#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
APLP2	334	genome.wustl.edu	37	11	130003584	130003584	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:130003584A>C	ENST00000263574.5	+	12	1717	c.1645A>C	c.(1645-1647)Aaa>Caa	p.K549Q	APLP2_ENST00000345598.5_Missense_Mutation_p.K320Q|APLP2_ENST00000338167.5_Missense_Mutation_p.K549Q|APLP2_ENST00000528499.1_Missense_Mutation_p.K493Q|APLP2_ENST00000543137.1_Missense_Mutation_p.K456Q|APLP2_ENST00000539648.1_Missense_Mutation_p.K337Q|APLP2_ENST00000278756.7_Missense_Mutation_p.K559Q	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	549					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TCTGCTCTACAAAGTACCTTA	0.468													ENSG00000084234																																					0													117.0	107.0	111.0					11																	130003584		2201	4297	6498	SO:0001583	missense	0			-	L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.1645A>C	11.37:g.130003584A>C	ENSP00000263574:p.Lys549Gln		B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.K549Q	ENST00000263574.5	37	c.1645	CCDS8486.1	11	.	.	.	.	.	.	.	.	.	.	A	19.16	3.773555	0.69992	.	.	ENSG00000084234	ENST00000528499;ENST00000539648;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756;ENST00000543137	T;T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64;0.64	5.07	5.07	0.68467	Amyloidogenic glycoprotein, E2 domain (1);	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	M	0.71581	2.175	0.80722	D	1	D;D;D;P;D;D;D	0.89917	0.999;1.0;1.0;0.839;1.0;1.0;0.999	D;D;D;P;D;D;D	0.85130	0.976;0.997;0.997;0.607;0.997;0.995;0.918	T	0.66524	-0.5902	10	0.38643	T	0.18	-15.0798	14.0522	0.64745	1.0:0.0:0.0:0.0	.	337;549;493;320;487;493;549	F5H845;Q06481;Q06481-2;Q06481-5;B4E3I5;Q06481-4;Q06481-3	.;APLP2_HUMAN;.;.;.;.;.	Q	493;337;549;320;549;559;456	ENSP00000435914:K493Q;ENSP00000443728:K337Q;ENSP00000263574:K549Q;ENSP00000263575:K320Q;ENSP00000345444:K549Q;ENSP00000278756:K559Q;ENSP00000444122:K456Q	ENSP00000263574:K549Q	K	+	1	0	APLP2	129508794	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.906000	0.92626	1.917000	0.55516	0.460000	0.39030	AAA	-	APLP2	-	superfamily_Amyloid_glyco_E2_domain		0.468	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APLP2	HGNC	protein_coding	OTTHUMT00000386109.1	0	0	0	43	43	106	0.00	0.00	A	NM_001642		130003584	+1	8	25	16	66	tier1	no_errors	ENST00000263574	ensembl	human	known	74_37	missense	33.33	27.47	SNP	1.000	C	8	16
ZNF175	7728	genome.wustl.edu	37	19	52090690	52090690	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr19:52090690G>T	ENST00000262259.2	+	5	1464	c.1106G>T	c.(1105-1107)gGa>gTa	p.G369V	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	369					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CATGACTGTGGAAAAGCCTTT	0.408													ENSG00000105497																																					0													105.0	110.0	108.0					19																	52090690		2203	4300	6503	SO:0001583	missense	0			-	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1106G>T	19.37:g.52090690G>T	ENSP00000262259:p.Gly369Val		A8K9H2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G369V	ENST00000262259.2	37	c.1106	CCDS12837.1	19	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780071	0.49891	.	.	ENSG00000105497	ENST00000262259	T	0.23754	1.89	2.3	2.3	0.28687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.60090	0.2242	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.71391	-0.4607	9	0.87932	D	0	.	10.7252	0.46064	0.0:0.0:1.0:0.0	.	369	Q9Y473	ZN175_HUMAN	V	369	ENSP00000262259:G369V	ENSP00000262259:G369V	G	+	2	0	ZNF175	56782502	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.531000	0.53546	1.614000	0.50241	0.563000	0.77884	GGA	-	ZNF175	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.408	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF175	HGNC	protein_coding	OTTHUMT00000396205.1	0	0	0	37	37	101	0.00	0.00	G	NM_007147		52090690	+1	5	24	23	119	tier1	no_errors	ENST00000262259	ensembl	human	known	74_37	missense	17.86	16.78	SNP	1.000	T	5	23
SIRPB2	284759	genome.wustl.edu	37	20	1456846	1456846	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr20:1456846A>C	ENST00000359801.3	-	5	1031	c.995T>G	c.(994-996)aTg>aGg	p.M332R	SIRPB2_ENST00000444444.2_Missense_Mutation_p.M234R|SIRPB2_ENST00000608747.1_5'Flank	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	366	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TAAGGTGTTCATGGCTCCTGC	0.587													ENSG00000196209																																					0													144.0	125.0	131.0					20																	1456846		1568	3582	5150	SO:0001583	missense	0			-	AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.995T>G	20.37:g.1456846A>C	ENSP00000352849:p.Met332Arg		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.M332R	ENST00000359801.3	37	c.995	CCDS42849.1	20	.	.	.	.	.	.	.	.	.	.	A	8.690	0.907264	0.17833	.	.	ENSG00000196209	ENST00000359801;ENST00000444444	T;T	0.02197	4.62;4.4	3.46	-2.0	0.07433	.	8.769010	0.00424	U	0.000060	T	0.01387	0.0045	N	0.14661	0.345	0.09310	N	1	B;B	0.16166	0.016;0.008	B;B	0.12156	0.007;0.007	T	0.42749	-0.9433	10	0.10902	T	0.67	-7.7086	0.9568	0.01387	0.2579:0.3219:0.1042:0.3159	.	234;332	E9PCW6;Q5JXA9	.;SIRB2_HUMAN	R	332;234	ENSP00000352849:M332R;ENSP00000402438:M234R	ENSP00000352849:M332R	M	-	2	0	SIRPB2	1404846	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.349000	0.07731	-0.433000	0.07286	0.402000	0.26972	ATG	-	SIRPB2	-	NULL		0.587	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPB2	HGNC	protein_coding	OTTHUMT00000077544.1	0	0	0	52	52	36	0.00	0.00	A	NM_178459		1456846	-1	8	12	30	32	tier1	no_errors	ENST00000359801	ensembl	human	known	74_37	missense	21.05	27.27	SNP	0.000	C	8	30
P2RX7	5027	genome.wustl.edu	37	12	121605337	121605337	+	Missense_Mutation	SNP	G	G	A	rs149639375	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:121605337G>A	ENST00000546057.1	+	8	934	c.791G>A	c.(790-792)cGt>cAt	p.R264H	P2RX7_ENST00000328963.5_Missense_Mutation_p.R94H|P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000377162.2_Intron|P2RX7_ENST00000535250.1_Missense_Mutation_p.R174H|P2RX7_ENST00000541446.1_Intron	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	264					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AACCTAGACCGTTGGTTCCAT	0.517													ENSG00000089041																																					0								G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	226.0	168.0	188.0		791	-2.3	0.0	12	dbSNP_134	188	4,8596	3.7+/-12.6	0,4,4296	yes	missense	P2RX7	NM_002562.5	29	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	possibly-damaging	264/596	121605337	5,13001	2203	4300	6503	SO:0001583	missense	0			-	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.791G>A	12.37:g.121605337G>A	ENSP00000442349:p.Arg264His		A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X7_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.R264H	ENST00000546057.1	37	c.791	CCDS9213.1	12	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086178	0.36855	2.27E-4	4.65E-4	ENSG00000089041	ENST00000546057;ENST00000328963;ENST00000535250	T;T;T	0.04454	3.62;3.62;3.62	6.04	-2.31	0.06765	.	1.250830	0.05304	N	0.523450	T	0.09202	0.0227	L	0.50333	1.59	0.09310	N	1	P;D;P	0.54397	0.928;0.966;0.952	B;P;P	0.51833	0.347;0.553;0.681	T	0.41822	-0.9487	10	0.30078	T	0.28	.	8.67	0.34145	0.2517:0.3609:0.3874:0.0	.	94;174;264	F8W951;F5H7E8;Q99572	.;.;P2RX7_HUMAN	H	264;94;174	ENSP00000442349:R264H;ENSP00000330696:R94H;ENSP00000442572:R174H	ENSP00000330696:R94H	R	+	2	0	P2RX7	120089720	0.000000	0.05858	0.002000	0.10522	0.720000	0.41350	0.138000	0.16016	-0.291000	0.09012	0.563000	0.77884	CGT	rs149639375	P2RX7	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor		0.517	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX7	HGNC	protein_coding	OTTHUMT00000402532.1	0	0	0	62	62	120	0.00	0.00	G	NM_002562		121605337	+1	8	21	38	121	tier1	no_errors	ENST00000546057	ensembl	human	known	74_37	missense	17.39	14.79	SNP	0.000	A	8	38
MARCH1	55016	genome.wustl.edu	37	4	164533818	164533818	+	Intron	SNP	G	G	A	rs575707342	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:164533818G>A	ENST00000503008.1	-	5	1219				MARCH1_ENST00000514618.1_Silent_p.N205N|MARCH1_ENST00000339875.5_Intron|MARCH1_ENST00000274056.7_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GCTCAATTCCGTTAGGAGTGG	0.413													ENSG00000145416	G|||	2	0.000399361	0.0	0.0014	5008	,	,		18531	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			-	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.242+647C>T	4.37:g.164533818G>A			D3DP29|Q9NWR0	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.N205	ENST00000503008.1	37	c.615	CCDS54814.1	4																																																																																			-	MARCH1	-	NULL		0.413	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH1	HGNC	protein_coding	OTTHUMT00000364493.2	0	0	0	55	55	72	0.00	0.00	G	NM_017923		164533818	-1	11	17	47	88	tier1	no_errors	ENST00000514618	ensembl	human	novel	74_37	silent	18.64	16.04	SNP	0.000	A	11	47
CRYBA4	1413	genome.wustl.edu	37	22	27026429	27026429	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr22:27026429G>T	ENST00000354760.3	+	6	604	c.569G>T	c.(568-570)aGc>aTc	p.S190I	CRYBA4_ENST00000466315.1_3'UTR	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	190	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						CAGGTGCAGAGCATCCGCAGG	0.582													ENSG00000196431																																					0													50.0	45.0	47.0					22																	27026429		2203	4300	6503	SO:0001583	missense	0			-		CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.569G>T	22.37:g.27026429G>T	ENSP00000346805:p.Ser190Ile		Q4VB22|Q6ICE4	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.S190I	ENST00000354760.3	37	c.569	CCDS13841.1	22	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569729	0.65765	.	.	ENSG00000196431	ENST00000354760	D	0.91521	-2.86	4.42	3.34	0.38264	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.119374	0.56097	D	0.000028	D	0.96996	0.9019	H	0.99104	4.43	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96576	0.9427	10	0.87932	D	0	.	10.1525	0.42803	0.0:0.3257:0.6743:0.0	.	190	P53673	CRBA4_HUMAN	I	190	ENSP00000346805:S190I	ENSP00000346805:S190I	S	+	2	0	CRYBA4	25356429	1.000000	0.71417	0.926000	0.36857	0.347000	0.29111	5.456000	0.66665	2.299000	0.77371	0.555000	0.69702	AGC	-	CRYBA4	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin		0.582	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYBA4	HGNC	protein_coding	OTTHUMT00000320793.1	0	0	0	65	65	33	0.00	0.00	G	NM_001886		27026429	+1	9	10	42	68	tier1	no_errors	ENST00000354760	ensembl	human	known	74_37	missense	17.65	12.82	SNP	0.995	T	9	42
LAMC2	3918	genome.wustl.edu	37	1	183212350	183212350	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:183212350C>T	ENST00000264144.4	+	23	3462	c.3397C>T	c.(3397-3399)Cag>Tag	p.Q1133*		NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	1133	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						AGCCAAGACCCAGATCAACAG	0.522													ENSG00000058085																																					0													78.0	77.0	77.0					1																	183212350		2203	4300	6503	SO:0001587	stop_gained	0			-	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.3397C>T	1.37:g.183212350C>T	ENSP00000264144:p.Gln1133*		Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Nonsense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_B_type_IV,superfamily_Growth_fac_rcpt_N_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin	p.Q1133*	ENST00000264144.4	37	c.3397	CCDS1352.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.129043|8.129043	0.98667|0.98667	.|.	.|.	ENSG00000058085|ENSG00000058085	ENST00000537180|ENST00000264144	.|.	.|.	.|.	5.02|5.02	3.98|3.98	0.46160|0.46160	.|.	.|0.363187	.|0.25925	.|N	.|0.027409	T|.	0.56352|.	0.1979|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.48502|.	-0.9030|.	5|.	0.54805|0.21014	T|T	0.06|0.42	.|.	12.5752|12.5752	0.56359|0.56359	0.2507:0.7493:0.0:0.0|0.2507:0.7493:0.0:0.0	.|.	.|.	.|.	.|.	L|X	975|1133	.|.	ENSP00000438496:P975L|ENSP00000264144:Q1133X	P|Q	+|+	2|1	0|0	LAMC2|LAMC2	181478973|181478973	0.392000|0.392000	0.25229|0.25229	0.991000|0.991000	0.47740|0.47740	0.807000|0.807000	0.45602|0.45602	1.012000|1.012000	0.29924|0.29924	2.479000|2.479000	0.83701|0.83701	0.650000|0.650000	0.86243|0.86243	CCA|CAG	-	LAMC2	-	NULL		0.522	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC2	HGNC	protein_coding	OTTHUMT00000086258.1	0	0	0	37	37	37	0.00	0.00	C	NM_005562		183212350	+1	17	19	40	69	tier1	no_errors	ENST00000264144	ensembl	human	known	74_37	nonsense	29.82	21.59	SNP	0.346	T	17	40
