#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
KIAA1549L	25758	genome.wustl.edu	37	11	33569421	33569421	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:33569421C>T	ENST00000321505.4	+	3	2786	c.2606C>T	c.(2605-2607)gCt>gTt	p.A869V	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.A875V|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.A875V			Q6ZVL6	K154L_HUMAN	KIAA1549-like	869						integral component of membrane (GO:0016021)											GATGTCTCAGCTCACGTAAGT	0.458													ENSG00000110427																																					0													108.0	103.0	105.0					11																	33569421		1990	4187	6177	SO:0001583	missense	0			-	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2606C>T	11.37:g.33569421C>T	ENSP00000315295:p.Ala869Val		B0QYU0	Missense_Mutation	SNP	NULL	p.A875V	ENST00000321505.4	37	c.2624	CCDS44565.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.8|27.8	4.865130|4.865130	0.91511|0.91511	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568|ENST00000526400	.|.	.|.	.|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.186460|.	0.45606|.	D|.	0.000346|.	T|T	0.74458|0.74458	0.3719|0.3719	M|M	0.66939|0.66939	2.045|2.045	0.38399|0.38399	D|D	0.945624|0.945624	D;D|.	0.89917|.	0.991;1.0|.	P;D|.	0.79108|.	0.8;0.992|.	T|T	0.74259|0.74259	-0.3723|-0.3723	9|5	0.54805|.	T|.	0.06|.	-17.3161|-17.3161	18.197|18.197	0.89825|0.89825	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	875;875|.	E9PAT2;Q6ZVL6-2|.	.;.|.	V|F	869;875;875;708|267	.|.	ENSP00000265654:A875V|.	A|L	+|+	2|1	0|0	C11orf41|C11orf41	33525997|33525997	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.815000|0.815000	0.46073|0.46073	5.275000|5.275000	0.65575|0.65575	2.740000|2.740000	0.93945|0.93945	0.455000|0.455000	0.32223|0.32223	GCT|CTC	-	KIAA1549L	-	NULL		0.458	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	HGNC	protein_coding	OTTHUMT00000317998.1	0	0	0	43	43	110	0.00	0.00	C	NM_012194		33569421	+1	11	23	20	63	tier1	no_errors	ENST00000389726	ensembl	human	known	74_37	missense	35.48	26.74	SNP	1.000	T	11	20
ZNF512B	57473	genome.wustl.edu	37	20	62614400	62614400	+	Intron	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr20:62614400C>T	ENST00000450537.1	-	2	56				PRPF6_ENST00000535781.1_Splice_Site_p.G24G|ZNF512B_ENST00000217130.3_Intron			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCTCCTGCAGCGCCACTGGCT	0.562													ENSG00000101161																																					0													35.0	33.0	34.0					20																	62614400		2203	4300	6503	SO:0001627	intron_variant	0			-	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-15092G>A	20.37:g.62614400C>T			Q08AK9|Q9ULM4	Silent	SNP	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.G24	ENST00000450537.1	37	c.72	CCDS13548.1	20																																																																																			-	PRPF6	-	pfam_PRP1_N		0.562	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	HGNC	protein_coding	OTTHUMT00000080246.1	0	0	0	44	44	60	0.00	0.00	C	NM_020713		62614400	+1	13	13	32	54	tier1	no_errors	ENST00000266079	ensembl	human	known	74_37	silent	28.89	19.40	SNP	0.848	T	13	32
HIP1	3092	genome.wustl.edu	37	7	75228536	75228536	+	Silent	SNP	C	C	T	rs372317584		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:75228536C>T	ENST00000336926.6	-	2	176	c.150G>A	c.(148-150)acG>acA	p.T50T	HIP1_ENST00000434438.2_Silent_p.T50T	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	50	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CCACTTCCTGCGTATTAATGG	0.498			T	PDGFRB	CMML								ENSG00000127946																												Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0								C		0,4406		0,0,2203	148.0	150.0	149.0		150	-5.0	0.9	7		149	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HIP1	NM_005338.5		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		50/1038	75228536	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.150G>A	7.37:g.75228536C>T			B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.T50	ENST00000336926.6	37	c.150	CCDS34669.1	7																																																																																			-	HIP1	-	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N		0.498	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	HGNC	protein_coding	OTTHUMT00000342863.2	0	0	0	43	43	93	0.00	0.00	C	NM_005338		75228536	-1	8	22	37	104	tier1	no_errors	ENST00000336926	ensembl	human	known	74_37	silent	17.78	17.46	SNP	0.695	T	8	37
DNAJC6	9829	genome.wustl.edu	37	1	65871755	65871755	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:65871755C>T	ENST00000395325.3	+	16	2416	c.2259C>T	c.(2257-2259)aaC>aaT	p.N753N	DNAJC6_ENST00000263441.7_Silent_p.N740N|DNAJC6_ENST00000371069.4_Silent_p.N810N	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	753	Pro-rich.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						CCAACTACAACGTGAGCTTCT	0.587													ENSG00000116675																																					0													115.0	108.0	111.0					1																	65871755		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2259C>T	1.37:g.65871755C>T			B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Silent	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_C2_dom,smart_DnaJ_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.N810	ENST00000395325.3	37	c.2430	CCDS30739.1	1																																																																																			-	DJC6	-	superfamily_DnaJ_domain		0.587	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DJC6	HGNC	protein_coding	OTTHUMT00000025134.1	0	0	0	62	62	94	0.00	0.00	C			65871755	+1	13	31	28	81	tier1	no_errors	ENST00000371069	ensembl	human	known	74_37	silent	31.71	27.68	SNP	0.096	T	13	28
CSMD1	64478	genome.wustl.edu	37	8	3265506	3265506	+	Missense_Mutation	SNP	C	C	A	rs559348370		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:3265506C>A	ENST00000520002.1	-	15	2544	c.1989G>T	c.(1987-1989)caG>caT	p.Q663H	CSMD1_ENST00000537824.1_Missense_Mutation_p.Q662H|CSMD1_ENST00000602723.1_Missense_Mutation_p.Q663H|CSMD1_ENST00000400186.3_Missense_Mutation_p.Q663H|CSMD1_ENST00000542608.1_Missense_Mutation_p.Q662H|CSMD1_ENST00000602557.1_Missense_Mutation_p.Q663H|CSMD1_ENST00000539096.1_Missense_Mutation_p.Q662H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	663	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGCTGGCCAGCTGGGAAGGCA	0.483													ENSG00000183117																																					0													77.0	71.0	73.0					8																	3265506		1945	4149	6094	SO:0001583	missense	0			-			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1989G>T	8.37:g.3265506C>A	ENSP00000430733:p.Gln663His		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.Q663H	ENST00000520002.1	37	c.1989		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.915|1.915	-0.449748|-0.449748	0.04572|0.04572	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.18657	.|2.2;2.2;2.2;2.2;2.2	5.23|5.23	2.42|2.42	0.29668|0.29668	.|CUB (5);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.16811|0.16811	0.0404|0.0404	N|N	0.04203|0.04203	-0.255|-0.255	0.34904|0.34904	D|D	0.746789|0.746789	.|D;B	.|0.67145	.|0.996;0.022	.|D;B	.|0.85130	.|0.997;0.036	T|T	0.29274|0.29274	-1.0017|-1.0017	5|10	.|0.14656	.|T	.|0.56	.|.	5.3656|5.3656	0.16111|0.16111	0.1359:0.5768:0.0:0.2873|0.1359:0.5768:0.0:0.2873	.|.	.|663;663	.|E5RIG2;Q96PZ7	.|.;CSMD1_HUMAN	S|H	143|663;663;525;662;662;662	.|ENSP00000383047:Q663H;ENSP00000430733:Q663H;ENSP00000441462:Q662H;ENSP00000446243:Q662H;ENSP00000441675:Q662H	.|ENSP00000320445:Q525H	A|Q	-|-	1|3	0|2	CSMD1|CSMD1	3252913|3252913	0.044000|0.044000	0.20184|0.20184	1.000000|1.000000	0.80357|0.80357	0.928000|0.928000	0.56348|0.56348	-0.338000|-0.338000	0.07842|0.07842	0.584000|0.584000	0.29591|0.29591	-0.444000|-0.444000	0.05651|0.05651	GCT|CAG	-	CSMD1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	0	0	0	30	30	103	0.00	0.00	C	NM_033225		3265506	-1	10	29	37	88	tier1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	21.28	24.79	SNP	0.991	A	10	37
ASIP	434	genome.wustl.edu	37	20	32848194	32848194	+	Missense_Mutation	SNP	G	G	A	rs145074053		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr20:32848194G>A	ENST00000568305.1	+	2	216	c.14G>A	c.(13-15)cGc>cAc	p.R5H	RP4-785G19.5_ENST00000512005.1_RNA|ASIP_ENST00000374954.3_Missense_Mutation_p.R5H			P42127	ASIP_HUMAN	agouti signaling protein	5					adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|generation of precursor metabolites and energy (GO:0006091)|genetic imprinting (GO:0071514)|hormone-mediated signaling pathway (GO:0009755)|melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|regulation of molecular function, epigenetic (GO:0040030)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			central_nervous_system(1)|lung(2)	3						GATGTCACCCGCTTACTCCTG	0.582													ENSG00000101440																																					0								G	HIS/ARG	0,4406		0,0,2203	123.0	114.0	117.0		14	3.2	1.0	20	dbSNP_134	117	1,8599	1.2+/-3.3	0,1,4299	no	missense	ASIP	NM_001672.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	5/133	32848194	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS13232.1	20q11.2-q12	2010-06-24	2010-06-24		ENSG00000101440	ENSG00000101440			745	protein-coding gene	gene with protein product	"""nonagouti homolog (mouse)"""	600201	"""agouti (mouse)-signaling protein"", ""agouti signaling protein, nonagouti homolog (mouse)"""	AGTIL		7937887, 7757071	Standard	NM_001672		Approved	ASP	uc002xah.1	P42127	OTTHUMG00000032289	ENST00000568305.1:c.14G>A	20.37:g.32848194G>A	ENSP00000454804:p.Arg5His		Q3SXL2	Missense_Mutation	SNP	pfam_Agouti,superfamily_Agouti_dom,smart_Agouti,pfscan_Agouti_dom	p.R5H	ENST00000568305.1	37	c.14	CCDS13232.1	20	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760491	0.49468	0.0	1.16E-4	ENSG00000101440	ENST00000374954	T	0.33216	1.42	5.3	3.24	0.37175	.	0.616301	0.16629	N	0.206151	T	0.22936	0.0554	L	0.41415	1.275	0.23162	N	0.998198	B	0.15473	0.013	B	0.06405	0.002	T	0.15037	-1.0451	10	0.59425	D	0.04	-4.6937	6.5837	0.22609	0.2141:0.0:0.7859:0.0	.	5	P42127	ASIP_HUMAN	H	5	ENSP00000364092:R5H	ENSP00000364092:R5H	R	+	2	0	ASIP	32311855	0.058000	0.20735	0.966000	0.40874	0.928000	0.56348	0.839000	0.27586	1.482000	0.48325	0.650000	0.86243	CGC	rs145074053	ASIP	-	NULL		0.582	ASIP-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ASIP	HGNC	protein_coding	OTTHUMT00000430541.1	0	0	0	52	52	74	0.00	0.00	G			32848194	+1	13	12	57	52	tier1	no_errors	ENST00000374954	ensembl	human	known	74_37	missense	18.57	18.75	SNP	0.668	A	13	57
TMEM2	23670	genome.wustl.edu	37	9	74360217	74360217	+	Missense_Mutation	SNP	C	C	A	rs139832017		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:74360217C>A	ENST00000377044.4	-	4	1290	c.751G>T	c.(751-753)Ggc>Tgc	p.G251C	TMEM2_ENST00000377066.5_Missense_Mutation_p.G251C	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	251					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AAGGGCAAGCCTGAGGAATTC	0.512													ENSG00000135048																																					0								C	CYS/GLY,CYS/GLY	0,4406		0,0,2203	83.0	77.0	79.0		751,751	6.0	1.0	9	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TMEM2	NM_001135820.1,NM_013390.2	159,159	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	251/1321,251/1384	74360217	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.751G>T	9.37:g.74360217C>A	ENSP00000366243:p.Gly251Cys		A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.G251C	ENST00000377044.4	37	c.751	CCDS6638.1	9	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026866	0.75390	0.0	1.16E-4	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.79845	-1.31;-1.24	6.03	6.03	0.97812	.	0.044877	0.85682	D	0.000000	D	0.91459	0.7304	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.91595	0.5290	10	0.87932	D	0	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	251;251	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	C	251	ENSP00000366243:G251C;ENSP00000366266:G251C	ENSP00000366243:G251C	G	-	1	0	TMEM2	73550037	1.000000	0.71417	0.998000	0.56505	0.447000	0.32167	7.263000	0.78421	2.861000	0.98227	0.655000	0.94253	GGC	rs139832017	TMEM2	-	NULL		0.512	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM2	HGNC	protein_coding	OTTHUMT00000052618.2	0	0	0	46	46	106	0.00	0.00	C	NM_013390		74360217	-1	12	32	42	109	tier1	no_errors	ENST00000377044	ensembl	human	known	74_37	missense	21.82	22.70	SNP	1.000	A	12	42
TAF1D	79101	genome.wustl.edu	37	11	93468208	93468208	+	IGR	SNP	T	T	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:93468208T>A	ENST00000448108.2	-	0	2082				SNORA40_ENST00000388090.1_RNA|MIR1304_ENST00000408243.1_RNA|TAF1D_ENST00000546088.1_5'UTR|SNORA8_ENST00000384574.1_RNA|SNORA18_ENST00000384416.1_RNA|SNORA1_ENST00000384107.1_RNA|SNORD5_ENST00000459342.1_RNA	NM_024116.3	NP_077021.1	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa						gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(3)|prostate(1)|skin(2)	7						gcttgacccattgcacctggc	0.438													ENSG00000166012																																					0																																										SO:0001628	intergenic_variant	0			-		CCDS8293.1	11q21	2012-05-30	2008-09-30	2008-09-30	ENSG00000166012	ENSG00000166012			28759	protein-coding gene	gene with protein product		612823	"""Josephin domain containing 3"""	JOSD3		15520167, 17318177	Standard	NM_024116		Approved	MGC5306, TAF(I)41	uc001pec.3	Q9H5J8	OTTHUMG00000167451		11.37:g.93468208T>A			Q6I9Y6	R	SNP	-	NULL	ENST00000448108.2	37	NULL	CCDS8293.1	11																																																																																			-	TAF1D	-	-		0.438	TAF1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1D	HGNC	protein_coding	OTTHUMT00000394662.2	0	0	0	32	32	30	0.00	0.00	T	NM_024116		93468208	-1	8	9	15	16	tier1	no_errors	ENST00000530089	ensembl	human	known	74_37	rna	34.78	36.00	SNP	0.001	A	8	15
