915		102661670	+1	11		57		tier1	no_errors	ENST00000251808	ensembl	human	known	74_37	silent	16.18		SNP	0.994	T	11	57
HTT	3064	genome.wustl.edu	37	4	3214355	3214355	+	Silent	SNP	G	G	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr4:3214355G>T	ENST00000355072.5	+	49	6838	c.6693G>T	c.(6691-6693)gtG>gtT	p.V2231V		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2231					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		ACCTGGTGGTGGTCTCCAAAC	0.572													ENSG00000197386																																					0													115.0	118.0	117.0					4																	3214355		1989	4166	6155	SO:0001819	synonymous_variant	0			-	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.6693G>T	4.37:g.3214355G>T			Q9UQB7	Silent	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.V2231	ENST00000355072.5	37	c.6693	CCDS43206.1	4																																																																																			-	HTT	-	pfam_Huntingtin_middle-repeat		0.572	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	0	0		50	50		0.00		G	NM_002111		3214355	+1	14		95		tier1	no_errors	ENST00000355072	ensembl	human	known	74_37	silent	12.84		SNP	0.000	T	14	95
UBQLN2	29978	genome.wustl.edu	37	X	56592114	56592114	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chrX:56592114C>G	ENST00000338222.5	+	1	2089	c.1808C>G	c.(1807-1809)gCc>gGc	p.A603G		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	603	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						AACTTGCAGGCCCTAATAGCA	0.478													ENSG00000188021																									Esophageal Squamous(104;218 1492 6022 10838 28884)												0													55.0	43.0	47.0					X																	56592114		2203	4300	6503	SO:0001583	missense	0			-	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.1808C>G	X.37:g.56592114C>G	ENSP00000345195:p.Ala603Gly		O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.A603G	ENST00000338222.5	37	c.1808	CCDS14374.1	X	.	.	.	.	.	.	.	.	.	.	C	14.56	2.570484	0.45798	.	.	ENSG00000188021	ENST00000338222	T	0.64803	-0.12	4.55	4.55	0.56014	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.000000	0.64402	D	0.000004	D	0.85120	0.5624	H	0.97077	3.935	0.80722	D	1	D;D	0.69078	0.997;0.991	D;D	0.80764	0.994;0.992	D	0.89918	0.4057	10	0.87932	D	0	-8.5652	13.8736	0.63638	0.0:1.0:0.0:0.0	.	491;603	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	G	603	ENSP00000345195:A603G	ENSP00000345195:A603G	A	+	2	0	UBQLN2	56608839	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.576000	0.82467	2.235000	0.73313	0.594000	0.82650	GCC	-	UBQLN2	-	pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk		0.478	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN2	HGNC	protein_coding	OTTHUMT00000056891.1	0	0		30	30		0.00		C	NM_013444		56592114	+1	6		35		tier1	no_errors	ENST00000338222	ensembl	human	known	74_37	missense	14.63		SNP	1.000	G	6	35
ACER1	125981	genome.wustl.edu	37	19	6307291	6307291	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:6307291T>A	ENST00000301452.4	-	5	576	c.499A>T	c.(499-501)Aag>Tag	p.K167*		NM_133492.2	NP_597999.1	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	167					cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|ceramide catabolic process (GO:0046514)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|regulation of lipid metabolic process (GO:0019216)|response to alkaline pH (GO:0010446)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)	15						CGAAGCTCCTTATTGCTGGTC	0.577													ENSG00000167769																																					0													64.0	65.0	65.0					19																	6307291		2203	4300	6503	SO:0001587	stop_gained	0			-	AF347024	CCDS12161.1	19p13.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000167769	ENSG00000167769	3.5.1.23	"""Alkaline ceramidase"""	18356	protein-coding gene	gene with protein product		613491	"""N-acylsphingosine amidohydrolase (alkaline ceramidase) 3"""	ASAH3		12783875	Standard	NM_133492		Approved		uc002mel.2	Q8TDN7		ENST00000301452.4:c.499A>T	19.37:g.6307291T>A	ENSP00000301452:p.Lys167*			Nonsense_Mutation	SNP	pfam_Ceramidase	p.K167*	ENST00000301452.4	37	c.499	CCDS12161.1	19	.	