ARAP1	116985	genome.wustl.edu	37	11	72404505	72404505	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:72404505G>A	ENST00000393609.3	-	29	4021	c.3819C>T	c.(3817-3819)gtC>gtT	p.V1273V	ARAP1_ENST00000426523.1_Silent_p.V1028V|ARAP1_ENST00000455638.2_Silent_p.V1273V|ARAP1_ENST00000429686.1_Silent_p.V967V|ARAP1_ENST00000359373.5_Silent_p.V1273V|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000334211.8_Silent_p.V1028V|ARAP1_ENST00000393605.3_Silent_p.V1033V|ARAP1-AS1_ENST00000542022.1_RNA	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1273					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TGGTGTCACCGACACGGCTGG	0.657													ENSG00000186635																									Ovarian(102;1198 1520 13195 17913 37529)												0													80.0	75.0	77.0					11																	72404505		2200	4293	6493	SO:0001819	synonymous_variant	0			-	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3819C>T	11.37:g.72404505G>A			A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_Ras-assoc,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.V1273	ENST00000393609.3	37	c.3819	CCDS41687.1	11																																																																																			-	ARAP1	-	NULL		0.657	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	HGNC	protein_coding	OTTHUMT00000347428.1	0	0	0	72	72	29	0.00	0.00	G	NM_001040118		72404505	-1	11	8	40	42	tier1	no_errors	ENST00000393609	ensembl	human	known	74_37	silent	21.57	16.00	SNP	0.993	A	11	40
RARB	5915	genome.wustl.edu	37	3	25636129	25636129	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:25636129C>G	ENST00000404969.1	+	7	1131	c.1131C>G	c.(1129-1131)atC>atG	p.I377M	RARB_ENST00000330688.4_Missense_Mutation_p.I370M|RARB_ENST00000458646.1_Missense_Mutation_p.I258M|RARB_ENST00000462272.1_3'UTR|RARB_ENST00000437042.2_Missense_Mutation_p.I258M			P10826	RARB_HUMAN	retinoic acid receptor, beta	377	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TTCCAAAGATCTTAATGAAAA	0.418													ENSG00000077092																																					0													119.0	113.0	115.0					3																	25636129		2203	4300	6503	SO:0001583	missense	0			-	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.1131C>G	3.37:g.25636129C>G	ENSP00000385865:p.Ile377Met		P12891|Q00989|Q15298|Q9UN48	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.I377M	ENST00000404969.1	37	c.1131		3	.	.	.	.	.	.	.	.	.	.	C	1.932	-0.445682	0.04604	.	.	ENSG00000077092	ENST00000383772;ENST00000404969;ENST00000538226;ENST00000437042;ENST00000330688;ENST00000458646	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	5.13	5.13	0.70059	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.051494	0.85682	D	0.000000	T	0.17874	0.0429	N	0.04116	-0.275	0.44611	D	0.997588	B;B	0.09022	0.002;0.001	B;B	0.24701	0.055;0.038	T	0.12477	-1.0546	10	0.11182	T	0.66	.	12.3238	0.54999	0.0:0.9221:0.0:0.0779	.	377;370	P10826;F1D8S6	RARB_HUMAN;.	M	377;377;377;258;370;258	ENSP00000373282:I377M;ENSP00000385865:I377M;ENSP00000398840:I258M;ENSP00000332296:I370M;ENSP00000391391:I258M	ENSP00000332296:I370M	I	+	3	3	RARB	25611133	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.811000	0.27198	2.558000	0.86282	0.591000	0.81541	ATC	-	RARB	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Nuc_orph_rcpt		0.418	RARB-201	KNOWN	basic	protein_coding	RARB	HGNC	protein_coding		0	0	0	43	43	78	0.00	0.00	C	NM_000965, NM_016152		25636129	+1	19	31	29	75	tier1	no_errors	ENST00000404969	ensembl	human	known	74_37	missense	38.78	29.25	SNP	1.000	G	19	29
SLC10A7	84068	genome.wustl.edu	37	4	147227160	147227160	+	Splice_Site	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:147227160A>G	ENST00000507030.1	-	7	472	c.473T>C	c.(472-474)cTt>cCt	p.L158P	SLC10A7_ENST00000335472.7_Splice_Site_p.L158P|SLC10A7_ENST00000394062.3_Splice_Site_p.L158P|SLC10A7_ENST00000432059.2_Splice_Site_p.L145P|SLC10A7_ENST00000264986.3_3'UTR			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7	158					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					AGATGAACCAAGCTGTAAAAC	0.348													ENSG00000120519																																					0													70.0	66.0	67.0					4																	147227160		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.472-1T>C	4.37:g.147227160A>G			A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Missense_Mutation	SNP	pfam_BilAc/Na_symport,pirsf_Put_Na-Bile_cotransptr	p.L158P	ENST00000507030.1	37	c.473	CCDS34073.1	4	.	.	.	.	.	.	.	.	.	.	A	22.4	4.278792	0.80692	.	.	ENSG00000120519	ENST00000432059;ENST00000335472;ENST00000507030;ENST00000394062	.	.	.	5.95	5.95	0.96441	.	0.057870	0.64402	D	0.000001	D	0.83755	0.5323	M	0.85197	2.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.982;0.989;0.974	D	0.86385	0.1732	9	0.87932	D	0	-17.4096	16.4237	0.83790	1.0:0.0:0.0:0.0	.	145;158;158	Q0GE19-3;Q0GE19;Q0GE19-2	.;NTCP7_HUMAN;.	P	145;158;158;158	.	ENSP00000334594:L158P	L	-	2	0	SLC10A7	147446610	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.842000	0.86851	2.279000	0.76181	0.533000	0.62120	CTT	-	SLC10A7	-	pfam_BilAc/Na_symport,pirsf_Put_Na-Bile_cotransptr		0.348	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	SLC10A7	HGNC	protein_coding	OTTHUMT00000366932.1	0	0	0	42	42	90	0.00	0.00	A	NM_032128	Missense_Mutation	147227160	-1	4	12	30	41	tier1	no_errors	ENST00000394062	ensembl	human	known	74_37	missense	11.76	22.64	SNP	1.000	G	4	30
KIF3B	9371	genome.wustl.edu	37	20	30917948	30917948	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr20:30917948A>G	ENST00000375712.3	+	8	2140	c.1973A>G	c.(1972-1974)gAa>gGa	p.E658G	KIF3B_ENST00000418717.2_Missense_Mutation_p.E284G	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	658	Globular.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTGCAGGCAGAAAACATTGTG	0.552													ENSG00000101350																																					0													50.0	46.0	47.0					20																	30917948		2203	4300	6503	SO:0001583	missense	0			-	AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1973A>G	20.37:g.30917948A>G	ENSP00000364864:p.Glu658Gly		B2RMP4|B4DSR5|E1P5M5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E658G	ENST00000375712.3	37	c.1973	CCDS13200.1	20	.	.	.	.	.	.	.	.	.	.	A	25.2	4.614297	0.87359	.	.	ENSG00000101350	ENST00000375712;ENST00000418717	T;T	0.78126	-1.15;0.0	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.87569	0.6210	M	0.85777	2.775	0.80722	D	1	D;D	0.64830	0.969;0.994	P;P	0.62813	0.785;0.907	D	0.89294	0.3621	10	0.56958	D	0.05	.	14.5009	0.67722	1.0:0.0:0.0:0.0	.	284;658	B4DSR5;O15066	.;KIF3B_HUMAN	G	658;284	ENSP00000364864:E658G;ENSP00000406287:E284G	ENSP00000364864:E658G	E	+	2	0	KIF3B	30381609	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.609000	0.90898	2.069000	0.61940	0.533000	0.62120	GAA	-	KIF3B	-	NULL		0.552	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	0	0	0	55	55	50	0.00	0.00	A	NM_004798		30917948	+1	6	7	56	62	tier1	no_errors	ENST00000375712	ensembl	human	known	74_37	missense	9.68	10.14	SNP	1.000	G	6	56
ZFR	51663	genome.wustl.edu	37	5	32379260	32379260	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:32379260G>A	ENST00000265069.8	-	17	2898	c.2796C>T	c.(2794-2796)ctC>ctT	p.L932L	ZFR_ENST00000510369.1_5'UTR|AC008949.1_ENST00000411029.1_RNA	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	932	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		CTCGCTGACAGAGGTCTCGAA	0.388													ENSG00000056097																																					0													81.0	78.0	79.0					5																	32379260		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2796C>T	5.37:g.32379260G>A			B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Silent	SNP	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.L932	ENST00000265069.8	37	c.2796	CCDS34139.1	5																																																																																			-	ZFR	-	pfam_DZF,smart_DZF		0.388	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	0	0	0	21	21	99	0.00	0.00	G			32379260	-1	7	58	24	216	tier1	no_errors	ENST00000265069	ensembl	human	known	74_37	silent	22.58	21.17	SNP	0.993	A	7	24
ACSL6	23305	genome.wustl.edu	37	5	131298244	131298244	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:131298244T>C	ENST00000379240.1	-	18	1919	c.1766A>G	c.(1765-1767)cAt>cGt	p.H589R	ACSL6_ENST00000357096.1_Missense_Mutation_p.H514R|ACSL6_ENST00000431707.1_Missense_Mutation_p.H569R|ACSL6_ENST00000379272.2_Missense_Mutation_p.H604R|ACSL6_ENST00000379249.3_Missense_Mutation_p.H589R|ACSL6_ENST00000544770.1_Missense_Mutation_p.H498R|ACSL6_ENST00000379244.1_Missense_Mutation_p.H589R|AC034228.4_ENST00000446275.1_RNA|ACSL6_ENST00000296869.4_Missense_Mutation_p.H614R|ACSL6_ENST00000379246.1_Missense_Mutation_p.H600R|ACSL6_ENST00000379264.2_Missense_Mutation_p.H614R|ACSL6_ENST00000379255.1_Missense_Mutation_p.H514R|ACSL6_ENST00000543479.1_Missense_Mutation_p.H589R			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	589					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCTGTCCCCATGGACATAGAT	0.468													ENSG00000164398																																					0													82.0	77.0	79.0					5																	131298244		2203	4300	6503	SO:0001583	missense	0			-	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1766A>G	5.37:g.131298244T>C	ENSP00000368542:p.His589Arg		J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.H614R	ENST00000379240.1	37	c.1841		5	.	.	.	.	.	.	.	.	.	.	T	22.1	4.246085	0.80024	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479	T;T;T;T;T;T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.57359	0.2048	H	0.96576	3.845	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.995;0.992;0.999;0.995;0.997;0.995	D;D;P;D;D;D;D	0.79784	0.993;0.962;0.899;0.984;0.962;0.975;0.962	T	0.73512	-0.3959	10	0.87932	D	0	.	15.7884	0.78326	0.0:0.0:0.0:1.0	.	589;604;579;589;514;614;614	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	R	589;614;604;514;514;614;600;589;498;589;569;589	ENSP00000368551:H589R;ENSP00000368566:H614R;ENSP00000368574:H604R;ENSP00000349608:H514R;ENSP00000368557:H514R;ENSP00000296869:H614R;ENSP00000368548:H600R;ENSP00000368546:H589R;ENSP00000445154:H498R;ENSP00000368542:H589R;ENSP00000413329:H569R;ENSP00000442124:H589R	ENSP00000296869:H614R	H	-	2	0	ACSL6	131326143	1.000000	0.71417	0.990000	0.47175	0.832000	0.47134	7.953000	0.87836	2.144000	0.66660	0.459000	0.35465	CAT	-	ACSL6	-	NULL		0.468	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	ACSL6	HGNC	protein_coding	OTTHUMT00000132622.1	0	0	0	27	27	84	0.00	0.00	T	NM_015256		131298244	-1	5	22	38	94	tier1	no_errors	ENST00000296869	ensembl	human	known	74_37	missense	11.63	18.97	SNP	1.000	C	5	38