PLEC	5339	genome.wustl.edu	37	8	144995433	144995433	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:144995433G>A	ENST00000322810.4	-	32	9136	c.8967C>T	c.(8965-8967)ggC>ggT	p.G2989G	PLEC_ENST00000357649.2_Silent_p.G2856G|PLEC_ENST00000354958.2_Silent_p.G2830G|PLEC_ENST00000354589.3_Silent_p.G2852G|PLEC_ENST00000345136.3_Silent_p.G2852G|PLEC_ENST00000356346.3_Silent_p.G2838G|PLEC_ENST00000436759.2_Silent_p.G2879G|PLEC_ENST00000398774.2_Silent_p.G2820G|PLEC_ENST00000527096.1_Silent_p.G2875G	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2989	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGTCAAAGAAGCCCTTGGTGT	0.667													ENSG00000178209																																					0													82.0	93.0	89.0					8																	144995433		2118	4240	6358	SO:0001819	synonymous_variant	0			-	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8967C>T	8.37:g.144995433G>A			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.G2989	ENST00000322810.4	37	c.8967	CCDS43772.1	8																																																																																			-	PLEC	-	smart_Plectin_repeat		0.667	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	0	0	0	60	60	10	0.00	0.00	G	NM_000445		144995433	-1	17	3	58	10	tier1	no_errors	ENST00000322810	ensembl	human	known	74_37	silent	22.67	23.08	SNP	1.000	A	17	58
HIST1H3E	8353	genome.wustl.edu	37	6	26225736	26225736	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr6:26225736G>A	ENST00000360408.1	+	1	354	c.354G>A	c.(352-354)gtG>gtA	p.V118V		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	118					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				CCAAACGCGTGACCATCATGC	0.552											OREG0017240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000196966																																					0													97.0	97.0	97.0					6																	26225736		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.354G>A	6.37:g.26225736G>A		785	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.V118	ENST00000360408.1	37	c.354	CCDS4596.1	6																																																																																			-	HIST1H3E	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3		0.552	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3E	HGNC	protein_coding	OTTHUMT00000040097.1	0	0	0	91	91	57	0.00	0.00	G	NM_003532		26225736	+1	16	12	60	49	tier1	no_errors	ENST00000360408	ensembl	human	known	74_37	silent	21.05	19.67	SNP	1.000	A	16	60
FGF23	8074	genome.wustl.edu	37	12	4488550	4488550	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:4488550G>A	ENST00000237837.1	-	1	344	c.199C>T	c.(199-201)Cag>Tag	p.Q67*		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	67					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			TAGATGGTCTGATGGGGTGCG	0.587													ENSG00000118972																																					0													162.0	125.0	137.0					12																	4488550		2203	4300	6503	SO:0001587	stop_gained	0			-	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.199C>T	12.37:g.4488550G>A	ENSP00000237837:p.Gln67*		Q4V758	Nonsense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.Q67*	ENST00000237837.1	37	c.199	CCDS8526.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.485755	0.97607	.	.	ENSG00000118972	ENST00000237837	.	.	.	4.03	4.03	0.46877	.	0.175652	0.50627	D	0.000112	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-12.1447	17.4772	0.87662	0.0:0.0:1.0:0.0	.	.	.	.	X	67	.	ENSP00000237837:Q67X	Q	-	1	0	FGF23	4358811	1.000000	0.71417	0.941000	0.38009	0.980000	0.70556	6.429000	0.73387	2.532000	0.85374	0.655000	0.94253	CAG	-	FGF23	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam		0.587	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF23	HGNC	protein_coding	OTTHUMT00000398936.1	0	0	0	22	22	105	0.00	0.00	G			4488550	-1	5	25	13	49	tier1	no_errors	ENST00000237837	ensembl	human	known	74_37	nonsense	27.78	33.78	SNP	0.992	A	5	13
CHMP7	91782	genome.wustl.edu	37	8	23115855	23115855	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:23115855C>G	ENST00000397677.1	+	7	1501	c.853C>G	c.(853-855)Ctc>Gtc	p.L285V	CHMP7_ENST00000313219.7_Missense_Mutation_p.L285V|CHMP7_ENST00000520102.1_3'UTR	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	285					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		ACTGAGGTCTCTCAAGGCCAA	0.577													ENSG00000147457																																					0													166.0	141.0	150.0					8																	23115855		2203	4300	6503	SO:0001583	missense	0			-	BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.853C>G	8.37:g.23115855C>G	ENSP00000380794:p.Leu285Val		B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Missense_Mutation	SNP	pfam_Snf7	p.L285V	ENST00000397677.1	37	c.853	CCDS6040.1	8	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063444	0.76187	.	.	ENSG00000147457	ENST00000397677;ENST00000313219	D;D	0.83075	-1.68;-1.68	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.91720	0.7382	M	0.82323	2.585	0.58432	D	0.999992	D;D	0.89917	0.999;1.0	D;D	0.97110	0.998;1.0	D	0.91885	0.5519	10	0.59425	D	0.04	-10.7227	16.9982	0.86373	0.0:1.0:0.0:0.0	.	175;285	B3KRZ9;Q8WUX9	.;CHMP7_HUMAN	V	285	ENSP00000380794:L285V;ENSP00000324491:L285V	ENSP00000324491:L285V	L	+	1	0	CHMP7	23171800	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.388000	0.34442	2.801000	0.96364	0.655000	0.94253	CTC	-	CHMP7	-	pfam_Snf7		0.577	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP7	HGNC	protein_coding	OTTHUMT00000254717.1	0	0	0	23	23	46	0.00	0.00	C	NM_152272		23115855	+1	12	10	23	84	tier1	no_errors	ENST00000313219	ensembl	human	known	74_37	missense	34.29	10.53	SNP	1.000	G	12	23
ZC2HC1A	51101	genome.wustl.edu	37	8	79609735	79609735	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:79609735G>T	ENST00000263849.4	+	6	700	c.598G>T	c.(598-600)Gtt>Ttt	p.V200F	ZC2HC1A_ENST00000521176.1_3'UTR	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	200							metal ion binding (GO:0046872)										TGGCAAAACTGTTGTAGGTAA	0.398													ENSG00000104427																																					0													59.0	57.0	58.0					8																	79609735		2203	4300	6503	SO:0001583	missense	0			-		CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.598G>T	8.37:g.79609735G>T	ENSP00000263849:p.Val200Phe		Q9Y372	Missense_Mutation	SNP	NULL	p.V200F	ENST00000263849.4	37	c.598	CCDS6223.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.55|10.55	1.380638|1.380638	0.24944|0.24944	.|.	.|.	ENSG00000104427|ENSG00000104427	ENST00000519307|ENST00000263849	.|T	.|0.46819	.|0.86	5.48|5.48	3.66|3.66	0.41972|0.41972	.|.	.|0.538192	.|0.21184	.|N	.|0.078767	T|T	0.26955|0.26955	0.0660|0.0660	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|P	.|0.35923	.|0.528	.|B	.|0.26864	.|0.074	T|T	0.03957|0.03957	-1.0989|-1.0989	5|9	.|.	.|.	.|.	-8.6006|-8.6006	9.023|9.023	0.36211|0.36211	0.2287:0.0:0.7713:0.0|0.2287:0.0:0.7713:0.0	.|.	.|200	.|Q96GY0	.|F164A_HUMAN	F|F	32|200	.|ENSP00000263849:V200F	.|.	C|V	+|+	2|1	0|0	FAM164A|FAM164A	79772290|79772290	0.999000|0.999000	0.42202|0.42202	0.996000|0.996000	0.52242|0.52242	0.279000|0.279000	0.26890|0.26890	3.045000|3.045000	0.49838|0.49838	0.770000|0.770000	0.33336|0.33336	0.655000|0.655000	0.94253|0.94253	TGT|GTT	-	ZC2HC1A	-	NULL		0.398	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1A	HGNC	protein_coding	OTTHUMT00000379423.2	0	0	0	76	76	160	0.00	0.00	G	NM_016010		79609735	+1	11	30	85	148	tier1	no_errors	ENST00000263849	ensembl	human	known	74_37	missense	11.46	16.85	SNP	0.868	T	11	85
TERT	7015	genome.wustl.edu	37	5	1279444	1279444	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:1279444G>A	ENST00000310581.5	-	5	2149	c.2092C>T	c.(2092-2094)Cgg>Tgg	p.R698W	TERT_ENST00000296820.5_Missense_Mutation_p.R698W|TERT_ENST00000508104.2_Missense_Mutation_p.R698W|TERT_ENST00000334602.6_Missense_Mutation_p.R698W	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	698	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	TCCTGGGCCCGCACACGCAGC	0.706									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis				ENSG00000164362																																					0													8.0	10.0	9.0					5																	1279444		2166	4258	6424	SO:0001583	missense	0	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	-	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2092C>T	5.37:g.1279444G>A	ENSP00000309572:p.Arg698Trp		O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	pfam_Telomerase_RBD,pfam_RVT,smart_Telomerase_RBD,pfscan_RVT,prints_Telomerase_RT	p.R698W	ENST00000310581.5	37	c.2092	CCDS3861.2	5	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111362	0.37242	.	.	ENSG00000164362	ENST00000310581;ENST00000296820;ENST00000334602;ENST00000508104	D;D;D;D	0.97089	-4.24;-4.22;-4.16;-4.22	4.67	2.77	0.32553	Reverse transcriptase (1);	0.844839	0.10230	N	0.699742	D	0.97895	0.9308	M	0.70275	2.135	0.29857	N	0.827975	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.981;0.991;0.958	D	0.93144	0.6544	10	0.87932	D	0	-9.6631	9.8893	0.41281	0.0:0.0:0.6324:0.3676	.	698;698;698	O14746-3;O14746;Q8NG38	.;TERT_HUMAN;.	W	698	ENSP00000309572:R698W;ENSP00000296820:R698W;ENSP00000334346:R698W;ENSP00000426042:R698W	ENSP00000296820:R698W	R	-	1	2	TERT	1332444	0.002000	0.14202	0.977000	0.42913	0.085000	0.17905	0.777000	0.26718	0.945000	0.37605	0.313000	0.20887	CGG	-	TERT	-	pfscan_RVT		0.706	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	HGNC	protein_coding	OTTHUMT00000206729.2	0	0	0	75	75	18	0.00	0.00	G			1279444	-1	29	8	84	15	tier1	no_errors	ENST00000310581	ensembl	human	known	74_37	missense	25.66	34.78	SNP	0.757	A	29	84
TIGD7	91151	genome.wustl.edu	37	16	3350579	3350579	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:3350579C>A	ENST00000396862.1	-	2	1864	c.36G>T	c.(34-36)ttG>ttT	p.L12F	TIGD7_ENST00000268674.2_Missense_Mutation_p.L12F|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	12	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						TTTTCTCCTCCAAATTCAGTG	0.338													ENSG00000140993																																					0													87.0	87.0	87.0					16																	3350579		2197	4300	6497	SO:0001583	missense	0			-	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.36G>T	16.37:g.3350579C>A	ENSP00000380071:p.Leu12Phe		Q9BXZ0	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_D-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_D-bd_dom,pfscan_HTH_Psq	p.L12F	ENST00000396862.1	37	c.36	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	C	14.35	2.509809	0.44660	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.49720	0.77;0.77	4.38	3.35	0.38373	Homeodomain-related (1);Homeodomain-like (1);Helix-turn-helix, Psq-like (1);Centromere protein Cenp-B, DNA-binding domain 1 (1);	0.000000	0.29594	U	0.011720	T	0.54983	0.1892	L	0.48877	1.53	0.26733	N	0.970545	D	0.76494	0.999	D	0.91635	0.999	T	0.38779	-0.9645	10	0.44086	T	0.13	.	6.4231	0.21754	0.0:0.8646:0.0:0.1354	.	12	Q6NT04	TIGD7_HUMAN	F	12	ENSP00000380071:L12F;ENSP00000268674:L12F	ENSP00000268674:L12F	L	-	3	2	TIGD7	3290580	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	0.502000	0.22594	2.283000	0.76528	0.655000	0.94253	TTG	-	TIGD7	-	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq		0.338	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1	0	0	0	77	77	159	0.00	0.00	C	NM_033208		3350579	-1	19	33	29	72	tier1	no_errors	ENST00000268674	ensembl	human	known	74_37	missense	38.78	31.43	SNP	1.000	A	19	29
GDF2	2658	genome.wustl.edu	37	10	48414171	48414171	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr10:48414171G>A	ENST00000249598.1	-	2	856	c.697C>T	c.(697-699)Cac>Tac	p.H233Y		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	233					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CCCTTCCTGTGGCTCTCCACA	0.577													ENSG00000128802																																					0													79.0	79.0	79.0					10																	48414171		2203	4300	6503	SO:0001583	missense	0			-	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.697C>T	10.37:g.48414171G>A	ENSP00000249598:p.His233Tyr		Q5VSQ9|Q9Y571	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.H233Y	ENST00000249598.1	37	c.697	CCDS7219.1	10	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333593	0.41297	.	.	ENSG00000128802	ENST00000249598	T	0.64260	-0.09	5.84	3.98	0.46160	Transforming growth factor-beta, N-terminal (1);	0.564646	0.21860	N	0.068048	T	0.56247	0.1972	M	0.65975	2.015	0.21782	N	0.999549	B	0.14438	0.01	B	0.13407	0.009	T	0.54268	-0.8319	10	0.59425	D	0.04	.	5.9106	0.19027	0.1422:0.0:0.5846:0.2732	.	233	Q9UK05	GDF2_HUMAN	Y	233	ENSP00000249598:H233Y	ENSP00000249598:H233Y	H	-	1	0	GDF2	48034177	0.016000	0.18221	0.985000	0.45067	0.987000	0.75469	1.566000	0.36396	0.811000	0.34303	0.591000	0.81541	CAC	-	GDF2	-	pfam_TGF-b_N		0.577	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF2	HGNC	protein_coding	OTTHUMT00000047891.1	0	0	0	29	29	52	0.00	0.00	G	NM_016204		48414171	-1	6	16	25	45	tier1	no_errors	ENST00000249598	ensembl	human	known	74_37	missense	19.35	26.23	SNP	0.615	A	6	25