.	.	.	.	.	.	.	.	.	T	21.5	4.157717	0.78114	.	.	ENSG00000167769	ENST00000301452	.	.	.	5.28	1.91	0.25777	.	0.791401	0.12183	N	0.491914	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-24.3361	4.6215	0.12455	0.0:0.1705:0.3169:0.5126	.	.	.	.	X	167	.	ENSP00000301452:K167X	K	-	1	0	ACER1	6258291	0.000000	0.05858	0.004000	0.12327	0.368000	0.29767	-0.060000	0.11712	0.361000	0.24292	0.459000	0.35465	AAG	-	ACER1	-	pfam_Ceramidase		0.577	ACER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACER1	HGNC	protein_coding	OTTHUMT00000452982.1	0	0		32	32		0.00		T	NM_133492		6307291	-1	12		51		tier1	no_errors	ENST00000301452	ensembl	human	known	74_37	nonsense	18.75		SNP	0.000	A	12	51
OBSCN	84033	genome.wustl.edu	37	1	228520959	228520959	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:228520959A>G	ENST00000422127.1	+	58	15835	c.15791A>G	c.(15790-15792)gAg>gGg	p.E5264G	OBSCN_ENST00000284548.11_Missense_Mutation_p.E5264G|OBSCN_ENST00000366707.4_Missense_Mutation_p.E2898G|OBSCN_ENST00000570156.2_Missense_Mutation_p.E6221G|OBSCN_ENST00000366709.4_Missense_Mutation_p.E2383G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5264	Ig-like 50.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGGTGGTGGAGGAGCTGAGA	0.622													ENSG00000154358																																					0													12.0	15.0	14.0					1																	228520959		1990	4146	6136	SO:0001583	missense	0			-	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15791A>G	1.37:g.228520959A>G	ENSP00000409493:p.Glu5264Gly		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.E5264G	ENST00000422127.1	37	c.15791	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	A	32	5.164589	0.94727	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.29	5.29	0.74685	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.069810	0.56097	D	0.000027	T	0.79251	0.4414	M	0.71871	2.18	0.44409	D	0.997326	D;D	0.76494	0.999;0.999	D;D	0.70935	0.971;0.951	T	0.77021	-0.2742	10	0.27082	T	0.32	.	15.3938	0.74774	1.0:0.0:0.0:0.0	.	5264;5264	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	5264;5264;2898;2383	ENSP00000284548:E5264G;ENSP00000409493:E5264G;ENSP00000355668:E2898G;ENSP00000355670:E2383G	ENSP00000284548:E5264G	E	+	2	0	OBSCN	226587582	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	8.195000	0.89723	2.215000	0.71742	0.459000	0.35465	GAG	-	OBSCN	-	pfam_Ig_I-set,pfscan_Ig-like_dom		0.622	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		0	0		43	43		0.00		A	NM_052843		228520959	+1	12		47		tier1	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	20.34		SNP	1.000	G	12	47
RB1	5925	genome.wustl.edu	37	13	49039503	49039511	+	Splice_Site	DEL	AGGTGTGTG	AGGTGTGTG	-			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	AGGTGTGTG	AGGTGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr13:49039503_49039511delAGGTGTGTG	ENST00000267163.4	+	23	2626_2627	c.2488_2489delAGGTGTGTG	c.(2488-2490)agg>g	p.R830del		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	830	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(14)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCCAAGATCAAGGTGTGTGTTTTCTCTTT	0.364		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	29	Whole gene deletion(15)|Unknown(14)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|endometrium(3)|urinary_tract(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|lung(1)|liver(1)	GRCh37	CS030560|CS030561	RB1	S																																				SO:0001630	splice_region_variant	0	Familial Cancer Database			M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2489+1AGGTGTGTG>-	13.37:g.49039503_49039511delAGGTGTGTG			A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R830fs	ENST00000267163.4	37	c.2488_2489	CCDS31973.1	13																																																																																				RB1	-	pfam_RB_C		0.364	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1									AGGTGTGTG		In_Frame_Del	49039511	+1					tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del			DEL	1.000:1.000	-		
