#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SGK223	157285	genome.wustl.edu	37	8	8185770	8185770	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr8:8185770G>T	ENST00000520004.1	-	5	2786	c.2522C>A	c.(2521-2523)gCa>gAa	p.A841E	SGK223_ENST00000330777.4_Missense_Mutation_p.A841E			Q86YV5	SG223_HUMAN		843							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CTTGGGGCTTGCTGTTCCGGG	0.592													ENSG00000182319																									GBM(34;731 755 10259 33573 33867)												0													127.0	139.0	135.0					8																	8185770		1980	4143	6123	SO:0001583	missense	0			-																												ENST00000520004.1:c.2522C>A	8.37:g.8185770G>T	ENSP00000428054:p.Ala841Glu		Q8N3N5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.A841E	ENST00000520004.1	37	c.2522	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	G	15.28	2.785526	0.49997	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.63744	-0.06;-0.06	4.97	4.97	0.65823	.	0.716493	0.12721	N	0.444688	T	0.75384	0.3842	M	0.61703	1.905	0.09310	N	0.999999	D	0.71674	0.998	P	0.59115	0.852	T	0.67968	-0.5533	10	0.72032	D	0.01	.	17.7673	0.88482	0.0:0.0:1.0:0.0	.	841	Q86YV5	SG223_HUMAN	E	841	ENSP00000330930:A841E;ENSP00000428054:A841E	ENSP00000330930:A841E	A	-	2	0	AC068353.1	8223180	0.434000	0.25570	0.026000	0.17262	0.279000	0.26890	3.614000	0.54160	2.751000	0.94390	0.563000	0.77884	GCA	-	SGK223	-	NULL		0.592	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1	0	0	0	61	61	117	0.00	0.00	G			8185770	-1	14	20	30	55	tier1	no_errors	ENST00000330777	ensembl	human	known	74_37	missense	31.82	26.67	SNP	0.038	T	14	30
SGK223	157285	genome.wustl.edu	37	8	8235474	8235474	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr8:8235474G>T	ENST00000520004.1	-	3	709	c.445C>A	c.(445-447)Cct>Act	p.P149T	SGK223_ENST00000330777.4_Missense_Mutation_p.P149T			Q86YV5	SG223_HUMAN		149							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TTGCCATCAGGGGAGGTAGAG	0.637													ENSG00000182319																									GBM(34;731 755 10259 33573 33867)												0													67.0	72.0	71.0					8																	8235474		2008	4181	6189	SO:0001583	missense	0			-																												ENST00000520004.1:c.445C>A	8.37:g.8235474G>T	ENSP00000428054:p.Pro149Thr		Q8N3N5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.P149T	ENST00000520004.1	37	c.445	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.508495	0.00153	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.54279	0.58;0.58	5.01	-8.33	0.00992	.	1.331090	0.05562	N	0.569376	T	0.18800	0.0451	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23547	-1.0185	10	0.05721	T	0.95	.	5.5412	0.17039	0.0901:0.1047:0.2077:0.5975	.	149	Q86YV5	SG223_HUMAN	T	149	ENSP00000330930:P149T;ENSP00000428054:P149T	ENSP00000330930:P149T	P	-	1	0	AC068353.1	8272884	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.711000	0.00817	-1.489000	0.01844	-0.211000	0.12701	CCT	-	SGK223	-	NULL		0.637	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1	0	0	0	70	70	33	0.00	0.00	G			8235474	-1	16	13	32	43	tier1	no_errors	ENST00000330777	ensembl	human	known	74_37	missense	33.33	23.21	SNP	0.000	T	16	32
PZP	5858	genome.wustl.edu	37	12	9307325	9307325	+	Missense_Mutation	SNP	C	C	T	rs577575931		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr12:9307325C>T	ENST00000261336.2	-	29	3689	c.3661G>A	c.(3661-3663)Gct>Act	p.A1221T	PZP_ENST00000381997.2_Missense_Mutation_p.A1007T	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1221					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GTGAGATAAGCGAGGAGCACA	0.577													ENSG00000126838																									Melanoma(125;1402 1695 4685 34487 38571)												0													94.0	85.0	88.0					12																	9307325		2203	4300	6503	SO:0001583	missense	0			-	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3661G>A	12.37:g.9307325C>T	ENSP00000261336:p.Ala1221Thr		A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.A1221T	ENST00000261336.2	37	c.3661	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	C	15.83	2.950136	0.53186	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.50548	0.74;0.74	4.15	2.2	0.27929	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.180154	0.33916	N	0.004423	T	0.49218	0.1544	L	0.52266	1.64	0.29372	N	0.863941	D;D	0.67145	0.996;0.983	P;P	0.52881	0.712;0.585	T	0.49790	-0.8902	10	0.59425	D	0.04	.	9.1058	0.36696	0.0:0.7666:0.1483:0.0851	.	1007;1221	P20742-2;P20742	.;PZP_HUMAN	T	1221;1007	ENSP00000261336:A1221T;ENSP00000371427:A1007T	ENSP00000261336:A1221T	A	-	1	0	PZP	9198592	0.995000	0.38212	0.001000	0.08648	0.338000	0.28826	3.316000	0.51960	0.422000	0.26005	0.563000	0.77884	GCT	-	PZP	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase		0.577	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	0	0	0	78	78	39	0.00	0.00	C	NM_002864		9307325	-1	15	8	40	23	tier1	no_errors	ENST00000261336	ensembl	human	known	74_37	missense	27.27	25.81	SNP	0.916	T	15	40
ATP6V0A4	50617	genome.wustl.edu	37	7	138432198	138432198	+	Missense_Mutation	SNP	C	C	T	rs531117418		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:138432198C>T	ENST00000310018.2	-	13	1574	c.1292G>A	c.(1291-1293)cGc>cAc	p.R431H	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.R431H|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.R431H	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	431					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GGAGAGCAAGCGTCTCTCATT	0.458													ENSG00000105929																																					0													113.0	97.0	102.0					7																	138432198		2203	4300	6503	SO:0001583	missense	0			-	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.1292G>A	7.37:g.138432198C>T	ENSP00000308122:p.Arg431His		A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	pfam_V-ATPase_116kDa_su	p.R431H	ENST00000310018.2	37	c.1292	CCDS5849.1	7	.	.	.	.	.	.	.	.	.	.	C	10.09	1.253671	0.22965	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.86030	-2.06;-2.06;-2.06	5.19	-8.27	0.01017	.	2.005500	0.01781	N	0.031736	T	0.66790	0.2825	N	0.04297	-0.235	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.59306	-0.7479	10	0.28530	T	0.3	0.4024	10.3664	0.44026	0.0:0.1683:0.2712:0.5604	.	431	Q9HBG4	VPP4_HUMAN	H	431	ENSP00000308122:R431H;ENSP00000376774:R431H;ENSP00000253856:R431H	ENSP00000308122:R431H	R	-	2	0	ATP6V0A4	138082738	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-1.230000	0.02942	-1.923000	0.01065	-1.036000	0.02392	CGC	-	ATP6V0A4	-	pfam_V-ATPase_116kDa_su		0.458	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A4	HGNC	protein_coding	OTTHUMT00000347514.1	0	0	0	46	46	108	0.00	0.00	C	NM_020632		138432198	-1	26	23	48	73	tier1	no_errors	ENST00000310018	ensembl	human	known	74_37	missense	35.14	23.96	SNP	0.000	T	26	48
BRD7	29117	genome.wustl.edu	37	16	50357503	50357503	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr16:50357503C>A	ENST00000394688.3	-	12	1597	c.1438G>T	c.(1438-1440)Gag>Tag	p.E480*	BRD7_ENST00000394689.2_Nonsense_Mutation_p.E480*			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	480					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CTTACCATCTCCATCTCTTGT	0.393													ENSG00000166164																																					0													157.0	129.0	139.0					16																	50357503		2198	4300	6498	SO:0001587	stop_gained	0			-	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1438G>T	16.37:g.50357503C>A	ENSP00000378180:p.Glu480*		Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Nonsense_Mutation	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E480*	ENST00000394688.3	37	c.1438	CCDS10742.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.253021	0.97417	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	.	.	.	5.5	5.5	0.81552	.	0.241141	0.45867	D	0.000334	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-30.1046	12.6985	0.57018	0.0:0.9245:0.0:0.0755	.	.	.	.	X	480	.	ENSP00000378180:E480X	E	-	1	0	BRD7	48915004	1.000000	0.71417	0.665000	0.29768	0.716000	0.41182	4.475000	0.60210	2.581000	0.87130	0.563000	0.77884	GAG	-	BRD7	-	pfam_DUF3512		0.393	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	HGNC	protein_coding	OTTHUMT00000256874.3	0	0	0	48	48	89	0.00	0.00	C	NM_013263		50357503	-1	16	12	22	26	tier1	no_errors	ENST00000394689	ensembl	human	known	74_37	nonsense	42.11	31.58	SNP	0.789	A	16	22
IFITM1	8519	genome.wustl.edu	37	11	314332	314332	+	Silent	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr11:314332C>T	ENST00000408968.3	+	1	480	c.162C>T	c.(160-162)ttC>ttT	p.F54F	IFITM1_ENST00000528780.1_Silent_p.F54F|IFITM1_ENST00000328221.5_Silent_p.F54F	NM_003641.3	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1	54					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of immune response (GO:0050776)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			large_intestine(1)|lung(3)	4		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GTCTGGGCTTCATAGCATTCG	0.617													ENSG00000185885																																					0													131.0	136.0	134.0					11																	314332		2063	4206	6269	SO:0001819	synonymous_variant	0			-	J04164	CCDS41584.1	11p15.5	2012-03-15	2012-03-13		ENSG00000185885	ENSG00000185885		"""CD molecules"""	5412	protein-coding gene	gene with protein product	"""interferon-induced transmembrane protein 1"""	604456	"""interferon induced transmembrane protein 1 (9-27)"""	IFI17		7559564	Standard	NM_003641		Approved	9-27, CD225	uc001loy.4	P13164		ENST00000408968.3:c.162C>T	11.37:g.314332C>T			Q15322|Q53XZ0	Silent	SNP	pfam_CD225/Dispanin_fam	p.F54	ENST00000408968.3	37	c.162	CCDS41584.1	11																																																																																			-	IFITM1	-	pfam_CD225/Dispanin_fam		0.617	IFITM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFITM1	HGNC	protein_coding	OTTHUMT00000383595.1	0	0	0	55	55	35	0.00	0.00	C	NM_003641		314332	+1	19	10	52	15	tier1	no_errors	ENST00000328221	ensembl	human	known	74_37	silent	26.76	40.00	SNP	0.997	T	19	52
HTR1D	3352	genome.wustl.edu	37	1	23520075	23520075	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:23520075A>T	ENST00000374619.1	-	1	1147	c.638T>A	c.(637-639)cTc>cAc	p.L213H	HTR1D_ENST00000314113.3_Missense_Mutation_p.L213H	NM_000864.4	NP_000855.1	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled	213					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intestine smooth muscle contraction (GO:0014827)|regulation of behavior (GO:0050795)|regulation of locomotion (GO:0040012)|response to toxic substance (GO:0009636)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Naratriptan(DB00952)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TAGGATGATGAGCAACACCGA	0.572													ENSG00000179546																																					0													63.0	67.0	66.0					1																	23520075		2203	4300	6503	SO:0001583	missense	0			-	M89955	CCDS231.1	1p36.3-p34.3	2012-08-08	2012-02-03		ENSG00000179546	ENSG00000179546		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5289	protein-coding gene	gene with protein product		182133	"""5-hydroxytryptamine (serotonin) receptor 1D"""	HTRL		2541503, 1662665	Standard	NM_000864		Approved	RDC4, HT1DA, 5-HT1D	uc001bgn.3	P28221	OTTHUMG00000003235	ENST00000374619.1:c.638T>A	1.37:g.23520075A>T	ENSP00000363748:p.Leu213His			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT1D_rcpt,prints_5HT_rcpt	p.L213H	ENST00000374619.1	37	c.638	CCDS231.1	1	.	.	.	.	.	.	.	.	.	.	A	19.01	3.743903	0.69418	.	.	ENSG00000179546	ENST00000314113;ENST00000374619	T;T	0.40476	1.03;1.03	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76809	-0.2822	10	0.87932	D	0	.	14.9212	0.70838	1.0:0.0:0.0:0.0	.	213	P28221	5HT1D_HUMAN	H	213	ENSP00000313661:L213H;ENSP00000363748:L213H	ENSP00000313661:L213H	L	-	2	0	HTR1D	23392662	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	9.339000	0.96797	2.133000	0.65898	0.533000	0.62120	CTC	-	HTR1D	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.572	HTR1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1D	HGNC	protein_coding	OTTHUMT00000008924.1	0	0	0	26	26	156	0.00	0.00	A	NM_000864		23520075	-1	12	14	12	33	tier1	no_errors	ENST00000314113	ensembl	human	known	74_37	missense	50.00	29.17	SNP	1.000	T	12	12
USH2A	7399	genome.wustl.edu	37	1	216011349	216011349	+	Missense_Mutation	SNP	G	G	A	rs576236830		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:216011349G>A	ENST00000307340.3	-	47	9741	c.9355C>T	c.(9355-9357)Cgt>Tgt	p.R3119C	USH2A_ENST00000366943.2_Missense_Mutation_p.R3119C	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3119	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTGATGCCACGAATTGTGGGT	0.398										HNSCC(13;0.011)			ENSG00000042781	G|||	1	0.000199681	0.0	0.0	5008	,	,		16748	0.0		0.0	False		,,,				2504	0.001																0													227.0	204.0	212.0					1																	216011349		2203	4300	6503	SO:0001583	missense	0			-	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9355C>T	1.37:g.216011349G>A	ENSP00000305941:p.Arg3119Cys		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.R3119C	ENST00000307340.3	37	c.9355	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157195	0.38119	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54479	0.57;0.57	5.01	4.09	0.47781	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.301359	0.23330	N	0.049349	T	0.47857	0.1468	L	0.40543	1.245	0.09310	N	0.99999	D	0.62365	0.991	B	0.44315	0.446	T	0.43893	-0.9363	10	0.52906	T	0.07	.	15.0901	0.72185	0.0:0.1426:0.8574:0.0	.	3119	O75445	USH2A_HUMAN	C	3119	ENSP00000305941:R3119C;ENSP00000355910:R3119C	ENSP00000305941:R3119C	R	-	1	0	USH2A	214077972	0.981000	0.34729	0.009000	0.14445	0.035000	0.12851	4.755000	0.62198	1.089000	0.41292	0.655000	0.94253	CGT	-	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3		0.398	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0	0	37	37	178	0.00	0.00	G	NM_007123		216011349	-1	20	60	9	44	tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	68.97	57.69	SNP	0.128	A	20	9
CECR2	27443	genome.wustl.edu	37	22	18022400	18022400	+	Silent	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr22:18022400G>A	ENST00000400585.2	+	16	2517	c.2079G>A	c.(2077-2079)gtG>gtA	p.V693V	CECR2_ENST00000262608.8_Silent_p.V835V|CECR2_ENST00000400573.5_Silent_p.V834V			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	876					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CACCTCCAGTGCCAGCACCCA	0.592													ENSG00000099954																																					0													49.0	55.0	53.0					22																	18022400		2065	4188	6253	SO:0001819	synonymous_variant	0			-	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.2079G>A	22.37:g.18022400G>A			A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.V834	ENST00000400585.2	37	c.2502		22																																																																																			-	CECR2	-	NULL		0.592	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	0	0	0	56	56	37	0.00	0.00	G	NM_031413		18022400	+1	29	18	23	21	tier1	no_errors	ENST00000400573	ensembl	human	novel	74_37	silent	54.72	46.15	SNP	0.274	A	29	23
ACBD6	84320	genome.wustl.edu	37	1	180257470	180257470	+	3'UTR	SNP	T	T	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:180257470T>C	ENST00000367595.3	-	0	1564				ACBD6_ENST00000475338.2_5'UTR	NM_032360.3	NP_115736.1	Q9BR61	ACBD6_HUMAN	acyl-CoA binding domain containing 6							cytoplasm (GO:0005737)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)		ACBD6/RRP15(2)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	7						CTTATGCTATTACAGACTGCA	0.418													ENSG00000135847																																					0													42.0	43.0	43.0					1																	180257470		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	BC006505	CCDS1339.1	1q25.1	2013-10-11	2010-04-30		ENSG00000135847			"""Ankyrin repeat domain containing"""	23339	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 6"""			18268358	Standard	NM_032360		Approved	MGC2404	uc001gog.3	Q9BR61	OTTHUMG00000035117	ENST00000367595.3:c.*28A>G	1.37:g.180257470T>C				R	SNP	-	NULL	ENST00000367595.3	37	NULL	CCDS1339.1	1																																																																																			-	ACBD6	-	-		0.418	ACBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACBD6	HGNC	protein_coding	OTTHUMT00000084998.1	0	0	0	42	42	121	0.00	0.00	T	NM_032360		180257470	-1	27	36	9	35	tier1	no_errors	ENST00000475338	ensembl	human	known	74_37	rna	75.00	50.70	SNP	0.000	C	27	9
IL20RA	53832	genome.wustl.edu	37	6	137323068	137323068	+	Missense_Mutation	SNP	G	G	T	rs377051637		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr6:137323068G>T	ENST00000316649.5	-	7	1524	c.1289C>A	c.(1288-1290)aCa>aAa	p.T430K	IL20RA_ENST00000468393.1_5'Flank|IL20RA_ENST00000541547.1_Missense_Mutation_p.T381K|IL20RA_ENST00000367748.1_Missense_Mutation_p.T319K|RP11-204P2.3_ENST00000458017.1_RNA	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	430					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		CTCCAATAATGTTCCTTGTGT	0.527													ENSG00000016402																																					0													71.0	59.0	63.0					6																	137323068		2203	4300	6503	SO:0001583	missense	0			-	AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.1289C>A	6.37:g.137323068G>T	ENSP00000314976:p.Thr430Lys		B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.T430K	ENST00000316649.5	37	c.1289	CCDS5181.1	6	.	.	.	.	.	.	.	.	.	.	G	2.094	-0.407652	0.04832	.	.	ENSG00000016402	ENST00000316649;ENST00000367748;ENST00000541547	T;T;T	0.58358	0.61;2.05;0.34	5.96	-7.76	0.01232	.	4.960380	0.00166	N	0.000019	T	0.03220	0.0094	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.05419	-1.0886	10	0.02654	T	1	2.2846	2.0444	0.03557	0.1925:0.1846:0.4027:0.2202	.	319;430	Q9UHF4-2;Q9UHF4	.;I20RA_HUMAN	K	430;319;381	ENSP00000314976:T430K;ENSP00000356722:T319K;ENSP00000437843:T381K	ENSP00000314976:T430K	T	-	2	0	IL20RA	137364761	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.841000	0.04359	-1.708000	0.01401	-0.839000	0.03059	ACA	-	IL20RA	-	NULL		0.527	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20RA	HGNC	protein_coding	OTTHUMT00000042393.1	0	0	0	49	49	116	0.00	0.00	G	NM_014432		137323068	-1	14	26	23	60	tier1	no_errors	ENST00000316649	ensembl	human	known	74_37	missense	37.84	30.23	SNP	0.000	T	14	23
GPR37	2861	genome.wustl.edu	37	7	124386687	124386687	+	Silent	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:124386687C>A	ENST00000303921.2	-	2	2384	c.1734G>T	c.(1732-1734)gtG>gtT	p.V578V		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	578					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CATCACTGGTCACCGTTGAAG	0.512													ENSG00000170775																																					0													164.0	137.0	146.0					7																	124386687		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1734G>T	7.37:g.124386687C>A			A4D0Y6|O00348|O14768|Q8TD39	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR37_orph,prints_GPCR_Rhodpsn	p.V578	ENST00000303921.2	37	c.1734	CCDS5792.1	7																																																																																			-	GPR37	-	NULL		0.512	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	HGNC	protein_coding	OTTHUMT00000347873.1	0	0	0	54	54	133	0.00	0.00	C	NM_005302		124386687	-1	21	60	22	69	tier1	no_errors	ENST00000303921	ensembl	human	known	74_37	silent	48.84	46.51	SNP	0.999	A	21	22
CPAMD8	27151	genome.wustl.edu	37	19	17086902	17086902	+	Silent	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:17086902G>T	ENST00000443236.1	-	16	1990	c.1959C>A	c.(1957-1959)atC>atA	p.I653I	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	606						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TTGCAGCCCTGATCCGCAGGT	0.562													ENSG00000160111																																					0													43.0	48.0	46.0					19																	17086902		2066	4208	6274	SO:0001819	synonymous_variant	0			-	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1959C>A	19.37:g.17086902G>T			Q8NC09|Q9ULD7	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.I653	ENST00000443236.1	37	c.1959	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	G	0.025	-1.382630	0.01204	.	.	ENSG00000160111	ENST00000443236	.	.	.	2.85	-1.56	0.08532	.	.	.	.	.	.	.	.	.	.	.	0.32411	N	0.550648	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.3979	0.02264	0.2011:0.3015:0.3409:0.1565	.	.	.	.	X	664	.	.	S	-	2	0	CPAMD8	16947902	0.300000	0.24435	0.037000	0.18230	0.010000	0.07245	0.006000	0.13152	-0.043000	0.13513	-0.323000	0.08544	TCA	-	CPAMD8	-	pfam_A2M_N_2		0.562	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	0	0	0	26	26	23	0.00	0.00	G	NM_015692		17086902	-1	10	6	32	35	tier1	no_errors	ENST00000443236	ensembl	human	known	74_37	silent	23.81	14.63	SNP	0.097	T	10	32
IDH3A	3419	genome.wustl.edu	37	15	78452504	78452504	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr15:78452504C>T	ENST00000299518.2	+	4	328	c.245C>T	c.(244-246)tCa>tTa	p.S82L	IDH3A_ENST00000558535.1_3'UTR|IDH3A_ENST00000559205.1_Intron|IDH3A_ENST00000558554.1_Missense_Mutation_p.S82L|IDH3A_ENST00000441490.2_Intron	NM_005530.2	NP_005521.1	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	82					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.S82L(1)		endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	12						ATGATCCCTTCAGAGGCTAAA	0.498													ENSG00000166411																																					1	Substitution - Missense(1)	large_intestine(1)											80.0	74.0	76.0					15																	78452504		2196	4293	6489	SO:0001583	missense	0			-		CCDS10297.1	15q25.1-q25.2	2008-07-18			ENSG00000166411	ENSG00000166411	1.1.1.41		5384	protein-coding gene	gene with protein product	"""H-IDH alpha"", ""isocitric dehydrogenase"", ""isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial"", ""NAD+-specific ICDH"", ""NAD(H)-specific isocitrate dehydrogenase alpha subunit"", ""isocitrate dehydrogenase (NAD+) alpha chain"""	601149				8833160	Standard	NM_005530		Approved		uc002bdd.3	P50213	OTTHUMG00000143732	ENST00000299518.2:c.245C>T	15.37:g.78452504C>T	ENSP00000299518:p.Ser82Leu		D3DW83|Q9H3X0	Missense_Mutation	SNP	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_D	p.S82L	ENST00000299518.2	37	c.245	CCDS10297.1	15	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593959	0.66219	.	.	ENSG00000166411	ENST00000299518	T	0.69175	-0.38	5.62	5.62	0.85841	Isopropylmalate dehydrogenase-like domain (2);	0.048279	0.85682	D	0.000000	T	0.63224	0.2493	L	0.46157	1.445	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.57768	-0.7754	10	0.45353	T	0.12	-3.9898	18.6639	0.91481	0.0:1.0:0.0:0.0	.	82;82	B4DSY4;P50213	.;IDH3A_HUMAN	L	82	ENSP00000299518:S82L	ENSP00000299518:S82L	S	+	2	0	IDH3A	76239559	0.985000	0.35326	0.941000	0.38009	0.986000	0.74619	3.913000	0.56394	2.644000	0.89710	0.561000	0.74099	TCA	-	IDH3A	-	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_D		0.498	IDH3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH3A	HGNC	protein_coding	OTTHUMT00000289799.4	0	0	0	42	42	123	0.00	0.00	C	NM_005530		78452504	+1	5	31	24	80	tier1	no_errors	ENST00000299518	ensembl	human	known	74_37	missense	17.24	27.93	SNP	0.999	T	5	24