WNK2	65268	genome.wustl.edu	37	9	96021357	96021357	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:96021357C>G	ENST00000297954.4	+	11	2527	c.2527C>G	c.(2527-2529)Ctc>Gtc	p.L843V	WNK2_ENST00000395477.2_Missense_Mutation_p.L843V|WNK2_ENST00000395475.2_Missense_Mutation_p.L777V|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000427277.2_Missense_Mutation_p.L455V|WNK2_ENST00000349097.3_Missense_Mutation_p.L455V	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	843					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CTTGCCGAGCCTCGCTGCCCC	0.701													ENSG00000165238																																					0													26.0	32.0	30.0					9																	96021357		2203	4296	6499	SO:0001583	missense	0			-	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.2527C>G	9.37:g.96021357C>G	ENSP00000297954:p.Leu843Val		Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L843V	ENST00000297954.4	37	c.2527		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.78|11.78	1.739748|1.739748	0.30865|0.30865	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000395475;ENST00000349097;ENST00000427277|ENST00000411624	T;T;T;T;T|.	0.77620|.	-0.48;-0.49;-1.11;0.1;0.11|.	5.11|5.11	3.11|3.11	0.35812|0.35812	.|.	0.359359|.	0.26224|.	N|.	0.025618|.	T|T	0.36496|0.36496	0.0969|0.0969	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	B;B;B;B;B|.	0.24721|.	0.11;0.041;0.067;0.11;0.067|.	B;B;B;B;B|.	0.18871|.	0.016;0.016;0.023;0.016;0.012|.	T|T	0.21759|0.21759	-1.0236|-1.0236	10|5	0.26408|.	T|.	0.33|.	.|.	2.5745|2.5745	0.04803|0.04803	0.2426:0.4143:0.2483:0.0948|0.2426:0.4143:0.2483:0.0948	.|.	843;843;446;843;843|.	Q9Y3S1-2;Q9Y3S1-4;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;.;WNK2_HUMAN|.	V|R	843;843;777;455;455|446	ENSP00000297954:L843V;ENSP00000378860:L843V;ENSP00000378858:L777V;ENSP00000297876:L455V;ENSP00000411181:L455V|.	ENSP00000297954:L843V|.	L|P	+|+	1|2	0|0	WNK2|WNK2	95061178|95061178	1.000000|1.000000	0.71417|0.71417	0.641000|0.641000	0.29422|0.29422	0.607000|0.607000	0.37147|0.37147	2.565000|2.565000	0.45939|0.45939	2.367000|2.367000	0.80283|0.80283	0.462000|0.462000	0.41574|0.41574	CTC|CCT	-	WNK2	-	NULL		0.701	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	HGNC	protein_coding	OTTHUMT00000317359.1	0	0	0	167	167	32	0.00	0.00	C	NM_006648		96021357	+1	55	13	178	46	tier1	no_errors	ENST00000297954	ensembl	human	known	74_37	missense	23.61	22.03	SNP	0.775	G	55	178
KAT7	11143	genome.wustl.edu	37	17	47903406	47903406	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:47903406C>T	ENST00000259021.4	+	13	1805	c.1525C>T	c.(1525-1527)Cgt>Tgt	p.R509C	KAT7_ENST00000424009.2_Missense_Mutation_p.R479C|KAT7_ENST00000510819.1_Missense_Mutation_p.R340C|KAT7_ENST00000509773.1_Missense_Mutation_p.R399C|KAT7_ENST00000454930.2_Missense_Mutation_p.R370C|KAT7_ENST00000513980.1_3'UTR|KAT7_ENST00000435742.2_Missense_Mutation_p.R323C|KAT7_ENST00000503935.2_Missense_Mutation_p.R353C	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	509	MYST-type HAT.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CTCCCCAGAACGTCCACTCTC	0.418													ENSG00000136504																																					0													99.0	97.0	98.0					17																	47903406		2203	4300	6503	SO:0001583	missense	0			-	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.1525C>T	17.37:g.47903406C>T	ENSP00000259021:p.Arg509Cys		B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.R509C	ENST00000259021.4	37	c.1525	CCDS11554.1	17	.	.	.	.	.	.	.	.	.	.	C	19.68	3.873448	0.72180	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009;ENST00000503935;ENST00000435742	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.74107	0.3673	M	0.88450	2.955	0.80722	D	1	P;B;P;B;P	0.49090	0.838;0.211;0.719;0.424;0.919	B;B;B;B;P	0.45856	0.274;0.081;0.075;0.222;0.495	T	0.81118	-0.1078	9	0.87932	D	0	-12.4457	18.7204	0.91691	0.0:1.0:0.0:0.0	.	472;340;399;370;509	B4DGY4;B4DFE0;B4DFB4;E7ER15;O95251	.;.;.;.;KAT7_HUMAN	C	509;370;399;340;479;353;323	.	ENSP00000259021:R509C	R	+	1	0	KAT7	45258405	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.930000	0.48924	2.756000	0.94617	0.561000	0.74099	CGT	-	KAT7	-	pfam_MOZ_SAS,superfamily_Acyl_CoA_acyltransferase		0.418	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	HGNC	protein_coding	OTTHUMT00000366032.1	1	1	0	110	110	34	0.90	0.00	C	NM_007067		47903406	+1	22	6	37	22	tier1	no_errors	ENST00000259021	ensembl	human	known	74_37	missense	37.29	21.43	SNP	1.000	T	22	37
MIP	4284	genome.wustl.edu	37	12	56847521	56847521	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:56847521C>T	ENST00000257979.4	-	2	407	c.379G>A	c.(379-381)Gtg>Atg	p.V127M	MIP_ENST00000555551.1_5'UTR	NM_012064.3	NP_036196.1	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	127					canalicular bile acid transport (GO:0015722)|lens development in camera-type eye (GO:0002088)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)|water transport (GO:0006833)	gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intracellular canaliculus (GO:0046691)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|structural constituent of eye lens (GO:0005212)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	16						GCCTGGCCCACGCTCACCGCA	0.582													ENSG00000135517																																					0													54.0	38.0	43.0					12																	56847521		2203	4300	6503	SO:0001583	missense	0			-		CCDS8919.1	12q13	2012-10-02				ENSG00000135517		"""Ion channels / Aquaporins"""	7103	protein-coding gene	gene with protein product	aquaporin 0	154050				1840563, 7536742	Standard	NM_012064		Approved	MP26, LIM1, AQP0	uc001slh.3	P30301		ENST00000257979.4:c.379G>A	12.37:g.56847521C>T	ENSP00000257979:p.Val127Met		Q17R41	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	p.V127M	ENST00000257979.4	37	c.379	CCDS8919.1	12	.	.	.	.	.	.	.	.	.	.	C	14.24	2.476509	0.44044	.	.	ENSG00000135517	ENST00000257979	D	0.93307	-3.2	4.98	3.1	0.35709	Aquaporin-like (2);	0.284770	0.35179	N	0.003387	D	0.83949	0.5365	N	0.13327	0.33	0.33720	D	0.6169	B	0.13594	0.008	B	0.15870	0.014	T	0.81011	-0.1126	10	0.56958	D	0.05	-4.9365	4.7305	0.12962	0.1565:0.6081:0.1516:0.0838	.	127	P30301	MIP_HUMAN	M	127	ENSP00000257979:V127M	ENSP00000257979:V127M	V	-	1	0	MIP	55133788	0.773000	0.28580	1.000000	0.80357	0.941000	0.58515	1.133000	0.31430	1.199000	0.43173	0.655000	0.94253	GTG	-	MIP	-	pfam_MIP,superfamily_Aquaporin-like,tigrfam_MIP		0.582	MIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIP	HGNC	protein_coding	OTTHUMT00000409620.1	0	0	0	23	23	43	0.00	0.00	C	NM_012064		56847521	-1	6	17	12	52	tier1	no_errors	ENST00000257979	ensembl	human	known	74_37	missense	33.33	24.64	SNP	1.000	T	6	12
ZNF592	9640	genome.wustl.edu	37	15	85327615	85327615	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr15:85327615C>T	ENST00000560079.2	+	4	1997	c.1709C>T	c.(1708-1710)cCa>cTa	p.P570L	ZNF592_ENST00000299927.3_Missense_Mutation_p.P570L	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	570					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTCTATGCGCCAAATCTCAGC	0.602													ENSG00000166716																																					0													93.0	97.0	96.0					15																	85327615		2203	4299	6502	SO:0001583	missense	0			-	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.1709C>T	15.37:g.85327615C>T	ENSP00000452877:p.Pro570Leu		Q2M1T2|Q504Y9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P570L	ENST00000560079.2	37	c.1709	CCDS32317.1	15	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793761	0.70452	.	.	ENSG00000166716	ENST00000299927	T	0.01113	5.32	4.85	4.85	0.62838	.	0.050975	0.85682	D	0.000000	T	0.04497	0.0123	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51748	-0.8666	10	0.59425	D	0.04	-10.3021	15.5092	0.75766	0.0:1.0:0.0:0.0	.	570	Q92610	ZN592_HUMAN	L	570	ENSP00000299927:P570L	ENSP00000299927:P570L	P	+	2	0	ZNF592	83128619	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.541000	0.82084	2.503000	0.84419	0.655000	0.94253	CCA	-	ZNF592	-	NULL		0.602	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	0	0	1	52	52	110	0.00	0.90	C	NM_014630		85327615	+1	16	27	44	105	tier1	no_errors	ENST00000299927	ensembl	human	known	74_37	missense	26.23	20.30	SNP	1.000	T	16	44
CPZ	8532	genome.wustl.edu	37	4	8609140	8609140	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr4:8609140G>A	ENST00000360986.4	+	7	1389	c.1215G>A	c.(1213-1215)acG>acA	p.T405T	CPZ_ENST00000382480.2_Silent_p.T268T|CPZ_ENST00000315782.6_Silent_p.T394T|CPZ_ENST00000429646.2_5'UTR	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	405					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TTTCTCCCACGCCCGACGAGA	0.632											OREG0016100	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000109625																																					0													79.0	68.0	72.0					4																	8609140		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1215G>A	4.37:g.8609140G>A		650	O00520|Q96MX2	Silent	SNP	pfam_Peptidase_M14,pfam_Frizzled_dom,superfamily_Frizzled_dom,superfamily_CarboxyPept-like_regulatory,smart_Frizzled_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Frizzled_dom	p.T405	ENST00000360986.4	37	c.1215	CCDS33953.1	4																																																																																			-	CPZ	-	pfam_Peptidase_M14,smart_Peptidase_M14		0.632	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	HGNC	protein_coding	OTTHUMT00000207001.4	0	0	0	55	55	94	0.00	0.00	G	NM_003652		8609140	+1	16	35	26	65	tier1	no_errors	ENST00000360986	ensembl	human	known	74_37	silent	37.21	34.65	SNP	0.006	A	16	26
PDE10A	10846	genome.wustl.edu	37	6	166401082	166401082	+	5'Flank	SNP	A	A	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr6:166401082A>T	ENST00000535229.1	-	0	0				LINC00473_ENST00000584911.1_lincRNA			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	ATTTAAAAAGAGACAGTGAGA	0.438													ENSG00000223414																									Esophageal Squamous(22;308 615 5753 12038 40624)												0																																										SO:0001631	upstream_gene_variant	0			-	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986		6.37:g.166401082A>T	Exception_encountered		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	R	SNP	-	NULL	ENST00000535229.1	37	NULL		6																																																																																			-	LINC00473	-	-		0.438	PDE10A-004	KNOWN	mRNA_end_NF|basic	processed_transcript	LINC00473	HGNC	protein_coding	OTTHUMT00000470299.1	0	0	0	25	25	29	0.00	0.00	A			166401082	-1	8	13	15	23	tier1	no_errors	ENST00000444465	ensembl	human	known	74_37	rna	34.78	36.11	SNP	0.000	T	8	15
SEMA5A	9037	genome.wustl.edu	37	5	9063189	9063189	+	Silent	SNP	C	C	A	rs142331748		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:9063189C>A	ENST00000382496.5	-	18	2993	c.2328G>T	c.(2326-2328)ggG>ggT	p.G776G		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	776					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CAGAGTATCTCCCAGCACGCA	0.557													ENSG00000112902																																					0								C		1,4405	2.1+/-5.4	0,1,2202	46.0	41.0	42.0		2328	-5.8	0.0	5	dbSNP_134	42	0,8600		0,0,4300	no	coding-synonymous	SEMA5A	NM_003966.2		0,1,6502	AA,AC,CC		0.0,0.0227,0.0077		776/1075	9063189	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2328G>T	5.37:g.9063189C>A			D3DTC6|O60408|Q1RLL9	Silent	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.G776	ENST00000382496.5	37	c.2328	CCDS3875.1	5																																																																																			rs142331748	SEMA5A	-	NULL		0.557	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	0	0	0	27	27	132	0.00	0.00	C			9063189	-1	8	27	33	136	tier1	no_errors	ENST00000382496	ensembl	human	known	74_37	silent	19.51	16.56	SNP	0.014	A	8	33
CHD1	1105	genome.wustl.edu	37	5	98236658	98236658	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:98236658T>A	ENST00000284049.3	-	6	865	c.716A>T	c.(715-717)aAt>aTt	p.N239I		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	239					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	ATAGCTAACATTAACAGTTGC	0.383													ENSG00000153922																																					0													160.0	156.0	157.0					5																	98236658		2203	4300	6503	SO:0001583	missense	0			-	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.716A>T	5.37:g.98236658T>A	ENSP00000284049:p.Asn239Ile		Q17RZ3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.N239I	ENST00000284049.3	37	c.716	CCDS34204.1	5	.	.	.	.	.	.	.	.	.	.	T	24.0	4.478494	0.84747	.	.	ENSG00000153922	ENST00000284049	D	0.90197	-2.63	5.51	5.51	0.81932	.	0.000000	0.35677	U	0.003051	D	0.93559	0.7944	M	0.76002	2.32	0.80722	D	1	D	0.58268	0.982	P	0.55455	0.776	D	0.93765	0.7070	10	0.52906	T	0.07	.	15.9157	0.79517	0.0:0.0:0.0:1.0	.	239	O14646	CHD1_HUMAN	I	239	ENSP00000284049:N239I	ENSP00000284049:N239I	N	-	2	0	CHD1	98264558	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.546000	0.82137	2.218000	0.71995	0.377000	0.23210	AAT	-	CHD1	-	NULL		0.383	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	HGNC	protein_coding	OTTHUMT00000370295.1	0	0	0	39	39	103	0.00	0.00	T	NM_001270		98236658	-1	5	42	26	70	tier1	no_errors	ENST00000284049	ensembl	human	known	74_37	missense	16.13	37.50	SNP	1.000	A	5	26