INO80	54617	genome.wustl.edu	37	15	41319993	41319994	+	Intron	INS	-	-	A	rs11461974|rs397948684	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr15:41319993_41319994insA	ENST00000361937.3	-	25	3332				INO80_ENST00000401393.3_Intron|RP11-540O11.4_ENST00000560178.1_RNA			Q9ULG1	INO80_HUMAN	INO80 complex subunit						ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TAAGCAAAATGAAAAAAAAAGC	0.297													ENSG00000259521	AAAAAAAAA|AAAAAAAAA|AAAAAAAAAA|insertion	154	0.0307508	0.1067	0.0115	5008	,	,		17444	0.003		0.0	False		,,,				2504	0.002																0																																										SO:0001627	intron_variant	0				AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.2908-59->T	15.37:g.41320002_41320002dupA			A6H8X4|Q9NTG6	R	INS	-	NULL	ENST00000361937.3	37	NULL	CCDS10071.1	15																																																																																				RP11-540O11.4	-	-		0.297	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259521	Clone_based_vega_gene	protein_coding	OTTHUMT00000252527.2	0	0		23	23		0.00		-	NM_017553		41319994	+1	3		18		tier1	no_errors	ENST00000560178	ensembl	human	known	74_37	rna	14.29		INS	0.001:0.001	A	3	18
MYOCD	93649	genome.wustl.edu	37	17	12661459	12661459	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr17:12661459A>C	ENST00000343344.4	+	11	2116	c.2116A>C	c.(2116-2118)Act>Cct	p.T706P	MYOCD_ENST00000425538.1_Missense_Mutation_p.T754P|RP11-1090M7.1_ENST00000584772.1_RNA|MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_Missense_Mutation_p.T658P			Q8IZQ8	MYCD_HUMAN	myocardin	706					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TCCATCCCCAACTTTTTCTAA	0.408													ENSG00000141052																																					0													108.0	100.0	103.0					17																	12661459		2203	4300	6503	SO:0001583	missense	0			-	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2116A>C	17.37:g.12661459A>C	ENSP00000341835:p.Thr706Pro		Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.T754P	ENST00000343344.4	37	c.2260	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	A	11.96	1.795653	0.31777	.	.	ENSG00000141052	ENST00000425538;ENST00000343344;ENST00000395988	T	0.44083	0.93	5.39	1.87	0.25490	.	0.433687	0.23571	N	0.046745	T	0.35038	0.0918	N	0.20401	0.57	0.25521	N	0.987364	D;D;P	0.65815	0.995;0.985;0.627	P;P;B	0.58266	0.836;0.693;0.184	T	0.09271	-1.0682	10	0.33940	T	0.23	-8.4979	3.696	0.08364	0.6553:0.1383:0.0739:0.1325	.	658;754;706	Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	P	754;706;658	ENSP00000341835:T706P	ENSP00000341835:T706P	T	+	1	0	MYOCD	12602184	1.000000	0.71417	0.988000	0.46212	0.882000	0.50991	2.216000	0.42871	0.416000	0.25844	-0.480000	0.04831	ACT	-	MYOCD	-	NULL		0.408	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1	0	0		41	41		0.00		A	NM_153604		12661459	+1	11		118		tier1	no_errors	ENST00000425538	ensembl	human	known	74_37	missense	8.53		SNP	0.912	C	11	118
BLOC1S3	388552	genome.wustl.edu	37	19	45684547	45684547	+	3'UTR	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr19:45684547C>T	ENST00000433642.2	+	0	2089				AC005779.2_ENST00000593083.1_Intron|BLOC1S3_ENST00000588362.1_3'UTR	NM_212550.3	NP_997715.1	Q6QNY0	BL1S3_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 3						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|eye development (GO:0001654)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of natural killer cell activation (GO:0032816)|post-Golgi vesicle-mediated transport (GO:0006892)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|transport vesicle (GO:0030133)				ovary(1)|skin(1)	