C16orf96	342346	genome.wustl.edu	37	16	4624985	4624985	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr16:4624985A>T	ENST00000444310.4	+	4	619	c.619A>T	c.(619-621)Aat>Tat	p.N207Y		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						TTCTCTCCAGAATAAGTTTAA	0.532													ENSG00000205832																																					0													96.0	89.0	91.0					16																	4624985		692	1591	2283	SO:0001583	missense	0			-		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.619A>T	16.37:g.4624985A>T	ENSP00000415027:p.Asn207Tyr			Missense_Mutation	SNP	NULL	p.N207Y	ENST00000444310.4	37	c.619	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	A	12.11	1.838153	0.32513	.	.	ENSG00000205832	ENST00000444310	T	0.22539	1.95	4.54	3.43	0.39272	.	0.986834	0.08239	N	0.976370	T	0.15782	0.0380	N	0.14661	0.345	0.26809	N	0.969033	B	0.25441	0.126	B	0.32928	0.155	T	0.35919	-0.9769	10	0.52906	T	0.07	-2.5294	8.4307	0.32755	0.7769:0.2231:0.0:0.0	.	207	A6NNT2	CP096_HUMAN	Y	207	ENSP00000415027:N207Y	ENSP00000415027:N207Y	N	+	1	0	C16orf96	4564986	0.512000	0.26186	0.416000	0.26546	0.053000	0.15095	0.855000	0.27805	0.844000	0.35094	0.379000	0.24179	AAT	-	C16orf96	-	NULL		0.532	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	0	0	0	36	36	154	0.00	0.00	A	NM_001145011		4624985	+1	7	13	16	71	tier1	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	30.43	15.48	SNP	0.709	T	7	16
ATP8A2	51761	genome.wustl.edu	37	13	26043135	26043135	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr13:26043135G>T	ENST00000381655.2	+	2	239	c.97G>T	c.(97-99)Ggc>Tgc	p.G33C	ATP8A2_ENST00000255283.8_5'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	0					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TTCTTCTTTGGGCTATAAGAA	0.607													ENSG00000132932																																					0													73.0	81.0	78.0					13																	26043135		2027	4182	6209	SO:0001583	missense	0			-	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.97G>T	13.37:g.26043135G>T	ENSP00000371070:p.Gly33Cys		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G33C	ENST00000381655.2	37	c.97	CCDS41873.1	13	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088366	0.55968	.	.	ENSG00000132932	ENST00000381655	T	0.59224	0.28	4.16	2.3	0.28687	.	0.344881	0.28877	N	0.013858	T	0.49321	0.1550	N	0.25647	0.755	0.80722	D	1	.	.	.	.	.	.	T	0.52837	-0.8522	8	0.62326	D	0.03	.	8.5993	0.33734	0.0944:0.1587:0.7469:0.0	.	.	.	.	C	33	ENSP00000371070:G33C	ENSP00000371070:G33C	G	+	1	0	ATP8A2	24941135	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	5.691000	0.68249	2.156000	0.67533	0.400000	0.26472	GGC	-	ATP8A2	-	NULL		0.607	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2	0	0	0	52	52	80	0.00	0.00	G	NM_016529		26043135	+1	11	22	9	20	tier1	no_errors	ENST00000381655	ensembl	human	known	74_37	missense	55.00	52.38	SNP	1.000	T	11	9
GLP1R	2740	genome.wustl.edu	37	6	39040728	39040728	+	Silent	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr6:39040728C>T	ENST00000373256.4	+	6	643	c.600C>T	c.(598-600)gcC>gcT	p.A200A		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	200					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	AGGACGCAGCCCTGAAGTGGA	0.582													ENSG00000112164																																					0													178.0	141.0	153.0					6																	39040728		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.600C>T	6.37:g.39040728C>T			Q2M229|Q99669	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GLP1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.A200	ENST00000373256.4	37	c.600	CCDS4839.1	6																																																																																			-	GLP1R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.582	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP1R	HGNC	protein_coding	OTTHUMT00000040443.1	0	0	0	53	53	86	0.00	0.00	C			39040728	+1	9	13	29	60	tier1	no_errors	ENST00000373256	ensembl	human	known	74_37	silent	23.68	17.81	SNP	1.000	T	9	29
DOCK6	57572	genome.wustl.edu	37	19	11353984	11353984	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:11353984A>C	ENST00000294618.7	-	12	1347	c.1336T>G	c.(1336-1338)Ttc>Gtc	p.F446V		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	446					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						AAGCCAGAGAAGCTGCAGGCG	0.647											OREG0025252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000130158																																					0													20.0	25.0	23.0					19																	11353984		1964	4138	6102	SO:0001583	missense	0			-		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.1336T>G	19.37:g.11353984A>C	ENSP00000294618:p.Phe446Val	671	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N	p.F446V	ENST00000294618.7	37	c.1336	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	A	13.36	2.213777	0.39102	.	.	ENSG00000130158	ENST00000294618	T	0.43688	0.94	4.15	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.25938	0.0632	L	0.27053	0.805	0.80722	D	1	B	0.24618	0.107	B	0.25987	0.065	T	0.06215	-1.0839	10	0.15499	T	0.54	-24.623	7.2428	0.26106	0.8959:0.0:0.1041:0.0	.	446	Q96HP0	DOCK6_HUMAN	V	446	ENSP00000294618:F446V	ENSP00000294618:F446V	F	-	1	0	DOCK6	11214984	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	1.650000	0.37292	1.518000	0.48934	0.379000	0.24179	TTC	-	DOCK6	-	NULL		0.647	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	0	0	0	127	127	50	0.00	0.00	A	NM_020812		11353984	-1	16	7	123	42	tier1	no_errors	ENST00000294618	ensembl	human	known	74_37	missense	11.51	14.29	SNP	1.000	C	16	123
SRPK2	6733	genome.wustl.edu	37	7	104844172	104844172	+	Silent	SNP	T	T	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:104844172T>A	ENST00000393651.3	-	3	219	c.132A>T	c.(130-132)ccA>ccT	p.P44P	SRPK2_ENST00000489828.1_Silent_p.P33P|SRPK2_ENST00000357311.3_Silent_p.P33P	NM_182692.1	NP_872634.1			SRSF protein kinase 2									p.P33P(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						AAggtggcggtggtggtggtg	0.557													ENSG00000135250																																					1	Substitution - coding silent(1)	large_intestine(1)											47.0	42.0	43.0					7																	104844172		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.132A>T	7.37:g.104844172T>A				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P44	ENST00000393651.3	37	c.132	CCDS34724.1	7																																																																																			-	SRPK2	-	NULL		0.557	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	HGNC	protein_coding	OTTHUMT00000348723.1	0	0	0	43	43	34	0.00	0.00	T	NM_182691		104844172	-1	20	15	40	39	tier1	no_errors	ENST00000393651	ensembl	human	known	74_37	silent	32.79	27.78	SNP	0.570	A	20	40
NPHP4	261734	genome.wustl.edu	37	1	5924040	5924040	+	Silent	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:5924040G>T	ENST00000378156.4	-	29	4315	c.4050C>A	c.(4048-4050)atC>atA	p.I1350I	NPHP4_ENST00000478423.2_5'UTR|MIR4689_ENST00000582517.1_RNA	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	1350					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTGTAGGTGATCCTCTTGT	0.627													ENSG00000131697																																					0													94.0	111.0	105.0					1																	5924040		2071	4182	6253	SO:0001819	synonymous_variant	0			-	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.4050C>A	1.37:g.5924040G>T			Q8IWC0	Silent	SNP	NULL	p.I1350	ENST00000378156.4	37	c.4050	CCDS44052.1	1																																																																																			-	NPHP4	-	NULL		0.627	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	0	0	0	80	80	131	0.00	0.00	G			5924040	-1	22	24	57	61	tier1	no_errors	ENST00000378156	ensembl	human	known	74_37	silent	27.85	27.91	SNP	1.000	T	22	57
PCDHB13	56123	genome.wustl.edu	37	5	140594306	140594306	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:140594306A>T	ENST00000341948.4	+	1	798	c.611A>T	c.(610-612)gAg>gTg	p.E204V		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	204	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGGACCGAGAGGAAGAAGCT	0.542													ENSG00000187372																																					0													53.0	58.0	56.0					5																	140594306		2202	4279	6481	SO:0001583	missense	0			-	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.611A>T	5.37:g.140594306A>T	ENSP00000345491:p.Glu204Val		A8K9V6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E204V	ENST00000341948.4	37	c.611	CCDS4255.1	5	.	.	.	.	.	.	.	.	.	.	a	21.2	4.110512	0.77210	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.73152	-0.72	3.51	3.51	0.40186	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.90390	0.6992	H	0.99919	4.95	0.42849	D	0.994075	D	0.89917	1.0	D	0.97110	1.0	D	0.90635	0.4570	9	0.87932	D	0	.	7.9204	0.29843	0.895:0.0:0.105:0.0	.	204	Q9Y5F0	PCDBD_HUMAN	V	204	ENSP00000345491:E204V	ENSP00000345491:E204V	E	+	2	0	PCDHB13	140574490	1.000000	0.71417	0.047000	0.18901	0.453000	0.32348	9.265000	0.95647	1.369000	0.46134	0.254000	0.18369	GAG	-	PCDHB13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.542	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	HGNC	protein_coding	OTTHUMT00000251810.1	0	0	0	70	70	78	0.00	0.00	A	NM_018933		140594306	+1	19	10	58	58	tier1	no_errors	ENST00000341948	ensembl	human	known	74_37	missense	24.68	14.71	SNP	0.974	T	19	58
TSPAN7	7102	genome.wustl.edu	37	X	38482210	38482210	+	Intron	SNP	T	T	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrX:38482210T>A	ENST00000378482.2	+	2	258				TSPAN7_ENST00000545599.1_5'UTR|TSPAN7_ENST00000488893.1_Intron|TSPAN7_ENST00000286824.6_Intron|TSPAN7_ENST00000422612.2_Intron|TM4SF2_ENST00000465127.1_Intron	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7						viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						ACATAACaagtaatatggtat	0.363													ENSG00000156298																																					0																																										SO:0001627	intron_variant	0			-	D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.82-43165T>A	X.37:g.38482210T>A			B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Nonstop_Mutation	SNP	NULL	p.*46K	ENST00000378482.2	37	c.136	CCDS14248.1	X																																																																																			-	TSPAN7	-	NULL		0.363	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN7	HGNC	protein_coding	OTTHUMT00000356412.1	0	0	0	57	57	129	0.00	0.00	T			38482210	+1	7	21	47	123	tier1	no_errors	ENST00000475216	ensembl	human	known	74_37	nonstop	12.96	14.58	SNP	0.000	A	7	47
CYP3A4	1576	genome.wustl.edu	37	7	99355784	99355784	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:99355784G>T	ENST00000336411.2	-	13	1667	c.1484C>A	c.(1483-1485)tCa>tAa	p.S495*	CYP3A4_ENST00000354593.2_Nonsense_Mutation_p.S345*	NM_001202855.2|NM_017460.5	NP_001189784.1|NP_059488.2	P08684	CP3A4_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 4	495					alkaloid catabolic process (GO:0009822)|androgen metabolic process (GO:0008209)|calcitriol biosynthetic process from calciol (GO:0036378)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|lipid metabolic process (GO:0006629)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	albendazole monooxygenase activity (GO:0047638)|caffeine oxidase activity (GO:0034875)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)|quinine 3-monooxygenase activity (GO:0050591)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)|taurochenodeoxycholate 6alpha-hydroxylase activity (GO:0033780)|testosterone 6-beta-hydroxylase activity (GO:0050649)|vitamin D 24-hydroxylase activity (GO:0070576)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(3)|central_nervous_system(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Abiraterone(DB05812)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetazolamide(DB00819)|Adinazolam(DB00546)|ado-trastuzumab emtansine(DB05773)|Albendazole(DB00518)|Alclometasone(DB00240)|Aldesleukin(DB00041)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Alimemazine(DB01246)|Aliskiren(DB01258)|Allylestrenol(DB01431)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alosetron(DB00969)|Alprazolam(DB00404)|Ambroxol(DB06742)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Arsenic trioxide(DB01169)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atazanavir(DB01072)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Avanafil(DB06237)|Axitinib(DB06626)|Azatadine(DB00719)|Azelastine(DB00972)|Azithromycin(DB00207)|Bedaquiline(DB08903)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bezafibrate(DB01393)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bisoprolol(DB00612)|Boceprevir(DB08873)|Bortezomib(DB00188)|Bosentan(DB00559)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Brinzolamide(DB01194)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Brompheniramine(DB00835)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Busulfan(DB01008)|Cabazitaxel(DB06772)|Cabergoline(DB00248)|Cabozantinib(DB08875)|Caffeine(DB00201)|Calcitriol(DB00136)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Caspofungin(DB00520)|Cefradine(DB01333)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chenodeoxycholic acid(DB06777)|Chloramphenicol(DB00446)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clemastine(DB00283)|Clevidipine(DB04920)|Clindamycin(DB01190)|Clobazam(DB00349)|Clofazimine(DB00845)|Clofibrate(DB00636)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonazepam(DB01068)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Colchicine(DB01394)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cortisone acetate(DB01380)|Crizotinib(DB08865)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Cytarabine(DB00987)|Dabrafenib(DB08912)|Dalfopristin(DB01764)|Danazol(DB01406)|Dantrolene(DB01219)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Deferasirox(DB01609)|Delavirdine(DB00705)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Dicloxacillin(DB00485)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydrocodeine(DB01551)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Disopyramide(DB00280)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dofetilide(DB00204)|Dolasetron(DB00757)|Dolutegravir(DB08930)|Domperidone(DB01184)|Donepezil(DB00843)|Dorzolamide(DB00869)|Doxepin(DB01142)|Doxorubicin(DB00997)|Doxycycline(DB00254)|Dronabinol(DB00470)|Dronedarone(DB04855)|Dutasteride(DB01126)|Econazole(DB01127)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Epinephrine(DB00668)|Eplerenone(DB00700)|Ergocalciferol(DB00153)|Ergoloid mesylate(DB01049)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Estradiol valerate/Dienogest(DB08866)|Estradiol(DB00783)|Estramustine(DB01196)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Etravirine(DB06414)|Everolimus(DB01590)|Exemestane(DB00990)|Ezetimibe(DB00973)|Famciclovir(DB00426)|Felbamate(DB00949)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Finasteride(DB01216)|Fingolimod(DB08868)|Flucloxacillin(DB00301)|Fluconazole(DB00196)|Flunisolide(DB00180)|Flunitrazepam(DB01544)|Fluorometholone(DB00324)|Fluoxetine(DB00472)|Flurazepam(DB00690)|Flutamide(DB00499)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosamprenavir(DB01319)|Fosphenytoin(DB01320)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Glipizide(DB01067)|Glyburide(DB01016)|Granisetron(DB00889)|Griseofulvin(DB00400)|Guanethidine(DB01170)|Guanfacine(DB01018)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Hydralazine(DB01275)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|Indacaterol(DB05039)|Indapamide(DB00808)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Irinotecan(DB00762)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ixabepilone(DB04845)|Josamycin(DB01321)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Levomethadyl Acetate(DB01227)|Levomilnacipran(DB08918)|Levonorgestrel(DB00367)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Lisuride(DB00589)|Lomitapide(DB08827)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumefantrine(DB06708)|Lurasidone(DB08815)|MACITENTAN(DB08932)|Maraviroc(DB04835)|Mebendazole(DB00643)|Medroxyprogesterone Acetate(DB00603)|Mefloquine(DB00358)|Meloxicam(DB00814)|Mequitazine(DB01071)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Methylergometrine(DB00353)|Methylprednisolone(DB00959)|Methyltestosterone(DB06710)|Metronidazole(DB00916)|Metyrapone(DB01011)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Mitoxantrone(DB01204)|Modafinil(DB00745)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nafcillin(DB00607)|Naloxone(DB01183)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nitric Oxide(DB00435)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Omeprazole(DB00338)|Ondansetron(DB00904)|Orlistat(DB01083)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paramethasone(DB01384)|Paricalcitol(DB00910)|Pazopanib(DB06589)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perampanel(DB08883)|Pergolide(DB01186)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenoxybenzamine(DB00925)|Phenprocoumon(DB00946)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pilocarpine(DB01085)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Prazepam(DB01588)|Praziquantel(DB01058)|Prednisolone(DB00860)|Prednisone(DB00635)|Primaquine(DB01087)|Primidone(DB00794)|Probenecid(DB01032)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Pyridostigmine(DB00545)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Quinupristin(DB01369)|Rabeprazole(DB01129)|Raloxifene(DB00481)|Ramelteon(DB00980)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Regorafenib(DB08896)|Repaglinide(DB00912)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rifapentine(DB01201)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Rimonabant(DB06155)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rivastigmine(DB00989)|Rolitetracycline(DB01301)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosuvastatin(DB01098)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Rufinamide(DB06201)|Ruxolitinib(DB08877)|Salbutamol(DB01001)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sevoflurane(DB01236)|Sibutramine(DB01105)|Sildenafil(DB00203)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Sitaxentan(DB06268)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sufentanil(DB00708)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfanilamide(DB00259)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tasosartan(DB01349)|Telaprevir(DB05521)|Telithromycin(DB00976)|Temazepam(DB00231)|Temozolomide(DB00853)|Temsirolimus(DB06287)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Thiopental(DB00599)|Thiotepa(DB04572)|Tiagabine(DB00906)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tioconazole(DB01007)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tofisopam(DB08811)|Tolterodine(DB01036)|Tolvaptan(DB06212)|Topiramate(DB00273)|Topotecan(DB01030)|Toremifene(DB00539)|Trabectedin(DB05109)|Tramadol(DB00193)|Trametinib(DB08911)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Tretinoin(DB00755)|Triamcinolone(DB00620)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vandetanib(DB05294)|Vardenafil(DB00862)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Zidovudine(DB00495)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)|Zopiclone(DB01198)	GCCATCCCTTGACTCAACCTT	0.428													ENSG00000160868																																					0													101.0	95.0	97.0					7																	99355784		2203	4300	6503	SO:0001587	stop_gained	0			-	AF280107	CCDS5674.1	7q21.1	2011-06-21	2003-01-14		ENSG00000160868	ENSG00000160868	1.1.1.161	"""Cytochrome P450s"""	2637	protein-coding gene	gene with protein product		124010	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4"""	CYP3A3		8269949, 1391968	Standard	NM_001202855		Approved		uc003urv.2	P08684	OTTHUMG00000156651	ENST00000336411.2:c.1484C>A	7.37:g.99355784G>T	ENSP00000337915:p.Ser495*		P05184|Q16757|Q9UK50	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.S495*	ENST00000336411.2	37	c.1484	CCDS5674.1	7	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360120	0.41801	.	.	ENSG00000160868	ENST00000354593;ENST00000336411	.	.	.	4.76	-1.72	0.08107	.	0.800601	0.11881	N	0.520531	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	6.6159	0.22776	0.3836:0.1195:0.4969:0.0	.	.	.	.	X	345;495	.	ENSP00000337915:S495X	S	-	2	0	CYP3A4	99193720	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.078000	0.14761	-0.309000	0.08779	-0.229000	0.12294	TCA	-	CYP3A4	-	superfamily_Cyt_P450		0.428	CYP3A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP3A4	HGNC	protein_coding	OTTHUMT00000345059.1	0	0	0	39	39	45	0.00	0.00	G			99355784	-1	7	9	55	40	tier1	no_errors	ENST00000336411	ensembl	human	known	74_37	nonsense	11.29	18.37	SNP	0.000	T	7	55