CAB39L	81617	genome.wustl.edu	37	13	49925039	49925039	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr13:49925039G>A	ENST00000355854.4	-	5	902	c.405C>T	c.(403-405)gcC>gcT	p.A135A	CAB39L_ENST00000410043.1_Silent_p.A135A|CAB39L_ENST00000409308.1_Silent_p.A135A|CAB39L_ENST00000347776.5_Silent_p.A135A|CAB39L_ENST00000409130.1_5'UTR	NM_030925.2	NP_112187.2	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like	135					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|stomach(1)	12		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		CAATCTGTGGGGCTTCATATC	0.343													ENSG00000102547																																					0													84.0	81.0	82.0					13																	49925039		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK022639	CCDS9416.2	13q14.11	2008-02-05			ENSG00000102547	ENSG00000102547			20290	protein-coding gene	gene with protein product		612175					Standard	NM_030925		Approved	bA103J18.3, FLJ12577, MO2L	uc001vcw.3	Q9H9S4	OTTHUMG00000016914	ENST00000355854.4:c.405C>T	13.37:g.49925039G>A			Q5TAW6|Q6WG71|Q96FG1|Q9BZ33	Silent	SNP	pfam_Mo25,superfamily_ARM-type_fold	p.A135	ENST00000355854.4	37	c.405	CCDS9416.2	13																																																																																			-	CAB39L	-	pfam_Mo25,superfamily_ARM-type_fold		0.343	CAB39L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAB39L	HGNC	protein_coding	OTTHUMT00000044908.3	0	0	0	56	56	162	0.00	0.00	G	NM_030925		49925039	-1	11	36	28	100	tier1	no_errors	ENST00000347776	ensembl	human	known	74_37	silent	27.50	26.47	SNP	1.000	A	11	28
LRRC69	100130742	genome.wustl.edu	37	8	92136873	92136873	+	Intron	SNP	T	T	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:92136873T>G	ENST00000448384.2	+	2	310				LRRC69_ENST00000343709.3_Intron	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69											endometrium(1)	1						AGGAACAACATTATAGCATCA	0.289													ENSG00000214954																																					0													47.0	40.0	42.0					8																	92136873		692	1588	2280	SO:0001627	intron_variant	0			-	AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.310+26T>G	8.37:g.92136873T>G				R	SNP	-	NULL	ENST00000448384.2	37	NULL		8																																																																																			-	LRRC69	-	-		0.289	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	LRRC69	HGNC	protein_coding	OTTHUMT00000415207.1	0	0	0	62	62	112	0.00	0.00	T	NM_001129890		92136873	+1	21	66	42	78	tier1	no_errors	ENST00000522144	ensembl	human	putative	74_37	rna	33.33	45.83	SNP	0.003	G	21	42
PRKACG	5568	genome.wustl.edu	37	9	71628289	71628289	+	Silent	SNP	G	G	A	rs140133619		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:71628289G>A	ENST00000377276.2	-	1	750	c.720C>T	c.(718-720)taC>taT	p.Y240Y		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)	p.Y240Y(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GCTGGTCGGCGTAGAAGGGTG	0.602													ENSG00000165059																									Esophageal Squamous(110;2236 2623 32146)												1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											70.0	68.0	68.0					9																	71628289		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.720C>T	9.37:g.71628289G>A			O60850|Q5VZ02|Q86YI1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y240	ENST00000377276.2	37	c.720	CCDS6625.1	9																																																																																			-	PRKACG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.602	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACG	HGNC	protein_coding	OTTHUMT00000052559.1	0	0	1	36	36	63	0.00	1.56	G			71628289	-1	5	31	16	25	tier1	no_errors	ENST00000377276	ensembl	human	known	74_37	silent	23.81	55.36	SNP	0.998	A	5	16
NALCN	259232	genome.wustl.edu	37	13	101936334	101936334	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr13:101936334C>A	ENST00000251127.6	-	10	1165	c.1084G>T	c.(1084-1086)Gta>Tta	p.V362L	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.V362L	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	362					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCCACAGCTACCAGCTGCCAA	0.468													ENSG00000102452																																					0													43.0	43.0	43.0					13																	101936334		2203	4300	6503	SO:0001583	missense	0			-	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1084G>T	13.37:g.101936334C>A	ENSP00000251127:p.Val362Leu		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.V362L	ENST00000251127.6	37	c.1084	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779604	0.90195	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98296	-4.58;-4.85	5.6	5.6	0.85130	.	0.058479	0.64402	D	0.000002	D	0.97888	0.9306	L	0.60455	1.87	0.80722	D	1	P;P;P	0.49961	0.76;0.915;0.93	P;P;P	0.49887	0.505;0.542;0.625	D	0.98065	1.0395	10	0.49607	T	0.09	.	19.6044	0.95575	0.0:1.0:0.0:0.0	.	362;362;362	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	L	362	ENSP00000251127:V362L;ENSP00000365367:V362L	ENSP00000251127:V362L	V	-	1	0	NALCN	100734335	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.450000	0.80656	2.638000	0.89438	0.543000	0.68304	GTA	-	LCN	-	NULL		0.468	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN	HGNC	protein_coding	OTTHUMT00000045663.2	0	0	0	87	87	72	0.00	0.00	C	NM_052867		101936334	-1	25	17	47	56	tier1	no_errors	ENST00000251127	ensembl	human	known	74_37	missense	34.72	23.29	SNP	1.000	A	25	47
SCN8A	6334	genome.wustl.edu	37	12	52145167	52145167	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:52145167G>A	ENST00000354534.6	+	14	2338	c.2160G>A	c.(2158-2160)ccG>ccA	p.P720P	SCN8A_ENST00000550891.1_Silent_p.P720P|SCN8A_ENST00000545061.1_Silent_p.P720P	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	720					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	GAAAGTGCCCGCCATGCTGGT	0.458													ENSG00000196876																																					0													142.0	130.0	134.0					12																	52145167		1891	4102	5993	SO:0001819	synonymous_variant	0			-	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2160G>A	12.37:g.52145167G>A			B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.P720	ENST00000354534.6	37	c.2160	CCDS44891.1	12																																																																																			-	SCN8A	-	NULL		0.458	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	0	0	0	67	67	72	0.00	0.00	G	NM_014191		52145167	+1	9	22	35	69	tier1	no_errors	ENST00000354534	ensembl	human	known	74_37	silent	20.45	24.18	SNP	0.002	A	9	35
TRIOBP	11078	genome.wustl.edu	37	22	38120154	38120154	+	Missense_Mutation	SNP	G	G	A	rs201112075	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr22:38120154G>A	ENST00000406386.3	+	7	1846	c.1591G>A	c.(1591-1593)Gcc>Acc	p.A531T		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	531					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AACATCCTGCGCCCAGCGGGA	0.597													ENSG00000100106	-|||	29	0.00579073	0.0008	0.0303	5008	,	,		29059	0.0069		0.0	False		,,,				2504	0.0																0													76.0	121.0	106.0					22																	38120154		1942	4169	6111	SO:0001583	missense	0			-	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1591G>A	22.37:g.38120154G>A	ENSP00000384312:p.Ala531Thr		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A531T	ENST00000406386.3	37	c.1591	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	-	2.979	-0.210711	0.06140	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.19250	2.16	3.17	-2.72	0.05968	.	.	.	.	.	T	0.12008	0.0292	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.30563	-0.9974	9	0.49607	T	0.09	.	6.7719	0.23598	0.6323:0.0:0.3677:0.0	.	531	Q9H2D6	TARA_HUMAN	T	531	ENSP00000384312:A531T	ENSP00000384312:A531T	A	+	1	0	TRIOBP	36450100	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-4.532000	0.00220	-0.265000	0.09352	-0.763000	0.03452	GCC	rs201112075	TRIOBP	-	NULL		0.597	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	0	0	0	165	165	47	0.00	0.00	G			38120154	+1	33	18	129	57	tier1	no_errors	ENST00000406386	ensembl	human	known	74_37	missense	20.12	23.68	SNP	0.000	A	33	129
C2CD5	9847	genome.wustl.edu	37	12	22670939	22670939	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:22670939C>G	ENST00000333957.4	-	8	1188	c.933G>C	c.(931-933)ttG>ttC	p.L311F	C2CD5_ENST00000544930.1_Intron|C2CD5_ENST00000446597.1_Missense_Mutation_p.L311F|C2CD5_ENST00000542676.1_Missense_Mutation_p.L311F|C2CD5_ENST00000396028.2_Intron|C2CD5_ENST00000536386.1_Intron|C2CD5_ENST00000540703.1_5'Flank|C2CD5_ENST00000545552.1_Intron	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	311					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										GTGTCAAACTCAAATCTGTGT	0.388													ENSG00000111731																																					0													195.0	191.0	193.0					12																	22670939		2203	4300	6503	SO:0001583	missense	0			-	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.933G>C	12.37:g.22670939C>G	ENSP00000334229:p.Leu311Phe		B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L311F	ENST00000333957.4	37	c.933	CCDS31758.1	12	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049558	0.36181	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000542676	T;T;T	0.58210	0.35;0.35;0.35	6.04	5.15	0.70609	.	.	.	.	.	T	0.69214	0.3086	M	0.65975	2.015	0.80722	D	1	P;D	0.65815	0.684;0.995	P;D	0.72982	0.453;0.979	T	0.68021	-0.5519	9	0.32370	T	0.25	-6.4076	15.1783	0.72934	0.0:0.9329:0.0:0.0671	.	311;311	B4DRN7;Q86YS7	.;K0528_HUMAN	F	311	ENSP00000334229:L311F;ENSP00000388756:L311F;ENSP00000441951:L311F	ENSP00000334229:L311F	L	-	3	2	KIAA0528	22562206	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.088000	0.71371	1.568000	0.49683	0.561000	0.74099	TTG	-	C2CD5	-	NULL		0.388	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD5	HGNC	protein_coding	OTTHUMT00000402257.1	0	0	0	61	61	106	0.00	0.00	C	NM_014802		22670939	-1	13	31	19	41	tier1	no_errors	ENST00000333957	ensembl	human	known	74_37	missense	40.62	43.06	SNP	1.000	G	13	19
DYNC1I1	1780	genome.wustl.edu	37	7	95625320	95625320	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:95625320G>C	ENST00000324972.6	+	10	1148	c.955G>C	c.(955-957)Gga>Cga	p.G319R	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.G299R|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.G302R|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.G282R|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.G282R|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.G302R	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	319					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TGAACCAGATGGAGTGGCCTT	0.428													ENSG00000158560																																					0													226.0	201.0	210.0					7																	95625320		2203	4300	6503	SO:0001583	missense	0			-	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.955G>C	7.37:g.95625320G>C	ENSP00000320130:p.Gly319Arg		B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.G319R	ENST00000324972.6	37	c.955	CCDS5644.1	7	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377713	0.82682	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81;2.81	4.89	4.89	0.63831	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.054422	0.64402	D	0.000001	T	0.45836	0.1362	M	0.93720	3.45	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.60037	-0.7341	10	0.87932	D	0	-1.2247	18.6224	0.91326	0.0:0.0:1.0:0.0	.	302;299;302;319;282	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	R	302;319;282;299;282;302	ENSP00000392337:G302R;ENSP00000320130:G319R;ENSP00000438377:G282R;ENSP00000398118:G299R;ENSP00000352348:G282R;ENSP00000412444:G302R	ENSP00000320130:G319R	G	+	1	0	DYNC1I1	95463256	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.717000	0.92951	0.655000	0.94253	GGA	-	DYNC1I1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.428	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	HGNC	protein_coding	OTTHUMT00000333432.1	0	0	0	88	88	202	0.00	0.00	G	NM_004411		95625320	+1	37	75	53	113	tier1	no_errors	ENST00000324972	ensembl	human	known	74_37	missense	41.11	39.89	SNP	1.000	C	37	53
RHOT2	89941	genome.wustl.edu	37	16	720824	720824	+	Intron	SNP	C	C	A	rs546664930		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:720824C>A	ENST00000315082.4	+	9	753				RHOT2_ENST00000569943.2_3'UTR	NM_138769.2	NP_620124.1	Q8IXI1	MIRO2_HUMAN	ras homolog family member T2						cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|pancreas(2)|prostate(1)	13		Hepatocellular(780;0.0218)				CCTCCGCTGCCGTTAGTGACT	0.642													ENSG00000140983																																					0													18.0	23.0	22.0					16																	720824		2193	4294	6487	SO:0001627	intron_variant	0			-	BC014942	CCDS10417.1	16p13.3	2013-01-10	2012-02-27	2004-03-24	ENSG00000140983	ENSG00000140983		"""EF-hand domain containing"""	21169	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 2"""	613889	"""chromosome 16 open reading frame 39"", ""ras homolog gene family, member T2"""	C16orf39, ARHT2		12482879	Standard	NM_138769		Approved	MIRO-2	uc002cip.3	Q8IXI1	OTTHUMG00000121139	ENST00000315082.4:c.639+51C>A	16.37:g.720824C>A			A2IDC2|Q8NF53|Q96C13|Q96S17|Q9BT60|Q9H7M8	R	SNP	-	NULL	ENST00000315082.4	37	NULL	CCDS10417.1	16																																																																																			-	RHOT2	-	-		0.642	RHOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOT2	HGNC	protein_coding	OTTHUMT00000241617.1	0	0	0	147	147	56	0.00	0.00	C	NM_138769		720824	+1	45	17	82	36	tier1	no_errors	ENST00000569943	ensembl	human	known	74_37	rna	35.43	32.08	SNP	0.000	A	45	82
SNHG14	104472715	genome.wustl.edu	37	15	25287126	25287126	+	RNA	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr15:25287126G>T	ENST00000552781.1	+	0	328				SNORD109A_ENST00000459128.1_RNA																							TGTTTGGATCGATGATGAGAA	0.433													ENSG00000270246																																					0													69.0	66.0	67.0					15																	25287126		876	1991	2867			0			-																													15.37:g.25287126G>T				R	SNP	-	NULL	ENST00000552781.1	37	NULL		15																																																																																			-	SNORD109A	-	-		0.433	RP11-701H24.10-001	KNOWN	basic|readthrough_transcript	processed_transcript	SNORD109A	HGNC	processed_transcript	OTTHUMT00000473258.1	0	0	0	98	98	112	0.00	0.00	G			25287126	+1	18	16	43	53	tier1	no_errors	ENST00000459128	ensembl	human	known	74_37	rna	29.51	23.19	SNP	0.983	T	18	43