SRCIN1	80725	genome.wustl.edu	37	17	36700164	36700164	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:36700164G>A	ENST00000264659.7	-	18	3535	c.3311C>T	c.(3310-3312)cCg>cTg	p.P1104L	SRCIN1_ENST00000398579.4_5'UTR|SRCIN1_ENST00000578925.1_Missense_Mutation_p.P1138L	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	976					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						AGAGGCCCCCGGAGTCACCAC	0.627													ENSG00000017373																																					0													20.0	24.0	22.0					17																	36700164		2166	4262	6428	SO:0001583	missense	0			-		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.3311C>T	17.37:g.36700164G>A	ENSP00000264659:p.Pro1104Leu		Q75T46|Q8N4W8	Missense_Mutation	SNP	pfam_AIP3_C	p.P1104L	ENST00000264659.7	37	c.3311	CCDS45660.1	17	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495434	0.64186	.	.	ENSG00000017373	ENST00000264659;ENST00000542707;ENST00000398579	T	0.49720	0.77	5.23	4.25	0.50352	.	0.070532	0.64402	D	0.000016	T	0.42177	0.1191	L	0.44542	1.39	0.51012	D	0.999901	D;D;P	0.57257	0.979;0.958;0.905	B;B;B	0.42995	0.404;0.266;0.194	T	0.44967	-0.9293	10	0.72032	D	0.01	-8.4047	13.0983	0.59206	0.0803:0.0:0.9197:0.0	.	976;976;1104	Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;SRCN1_HUMAN;.	L	1104;885;999	ENSP00000264659:P1104L	ENSP00000264659:P1104L	P	-	2	0	SRCIN1	33953690	1.000000	0.71417	0.901000	0.35422	0.981000	0.71138	4.143000	0.58051	1.179000	0.42884	0.462000	0.41574	CCG	-	SRCIN1	-	NULL		0.627	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	HGNC	protein_coding	OTTHUMT00000441878.4	0	0	0	137	137	15	0.00	0.00	G	NM_025248		36700164	-1	43	14	101	17	tier1	no_errors	ENST00000264659	ensembl	human	known	74_37	missense	29.86	45.16	SNP	0.995	A	43	101
CEACAM5	1048	genome.wustl.edu	37	19	42224881	42224881	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr19:42224881C>G	ENST00000221992.6	+	8	1925	c.1811C>G	c.(1810-1812)tCt>tGt	p.S604C	CEACAM5_ENST00000405816.1_Missense_Mutation_p.S604C|CEACAM5_ENST00000398599.4_Missense_Mutation_p.S603C|CEA_ENST00000598976.1_Intron	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	604	Ig-like 7.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CCAGACTCGTCTTACCTTTCG	0.547													ENSG00000105388																																					0													139.0	137.0	138.0					19																	42224881		2203	4300	6503	SO:0001583	missense	0			-	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1811C>G	19.37:g.42224881C>G	ENSP00000221992:p.Ser604Cys		H9KVA7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S604C	ENST00000221992.6	37	c.1811	CCDS12584.1	19	.	.	.	.	.	.	.	.	.	.	C	9.159	1.018138	0.19355	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.13307	2.6;2.6	2.17	-0.0978	0.13631	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28699	0.0711	M	0.77486	2.375	0.09310	N	1	D;P	0.58970	0.984;0.953	D;P	0.66196	0.942;0.819	T	0.11275	-1.0594	9	0.56958	D	0.05	.	2.9099	0.05733	0.4808:0.3367:0.1824:0.0	.	604;604	P06731;Q53G30	CEAM5_HUMAN;.	C	604;604;322	ENSP00000221992:S604C;ENSP00000385072:S604C	ENSP00000221992:S604C	S	+	2	0	CEACAM5	46916721	0.010000	0.17322	0.002000	0.10522	0.004000	0.04260	0.717000	0.25851	-0.073000	0.12842	0.467000	0.42956	TCT	-	CEACAM5	-	smart_Ig_sub,pfscan_Ig-like_dom		0.547	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	HGNC	protein_coding	OTTHUMT00000321132.2	0	0	0	79	79	87	0.00	0.00	C	NM_004363		42224881	+1	7	21	54	123	tier1	no_errors	ENST00000221992	ensembl	human	known	74_37	missense	11.48	14.48	SNP	0.002	G	7	54
IDH1	3417	genome.wustl.edu	37	2	209110099	209110099	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr2:209110099G>C	ENST00000415913.1	-	5	845	c.464C>G	c.(463-465)aCc>aGc	p.T155S	IDH1_ENST00000345146.2_Missense_Mutation_p.T155S|IDH1_ENST00000446179.1_Missense_Mutation_p.T155S	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	155					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TGGTGTGTAGGTTATCTCTAC	0.373			Mis		gliobastoma								ENSG00000138413																									Pancreas(158;264 1958 3300 35450 36047)			Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	0													152.0	139.0	144.0					2																	209110099		2203	4300	6503	SO:0001583	missense	0			-		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.464C>G	2.37:g.209110099G>C	ENSP00000390265:p.Thr155Ser		Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_DP,tigrfam_Isocitrate_DH_DP	p.T155S	ENST00000415913.1	37	c.464	CCDS2381.1	2	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318018	0.40996	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.66	2.76	0.32466	Isopropylmalate dehydrogenase-like domain (2);	0.357409	0.34879	N	0.003620	T	0.66167	0.2762	L	0.42632	1.34	0.41368	D	0.987479	B	0.02656	0.0	B	0.06405	0.002	T	0.63005	-0.6733	10	0.41790	T	0.15	-6.2791	7.1387	0.25543	0.2024:0.1282:0.6694:0.0	.	155	O75874	IDHC_HUMAN	S	155	ENSP00000260985:T155S;ENSP00000410513:T155S;ENSP00000390265:T155S;ENSP00000391075:T155S	ENSP00000260985:T155S	T	-	2	0	IDH1	208818344	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	1.312000	0.33574	1.398000	0.46701	0.561000	0.74099	ACC	-	IDH1	-	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_DP,tigrfam_Isocitrate_DH_DP		0.373	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IDH1	HGNC	protein_coding	OTTHUMT00000336672.1	0	0	0	56	56	135	0.00	0.00	G			209110099	-1	24	57	27	84	tier1	no_errors	ENST00000345146	ensembl	human	known	74_37	missense	47.06	40.43	SNP	1.000	C	24	27
OR56A3	390083	genome.wustl.edu	37	11	5969152	5969152	+	Silent	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:5969152C>T	ENST00000329564.6	+	1	583	c.576C>T	c.(574-576)tcC>tcT	p.S192S	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCAGACTCTCCTGCGATGATG	0.468													ENSG00000184478																																					0													116.0	116.0	116.0					11																	5969152		2159	4286	6445	SO:0001819	synonymous_variant	0			-		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.576C>T	11.37:g.5969152C>T			A6NN77|Q6IFF7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S192	ENST00000329564.6	37	c.576	CCDS41614.1	11																																																																																			-	OR56A3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.468	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR56A3	HGNC	protein_coding	OTTHUMT00000383753.1	0	0	0	53	53	73	0.00	0.00	C	NM_001003443		5969152	+1	8	25	17	70	tier1	no_errors	ENST00000329564	ensembl	human	known	74_37	silent	32.00	26.32	SNP	0.998	T	8	17
CNTNAP5	129684	genome.wustl.edu	37	2	125547486	125547486	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr2:125547486G>A	ENST00000431078.1	+	18	3121	c.2757G>A	c.(2755-2757)acG>acA	p.T919T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	919	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TAGGGGGAACGTCATCCAGAC	0.418													ENSG00000155052																																					0													46.0	43.0	44.0					2																	125547486		1946	4157	6103	SO:0001819	synonymous_variant	0			-	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2757G>A	2.37:g.125547486G>A			Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.T919	ENST00000431078.1	37	c.2757	CCDS46401.1	2																																																																																			-	CNTP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.418	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTP5	HGNC	protein_coding	OTTHUMT00000330864.3	0	0	0	45	45	83	0.00	0.00	G			125547486	+1	6	40	26	56	tier1	no_errors	ENST00000431078	ensembl	human	known	74_37	silent	18.75	41.67	SNP	1.000	A	6	26
PCDHGA4	56111	genome.wustl.edu	37	5	140736262	140736262	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:140736262G>A	ENST00000571252.1	+	1	1495	c.1495G>A	c.(1495-1497)Gca>Aca	p.A499T	PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	499	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCCAGGGTGCACCTCTGTC	0.517													ENSG00000262576																																					0													128.0	135.0	133.0					5																	140736262		2096	4256	6352	SO:0001583	missense	0			-	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1495G>A	5.37:g.140736262G>A	ENSP00000458570:p.Ala499Thr		Q9Y5D3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A499T	ENST00000571252.1	37	c.1495	CCDS58979.1	5																																																																																			-	PCDHGA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.517	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	0	0	0	39	39	75	0.00	0.00	G	NM_018917		140736262	+1	15	38	19	89	tier1	no_errors	ENST00000571252	ensembl	human	known	74_37	missense	44.12	29.92	SNP	0.000	A	15	19
KRT12	3859	genome.wustl.edu	37	17	39023145	39023145	+	Silent	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:39023145C>T	ENST00000251643.4	-	1	317	c.294G>A	c.(292-294)ggG>ggA	p.G98G		NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	98	Gly-rich.|Head.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	CAAATCCCATCCCCAGCCCTC	0.562													ENSG00000187242																																					0													99.0	120.0	113.0					17																	39023145		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.294G>A	17.37:g.39023145C>T			B2R9E0	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.G98	ENST00000251643.4	37	c.294	CCDS11378.1	17																																																																																			-	KRT12	-	NULL		0.562	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT12	HGNC	protein_coding	OTTHUMT00000257214.2	0	0	0	75	75	63	0.00	0.00	C	NM_000223		39023145	-1	21	34	35	64	tier1	no_errors	ENST00000251643	ensembl	human	known	74_37	silent	36.84	34.69	SNP	0.002	T	21	35
PCDHGA1	56114	genome.wustl.edu	37	5	140710512	140710512	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:140710512G>A	ENST00000517417.1	+	1	261	c.261G>A	c.(259-261)gcG>gcA	p.A87A	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Silent_p.A87A	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	87	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATCACCGCGCGCAGGATAG	0.537													ENSG00000204956																																					0													109.0	122.0	117.0					5																	140710512		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.261G>A	5.37:g.140710512G>A			Q2M273|Q9Y5D6	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A87	ENST00000517417.1	37	c.261	CCDS54922.1	5																																																																																			-	PCDHGA1	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.537	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	0	0	0	28	28	47	0.00	0.00	G	NM_018912		140710512	+1	5	20	28	53	tier1	no_errors	ENST00000517417	ensembl	human	known	74_37	silent	15.15	27.40	SNP	0.004	A	5	28
KLRC3	3823	genome.wustl.edu	37	12	10588425	10588425	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:10588425C>T	ENST00000539033.1	-	1	175	c.161G>A	c.(160-162)gGg>gAg	p.G54E	KLRC2_ENST00000381902.2_Missense_Mutation_p.G54E|KLRC2_ENST00000381901.1_Missense_Mutation_p.G54E|KLRC2_ENST00000536833.2_Intron																							TTTATCAATCCCTTGATGATT	0.338													ENSG00000255641																																					0													110.0	120.0	116.0					12																	10588425		2124	4212	6336	SO:0001583	missense	0			-																												ENST00000539033.1:c.161G>A	12.37:g.10588425C>T	ENSP00000437563:p.Gly54Glu			Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G54E	ENST00000539033.1	37	c.161		12	.	.	.	.	.	.	.	.	.	.	C	5.455	0.268987	0.10349	.	.	ENSG00000255641;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000381901	T;T;T	0.05717	3.4;3.4;3.4	1.91	0.998	0.19857	.	1.377710	0.04503	N	0.381643	T	0.16685	0.0401	M	0.82630	2.6	0.09310	N	1	B;B;B	0.30511	0.109;0.098;0.282	B;B;B	0.42798	0.163;0.144;0.398	T	0.40459	-0.9562	10	0.42905	T	0.14	.	4.344	0.11124	0.0:0.7932:0.0:0.2068	.	40;54;54	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	E	54	ENSP00000437563:G54E;ENSP00000371327:G54E;ENSP00000371326:G54E	ENSP00000371326:G54E	G	-	2	0	KLRC2;RP11-277P12.6	10479692	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-1.324000	0.02690	0.388000	0.25054	0.184000	0.17185	GGG	-	NKG2-E	-	NULL		0.338	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	ENSG00000255641	Uniprot_gn	protein_coding	OTTHUMT00000400274.1	0	0	0	109	109	59	0.00	0.00	C			10588425	-1	13	6	60	27	tier1	no_errors	ENST00000539033	ensembl	human	known	74_37	missense	17.81	18.18	SNP	0.001	T	13	60