TUBA4A	7277	genome.wustl.edu	37	2	220115874	220115874	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr2:220115874C>G	ENST00000248437.4	-	4	720	c.547G>C	c.(547-549)Gag>Cag	p.E183Q	TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000498660.1_5'UTR|TUBA4A_ENST00000392088.2_Missense_Mutation_p.E168Q	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	183					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	TTGTAGGGCTCGACCACGGCT	0.557													ENSG00000127824																																					0																																										SO:0001583	missense	0			-	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.547G>C	2.37:g.220115874C>G	ENSP00000248437:p.Glu183Gln		A8MUB1|B3KNQ6|P05215	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.E183Q	ENST00000248437.4	37	c.547	CCDS2438.1	2	.	.	.	.	.	.	.	.	.	.	C	16.82	3.227468	0.58668	.	.	ENSG00000127824	ENST00000248437;ENST00000392088;ENST00000398989;ENST00000427737	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	5.05	5.05	0.67936	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	D	0.84151	0.5409	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86661	0.1904	10	0.87932	D	0	.	18.5898	0.91206	0.0:1.0:0.0:0.0	.	183	P68366	TBA4A_HUMAN	Q	183;168;30;168	ENSP00000248437:E183Q;ENSP00000375938:E168Q;ENSP00000396212:E30Q;ENSP00000408194:E168Q	ENSP00000248437:E183Q	E	-	1	0	TUBA4A	219824118	1.000000	0.71417	0.965000	0.40720	0.950000	0.60333	7.538000	0.82048	2.633000	0.89246	0.650000	0.86243	GAG	-	TUBA4A	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Epsilon_tubulin		0.557	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4A	HGNC	protein_coding	OTTHUMT00000256816.3	0	0	0	75	75	23	0.00	0.00	C	NM_006000		220115874	-1	13	4	36	19	tier1	no_errors	ENST00000248437	ensembl	human	known	74_37	missense	26.53	17.39	SNP	1.000	G	13	36
BOD1	91272	genome.wustl.edu	37	5	173036274	173036274	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:173036274C>A	ENST00000311086.4	-	3	749	c.526G>T	c.(526-528)Gac>Tac	p.D176Y	BOD1_ENST00000480951.1_Intron|BOD1_ENST00000285908.5_Intron|BOD1_ENST00000471339.1_5'Flank	NM_138369.2	NP_612378.1	Q96IK1	BOD1_HUMAN	biorientation of chromosomes in cell division 1	176					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|kinetochore (GO:0000776)				endometrium(1)|large_intestine(2)|lung(2)|ovary(2)	7						GCTGGAGGGTCCTGGCCTTCG	0.517													ENSG00000145919																																					0													97.0	94.0	95.0					5																	173036274		2203	4300	6503	SO:0001583	missense	0			-	AY303777	CCDS4389.1, CCDS54951.1	5q35.2	2013-10-11	2009-03-04	2009-03-04	ENSG00000145919	ENSG00000145919			25114	protein-coding gene	gene with protein product	"""biorientation defective 1"""		"""family with sequence similarity 44, member B"""	FAM44B		17938248	Standard	NM_138369		Approved		uc003mcq.2	Q96IK1	OTTHUMG00000130540	ENST00000311086.4:c.526G>T	5.37:g.173036274C>A	ENSP00000309644:p.Asp176Tyr		B4DXH8|Q9BTW1	Missense_Mutation	SNP	NULL	p.D176Y	ENST00000311086.4	37	c.526	CCDS4389.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.7|23.7	4.443124|4.443124	0.83993|0.83993	.|.	.|.	ENSG00000145919|ENSG00000145919	ENST00000311086|ENST00000477985	.|.	.|.	.|.	5.86|5.86	4.98|4.98	0.66077|0.66077	.|.	0.156460|.	0.56097|.	D|.	0.000022|.	T|T	0.54464|0.54464	0.1860|0.1860	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	P|.	0.36789|.	0.57|.	B|.	0.36885|.	0.235|.	T|T	0.47341|0.47341	-0.9125|-0.9125	9|5	0.87932|.	D|.	0|.	-19.8745|-19.8745	14.3972|14.3972	0.67020|0.67020	0.0:0.9297:0.0:0.0703|0.0:0.9297:0.0:0.0703	.|.	176|.	Q96IK1|.	BOD1_HUMAN|.	Y|V	176|108	.|.	ENSP00000309644:D176Y|.	D|G	-|-	1|2	0|0	BOD1|BOD1	172968880|172968880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.928000|0.928000	0.56348|0.56348	5.356000|5.356000	0.66052|0.66052	2.778000|2.778000	0.95560|0.95560	0.655000|0.655000	0.94253|0.94253	GAC|GGA	-	BOD1	-	NULL		0.517	BOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1	HGNC	protein_coding	OTTHUMT00000252963.1	0	0	1	78	78	64	0.00	1.54	C	NM_138369		173036274	-1	16	16	66	48	tier1	no_errors	ENST00000311086	ensembl	human	known	74_37	missense	19.51	25.00	SNP	1.000	A	16	66
SCFD2	152579	genome.wustl.edu	37	4	53822220	53822220	+	Intron	SNP	T	T	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr4:53822220T>C	ENST00000401642.3	-	6	1695				SCFD2_ENST00000388940.4_Intron|RP11-752D24.2_ENST00000508813.1_RNA	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2						protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GAGAAAGCTATGGGGGTCCCA	0.512													ENSG00000248115																																					0																																										SO:0001627	intron_variant	0			-	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.1562-35183A>G	4.37:g.53822220T>C			Q8N5F3|Q8N8H0|Q96ED3	R	SNP	-	NULL	ENST00000401642.3	37	NULL	CCDS33984.1	4																																																																																			-	RP11-752D24.2	-	-		0.512	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248115	Clone_based_vega_gene	protein_coding	OTTHUMT00000361311.3	0	0	0	44	44	121	0.00	0.00	T	NM_152540		53822220	+1	14	25	33	73	tier1	no_errors	ENST00000508813	ensembl	human	known	74_37	rna	29.79	25.51	SNP	0.000	C	14	33
MROH2B	133558	genome.wustl.edu	37	5	41005734	41005734	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:41005734A>T	ENST00000399564.4	-	35	4213	c.3763T>A	c.(3763-3765)Tgg>Agg	p.W1255R	MROH2B_ENST00000506092.2_Missense_Mutation_p.W810R	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1255																	CCGTGTTGCCACACTGCCATG	0.443													ENSG00000171495																																					0													66.0	68.0	67.0					5																	41005734		2041	4209	6250	SO:0001583	missense	0			-		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3763T>A	5.37:g.41005734A>T	ENSP00000382476:p.Trp1255Arg		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.W1255R	ENST00000399564.4	37	c.3763	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683765	0.68157	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.01295	5.04;5.29	6.15	6.15	0.99193	Armadillo-type fold (1);	0.221387	0.32852	N	0.005562	T	0.02533	0.0077	L	0.54323	1.7	0.38926	D	0.957844	B	0.32968	0.392	B	0.36766	0.232	T	0.61377	-0.7075	10	0.25106	T	0.35	.	13.1804	0.59651	1.0:0.0:0.0:0.0	.	1255	Q7Z745	HTRB2_HUMAN	R	810;960;1255	ENSP00000441504:W810R;ENSP00000382476:W1255R	ENSP00000296803:W960R	W	-	1	0	HEATR7B2	41041491	0.986000	0.35501	1.000000	0.80357	0.966000	0.64601	2.786000	0.47790	2.363000	0.80096	0.523000	0.50628	TGG	-	MROH2B	-	superfamily_ARM-type_fold		0.443	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	0	0	0	72	72	128	0.00	0.00	A	NM_173489		41005734	-1	14	23	59	82	tier1	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	19.18	21.70	SNP	0.999	T	14	59
LOC285556	285556	genome.wustl.edu	37	4	100574194	100574194	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr4:100574194C>T	ENST00000511828.1	-	1	1611	c.1612G>A	c.(1612-1614)Gca>Aca	p.A538T																								TTTTGCTTTGCACGCACGTTG	0.532													ENSG00000248713																																					0																																										SO:0001583	missense	0			-																												ENST00000511828.1:c.1612G>A	4.37:g.100574194C>T	ENSP00000427555:p.Ala538Thr			Missense_Mutation	SNP	NULL	p.A538T	ENST00000511828.1	37	c.1612		4	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156219	0.57259	.	.	ENSG00000248713	ENST00000511828	T	0.19669	2.13	4.79	4.79	0.61399	.	.	.	.	.	T	0.19366	0.0465	N	0.14661	0.345	.	.	.	.	.	.	.	.	.	T	0.22871	-1.0204	6	0.62326	D	0.03	.	12.8123	0.57647	0.0:0.9217:0.0:0.0783	.	.	.	.	T	538	ENSP00000427555:A538T	ENSP00000427555:A538T	A	-	1	0	RP11-766F14.2	100793217	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	2.753000	0.47524	2.648000	0.89879	0.650000	0.86243	GCA	-	RP11-766F14.2	-	NULL		0.532	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	Clone_based_vega_gene	protein_coding	OTTHUMT00000365456.1	0	0	1	55	55	57	0.00	1.72	C			100574194	-1	33	28	13	17	tier1	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	71.74	62.22	SNP	1.000	T	33	13
PKHD1	5314	genome.wustl.edu	37	6	51612752	51612752	+	Missense_Mutation	SNP	G	G	A	rs145141656	byFrequency	TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr6:51612752G>A	ENST00000371117.3	-	58	9937	c.9662C>T	c.(9661-9663)cCg>cTg	p.P3221L	PKHD1_ENST00000340994.4_Missense_Mutation_p.P3221L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3221					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGCTGAGTGCGGCTTCACTTT	0.463													ENSG00000170927	G|||	3	0.000599042	0.0	0.0	5008	,	,		18978	0.002		0.0	False		,,,				2504	0.001																0								G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	111.0	110.0	111.0		9662,9662	5.8	0.5	6	dbSNP_134	111	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PKHD1	NM_138694.3,NM_170724.2	98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	3221/4075,3221/3397	51612752	1,13005	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.9662C>T	6.37:g.51612752G>A	ENSP00000360158:p.Pro3221Leu		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.P3221L	ENST00000371117.3	37	c.9662	CCDS4935.1	6	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.17	3.565219	0.65651	0.0	1.16E-4	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88354	-2.19;-2.37	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.93096	0.7802	M	0.72118	2.19	0.58432	D	0.999991	D;D;D	0.89917	1.0;0.977;0.999	D;P;D	0.71414	0.973;0.787;0.947	D	0.91950	0.5570	10	0.45353	T	0.12	.	18.9315	0.92568	0.0:0.0:1.0:0.0	.	3221;3221;3221	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	L	3221	ENSP00000360158:P3221L;ENSP00000341097:P3221L	ENSP00000341097:P3221L	P	-	2	0	PKHD1	51720711	1.000000	0.71417	0.485000	0.27403	0.621000	0.37620	6.432000	0.73400	2.716000	0.92895	0.655000	0.94253	CCG	rs145141656	PKHD1	-	NULL		0.463	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	0	0	0	43	43	132	0.00	0.00	G	NM_138694		51612752	-1	18	22	28	64	tier1	no_errors	ENST00000371117	ensembl	human	known	74_37	missense	39.13	25.58	SNP	0.988	A	18	28
KRT6A	3853	genome.wustl.edu	37	12	52886582	52886582	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr12:52886582G>A	ENST00000330722.6	-	1	459	c.391C>T	c.(391-393)Ccc>Tcc	p.P131S		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	131	Head.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTCCAGGGGGGCACACAGGG	0.637													ENSG00000205420																																					0													56.0	54.0	55.0					12																	52886582		2203	4296	6499	SO:0001583	missense	0			-	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.391C>T	12.37:g.52886582G>A	ENSP00000369317:p.Pro131Ser		A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.P131S	ENST00000330722.6	37	c.391	CCDS41786.1	12	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763584	0.69878	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.84730	-1.89	5.24	5.24	0.73138	.	0.100557	0.44285	N	0.000461	D	0.91503	0.7317	M	0.81112	2.525	0.35032	D	0.758871	D	0.63880	0.993	D	0.69307	0.963	D	0.94387	0.7610	10	0.62326	D	0.03	.	12.6041	0.56513	0.0763:0.0:0.9237:0.0	.	131	P02538	K2C6A_HUMAN	S	131;87	ENSP00000369317:P131S	ENSP00000369317:P131S	P	-	1	0	KRT6A	51172849	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.098000	0.64548	2.626000	0.88956	0.549000	0.68633	CCC	-	KRT6A	-	NULL		0.637	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6A	HGNC	protein_coding	OTTHUMT00000404978.2	0	0	0	100	100	29	0.00	0.00	G	NM_005554		52886582	-1	15	6	84	11	tier1	no_errors	ENST00000330722	ensembl	human	known	74_37	missense	15.15	35.29	SNP	1.000	A	15	84
SLC25A48	153328	genome.wustl.edu	37	5	135188365	135188365	+	Silent	SNP	C	C	T	rs368023667		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:135188365C>T	ENST00000420621.1	+	4	448	c.276C>T	c.(274-276)tgC>tgT	p.C92C	SLC25A48_ENST00000433282.2_Silent_p.C38C|SLC25A48_ENST00000425402.1_Intron|SLC25A48_ENST00000274513.5_Silent_p.C92C|SLC25A48_ENST00000412661.2_Silent_p.C92C			Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	92					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						AGCACCGCTGCGGGGAGCCAG	0.667													ENSG00000145832	C|||	1	0.000199681	0.0008	0.0	5008	,	,		17722	0.0		0.0	False		,,,				2504	0.0																0													58.0	69.0	65.0					5																	135188365		1946	4122	6068	SO:0001819	synonymous_variant	0			-		CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000420621.1:c.276C>T	5.37:g.135188365C>T			Q8TAV9	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.C92	ENST00000420621.1	37	c.276		5																																																																																			-	SLC25A48	-	superfamily_Mt_carrier_dom		0.667	SLC25A48-201	KNOWN	basic|appris_principal	protein_coding	SLC25A48	HGNC	protein_coding		0	0	0	38	38	86	0.00	0.00	C	NM_145282		135188365	+1	19	37	19	32	tier1	no_errors	ENST00000420621	ensembl	human	known	74_37	silent	50.00	52.86	SNP	0.862	T	19	19
SCN2A	6326	genome.wustl.edu	37	2	166168534	166168534	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr2:166168534G>T	ENST00000375437.2	+	8	1260		c.e8-1		SCN2A_ENST00000283256.6_Splice_Site|SCN2A_ENST00000357398.3_Splice_Site|SCN2A_ENST00000375427.2_Splice_Site	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit						intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTTAAATAGGTCACTTTTA	0.383													ENSG00000136531																																					0													101.0	99.0	99.0					2																	166168534		2202	4299	6501	SO:0001630	splice_region_variant	0			-	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.971-1G>T	2.37:g.166168534G>T			A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Splice_Site	SNP	-	e7-1	ENST00000375437.2	37	c.971-1	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.378366	0.82682	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4127	0.94681	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCN2A	165876780	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.476000	0.97823	2.639000	0.89480	0.655000	0.94253	.	-	SCN2A	-	-		0.383	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	0	0	0	35	35	88	0.00	0.00	G	NM_021007	Intron	166168534	+1	6	6	25	35	tier1	no_errors	ENST00000283256	ensembl	human	known	74_37	splice_site	19.35	14.63	SNP	1.000	T	6	25
DOCK8	81704	genome.wustl.edu	37	9	421060	421060	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr9:421060A>T	ENST00000453981.1	+	32	4247	c.4135A>T	c.(4135-4137)Atg>Ttg	p.M1379L	DOCK8_ENST00000382329.1_Missense_Mutation_p.M846L|DOCK8_ENST00000493666.2_3'UTR|DOCK8_ENST00000432829.2_Missense_Mutation_p.M1311L|DOCK8_ENST00000469391.1_Missense_Mutation_p.M1279L			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1379					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AGGGGAGATGATGCGCCGCCG	0.567													ENSG00000107099																																					0													71.0	75.0	74.0					9																	421060		2203	4300	6503	SO:0001583	missense	0			-	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.4135A>T	9.37:g.421060A>T	ENSP00000408464:p.Met1379Leu		A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.M1379L	ENST00000453981.1	37	c.4135	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	A	14.88	2.667470	0.47677	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.01665	4.7;4.7;4.7;4.7	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.01870	0.0059	L	0.28556	0.865	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.09377	0.001;0.001;0.004	T	0.50591	-0.8810	10	0.07644	T	0.81	.	16.087	0.81065	1.0:0.0:0.0:0.0	.	1279;846;1379	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	L	1379;1347;1311;1279;846	ENSP00000408464:M1379L;ENSP00000394888:M1311L;ENSP00000419438:M1279L;ENSP00000371766:M846L	ENSP00000287364:M1347L	M	+	1	0	DOCK8	411060	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.189000	0.65098	2.202000	0.70862	0.533000	0.62120	ATG	-	DOCK8	-	NULL		0.567	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	0	0	0	66	66	54	0.00	0.00	A	XM_036307		421060	+1	14	10	35	22	tier1	no_errors	ENST00000453981	ensembl	human	known	74_37	missense	28.57	31.25	SNP	1.000	T	14	35
MED12L	116931	genome.wustl.edu	37	3	151107922	151107922	+	Splice_Site	SNP	A	A	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:151107922A>G	ENST00000474524.1	+	36	5540	c.5502A>G	c.(5500-5502)ccA>ccG	p.P1834P	MED12L_ENST00000273432.4_Splice_Site_p.P1694P	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1834						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTCTTACTCCAGGTATGTGAT	0.483													ENSG00000144893																																					0													115.0	128.0	124.0					3																	151107922		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5503+1A>G	3.37:g.151107922A>G			Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.P1834	ENST00000474524.1	37	c.5502	CCDS33876.1	3																																																																																			-	MED12L	-	pfam_Mediator_Med12_catenin-bd		0.483	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	0	0	0	57	57	107	0.00	0.00	A	NM_053002	Silent	151107922	+1	22	27	49	73	tier1	no_errors	ENST00000474524	ensembl	human	known	74_37	silent	30.99	27.00	SNP	1.000	G	22	49
PAGE3	139793	genome.wustl.edu	37	X	55287001	55287001	+	Silent	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrX:55287001C>A	ENST00000374951.1	-	4	593	c.285G>T	c.(283-285)ctG>ctT	p.L95L	PAGE3_ENST00000519203.1_Silent_p.L95L			Q5JUK9	PAGE3_HUMAN	P antigen family, member 3 (prostate associated)	95										endometrium(1)|kidney(1)|lung(1)	3						CCAGATTTGGCAGAAATTCTC	0.388													ENSG00000204279																																					0													60.0	52.0	55.0					X																	55287001		2203	4299	6502	SO:0001819	synonymous_variant	0			-			Xp11	2009-06-17	2005-01-26	2005-01-27	ENSG00000204279	ENSG00000204279			4110	protein-coding gene	gene with protein product		300739	"""G antigen, family D, 1"""	GAGED1		9724777	Standard	NR_033460		Approved	PAGE-3, CT16.6	uc022bxs.2	Q5JUK9	OTTHUMG00000021654	ENST00000374951.1:c.285G>T	X.37:g.55287001C>A			A5D6Y1	Silent	SNP	pfam_GAGE	p.L95	ENST00000374951.1	37	c.285		X																																																																																			-	PAGE3	-	pfam_GAGE		0.388	PAGE3-001	KNOWN	basic|appris_principal	protein_coding	PAGE3	HGNC	protein_coding	OTTHUMT00000056867.2	0	0	0	246	246	113	0.00	0.00	C	XM_060054		55287001	-1	77	34	240	88	tier1	no_errors	ENST00000374951	ensembl	human	known	74_37	silent	24.29	27.87	SNP	0.000	A	77	240
POF1B	79983	genome.wustl.edu	37	X	84560869	84560869	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrX:84560869C>A	ENST00000262753.4	-	13	1510	c.1365G>T	c.(1363-1365)gaG>gaT	p.E455D	POF1B_ENST00000373145.3_Missense_Mutation_p.E455D	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	455						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						GGTTGCCAATCTCATCCATTT	0.388													ENSG00000124429																																					0													195.0	164.0	175.0					X																	84560869		2203	4300	6503	SO:0001583	missense	0			-	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.1365G>T	X.37:g.84560869C>A	ENSP00000262753:p.Glu455Asp		A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	NULL	p.E455D	ENST00000262753.4	37	c.1365	CCDS14452.1	X	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676124	0.67928	.	.	ENSG00000124429	ENST00000262753;ENST00000373145	T;T	0.21734	2.0;1.99	5.69	1.91	0.25777	.	0.045411	0.85682	N	0.000000	T	0.18130	0.0435	L	0.59436	1.845	0.41141	D	0.985956	B;B	0.19935	0.04;0.04	B;B	0.19666	0.026;0.026	T	0.05750	-1.0866	10	0.39692	T	0.17	.	5.3213	0.15883	0.0:0.5379:0.1372:0.3249	.	455;455	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	D	455	ENSP00000262753:E455D;ENSP00000362238:E455D	ENSP00000262753:E455D	E	-	3	2	POF1B	84447525	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	0.495000	0.22483	-0.042000	0.13535	0.600000	0.82982	GAG	-	POF1B	-	NULL		0.388	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POF1B	HGNC	protein_coding	OTTHUMT00000057391.2	0	0	0	51	51	125	0.00	0.00	C	NM_024921		84560869	-1	8	12	26	49	tier1	no_errors	ENST00000373145	ensembl	human	known	74_37	missense	23.53	19.67	SNP	0.999	A	8	26
BTBD11	121551	genome.wustl.edu	37	12	108051405	108051405	+	Silent	SNP	C	C	A	rs576588335		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr12:108051405C>A	ENST00000280758.5	+	17	3753	c.3225C>A	c.(3223-3225)acC>acA	p.T1075T	BTBD11_ENST00000420571.2_Silent_p.T956T|BTBD11_ENST00000494235.2_Silent_p.T154T|BTBD11_ENST00000357167.4_Silent_p.T612T	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	1075						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GTGAAGGGACCGGCCAGGATG	0.473													ENSG00000151136																																					0													124.0	112.0	116.0					12																	108051405		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.3225C>A	12.37:g.108051405C>A			A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Silent	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.T1075	ENST00000280758.5	37	c.3225	CCDS31893.1	12																																																																																			-	BTBD11	-	NULL		0.473	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	0	0	0	56	56	128	0.00	0.00	C	NM_152322		108051405	+1	20	23	30	57	tier1	no_errors	ENST00000280758	ensembl	human	known	74_37	silent	39.22	28.75	SNP	0.470	A	20	30
OR2J3	442186	genome.wustl.edu	37	6	29080202	29080202	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr6:29080202C>A	ENST00000377169.1	+	1	535	c.535C>A	c.(535-537)Cac>Aac	p.H179N		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						CCAAGTAGATCACTTTTTCTG	0.473													ENSG00000204701																																					0													117.0	126.0	123.0					6																	29080202		1289	2578	3867	SO:0001583	missense	0			-		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.535C>A	6.37:g.29080202C>A	ENSP00000366374:p.His179Asn		B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H179N	ENST00000377169.1	37	c.535	CCDS43433.1	6	.	.	.	.	.	.	.	.	.	.	C	7.962	0.747240	0.15710	.	.	ENSG00000204701	ENST00000377169	T	0.00164	8.64	2.78	1.76	0.24704	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	L	0.60904	1.88	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.38436	-0.9661	9	0.41790	T	0.15	.	6.1697	0.20410	0.1869:0.6963:0.0:0.1168	.	179	O76001	OR2J3_HUMAN	N	179	ENSP00000366374:H179N	ENSP00000366374:H179N	H	+	1	0	OR2J3	29188181	0.022000	0.18835	0.991000	0.47740	0.278000	0.26855	0.154000	0.16343	1.549000	0.49425	0.436000	0.28706	CAC	-	OR2J3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.473	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J3	HGNC	protein_coding	OTTHUMT00000076132.2	0	0	0	65	65	86	0.00	0.00	C			29080202	+1	7	12	57	58	tier1	no_errors	ENST00000377169	ensembl	human	known	74_37	missense	10.94	17.14	SNP	0.024	A	7	57