DST	667	genome.wustl.edu	37	6	56489356	56489356	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr6:56489356T>G	ENST00000361203.3	-	32	4275	c.4268A>C	c.(4267-4269)gAt>gCt	p.D1423A	DST_ENST00000312431.6_Missense_Mutation_p.D1423A|DST_ENST00000446842.2_Missense_Mutation_p.D1097A|DST_ENST00000518935.1_Missense_Mutation_p.D1097A|DST_ENST00000244364.6_Missense_Mutation_p.D1097A|DST_ENST00000421834.2_Missense_Mutation_p.D1423A|DST_ENST00000370788.2_Missense_Mutation_p.D1423A|DST_ENST00000370769.4_Missense_Mutation_p.D1423A|DST_ENST00000370754.5_Missense_Mutation_p.D1601A|DST_ENST00000370765.6_Missense_Mutation_p.D1097A			Q03001	DYST_HUMAN	dystonin	1423					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTTCAATGAATCACCAGCAAA	0.393													ENSG00000151914																																					0													82.0	77.0	79.0					6																	56489356		2203	4300	6503	SO:0001583	missense	0			-	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.4268A>C	6.37:g.56489356T>G	ENSP00000354508:p.Asp1423Ala		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.D1601A	ENST00000361203.3	37	c.4802		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.16|18.16	3.562977|3.562977	0.65538|0.65538	.|.	.|.	ENSG00000151914|ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935|ENST00000522360	T;T;T;T;T;T;T;T;T;T;T;T|.	0.26957|.	1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.56097|.	D|.	0.000028|.	T|T	0.52980|0.52980	0.1768|0.1768	L|L	0.52126|0.52126	1.63|1.63	0.19300|.	N|.	0.999977|.	P;D;D;P;D;D;P;D|.	0.89917|.	0.734;0.983;0.979;0.672;0.992;0.999;0.734;1.0|.	B;P;P;B;D;D;B;D|.	0.78314|.	0.196;0.68;0.549;0.217;0.915;0.991;0.196;0.981|.	T|T	0.54918|0.54918	-0.8221|-0.8221	9|4	0.52906|.	T|.	0.07|.	.|.	15.1167|15.1167	0.72407|0.72407	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1423;1423;1601;1097;1097;1097;1423;1097|.	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8|.	.;.;.;.;.;.;DYST_HUMAN;.|.	A|L	1097;1601;1423;1423;1097;1423;1423;1423;1097;1463;1097;1097|95	ENSP00000244364:D1097A;ENSP00000359790:D1601A;ENSP00000359805:D1423A;ENSP00000400883:D1423A;ENSP00000393645:D1097A;ENSP00000307959:D1423A;ENSP00000359824:D1423A;ENSP00000354508:D1423A;ENSP00000404924:D1097A;ENSP00000431030:D1463A;ENSP00000359801:D1097A;ENSP00000431003:D1097A|.	ENSP00000244364:D1097A|.	D|I	-|-	2|1	0|0	DST|DST	56597315|56597315	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.995000|0.995000	0.86356|0.86356	7.997000|7.997000	0.88414|0.88414	2.222000|2.222000	0.72286|0.72286	0.528000|0.528000	0.53228|0.53228	GAT|ATT	-	DST	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.393	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	0	0	0	32	32	107	0.00	0.00	T	NM_001723		56489356	-1	8	24	19	89	tier1	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	29.63	21.24	SNP	1.000	G	8	19
PCLO	27445	genome.wustl.edu	37	7	82544714	82544714	+	Silent	SNP	A	A	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:82544714A>G	ENST00000333891.9	-	7	12925	c.12588T>C	c.(12586-12588)atT>atC	p.I4196I	PCLO_ENST00000423517.2_Silent_p.I4196I|PCLO_ENST00000437081.1_Silent_p.I916I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTTAGGGTCAATTAGTGATT	0.363													ENSG00000186472																																					0													82.0	73.0	76.0					7																	82544714		1870	4101	5971	SO:0001819	synonymous_variant	0			-	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12588T>C	7.37:g.82544714A>G				Silent	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.I4196	ENST00000333891.9	37	c.12588	CCDS47630.1	7																																																																																			-	PCLO	-	NULL		0.363	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	0	0	0	46	46	127	0.00	0.00	A	NM_014510		82544714	-1	7	20	47	135	tier1	no_errors	ENST00000333891	ensembl	human	known	74_37	silent	12.96	12.90	SNP	1.000	G	7	47
DYNC1H1	1778	genome.wustl.edu	37	14	102505858	102505858	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:102505858C>G	ENST00000360184.4	+	61	11734	c.11570C>G	c.(11569-11571)tCc>tGc	p.S3857C	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3857					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CAGCGCCTGTCCATTATAACA	0.532													ENSG00000197102																																					0													98.0	91.0	94.0					14																	102505858		2203	4300	6503	SO:0001583	missense	0			-	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11570C>G	14.37:g.102505858C>G	ENSP00000348965:p.Ser3857Cys		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.S3857C	ENST00000360184.4	37	c.11570	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467064	0.43839	.	.	ENSG00000197102	ENST00000360184	T	0.62364	0.03	5.42	3.51	0.40186	.	0.299368	0.37261	N	0.002170	T	0.59004	0.2162	L	0.50333	1.59	0.41158	D	0.986071	B	0.32939	0.391	B	0.35240	0.198	T	0.59563	-0.7431	10	0.52906	T	0.07	.	15.4934	0.75629	0.0:0.737:0.263:0.0	.	3857	Q14204	DYHC1_HUMAN	C	3857	ENSP00000348965:S3857C	ENSP00000348965:S3857C	S	+	2	0	DYNC1H1	101575611	0.753000	0.28349	0.634000	0.29324	0.786000	0.44442	1.506000	0.35747	0.589000	0.29677	0.591000	0.81541	TCC	-	DYNC1H1	-	NULL		0.532	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	0	0	0	33	33	112	0.00	0.00	C	NM_001376		102505858	+1	13	28	19	90	tier1	no_errors	ENST00000360184	ensembl	human	known	74_37	missense	40.62	23.73	SNP	0.902	G	13	19
SRPX2	27286	genome.wustl.edu	37	X	99905881	99905881	+	Intron	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chrX:99905881C>G	ENST00000373004.3	+	3	591				SRPX2_ENST00000481988.1_3'UTR	NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2						angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						CCCTGCTTCTCAAGCCCAGAA	0.517													ENSG00000102359																																					0													70.0	65.0	67.0					X																	99905881		2203	4300	6503	SO:0001627	intron_variant	0			-	AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.163+19C>G	X.37:g.99905881C>G			B3KQT3|Q8WW85	R	SNP	-	NULL	ENST00000373004.3	37	NULL	CCDS14471.1	X																																																																																			-	SRPX2	-	-		0.517	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX2	HGNC	protein_coding	OTTHUMT00000057486.1	0	0	0	23	23	48	0.00	0.00	C	NM_014467		99905881	+1	5	24	17	49	tier1	no_errors	ENST00000481988	ensembl	human	known	74_37	rna	21.74	32.88	SNP	0.000	G	5	17
CLDN10	9071	genome.wustl.edu	37	13	96212707	96212707	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr13:96212707G>A	ENST00000299339.2	+	3	483	c.454G>A	c.(454-456)Gtt>Att	p.V152I	CLDN10_ENST00000376855.1_Missense_Mutation_p.V70I|CLDN10_ENST00000376873.3_Missense_Mutation_p.V150I	NM_006984.4	NP_008915.1	P78369	CLD10_HUMAN	claudin 10	152					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			TCCTCTCTTTGTTGAGCAAAA	0.368													ENSG00000134873																																					0													150.0	138.0	142.0					13																	96212707		2203	4300	6503	SO:0001583	missense	0			-	U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000299339.2:c.454G>A	13.37:g.96212707G>A	ENSP00000299339:p.Val152Ile		Q6IBF9|Q96N78	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin10,prints_Claudin	p.V152I	ENST00000299339.2	37	c.454	CCDS9476.1	13	.	.	.	.	.	.	.	.	.	.	G	7.957	0.746236	0.15710	.	.	ENSG00000134873	ENST00000376873;ENST00000299339;ENST00000376855	D;D;D	0.88975	-2.45;-2.45;-2.45	5.75	2.93	0.34026	.	0.818386	0.11238	N	0.584893	D	0.83580	0.5285	L	0.52011	1.625	0.33863	D	0.634069	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.15052	0.005;0.005;0.012	T	0.78076	-0.2345	10	0.28530	T	0.3	.	5.9064	0.19004	0.2186:0.0:0.6458:0.1357	.	152;152;150	Q6IBF9;P78369;Q96N78	.;CLD10_HUMAN;.	I	150;152;70	ENSP00000366069:V150I;ENSP00000299339:V152I;ENSP00000366051:V70I	ENSP00000299339:V152I	V	+	1	0	CLDN10	95010708	0.037000	0.19845	0.403000	0.26384	0.845000	0.48019	0.316000	0.19469	0.760000	0.33108	0.650000	0.86243	GTT	-	CLDN10	-	pfam_PMP22/EMP/MP20/Claudin		0.368	CLDN10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN10	HGNC	protein_coding	OTTHUMT00000045484.1	0	0	0	39	39	146	0.00	0.00	G	NM_006984		96212707	+1	18	38	33	53	tier1	no_errors	ENST00000299339	ensembl	human	known	74_37	missense	35.29	41.76	SNP	0.700	A	18	33
CDH11	1009	genome.wustl.edu	37	16	65016106	65016106	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:65016106G>T	ENST00000268603.4	-	8	1713	c.1098C>A	c.(1096-1098)gaC>gaA	p.D366E	CDH11_ENST00000566827.1_Missense_Mutation_p.D240E|CDH11_ENST00000394156.3_Missense_Mutation_p.D366E	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	366	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CGGTCACAGTGTCCTTGAAAG	0.488			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			ENSG00000140937																												Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													163.0	131.0	142.0					16																	65016106		2203	4300	6503	SO:0001583	missense	0			-	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1098C>A	16.37:g.65016106G>T	ENSP00000268603:p.Asp366Glu		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D366E	ENST00000268603.4	37	c.1098	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991260	0.74703	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.01705	4.68;4.68	5.61	4.62	0.57501	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.11110	0.0271	M	0.89904	3.07	0.45930	D	0.998766	D;D	0.76494	0.992;0.999	P;D	0.69479	0.639;0.964	T	0.00135	-1.2007	10	0.87932	D	0	.	9.0595	0.36425	0.1743:0.0:0.8257:0.0	.	366;366	P55287-2;P55287	.;CAD11_HUMAN	E	366;366;349	ENSP00000268603:D366E;ENSP00000377711:D366E	ENSP00000268603:D366E	D	-	3	2	CDH11	63573607	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	0.954000	0.29175	1.433000	0.47394	0.655000	0.94253	GAC	-	CDH11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.488	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	0	0	0	103	103	131	0.00	0.00	G	NM_033664		65016106	-1	18	33	40	51	tier1	no_errors	ENST00000268603	ensembl	human	known	74_37	missense	31.03	39.29	SNP	1.000	T	18	40
DYNC1H1	1778	genome.wustl.edu	37	14	102505775	102505775	+	Silent	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:102505775C>G	ENST00000360184.4	+	61	11651	c.11487C>G	c.(11485-11487)ctC>ctG	p.L3829L	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3829					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AGTACTCCCTCCAGTTTTTCC	0.542													ENSG00000197102																																					0													94.0	87.0	89.0					14																	102505775		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11487C>G	14.37:g.102505775C>G			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.L3829	ENST00000360184.4	37	c.11487	CCDS9966.1	14																																																																																			-	DYNC1H1	-	NULL		0.542	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	0	0	0	61	61	120	0.00	0.00	C	NM_001376		102505775	+1	14	28	48	126	tier1	no_errors	ENST00000360184	ensembl	human	known	74_37	silent	22.58	18.18	SNP	0.620	G	14	48
PCDHA8	56140	genome.wustl.edu	37	5	140222280	140222280	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:140222280C>T	ENST00000531613.1	+	1	1374	c.1374C>T	c.(1372-1374)ccC>ccT	p.P458P	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.P458P|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	458	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGCGCAGCCCGAGTACACGG	0.672													ENSG00000204962																																					0													56.0	57.0	57.0					5																	140222280		2194	4267	6461	SO:0001819	synonymous_variant	0			-	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1374C>T	5.37:g.140222280C>T			B9EGT7|O75281	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P458	ENST00000531613.1	37	c.1374	CCDS54919.1	5																																																																																			-	PCDHA8	-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.672	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	0	0	0	103	103	38	0.00	0.00	C	NM_018911		140222280	+1	33	9	136	27	tier1	no_errors	ENST00000531613	ensembl	human	known	74_37	silent	19.41	25.00	SNP	0.001	T	33	136
CHST11	50515	genome.wustl.edu	37	12	105151192	105151192	+	Missense_Mutation	SNP	G	G	A	rs148230565	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:105151192G>A	ENST00000303694.5	+	3	1109	c.670G>A	c.(670-672)Gcc>Acc	p.A224T	CHST11_ENST00000549260.1_Missense_Mutation_p.A219T	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	224					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						GCGGAAGAACGCCACCCAGGA	0.567													ENSG00000171310																																					0													125.0	106.0	113.0					12																	105151192		2203	4300	6503	SO:0001583	missense	0			-	AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.670G>A	12.37:g.105151192G>A	ENSP00000305725:p.Ala224Thr		A8K4F8|Q9NXY6|Q9NY36	Missense_Mutation	SNP	pfam_Sulfotransferase	p.A224T	ENST00000303694.5	37	c.670	CCDS9099.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074232	0.76415	.	.	ENSG00000171310	ENST00000549260;ENST00000303694	T;T	0.74209	-0.82;-0.82	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.84234	0.5427	M	0.72118	2.19	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.65443	0.774;0.935	T	0.80443	-0.1380	10	0.20046	T	0.44	-9.1307	19.2155	0.93776	0.0:0.0:1.0:0.0	.	219;224	Q9NPF2-2;Q9NPF2	.;CHSTB_HUMAN	T	219;224	ENSP00000450004:A219T;ENSP00000305725:A224T	ENSP00000305725:A224T	A	+	1	0	CHST11	103675322	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.573000	0.74009	2.553000	0.86117	0.655000	0.94253	GCC	-	CHST11	-	pfam_Sulfotransferase		0.567	CHST11-001	KNOWN	basic|CCDS	protein_coding	CHST11	HGNC	protein_coding	OTTHUMT00000405960.2	0	0	0	54	54	47	0.00	0.00	G	NM_018413		105151192	+1	8	24	76	116	tier1	no_errors	ENST00000303694	ensembl	human	known	74_37	missense	9.52	17.14	SNP	1.000	A	8	76