BNIP2	663	genome.wustl.edu	37	15	59955820	59955820	+	3'UTR	SNP	T	T	C	rs566176318		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:59955820T>C	ENST00000607373.1	-	0	1595				BNIP2_ENST00000478981.1_5'UTR|AC092755.4_ENST00000441746.1_RNA|BNIP2_ENST00000267859.3_3'UTR	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2						apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)			NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						AAAATTCTAATATGCACTTTA	0.274													ENSG00000140299	T|||	1	0.000199681	0.0	0.0	5008	,	,		16807	0.0		0.0	False		,,,				2504	0.001				Ovarian(174;1936 1978 6671 8240 38212)												0																																										SO:0001624	3_prime_UTR_variant	0			-	U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727	ENST00000607373.1:c.*448A>G	15.37:g.59955820T>C			B4DS94	R	SNP	-	NULL	ENST00000607373.1	37	NULL		15																																																																																			-	BNIP2	-	-		0.274	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	BNIP2	HGNC	protein_coding	OTTHUMT00000470740.1	0	0	0	56	56	105	0.00	0.00	T	NM_004330		59955820	-1	23	12	22	14	tier1	no_errors	ENST00000478981	ensembl	human	known	74_37	rna	51.11	46.15	SNP	0.931	C	23	22
TM7SF2	7108	genome.wustl.edu	37	11	64880999	64880999	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:64880999T>A	ENST00000279263.7	+	5	698	c.536T>A	c.(535-537)cTc>cAc	p.L179H	TM7SF2_ENST00000531029.1_Intron|TM7SF2_ENST00000540748.1_Missense_Mutation_p.L63H|AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Missense_Mutation_p.L179H	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	179				L -> V (in Ref. 4; AAH12857). {ECO:0000305}.	cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGACGAGAGCTCAACCCTCGT	0.532											OREG0021072	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000149809																																					0													231.0	236.0	234.0					11																	64880999		1931	4115	6046	SO:0001583	missense	0			-	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.536T>A	11.37:g.64880999T>A	ENSP00000279263:p.Leu179His	134	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Missense_Mutation	SNP	pfam_Ergosterol_biosynth_ERG4_ERG24,pfam_DUF1295	p.L179H	ENST00000279263.7	37	c.536	CCDS41669.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.2|25.2	4.608965|4.608965	0.87258|0.87258	.|.	.|.	ENSG00000149809|ENSG00000149809	ENST00000279263;ENST00000524986;ENST00000534371;ENST00000540748;ENST00000525385;ENST00000345348;ENST00000531321;ENST00000529414;ENST00000526085;ENST00000530750;ENST00000527968|ENST00000528802	D;D;D;D;D;D;D;D;D;D;D|.	0.99292|.	-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-2.29;-5.7|.	4.83|4.83	4.83|4.83	0.62350|0.62350	Sterol reductase, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85084|0.85084	0.5616|0.5616	H|H	0.94698|0.94698	3.57|3.57	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;0.999;1.0|.	D|D	0.88864|0.88864	0.3328|0.3328	10|5	0.87932|.	D|.	0|.	-0.757|-0.757	12.3862|12.3862	0.55333|0.55333	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	63;179;179|.	F5GYV3;O76062-2;O76062|.	.;.;ERG24_HUMAN|.	H|T	179;150;111;63;150;179;85;168;30;114;11|7	ENSP00000279263:L179H;ENSP00000435972:L150H;ENSP00000432187:L111H;ENSP00000441215:L63H;ENSP00000433325:L150H;ENSP00000329520:L179H;ENSP00000431300:L85H;ENSP00000433275:L168H;ENSP00000434447:L30H;ENSP00000432413:L114H;ENSP00000431685:L11H|.	ENSP00000279263:L179H|.	L|S	+|+	2|1	0|0	TM7SF2|TM7SF2	64637575|64637575	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	7.441000|7.441000	0.80485|0.80485	2.039000|2.039000	0.60335|0.60335	0.402000|0.402000	0.26972|0.26972	CTC|TCA	-	TM7SF2	-	pfam_Ergosterol_biosynth_ERG4_ERG24		0.532	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM7SF2	HGNC	protein_coding	OTTHUMT00000385234.1	0	0	0	59	59	81	0.00	0.00	T	NM_003273		64880999	+1	6	18	67	124	tier1	no_errors	ENST00000279263	ensembl	human	known	74_37	missense	8.22	12.68	SNP	1.000	A	6	67
NRIP1	8204	genome.wustl.edu	37	21	16338470	16338470	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:16338470C>T	ENST00000400202.1	-	3	2756	c.2044G>A	c.(2044-2046)Gaa>Aaa	p.E682K	AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000318948.4_Missense_Mutation_p.E682K|NRIP1_ENST00000400199.1_Missense_Mutation_p.E682K			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	682	Repression domain 2.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TTATTTTCTTCAACTGCATTT	0.388													ENSG00000180530																																					0													106.0	104.0	105.0					21																	16338470		2203	4300	6503	SO:0001583	missense	0			-	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2044G>A	21.37:g.16338470C>T	ENSP00000383063:p.Glu682Lys		Q8IWE8	Missense_Mutation	SNP	NULL	p.E682K	ENST00000400202.1	37	c.2044	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	C	16.28	3.078887	0.55753	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.23147	1.92;1.92;1.92	5.69	5.69	0.88448	.	0.154328	0.43416	D	0.000575	T	0.34337	0.0894	L	0.53249	1.67	0.46222	D	0.998935	P	0.50272	0.933	P	0.44811	0.461	T	0.08289	-1.0729	10	0.72032	D	0.01	-5.898	20.2085	0.98285	0.0:1.0:0.0:0.0	.	682	P48552	NRIP1_HUMAN	K	682	ENSP00000383060:E682K;ENSP00000383063:E682K;ENSP00000327213:E682K	ENSP00000327213:E682K	E	-	1	0	NRIP1	15260341	0.999000	0.42202	0.973000	0.42090	0.020000	0.10135	5.255000	0.65462	2.865000	0.98341	0.655000	0.94253	GAA	-	NRIP1	-	NULL		0.388	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	0	0	0	46	46	79	0.00	0.00	C	NM_003489		16338470	-1	17	35	38	79	tier1	no_errors	ENST00000318948	ensembl	human	known	74_37	missense	30.91	30.70	SNP	0.997	T	17	38
IGF2BP3	10643	genome.wustl.edu	37	7	23509681	23509681	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr7:23509681C>A	ENST00000258729.3	-	1	405	c.49G>T	c.(49-51)Gac>Tac	p.D17Y	IGF2BP3_ENST00000491719.1_5'Flank	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	17	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						CTTTCTAGGTCCGAGGGGGCG	0.493													ENSG00000136231																																					0													79.0	91.0	87.0					7																	23509681		2203	4300	6503	SO:0001583	missense	0			-	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.49G>T	7.37:g.23509681C>A	ENSP00000258729:p.Asp17Tyr		A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.D17Y	ENST00000258729.3	37	c.49	CCDS5382.1	7	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341423	0.81911	.	.	ENSG00000136231	ENST00000258729	T	0.12774	2.65	4.09	4.09	0.47781	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	U	0.000000	T	0.44993	0.1320	M	0.93375	3.41	0.80722	D	1	P	0.51240	0.943	P	0.59424	0.857	T	0.63051	-0.6723	10	0.72032	D	0.01	-12.1306	16.2899	0.82742	0.0:1.0:0.0:0.0	.	17	O00425	IF2B3_HUMAN	Y	17	ENSP00000258729:D17Y	ENSP00000258729:D17Y	D	-	1	0	IGF2BP3	23476206	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.403000	0.79983	1.800000	0.52685	0.557000	0.71058	GAC	-	IGF2BP3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.493	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP3	HGNC	protein_coding	OTTHUMT00000250243.2	0	0	0	91	91	59	0.00	0.00	C	NM_006547		23509681	-1	6	9	45	46	tier1	no_errors	ENST00000258729	ensembl	human	known	74_37	missense	11.76	16.07	SNP	1.000	A	6	45
NRIP1	8204	genome.wustl.edu	37	21	16337345	16337345	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:16337345C>G	ENST00000400202.1	-	3	3881	c.3169G>C	c.(3169-3171)Gac>Cac	p.D1057H	AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000318948.4_Missense_Mutation_p.D1057H|NRIP1_ENST00000400199.1_Missense_Mutation_p.D1057H			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1057	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		CTTGGAGAGTCTTTTTCATAC	0.418													ENSG00000180530																																					0													155.0	149.0	151.0					21																	16337345		2203	4300	6503	SO:0001583	missense	0			-	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.3169G>C	21.37:g.16337345C>G	ENSP00000383063:p.Asp1057His		Q8IWE8	Missense_Mutation	SNP	NULL	p.D1057H	ENST00000400202.1	37	c.3169	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948701	0.73787	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.27402	1.67;1.67;1.67	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52719	-0.8538	10	0.72032	D	0.01	-17.5931	20.4375	0.99097	0.0:1.0:0.0:0.0	.	1057	P48552	NRIP1_HUMAN	H	1057	ENSP00000383060:D1057H;ENSP00000383063:D1057H;ENSP00000327213:D1057H	ENSP00000327213:D1057H	D	-	1	0	NRIP1	15259216	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.356000	0.79445	2.906000	0.99361	0.655000	0.94253	GAC	-	NRIP1	-	NULL		0.418	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	0	0	0	77	77	86	0.00	0.00	C	NM_003489		16337345	-1	24	38	77	114	tier1	no_errors	ENST00000318948	ensembl	human	known	74_37	missense	23.76	25.00	SNP	1.000	G	24	77
SARDH	1757	genome.wustl.edu	37	9	136573521	136573521	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr9:136573521G>C	ENST00000371872.4	-	11	1615	c.1358C>G	c.(1357-1359)cCc>cGc	p.P453R	SARDH_ENST00000422262.2_Missense_Mutation_p.P285R|SARDH_ENST00000439388.1_Missense_Mutation_p.P453R	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	453					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GATCCAGCGGGGGTGGTCCGT	0.652													ENSG00000123453																																					0													68.0	75.0	73.0					9																	136573521		2203	4300	6503	SO:0001583	missense	0			-		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1358C>G	9.37:g.136573521G>C	ENSP00000360938:p.Pro453Arg		B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.P453R	ENST00000371872.4	37	c.1358	CCDS6978.1	9	.	.	.	.	.	.	.	.	.	.	G	0.166	-1.075873	0.01903	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227	D;D;D	0.84146	-1.81;-1.81;-1.81	5.16	-1.43	0.08884	.	1.820710	0.02193	N	0.061576	T	0.69797	0.3151	N	0.17312	0.475	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.54622	-0.8266	10	0.14656	T	0.56	-0.0244	1.8921	0.03250	0.1119:0.2797:0.3205:0.2879	.	453	Q9UL12	SARDH_HUMAN	R	453;453;285;453;453	ENSP00000360938:P453R;ENSP00000403084:P453R;ENSP00000415537:P285R	ENSP00000360938:P453R	P	-	2	0	SARDH	135563342	0.005000	0.15991	0.025000	0.17156	0.060000	0.15804	0.025000	0.13577	-0.149000	0.11215	-1.097000	0.02148	CCC	-	SARDH	-	NULL		0.652	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	HGNC	protein_coding	OTTHUMT00000054931.1	0	0	0	73	73	41	0.00	0.00	G			136573521	-1	15	10	64	53	tier1	no_errors	ENST00000371872	ensembl	human	known	74_37	missense	18.99	15.87	SNP	0.040	C	15	64
ZNF718	255403	genome.wustl.edu	37	4	155020	155020	+	lincRNA	SNP	T	T	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:155020T>C	ENST00000510175.1	+	0	455							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		TCATTTCACGTGCTCTCACGC	0.338													ENSG00000250312																																					0													28.0	31.0	30.0					4																	155020		2083	4221	6304			0			-	AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155020T>C			Q3SXZ4|Q3SXZ5	R	SNP	-	NULL	ENST00000510175.1	37	NULL		4																																																																																			-	ZNF718	-	-		0.338	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	HGNC	lincRNA	OTTHUMT00000357865.3	0	0	0	39	39	76	0.00	0.00	T	NM_001039127		155020	+1	3	17	11	77	tier1	no_errors	ENST00000400172	ensembl	human	known	74_37	rna	21.43	18.09	SNP	0.001	C	3	11