IDH3A	3419	genome.wustl.edu	37	15	78452499	78452499	+	Silent	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr15:78452499C>T	ENST00000299518.2	+	4	323	c.240C>T	c.(238-240)atC>atT	p.I80I	IDH3A_ENST00000558535.1_3'UTR|IDH3A_ENST00000559205.1_Intron|IDH3A_ENST00000558554.1_Silent_p.I80I|IDH3A_ENST00000441490.2_Intron	NM_005530.2	NP_005521.1	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	80					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	12						AGTGGATGATCCCTTCAGAGG	0.507													ENSG00000166411																																					0													85.0	78.0	80.0					15																	78452499		2196	4293	6489	SO:0001819	synonymous_variant	0			-		CCDS10297.1	15q25.1-q25.2	2008-07-18			ENSG00000166411	ENSG00000166411	1.1.1.41		5384	protein-coding gene	gene with protein product	"""H-IDH alpha"", ""isocitric dehydrogenase"", ""isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial"", ""NAD+-specific ICDH"", ""NAD(H)-specific isocitrate dehydrogenase alpha subunit"", ""isocitrate dehydrogenase (NAD+) alpha chain"""	601149				8833160	Standard	NM_005530		Approved		uc002bdd.3	P50213	OTTHUMG00000143732	ENST00000299518.2:c.240C>T	15.37:g.78452499C>T			D3DW83|Q9H3X0	Silent	SNP	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_D	p.I80	ENST00000299518.2	37	c.240	CCDS10297.1	15																																																																																			-	IDH3A	-	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_D		0.507	IDH3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH3A	HGNC	protein_coding	OTTHUMT00000289799.4	0	0	0	42	42	119	0.00	0.00	C	NM_005530		78452499	+1	5	32	26	83	tier1	no_errors	ENST00000299518	ensembl	human	known	74_37	silent	16.13	27.83	SNP	1.000	T	5	26
NOA1	84273	genome.wustl.edu	37	4	57832838	57832838	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr4:57832838A>G	ENST00000264230.4	-	5	2949	c.1712T>C	c.(1711-1713)tTg>tCg	p.L571S		NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	571					apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										TGCCCTGTCCAAGGAGGTGAT	0.468													ENSG00000084092																																					0													160.0	133.0	142.0					4																	57832838		2203	4300	6503	SO:0001583	missense	0			-	AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.1712T>C	4.37:g.57832838A>G	ENSP00000264230:p.Leu571Ser		Q8N7L6|Q9BSQ9	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.L571S	ENST00000264230.4	37	c.1712	CCDS3510.1	4	.	.	.	.	.	.	.	.	.	.	A	17.66	3.444947	0.63178	.	.	ENSG00000084092	ENST00000264230	T	0.32272	1.46	5.66	5.66	0.87406	.	0.160766	0.37623	N	0.002020	T	0.50871	0.1641	M	0.82193	2.58	0.53688	D	0.999976	D	0.54772	0.968	P	0.52627	0.704	T	0.57106	-0.7868	10	0.51188	T	0.08	.	15.8881	0.79269	1.0:0.0:0.0:0.0	.	571	Q8NC60	CD014_HUMAN	S	571	ENSP00000264230:L571S	ENSP00000264230:L571S	L	-	2	0	C4orf14	57527595	1.000000	0.71417	0.999000	0.59377	0.334000	0.28698	5.033000	0.64146	2.145000	0.66743	0.374000	0.22700	TTG	-	NOA1	-	NULL		0.468	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOA1	HGNC	protein_coding	OTTHUMT00000250694.2	0	0	0	35	35	105	0.00	0.00	A	NM_032313		57832838	-1	20	54	8	28	tier1	no_errors	ENST00000264230	ensembl	human	known	74_37	missense	71.43	65.85	SNP	0.996	G	20	8
ADAM29	11086	genome.wustl.edu	37	4	175898452	175898452	+	Silent	SNP	A	A	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr4:175898452A>G	ENST00000359240.3	+	5	2446	c.1776A>G	c.(1774-1776)ggA>ggG	p.G592G	ADAM29_ENST00000514159.1_Silent_p.G592G|ADAM29_ENST00000445694.1_Silent_p.G592G|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Silent_p.G592G	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	592	Cys-rich.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GGATGAAGGGACCTGATATTG	0.413													ENSG00000168594																									Ovarian(140;1727 1835 21805 25838 41440)												0													202.0	183.0	189.0					4																	175898452		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1776A>G	4.37:g.175898452A>G			Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.G592	ENST00000359240.3	37	c.1776	CCDS3823.1	4																																																																																			-	ADAM29	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich		0.413	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		0	0	0	47	47	144	0.00	0.00	A			175898452	+1	9	36	27	67	tier1	no_errors	ENST00000359240	ensembl	human	known	74_37	silent	25.00	34.95	SNP	0.032	G	9	27
FBXO40	51725	genome.wustl.edu	37	3	121340749	121340749	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:121340749C>A	ENST00000338040.4	+	3	887	c.473C>A	c.(472-474)cCa>cAa	p.P158Q		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	158					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		GAGGAGGAACCAACTATGAAT	0.507													ENSG00000163833																																					0													93.0	100.0	97.0					3																	121340749		2203	4300	6503	SO:0001583	missense	0			-	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.473C>A	3.37:g.121340749C>A	ENSP00000337510:p.Pro158Gln		B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	superfamily_F-box_dom,superfamily_TRAF-like,pfscan_F-box_dom,pfscan_Znf_TRAF	p.P158Q	ENST00000338040.4	37	c.473	CCDS33835.1	3	.	.	.	.	.	.	.	.	.	.	C	0.708	-0.788236	0.02884	.	.	ENSG00000163833	ENST00000338040	T	0.41065	1.01	5.46	1.02	0.19986	.	0.862995	0.10130	N	0.712195	T	0.32823	0.0842	L	0.50333	1.59	0.09310	N	1	B	0.30973	0.302	B	0.24701	0.055	T	0.26360	-1.0105	10	0.52906	T	0.07	0.0137	6.2724	0.20961	0.0:0.5334:0.2939:0.1727	.	158	Q9UH90	FBX40_HUMAN	Q	158	ENSP00000337510:P158Q	ENSP00000337510:P158Q	P	+	2	0	FBXO40	122823439	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	0.145000	0.16157	0.644000	0.30656	0.650000	0.86243	CCA	-	FBXO40	-	NULL		0.507	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO40	HGNC	protein_coding	OTTHUMT00000355158.1	0	0	1	29	29	174	0.00	0.57	C	NM_016298		121340749	+1	8	34	20	87	tier1	no_errors	ENST00000338040	ensembl	human	known	74_37	missense	28.57	28.10	SNP	0.001	A	8	20
OR13G1	441933	genome.wustl.edu	37	1	247836034	247836034	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:247836034A>T	ENST00000359688.2	-	1	331	c.310T>A	c.(310-312)Tct>Act	p.S104T	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GCTCCCAGAGACCATGTGAAC	0.458													ENSG00000197437																																					0													86.0	71.0	76.0					1																	247836034		2203	4300	6503	SO:0001583	missense	0			-	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.310T>A	1.37:g.247836034A>T	ENSP00000352717:p.Ser104Thr		B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S104T	ENST00000359688.2	37	c.310	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	A	11.51	1.659909	0.29515	.	.	ENSG00000197437	ENST00000359688	T	0.00348	8.0	4.2	1.78	0.24846	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000599	T	0.00241	0.0007	N	0.12502	0.225	0.18873	N	0.999985	P	0.47253	0.892	P	0.55545	0.778	T	0.53760	-0.8393	10	0.72032	D	0.01	-34.3734	3.5848	0.07966	0.5965:0.197:0.2065:0.0	.	104	Q8NGZ3	O13G1_HUMAN	T	104	ENSP00000352717:S104T	ENSP00000352717:S104T	S	-	1	0	OR13G1	245902657	0.000000	0.05858	0.598000	0.28837	0.942000	0.58702	0.118000	0.15605	0.244000	0.21351	0.460000	0.39030	TCT	-	OR13G1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.458	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	HGNC	protein_coding	OTTHUMT00000096869.1	0	0	0	45	45	105	0.00	0.00	A	NM_001005487		247836034	-1	3	7	24	43	tier1	no_errors	ENST00000359688	ensembl	human	known	74_37	missense	11.11	14.00	SNP	0.390	T	3	24
CAMK2B	816	genome.wustl.edu	37	7	44294196	44294196	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:44294196C>A	ENST00000395749.2	-	5	362	c.286G>T	c.(286-288)Ggg>Tgg	p.G96W	CAMK2B_ENST00000502837.2_Intron|CAMK2B_ENST00000395747.2_Missense_Mutation_p.G96W|CAMK2B_ENST00000346990.4_Missense_Mutation_p.G96W|CAMK2B_ENST00000347193.4_Missense_Mutation_p.G96W|CAMK2B_ENST00000350811.3_Missense_Mutation_p.G96W|CAMK2B_ENST00000457475.1_Missense_Mutation_p.G96W|CAMK2B_ENST00000358707.3_Missense_Mutation_p.G96W|CAMK2B_ENST00000440254.2_Missense_Mutation_p.G96W|CAMK2B_ENST00000353625.4_Missense_Mutation_p.G96W|CAMK2B_ENST00000258682.6_Missense_Mutation_p.G96W	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	96	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						AAGAGCTCCCCACCAGTGACC	0.552													ENSG00000058404																																					0													137.0	119.0	125.0					7																	44294196		2203	4300	6503	SO:0001583	missense	0			-	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.286G>T	7.37:g.44294196C>A	ENSP00000379098:p.Gly96Trp		A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G96W	ENST00000395749.2	37	c.286	CCDS5483.1	7	.	.	.	.	.	.	.	.	.	.	C	20.5	4.001188	0.74818	.	.	ENSG00000058404	ENST00000350811;ENST00000457475;ENST00000395749;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747;ENST00000415369;ENST00000424197;ENST00000421607	T;T;T;T;T;T;T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1	3.6	3.6	0.41247	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.76278	0.3965	H	0.97783	4.075	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.999;0.993;0.999;0.998;0.953;0.999;0.999;1.0;0.997	D	0.85776	0.1358	9	0.87932	D	0	.	14.0541	0.64756	0.0:1.0:0.0:0.0	.	96;96;96;96;96;96;96;96;96	Q13554-8;Q13554-7;Q13554-4;Q13554-3;Q13554-6;A4D2K5;Q13554-5;Q13554;Q13554-2	.;.;.;.;.;.;.;KCC2B_HUMAN;.	W	96;96;96;96;96;96;96;96;96;96;112;96;96	ENSP00000326375:G96W;ENSP00000390292:G96W;ENSP00000379098:G96W;ENSP00000397937:G96W;ENSP00000351542:G96W;ENSP00000326427:G96W;ENSP00000326544:G96W;ENSP00000326518:G96W;ENSP00000258682:G96W;ENSP00000379096:G96W;ENSP00000390419:G112W;ENSP00000400387:G96W;ENSP00000388445:G96W	ENSP00000258682:G96W	G	-	1	0	CAMK2B	44260721	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.683000	0.74533	1.572000	0.49736	0.465000	0.42564	GGG	-	CAMK2B	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.552	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	CAMK2B	HGNC	protein_coding	OTTHUMT00000251138.2	0	0	0	47	47	60	0.00	0.00	C	NM_172084		44294196	-1	13	14	52	72	tier1	no_errors	ENST00000395749	ensembl	human	known	74_37	missense	20.00	16.28	SNP	1.000	A	13	52
HDC	3067	genome.wustl.edu	37	15	50534992	50534992	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr15:50534992G>A	ENST00000267845.3	-	12	1856	c.1454C>T	c.(1453-1455)cCt>cTt	p.P485L	RN7SL494P_ENST00000461517.2_RNA|HDC_ENST00000543581.1_Missense_Mutation_p.P452L	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		CCCAACCCGAGGGCTGGGTTG	0.562													ENSG00000140287																									GBM(95;1627 1936 6910 9570)												0													43.0	47.0	46.0					15																	50534992		2196	4295	6491	SO:0001583	missense	0			-		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1454C>T	15.37:g.50534992G>A	ENSP00000267845:p.Pro485Leu			Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.P485L	ENST00000267845.3	37	c.1454	CCDS10134.1	15	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955555	0.34471	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.09538	3.08;2.97	5.95	5.02	0.67125	.	0.377447	0.26867	N	0.022081	T	0.10680	0.0261	L	0.34521	1.04	0.46749	D	0.999181	B;P	0.38922	0.329;0.651	B;B	0.36030	0.077;0.216	T	0.04635	-1.0937	10	0.66056	D	0.02	-10.1816	15.4985	0.75677	0.0:0.1378:0.8622:0.0	.	452;485	B7ZM01;P19113	.;DCHS_HUMAN	L	485;452	ENSP00000267845:P485L;ENSP00000440252:P452L	ENSP00000267845:P485L	P	-	2	0	HDC	48322284	0.986000	0.35501	0.953000	0.39169	0.405000	0.30901	5.856000	0.69518	1.504000	0.48704	0.563000	0.77884	CCT	-	HDC	-	NULL		0.562	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	HGNC	protein_coding	OTTHUMT00000254540.1	0	0	0	42	42	90	0.00	0.00	G			50534992	-1	12	26	14	27	tier1	no_errors	ENST00000267845	ensembl	human	known	74_37	missense	46.15	49.06	SNP	0.924	A	12	14
LOC285556	285556	genome.wustl.edu	37	4	100575157	100575157	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr4:100575157G>T	ENST00000511828.1	-	1	648	c.649C>A	c.(649-651)Cac>Aac	p.H217N																								CCAGGGCAGTGCCCCAGGGTA	0.582													ENSG00000248713																																					0																																										SO:0001583	missense	0			-																												ENST00000511828.1:c.649C>A	4.37:g.100575157G>T	ENSP00000427555:p.His217Asn			Missense_Mutation	SNP	NULL	p.H217N	ENST00000511828.1	37	c.649		4	.	.	.	.	.	.	.	.	.	.	G	1.261	-0.615745	0.03663	.	.	ENSG00000248713	ENST00000511828	D	0.97772	-4.53	3.99	0.407	0.16371	.	.	.	.	.	D	0.89694	0.6789	N	0.08118	0	.	.	.	.	.	.	.	.	.	D	0.84111	0.0401	6	0.09084	T	0.74	.	4.4808	0.11766	0.3926:0.2071:0.4003:0.0	.	.	.	.	N	217	ENSP00000427555:H217N	ENSP00000427555:H217N	H	-	1	0	RP11-766F14.2	100794180	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	0.343000	0.19944	0.028000	0.15324	0.655000	0.94253	CAC	-	RP11-766F14.2	-	NULL		0.582	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	Clone_based_vega_gene	protein_coding	OTTHUMT00000365456.1	0	0	0	39	39	92	0.00	0.00	G			100575157	-1	5	18	19	50	tier1	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	20.83	26.47	SNP	0.000	T	5	19
CD1C	911	genome.wustl.edu	37	1	158261127	158261127	+	Missense_Mutation	SNP	C	C	T	rs145638725		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:158261127C>T	ENST00000368170.3	+	2	544	c.265C>T	c.(265-267)Cgt>Tgt	p.R89C		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	89					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)	p.R89C(1)		NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					GTTGTTATTTCGTTTCTACCT	0.398													ENSG00000158481																																					1	Substitution - Missense(1)	skin(1)											111.0	108.0	109.0					1																	158261127		2203	4300	6503	SO:0001583	missense	0			-	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.265C>T	1.37:g.158261127C>T	ENSP00000357152:p.Arg89Cys		Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R89C	ENST00000368170.3	37	c.265	CCDS1175.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.579|8.579	0.881755|0.881755	0.17467|0.17467	.|.	.|.	ENSG00000158481|ENSG00000158481	ENST00000368169;ENST00000368170|ENST00000443761	T|.	0.08102|.	3.13|.	3.52|3.52	-3.21|-3.21	0.05140|0.05140	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	0.543957|.	0.14309|.	N|.	0.327809|.	T|T	0.32823|0.32823	0.0842|0.0842	M|M	0.72894|0.72894	2.215|2.215	0.09310|0.09310	N|N	1|1	B|.	0.33841|.	0.428|.	B|.	0.18561|.	0.022|.	T|T	0.47623|0.47623	-0.9103|-0.9103	10|5	0.87932|.	D|.	0|.	.|.	9.3198|9.3198	0.37957|0.37957	0.0:0.2985:0.0:0.7015|0.0:0.2985:0.0:0.7015	.|.	89|.	P29017|.	CD1C_HUMAN|.	C|L	89|23	ENSP00000357152:R89C|.	ENSP00000357151:R89C|.	R|S	+|+	1|2	0|0	CD1C|CD1C	156527751|156527751	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.106000|-0.106000	0.10890|0.10890	-0.744000|-0.744000	0.04778|0.04778	-0.781000|-0.781000	0.03364|0.03364	CGT|TCG	rs145638725	CD1C	-	superfamily_MHC_I/II-like_Ag-recog		0.398	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1C	HGNC	protein_coding	OTTHUMT00000046351.2	0	0	0	62	62	129	0.00	0.00	C	NM_001765		158261127	+1	25	45	14	31	tier1	no_errors	ENST00000368170	ensembl	human	known	74_37	missense	64.10	58.44	SNP	0.000	T	25	14
WNK3	65267	genome.wustl.edu	37	X	54263641	54263641	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrX:54263641G>A	ENST00000375159.2	-	19	4357	c.4358C>T	c.(4357-4359)tCt>tTt	p.S1453F	WNK3_ENST00000375169.3_Missense_Mutation_p.S1406F|WNK3_ENST00000354646.2_Missense_Mutation_p.S1453F			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1453					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CAACAGTTCAGATCCAGACTG	0.448													ENSG00000196632																																					0													82.0	70.0	74.0					X																	54263641		2203	4300	6503	SO:0001583	missense	0			-	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4358C>T	X.37:g.54263641G>A	ENSP00000364301:p.Ser1453Phe		B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S1453F	ENST00000375159.2	37	c.4358	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	G	2.266	-0.368026	0.05069	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.71461	-0.56;-0.57;-0.57	5.1	2.22	0.28083	.	0.760567	0.11758	N	0.532360	T	0.55561	0.1928	L	0.27053	0.805	0.09310	N	1	P;P	0.38440	0.631;0.498	B;B	0.39904	0.313;0.166	T	0.46386	-0.9195	10	0.48119	T	0.1	-1.5407	4.5674	0.12193	0.268:0.0:0.5752:0.1567	.	1406;1453	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	F	1406;1453;1453	ENSP00000364312:S1406F;ENSP00000346667:S1453F;ENSP00000364301:S1453F	ENSP00000346667:S1453F	S	-	2	0	WNK3	54280366	0.004000	0.15560	0.003000	0.11579	0.003000	0.03518	0.988000	0.29616	0.406000	0.25560	-0.176000	0.13171	TCT	-	WNK3	-	NULL		0.448	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	0	0	0	61	61	77	0.00	0.00	G	NM_020922		54263641	-1	37	39	36	36	tier1	no_errors	ENST00000354646	ensembl	human	known	74_37	missense	50.68	51.32	SNP	0.000	A	37	36
FABP1	2168	genome.wustl.edu	37	2	88427556	88427556	+	5'UTR	SNP	C	C	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr2:88427556C>G	ENST00000295834.3	-	0	79				FABP1_ENST00000393750.3_5'UTR|FABP1_ENST00000495375.1_5'UTR	NM_001443.2	NP_001434.1	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver						cellular lipid metabolic process (GO:0044255)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|intestinal absorption (GO:0050892)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)	apical cortex (GO:0045179)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|peroxisomal matrix (GO:0005782)	antioxidant activity (GO:0016209)|bile acid binding (GO:0032052)|chromatin binding (GO:0003682)|drug binding (GO:0008144)|fatty acid binding (GO:0005504)|long-chain fatty acid transporter activity (GO:0005324)|phospholipid binding (GO:0005543)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|stomach(1)	6						AGAGCTCCCTCTTCACGACTG	0.552													ENSG00000163586																																					0													120.0	105.0	110.0					2																	88427556		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			-	M10617	CCDS2001.1	2p11	2013-03-01			ENSG00000163586	ENSG00000163586		"""Fatty acid binding protein family"""	3555	protein-coding gene	gene with protein product		134650				3012800, 17698986	Standard	NM_001443		Approved	L-FABP	uc002sst.2	P07148	OTTHUMG00000130312	ENST00000295834.3:c.-20G>C	2.37:g.88427556C>G				R	SNP	-	NULL	ENST00000295834.3	37	NULL	CCDS2001.1	2																																																																																			-	FABP1	-	-		0.552	FABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP1	HGNC	protein_coding	OTTHUMT00000252660.1	0	0	0	43	43	69	0.00	0.00	C	NM_001443		88427556	-1	13	14	32	38	tier1	no_errors	ENST00000495375	ensembl	human	known	74_37	rna	28.89	26.92	SNP	0.000	G	13	32
CTB-52I2.4	0	genome.wustl.edu	37	19	18142570	18142570	+	RNA	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:18142570G>T	ENST00000594957.3	+	0	1331																											TAAGTTGGTTGCTCAGCTATG	0.493													ENSG00000268032																																					0																																												0			-																													19.37:g.18142570G>T				R	SNP	-	NULL	ENST00000594957.3	37	NULL		19																																																																																			-	CTB-52I2.4	-	-		0.493	CTB-52I2.4-002	KNOWN	basic	processed_transcript	ENSG00000268032	Clone_based_vega_gene	pseudogene	OTTHUMT00000466852.4	0	0	0	36	36	107	0.00	0.00	G			18142570	+1	13	31	55	136	tier1	no_errors	ENST00000594957	ensembl	human	known	74_37	rna	19.12	18.56	SNP	1.000	T	13	55
ASPHD2	57168	genome.wustl.edu	37	22	26839163	26839163	+	Silent	SNP	G	G	T	rs377666159		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr22:26839163G>T	ENST00000215906.5	+	4	1539	c.1101G>T	c.(1099-1101)ccG>ccT	p.P367P	HPS4_ENST00000493455.2_5'Flank	NM_020437.4	NP_065170.2	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	367					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.P341P(1)		endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	16						TCTTTGCTCCGGGACGATGAG	0.597													ENSG00000128203																																					1	Substitution - coding silent(1)	large_intestine(1)											97.0	101.0	100.0					22																	26839163		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK097157	CCDS13834.2	22q12.1	2006-02-02			ENSG00000128203	ENSG00000128203			30437	protein-coding gene	gene with protein product							Standard	NM_020437		Approved	FLJ39838	uc003acg.2	Q6ICH7	OTTHUMG00000150884	ENST00000215906.5:c.1101G>T	22.37:g.26839163G>T			B2RCH3|Q7L0W3|Q9NSN3	Silent	SNP	pfam_Asp_Arg_b-Hydrxlase	p.P367	ENST00000215906.5	37	c.1101	CCDS13834.2	22																																																																																			-	ASPHD2	-	NULL		0.597	ASPHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPHD2	HGNC	protein_coding	OTTHUMT00000320422.1	0	0	0	36	36	105	0.00	0.00	G	NM_020437		26839163	+1	5	11	30	65	tier1	no_errors	ENST00000215906	ensembl	human	known	74_37	silent	14.29	14.47	SNP	0.006	T	5	30
HNRNPM	4670	genome.wustl.edu	37	19	8553897	8553897	+	3'UTR	SNP	G	G	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:8553897G>C	ENST00000325495.4	+	0	2393				HNRNPM_ENST00000348943.3_3'UTR|HNRNPM_ENST00000602219.1_3'UTR	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GGTTCCATTTGACTGTTTGCA	0.323													ENSG00000099783																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.*159G>C	19.37:g.8553897G>C			Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	R	SNP	-	NULL	ENST00000325495.4	37	NULL	CCDS12203.1	19																																																																																			-	HNRNPM	-	-		0.323	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPM	HGNC	protein_coding	OTTHUMT00000460894.1	0	0	0	82	82	116	0.00	0.00	G			8553897	+1	15	26	81	118	tier1	no_errors	ENST00000602219	ensembl	human	known	74_37	rna	15.62	17.81	SNP	1.000	C	15	81