BLNK	29760	genome.wustl.edu	37	10	98031113	98031113	+	Silent	SNP	A	A	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr10:98031113A>G	ENST00000224337.5	-	1	184	c.43T>C	c.(43-45)Ttg>Ctg	p.L15L	BLNK_ENST00000371176.2_Silent_p.L15L|BLNK_ENST00000427367.2_Silent_p.L15L|BLNK_ENST00000495266.1_Silent_p.L15L|BLNK_ENST00000413476.2_Silent_p.L15L	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	15					B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		TCTTACCTCAACTTCTGACTG	0.438													ENSG00000095585																																					0													108.0	104.0	105.0					10																	98031113		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.43T>C	10.37:g.98031113A>G			O75498|O75499|Q2MD49	Silent	SNP	pfam_SH2,smart_SH2,pfscan_SH2	p.L15	ENST00000224337.5	37	c.43	CCDS7446.1	10																																																																																			-	BLNK	-	NULL		0.438	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLNK	HGNC	protein_coding	OTTHUMT00000049593.1	0	0	0	77	77	125	0.00	0.00	A	NM_013314		98031113	-1	13	20	34	59	tier1	no_errors	ENST00000224337	ensembl	human	known	74_37	silent	27.08	25.32	SNP	0.987	G	13	34
IQCG	84223	genome.wustl.edu	37	3	197639636	197639636	+	Intron	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:197639636G>T	ENST00000265239.6	-	9	1313				IQCG_ENST00000455191.1_Intron	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G							extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		AGAACAATCAGATACCAGTAC	0.522													ENSG00000114473																																					0													129.0	137.0	134.0					3																	197639636		2203	4300	6503	SO:0001627	intron_variant	0			-	AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.889-16C>A	3.37:g.197639636G>T			Q9BST2|Q9HAG8	R	SNP	-	NULL	ENST00000265239.6	37	NULL	CCDS3331.1	3																																																																																			-	IQCG	-	-		0.522	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	0	0	0	71	71	101	0.00	0.00	G	NM_032263		197639636	-1	16	22	40	48	tier1	no_errors	ENST00000469822	ensembl	human	putative	74_37	rna	28.57	31.43	SNP	0.001	T	16	40
EVI2A	2123	genome.wustl.edu	37	17	29645499	29645499	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:29645499C>G	ENST00000462804.2	-	2	932	c.533G>C	c.(532-534)aGa>aCa	p.R178T	EVI2A_ENST00000247270.3_Missense_Mutation_p.R201T|NF1_ENST00000581113.2_3'UTR|NF1_ENST00000356175.3_Intron|EVI2A_ENST00000461237.1_Missense_Mutation_p.R178T|CTD-2370N5.3_ENST00000578584.1_Nonstop_Mutation_p.*117Y|NF1_ENST00000358273.4_Intron	NM_014210.3	NP_055025.2	P22794	EVI2A_HUMAN	ecotropic viral integration site 2A	178					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.0?(8)|p.?(3)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;5.94e-13)|Epithelial(4;7.98e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.4e-12)|GBM - Glioblastoma multiforme(4;0.18)		GCCATTGCTTCTAGGCTGACG	0.438													ENSG00000126860																																					11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											90.0	79.0	83.0					17																	29645499		2203	4300	6503	SO:0001583	missense	0			-	M55267	CCDS32608.1, CCDS42293.1	17q11.2	2008-07-18			ENSG00000126860	ENSG00000126860			3499	protein-coding gene	gene with protein product		158380		EVI2		2117566	Standard	NM_014210		Approved	EVDA	uc002hgm.3	P22794	OTTHUMG00000159306	ENST00000462804.2:c.533G>C	17.37:g.29645499C>G	ENSP00000420557:p.Arg178Thr		B2R5X2|B4DHX8	Missense_Mutation	SNP	pfam_Ectropic_vir_integratn_site_2A,pirsf_Ectropic_vir_integratn_site_2A	p.R201T	ENST00000462804.2	37	c.602	CCDS42293.1	17	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516696	0.85495	.	.	ENSG00000126860	ENST00000394755;ENST00000462804;ENST00000461237;ENST00000247270	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.79034	0.4378	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80139	-0.1507	9	0.87932	D	0	.	18.8387	0.92172	0.0:1.0:0.0:0.0	.	178;201	P22794;P22794-2	EVI2A_HUMAN;.	T	178;174;178;201	.	ENSP00000247270:R201T	R	-	2	0	EVI2A	26669625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.167000	0.64972	2.688000	0.91661	0.655000	0.94253	AGA	-	EVI2A	-	pfam_Ectropic_vir_integratn_site_2A,pirsf_Ectropic_vir_integratn_site_2A		0.438	EVI2A-001	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	EVI2A	HGNC	protein_coding	OTTHUMT00000354491.3	0	0	0	37	37	88	0.00	0.00	C	NM_014210		29645499	-1	17	25	27	54	tier1	no_errors	ENST00000247270	ensembl	human	known	74_37	missense	38.64	31.65	SNP	1.000	G	17	27
DYNC1H1	1778	genome.wustl.edu	37	14	102504807	102504807	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:102504807G>C	ENST00000360184.4	+	58	11083	c.10919G>C	c.(10918-10920)aGc>aCc	p.S3640T	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3640	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GATGTGGAAAGCTACGATCCA	0.527													ENSG00000197102																																					0													79.0	77.0	78.0					14																	102504807		2203	4300	6503	SO:0001583	missense	0			-	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10919G>C	14.37:g.102504807G>C	ENSP00000348965:p.Ser3640Thr		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.S3640T	ENST00000360184.4	37	c.10919	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684860	0.68157	.	.	ENSG00000197102	ENST00000360184	T	0.24350	1.86	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.18467	0.0443	N	0.13168	0.305	0.80722	D	1	B	0.32283	0.362	B	0.30029	0.11	T	0.05178	-1.0901	10	0.27082	T	0.32	.	20.1184	0.97949	0.0:0.0:1.0:0.0	.	3640	Q14204	DYHC1_HUMAN	T	3640	ENSP00000348965:S3640T	ENSP00000348965:S3640T	S	+	2	0	DYNC1H1	101574560	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.869000	0.99810	2.769000	0.95229	0.655000	0.94253	AGC	-	DYNC1H1	-	NULL		0.527	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	0	0	0	49	49	140	0.00	0.00	G	NM_001376		102504807	+1	12	33	42	114	tier1	no_errors	ENST00000360184	ensembl	human	known	74_37	missense	22.22	22.45	SNP	1.000	C	12	42
DYNC1H1	1778	genome.wustl.edu	37	14	102505585	102505585	+	Silent	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:102505585C>G	ENST00000360184.4	+	60	11618	c.11454C>G	c.(11452-11454)ctC>ctG	p.L3818L	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3818					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGGAGTCCCTCAAGCAGGTGG	0.642													ENSG00000197102																																					0													55.0	56.0	55.0					14																	102505585		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11454C>G	14.37:g.102505585C>G			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.L3818	ENST00000360184.4	37	c.11454	CCDS9966.1	14																																																																																			-	DYNC1H1	-	NULL		0.642	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	0	0	0	90	90	32	0.00	0.00	C	NM_001376		102505585	+1	19	21	58	38	tier1	no_errors	ENST00000360184	ensembl	human	known	74_37	silent	24.68	35.59	SNP	1.000	G	19	58
OR52A5	390054	genome.wustl.edu	37	11	5153475	5153475	+	Missense_Mutation	SNP	C	C	T	rs538295981	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:5153475C>T	ENST00000307388.1	-	1	397	c.398G>A	c.(397-399)aGa>aAa	p.R133K		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	133					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGTGGCATGTCTCAAGGGGAT	0.463													ENSG00000171944																																					0													71.0	62.0	65.0					11																	5153475		2201	4298	6499	SO:0001583	missense	0			-	BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.398G>A	11.37:g.5153475C>T	ENSP00000303469:p.Arg133Lys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R133K	ENST00000307388.1	37	c.398	CCDS31373.1	11	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534595	0.64972	.	.	ENSG00000171944	ENST00000307388	T	0.00416	7.51	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000068	T	0.01029	0.0034	M	0.89353	3.025	0.36194	D	0.850262	P	0.50943	0.94	P	0.49853	0.624	T	0.58509	-0.7624	10	0.72032	D	0.01	.	17.5151	0.87771	0.0:1.0:0.0:0.0	.	133	Q9H2C5	O52A5_HUMAN	K	133	ENSP00000303469:R133K	ENSP00000303469:R133K	R	-	2	0	OR52A5	5110051	0.005000	0.15991	1.000000	0.80357	0.298000	0.27526	2.136000	0.42121	2.707000	0.92482	0.655000	0.94253	AGA	-	OR52A5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.463	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52A5	HGNC	protein_coding	OTTHUMT00000142823.1	0	0	1	48	48	125	0.00	0.79	C	NM_001005160		5153475	-1	8	26	26	56	tier1	no_errors	ENST00000307388	ensembl	human	known	74_37	missense	23.53	31.71	SNP	1.000	T	8	26
KRTAP13-3	337960	genome.wustl.edu	37	21	31797893	31797893	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr21:31797893C>T	ENST00000390690.2	-	1	393	c.338G>A	c.(337-339)gGa>gAa	p.G113E		NM_181622.1	NP_853653.1	Q3SY46	KR133_HUMAN	keratin associated protein 13-3	113						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	14						GCTCCTGGATCCACAGCTCAG	0.502													ENSG00000240432																																					0													44.0	48.0	47.0					21																	31797893		2136	4283	6419	SO:0001583	missense	0			-	AP001708	CCDS13591.1	21q22.1	2006-03-13			ENSG00000240432	ENSG00000240432		"""Keratin associated proteins"""	18925	protein-coding gene	gene with protein product						12359730	Standard	NM_181622		Approved	KAP13.3	uc002yob.1	Q3SY46	OTTHUMG00000057776	ENST00000390690.2:c.338G>A	21.37:g.31797893C>T	ENSP00000375109:p.Gly113Glu		Q3LI78	Missense_Mutation	SNP	pfam_KRTAP_PMG	p.G113E	ENST00000390690.2	37	c.338	CCDS13591.1	21	.	.	.	.	.	.	.	.	.	.	c	15.28	2.787835	0.49997	.	.	ENSG00000240432	ENST00000390690;ENST00000448917	T	0.03386	3.95	4.54	3.65	0.41850	.	0.175712	0.26293	U	0.025203	T	0.13970	0.0338	M	0.83774	2.66	0.09310	N	1	P	0.49447	0.924	P	0.57468	0.821	T	0.02037	-1.1225	10	0.72032	D	0.01	-5.4913	9.1497	0.36955	0.0:0.8944:0.0:0.1056	.	113	Q3SY46	KR133_HUMAN	E	113;103	ENSP00000375109:G113E	ENSP00000375109:G113E	G	-	2	0	KRTAP13-3	30719764	0.021000	0.18746	0.052000	0.19188	0.002000	0.02628	3.191000	0.50981	1.206000	0.43276	-0.237000	0.12165	GGA	-	KRTAP13-3	-	pfam_KRTAP_PMG		0.502	KRTAP13-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP13-3	HGNC	protein_coding	OTTHUMT00000128228.2	0	0	0	34	34	71	0.00	0.00	C			31797893	-1	12	9	15	32	tier1	no_errors	ENST00000390690	ensembl	human	known	74_37	missense	44.44	21.95	SNP	0.026	T	12	15
PIK3CA	5290	genome.wustl.edu	37	3	178936094	178936094	+	Missense_Mutation	SNP	C	C	A	rs121913286		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:178936094C>A	ENST00000263967.3	+	10	1793	c.1636C>A	c.(1636-1638)Cag>Aag	p.Q546K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	546	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		Q -> E (in BC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> K (in OC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> P (found in an anaplastic astrocytoma sample; unknown pathological significance). {ECO:0000269|PubMed:15289301}.|Q -> R (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.Q546K(89)|p.Q546E(12)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATCACTGAGCAGGAGAAAGA	0.358		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)			ENSG00000121879																									Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	101	Substitution - Missense(101)	large_intestine(55)|breast(17)|endometrium(15)|central_nervous_system(3)|lung(3)|ovary(3)|skin(2)|cervix(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)											61.0	61.0	61.0					3																	178936094		1814	4072	5886	SO:0001583	missense	0			-		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1636C>A	3.37:g.178936094C>A	ENSP00000263967:p.Gln546Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.Q546K	ENST00000263967.3	37	c.1636	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838482	0.91117	.	.	ENSG00000121879	ENST00000263967	T	0.62232	0.04	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75191	0.3816	M	0.64404	1.975	0.80722	D	1	D	0.58970	0.984	P	0.58660	0.843	T	0.73833	-0.3858	10	0.46703	T	0.11	-14.2064	20.0024	0.97423	0.0:1.0:0.0:0.0	.	546	P42336	PK3CA_HUMAN	K	546	ENSP00000263967:Q546K	ENSP00000263967:Q546K	Q	+	1	0	PIK3CA	180418788	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.487000	0.81328	2.722000	0.93159	0.467000	0.42956	CAG	rs121913286	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.358	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	0	0	0	55	55	120	0.00	0.00	C			178936094	+1	18	15	35	39	tier1	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	33.96	27.78	SNP	1.000	A	18	35