ERICH3	127254	genome.wustl.edu	37	1	75038857	75038857	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:75038857T>A	ENST00000326665.5	-	14	2755	c.2537A>T	c.(2536-2538)gAa>gTa	p.E846V	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		846	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TCTGACCCCTTCTGCTTCTGC	0.532													ENSG00000178965																																					0													117.0	111.0	113.0					1																	75038857		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000326665.5:c.2537A>T	1.37:g.75038857T>A	ENSP00000322609:p.Glu846Val		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.E846V	ENST00000326665.5	37	c.2537	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701652	0.68501	.	.	ENSG00000178965	ENST00000326665	T	0.18657	2.2	4.95	1.22	0.21188	.	.	.	.	.	T	0.17323	0.0416	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.03750	-1.1007	9	0.56958	D	0.05	-0.0045	6.8518	0.24018	0.0:0.0776:0.2861:0.6364	.	846	Q5RHP9	CA173_HUMAN	V	846	ENSP00000322609:E846V	ENSP00000322609:E846V	E	-	2	0	C1orf173	74811445	0.002000	0.14202	0.658000	0.29665	0.177000	0.22998	0.402000	0.20965	-0.042000	0.13535	0.460000	0.39030	GAA	-	C1orf173	-	NULL		0.532	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	0	0	0	61	61	42	0.00	0.00	T			75038857	-1	5	7	31	38	tier1	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	13.89	15.56	SNP	0.966	A	5	31
PLCXD3	345557	genome.wustl.edu	37	5	41313778	41313778	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:41313778A>T	ENST00000377801.3	-	3	981	c.907T>A	c.(907-909)Ttt>Att	p.F303I	PLCXD3_ENST00000328457.3_Missense_Mutation_p.F303I			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	303					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GTGCTGATAAAGTCACCAAGT	0.453													ENSG00000182836																																					0													125.0	111.0	116.0					5																	41313778		2203	4300	6503	SO:0001583	missense	0			-		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.907T>A	5.37:g.41313778A>T	ENSP00000367032:p.Phe303Ile		A6NL04	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.F303I	ENST00000377801.3	37	c.907	CCDS34150.1	5	.	.	.	.	.	.	.	.	.	.	A	34	5.302475	0.95601	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	5.65	5.65	0.86999	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.046906	0.85682	D	0.000000	T	0.73969	0.3655	M	0.72894	2.215	0.80722	D	1	D	0.54601	0.967	P	0.60789	0.879	T	0.70615	-0.4823	9	0.15952	T	0.53	-11.6682	15.8879	0.79264	1.0:0.0:0.0:0.0	.	303	Q63HM9	PLCX3_HUMAN	I	303	.	ENSP00000333751:F303I	F	-	1	0	PLCXD3	41349535	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.886000	0.92447	2.163000	0.67991	0.533000	0.62120	TTT	-	PLCXD3	-	superfamily_PLC-like_Pdiesterase_TIM-brl		0.453	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCXD3	HGNC	protein_coding	OTTHUMT00000367109.1	0	0	0	34	34	69	0.00	0.00	A	XM_293875		41313778	-1	12	26	33	127	tier1	no_errors	ENST00000328457	ensembl	human	known	74_37	missense	26.67	16.99	SNP	1.000	T	12	33
HSF2BP	11077	genome.wustl.edu	37	21	44949728	44949728	+	Missense_Mutation	SNP	C	C	T	rs145814386		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:44949728C>T	ENST00000291560.2	-	9	1242	c.911G>A	c.(910-912)cGc>cAc	p.R304H	HSF2BP_ENST00000542962.1_Missense_Mutation_p.R229H	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	304					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		TGCCAGGATGCGTTGCAGGGG	0.587													ENSG00000160207																																					0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	69.0	70.0	69.0		911	3.4	1.0	21	dbSNP_134	69	0,8600		0,0,4300	no	missense	HSF2BP	NM_007031.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	304/335	44949728	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.911G>A	21.37:g.44949728C>T	ENSP00000291560:p.Arg304His		B4DX36	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R304H	ENST00000291560.2	37	c.911	CCDS13697.1	21	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489271	0.44249	2.27E-4	0.0	ENSG00000160207	ENST00000291560;ENST00000542962	T;T	0.68331	-0.32;0.75	5.57	3.43	0.39272	Armadillo-like helical (1);Armadillo-type fold (1);	0.201479	0.53938	N	0.000050	T	0.50171	0.1600	N	0.25426	0.745	0.47214	D	0.999359	B	0.24651	0.108	B	0.17098	0.017	T	0.49041	-0.8980	10	0.41790	T	0.15	.	10.4185	0.44335	0.0:0.7628:0.0:0.2372	.	304	O75031	HSF2B_HUMAN	H	304;229	ENSP00000291560:R304H;ENSP00000443367:R229H	ENSP00000291560:R304H	R	-	2	0	HSF2BP	43774156	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	1.912000	0.39946	1.369000	0.46134	0.563000	0.77884	CGC	rs145814386	HSF2BP	-	superfamily_ARM-type_fold		0.587	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2BP	HGNC	protein_coding	OTTHUMT00000195620.1	0	0	0	84	84	53	0.00	0.00	C	NM_007031		44949728	-1	16	18	73	77	tier1	no_errors	ENST00000291560	ensembl	human	known	74_37	missense	17.98	18.95	SNP	1.000	T	16	73
SLC4A2	6522	genome.wustl.edu	37	7	150772280	150772280	+	Intron	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr7:150772280G>C	ENST00000485713.1	+	20	4087				SLC4A2_ENST00000310317.5_Intron|SLC4A2_ENST00000392826.2_Intron|RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000461735.1_Intron|SLC4A2_ENST00000413384.2_Intron	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2						anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATTCTGGAAAGACCCTGTGGT	0.592													ENSG00000244151																																					0																																										SO:0001627	intron_variant	0			-		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3048-62G>C	7.37:g.150772280G>C			B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	R	SNP	-	NULL	ENST00000485713.1	37	NULL	CCDS5917.1	7																																																																																			-	RP11-148K1.12	-	-		0.592	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000244151	Clone_based_vega_gene	protein_coding	OTTHUMT00000351039.1	0	0	0	50	50	46	0.00	0.00	G	NM_003040		150772280	-1	11	23	21	34	tier1	no_errors	ENST00000485974	ensembl	human	known	74_37	rna	34.38	40.35	SNP	0.056	C	11	21
SFT2D2	375035	genome.wustl.edu	37	1	168216218	168216218	+	3'UTR	SNP	A	A	G	rs573236357		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:168216218A>G	ENST00000271375.4	+	0	4995				ANKRD36BP1_ENST00000358576.4_RNA	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					AATGGTTTTTATGCAACAGGT	0.318													ENSG00000214262																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.*4440A>G	1.37:g.168216218A>G				R	SNP	-	NULL	ENST00000271375.4	37	NULL	CCDS1271.1	1																																																																																			-	ANKRD36BP1	-	-		0.318	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36BP1	HGNC	protein_coding	OTTHUMT00000083827.2	0	0	0	86	86	67	0.00	0.00	A	NM_199344		168216218	-1	13	17	132	79	tier1	no_errors	ENST00000358576	ensembl	human	known	74_37	rna	8.97	17.53	SNP	0.294	G	13	132
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	85	85	101	0.00	0.00	G	NM_000546		7578212	-1	48	100	21	56	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	69.57	63.69	SNP	0.893	A	48	21
SPATA31E1	286234	genome.wustl.edu	37	9	90500141	90500141	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr9:90500141C>A	ENST00000325643.5	+	4	805	c.739C>A	c.(739-741)Cag>Aag	p.Q247K		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	247	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCTTCACCACAGCCGCATGG	0.632													ENSG00000177992																																					0													87.0	94.0	92.0					9																	90500141		2203	4300	6503	SO:0001583	missense	0			-	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.739C>A	9.37:g.90500141C>A	ENSP00000322640:p.Gln247Lys		B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.Q247K	ENST00000325643.5	37	c.739	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.189199	0.00302	.	.	ENSG00000177992	ENST00000325643	T	0.03242	4.0	0.781	-0.641	0.11490	.	.	.	.	.	T	0.02455	0.0075	L	0.36672	1.1	0.09310	N	1	B	0.26975	0.165	B	0.26969	0.075	T	0.46925	-0.9156	9	0.05833	T	0.94	.	4.5156	0.11934	0.0:0.5858:0.4142:0.0	.	247	Q6ZUB1	CI079_HUMAN	K	247	ENSP00000322640:Q247K	ENSP00000322640:Q247K	Q	+	1	0	C9orf79	89689961	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.907000	0.28531	-0.217000	0.10033	-0.519000	0.04390	CAG	-	SPATA31E1	-	NULL		0.632	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	0	0	0	49	49	72	0.00	0.00	C	NM_178828		90500141	+1	7	24	41	78	tier1	no_errors	ENST00000325643	ensembl	human	known	74_37	missense	14.58	23.53	SNP	0.001	A	7	41
PABPC4L	132430	genome.wustl.edu	37	4	135121102	135121102	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:135121102C>A	ENST00000421491.3	-	2	1329	c.1073G>T	c.(1072-1074)gGc>gTc	p.G358V	PABPC4L_ENST00000529122.2_Missense_Mutation_p.G416V			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	358	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						AGGTTTGGAGCCCAAGATGCG	0.493													ENSG00000254535																																					0													58.0	49.0	52.0					4																	135121102		692	1591	2283	SO:0001583	missense	0			-	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.1073G>T	4.37:g.135121102C>A	ENSP00000463233:p.Gly358Val			Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_PABP_1234	p.G416V	ENST00000421491.3	37	c.1247		4																																																																																			-	PABPC4L	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234		0.493	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	PABPC4L	HGNC	protein_coding	OTTHUMT00000364399.2	0	0	0	36	36	87	0.00	0.00	C	NM_001114734		135121102	-1	8	25	12	60	tier1	no_errors	ENST00000529122	ensembl	human	known	74_37	missense	40.00	29.41	SNP	1.000	A	8	12
LRP5	4041	genome.wustl.edu	37	11	68115452	68115452	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:68115452G>T	ENST00000294304.7	+	2	335	c.229G>T	c.(229-231)Gtg>Ttg	p.V77L		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	77	Beta-propeller 1.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAAGGGAGCCGTGTACTGGAC	0.647													ENSG00000162337																																					0													83.0	77.0	79.0					11																	68115452		2200	4294	6494	SO:0001583	missense	0			-	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.229G>T	11.37:g.68115452G>T	ENSP00000294304:p.Val77Leu		Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.V77L	ENST00000294304.7	37	c.229	CCDS8181.1	11	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738118	0.49045	.	.	ENSG00000162337	ENST00000294304	D	0.88586	-2.4	4.58	3.65	0.41850	Six-bladed beta-propeller, TolB-like (1);	0.193343	0.24345	U	0.039323	T	0.79639	0.4480	N	0.22421	0.69	0.34616	D	0.7181	B	0.19200	0.034	B	0.22152	0.038	T	0.78188	-0.2301	10	0.31617	T	0.26	.	8.5473	0.33429	0.2388:0.0:0.7612:0.0	.	77	O75197	LRP5_HUMAN	L	77	ENSP00000294304:V77L	ENSP00000294304:V77L	V	+	1	0	LRP5	67872028	0.997000	0.39634	1.000000	0.80357	0.952000	0.60782	2.955000	0.49121	2.245000	0.73994	0.561000	0.74099	GTG	-	LRP5	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,smart_LDLR_classB_rpt		0.647	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	HGNC	protein_coding	OTTHUMT00000395088.1	0	0	0	56	56	62	0.00	0.00	G	NM_002335		68115452	+1	9	13	38	79	tier1	no_errors	ENST00000294304	ensembl	human	known	74_37	missense	19.15	14.13	SNP	0.989	T	9	38