FAM186B	84070	genome.wustl.edu	37	12	49993263	49993263	+	Silent	SNP	G	G	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr12:49993263G>C	ENST00000257894.2	-	4	2321	c.2160C>G	c.(2158-2160)ctC>ctG	p.L720L	FAM186B_ENST00000544141.1_Silent_p.L630L|FAM186B_ENST00000551047.1_Intron	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	720						protein complex (GO:0043234)				breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGAGGCTCTGGAGGCGTCTAT	0.592													ENSG00000135436																																					0													49.0	48.0	48.0					12																	49993263		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.2160C>G	12.37:g.49993263G>C			B4DZ15|Q8TCP7|Q9H0L3	Silent	SNP	NULL	p.L720	ENST00000257894.2	37	c.2160	CCDS8788.1	12																																																																																			-	FAM186B	-	NULL		0.592	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM186B	HGNC	protein_coding	OTTHUMT00000394583.2	0	0	0	53	53	107	0.00	0.00	G	NM_032130		49993263	-1	6	19	42	39	tier1	no_errors	ENST00000257894	ensembl	human	known	74_37	silent	12.50	32.76	SNP	0.996	C	6	42
ATRX	546	genome.wustl.edu	37	X	76909587	76909587	+	Splice_Site	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrX:76909587C>T	ENST00000373344.5	-	14	4532		c.e14+1		ATRX_ENST00000395603.3_Splice_Site|ATRX_ENST00000480283.1_Splice_Site	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GTCATTATTACCTTGTTTTCA	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											236.0	200.0	212.0					X																	76909587		2203	4295	6498	SO:0001630	splice_region_variant	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4317+1G>A	X.37:g.76909587C>T			D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Splice_Site	SNP	-	e14+1	ENST00000373344.5	37	c.4317+1	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	c	19.63	3.863089	0.71949	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5589	0.56269	0.0:0.9151:0.0:0.0849	.	.	.	.	.	-1	.	.	.	-	.	.	ATRX	76796243	1.000000	0.71417	0.991000	0.47740	0.960000	0.62799	4.803000	0.62546	2.332000	0.79248	0.502000	0.49764	.	-	ATRX	-	-		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	33	33	170	0.00	0.00	C	NM_000489	Intron	76909587	-1	16	69	10	34	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	splice_site	61.54	66.99	SNP	1.000	T	16	10
TENM4	26011	genome.wustl.edu	37	11	78497988	78497988	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr11:78497988T>A	ENST00000278550.7	-	16	2782	c.2320A>T	c.(2320-2322)Aag>Tag	p.K774*		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	774	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CACTCGCACTTGCCGTCGCGG	0.687													ENSG00000149256																																					0													13.0	16.0	15.0					11																	78497988		2050	4166	6216	SO:0001587	stop_gained	0			-	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.2320A>T	11.37:g.78497988T>A	ENSP00000278550:p.Lys774*		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Nonsense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.K774*	ENST00000278550.7	37	c.2320	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	T	46	12.435856	0.99667	.	.	ENSG00000149256	ENST00000278550	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2402	0.73465	0.0:0.0:0.0:1.0	.	.	.	.	X	774	.	.	K	-	1	0	ODZ4	78175636	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.820000	0.86633	2.198000	0.70561	0.533000	0.62120	AAG	-	TENM4	-	pfam_EGF_extracell,smart_EG-like_dom,pfscan_EG-like_dom		0.687	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	0	0	0	78	78	16	0.00	0.00	T			78497988	-1	16	2	51	12	tier1	no_errors	ENST00000278550	ensembl	human	known	74_37	nonsense	23.88	14.29	SNP	1.000	A	16	51
Unknown	0	genome.wustl.edu	37	16	33490022	33490022	+	IGR	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr16:33490022G>T								RP11-23E10.4 (123209 upstream) : BMS1P8 (7140 downstream)																							GCAGTGTGAGGATCTGACAAG	0.507													ENSG00000260518																																					0																																										SO:0001628	intergenic_variant	0			-																													16.37:g.33490022G>T				R	SNP	-	NULL		37	NULL		16																																																																																			-	BMS1P8	-	-	0	0.507					BMS1P8	HGNC			0	0	0	17	17	113	0.00	0.00	G			33490022	-1	5	12	14	84	tier1	no_errors	ENST00000567036	ensembl	human	known	74_37	rna	26.32	12.50	SNP	0.990	T	5	14
ZNF85	7639	genome.wustl.edu	37	19	21131580	21131580	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:21131580G>T	ENST00000328178.8	+	4	373	c.260G>T	c.(259-261)tGg>tTg	p.W87L	ZNF85_ENST00000597314.1_3'UTR|ZNF85_ENST00000601023.1_Missense_Mutation_p.W28L|ZNF85_ENST00000345030.6_Missense_Mutation_p.W54L	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	87					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.W87S(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						CAAGACCTTTGGCCGGAGCAG	0.323													ENSG00000105750																																					1	Substitution - Missense(1)	lung(1)											58.0	58.0	58.0					19																	21131580		2203	4299	6502	SO:0001583	missense	0			-	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.260G>T	19.37:g.21131580G>T	ENSP00000329793:p.Trp87Leu		B9ZVP4|Q6NVI0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.W87L	ENST00000328178.8	37	c.260	CCDS32977.1	19	.	.	.	.	.	.	.	.	.	.	.	3.436	-0.115088	0.06881	.	.	ENSG00000105750	ENST00000328178;ENST00000345030	T;T	0.05139	3.62;3.49	1.04	-2.09	0.07232	.	.	.	.	.	T	0.04497	0.0123	L	0.46670	1.46	0.09310	N	1	P;P;P	0.44521	0.837;0.675;0.788	B;B;B	0.42030	0.373;0.122;0.244	T	0.27365	-1.0076	9	0.07325	T	0.83	.	2.2232	0.03978	0.2323:0.0:0.2604:0.5072	.	54;28;87	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	L	87;54	ENSP00000329793:W87L;ENSP00000342340:W54L	ENSP00000329793:W87L	W	+	2	0	ZNF85	20923420	0.000000	0.05858	0.036000	0.18154	0.035000	0.12851	-2.184000	0.01254	-0.530000	0.06349	-0.538000	0.04264	TGG	-	ZNF85	-	NULL		0.323	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF85	HGNC	protein_coding	OTTHUMT00000463430.1	0	0	0	50	50	40	0.00	0.00	G	NM_003429		21131580	+1	8	7	75	51	tier1	no_errors	ENST00000328178	ensembl	human	known	74_37	missense	9.64	12.07	SNP	0.001	T	8	75
MUC17	140453	genome.wustl.edu	37	7	100679631	100679631	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:100679631G>T	ENST00000306151.4	+	3	4998	c.4934G>T	c.(4933-4935)aGt>aTt	p.S1645I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1645	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCGGTGGCCAGTCCTGAGGCT	0.493													ENSG00000169876																																					0													236.0	246.0	243.0					7																	100679631		2203	4300	6503	SO:0001583	missense	0			-	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4934G>T	7.37:g.100679631G>T	ENSP00000302716:p.Ser1645Ile		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S1645I	ENST00000306151.4	37	c.4934	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	0.583	-0.836417	0.02692	.	.	ENSG00000169876	ENST00000306151	T	0.02369	4.32	0.932	-1.86	0.07760	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	0.09310	N	1	P	0.42993	0.797	B	0.34180	0.177	T	0.49399	-0.8944	9	0.32370	T	0.25	.	6.4998	0.22162	0.0:0.4172:0.5828:0.0	.	1645	Q685J3	MUC17_HUMAN	I	1645	ENSP00000302716:S1645I	ENSP00000302716:S1645I	S	+	2	0	MUC17	100466351	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.769000	0.01792	-0.958000	0.03622	0.134000	0.15878	AGT	-	MUC17	-	NULL		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	0	0	0	81	81	29	0.00	0.00	G	NM_001040105		100679631	+1	21	5	82	28	tier1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	20.39	15.15	SNP	0.000	T	21	82
RGN	9104	genome.wustl.edu	37	X	46952420	46952420	+	3'UTR	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrX:46952420G>T	ENST00000352078.4	+	0	1319				RGN_ENST00000336169.3_3'UTR|RGN_ENST00000397180.1_3'UTR|RGN_ENST00000457380.1_3'UTR	NM_004683.4	NP_004674.1	Q15493	RGN_HUMAN	regucalcin						cellular calcium ion homeostasis (GO:0006874)|L-ascorbic acid biosynthetic process (GO:0019853)|positive regulation of ATPase activity (GO:0032781)|regulation of calcium-mediated signaling (GO:0050848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|enzyme regulator activity (GO:0030234)|gluconolactonase activity (GO:0004341)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	9						TTTCAATCTAGTTAGAAAGAA	0.398													ENSG00000130988																																					0													32.0	27.0	28.0					X																	46952420		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			-	D31815	CCDS14272.1, CCDS75968.1	Xp11.3	2014-03-14	2013-04-26		ENSG00000130988	ENSG00000130988	3.1.1.17		9989	protein-coding gene	gene with protein product	"""senescence marker protein-30"", ""gluconolactonase"""	300212	"""regucalcin (senescence marker protein-30)"""			7548213	Standard	NM_152869		Approved	SMP30, RC	uc004dha.1	Q15493	OTTHUMG00000021435	ENST00000352078.4:c.*74G>T	X.37:g.46952420G>T			A4FTW1|A8K271|Q53FC9|Q5JRR5	R	SNP	-	NULL	ENST00000352078.4	37	NULL	CCDS14272.1	X																																																																																			-	RGN	-	-		0.398	RGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGN	HGNC	protein_coding	OTTHUMT00000056385.1	0	0	0	76	76	134	0.00	0.00	G	NM_004683		46952420	+1	14	30	74	80	tier1	no_errors	ENST00000475448	ensembl	human	known	74_37	rna	15.91	27.27	SNP	0.019	T	14	74
LPAR3	23566	genome.wustl.edu	37	1	85331339	85331339	+	Silent	SNP	G	G	A	rs565409119		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:85331339G>A	ENST00000440886.1	-	1	503	c.465C>T	c.(463-465)atC>atT	p.I155I	LPAR3_ENST00000370611.3_Silent_p.I155I|LPAR3_ENST00000491034.1_Intron			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	155					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						TAAAAATGGCGATGGCCCAGA	0.542													ENSG00000171517																																					0													145.0	151.0	149.0					1																	85331339		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.465C>T	1.37:g.85331339G>A			A0AVA3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_LPA_rcpt_EDG7,prints_GPCR_Rhodpsn,prints_LPA_rcpt,prints_LPA_rcpt_EDG2,prints_Melcrt_ACTH_rcpt	p.I155	ENST00000440886.1	37	c.465	CCDS700.1	1																																																																																			-	LPAR3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.542	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR3	HGNC	protein_coding	OTTHUMT00000027467.1	0	0	1	35	35	121	0.00	0.82	G	NM_012152		85331339	-1	10	23	33	38	tier1	no_errors	ENST00000370611	ensembl	human	known	74_37	silent	23.26	37.70	SNP	0.583	A	10	33
CCDC144CP	348254	genome.wustl.edu	37	17	20239613	20239613	+	RNA	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr17:20239613G>T	ENST00000340196.4	+	0	1037							Q8IYA2	C144C_HUMAN	coiled-coil domain containing 144C, pseudogene																		ATTTTCTTTAGGAAGTAGGAT	0.343													ENSG00000154898																																					0																																												0			-			17p11.2	2013-03-14	2013-03-14	2013-03-14	ENSG00000154898	ENSG00000154898			29073	pseudogene	pseudogene			"""coiled-coil domain containing 144C"""	CCDC144C		11997339	Standard	NR_023380		Approved		uc010cqy.1	Q8IYA2	OTTHUMG00000059513		17.37:g.20239613G>T			B7WNP5	R	SNP	-	NULL	ENST00000340196.4	37	NULL		17																																																																																			-	CCDC144CP	-	-		0.343	CCDC144CP-001	KNOWN	basic	processed_transcript	CCDC144CP	HGNC	pseudogene	OTTHUMT00000132378.2	0	0	0	13	13	31	0.00	0.00	G	NR_023380		20239613	+1	4	6	7	18	tier1	no_errors	ENST00000340196	ensembl	human	known	74_37	rna	36.36	25.00	SNP	0.002	T	4	7
SPEF2	79925	genome.wustl.edu	37	5	35700617	35700617	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:35700617G>A	ENST00000356031.3	+	16	2315	c.2161G>A	c.(2161-2163)Gac>Aac	p.D721N	SPEF2_ENST00000509059.1_Missense_Mutation_p.D716N|SPEF2_ENST00000440995.2_Missense_Mutation_p.D716N|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	721					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGTGAATCAAGACTGTATCCT	0.363													ENSG00000152582																																					0													79.0	72.0	74.0					5																	35700617		1824	4089	5913	SO:0001583	missense	0			-	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2161G>A	5.37:g.35700617G>A	ENSP00000348314:p.Asp721Asn		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.D721N	ENST00000356031.3	37	c.2161	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	G	7.223	0.597830	0.13875	.	.	ENSG00000152582	ENST00000356031;ENST00000509059;ENST00000440995;ENST00000504054	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	5.99	0.607	0.17564	.	0.538685	0.18461	N	0.140539	T	0.54647	0.1871	N	0.16066	0.365	0.47621	D	0.999471	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.28170	-1.0052	10	0.41790	T	0.15	.	10.1389	0.42723	0.1814:0.1089:0.7096:0.0	.	716;716;721	D6REZ4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	N	721;716;716;227	ENSP00000348314:D721N;ENSP00000421593:D716N;ENSP00000412125:D716N;ENSP00000421744:D227N	ENSP00000348314:D721N	D	+	1	0	SPEF2	35736374	1.000000	0.71417	0.517000	0.27799	0.018000	0.09664	1.238000	0.32707	-0.451000	0.07097	-0.795000	0.03280	GAC	-	SPEF2	-	pfam_Adenylate_kin,superfamily_P-loop_NTPase		0.363	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	0	0	0	25	25	108	0.00	0.00	G	NM_144722		35700617	+1	11	23	26	65	tier1	no_errors	ENST00000356031	ensembl	human	known	74_37	missense	29.73	26.14	SNP	0.819	A	11	26
SCN9A	6335	genome.wustl.edu	37	2	167085227	167085227	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr2:167085227G>T	ENST00000409435.1	-	21	4179	c.4180C>A	c.(4180-4182)Ctt>Att	p.L1394I	SCN9A_ENST00000409672.1_Missense_Mutation_p.L1383I|SCN9A_ENST00000303354.6_Missense_Mutation_p.L1395I|SCN9A_ENST00000375387.4_Missense_Mutation_p.L1395I|AC010127.3_ENST00000447809.2_RNA			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1394					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGGTAACCAAGTCCGACATTA	0.353													ENSG00000169432																																					0													183.0	180.0	181.0					2																	167085227		1868	4119	5987	SO:0001583	missense	0			-	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4180C>A	2.37:g.167085227G>T	ENSP00000386330:p.Leu1394Ile		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.L1395I	ENST00000409435.1	37	c.4183	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	G	9.799	1.179898	0.21787	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98455	-4.94;-4.94;-4.94;-4.94	5.23	3.27	0.37495	.	0.466032	0.20443	N	0.092245	D	0.93497	0.7925	N	0.16602	0.42	0.31333	N	0.684521	B	0.09022	0.002	B	0.16722	0.016	D	0.89420	0.3709	10	0.25751	T	0.34	.	7.7026	0.28632	0.0:0.402:0.3567:0.2413	.	1383	E7EUN6	.	I	1383;1395;1395;1394	ENSP00000386306:L1383I;ENSP00000364536:L1395I;ENSP00000304748:L1395I;ENSP00000386330:L1394I	ENSP00000304748:L1395I	L	-	1	0	SCN9A	166793473	0.051000	0.20477	1.000000	0.80357	0.902000	0.53008	0.954000	0.29175	2.454000	0.82982	0.557000	0.71058	CTT	-	SCN9A	-	pfam_Ion_trans_dom		0.353	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	0	0	0	57	57	158	0.00	0.00	G	NM_002977		167085227	-1	21	34	9	40	tier1	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	70.00	45.95	SNP	0.994	T	21	9
ADAM22	53616	genome.wustl.edu	37	7	87774475	87774475	+	Silent	SNP	T	T	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:87774475T>A	ENST00000265727.7	+	16	1435	c.1356T>A	c.(1354-1356)atT>atA	p.I452I	ADAM22_ENST00000398201.4_Silent_p.I452I|ADAM22_ENST00000398204.4_Silent_p.I452I|ADAM22_ENST00000315984.7_Silent_p.I452I|ADAM22_ENST00000398209.3_Silent_p.I452I			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	452	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			ATGGCTTCATTGAAACTGGAG	0.423													ENSG00000008277																																					0													136.0	129.0	131.0					7																	87774475		1855	4095	5950	SO:0001819	synonymous_variant	0			-	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1356T>A	7.37:g.87774475T>A			O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.I452	ENST00000265727.7	37	c.1356	CCDS47637.1	7																																																																																			-	ADAM22	-	pfscan_Blood-coag_inhib_Disintegrin		0.423	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM22	HGNC	protein_coding	OTTHUMT00000268370.2	0	0	0	69	69	97	0.00	0.00	T	NM_021723		87774475	+1	18	20	83	72	tier1	no_errors	ENST00000265727	ensembl	human	known	74_37	silent	17.82	21.74	SNP	1.000	A	18	83
DCC	1630	genome.wustl.edu	37	18	50985690	50985690	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr18:50985690G>A	ENST00000442544.2	+	24	4097	c.3481G>A	c.(3481-3483)Gag>Aag	p.E1161K	DCC_ENST00000581580.1_Missense_Mutation_p.E796K	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1161					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGAAGAAATGGAGATGAAAAA	0.522													ENSG00000187323																																					0													95.0	97.0	96.0					18																	50985690		2203	4300	6503	SO:0001583	missense	0			-	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3481G>A	18.37:g.50985690G>A	ENSP00000389140:p.Glu1161Lys			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E1161K	ENST00000442544.2	37	c.3481	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284158	0.59867	.	.	ENSG00000187323	ENST00000442544	T	0.68025	-0.3	5.93	5.93	0.95920	Neogenin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81669	0.4871	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81936	-0.0705	10	0.72032	D	0.01	-10.6014	19.1254	0.93380	0.0:0.0:1.0:0.0	.	1161	P43146	DCC_HUMAN	K	1161	ENSP00000389140:E1161K	ENSP00000389140:E1161K	E	+	1	0	DCC	49239688	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.322000	0.96357	2.826000	0.97356	0.655000	0.94253	GAG	-	DCC	-	pfam_Neogenin_C		0.522	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	0	0	0	40	40	108	0.00	0.00	G	NM_005215		50985690	+1	9	31	27	47	tier1	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	25.00	39.74	SNP	1.000	A	9	27
GMFG	9535	genome.wustl.edu	37	19	39819656	39819656	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:39819656G>C	ENST00000597595.1	-	6	549	c.341C>G	c.(340-342)aCa>aGa	p.T114R	GMFG_ENST00000594700.1_Intron|GMFG_ENST00000602185.1_Missense_Mutation_p.T65R|GMFG_ENST00000595636.1_3'UTR|GMFG_ENST00000253054.8_Missense_Mutation_p.T81R|GMFG_ENST00000598034.1_Missense_Mutation_p.T114R|GMFG_ENST00000601387.1_Missense_Mutation_p.T73R|GMFG_ENST00000600322.1_Missense_Mutation_p.T81R	NM_004877.2	NP_004868.1	O60234	GMFG_HUMAN	glia maturation factor, gamma	114	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				negative regulation of protein kinase activity (GO:0006469)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)	intracellular (GO:0005622)	enzyme activator activity (GO:0008047)|protein kinase inhibitor activity (GO:0004860)			breast(1)|large_intestine(2)|liver(2)|lung(3)|skin(1)|stomach(1)	10	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.15e-27)|all cancers(26;1.3e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GAGCTCTGCTGTCTGCACCAG	0.562													ENSG00000130755																																					0													191.0	159.0	170.0					19																	39819656		2203	4300	6503	SO:0001583	missense	0			-	AB001993	CCDS12532.1, CCDS74364.1	19q13.2	2014-08-12			ENSG00000130755	ENSG00000130755			4374	protein-coding gene	gene with protein product		604104				9545571, 9653160, 17127212	Standard	XM_005259440		Approved		uc002okz.4	O60234	OTTHUMG00000182811	ENST00000597595.1:c.341C>G	19.37:g.39819656G>C	ENSP00000472249:p.Thr114Arg		Q6IB37	Missense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin,pirsf_GMF-beta	p.T114R	ENST00000597595.1	37	c.341	CCDS12532.1	19	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194277	0.38806	.	.	ENSG00000130755	ENST00000253054	.	.	.	5.44	4.38	0.52667	Actin-binding, cofilin/tropomyosin type (3);	0.150560	0.43416	D	0.000579	T	0.68833	0.3044	M	0.74546	2.27	0.53688	D	0.999974	P;D	0.69078	0.903;0.997	B;P	0.60173	0.258;0.87	T	0.67027	-0.5774	9	0.19147	T	0.46	-15.0678	12.3569	0.55180	0.0838:0.0:0.9162:0.0	.	114;114	O60234;Q6IB37	GMFG_HUMAN;.	R	114	.	ENSP00000253054:T114R	T	-	2	0	GMFG	44511496	1.000000	0.71417	0.955000	0.39395	0.977000	0.68977	5.536000	0.67180	1.249000	0.43950	0.655000	0.94253	ACA	-	GMFG	-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin,pirsf_GMF-beta		0.562	GMFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMFG	HGNC	protein_coding	OTTHUMT00000463839.1	0	0	0	41	41	112	0.00	0.00	G			39819656	-1	6	14	41	100	tier1	no_errors	ENST00000597595	ensembl	human	known	74_37	missense	12.77	12.28	SNP	0.996	C	6	41
DRD3	1814	genome.wustl.edu	37	3	113850079	113850079	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:113850079C>A	ENST00000460779.1	-	7	1181	c.892G>T	c.(892-894)Gtt>Ttt	p.V298F	DRD3_ENST00000383673.2_Missense_Mutation_p.V298F|DRD3_ENST00000295881.7_Intron|DRD3_ENST00000467632.1_Missense_Mutation_p.V298F	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	298					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	AGTTTTCGAACTTCTAAGCTG	0.532													ENSG00000151577																																					0													183.0	189.0	187.0					3																	113850079		2203	4300	6503	SO:0001583	missense	0			-		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.892G>T	3.37:g.113850079C>A	ENSP00000419402:p.Val298Phe		A1A4V5|Q4VBM8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Dopamine_D3_rcpt,prints_GPCR_Rhodpsn,prints_Dopamine_rcpt	p.V298F	ENST00000460779.1	37	c.892	CCDS2978.1	3	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270257	0.59540	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673	T;T;T	0.73789	-0.78;-0.78;-0.78	5.52	5.52	0.82312	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.74038	0.3664	L	0.52206	1.635	0.47778	D	0.999516	P;P;P	0.44816	0.844;0.844;0.73	P;P;P	0.49597	0.616;0.515;0.616	T	0.68025	-0.5518	10	0.20046	T	0.44	.	12.552	0.56231	0.0:0.924:0.0:0.076	.	298;298;298	A1A4V4;A8K8E4;P35462	.;.;DRD3_HUMAN	F	298	ENSP00000419402:V298F;ENSP00000420662:V298F;ENSP00000373169:V298F	ENSP00000373169:V298F	V	-	1	0	DRD3	115332769	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	4.971000	0.63749	2.866000	0.98385	0.650000	0.86243	GTT	-	DRD3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Dopamine_D3_rcpt		0.532	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD3	HGNC	protein_coding	OTTHUMT00000354699.1	0	0	0	86	86	140	0.00	0.00	C	NM_000796.3		113850079	-1	11	21	34	69	tier1	no_errors	ENST00000383673	ensembl	human	known	74_37	missense	24.44	23.33	SNP	1.000	A	11	34