2		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		ATGATGGCCCCTCTTAACCCA	0.557									Hermansky-Pudlak syndrome				ENSG00000189114																																					0																																										SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	HPS, HPS1-8	-	AY531266	CCDS12656.1	19q13.32	2012-08-01	2008-08-11			ENSG00000189114		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20914	protein-coding gene	gene with protein product	"""BLOC-1 subunit 3"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 3"", ""Hermansky-Pudlak syndrome 8"""	609762				15102850	Standard	NM_212550		Approved	BLOS3, HPS8	uc002pax.4	Q6QNY0		ENST00000433642.2:c.*1384C>T	19.37:g.45684547C>T			B2RXB8	R	SNP	-	NULL	ENST00000433642.2	37	NULL	CCDS12656.1	19																																																																																			-	BLOC1S3	-	-		0.557	BLOC1S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S3	HGNC	protein_coding	OTTHUMT00000457559.1	0	0		27	27		0.00		C	NM_212550		45684547	+1	9		32		tier1	no_errors	ENST00000588362	ensembl	human	putative	74_37	rna	21.95		SNP	0.000	T	9	32
DTL	51514	genome.wustl.edu	37	1	212274107	212274107	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:212274107C>T	ENST00000366991.4	+	14	2089	c.1775C>T	c.(1774-1776)gCt>gTt	p.A592V	DTL_ENST00000475419.1_3'UTR|DTL_ENST00000542077.1_Missense_Mutation_p.A550V|RN7SKP98_ENST00000517070.1_RNA	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	592					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		TGCTGCCTTGCTGGTAACCAG	0.453													ENSG00000143476																																					0													123.0	120.0	121.0					1																	212274107		2203	4300	6503	SO:0001583	missense	0			-	AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.1775C>T	1.37:g.212274107C>T	ENSP00000355958:p.Ala592Val		A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A592V	ENST00000366991.4	37	c.1775	CCDS1502.1	1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.246358	0.39697	.	.	ENSG00000143476	ENST00000366991;ENST00000542077;ENST00000420235	T;T	0.72725	-0.61;-0.68	5.95	5.05	0.67936	.	0.866916	0.10543	N	0.662453	T	0.55593	0.1930	N	0.24115	0.695	0.09310	N	1	B;B;B	0.11235	0.003;0.004;0.002	B;B;B	0.09377	0.004;0.003;0.002	T	0.42548	-0.9445	10	0.30078	T	0.28	-31.0273	7.8533	0.29468	0.0:0.7223:0.134:0.1438	.	550;592;550	F5GZ90;Q9NZJ0;B4E0E6	.;DTL_HUMAN;.	V	592;550;271	ENSP00000355958:A592V;ENSP00000443870:A550V	ENSP00000355958:A592V	A	+	2	0	DTL	210340730	0.004000	0.15560	0.885000	0.34714	0.996000	0.88848	0.802000	0.27069	1.535000	0.49220	-0.136000	0.14681	GCT	-	DTL	-	NULL		0.453	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTL	HGNC	protein_coding	OTTHUMT00000090182.1	0	0		30	30		0.00		C	NM_016448		212274107	+1	15		17		tier1	no_errors	ENST00000366991	ensembl	human	known	74_37	missense	46.88		SNP	0.038	T	15	17
NCAM2	4685	genome.wustl.edu	37	21	22910184	22910184	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr21:22910184A>T	ENST00000400546.1	+	18	2669	c.2420A>T	c.(2419-2421)gAa>gTa	p.E807V	NCAM2_ENST00000284894.7_Missense_Mutation_p.E665V	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	807					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CCTTTAAAGGAAGAAGATGGG	0.318													ENSG00000154654																																					0													53.0	54.0	53.0					21																	22910184		1802	4059	5861	SO:0001583	missense	0			-		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2420A>T	21.37:g.22910184A>T	ENSP00000383392:p.Glu807Val		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.E807V	ENST00000400546.1	37	c.2420	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	A	20.3	3.969143	0.74131	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.46063	0.88;0.88	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.62392	0.2424	M	0.64997	1.995	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.64381	-0.6421	10	0.62326	D	0.03	-32.6513	15.0645	0.71983	1.0:0.0:0.0:0.0	.	665;807	B7Z5K2;O15394	.;NCAM2_HUMAN	V	807;665	ENSP00000383392:E807V;ENSP00000284894:E665V	ENSP00000284894:E665V	E	+	2	0	NCAM2	21832055	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.148000	0.77389	2.238000	0.73509	0.477000	0.44152	GAA	-	NCAM2	-	NULL		0.318	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	0	0		36	36		0.00		A	NM_004540		22910184	+1	11		23		tier1	no_errors	ENST00000400546	ensembl	human	known	74_37	missense	32.35		SNP	1.000	T	11	23