C9	735	genome.wustl.edu	37	5	39342252	39342252	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:39342252C>G	ENST00000263408.4	-	2	219	c.124G>C	c.(124-126)Gac>Cac	p.D42H	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	42	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			ATTCTGCAGTCTATGTGTGAT	0.453													ENSG00000113600																																					0													169.0	141.0	150.0					5																	39342252		2203	4300	6503	SO:0001583	missense	0			-		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.124G>C	5.37:g.39342252C>G	ENSP00000263408:p.Asp42His			Missense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt	p.D42H	ENST00000263408.4	37	c.124	CCDS3929.1	5	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305721	0.60305	.	.	ENSG00000113600	ENST00000263408	T	0.21031	2.03	5.51	5.51	0.81932	.	0.099071	0.64402	D	0.000003	T	0.46776	0.1410	M	0.75777	2.31	0.51233	D	0.999915	D	0.89917	1.0	D	0.73380	0.98	T	0.44802	-0.9304	10	0.72032	D	0.01	-25.6663	14.9066	0.70724	0.0:1.0:0.0:0.0	.	42	P02748	CO9_HUMAN	H	42	ENSP00000263408:D42H	ENSP00000263408:D42H	D	-	1	0	C9	39378009	0.998000	0.40836	1.000000	0.80357	0.304000	0.27724	2.667000	0.46808	2.582000	0.87167	0.655000	0.94253	GAC	-	C9	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.453	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	HGNC	protein_coding	OTTHUMT00000211576.3	0	0	0	58	58	52	0.00	0.00	C			39342252	-1	10	21	93	158	tier1	no_errors	ENST00000263408	ensembl	human	known	74_37	missense	9.71	11.73	SNP	1.000	G	10	93
TMEM199	147007	genome.wustl.edu	37	17	26685947	26685947	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:26685947C>G	ENST00000292114.3	+	2	310	c.220C>G	c.(220-222)Cta>Gta	p.L74V	MIR4723_ENST00000585070.1_RNA|TMEM199_ENST00000509083.1_Missense_Mutation_p.L74V|TMEM199_ENST00000581386.1_3'UTR|POLDIP2_ENST00000540200.1_5'Flank|POLDIP2_ENST00000003607.4_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000395404.3_Intron|CTB-96E2.7_ENST00000577850.1_RNA	NM_152464.1	NP_689677.1	Q8N511	TM199_HUMAN	transmembrane protein 199	74						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		AGATTCCAAACTATACCTCCA	0.443													ENSG00000244045																																					0													129.0	117.0	121.0					17																	26685947		2203	4300	6503	SO:0001583	missense	0			-	AY074907	CCDS11228.1	17q11.2	2007-12-17	2007-12-17	2007-12-17	ENSG00000244045	ENSG00000244045			18085	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 32"""	C17orf32			Standard	NM_152464		Approved	MGC45714	uc002hba.3	Q8N511	OTTHUMG00000132498	ENST00000292114.3:c.220C>G	17.37:g.26685947C>G	ENSP00000292114:p.Leu74Val			Missense_Mutation	SNP	pfam_ATPase_Vma12	p.L74V	ENST00000292114.3	37	c.220	CCDS11228.1	17	.	.	.	.	.	.	.	.	.	.	C	7.854	0.724680	0.15439	.	.	ENSG00000244045	ENST00000292114;ENST00000509083	T;T	0.30714	1.63;1.52	5.63	-0.0502	0.13831	.	0.318769	0.32836	N	0.005583	T	0.08403	0.0209	N	0.02916	-0.46	0.09310	N	1	B;B	0.21520	0.057;0.001	B;B	0.22753	0.041;0.001	T	0.25187	-1.0139	10	0.09338	T	0.73	-3.149	2.2108	0.03947	0.1216:0.4359:0.2365:0.206	.	74;74	E9PBQ3;Q8N511	.;TM199_HUMAN	V	74	ENSP00000292114:L74V;ENSP00000427614:L74V	ENSP00000292114:L74V	L	+	1	2	TMEM199	23710074	0.001000	0.12720	0.063000	0.19743	0.850000	0.48378	-0.112000	0.10791	0.066000	0.16515	-0.830000	0.03078	CTA	-	TMEM199	-	NULL		0.443	TMEM199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM199	HGNC	protein_coding	OTTHUMT00000255676.2	0	0	0	55	55	109	0.00	0.00	C	NM_152464		26685947	+1	10	25	32	122	tier1	no_errors	ENST00000509083	ensembl	human	known	74_37	missense	23.81	17.01	SNP	0.018	G	10	32
ANKUB1	389161	genome.wustl.edu	37	3	149485707	149485707	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:149485707C>T	ENST00000383050.3	-	5	1198	c.742G>A	c.(742-744)Gca>Aca	p.A248T	ANKUB1_ENST00000462519.2_Missense_Mutation_p.A248T|ANKUB1_ENST00000446160.1_Missense_Mutation_p.A248T			A6NFN9	ANKUB_HUMAN	ankyrin repeat and ubiquitin domain containing 1	248										breast(1)|kidney(1)|lung(1)|skin(1)	4						CCTGCTTCTGCGGCTGCATGA	0.547													ENSG00000206199																																					0													80.0	68.0	72.0					3																	149485707		692	1591	2283	SO:0001583	missense	0			-	AK027233		3q25.1	2013-01-11	2011-05-10	2011-05-10	ENSG00000206199	ENSG00000206199		"""Ankyrin repeat domain containing"""	29642	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 16"""	C3orf16			Standard	NM_001144960		Approved		uc003exl.3	A6NFN9	OTTHUMG00000159615	ENST00000383050.3:c.742G>A	3.37:g.149485707C>T	ENSP00000372522:p.Ala248Thr		B4E2N8	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ubiquitin_supergroup	p.A248T	ENST00000383050.3	37	c.742		3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902288	0.92035	.	.	ENSG00000206199	ENST00000446160;ENST00000383050;ENST00000462519	T;T;T	0.71817	-0.6;-0.6;-0.6	5.44	5.44	0.79542	Ankyrin repeat-containing domain (3);	.	.	.	.	T	0.81602	0.4857	L	0.56396	1.775	0.32030	N	0.599663	D;D	0.76494	0.999;0.999	D;P	0.64595	0.927;0.9	D	0.84082	0.0385	9	0.87932	D	0	.	18.0541	0.89358	0.0:1.0:0.0:0.0	.	248;248	A6NFN9;E9PHT4	ANKUB_HUMAN;.	T	248	ENSP00000387907:A248T;ENSP00000372522:A248T;ENSP00000417635:A248T	ENSP00000372522:A248T	A	-	1	0	ANKUB1	150968397	1.000000	0.71417	0.845000	0.33349	0.955000	0.61496	3.916000	0.56416	2.551000	0.86045	0.650000	0.86243	GCA	-	ANKUB1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt		0.547	ANKUB1-201	KNOWN	basic	protein_coding	ANKUB1	HGNC	protein_coding		0	0	0	45	45	33	0.00	0.00	C	NM_001144960		149485707	-1	4	13	33	50	tier1	no_errors	ENST00000446160	ensembl	human	known	74_37	missense	10.81	20.63	SNP	1.000	T	4	33
SULT1E1	6783	genome.wustl.edu	37	4	70715166	70715166	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:70715166A>T	ENST00000226444.3	-	5	597	c.485T>A	c.(484-486)aTg>aAg	p.M162K		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	162					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	CTGTCCTTGCATGAATTTCTC	0.378													ENSG00000109193																																					0													67.0	72.0	70.0					4																	70715166		2203	4300	6503	SO:0001583	missense	0			-	BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.485T>A	4.37:g.70715166A>T	ENSP00000226444:p.Met162Lys		Q8N6X5	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.M162K	ENST00000226444.3	37	c.485	CCDS3531.1	4	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763618	0.49574	.	.	ENSG00000109193	ENST00000226444	D	0.82433	-1.61	3.85	3.85	0.44370	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.91300	0.7257	M	0.90309	3.105	0.58432	D	0.999994	D;D	0.65815	0.995;0.995	D;D	0.72625	0.978;0.978	D	0.91857	0.5496	10	0.52906	T	0.07	.	11.287	0.49228	1.0:0.0:0.0:0.0	.	162;162	Q53X91;P49888	.;ST1E1_HUMAN	K	162	ENSP00000226444:M162K	ENSP00000226444:M162K	M	-	2	0	SULT1E1	70749755	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	7.371000	0.79600	1.986000	0.57962	0.528000	0.53228	ATG	-	SULT1E1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.378	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1E1	HGNC	protein_coding	OTTHUMT00000251559.1	0	0	0	96	96	85	0.00	0.00	A	NM_005420		70715166	-1	18	13	82	56	tier1	no_errors	ENST00000226444	ensembl	human	known	74_37	missense	18.00	18.84	SNP	1.000	T	18	82
C1orf21	81563	genome.wustl.edu	37	1	184588751	184588751	+	3'UTR	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:184588751A>G	ENST00000235307.6	+	0	862				C1orf21_ENST00000367514.3_3'UTR	NM_030806.3	NP_110433.1	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21											breast(1)|lung(1)	2		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		ACCCCAGTTGAAATCTTTGCA	0.408													ENSG00000116667																																					0													110.0	95.0	99.0					1																	184588751		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			-	AF312864	CCDS1362.1	1q25	2008-07-18			ENSG00000116667	ENSG00000116667			15494	protein-coding gene	gene with protein product	"""proliferation-inducing protein 13"""					11318611	Standard	NM_030806		Approved	PIG13	uc001gqv.1	Q9H246	OTTHUMG00000035386	ENST00000235307.6:c.*61A>G	1.37:g.184588751A>G			B2R551	R	SNP	-	NULL	ENST00000235307.6	37	NULL	CCDS1362.1	1																																																																																			-	C1orf21	-	-		0.408	C1orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf21	HGNC	protein_coding	OTTHUMT00000085784.2	0	0	0	54	54	170	0.00	0.00	A	NM_030806		184588751	+1	23	91	34	125	tier1	no_errors	ENST00000367514	ensembl	human	known	74_37	rna	39.66	42.13	SNP	1.000	G	23	34
HMCN1	83872	genome.wustl.edu	37	1	186089277	186089277	+	Splice_Site	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:186089277G>A	ENST00000271588.4	+	80	12458	c.12229G>A	c.(12229-12231)Gtt>Att	p.V4077I	HMCN1_ENST00000367492.2_Splice_Site_p.V4077I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4077					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAATGTCCAAGGTACCTAAAT	0.408													ENSG00000143341																																					0													43.0	45.0	44.0					1																	186089277		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12229+1G>A	1.37:g.186089277G>A			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.V4077I	ENST00000271588.4	37	c.12229	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922398	0.92319	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.36157	1.27;1.27	6.05	6.05	0.98169	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.57315	0.2045	L	0.53617	1.68	0.80722	D	1	D	0.56035	0.974	D	0.66716	0.946	T	0.44236	-0.9341	10	0.38643	T	0.18	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	4077	Q96RW7	HMCN1_HUMAN	I	4077	ENSP00000271588:V4077I;ENSP00000356462:V4077I	ENSP00000271588:V4077I	V	+	1	0	HMCN1	184355900	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	7.883000	0.87264	2.878000	0.98634	0.650000	0.86243	GTT	-	HMCN1	-	NULL		0.408	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	0	0	0	71	71	102	0.00	0.00	G	NM_031935	Missense_Mutation	186089277	+1	30	55	48	98	tier1	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	38.46	35.95	SNP	1.000	A	30	48
RIN2	54453	genome.wustl.edu	37	20	19970901	19970901	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr20:19970901A>G	ENST00000255006.6	+	9	2310	c.2161A>G	c.(2161-2163)Atg>Gtg	p.M721V	RIN2_ENST00000440354.2_Missense_Mutation_p.M239V|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	672	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AAAGAAGGTCATGCTGCTGCT	0.557													ENSG00000132669																																					0													45.0	46.0	46.0					20																	19970901		2056	4207	6263	SO:0001583	missense	0			-	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2161A>G	20.37:g.19970901A>G	ENSP00000255006:p.Met721Val		Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.M721V	ENST00000255006.6	37	c.2161	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	A	10.92	1.486371	0.26686	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.28255	1.62;1.62	5.83	4.67	0.58626	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.272590	0.45606	D	0.000342	T	0.15869	0.0382	N	0.11201	0.11	0.37198	D	0.904223	B;P	0.40144	0.028;0.704	B;B	0.36608	0.039;0.229	T	0.17167	-1.0378	9	.	.	.	-37.1052	12.4251	0.55542	0.8599:0.1401:0.0:0.0	.	239;672	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	V	721;239	ENSP00000255006:M721V;ENSP00000391239:M239V	.	M	+	1	0	RIN2	19918901	0.989000	0.36119	1.000000	0.80357	0.991000	0.79684	1.054000	0.30455	2.225000	0.72522	0.482000	0.46254	ATG	-	RIN2	-	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9		0.557	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	0	0	0	40	40	53	0.00	0.00	A			19970901	+1	4	12	16	40	tier1	no_errors	ENST00000255006	ensembl	human	known	74_37	missense	20.00	23.08	SNP	1.000	G	4	16