SCN2A	6326	genome.wustl.edu	37	2	166188073	166188073	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:166188073A>T	ENST00000375437.2	+	14	2673	c.2383A>T	c.(2383-2385)Aac>Tac	p.N795Y	SCN2A_ENST00000375427.2_Missense_Mutation_p.N795Y|SCN2A_ENST00000283256.6_Missense_Mutation_p.N795Y|SCN2A_ENST00000357398.3_Missense_Mutation_p.N795Y	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	795					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTCTGTTGGAAACCTGGTAAG	0.398													ENSG00000136531																																					0													80.0	70.0	74.0					2																	166188073		2203	4299	6502	SO:0001583	missense	0			-	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2383A>T	2.37:g.166188073A>T	ENSP00000364586:p.Asn795Tyr		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.N795Y	ENST00000375437.2	37	c.2383	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443187	0.83993	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.54	5.55	5.55	0.83447	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99327	0.9764	H	0.99273	4.495	0.80722	D	1	P;P	0.47106	0.89;0.869	P;D	0.65140	0.652;0.932	D	0.98227	1.0481	10	0.87932	D	0	.	15.6948	0.77488	1.0:0.0:0.0:0.0	.	795;795	Q99250-2;Q99250	.;SCN2A_HUMAN	Y	795	ENSP00000364586:N795Y;ENSP00000349973:N795Y;ENSP00000283256:N795Y;ENSP00000364576:N795Y	ENSP00000283256:N795Y	N	+	1	0	SCN2A	165896319	1.000000	0.71417	0.992000	0.48379	0.911000	0.54048	9.339000	0.96797	2.114000	0.64651	0.477000	0.44152	AAC	-	SCN2A	-	pfam_Ion_trans_dom		0.398	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	0	0	0	57	57	140	0.00	0.00	A	NM_021007		166188073	+1	11	36	26	61	tier1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	29.73	37.11	SNP	1.000	T	11	26
VN1R4	317703	genome.wustl.edu	37	19	53770511	53770511	+	Silent	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:53770511G>T	ENST00000311170.4	-	1	461	c.408C>A	c.(406-408)atC>atA	p.I136I	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	136					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		ACATGCACACGATCCAGCACA	0.473										HNSCC(26;0.072)			ENSG00000228567																																					0													26.0	20.0	22.0					19																	53770511		2203	4297	6500	SO:0001819	synonymous_variant	0			-	AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.408C>A	19.37:g.53770511G>T			Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Silent	SNP	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.I136	ENST00000311170.4	37	c.408	CCDS33099.1	19																																																																																			-	VN1R4	-	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.473	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R4	HGNC	protein_coding	OTTHUMT00000464287.1	0	0	0	133	133	73	0.00	0.00	G	NM_173857		53770511	-1	40	23	140	93	tier1	no_errors	ENST00000311170	ensembl	human	known	74_37	silent	22.22	19.83	SNP	0.003	T	40	140
WDR7	23335	genome.wustl.edu	37	18	54424260	54424260	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr18:54424260G>C	ENST00000254442.3	+	15	2647	c.2436G>C	c.(2434-2436)ttG>ttC	p.L812F	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.L812F	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	812					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		CCTGGGGTTTGAATGAAGTAC	0.458													ENSG00000091157																																					0													176.0	167.0	170.0					18																	54424260		2203	4300	6503	SO:0001583	missense	0			-	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2436G>C	18.37:g.54424260G>C	ENSP00000254442:p.Leu812Phe		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L812F	ENST00000254442.3	37	c.2436	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222298	0.58560	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.72282	-0.64;-0.56	5.83	2.01	0.26516	.	0.000000	0.64402	D	0.000001	T	0.77870	0.4195	M	0.61703	1.905	0.54753	D	0.999982	D;D	0.89917	1.0;0.998	D;D	0.78314	0.988;0.991	T	0.73678	-0.3907	10	0.51188	T	0.08	.	7.4927	0.27471	0.2014:0.1203:0.6783:0.0	.	812;812	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	F	812;812;137;812	ENSP00000254442:L812F;ENSP00000350187:L812F	ENSP00000254442:L812F	L	+	3	2	WDR7	52575258	1.000000	0.71417	0.996000	0.52242	0.999000	0.98932	0.584000	0.23864	0.081000	0.16988	0.655000	0.94253	TTG	-	WDR7	-	NULL		0.458	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	0	0	0	65	65	129	0.00	0.00	G			54424260	+1	6	28	27	63	tier1	no_errors	ENST00000254442	ensembl	human	known	74_37	missense	18.18	30.77	SNP	1.000	C	6	27
CCDC103	388389	genome.wustl.edu	37	17	42978925	42978925	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:42978925C>T	ENST00000417826.2	+	3	276	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W	FAM187A_ENST00000331733.4_5'UTR|AC015936.3_ENST00000441312.1_RNA|FAM187A_ENST00000412523.2_Intron|EFTUD2_ENST00000591382.1_5'Flank|CCDC103_ENST00000410006.2_Missense_Mutation_p.R61W|EFTUD2_ENST00000402521.3_5'Flank|CCDC103_ENST00000410027.1_Missense_Mutation_p.R61W|EFTUD2_ENST00000426333.2_5'Flank|EFTUD2_ENST00000592576.1_5'Flank	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	61					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				GCCACTGGAGCGGAAGGATAA	0.517													ENSG00000167131																																					0													150.0	127.0	135.0					17																	42978925		2203	4300	6503	SO:0001583	missense	0			-	AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.181C>T	17.37:g.42978925C>T	ENSP00000391692:p.Arg61Trp		A8K145|B8ZZU0	Missense_Mutation	SNP	NULL	p.R61W	ENST00000417826.2	37	c.181	CCDS11490.1	17	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164605	0.78339	.	.	ENSG00000167131	ENST00000357776;ENST00000410027;ENST00000417826;ENST00000410006	T;T;T	0.79033	-1.23;-1.23;-1.23	5.63	3.41	0.39046	.	0.652152	0.12226	U	0.487882	T	0.76018	0.3929	L	0.58810	1.83	0.35278	D	0.781083	D	0.67145	0.996	B	0.43623	0.425	T	0.82244	-0.0553	10	0.87932	D	0	-2.8181	13.5562	0.61761	0.4575:0.5425:0.0:0.0	.	61	Q8IW40	CC103_HUMAN	W	61	ENSP00000350420:R61W;ENSP00000391692:R61W;ENSP00000387252:R61W	ENSP00000350420:R61W	R	+	1	2	CCDC103	40334451	0.606000	0.26949	0.798000	0.32154	0.977000	0.68977	0.665000	0.25083	1.224000	0.43551	0.555000	0.69702	CGG	-	CCDC103	-	NULL		0.517	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC103	HGNC	protein_coding	OTTHUMT00000334578.1	0	0	0	67	67	127	0.00	0.00	C	NM_213607		42978925	+1	9	32	22	53	tier1	no_errors	ENST00000410006	ensembl	human	known	74_37	missense	29.03	37.65	SNP	0.742	T	9	22
KIAA1109	84162	genome.wustl.edu	37	4	123150375	123150375	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr4:123150375G>C	ENST00000264501.4	+	25	3395	c.3022G>C	c.(3022-3024)Ggt>Cgt	p.G1008R	KIAA1109_ENST00000455637.1_Missense_Mutation_p.G1008R|KIAA1109_ENST00000495260.1_3'UTR|KIAA1109_ENST00000388738.3_Missense_Mutation_p.G1008R			Q2LD37	K1109_HUMAN	KIAA1109	1008					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGTTGAGCATGGTTGTGCTAC	0.358													ENSG00000138688																																					0													224.0	204.0	210.0					4																	123150375		1879	4118	5997	SO:0001583	missense	0			-	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.3022G>C	4.37:g.123150375G>C	ENSP00000264501:p.Gly1008Arg		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.G1008R	ENST00000264501.4	37	c.3022	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.852284|4.852284	0.91355|0.91355	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	T;T;T|.	0.53423|.	0.62;0.62;0.62|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.179586|.	0.35096|.	U|.	0.003441|.	T|T	0.69205|0.69205	0.3085|0.3085	L|L	0.47016|0.47016	1.485|1.485	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.65413|0.65413	-0.6174|-0.6174	10|5	0.36615|.	T|.	0.2|.	.|.	19.0697|19.0697	0.93127|0.93127	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1008|.	Q2LD37|.	K1109_HUMAN|.	R|S	1008|839	ENSP00000264501:G1008R;ENSP00000373390:G1008R;ENSP00000389925:G1008R|.	ENSP00000264501:G1008R|.	G|W	+|+	1|2	0|0	KIAA1109|KIAA1109	123369825|123369825	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.585000|9.585000	0.98223|0.98223	2.545000|2.545000	0.85829|0.85829	0.561000|0.561000	0.74099|0.74099	GGT|TGG	-	KIAA1109	-	NULL		0.358	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	0	0	0	65	65	162	0.00	0.00	G	NM_020797		123150375	+1	14	29	32	61	tier1	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	30.43	32.22	SNP	1.000	C	14	32
SPTA1	6708	genome.wustl.edu	37	1	158648297	158648297	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:158648297G>C	ENST00000368147.4	-	6	886	c.706C>G	c.(706-708)Cag>Gag	p.Q236E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	236					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGCTTAGACTGAATTAAGGGT	0.403													ENSG00000163554																																					0													72.0	68.0	69.0					1																	158648297		1871	4104	5975	SO:0001583	missense	0			-	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.706C>G	1.37:g.158648297G>C	ENSP00000357129:p.Gln236Glu		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.Q236E	ENST00000368147.4	37	c.706	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	7.679	0.688677	0.14973	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.48836	0.8;0.8	4.66	-2.9	0.05648	.	0.956614	0.08483	N	0.939112	T	0.10035	0.0246	N	0.21282	0.65	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37337	-0.9710	10	0.09084	T	0.74	.	9.8126	0.40833	0.0:0.0709:0.5401:0.3891	.	236	P02549	SPTA1_HUMAN	E	236	ENSP00000357130:Q236E;ENSP00000357129:Q236E	ENSP00000357129:Q236E	Q	-	1	0	SPTA1	156914921	0.563000	0.26594	0.002000	0.10522	0.004000	0.04260	0.370000	0.20433	-0.573000	0.05998	-1.496000	0.00964	CAG	-	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.403	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	0	0	0	67	67	88	0.00	0.00	G	NM_003126		158648297	-1	13	14	32	29	tier1	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	28.26	32.56	SNP	0.011	C	13	32
PMEL	6490	genome.wustl.edu	37	12	56355132	56355132	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:56355132C>T	ENST00000548747.1	-	3	965	c.303G>A	c.(301-303)caG>caA	p.Q101Q	PMEL_ENST00000539511.1_Intron|PMEL_ENST00000552882.1_Silent_p.Q101Q|PMEL_ENST00000550447.1_Silent_p.Q64Q|PMEL_ENST00000548689.1_5'UTR|PMEL_ENST00000550464.1_Intron|PMEL_ENST00000360714.4_Silent_p.Q101Q|PMEL_ENST00000536427.1_Silent_p.Q101Q|PMEL_ENST00000548493.1_Silent_p.Q101Q|PMEL_ENST00000449260.2_Silent_p.Q101Q			P40967	PMEL_HUMAN	premelanosome protein	101					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCCAGATAACCTGCCCATCTG	0.478													ENSG00000185664																																					0													192.0	169.0	177.0					12																	56355132		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.303G>A	12.37:g.56355132C>T			B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.Q101	ENST00000548747.1	37	c.303	CCDS8897.1	12																																																																																			-	PMEL	-	NULL		0.478	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	HGNC	protein_coding	OTTHUMT00000409626.1	0	0	0	27	27	114	0.00	0.00	C	NM_006928		56355132	-1	8	31	35	97	tier1	no_errors	ENST00000360714	ensembl	human	known	74_37	silent	18.60	24.22	SNP	0.999	T	8	35
AXL	558	genome.wustl.edu	37	19	41748828	41748828	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:41748828G>C	ENST00000301178.4	+	11	1543	c.1353G>C	c.(1351-1353)tgG>tgC	p.W451C	AXL_ENST00000359092.3_Missense_Mutation_p.W442C|AXL_ENST00000593513.1_Missense_Mutation_p.W183C	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	451					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						GGCCCTGGTGGTATGTACTGC	0.562													ENSG00000167601																																					0													154.0	122.0	132.0					19																	41748828		2203	4300	6503	SO:0001583	missense	0			-	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.1353G>C	19.37:g.41748828G>C	ENSP00000301178:p.Trp451Cys		Q8N5L2|Q9UD27	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.W451C	ENST00000301178.4	37	c.1353	CCDS12575.1	19	.	.	.	.	.	.	.	.	.	.	g	17.46	3.394679	0.62066	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.75154	-0.91;-0.85	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.81654	0.4868	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.979	T	0.81050	-0.1108	10	0.38643	T	0.18	-13.5429	16.3138	0.82906	0.0:0.0:1.0:0.0	.	442;451	P30530-2;P30530	.;UFO_HUMAN	C	451;442	ENSP00000301178:W451C;ENSP00000351995:W442C	ENSP00000301178:W451C	W	+	3	0	AXL	46440668	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	6.161000	0.71868	2.198000	0.70561	0.650000	0.86243	TGG	-	AXL	-	NULL		0.562	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	HGNC	protein_coding	OTTHUMT00000463323.2	0	0	0	41	41	120	0.00	0.00	G			41748828	+1	12	24	45	130	tier1	no_errors	ENST00000301178	ensembl	human	known	74_37	missense	21.05	15.58	SNP	1.000	C	12	45