NELL1	4745	genome.wustl.edu	37	11	21305901	21305901	+	Intron	SNP	A	A	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr11:21305901A>T	ENST00000357134.5	+	14	1701				NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000298925.5_Intron|NELL1_ENST00000532434.1_Intron|NELL1_ENST00000325319.5_Intron	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)						cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GAGAGCCTAAAGATCATGACT	0.463													ENSG00000165973																																					0																																										SO:0001627	intron_variant	0			-	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1549+54901A>T	11.37:g.21305901A>T			B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	R	SNP	-	NULL	ENST00000357134.5	37	NULL	CCDS7855.1	11																																																																																			-	NELL1	-	-		0.463	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	0	0		37	37		0.00		A	NM_006157		21305901	+1	20		54		tier1	no_errors	ENST00000529218	ensembl	human	known	74_37	rna	27.03		SNP	1.000	T	20	54
GJA9	81025	genome.wustl.edu	37	1	39340985	39340985	+	Silent	SNP	T	T	C			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr1:39340985T>C	ENST00000360786.3	-	1	1038	c.786A>G	c.(784-786)caA>caG	p.Q262Q	RP5-864K19.4_ENST00000443161.1_RNA|RP5-864K19.4_ENST00000456813.1_RNA|GJA9_ENST00000454994.2_Silent_p.Q262Q|MYCBP_ENST00000397572.2_5'Flank|MYCBP_ENST00000489803.1_5'UTR|GJA9_ENST00000357771.3_Silent_p.Q262Q|RP5-864K19.4_ENST00000433671.2_RNA			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	262					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			TGGCTACATTTTGTTTTGCCT	0.383													ENSG00000131233																																					0													138.0	135.0	136.0					1																	39340985		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.786A>G	1.37:g.39340985T>C			B2R722|B3KVQ2|Q5TA63|Q96KG0	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.Q262	ENST00000360786.3	37	c.786	CCDS432.1	1																																																																																			-	GJA9	-	NULL		0.383	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA9	HGNC	protein_coding	OTTHUMT00000001205.1	0	0		29	29		0.00		T	NM_030772		39340985	-1	11		53		tier1	no_errors	ENST00000357771	ensembl	human	known	74_37	silent	17.19		SNP	0.991	C	11	53
RBM10	8241	genome.wustl.edu	37	X	47039357	47039357	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chrX:47039357C>T	ENST00000377604.3	+	10	1722	c.980C>T	c.(979-981)tCc>tTc	p.S327F	RBM10_ENST00000329236.7_Missense_Mutation_p.S250F|RBM10_ENST00000345781.6_Missense_Mutation_p.S250F|RBM10_ENST00000478410.1_3'UTR	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	327	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GCGGTGCTGTCCTCCTCCAAC	0.597													ENSG00000182872																									Melanoma(171;120 2705 19495 39241)												0													51.0	35.0	40.0					X																	47039357		2203	4300	6503	SO:0001583	missense	0			-	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.980C>T	X.37:g.47039357C>T	ENSP00000366829:p.Ser327Phe		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.S327F	ENST00000377604.3	37	c.980	CCDS14274.1	X	.	.	.	.	.	.	.	.	.	.	