SCN2A	6326	genome.wustl.edu	37	2	166223861	166223861	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr2:166223861C>A	ENST00000375437.2	+	19	3945	c.3655C>A	c.(3655-3657)Ctg>Atg	p.L1219M	SCN2A_ENST00000357398.3_Missense_Mutation_p.L1219M|SCN2A_ENST00000375427.2_Missense_Mutation_p.L1219M|SCN2A_ENST00000283256.6_Missense_Mutation_p.L1219M	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1219					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTCATGATTCTGCTGAGCAG	0.428													ENSG00000136531																																					0													157.0	140.0	146.0					2																	166223861		2203	4300	6503	SO:0001583	missense	0			-	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3655C>A	2.37:g.166223861C>A	ENSP00000364586:p.Leu1219Met		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.L1219M	ENST00000375437.2	37	c.3655	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172573	0.78452	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71	6.07	6.07	0.98685	.	0.000000	0.56097	D	0.000034	D	0.98676	0.9556	M	0.78285	2.405	0.51767	D	0.999939	D;D	0.69078	0.995;0.997	D;D	0.66979	0.948;0.944	D	0.99274	1.0894	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1219;1219	Q99250-2;Q99250	.;SCN2A_HUMAN	M	1219	ENSP00000364586:L1219M;ENSP00000349973:L1219M;ENSP00000283256:L1219M;ENSP00000364576:L1219M	ENSP00000283256:L1219M	L	+	1	2	SCN2A	165932107	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.300000	0.51834	2.885000	0.99019	0.655000	0.94253	CTG	-	SCN2A	-	NULL		0.428	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	0	0	0	61	61	62	0.00	0.00	C	NM_021007		166223861	+1	5	16	42	100	tier1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	10.64	13.79	SNP	1.000	A	5	42
ALG1L	200810	genome.wustl.edu	37	3	125648532	125648532	+	Intron	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:125648532C>T	ENST00000340333.3	-	6	512				FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like								transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						CTAACTCTCTCACTTGGACTC	0.577													ENSG00000171084																																					0																																										SO:0001627	intron_variant	0			-	BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.349-122G>A	3.37:g.125648532C>T			D3DNA5	R	SNP	-	NULL	ENST00000340333.3	37	NULL	CCDS33840.1	3																																																																																			-	FAM86JP	-	-		0.577	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86JP	HGNC	protein_coding	OTTHUMT00000356347.1	0	0	0	43	43	60	0.00	0.00	C	NM_001015050		125648532	+1	16	21	36	40	tier1	no_errors	ENST00000467239	ensembl	human	known	74_37	rna	30.77	34.43	SNP	0.001	T	16	36
NRIP1	8204	genome.wustl.edu	37	21	16333666	16333666	+	3'UTR	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:16333666C>T	ENST00000400202.1	-	0	7560				AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000318948.4_3'UTR|NRIP1_ENST00000400199.1_3'UTR			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1						androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TTCATGACATCACATGAAGAA	0.279													ENSG00000229047																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.*3371G>A	21.37:g.16333666C>T			Q8IWE8	R	SNP	-	NULL	ENST00000400202.1	37	NULL	CCDS13568.1	21																																																																																			-	AF127577.10	-	-		0.279	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000229047	Clone_based_vega_gene	protein_coding	OTTHUMT00000157926.1	0	0	0	41	41	64	0.00	0.00	C	NM_003489		16333666	+1	6	9	38	26	tier1	no_errors	ENST00000446301	ensembl	human	known	74_37	rna	13.64	25.71	SNP	1.000	T	6	38
ATRX	546	genome.wustl.edu	37	X	76937766	76937769	+	Frame_Shift_Del	DEL	TTTC	TTTC	-	rs371962239		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	TTTC	TTTC	TTTC	-	TTTC	TTTC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chrX:76937766_76937769delTTTC	ENST00000373344.5	-	9	3193_3196	c.2979_2982delGAAA	c.(2977-2982)aagaaafs	p.KK993fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.KK955fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	993					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AGTCTGAAGGTTTCTTTTTTTCTT	0.338			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								SO:0001589	frameshift_variant	0				U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2979_2982delGAAA	X.37:g.76937766_76937769delTTTC	ENSP00000362441:p.Lys993fs		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K993fs	ENST00000373344.5	37	c.2982_2979	CCDS14434.1	X																																																																																				ATRX	-	NULL		0.338	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	41	41	51	0.00	0.00	TTTC	NM_000489		76937769	-1	13	18	13	16	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	50.00	52.94	DEL	0.936:0.944:0.949:0.993	-	13	13
HNRNPA0	10949	genome.wustl.edu	37	5	137089075	137089076	+	In_Frame_Ins	INS	-	-	CCG			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	-	-	-	CCG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:137089075_137089076insCCG	ENST00000314940.4	-	1	963_964	c.680_681insCGG	c.(679-681)gga>ggCGGa	p.227_227G>GG		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	227	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			agccgccgcctccgccgccgcc	0.723													ENSG00000177733																																					0										19,2353		7,5,1174						-4.0	0.0			5	59,5139		13,33,2553	no	coding	HNRNPA0	NM_006805.3		20,38,3727	A1A1,A1R,RR		1.1351,0.801,1.0304				78,7492				SO:0001652	inframe_insertion	0				U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.678_680dupCGG	5.37:g.137089082_137089084dupCCG	ENSP00000316042:p.Gly230dup		Q6IB18	In_Frame_Ins	INS	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.231in_frame_insG	ENST00000314940.4	37	c.681_680	CCDS4193.1	5																																																																																				HNRNPA0	-	NULL		0.723	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA0	HGNC	protein_coding	OTTHUMT00000251221.1	0	0	0	12	12	12	0.00	0.00	-	NM_006805		137089076	-1	4	2	9	13	tier1	no_errors	ENST00000314940	ensembl	human	known	74_37	in_frame_ins	30.77	13.33	INS	0.019:0.578	CCG	4	9
DHX37	57647	genome.wustl.edu	37	12	125436983	125436983	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:125436983G>A	ENST00000308736.2	-	21	2927	c.2829C>T	c.(2827-2829)agC>agT	p.S943S	DHX37_ENST00000544745.1_Silent_p.S730S	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	943							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GCATCTCCTCGCTCTGGACCC	0.687													ENSG00000150990																																					0													48.0	39.0	42.0					12																	125436983		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2829C>T	12.37:g.125436983G>A			Q9BUI7|Q9P211	Silent	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_D/R_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S943	ENST00000308736.2	37	c.2829	CCDS9261.1	12																																																																																			-	DHX37	-	pfam_DUF1605,superfamily_P-loop_NTPase		0.687	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX37	HGNC	protein_coding		0	0	0	35	35	10	0.00	0.00	G	NM_032656		125436983	-1	10	4	19	8	tier1	no_errors	ENST00000308736	ensembl	human	known	74_37	silent	34.48	33.33	SNP	0.290	A	10	19
CCL15	6359	genome.wustl.edu	37	17	34324877	34324877	+	Missense_Mutation	SNP	G	G	A	rs138739843		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:34324877G>A	ENST00000354059.4	-	4	820	c.268C>T	c.(268-270)Cgg>Tgg	p.R90W	CCL15-CCL14_ENST00000481427.2_Missense_Mutation_p.R90W|CCL14_ENST00000536149.1_5'UTR	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15	90					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAGACTTGCCGCCCCTTCTTG	0.522													ENSG00000267596																																					0								G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	56.0	55.0	55.0		268	-9.4	0.0	17	dbSNP_134	55	0,8600		0,0,4300	no	missense	CCL15	NM_032965.4	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	90/114	34324877	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.268C>T	17.37:g.34324877G>A	ENSP00000293276:p.Arg90Trp		B2RU34|E1P651|Q9UM74	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.R90W	ENST00000354059.4	37	c.268	CCDS11304.1	17	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710305	0.48517	2.27E-4	0.0	ENSG00000161574	ENST00000354059	T	0.07327	3.2	4.72	-9.44	0.00603	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	1.654160	0.04448	N	0.372034	T	0.30448	0.0765	M	0.90705	3.14	0.09310	N	1	D	0.89917	1.0	D	0.63957	0.92	T	0.59799	-0.7386	10	0.87932	D	0	.	14.6518	0.68803	0.0668:0.0:0.1316:0.8015	.	90	Q16663	CCL15_HUMAN	W	90	ENSP00000293276:R90W	ENSP00000293276:R90W	R	-	1	2	CCL15	31348990	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.875000	0.01634	-2.539000	0.00486	0.591000	0.81541	CGG	rs138739843	CCL15	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom		0.522	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL15	HGNC	protein_coding	OTTHUMT00000256584.2	0	0	1	60	60	98	0.00	1.01	G	NM_004167		34324877	-1	9	12	54	109	tier1	no_errors	ENST00000354059	ensembl	human	known	74_37	missense	14.06	9.92	SNP	0.000	A	9	54
OR10C1	442194	genome.wustl.edu	37	6	29407999	29407999	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr6:29407999G>C	ENST00000444197.2	+	1	917	c.207G>C	c.(205-207)gaG>gaC	p.E69D	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGGCCTTGGAGATTGGCTATA	0.572													ENSG00000206474																																					0													176.0	154.0	161.0					6																	29407999		1511	2708	4219	SO:0001583	missense	0			-		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.207G>C	6.37:g.29407999G>C	ENSP00000419119:p.Glu69Asp		Q5SUN7|Q96R18	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.E69D	ENST00000444197.2	37	c.207	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	G	3.194	-0.165267	0.06461	.	.	ENSG00000206474	ENST00000444197	T	0.00008	9.61	3.6	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	N	0.001313	T	0.00012	0.0000	N	0.21240	0.645	0.22975	N	0.998488	B	0.18461	0.028	B	0.24394	0.053	T	0.49835	-0.8897	10	0.15499	T	0.54	.	2.6706	0.05066	0.1058:0.1827:0.5232:0.1884	.	69	Q96KK4	O10C1_HUMAN	D	69	ENSP00000419119:E69D	ENSP00000419119:E69D	E	+	3	2	OR10C1	29515978	0.000000	0.05858	0.633000	0.29310	0.011000	0.07611	-0.801000	0.04550	2.008000	0.58898	0.430000	0.28490	GAG	-	OR10C1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.572	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	HGNC	protein_coding	OTTHUMT00000076415.2	0	0	0	56	56	47	0.00	0.00	G			29407999	+1	6	4	42	60	tier1	no_errors	ENST00000444197	ensembl	human	known	74_37	missense	12.50	6.25	SNP	0.558	C	6	42
OR14K1	343170	genome.wustl.edu	37	1	247902370	247902370	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:247902370G>C	ENST00000283225.2	+	1	454	c.454G>C	c.(454-456)Gcc>Ccc	p.A152P	RP11-634B7.4_ENST00000449298.1_RNA			Q8NGZ2	O14K1_HUMAN	olfactory receptor, family 14, subfamily K, member 1	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|lung(18)|ovary(1)|urinary_tract(1)	27						CAACAGAGGGGCCTTGGGACT	0.527													ENSG00000153230																																					0													90.0	94.0	93.0					1																	247902370		2120	4239	6359	SO:0001583	missense	0			-	BK004377		1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000153230	ENSG00000153230		"""GPCR / Class A : Olfactory receptors"""	15025	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AY, member 1"""	OR5AY1			Standard	NG_007559		Approved			Q8NGZ2	OTTHUMG00000040211	ENST00000283225.2:c.454G>C	1.37:g.247902370G>C	ENSP00000283225:p.Ala152Pro		A8MPV5|Q6IF85|Q96R53	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A152P	ENST00000283225.2	37	c.454		1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439172	0.25900	.	.	ENSG00000153230	ENST00000283225	T	0.00137	8.68	3.81	-3.26	0.05064	.	0.971136	0.08316	U	0.964600	T	0.00144	0.0004	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.09640	-1.0665	7	0.87932	D	0	.	3.1117	0.06361	0.0873:0.3504:0.2119:0.3505	.	.	.	.	P	152	ENSP00000283225:A152P	ENSP00000283225:A152P	A	+	1	0	OR14K1	245968993	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.156000	0.10100	-0.426000	0.07360	-0.324000	0.08512	GCC	-	OR14K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.527	OR14K1-001	KNOWN	basic|appris_principal	protein_coding	OR14K1	HGNC	protein_coding	OTTHUMT00000096868.1	0	0	0	50	50	57	0.00	0.00	G	NM_001004732		247902370	+1	13	5	38	63	tier1	no_errors	ENST00000283225	ensembl	human	known	74_37	missense	25.49	7.35	SNP	0.000	C	13	38