ACRBP	84519	genome.wustl.edu	37	12	6753720	6753720	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr12:6753720A>C	ENST00000229243.2	-	5	620	c.527T>G	c.(526-528)gTg>gGg	p.V176G	ACRBP_ENST00000414226.2_Intron|ACRBP_ENST00000536350.1_Missense_Mutation_p.V176G|ACRBP_ENST00000542357.1_5'Flank	NM_032489.2	NP_115878.2			acrosin binding protein											NS(1)|breast(1)|central_nervous_system(1)|large_intestine(8)|lung(5)|ovary(1)	17						GAGCTCTTCCACGTTGTTGCT	0.587													ENSG00000111644																																					0													80.0	75.0	77.0					12																	6753720		2203	4300	6503	SO:0001583	missense	0			-	AB051833	CCDS8554.1	12p13.31	2009-03-12			ENSG00000111644	ENSG00000111644			17195	protein-coding gene	gene with protein product	"""proacrosin binding protein sp32"", ""cancer/testis antigen 23"""	608352				11248070	Standard	NM_032489		Approved	SP32, OY-TES-1, CT23	uc001qpu.1	Q8NEB7	OTTHUMG00000168715	ENST00000229243.2:c.527T>G	12.37:g.6753720A>C	ENSP00000229243:p.Val176Gly			Missense_Mutation	SNP	pfam_Proacrosin-bd	p.V176G	ENST00000229243.2	37	c.527	CCDS8554.1	12	.	.	.	.	.	.	.	.	.	.	A	18.59	3.657722	0.67586	.	.	ENSG00000111644	ENST00000229243;ENST00000536350	T	0.57436	0.4	4.64	4.64	0.57946	.	0.127261	0.35067	N	0.003465	T	0.56834	0.2012	L	0.60455	1.87	0.58432	D	0.999999	P	0.41131	0.739	P	0.48114	0.567	T	0.61633	-0.7023	10	0.87932	D	0	0.3069	10.3671	0.44030	1.0:0.0:0.0:0.0	.	176	Q8NEB7	ACRBP_HUMAN	G	176	ENSP00000229243:V176G	ENSP00000229243:V176G	V	-	2	0	ACRBP	6623981	0.996000	0.38824	0.992000	0.48379	0.925000	0.55904	4.300000	0.59079	1.945000	0.56424	0.459000	0.35465	GTG	-	ACRBP	-	pfam_Proacrosin-bd		0.587	ACRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACRBP	HGNC	protein_coding	OTTHUMT00000400703.1	0	0	0	55	55	54	0.00	0.00	A	NM_032489		6753720	-1	29	34	11	18	tier1	no_errors	ENST00000229243	ensembl	human	known	74_37	missense	72.50	65.38	SNP	0.979	C	29	11
SPHKAP	80309	genome.wustl.edu	37	2	228883837	228883837	+	Missense_Mutation	SNP	T	T	C	rs370073181		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr2:228883837T>C	ENST00000392056.3	-	7	1779	c.1733A>G	c.(1732-1734)gAg>gGg	p.E578G	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E578G	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	578						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.E578V(1)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GCATGTCACCTCTTCTCTTTC	0.552													ENSG00000153820																																					1	Substitution - Missense(1)	breast(1)						T	GLY/GLU,GLY/GLU	0,4406		0,0,2203	78.0	72.0	74.0		1733,1733	4.7	0.9	2		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SPHKAP	NM_030623.3,NM_001142644.1	98,98	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign	578/1672,578/1701	228883837	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1733A>G	2.37:g.228883837T>C	ENSP00000375909:p.Glu578Gly		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.E578G	ENST00000392056.3	37	c.1733	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	T	15.49	2.848937	0.51164	0.0	1.16E-4	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.52295	0.67;0.67	5.84	4.68	0.58851	.	0.211367	0.48767	D	0.000165	T	0.48607	0.1509	M	0.73598	2.24	0.39967	D	0.974741	B;P	0.38473	0.058;0.633	B;B	0.37198	0.028;0.243	T	0.55477	-0.8135	10	0.87932	D	0	.	11.2548	0.49048	0.0:0.0713:0.0:0.9287	.	578;578	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	G	578	ENSP00000375909:E578G;ENSP00000339886:E578G	ENSP00000339886:E578G	E	-	2	0	SPHKAP	228592081	0.983000	0.35010	0.921000	0.36526	0.868000	0.49771	2.213000	0.42844	1.027000	0.39758	0.533000	0.62120	GAG	-	SPHKAP	-	NULL		0.552	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	0	0	0	27	27	61	0.00	0.00	T	NM_030623		228883837	-1	7	8	16	28	tier1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	30.43	22.22	SNP	0.995	C	7	16
OR1L1	26737	genome.wustl.edu	37	9	125424787	125424787	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr9:125424787A>T	ENST00000373686.1	+	1	943	c.943A>T	c.(943-945)Aac>Tac	p.N315Y	OR1L1_ENST00000309623.1_Missense_Mutation_p.N265Y			Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L, member 1	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)	17						GCCCCTGTCCAACTATACTGT	0.408													ENSG00000173679																																					0													150.0	148.0	149.0					9																	125424787		2203	4300	6503	SO:0001583	missense	0			-		CCDS35127.1, CCDS35127.2	9q33.2	2013-09-20			ENSG00000173679	ENSG00000173679		"""GPCR / Class A : Olfactory receptors"""	8213	protein-coding gene	gene with protein product				OR1L2			Standard	NM_001005236		Approved	OR9-C	uc022bmz.1	Q8NH94	OTTHUMG00000020618	ENST00000373686.1:c.943A>T	9.37:g.125424787A>T	ENSP00000362790:p.Asn315Tyr		Q5T7Z3|Q6IFN2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N315Y	ENST00000373686.1	37	c.943		9	.	.	.	.	.	.	.	.	.	.	A	14.56	2.572860	0.45798	.	.	ENSG00000173679	ENST00000373686;ENST00000309623	T;T	0.00123	8.7;8.7	3.26	3.26	0.37387	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00178	0.0005	N	0.21097	0.63	0.09310	N	1	D	0.55385	0.971	P	0.56163	0.793	T	0.59150	-0.7508	9	0.54805	T	0.06	.	7.3013	0.26422	0.8029:0.0:0.0:0.1971	.	315	Q8NH94	OR1L1_HUMAN	Y	315;265	ENSP00000362790:N315Y;ENSP00000310773:N265Y	ENSP00000310773:N265Y	N	+	1	0	OR1L1	124464608	0.028000	0.19301	0.003000	0.11579	0.335000	0.28730	2.870000	0.48451	1.470000	0.48102	0.260000	0.18958	AAC	-	OR1L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.408	OR1L1-201	KNOWN	basic	protein_coding	OR1L1	HGNC	protein_coding		0	0	0	34	34	119	0.00	0.00	A			125424787	+1	17	53	15	34	tier1	no_errors	ENST00000373686	ensembl	human	known	74_37	missense	53.12	60.92	SNP	0.000	T	17	15
CACNA1B	774	genome.wustl.edu	37	9	140852096	140852096	+	Silent	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr9:140852096C>T	ENST00000371372.1	+	10	1435	c.1290C>T	c.(1288-1290)caC>caT	p.H430H	CACNA1B_ENST00000371357.1_Silent_p.H431H|CACNA1B_ENST00000277551.2_Silent_p.H430H|CACNA1B_ENST00000371355.4_Silent_p.H431H|CACNA1B_ENST00000371363.1_Silent_p.H430H|CACNA1B_ENST00000277549.5_5'UTR	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	430					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	ACCTGATCCACGCAGAGGAGG	0.572													ENSG00000148408																																					0													91.0	111.0	104.0					9																	140852096		2129	4252	6381	SO:0001819	synonymous_variant	0			-	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1290C>T	9.37:g.140852096C>T			B1AQK5	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.H431	ENST00000371372.1	37	c.1293	CCDS59522.1	9																																																																																			-	CAC1B	-	NULL		0.572	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CAC1B	HGNC	protein_coding	OTTHUMT00000055380.1	0	0	1	20	20	68	0.00	1.45	C	NM_000718		140852096	+1	16	29	4	17	tier1	no_errors	ENST00000371355	ensembl	human	known	74_37	silent	80.00	63.04	SNP	0.995	T	16	4
ZNF343	79175	genome.wustl.edu	37	20	2473378	2473378	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr20:2473378T>A	ENST00000278772.4	-	5	758	c.271A>T	c.(271-273)Atg>Ttg	p.M91L	RP4-734P14.4_ENST00000461548.1_Missense_Mutation_p.M91L|ZNF343_ENST00000358413.2_Missense_Mutation_p.M91L|ZNF343_ENST00000381253.1_Missense_Mutation_p.M91L	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	91	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						TTCTCCAGCATCACTTCTTTG	0.403													ENSG00000088876																																					0													241.0	222.0	228.0					20																	2473378		2203	4300	6503	SO:0001583	missense	0			-	AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.271A>T	20.37:g.2473378T>A	ENSP00000278772:p.Met91Leu		Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M91L	ENST00000278772.4	37	c.271	CCDS13028.1	20	.	.	.	.	.	.	.	.	.	.	T	24.6	4.554187	0.86231	.	.	ENSG00000088876	ENST00000278772;ENST00000445484;ENST00000381253;ENST00000358413;ENST00000421216	T;T;T;T;T	0.03181	4.02;4.02;4.02;4.02;4.02	3.96	0.234	0.15390	Krueppel-associated box (4);	.	.	.	.	T	0.14960	0.0361	M	0.86343	2.81	0.09310	N	0.999992	P	0.52463	0.953	D	0.68192	0.956	T	0.08330	-1.0727	9	0.48119	T	0.1	.	3.8105	0.08795	0.3291:0.0972:0.0:0.5736	.	91	Q6P1L6	ZN343_HUMAN	L	91	ENSP00000278772:M91L;ENSP00000399682:M91L;ENSP00000370652:M91L;ENSP00000351188:M91L;ENSP00000416488:M91L	ENSP00000443337:M91L	M	-	1	0	ZNF343	2421378	0.701000	0.27806	0.013000	0.15412	0.989000	0.77384	0.734000	0.26101	-0.071000	0.12886	0.477000	0.44152	ATG	-	ZNF343	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.403	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF343	HGNC	protein_coding	OTTHUMT00000077617.1	0	0	0	49	49	105	0.00	0.00	T	NM_024325		2473378	-1	14	27	34	54	tier1	no_errors	ENST00000278772	ensembl	human	known	74_37	missense	29.17	32.93	SNP	0.468	A	14	34
SNRPE	6635	genome.wustl.edu	37	1	203830841	203830841	+	Splice_Site	SNP	C	C	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:203830841C>G	ENST00000414487.2	+	1	99	c.54C>G	c.(52-54)atC>atG	p.I18M	SNRPE_ENST00000367208.1_5'Flank|SNRPE_ENST00000483099.1_3'UTR	NM_003094.2	NP_003085.1	P62304	RUXE_HUMAN	small nuclear ribonucleoprotein polypeptide E	18					gene expression (GO:0010467)|hair cycle (GO:0042633)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	RNA binding (GO:0003723)			breast(1)|large_intestine(2)|lung(1)|skin(1)	5	all_cancers(21;0.103)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGCAGCCCATCGTATCCTACG	0.582													ENSG00000182004																									Ovarian(83;324 1318 17952 32395 39614)												0													124.0	99.0	108.0					1																	203830841		2203	4300	6503	SO:0001630	splice_region_variant	0			-	M37716	CCDS30979.1	1q32	2011-10-11			ENSG00000182004	ENSG00000182004			11161	protein-coding gene	gene with protein product		128260				1835977, 2143747	Standard	NM_003094		Approved	Sm-E	uc001hai.3	P62304	OTTHUMG00000035985	ENST00000414487.2:c.54+1C>G	1.37:g.203830841C>G			B2R5B9|P08578|Q15498|Q5BKT2	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.I18M	ENST00000414487.2	37	c.54	CCDS30979.1	1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627336	0.87560	.	.	ENSG00000182004	ENST00000414487	.	.	.	5.6	4.69	0.59074	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.76744	0.4030	.	.	.	0.80722	D	1	D	0.53462	0.96	P	0.60949	0.881	T	0.80353	-0.1418	8	0.87932	D	0	.	14.117	0.65161	0.0:0.9269:0.0:0.0731	.	18	P62304	RUXE_HUMAN	M	18	.	ENSP00000400591:I18M	I	+	3	3	SNRPE	202097464	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.396000	0.44468	1.358000	0.45922	0.609000	0.83330	ATC	-	SNRPE	-	superfamily_LSM_dom		0.582	SNRPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPE	HGNC	protein_coding	OTTHUMT00000087703.1	0	0	0	46	46	116	0.00	0.00	C	NM_003094	Missense_Mutation	203830841	+1	30	41	9	18	tier1	no_errors	ENST00000414487	ensembl	human	known	74_37	missense	76.92	69.49	SNP	1.000	G	30	9
PIK3CB	5291	genome.wustl.edu	37	3	138478102	138478102	+	Silent	SNP	G	G	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:138478102G>C	ENST00000477593.1	-	2	157	c.84C>G	c.(82-84)ggC>ggG	p.G28G	PIK3CB_ENST00000289153.2_Silent_p.G28G			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	28	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	CAGGTATGGAGCCATCAGATG	0.468													ENSG00000051382																																					0													86.0	82.0	83.0					3																	138478102		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.84C>G	3.37:g.138478102G>C			D3DNF0|Q24JU2	Silent	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,superfamily_ARM-type_fold,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G28	ENST00000477593.1	37	c.84	CCDS3104.1	3																																																																																			-	PIK3CB	-	NULL		0.468	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CB	HGNC	protein_coding	OTTHUMT00000358019.1	0	0	0	40	40	122	0.00	0.00	G			138478102	-1	13	15	16	74	tier1	no_errors	ENST00000289153	ensembl	human	known	74_37	silent	44.83	16.85	SNP	1.000	C	13	16
PHKA1	5255	genome.wustl.edu	37	X	71800880	71800880	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrX:71800880A>C	ENST00000373542.4	-	32	3803	c.3644T>G	c.(3643-3645)cTg>cGg	p.L1215R	PHKA1_ENST00000373545.3_Missense_Mutation_p.L1173R|PHKA1_ENST00000339490.3_Missense_Mutation_p.L1202R|PHKA1_ENST00000541944.1_Missense_Mutation_p.L1143R|PHKA1_ENST00000373539.3_Missense_Mutation_p.L1232R	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	1215					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GCTGTGGGGCAGGAACTCCTG	0.562													ENSG00000067177																																					0													75.0	57.0	63.0					X																	71800880		2203	4300	6503	SO:0001583	missense	0			-		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.3644T>G	X.37:g.71800880A>C	ENSP00000362643:p.Leu1215Arg		B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.L1232R	ENST00000373542.4	37	c.3695	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	A	22.9	4.355570	0.82243	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000001	D	0.97087	0.9048	M	0.84683	2.71	0.58432	D	0.999997	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.986;0.991;0.996	D	0.97468	1.0039	10	0.87932	D	0	-5.0252	11.5812	0.50891	1.0:0.0:0.0:0.0	.	1143;1173;1202;1215	B7ZL07;A6NIT2;P46020-2;P46020	.;.;.;KPB1_HUMAN	R	1173;1215;1143;1202;1232	ENSP00000362646:L1173R;ENSP00000362643:L1215R;ENSP00000441251:L1143R;ENSP00000342469:L1202R;ENSP00000362640:L1232R	ENSP00000342469:L1202R	L	-	2	0	PHKA1	71717605	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.855000	0.92236	1.634000	0.50500	0.437000	0.28790	CTG	-	PHKA1	-	NULL		0.562	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	0	0	0	124	124	97	0.00	0.00	A			71800880	-1	17	13	112	85	tier1	no_errors	ENST00000373539	ensembl	human	known	74_37	missense	13.18	13.27	SNP	1.000	C	17	112
NME9	347736	genome.wustl.edu	37	3	138037031	138037031	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:138037031T>A	ENST00000333911.3	-	4	253	c.226A>T	c.(226-228)Aag>Tag	p.K76*	NME9_ENST00000383180.2_Nonsense_Mutation_p.K54*|NME9_ENST00000536478.1_Nonsense_Mutation_p.K54*|NME9_ENST00000484930.1_Intron|NME9_ENST00000341790.5_Intron|NME9_ENST00000317876.4_Nonsense_Mutation_p.K54*			Q86XW9	TXND6_HUMAN	NME/NM23 family member 9	76	Thioredoxin.				cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										CCTCTGTACTTTTCGAGGACA	0.448													ENSG00000181322																																					0													130.0	114.0	119.0					3																	138037031		2203	4300	6503	SO:0001587	stop_gained	0			-	AF196568	CCDS3099.1	3q22.3	2012-05-18	2012-05-18	2011-08-24	ENSG00000181322	ENSG00000181322			21343	protein-coding gene	gene with protein product			"""thioredoxin domain containing 6"", ""NME gene family member 9"", ""NME family member 9"""	TXNDC6		12569107, 19852809	Standard	NM_178130		Approved	TXL-2, NM23-H9	uc003ese.1	Q86XW9	OTTHUMG00000159823	ENST00000333911.3:c.226A>T	3.37:g.138037031T>A	ENSP00000335444:p.Lys76*		Q7Z4A8|Q8N1V7	Nonsense_Mutation	SNP	pfam_Nucleoside_diP_kinase,pfam_Thioredoxin_domain,superfamily_Nucleoside_diP_kinase,superfamily_Thioredoxin-like_fold,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	p.K76*	ENST00000333911.3	37	c.226		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	33|33	5.200029|5.200029	0.94997|0.94997	.|.	.|.	ENSG00000181322|ENSG00000181322	ENST00000474690|ENST00000383180;ENST00000317876;ENST00000536478;ENST00000333911;ENST00000475751	.|.	.|.	.|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	0.304579|0.304579	0.34676|0.34676	N|N	0.003768|0.003768	T|.	0.33000|.	0.0848|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35724|.	-0.9777|.	4|.	.|0.02654	.|T	.|1	-19.3939|-19.3939	12.6045|12.6045	0.56514|0.56514	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	I|X	45|54;54;54;76;76	.|.	.|ENSP00000321929:K54X	K|K	-|-	2|1	0|0	TXNDC6|TXNDC6	139519721|139519721	1.000000|1.000000	0.71417|0.71417	0.957000|0.957000	0.39632|0.39632	0.654000|0.654000	0.38779|0.38779	2.277000|2.277000	0.43417|0.43417	1.865000|1.865000	0.54081|0.54081	0.402000|0.402000	0.26972|0.26972	AAA|AAG	-	NME9	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold		0.448	NME9-003	KNOWN	basic|appris_principal	protein_coding	NME9	HGNC	protein_coding	OTTHUMT00000357583.1	0	0	0	39	39	121	0.00	0.00	T	NM_178130		138037031	-1	5	26	30	76	tier1	no_errors	ENST00000333911	ensembl	human	known	74_37	nonsense	14.29	25.49	SNP	0.992	A	5	30
PCDHAC2	56134	genome.wustl.edu	37	5	140348132	140348132	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:140348132T>G	ENST00000289269.5	+	1	2313	c.1781T>G	c.(1780-1782)gTg>gGg	p.V594G	PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	594	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGAGATGGTGCCTCGAACT	0.517													ENSG00000243232																									Melanoma(190;638 2083 3390 11909 52360)												0													101.0	87.0	92.0					5																	140348132		2203	4300	6503	SO:0001583	missense	0			-	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1781T>G	5.37:g.140348132T>G	ENSP00000289269:p.Val594Gly		Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V594G	ENST00000289269.5	37	c.1781	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	T	17.72	3.460327	0.63401	.	.	ENSG00000243232	ENST00000289269	T	0.64618	-0.11	5.87	5.87	0.94306	Cadherin (2);Cadherin-like (1);	0.000000	0.38005	N	0.001852	D	0.84183	0.5416	H	0.95004	3.61	0.80722	D	1	D;D	0.67145	0.991;0.996	D;P	0.65684	0.937;0.906	D	0.88767	0.3261	10	0.87932	D	0	.	16.2806	0.82678	0.0:0.0:0.0:1.0	.	594;594	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	G	594	ENSP00000289269:V594G	ENSP00000289269:V594G	V	+	2	0	PCDHAC2	140328316	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.248000	0.74166	0.533000	0.62120	GTG	-	PCDHAC2	-	superfamily_Cadherin-like,pfscan_Cadherin		0.517	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	0	0	0	24	24	140	0.00	0.00	T	NM_018899		140348132	+1	6	20	21	116	tier1	no_errors	ENST00000289269	ensembl	human	known	74_37	missense	22.22	14.71	SNP	1.000	G	6	21
DNAJC13	23317	genome.wustl.edu	37	3	132235548	132235548	+	Splice_Site	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:132235548G>A	ENST00000260818.6	+	48	5809	c.5561G>A	c.(5560-5562)gGt>gAt	p.G1854D		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1854					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TCCTTCATAGGTGCTTTGATC	0.323													ENSG00000138246																																					0													65.0	63.0	64.0					3																	132235548		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.5561-1G>A	3.37:g.132235548G>A			Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.G1854D	ENST00000260818.6	37	c.5561	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.608677	0.87258	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	T	0.55413	0.52	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.059006	0.64402	D	0.000002	T	0.77955	0.4208	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79771	-0.1663	9	.	.	.	.	19.8594	0.96778	0.0:0.0:1.0:0.0	.	1854	O75165	DJC13_HUMAN	D	1854;501	ENSP00000260818:G1854D	.	G	+	2	0	DNAJC13	133718238	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	9.449000	0.97603	2.691000	0.91804	0.650000	0.86243	GGT	-	DJC13	-	superfamily_ARM-type_fold		0.323	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DJC13	HGNC	protein_coding	OTTHUMT00000356807.2	0	0	1	41	41	94	0.00	1.05	G	NM_015268	Missense_Mutation	132235548	+1	3	16	28	50	tier1	no_errors	ENST00000260818	ensembl	human	known	74_37	missense	9.68	24.24	SNP	1.000	A	3	28
PAQR9	344838	genome.wustl.edu	37	3	142681480	142681480	+	Silent	SNP	G	G	A	rs373178792		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:142681480G>A	ENST00000340634.3	-	1	698	c.699C>T	c.(697-699)acC>acT	p.T233T	RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	233						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						TACACCAGTCGGTACGGCTCT	0.652													ENSG00000188582																																					0													61.0	57.0	58.0					3																	142681480		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.699C>T	3.37:g.142681480G>A			Q147T6	Silent	SNP	pfam_HlyIII-related	p.T233	ENST00000340634.3	37	c.699	CCDS3128.1	3																																																																																			-	PAQR9	-	pfam_HlyIII-related		0.652	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR9	HGNC	protein_coding	OTTHUMT00000354538.1	0	0	0	31	31	28	0.00	0.00	G	NM_198504		142681480	-1	11	14	17	22	tier1	no_errors	ENST00000340634	ensembl	human	known	74_37	silent	39.29	38.89	SNP	0.168	A	11	17
PMFBP1	83449	genome.wustl.edu	37	16	72166711	72166711	+	Silent	SNP	C	C	A	rs372420846		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr16:72166711C>A	ENST00000237353.10	-	10	1644	c.1383G>T	c.(1381-1383)ctG>ctT	p.L461L	PMFBP1_ENST00000355636.6_Silent_p.L316L|PMFBP1_ENST00000537465.1_Silent_p.L461L	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	461						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				CCTCAGCCTGCAGGGCCTTGC	0.577													ENSG00000118557																																					0													148.0	119.0	129.0					16																	72166711		2198	4300	6498	SO:0001819	synonymous_variant	0			-	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1383G>T	16.37:g.72166711C>A			B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Silent	SNP	NULL	p.L461	ENST00000237353.10	37	c.1383	CCDS32483.1	16																																																																																			-	PMFBP1	-	NULL		0.577	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PMFBP1	HGNC	protein_coding	OTTHUMT00000396473.2	0	0	0	54	54	65	0.00	0.00	C	NM_031293		72166711	-1	12	9	18	23	tier1	no_errors	ENST00000537465	ensembl	human	known	74_37	silent	40.00	28.12	SNP	0.017	A	12	18