C	12.32	1.901259	0.33535	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.36157	1.27;1.27;1.27	3.85	3.85	0.44370	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.071764	0.56097	D	0.000026	T	0.49218	0.1544	M	0.64404	1.975	0.38105	D	0.937373	D;P;P;P;P	0.54964	0.969;0.6;0.813;0.873;0.842	P;P;P;P;P	0.59761	0.863;0.781;0.715;0.679;0.588	T	0.56226	-0.8014	10	0.66056	D	0.02	-13.1975	9.3138	0.37921	0.0:0.7829:0.2171:0.0	.	250;392;327;250;327	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	F	327;250;250	ENSP00000366829:S327F;ENSP00000328848:S250F;ENSP00000329659:S250F	ENSP00000328848:S250F	S	+	2	0	RBM10	46924301	0.995000	0.38212	0.998000	0.56505	0.070000	0.16714	5.963000	0.70372	1.860000	0.53959	0.431000	0.28591	TCC	-	RBM10	-	smart_RRM_dom,pfscan_RRM_dom		0.597	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM10	HGNC	protein_coding	OTTHUMT00000056381.1	0	0		55	55		0.00		C	NM_005676		47039357	+1	9		82		tier1	no_errors	ENST00000377604	ensembl	human	known	74_37	missense	9.89		SNP	0.997	T	9	82
GOLGA2P5	55592	genome.wustl.edu	37	12	100562921	100562921	+	RNA	DEL	T	T	-			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr12:100562921delT	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						GTCTCATTTGTTTTttttttt	0.403													ENSG00000238105																																					0																																												0																																12.37:g.100562921delT			Q9NSV2	R	DEL	-	NULL	ENST00000397112.4	37	NULL		12																																																																																				GOLGA2B	-	-		0.403	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	Clone_based_vega_gene	pseudogene	OTTHUMT00000396439.2	0	0		14	14		0.00		T			100562921	-1	3		13		tier1	no_errors	ENST00000421840	ensembl	human	known	74_37	rna	18.75		DEL	0.000	-	3	13
ZNF733P	643955	genome.wustl.edu	37	7	62752482	62752482	+	RNA	SNP	T	T	C			TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr7:62752482T>C	ENST00000331425.6	-	0	953					NR_003952.1				zinc finger protein 733, pseudogene																		GCCACATTCCTCACACCTGCA	0.453													ENSG00000185037																																					0																																												0			-			7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752482T>C				R	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			-	ZNF733P	-	-		0.453	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	HGNC	pseudogene	OTTHUMT00000343679.1	0	0		48	48		0.00		T			62752482	-1	14		87		tier1	no_errors	ENST00000331425	ensembl	human	known	74_37	rna	13.86		SNP	0.086	C	14	87
TNRC6A	27327	genome.wustl.edu	37	16	24802323	24802330	+	Frame_Shift_Del	DEL	AACCTGCT	AACCTGCT	-	rs3803716	byFrequency	TCGA-DX-A8BS-01A-11D-A37C-09	TCGA-DX-A8BS-11A-13D-A37F-09	AACCTGCT	AACCTGCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d3757dd0-b728-4ef8-b4db-cda45a664070	843ebeaf-a333-4f5b-9c34-1629672f36e5	g.chr16:24802323_24802330delAACCTGCT	ENST00000395799.3	+	6	2489_2496	c.2360_2367delAACCTGCT	c.(2359-2367)aaacctgctfs	p.KPA787fs	TNRC6A_ENST00000315183.7_Frame_Shift_Del_p.KPA787fs	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	787	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GGCGATCCCAAACCTGCTCTGAGGTGGG	0.505													ENSG00000090905																																					0																																										SO:0001589	frameshift_variant	0				U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.2360_2367delAACCTGCT	16.37:g.24802323_24802330delAACCTGCT	ENSP00000379144:p.Lys787fs		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Frame_Shift_Del	DEL	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.K787fs	ENST00000395799.3	37	c.2360_2367	CCDS10624.2	16																																																																																				TNRC6A	-	NULL		0.505	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1									AACCTGCT	NM_020847		24802330	+1					tier1	no_errors	ENST00000395799	ensembl	human	known	74_37	frame_shift_del			DEL	1.000:0.992:1.000:0.999:0.793:0.172:0.946:0.631	-		