LILRB5	10990	genome.wustl.edu	37	19	54758267	54758267	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr19:54758267C>A	ENST00000316219.5	-	7	1374	c.1267G>T	c.(1267-1269)Gat>Tat	p.D423Y	LILRB5_ENST00000449561.2_Missense_Mutation_p.D423Y|LILRB5_ENST00000450632.1_Missense_Mutation_p.D414Y|LILRB5_ENST00000345866.6_Missense_Mutation_p.D323Y	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	423					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGCTGGGATCCCCAGAGGGT	0.637													ENSG00000105609																																					0													27.0	30.0	29.0					19																	54758267		2196	4296	6492	SO:0001583	missense	0			-	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1267G>T	19.37:g.54758267C>A	ENSP00000320390:p.Asp423Tyr		Q8N760	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D414Y	ENST00000316219.5	37	c.1240	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	C	8.966	0.971728	0.18736	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00491	7.07;7.02;7.07;7.1	1.96	-3.93	0.04143	.	.	.	.	.	T	0.00724	0.0024	M	0.66939	2.045	0.09310	N	1	D;D;B;P	0.57257	0.966;0.979;0.251;0.93	P;P;B;P	0.53593	0.73;0.62;0.159;0.454	T	0.15292	-1.0442	9	0.62326	D	0.03	.	3.0058	0.06028	0.1405:0.2536:0.475:0.1309	.	414;323;423;423	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	Y	423;414;423;323	ENSP00000320390:D423Y;ENSP00000414225:D414Y;ENSP00000406478:D423Y;ENSP00000263430:D323Y	ENSP00000320390:D423Y	D	-	1	0	LILRB5	59450079	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.303000	0.08210	-2.004000	0.00961	-1.548000	0.00902	GAT	-	LILRB5	-	NULL		0.637	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	0	0	0	61	61	93	0.00	0.00	C			54758267	-1	8	6	40	106	tier1	no_errors	ENST00000450632	ensembl	human	known	74_37	missense	16.67	5.36	SNP	0.000	A	8	40
MAPKBP1	23005	genome.wustl.edu	37	15	42106769	42106769	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:42106769G>A	ENST00000456763.2	+	11	1216	c.1020G>A	c.(1018-1020)gcG>gcA	p.A340A	MAPKBP1_ENST00000457542.2_Silent_p.A334A|MAPKBP1_ENST00000221214.6_Intron|MAPKBP1_ENST00000260357.7_Silent_p.A222A|MAPKBP1_ENST00000514566.1_Silent_p.A334A	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	340										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CTGGAGTGGCGAATGCCAGGT	0.488													ENSG00000137802																																					0													212.0	177.0	189.0					15																	42106769		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1020G>A	15.37:g.42106769G>A			A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A340	ENST00000456763.2	37	c.1020	CCDS45239.1	15																																																																																			-	MAPKBP1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.488	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	0	0	1	71	71	53	0.00	1.85	G	NM_014994		42106769	+1	10	10	39	97	tier1	no_errors	ENST00000456763	ensembl	human	known	74_37	silent	20.41	9.35	SNP	0.547	A	10	39
PAQR4	124222	genome.wustl.edu	37	16	3022637	3022637	+	3'UTR	DEL	G	G	-	rs572756044		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr16:3022637delG	ENST00000318782.8	+	0	1940				PAQR4_ENST00000572687.1_3'UTR|PKMYT1_ENST00000431515.2_Splice_Site_p.R503fs|PAQR4_ENST00000293978.8_3'UTR|PKMYT1_ENST00000571102.1_5'Flank	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV							integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						GGTACCCACCGGGGGATGTGC	0.647													ENSG00000127564																																					0																																										SO:0001624	3_prime_UTR_variant	0					CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.*688G>-	16.37:g.3022637delG			A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R503fs	ENST00000318782.8	37	c.1507	CCDS10485.1	16																																																																																				PKMYT1	-	NULL		0.647	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKMYT1	HGNC	protein_coding	OTTHUMT00000250966.1	0	0	0	44	44	100	0.00	0.00	G	NM_152341		3022637	-1	6	6	31	91	tier1	no_errors	ENST00000431515	ensembl	human	putative	74_37	frame_shift_del	16.22	6.19	DEL	0.000	-	6	31
LINC01000	402483	genome.wustl.edu	37	1	133414	133414	+	IGR	SNP	T	T	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:133414T>G	ENST00000423372.3	-	0	2661																											GCCCCACCAGTGCTTCTGCCC	0.672													ENSG00000238009																																					0																																										SO:0001628	intergenic_variant	0			-																													1.37:g.133414T>G				R	SNP	-	NULL	ENST00000423372.3	37	NULL		1																																																																																			-	RP11-34P13.7	-	-		0.672	AL627309.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000238009	Clone_based_vega_gene	protein_coding		0	0	0	73	73	0	0.00	0.00	T			133414	-1	17	0	80	0	tier1	no_errors	ENST00000453576	ensembl	human	known	74_37	rna	17.53	0.00	SNP	0.955	G	17	80
KCNA5	3741	genome.wustl.edu	37	12	5153524	5153524	+	Missense_Mutation	SNP	C	C	A	rs144879674|rs71581015	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:5153524C>A	ENST00000252321.3	+	1	440	c.211C>A	c.(211-213)Ccg>Acg	p.P71T		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	71	2 X 11 AA tandem repeat of D-[SP]-G-V-R- P-L-P-P-L-P.				atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GCCTCCGCTGCCGGACCCGGG	0.751													ENSG00000130037																																					0													4.0	6.0	5.0					12																	5153524		1958	3858	5816	SO:0001583	missense	0			-	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.211C>A	12.37:g.5153524C>A	ENSP00000252321:p.Pro71Thr		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.P71T	ENST00000252321.3	37	c.211	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	-	16.92	3.255131	0.59321	.	.	ENSG00000130037	ENST00000252321	D	0.97455	-4.39	3.13	1.07	0.20283	.	2.810250	0.02044	N	0.049486	D	0.92763	0.7699	N	0.24115	0.695	0.09310	N	1	.	.	.	.	.	.	D	0.86007	0.1498	8	0.14656	T	0.56	.	6.5869	0.22626	0.2037:0.5984:0.1979:0.0	.	71	P22460	KCNA5_HUMAN	T	71	ENSP00000252321:P71T	ENSP00000252321:P71T	P	+	1	0	KCNA5	5023785	0.037000	0.19845	0.438000	0.26821	0.832000	0.47134	0.116000	0.15561	0.123000	0.18342	0.511000	0.50034	CCG	-	KC5	-	NULL		0.751	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KC5	HGNC	protein_coding	OTTHUMT00000398925.2	0	0	0	29	29	2	0.00	0.00	C	NM_002234		5153524	+1	5	0	15	2	tier1	no_errors	ENST00000252321	ensembl	human	known	74_37	missense	25.00	0.00	SNP	0.043	A	5	15
MAGEL2	54551	genome.wustl.edu	37	15	23890932	23890932	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:23890932G>C	ENST00000532292.1	-	1	243	c.149C>G	c.(148-150)cCg>cGg	p.P50R		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TTGGGAGGGCGGGGCTCCCTG	0.692													ENSG00000254585																																					0													5.0	6.0	6.0					15																	23890932		1773	3915	5688	SO:0001583	missense	0			-	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.149C>G	15.37:g.23890932G>C	ENSP00000433433:p.Pro50Arg			Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.P50R	ENST00000532292.1	37	c.149		15	.	.	.	.	.	.	.	.	.	.	G	3.706	-0.060633	0.07317	.	.	ENSG00000254585	ENST00000532292	.	.	.	3.43	0.294	0.15747	.	.	.	.	.	T	0.32971	0.0847	L	0.40543	1.245	0.09310	N	1	.	.	.	.	.	.	T	0.27020	-1.0086	5	.	.	.	.	5.5434	0.17051	0.1042:0.0:0.5683:0.3276	.	.	.	.	G	82	.	.	R	-	1	0	MAGEL2	21442025	0.000000	0.05858	0.003000	0.11579	0.218000	0.24690	-0.471000	0.06631	0.063000	0.16370	0.197000	0.17608	CGC	-	MAGEL2	-	NULL		0.692	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	0	0	0	46	46	0	0.00	0.00	G	NM_019066		23890932	-1	8	0	24	1	tier1	no_errors	ENST00000532292	ensembl	human	known	74_37	missense	25.00	0.00	SNP	0.068	C	8	24
MUC4	4585	genome.wustl.edu	37	3	195508545	195508546	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:195508545_195508546insG	ENST00000463781.3	-	2	10364_10365	c.9905_9906insC	c.(9904-9906)actfs	p.T3302fs	MUC4_ENST00000475231.1_Frame_Shift_Ins_p.T3302fs|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATACTGAGGAAGTCTCGGTGAC	0.559													ENSG00000145113																																					0																																										SO:0001589	frameshift_variant	0				AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9906dupC	3.37:g.195508546_195508546dupG	ENSP00000417498:p.Thr3302fs		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Ins	INS	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3303fs	ENST00000463781.3	37	c.9906_9905	CCDS54700.1	3																																																																																				MUC4	-	NULL		0.559	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	44	44	1	0.00	0.00	-	NM_018406		195508546	-1	3	0	22	0	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	frame_shift_ins	12.00	0.00	INS	0.002:0.002	G	3	22
WASH3P	374666	genome.wustl.edu	37	15	102513202	102513202	+	RNA	DEL	C	C	-			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:102513202delC	ENST00000557932.1	+	0	383							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.H121fs*24(1)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GACGCCCCCGCCACAGGATCC	0.652													ENSG00000185596																																					1	Deletion - Frameshift(1)	central_nervous_system(1)																																										0						15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102513202delC				R	DEL	-	NULL	ENST00000557932.1	37	NULL		15																																																																																				WASH3P	-	-		0.652	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1	0	0	0	19	19	0	0.00	0.00	C	NM_199163		102513202	+1	5	0	13	0	tier1	no_errors	ENST00000354296	ensembl	human	known	74_37	rna	27.78	0.00	DEL	0.994	-	5	13
TRIM46	80128	genome.wustl.edu	37	1	155147426	155147426	+	Intron	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:155147426G>T	ENST00000334634.4	+	2	63				KRTCAP2_ENST00000490672.1_5'Flank|TRIM46_ENST00000368385.4_Intron|TRIM46_ENST00000392451.2_Intron|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368382.1_Intron|TRIM46_ENST00000543729.1_Intron|KRTCAP2_ENST00000295682.4_5'Flank|TRIM46_ENST00000545012.1_Intron|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000368383.3_Intron	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACCTCGCCTGGCTATCGGGAG	0.627													ENSG00000163462																																					0																																										SO:0001627	intron_variant	0			-		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.64-436G>T	1.37:g.155147426G>T			A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	R	SNP	-	NULL	ENST00000334634.4	37	NULL	CCDS1097.1	1																																																																																			-	TRIM46	-	-		0.627	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	HGNC	protein_coding	OTTHUMT00000086728.1	0	0	0	37	37	17	0.00	0.00	G	NM_025058		155147426	+1	10	2	36	23	tier1	no_errors	ENST00000468878	ensembl	human	known	74_37	rna	21.74	8.00	SNP	0.000	T	10	36