ZNF724P	440519	genome.wustl.edu	37	19	23405795	23405795	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:23405795C>T	ENST00000418100.1	-	4	1369	c.1252G>A	c.(1252-1254)Gga>Aga	p.G418R				A8MTY0	ZN724_HUMAN	zinc finger protein 724, pseudogene	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|lung(2)|ovary(2)	8						GGTTTCTCTCCGGTATGAATT	0.378													ENSG00000196081																																					0																																										SO:0001583	missense	0			-			19p12	2014-02-14	2010-08-03		ENSG00000196081	ENSG00000196081			32460	pseudogene	pseudogene			"""zinc finger protein 724 pseudogene"", ""zinc finger protein 724 (pseudogene)"""				Standard	NR_045525		Approved		uc021uru.1	A8MTY0	OTTHUMG00000183231	ENST00000418100.1:c.1252G>A	19.37:g.23405795C>T	ENSP00000413411:p.Gly418Arg			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G418R	ENST00000418100.1	37	c.1252		19	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008206	0.35415	.	.	ENSG00000196081	ENST00000418100	T	0.01629	4.72	1.09	1.09	0.20402	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02571	0.0078	.	.	.	0.43517	D	0.995786	D	0.76494	0.999	P	0.45037	0.467	T	0.60424	-0.7266	8	0.54805	T	0.06	.	8.9884	0.36008	0.0:1.0:0.0:0.0	.	418	A8MTY0	ZN724_HUMAN	R	418	ENSP00000413411:G418R	ENSP00000413411:G418R	G	-	1	0	ZNF724P	23197635	0.001000	0.12720	0.294000	0.24946	0.284000	0.27059	1.410000	0.34691	0.488000	0.27723	0.491000	0.48974	GGA	-	ZNF724P	-	pfscan_Znf_C2H2		0.378	ZNF724P-001	NOVEL	basic|appris_principal	protein_coding	ZNF724P	HGNC	protein_coding	OTTHUMT00000465743.1	0	0	0	49	49	36	0.00	0.00	C			23405795	-1	11	10	40	35	tier1	no_errors	ENST00000418100	ensembl	human	novel	74_37	missense	21.57	22.22	SNP	1.000	T	11	40
GLTSCR2	29997	genome.wustl.edu	37	19	48248837	48248837	+	Silent	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:48248837C>T	ENST00000246802.5	+	1	59	c.21C>T	c.(19-21)ggC>ggT	p.G7G	GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	7						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		GAGGCAGTGGCGTTGGTGGGA	0.647													ENSG00000105373																									Colon(58;613 1041 9473 10089 15241)												0													92.0	103.0	99.0					19																	48248837		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.21C>T	19.37:g.48248837C>T			Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Silent	SNP	pfam_P60-like,pirsf_Gltscr2	p.G7	ENST00000246802.5	37	c.21	CCDS12705.1	19																																																																																			-	GLTSCR2	-	pirsf_Gltscr2		0.647	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTSCR2	HGNC	protein_coding	OTTHUMT00000464870.1	0	0	0	173	173	30	0.00	0.00	C	NM_015710		48248837	+1	40	11	81	20	tier1	no_errors	ENST00000246802	ensembl	human	known	74_37	silent	32.79	35.48	SNP	0.000	T	40	81
PRKXP1	441733	genome.wustl.edu	37	15	101088251	101088254	+	lincRNA	DEL	AACA	AACA	-			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	AACA	AACA	AACA	-	AACA	AACA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr15:101088251_101088254delAACA	ENST00000602585.1	-	0	2104_2107					NR_073405.1																						TCCATGGTGCAACAAACAGACAAG	0.451													ENSG00000270127																																					0																																												0																																15.37:g.101088255_101088258delAACA				R	DEL	-	NULL	ENST00000602585.1	37	NULL		15																																																																																				RP11-526I2.5	-	-		0.451	RP11-526I2.5-001	KNOWN	basic	lincRNA	PRKXP1	Clone_based_vega_gene	lincRNA	OTTHUMT00000435966.1	0	0	0	23	23	43	0.00	0.00	AACA			101088254	-1	10	18	8	18	tier1	no_errors	ENST00000602585	ensembl	human	known	74_37	rna	55.56	50.00	DEL	0.118:0.119:0.119:0.117	-	10	8
IP6K3	117283	genome.wustl.edu	37	6	33703226	33703226	+	Missense_Mutation	SNP	C	C	T	rs141301327		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr6:33703226C>T	ENST00000293756.4	-	2	354	c.28G>A	c.(28-30)Ggg>Agg	p.G10R	IP6K3_ENST00000451316.1_Missense_Mutation_p.G10R	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	10					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						CTCATGTCCCCGGCGTCTGCG	0.612													ENSG00000161896																																					0								C	ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	52.0	39.0	44.0		28,28	2.2	0.0	6	dbSNP_134	44	0,8600		0,0,4300	no	missense,missense	IP6K3	NM_001142883.1,NM_054111.4	125,125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	10/411,10/411	33703226	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.28G>A	6.37:g.33703226C>T	ENSP00000293756:p.Gly10Arg		Q96MQ9	Missense_Mutation	SNP	pfam_IPK	p.G10R	ENST00000293756.4	37	c.28	CCDS34435.1	6	.	.	.	.	.	.	.	.	.	.	C	17.40	3.381202	0.61845	2.27E-4	0.0	ENSG00000161896	ENST00000451316;ENST00000293756	T;T	0.18016	2.24;2.24	4.99	2.24	0.28232	.	0.758537	0.12042	N	0.504904	T	0.13243	0.0321	L	0.47716	1.5	0.23331	N	0.997892	D	0.89917	1.0	D	0.66979	0.948	T	0.16928	-1.0386	10	0.15499	T	0.54	-16.1663	9.4209	0.38550	0.0:0.7658:0.0:0.2342	.	10	Q96PC2	IP6K3_HUMAN	R	10	ENSP00000398861:G10R;ENSP00000293756:G10R	ENSP00000293756:G10R	G	-	1	0	IP6K3	33811204	0.000000	0.05858	0.003000	0.11579	0.013000	0.08279	-0.406000	0.07187	0.159000	0.19401	-0.339000	0.08088	GGG	rs141301327	IP6K3	-	NULL		0.612	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K3	HGNC	protein_coding	OTTHUMT00000040203.1	0	0	0	44	44	24	0.00	0.00	C	NM_054111		33703226	-1	36	20	16	3	tier1	no_errors	ENST00000293756	ensembl	human	known	74_37	missense	69.23	86.96	SNP	0.440	T	36	16
PRPF31	26121	genome.wustl.edu	37	19	54628083	54628083	+	Intron	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:54628083C>A	ENST00000321030.4	+	8	1204				AC012314.8_ENST00000452097.1_RNA|PRPF31_ENST00000391755.1_Intron|PRPF31_ENST00000419967.1_Intron|PRPF31_ENST00000498612.1_Intron	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31						mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTGGAGCCTTCCGCTGTGCCC	0.672													ENSG00000237017																																					0													26.0	26.0	26.0					19																	54628083		2203	4298	6501	SO:0001627	intron_variant	0			-	AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.855+48C>A	19.37:g.54628083C>A			Q17RB4|Q8N7F9|Q9H271|Q9Y439	R	SNP	-	NULL	ENST00000321030.4	37	NULL	CCDS12879.1	19																																																																																			-	AC012314.8	-	-		0.672	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928780	Clone_based_vega_gene	protein_coding	OTTHUMT00000141417.2	0	0	0	73	73	20	0.00	0.00	C			54628083	-1	15	3	52	9	tier1	no_errors	ENST00000452097	ensembl	human	known	74_37	rna	22.39	25.00	SNP	0.003	A	15	52
MUC4	4585	genome.wustl.edu	37	3	195509808	195509808	+	Silent	SNP	A	A	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:195509808A>G	ENST00000463781.3	-	2	9102	c.8643T>C	c.(8641-8643)ctT>ctC	p.L2881L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.L2881L|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGTGACAGGAAGAGGGGTGG	0.592													ENSG00000145113																																					0													16.0	15.0	15.0					3																	195509808		673	1556	2229	SO:0001819	synonymous_variant	0			-	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8643T>C	3.37:g.195509808A>G			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.L2881	ENST00000463781.3	37	c.8643	CCDS54700.1	3																																																																																			-	MUC4	-	NULL		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	219	219	11	0.00	0.00	A	NM_018406		195509808	-1	58	3	113	9	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	33.92	25.00	SNP	0.086	G	58	113
SYNE1	23345	genome.wustl.edu	37	6	152763261	152763261	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr6:152763261G>T	ENST00000367255.5	-	31	4558	c.3957C>A	c.(3955-3957)agC>agA	p.S1319R	SYNE1_ENST00000413186.2_Missense_Mutation_p.S1319R|SYNE1_ENST00000341594.5_Missense_Mutation_p.S1385R|SYNE1_ENST00000367253.4_Missense_Mutation_p.S1319R|SYNE1_ENST00000448038.1_Missense_Mutation_p.S1326R|SYNE1_ENST00000265368.4_Missense_Mutation_p.S1319R|SYNE1_ENST00000423061.1_Missense_Mutation_p.S1326R|SYNE1_ENST00000367248.3_Missense_Mutation_p.S1309R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1319					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATCCAGTGTGCTCTCCAGCT	0.637										HNSCC(10;0.0054)			ENSG00000131018																																					0													73.0	71.0	72.0					6																	152763261		2203	4300	6503	SO:0001583	missense	0			-	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3957C>A	6.37:g.152763261G>T	ENSP00000356224:p.Ser1319Arg		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S1319R	ENST00000367255.5	37	c.3957	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400882	0.25291	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.87966	0.66;0.66;0.56;0.66;0.75;-2.25;-2.32;-2.32	5.19	0.726	0.18248	.	0.320832	0.27917	N	0.017338	T	0.60274	0.2256	L	0.40543	1.245	0.58432	D	0.999999	B;B;B;B;B;B	0.11235	0.0;0.0;0.001;0.004;0.0;0.001	B;B;B;B;B;B	0.11329	0.001;0.002;0.006;0.004;0.002;0.004	T	0.52487	-0.8569	10	0.25751	T	0.34	.	0.2626	0.00220	0.3276:0.1332:0.2335:0.3056	.	1302;1319;1309;1319;1319;1326	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	R	1319;1326;1319;1326;1385;1319;1309;1319	ENSP00000356224:S1319R;ENSP00000396024:S1326R;ENSP00000265368:S1319R;ENSP00000390975:S1326R;ENSP00000341887:S1385R;ENSP00000356222:S1319R;ENSP00000356217:S1309R;ENSP00000414510:S1319R	ENSP00000265368:S1319R	S	-	3	2	SYNE1	152804954	0.992000	0.36948	0.980000	0.43619	0.439000	0.31926	0.623000	0.24447	0.273000	0.22049	-0.143000	0.13931	AGC	-	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom		0.637	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	0	0	0	25	25	8	0.00	0.00	G	NM_182961		152763261	-1	7	2	9	5	tier1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	43.75	28.57	SNP	0.774	T	7	9
PELO	53918	genome.wustl.edu	37	5	52096725	52096725	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:52096725A>T	ENST00000274311.2	+	2	1482	c.497A>T	c.(496-498)aAc>aTc	p.N166I	ITGA1_ENST00000504086.1_Intron|PELO_ENST00000506949.1_Intron|ITGA1_ENST00000282588.6_Intron	NM_015946.4	NP_057030.3	Q9BRX2	PELO_HUMAN	pelota homolog (Drosophila)	166					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA catabolic process, non-stop decay (GO:0070481)|RNA surveillance (GO:0071025)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	11		Lung NSC(810;4.94e-05)|Breast(144;0.0848)				GTGGAGGTGAACATCCCTAGG	0.567													ENSG00000152684																																					0													93.0	81.0	85.0					5																	52096725		2203	4300	6503	SO:0001583	missense	0			-		CCDS3956.1	5q11.2	2008-07-18	2001-11-28		ENSG00000152684	ENSG00000152684			8829	protein-coding gene	gene with protein product		605757	"""pelota (Drosophila) homolog"""			11060452	Standard	NM_015946		Approved		uc003jos.3	Q9BRX2	OTTHUMG00000096973	ENST00000274311.2:c.497A>T	5.37:g.52096725A>T	ENSP00000274311:p.Asn166Ile		Q9GZS6|Q9Y306	Missense_Mutation	SNP	pfam_eRF1_1_Pelota,pfam_eRF1_2,pfam_eRF1_3,tigrfam_Transl_rel_pelota-like	p.N166I	ENST00000274311.2	37	c.497	CCDS3956.1	5	.	.	.	.	.	.	.	.	.	.	A	13.67	2.306019	0.40795	.	.	ENSG00000152684	ENST00000274311	T	0.45276	0.9	5.4	1.52	0.23074	eRF1 domain 2 (1);	0.122639	0.53938	U	0.000045	T	0.33118	0.0852	L	0.60845	1.875	0.39573	D	0.969307	B	0.30973	0.302	B	0.29077	0.098	T	0.11767	-1.0574	10	0.56958	D	0.05	-22.0759	4.802	0.13301	0.4958:0.2871:0.2171:0.0	.	166	Q9BRX2	PELO_HUMAN	I	166	ENSP00000274311:N166I	ENSP00000274311:N166I	N	+	2	0	PELO	52132482	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.066000	0.41452	0.110000	0.17919	0.460000	0.39030	AAC	-	PELO	-	pfam_eRF1_2,tigrfam_Transl_rel_pelota-like		0.567	PELO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PELO	HGNC	protein_coding	OTTHUMT00000214040.1	0	0	0	30	30	93	0.00	0.00	A	NM_015946		52096725	+1	6	7	18	67	tier1	no_errors	ENST00000274311	ensembl	human	known	74_37	missense	25.00	9.46	SNP	1.000	T	6	18
CXorf30	645090	genome.wustl.edu	37	X	36371692	36371692	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrX:36371692T>G	ENST00000378657.4	+	14	1733	c.1085T>G	c.(1084-1086)aTc>aGc	p.I362S		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	362										breast(1)|lung(2)|stomach(1)	4						AAGGTAGAAATCATACTGAAT	0.378													ENSG00000205081																																					0													140.0	105.0	116.0					X																	36371692		692	1591	2283	SO:0001583	missense	0			-		CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.1085T>G	X.37:g.36371692T>G	ENSP00000367926:p.Ile362Ser			Missense_Mutation	SNP	NULL	p.I362S	ENST00000378657.4	37	c.1085	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	T	14.88	2.668214	0.47677	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.27402	1.67;1.68	4.62	4.62	0.57501	.	0.499415	0.19498	N	0.112811	T	0.35799	0.0944	L	0.38175	1.15	0.09310	N	1	D	0.59357	0.985	P	0.55391	0.775	T	0.11179	-1.0598	10	0.51188	T	0.08	-2.5071	9.4416	0.38673	0.0:0.0:0.0:1.0	.	362	A6PW82	CX030_HUMAN	S	647;362	ENSP00000367922:I647S;ENSP00000367926:I362S	ENSP00000367922:I647S	I	+	2	0	CXorf30	36281613	0.487000	0.25988	0.003000	0.11579	0.008000	0.06430	2.422000	0.44696	1.830000	0.53286	0.437000	0.28790	ATC	-	CXorf30	-	NULL		0.378	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding		0	0	0	55	55	128	0.00	0.00	T	NP_001092313		36371692	+1	12	8	55	80	tier1	no_errors	ENST00000378657	ensembl	human	known	74_37	missense	17.91	9.09	SNP	0.004	G	12	55
ADAMTS20	80070	genome.wustl.edu	37	12	43821218	43821218	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr12:43821218C>A	ENST00000389420.3	-	27	3999	c.4000G>T	c.(4000-4002)Gaa>Taa	p.E1334*	ADAMTS20_ENST00000553158.1_Nonsense_Mutation_p.E1334*|ADAMTS20_ENST00000395541.2_Nonsense_Mutation_p.E452*	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1334	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TGTCCATTTTCATCCTGGCAG	0.488													ENSG00000173157																																					0													116.0	86.0	96.0					12																	43821218		2203	4300	6503	SO:0001587	stop_gained	0			-	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4000G>T	12.37:g.43821218C>A	ENSP00000374071:p.Glu1334*		A6NNC9|J3QT00	Nonsense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.E1334*	ENST00000389420.3	37	c.4000	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	C	42	9.674013	0.99236	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	.	.	.	4.94	4.94	0.65067	.	0.000000	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	19.0406	0.92997	0.0:1.0:0.0:0.0	.	.	.	.	X	1334;464;452;1334;1334	.	ENSP00000374068:E1334X	E	-	1	0	ADAMTS20	42107485	1.000000	0.71417	0.990000	0.47175	0.873000	0.50193	5.541000	0.67212	2.670000	0.90874	0.650000	0.86243	GAA	-	ADAMTS20	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.488	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	0	0	0	43	43	110	0.00	0.00	C	NM_025003		43821218	-1	4	4	37	86	tier1	no_errors	ENST00000389420	ensembl	human	known	74_37	nonsense	9.76	4.44	SNP	1.000	A	4	37
SLCO5A1	81796	genome.wustl.edu	37	8	70650332	70650332	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr8:70650332G>T	ENST00000260126.4	-	5	2072	c.1366C>A	c.(1366-1368)Ccc>Acc	p.P456T	SLCO5A1_ENST00000530307.1_Intron|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.P456T	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	456						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			ATGAACTTGGGAATGAAGGTA	0.448													ENSG00000137571																																					0													182.0	158.0	166.0					8																	70650332		2203	4300	6503	SO:0001583	missense	0			-	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1366C>A	8.37:g.70650332G>T	ENSP00000260126:p.Pro456Thr		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.P456T	ENST00000260126.4	37	c.1366	CCDS6205.1	8	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822687	0.90873	.	.	ENSG00000137571	ENST00000260126;ENST00000524945	T;T	0.65549	-0.16;-0.16	5.81	5.81	0.92471	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.81550	0.4846	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.81720	-0.0804	10	0.54805	T	0.06	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	456;456	Q9H2Y9;G3V1C0	SO5A1_HUMAN;.	T	456	ENSP00000260126:P456T;ENSP00000434422:P456T	ENSP00000260126:P456T	P	-	1	0	SLCO5A1	70812886	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.863000	0.99569	2.736000	0.93811	0.655000	0.94253	CCC	-	SLCO5A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.448	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO5A1	HGNC	protein_coding	OTTHUMT00000381990.3	0	0	2	43	43	165	0.00	1.20	G	NM_030958		70650332	-1	5	21	37	99	tier1	no_errors	ENST00000260126	ensembl	human	known	74_37	missense	11.90	17.50	SNP	1.000	T	5	37
SRPK2	6733	genome.wustl.edu	37	7	104844171	104844171	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:104844171G>T	ENST00000393651.3	-	3	220	c.133C>A	c.(133-135)Ccg>Acg	p.P45T	SRPK2_ENST00000489828.1_Missense_Mutation_p.P34T|SRPK2_ENST00000357311.3_Missense_Mutation_p.P34T	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						AAAggtggcggtggtggtggt	0.557													ENSG00000135250																																					0													47.0	42.0	44.0					7																	104844171		2203	4300	6503	SO:0001583	missense	0			-	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.133C>A	7.37:g.104844171G>T	ENSP00000377262:p.Pro45Thr			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P45T	ENST00000393651.3	37	c.133	CCDS34724.1	7	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919005	0.52546	.	.	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828;ENST00000482897;ENST00000460391	D;D;D;T;T	0.86865	-2.18;-2.18;-2.18;0.76;0.76	6.04	6.04	0.98038	.	0.142511	0.45361	D	0.000373	D	0.89054	0.6606	L	0.27053	0.805	0.58432	D	0.999998	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.987	D	0.85244	0.1040	10	0.18276	T	0.48	-11.3591	18.3674	0.90396	0.0:0.0:1.0:0.0	.	45;34	P78362-2;P78362	.;SRPK2_HUMAN	T	45;34;34;82;34	ENSP00000377262:P45T;ENSP00000349863:P34T;ENSP00000419791:P34T;ENSP00000419240:P82T;ENSP00000417357:P34T	ENSP00000349863:P34T	P	-	1	0	SRPK2	104631407	1.000000	0.71417	0.747000	0.31113	0.590000	0.36582	9.036000	0.93758	2.873000	0.98535	0.561000	0.74099	CCG	-	SRPK2	-	NULL		0.557	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	HGNC	protein_coding	OTTHUMT00000348723.1	0	0	1	43	43	35	0.00	2.78	G	NM_182691		104844171	-1	20	15	41	39	tier1	no_errors	ENST00000393651	ensembl	human	known	74_37	missense	32.79	27.78	SNP	1.000	T	20	41
ATXN1	6310	genome.wustl.edu	37	6	16327956	16327956	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr6:16327956C>G	ENST00000244769.4	-	8	1522	c.586G>C	c.(586-588)Gag>Cag	p.E196Q	ATXN1_ENST00000436367.1_Missense_Mutation_p.E196Q	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	196					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				tgctgctgctCAGCCTTGTGT	0.652													ENSG00000124788																																					0													12.0	14.0	13.0					6																	16327956		2090	4139	6229	SO:0001583	missense	0			-	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.586G>C	6.37:g.16327956C>G	ENSP00000244769:p.Glu196Gln		Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_Capicua_tscrpt_rep_mod,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.E196Q	ENST00000244769.4	37	c.586	CCDS34342.1	6	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234922	0.79800	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.31510	1.49;1.49	5.14	5.14	0.70334	.	0.170141	0.39475	N	0.001358	T	0.45357	0.1338	M	0.63843	1.955	0.46356	D	0.999004	D	0.69078	0.997	D	0.75484	0.986	T	0.38564	-0.9655	10	0.51188	T	0.08	-29.1264	16.789	0.85582	0.0:1.0:0.0:0.0	.	196	P54253	ATX1_HUMAN	Q	196	ENSP00000244769:E196Q;ENSP00000416360:E196Q	ENSP00000244769:E196Q	E	-	1	0	ATXN1	16435935	1.000000	0.71417	0.994000	0.49952	0.773000	0.43773	5.230000	0.65321	2.390000	0.81377	0.467000	0.42956	GAG	-	ATXN1	-	NULL		0.652	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1	HGNC	protein_coding	OTTHUMT00000039943.3	0	0	0	37	37	10	0.00	0.00	C	NM_000332		16327956	-1	4	0	21	3	tier1	no_errors	ENST00000244769	ensembl	human	known	74_37	missense	14.81	0.00	SNP	1.000	G	4	21
OR12D2	26529	genome.wustl.edu	37	6	29365079	29365079	+	Silent	SNP	G	G	T	rs201460005	byFrequency	TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr6:29365079G>T	ENST00000383555.2	+	1	664	c.603G>T	c.(601-603)acG>acT	p.T201T	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						GTACTGTCACGGGGACAATTG	0.448													ENSG00000168787																																					0													156.0	160.0	158.0					6																	29365079		1511	2709	4220	SO:0001819	synonymous_variant	0			-		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.603G>T	6.37:g.29365079G>T			B0S862|Q5SUN9|Q6IET9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T201	ENST00000383555.2	37	c.603	CCDS4659.1	6																																																																																			-	OR12D2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.448	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR12D2	HGNC	protein_coding	OTTHUMT00000076054.2	0	0	0	23	23	95	0.00	0.00	G			29365079	+1	11	20	17	41	tier1	no_errors	ENST00000383555	ensembl	human	known	74_37	silent	39.29	32.79	SNP	0.000	T	11	17
FAR2	55711	genome.wustl.edu	37	12	29449969	29449969	+	Silent	SNP	T	T	C			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr12:29449969T>C	ENST00000536681.3	+	4	627	c.381T>C	c.(379-381)ctT>ctC	p.L127L	FAR2_ENST00000182377.4_Silent_p.L127L|FAR2_ENST00000547116.1_Silent_p.L30L|RP11-996F15.2_ENST00000553105.1_RNA	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	127					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						CTGTGCAACTTAACGTCACTG	0.428													ENSG00000064763																																					0													153.0	155.0	155.0					12																	29449969		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.381T>C	12.37:g.29449969T>C			F8VV73|Q9H0D5|Q9NVW8	Silent	SNP	pfam_Male_sterile_D-bd,pfam_FAR,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_Polysac_CapD-like	p.L127	ENST00000536681.3	37	c.381	CCDS8717.1	12																																																																																			-	FAR2	-	pfam_Male_sterile_D-bd,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_Polysac_CapD-like		0.428	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAR2	HGNC	protein_coding	OTTHUMT00000403479.2	0	0	0	31	31	10	0.00	0.00	T	NM_018099		29449969	+1	3	0	18	4	tier1	no_errors	ENST00000182377	ensembl	human	known	74_37	silent	14.29	0.00	SNP	0.237	C	3	18
IPO13	9670	genome.wustl.edu	37	1	44415575	44415575	+	Silent	SNP	C	C	A	rs553921358		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:44415575C>A	ENST00000372343.3	+	2	1233	c.571C>A	c.(571-573)Cgg>Agg	p.R191R		NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	191					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				AGGCCTGGTGCGGACCAGCCT	0.642													ENSG00000117408																																					0													18.0	19.0	18.0					1																	44415575		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.571C>A	1.37:g.44415575C>A			D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Silent	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.R191	ENST00000372343.3	37	c.571	CCDS503.1	1																																																																																			-	IPO13	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold		0.642	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO13	HGNC	protein_coding	OTTHUMT00000022846.1	0	0	0	49	49	9	0.00	0.00	C	NM_014652		44415575	+1	12	0	39	1	tier1	no_errors	ENST00000372343	ensembl	human	known	74_37	silent	23.53	0.00	SNP	1.000	A	12	39
PIEZO1	9780	genome.wustl.edu	37	16	88800395	88800395	+	Missense_Mutation	SNP	C	C	G	rs144777557|rs144269709|rs202139830	byFrequency	TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr16:88800395C>G	ENST00000301015.9	-	17	2494	c.2248G>C	c.(2248-2250)Gag>Cag	p.E750Q	RP5-1142A6.2_ENST00000440406.2_RNA|RP5-1142A6.2_ENST00000567968.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	750				Missing (in Ref. 3; BAA13240 and 4; AAI50272). {ECO:0000305}.	cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						tcctcctcctcctgctgctgc	0.667													ENSG00000103335	c|||	215	0.0429313	0.1422	0.0144	5008	,	,		18034	0.002		0.005	False		,,,				2504	0.0102																0													8.0	11.0	10.0					16																	88800395		685	1579	2264	SO:0001583	missense	0			-	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2248G>C	16.37:g.88800395C>G	ENSP00000301015:p.Glu750Gln		A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_Piezo	p.E750Q	ENST00000301015.9	37	c.2248	CCDS54058.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.314|1.314	-0.601304|-0.601304	0.03744|0.03744	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000301015|ENST00000451779	T|.	0.42513|.	0.97|.	0.95|0.95	-0.894|-0.894	0.10563|0.10563	.|.	6.054080|.	0.02478|.	U|.	0.088226|.	T|T	0.24928|0.24928	0.0605|0.0605	L|L	0.32530|0.32530	0.975|0.975	0.22851|0.22851	N|N	0.998657|0.998657	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.28808|0.28808	-1.0032|-1.0032	10|5	0.14252|.	T|.	0.57|.	.|.	4.7743|4.7743	0.13171|0.13171	0.0:0.5999:0.4001:0.0|0.0:0.5999:0.4001:0.0	.|.	750|.	Q92508|.	PIEZ1_HUMAN|.	Q|A	750|695	ENSP00000301015:E750Q|.	ENSP00000301015:E750Q|.	E|G	-|-	1|2	0|0	FAM38A|FAM38A	87327896|87327896	0.001000|0.001000	0.12720|0.12720	0.479000|0.479000	0.27329|0.27329	0.108000|0.108000	0.19459|0.19459	0.550000|0.550000	0.23345|0.23345	-0.003000|-0.003000	0.14444|0.14444	0.000000|0.000000	0.15137|0.15137	GAG|GGA	rs202139830	PIEZO1	-	NULL		0.667	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	0	0	0	43	43	14	0.00	0.00	C	NM_014745		88800395	-1	4	1	15	1	tier1	no_errors	ENST00000301015	ensembl	human	novel	74_37	missense	21.05	50.00	SNP	0.340	G	4	15
PLA2G4F	255189	genome.wustl.edu	37	15	42448730	42448730	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr15:42448730C>T	ENST00000382396.4	-	1	104	c.18G>A	c.(16-18)tgG>tgA	p.W6*	PLA2G4F_ENST00000397272.3_Nonsense_Mutation_p.W6*			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	6					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GCCACCTTGGCCAGAGTGCCC	0.647													ENSG00000168907																																					0													15.0	14.0	14.0					15																	42448730		2178	4216	6394	SO:0001587	stop_gained	0			-		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.18G>A	15.37:g.42448730C>T	ENSP00000371833:p.Trp6*		Q6ZMC8	Nonsense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.W6*	ENST00000382396.4	37	c.18	CCDS32204.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.501811|5.501811	0.96371|0.96371	.|.	.|.	ENSG00000168907|ENSG00000168907	ENST00000290497|ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.687962	.|0.12872	.|N	.|0.432161	T|.	0.67192|.	0.2867|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.66160|.	-0.5993|.	4|.	0.31617|0.32370	T|T	0.26|0.25	-4.5449|-4.5449	17.3394|17.3394	0.87291|0.87291	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	T|X	27|6	.|.	ENSP00000290497:A27T|ENSP00000350604:W6X	A|W	-|-	1|3	0|0	PLA2G4F|PLA2G4F	40236022|40236022	0.998000|0.998000	0.40836|0.40836	0.745000|0.745000	0.31077|0.31077	0.977000|0.977000	0.68977|0.68977	4.087000|4.087000	0.57671|0.57671	2.708000|2.708000	0.92522|0.92522	0.655000|0.655000	0.94253|0.94253	GCC|TGG	-	PLA2G4F	-	NULL		0.647	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLA2G4F	HGNC	protein_coding	OTTHUMT00000420463.1	0	0	0	43	43	11	0.00	0.00	C	NM_213600		42448730	-1	4	0	26	3	tier1	no_errors	ENST00000397272	ensembl	human	known	74_37	nonsense	13.33	0.00	SNP	0.933	T	4	26
ZNF733P	643955	genome.wustl.edu	37	7	62752861	62752861	+	RNA	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:62752861G>A	ENST00000331425.6	-	0	574					NR_003952.1				zinc finger protein 733, pseudogene																		ACCTGATGTTGATTTAGGTGT	0.313													ENSG00000185037																																					0																																												0			-			7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752861G>A				R	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			-	ZNF733P	-	-		0.313	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	HGNC	pseudogene	OTTHUMT00000343679.1	0	0	0	43	43	8	0.00	0.00	G			62752861	-1	12	0	48	8	tier1	no_errors	ENST00000331425	ensembl	human	known	74_37	rna	20.00	0.00	SNP	0.000	A	12	48
SSPO	23145	genome.wustl.edu	37	7	149489488	149489488	+	RNA	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr7:149489488C>A	ENST00000378016.2	+	0	5641							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTGGCCTGGGCAACGCATCAA	0.706													ENSG00000197558																																					0													14.0	21.0	19.0					7																	149489488		2134	4222	6356			0			-	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149489488C>A			Q76B61	R	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	SSPO	-	-		0.706	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		0	0	0	98	98	6	0.00	0.00	C			149489488	+1	18	0	63	4	tier1	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	22.22	0.00	SNP	1.000	A	18	63
GOLGA6L4	643707	genome.wustl.edu	37	15	82932257	82932288	+	5'UTR	DEL	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC	-	rs555363824	byFrequency	TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr15:82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC	ENST00000560844.1	-	0	2502_2533																				NS(1)	1						taaattagaaacacaaataaatttaaactataaattagaaacacaaataaat	0.207													ENSG00000215749																																					0																																										SO:0001623	5_prime_UTR_variant	0																															ENST00000560844.1:c.-1851GTTTCTAATTTATAGTTTAAATTTATTTGTGT>-	15.37:g.82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC				R	DEL	-	NULL	ENST00000560844.1	37	NULL		15																																																																																				RP13-996F3.5	-	-		0.207	RP13-996F3.5-002	KNOWN	basic	processed_transcript	GOLGA6L4	Clone_based_vega_gene	protein_coding	OTTHUMT00000419267.1	0	0	0	0	0	0	0.00	0.00	ACACAAATAAATTTAAACTATAAATTAGAAAC			82932288	-1	0	0	0	0	tier1	no_errors	ENST00000560844	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.140:0.148:0.154:0.160:0.165:0.169:0.172:0.175:0.177:0.178:0.179:0.179:0.180:0.179:0.135:0.131:0.126:0.121:0.112:0.097:0.077:0.050:0.041:0.040:0.045:0.047:0.048:0.046:0.049:0.052:0.050:0.046	-	0	0
KCNQ4	9132	genome.wustl.edu	37	1	41304460	41304460	+	3'UTR	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:41304460G>T	ENST00000347132.5	+	0	2435				KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4						inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	CCAGTGCCCTGCCCACTCCAT	0.731													ENSG00000117013																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.*265G>T	1.37:g.41304460G>T			O96025	R	SNP	-	NULL	ENST00000347132.5	37	NULL	CCDS456.1	1																																																																																			-	KCNQ4	-	-		0.731	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	0	0	0	32	32	3	0.00	0.00	G	NM_004700		41304460	+1	11	0	15	0	tier1	no_errors	ENST00000506017	ensembl	human	known	74_37	rna	42.31	0.00	SNP	0.354	T	11	15
MT-ND6	4541	genome.wustl.edu	37	M	14569	14569	+	Silent	SNP	G	G	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chrM:14569G>A	ENST00000361681.2	-	1	104	c.105C>T	c.(103-105)agC>agT	p.S35S	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	35					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CCGACCACACCGCTAACAATC	0.383													ENSG00000198695																																					0																																										SO:0001819	synonymous_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.105C>T	M.37:g.14569G>A			Q34774|Q8HG30	Silent	SNP	pfam_DH_UbQ/plastoQ_OxRdtase_su6	p.S35	ENST00000361681.2	37	c.105		MT																																																																																			-	MT-ND6	-	pfam_DH_UbQ/plastoQ_OxRdtase_su6		0.383	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	MT-ND6	HGNC	protein_coding		1	1	0	447	447	0	0.22	0.00	G	YP_003024037		14569	-1	293	0	103	0	tier1	no_errors	ENST00000361681	ensembl	human	known	74_37	silent	73.99	0.00	SNP	NULL	A	293	103
OR7E94P	79273	genome.wustl.edu	37	4	80508906	80508907	+	RNA	INS	-	-	AA	rs398107552|rs35732335	byFrequency	TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr4:80508906_80508907insAA	ENST00000601375.1	-	0	338_339									olfactory receptor, family 7, subfamily E, member 94 pseudogene																		aataataattgaaaaaaaaAGG	0.406													ENSG00000249646																																					0																																												0				AC013662		4q21.21	2013-09-24			ENSG00000249646	ENSG00000249646		"""GPCR / Class A : Olfactory receptors"""	14789	pseudogene	pseudogene							Standard	NG_002221		Approved				OTTHUMG00000160914		4.37:g.80508913_80508914dupAA				R	INS	-	NULL	ENST00000601375.1	37	NULL		4																																																																																				OR7E94P	-	-		0.406	OR7E94P-002	KNOWN	basic	processed_transcript	OR7E94P	HGNC	pseudogene	OTTHUMT00000464523.1	0	0	0	16	16	2	0.00	0.00	-			80508907	-1	3	0	15	1	tier1	no_errors	ENST00000601375	ensembl	human	known	74_37	rna	16.67	0.00	INS	0.004:0.015	AA	3	15
SLC22A17	51310	genome.wustl.edu	37	14	23822003	23822003	+	5'UTR	SNP	C	C	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr14:23822003C>G	ENST00000397267.1	-	0	77				SLC22A17_ENST00000474057.1_5'UTR|SLC22A17_ENST00000397260.3_5'UTR|SLC22A17_ENST00000354772.3_5'UTR|SLC22A17_ENST00000206544.8_5'Flank			Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17						ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		GCGCTGTCCTCTGGCTCAGTT	0.726													ENSG00000092096																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000397267.1:c.-386G>C	14.37:g.23822003C>G			A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	R	SNP	-	NULL	ENST00000397267.1	37	NULL	CCDS9593.1	14																																																																																			-	SLC22A17	-	-		0.726	SLC22A17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC22A17	HGNC	protein_coding		0	0	0	43	43	0	0.00	0.00	C	NM_020372		23822003	-1	17	0	10	2	tier1	no_errors	ENST00000474057	ensembl	human	known	74_37	rna	62.96	0.00	SNP	0.003	G	17	10
TM6SF2	53345	genome.wustl.edu	37	19	19384023	19384023	+	Start_Codon_SNP	SNP	A	A	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr19:19384023A>G	ENST00000389363.4	-	1	74	c.2T>C	c.(1-3)aTg>aCg	p.M1T	AC138430.4_ENST00000586064.2_RNA|TM6SF2_ENST00000586107.1_5'UTR	NM_001001524.2	NP_001001524.2	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	1						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14			Epithelial(12;0.0151)			CGGGATGTCCATAGCGGCGGC	0.741													ENSG00000213996																																					0													3.0	4.0	4.0					19																	19384023		1677	3670	5347	SO:0001582	initiator_codon_variant	0			-	AF255923	CCDS42528.1	19p13.3-p12	2008-02-05							11861	protein-coding gene	gene with protein product		606563				11124529	Standard	NM_001001524		Approved	Lpr4	uc002nmd.1	Q9BZW4		ENST00000389363.4:c.2T>C	19.37:g.19384023A>G	ENSP00000374014:p.Met1Thr		Q0IJ64	Missense_Mutation	SNP	pfam_Transmembrane_6/97	p.M1T	ENST00000389363.4	37	c.2	CCDS42528.1	19	.	.	.	.	.	.	.	.	.	.	A	15.97	2.989955	0.54041	.	.	ENSG00000213996	ENST00000389363;ENST00000431465;ENST00000269990	T	0.23950	1.88	4.25	4.25	0.50352	.	.	.	.	.	T	0.43700	0.1259	.	.	.	0.80722	D	1	D	0.54601	0.967	P	0.60789	0.879	T	0.41395	-0.9511	8	0.72032	D	0.01	-21.7481	9.672	0.40017	1.0:0.0:0.0:0.0	.	1	Q9BZW4	TM6S2_HUMAN	T	1	ENSP00000374014:M1T	ENSP00000269990:M1T	M	-	2	0	TM6SF2	19245023	1.000000	0.71417	0.984000	0.44739	0.269000	0.26545	3.619000	0.54196	1.806000	0.52798	0.448000	0.29417	ATG	-	TM6SF2	-	NULL		0.741	TM6SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM6SF2	HGNC	protein_coding	OTTHUMT00000460122.2	0	0	0	11	11	2	0.00	0.00	A	NM_203510	Missense_Mutation	19384023	-1	7	0	11	2	tier1	no_errors	ENST00000389363	ensembl	human	known	74_37	missense	38.89	0.00	SNP	0.994	G	7	11
TNFRSF1B	7133	genome.wustl.edu	37	1	12251943	12251943	+	Silent	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:12251943G>T	ENST00000376259.3	+	4	509	c.420G>T	c.(418-420)ctG>ctT	p.L140L	MIR4632_ENST00000584158.1_RNA|TNFRSF1B_ENST00000492361.1_3'UTR|TNFRSF1B_ENST00000536782.1_Silent_p.L140L	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	140					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	GCGCGCCGCTGCGCAAGTGCC	0.687													ENSG00000028137																																					0													20.0	22.0	21.0					1																	12251943		2200	4298	6498	SO:0001819	synonymous_variant	0			-	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.420G>T	1.37:g.12251943G>T			B1AJZ3|Q16042|Q6YI29|Q9UIH1	Silent	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_1B	p.L140	ENST00000376259.3	37	c.420	CCDS145.1	1																																																																																			-	TNFRSF1B	-	smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg		0.687	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF1B	HGNC	protein_coding	OTTHUMT00000005133.1	0	0	0	29	29	1	0.00	0.00	G	NM_001066		12251943	+1	4	0	32	4	tier1	no_errors	ENST00000376259	ensembl	human	known	74_37	silent	11.11	0.00	SNP	0.008	T	4	32
CNOT6	57472	genome.wustl.edu	37	5	179921643	179921643	+	5'UTR	SNP	C	C	A			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:179921643C>A	ENST00000393356.1	+	0	134				CNOT6_ENST00000261951.4_5'UTR			Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|skin(1)	23	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		AGAGGAGCGGCGGCGGTGGCG	0.731													ENSG00000113300																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AB033020	CCDS4455.1	5q35.3	2014-06-17			ENSG00000113300	ENSG00000113300			14099	protein-coding gene	gene with protein product		608951				11889047	Standard	XM_005265953		Approved	CCR4, KIAA1194, Ccr4a	uc003mlx.3	Q9ULM6	OTTHUMG00000130935	ENST00000393356.1:c.-291C>A	5.37:g.179921643C>A			A7MD46|D3DWR0	R	SNP	-	NULL	ENST00000393356.1	37	NULL	CCDS4455.1	5																																																																																			-	CNOT6	-	-		0.731	CNOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT6	HGNC	protein_coding	OTTHUMT00000253532.1	0	0	0	22	22	4	0.00	0.00	C	NM_015455		179921643	+1	7	5	11	4	tier1	no_errors	ENST00000507016	ensembl	human	putative	74_37	rna	38.89	55.56	SNP	0.998	A	7	11
HIVEP3	59269	genome.wustl.edu	37	1	41976281	41976281	+	Silent	SNP	A	A	G			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr1:41976281A>G	ENST00000372583.1	-	9	7947	c.7062T>C	c.(7060-7062)tcT>tcC	p.S2354S	HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000247584.5_Silent_p.S2354S|HIVEP3_ENST00000429157.2_Silent_p.S2353S|HIVEP3_ENST00000372584.1_Silent_p.S2353S	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2354					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GGCAGCCCACAGAGCTGCTGC	0.721													ENSG00000127124																																					0													9.0	9.0	9.0					1																	41976281		2119	4157	6276	SO:0001819	synonymous_variant	0			-	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.7062T>C	1.37:g.41976281A>G			A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S2354	ENST00000372583.1	37	c.7062	CCDS463.1	1																																																																																			-	HIVEP3	-	NULL		0.721	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	0	0	0	48	48	3	0.00	0.00	A	NM_024503		41976281	-1	6	4	18	5	tier1	no_errors	ENST00000247584	ensembl	human	known	74_37	silent	25.00	44.44	SNP	0.168	G	6	18
ZAK	51776	genome.wustl.edu	37	2	174085893	174085893	+	Intron	SNP	G	G	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr2:174085893G>T	ENST00000375213.3	+	11	1065				MLTK_ENST00000431503.2_Missense_Mutation_p.A234S|MLK7-AS1_ENST00000423106.2_RNA|MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000409176.2_Intron|MLTK_ENST00000338983.3_Missense_Mutation_p.A335S|MLTK_ENST00000539448.1_Missense_Mutation_p.A335S	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN							activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										CTTGCCTCTTGCTGCAAGAAT	0.393													ENSG00000091436																																					0													56.0	59.0	58.0					2																	174085893		2203	4300	6503	SO:0001627	intron_variant	0			-																												ENST00000375213.3:c.987+3915G>T	2.37:g.174085893G>T			B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A335S	ENST00000375213.3	37	c.1003	CCDS42777.1	2	.	.	.	.	.	.	.	.	.	.	G	8.200	0.797980	0.16327	.	.	ENSG00000091436	ENST00000539448;ENST00000338983;ENST00000431503	T;T;T	0.78481	-0.79;-0.79;-1.18	5.92	5.02	0.67125	.	.	.	.	.	T	0.59238	0.2179	N	0.08118	0	0.30589	N	0.761717	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.47611	-0.9104	9	0.08837	T	0.75	.	16.0582	0.80820	0.0:0.0:0.861:0.139	.	335;335	A8K710;D4Q8H0	.;.	S	335;335;234	ENSP00000439414:A335S;ENSP00000340257:A335S;ENSP00000399787:A234S	ENSP00000340257:A335S	A	+	1	0	AC013461.1	173794139	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.154000	0.64894	1.458000	0.47871	0.655000	0.94253	GCT	-	MLTK	-	NULL		0.393	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	Uniprot_gn	protein_coding	OTTHUMT00000255401.1	0	0	0	66	66	83	0.00	0.00	G			174085893	+1	5	2	50	43	tier1	no_errors	ENST00000338983	ensembl	human	known	74_37	missense	9.09	4.44	SNP	1.000	T	5	50
AGGF1	55109	genome.wustl.edu	37	5	76358970	76358970	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr5:76358970A>T	ENST00000312916.7	+	14	2420	c.2038A>T	c.(2038-2040)Aaa>Taa	p.K680*		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	680					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		CAAGAACAAAAAAAACTGGGA	0.463													ENSG00000164252																																					0													143.0	156.0	152.0					5																	76358970		2203	4300	6503	SO:0001587	stop_gained	0			-	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.2038A>T	5.37:g.76358970A>T	ENSP00000316109:p.Lys680*		O00581|Q53YS3|Q9BU84|Q9NW66	Nonsense_Mutation	SNP	pfam_FHA_dom,pfam_G_patch_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_G_patch_dom,pfscan_FHA_dom,pfscan_G_patch_dom	p.K680*	ENST00000312916.7	37	c.2038	CCDS4035.1	5	.	.	.	.	.	.	.	.	.	.	A	42	9.560002	0.99205	.	.	ENSG00000164252	ENST00000312916	.	.	.	5.47	5.47	0.80525	.	0.092425	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.2821	15.5576	0.76208	1.0:0.0:0.0:0.0	.	.	.	.	X	680	.	ENSP00000316109:K680X	K	+	1	0	AGGF1	76394726	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.938000	0.75904	2.073000	0.62155	0.528000	0.53228	AAA	-	AGGF1	-	NULL		0.463	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGGF1	HGNC	protein_coding	OTTHUMT00000219971.2	0	0	0	29	29	61	0.00	0.00	A	NM_018046		76358970	+1	8	3	21	33	tier1	no_errors	ENST00000312916	ensembl	human	known	74_37	nonsense	27.59	8.33	SNP	1.000	T	8	21
PLD1	5337	genome.wustl.edu	37	3	171455451	171455452	+	Splice_Site	INS	-	-	A	rs545683379|rs71178233		TCGA-DX-A8BT-01A-11D-A37C-09	TCGA-DX-A8BT-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68092db5-7dc6-4600-a753-460a962693ac	7e653b4b-2223-4e17-8e5f-6af07a25792d	g.chr3:171455451_171455452insA	ENST00000351298.4	-	3	287		c.e3-2		PLD1_ENST00000356327.5_Splice_Site|PLD1_ENST00000340989.4_Splice_Site|PLD1_ENST00000342215.6_Splice_Site	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific						chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GGATATACACTAAAAAAAAAAG	0.327													ENSG00000075651																									NSCLC(149;2174 3517 34058)												0																																										SO:0001630	splice_region_variant	0				U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.161-2->T	3.37:g.171455461_171455461dupA				Splice_Site	INS	-	e2-2	ENST00000351298.4	37	c.161-3_161-2	CCDS3216.1	3																																																																																				PLD1	-	-		0.327	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	0	0	0	35	35	66	0.00	0.00	-	NM_002662	Intron	171455452	-1	4	2	25	33	tier1	no_errors	ENST00000351298	ensembl	human	known	74_37	splice_site_ins	13.79	5.71	INS	0.999:0.901	A	4	25