KIR3DX1	90011	genome.wustl.edu	37	19	55045167	55045167	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:55045167G>A	ENST00000335056.3	+	3	325	c.287G>A	c.(286-288)gGa>gAa	p.G96E				Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	96	Ig-like C2-type 1.					extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		AGATGTGTTGGAATTTACAAG	0.547													ENSG00000104970																									Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)												0													83.0	86.0	85.0					19																	55045167		2113	4245	6358	SO:0001583	missense	0			-	BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.287G>A	19.37:g.55045167G>A	ENSP00000335388:p.Gly96Glu		B7WNL0|Q8N0S4	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.G96E	ENST00000335056.3	37	c.287		19	.	.	.	.	.	.	.	.	.	.	G	9.053	0.992520	0.18966	.	.	ENSG00000104970	ENST00000335056	T	0.13778	2.56	2.74	0.485	0.16830	.	.	.	.	.	T	0.13200	0.0320	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30031	-0.9992	6	0.87932	D	0	.	3.1897	0.06613	0.1489:0.0:0.5907:0.2604	.	.	.	.	E	96	ENSP00000335388:G96E	ENSP00000221567:G96E	G	+	2	0	KIR3DX1	59736979	0.020000	0.18652	0.001000	0.08648	0.012000	0.07955	0.966000	0.29331	0.211000	0.20683	0.655000	0.94253	GGA	-	KIR3DX1	-	smart_Ig_sub		0.547	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	KIR3DX1	HGNC	protein_coding	OTTHUMT00000140800.2	0	0	0	77	77	86	0.00	0.00	G	NR_026716		55045167	+1	18	23	77	79	tier1	no_errors	ENST00000335056	ensembl	human	known	74_37	missense	18.95	22.55	SNP	0.001	A	18	77
ZNF398	57541	genome.wustl.edu	37	7	148851394	148851394	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:148851394C>T	ENST00000475153.1	+	2	649	c.382C>T	c.(382-384)Ctg>Ttg	p.L128L	ZNF398_ENST00000335901.4_5'UTR|ZNF398_ENST00000483892.1_5'UTR|ZNF398_ENST00000420008.2_5'UTR|ZNF398_ENST00000491174.1_5'UTR|ZNF398_ENST00000485111.1_3'UTR|ZNF398_ENST00000426851.2_5'UTR|ZNF398_ENST00000540950.1_Silent_p.L133L			Q8TD17	ZN398_HUMAN	zinc finger protein 398	128					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			CTTCTGGATCCTGCGGCTCCC	0.517													ENSG00000197024																																					0													50.0	53.0	52.0					7																	148851394		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.382C>T	7.37:g.148851394C>T			A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.L133	ENST00000475153.1	37	c.397	CCDS5894.1	7																																																																																			-	ZNF398	-	NULL		0.517	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF398	HGNC	protein_coding	OTTHUMT00000352722.2	0	0	0	87	87	79	0.00	0.00	C			148851394	+1	17	23	36	48	tier1	no_errors	ENST00000540950	ensembl	human	known	74_37	silent	32.08	32.39	SNP	1.000	T	17	36
KIR3DX1	90011	genome.wustl.edu	37	19	55054687	55054687	+	3'UTR	SNP	C	C	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:55054687C>A	ENST00000482404.1	+	0	2042				KIR3DX1_ENST00000335056.3_Intron			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1							extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		CCCTCCCATTCCCAGTGCCCC	0.547													ENSG00000104970																									Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)												0																																										SO:0001624	3_prime_UTR_variant	0			-	BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000482404.1:c.*2039C>A	19.37:g.55054687C>A			B7WNL0|Q8N0S4	R	SNP	-	NULL	ENST00000482404.1	37	NULL		19																																																																																			-	KIR3DX1	-	-		0.547	KIR3DX1-001	KNOWN	basic	processed_transcript	KIR3DX1	HGNC	protein_coding	OTTHUMT00000140799.1	0	0	0	72	72	119	0.00	0.00	C	NR_026716		55054687	+1	18	22	77	163	tier1	no_errors	ENST00000482404	ensembl	human	known	74_37	rna	18.95	11.89	SNP	0.000	A	18	77
CCDC60	160777	genome.wustl.edu	37	12	119943003	119943003	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:119943003G>A	ENST00000327554.2	+	7	1243	c.778G>A	c.(778-780)Ggc>Agc	p.G260S	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	260										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TGTGAACCCTGGCTCGGATGA	0.572													ENSG00000183273																																					0													144.0	147.0	146.0					12																	119943003		2203	4300	6503	SO:0001583	missense	0			-	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.778G>A	12.37:g.119943003G>A	ENSP00000333374:p.Gly260Ser			Missense_Mutation	SNP	NULL	p.G260S	ENST00000327554.2	37	c.778	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	G	8.887	0.952968	0.18431	.	.	ENSG00000183273	ENST00000327554	T	0.24723	1.84	5.07	0.915	0.19366	.	0.414382	0.20472	N	0.091680	T	0.16342	0.0393	L	0.44542	1.39	0.48696	D	0.999693	P	0.44627	0.839	B	0.38985	0.287	T	0.06661	-1.0814	9	.	.	.	-18.4495	3.9123	0.09209	0.3204:0.1784:0.5012:0.0	.	260	Q8IWA6	CCD60_HUMAN	S	260	ENSP00000333374:G260S	.	G	+	1	0	CCDC60	118427386	0.830000	0.29337	0.366000	0.25914	0.325000	0.28411	0.983000	0.29552	0.101000	0.17610	-0.182000	0.12963	GGC	-	CCDC60	-	NULL		0.572	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	0	0	0	57	57	70	0.00	0.00	G	NM_178499		119943003	+1	14	13	68	113	tier1	no_errors	ENST00000327554	ensembl	human	known	74_37	missense	17.07	10.24	SNP	0.246	A	14	68
IFT52	51098	genome.wustl.edu	37	20	42275584	42275584	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr20:42275584C>T	ENST00000373030.3	+	14	1405	c.1275C>T	c.(1273-1275)gaC>gaT	p.D425D	IFT52_ENST00000471199.1_3'UTR|IFT52_ENST00000373039.4_Silent_p.D425D	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	425					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGGAACATGACATCGATACAA	0.358													ENSG00000101052																																					0													163.0	153.0	157.0					20																	42275584		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1275C>T	20.37:g.42275584C>T			B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Silent	SNP	pfam_ABC_transp_unknown	p.D425	ENST00000373030.3	37	c.1275	CCDS33470.1	20																																																																																			-	IFT52	-	NULL		0.358	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	HGNC	protein_coding	OTTHUMT00000079317.1	0	0	0	81	81	112	0.00	0.00	C	NM_016004		42275584	+1	22	26	60	97	tier1	no_errors	ENST00000373030	ensembl	human	known	74_37	silent	26.83	20.80	SNP	0.349	T	22	60
LRRC16B	90668	genome.wustl.edu	37	14	24538444	24538444	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:24538444C>T	ENST00000342740.5	+	39	4235	c.4081C>T	c.(4081-4083)Cct>Tct	p.P1361S	CPNE6_ENST00000397016.2_5'Flank|CPNE6_ENST00000537691.1_5'Flank|LRRC16B_ENST00000334420.7_Missense_Mutation_p.P414S|CPNE6_ENST00000216775.2_5'Flank	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1361						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		AAGACGGCCTCCTGACCCCAC	0.657													ENSG00000186648																																					0													44.0	48.0	47.0					14																	24538444		2203	4300	6503	SO:0001583	missense	0			-	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.4081C>T	14.37:g.24538444C>T	ENSP00000340467:p.Pro1361Ser		Q8TEF7|Q96HS9	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.P1361S	ENST00000342740.5	37	c.4081	CCDS32054.1	14	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382455	0.61845	.	.	ENSG00000186648	ENST00000342740;ENST00000334420	T;T	0.60299	0.2;0.2	4.85	4.85	0.62838	.	0.000000	0.41396	D	0.000887	T	0.61299	0.2336	N	0.19112	0.55	0.33138	D	0.544025	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.68853	-0.5299	10	0.45353	T	0.12	-2.2147	13.3355	0.60515	0.0:1.0:0.0:0.0	.	414;1361	Q8ND23-2;Q8ND23	.;LR16B_HUMAN	S	1361;414	ENSP00000340467:P1361S;ENSP00000334701:P414S	ENSP00000334701:P414S	P	+	1	0	LRRC16B	23608284	0.893000	0.30496	1.000000	0.80357	0.894000	0.52154	2.391000	0.44424	2.513000	0.84729	0.563000	0.77884	CCT	-	LRRC16B	-	NULL		0.657	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	HGNC	protein_coding	OTTHUMT00000416527.1	0	0	0	31	31	37	0.00	0.00	C	NM_138360		24538444	+1	16	10	21	19	tier1	no_errors	ENST00000342740	ensembl	human	known	74_37	missense	43.24	34.48	SNP	1.000	T	16	21
DCC	1630	genome.wustl.edu	37	18	51056781	51056781	+	Intron	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr18:51056781C>T	ENST00000442544.2	+	29	4870				RP11-671P2.1_ENST00000582064.1_RNA|DCC_ENST00000581580.1_Missense_Mutation_p.S1073L	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCAGCATCTTCATTCAGTGAG	0.458													ENSG00000187323																																					0																																										SO:0001627	intron_variant	0			-	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.4255-153C>T	18.37:g.51056781C>T				Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S1073L	ENST00000442544.2	37	c.3218	CCDS11952.1	18																																																																																			-	DCC	-	NULL		0.458	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	0	0	0	68	68	95	0.00	0.00	C	NM_005215		51056781	+1	10	29	30	58	tier1	no_errors	ENST00000581580	ensembl	human	putative	74_37	missense	25.00	33.33	SNP	0.080	T	10	30
KAT7	11143	genome.wustl.edu	37	17	47903425	47903426	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-	-	GC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:47903425_47903426insGC	ENST00000259021.4	+	13	1824_1825	c.1544_1545insGC	c.(1543-1548)gggcttfs	p.L516fs	KAT7_ENST00000424009.2_Frame_Shift_Ins_p.L486fs|KAT7_ENST00000510819.1_Frame_Shift_Ins_p.L347fs|KAT7_ENST00000509773.1_Frame_Shift_Ins_p.L406fs|KAT7_ENST00000454930.2_Frame_Shift_Ins_p.L377fs|KAT7_ENST00000513980.1_3'UTR|KAT7_ENST00000435742.2_Frame_Shift_Ins_p.L330fs|KAT7_ENST00000503935.2_Frame_Shift_Ins_p.L360fs	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	516	MYST-type HAT.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCAGATCTGGGGCTTATAAGCT	0.421													ENSG00000136504																																					0																																										SO:0001589	frameshift_variant	0				AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.1545_1546dupGC	17.37:g.47903426_47903427dupGC	ENSP00000259021:p.Leu516fs		B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Frame_Shift_Ins	INS	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.L516fs	ENST00000259021.4	37	c.1544_1545	CCDS11554.1	17																																																																																				KAT7	-	pfam_MOZ_SAS,superfamily_Acyl_CoA_acyltransferase		0.421	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	HGNC	protein_coding	OTTHUMT00000366032.1	0	0	0	108	108	42	0.00	0.00	-	NM_007067		47903426	+1	27	17	35	18	tier1	no_errors	ENST00000259021	ensembl	human	known	74_37	frame_shift_ins	43.55	48.57	INS	1.000:0.989	GC	27	35
KDM5A	5927	genome.wustl.edu	37	12	464396	464397	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	TC	TC	TC	-	TC	TC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:464396_464397delTC	ENST00000399788.2	-	7	1159_1160	c.797_798delGA	c.(796-798)cgafs	p.R266fs	KDM5A_ENST00000382815.4_Frame_Shift_Del_p.R266fs	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	266					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R266Q(2)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						TGGTAACTTTTCGTCTTCGGGT	0.376			T	NUP98	AML								ENSG00000073614																												Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	2	Substitution - Missense(2)	cervix(2)																																								SO:0001589	frameshift_variant	0					CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.797_798delGA	12.37:g.464396_464397delTC	ENSP00000382688:p.Arg266fs		A8MV76|Q4LE72|Q86XZ1	Frame_Shift_Del	DEL	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_D-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_D-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_D-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_D-bd	p.R266fs	ENST00000399788.2	37	c.798_797	CCDS41736.1	12																																																																																				KDM5A	-	NULL		0.376	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	HGNC	protein_coding	OTTHUMT00000397812.1	0	0	0	47	47	160	0.00	0.00	TC	NM_005056		464397	-1	8	24	26	62	tier1	no_errors	ENST00000399788	ensembl	human	known	74_37	frame_shift_del	23.53	27.91	DEL	1.000:1.000	-	8	26
DDX5	1655	genome.wustl.edu	37	17	62500099	62500102	+	Splice_Site	DEL	ACAG	ACAG	-			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	ACAG	ACAG	ACAG	-	ACAG	ACAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:62500099_62500102delACAG	ENST00000225792.5	-	4	841_843	c.440_442delCTGT	c.(439-444)tctgta>tta	p.SV147fs	DDX5_ENST00000578804.1_Splice_Site_p.SV147fs|MIR5047_ENST00000579212.1_RNA|CEP95_ENST00000556440.2_5'Flank|DDX5_ENST00000580026.1_5'Flank|DDX5_ENST00000450599.2_Intron	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	147	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TCCCAAACTTACAGACAATGTTTT	0.397			T	ETV4	prostate								ENSG00000108654																									NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0																																										SO:0001630	splice_region_variant	0				AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.441+1CTGT>-	17.37:g.62500099_62500102delACAG			B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Frame_Shift_Del	DEL	pfam_D/R_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_R_helicase_DEAD_Q_motif	p.S147fs	ENST00000225792.5	37	c.443_440	CCDS11659.1	17																																																																																				DDX5	-	pfam_D/R_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.397	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000444030.1	0	0	0	30	30	104	0.00	0.00	ACAG	NM_004396	Frame_Shift_Del	62500102	-1	8	21	15	58	tier1	no_errors	ENST00000225792	ensembl	human	known	74_37	frame_shift_del	34.78	26.58	DEL	1.000:1.000:1.000:1.000	-	8	15
ALLC	55821	genome.wustl.edu	37	2	3750075	3750075	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:3750075C>T	ENST00000252505.3	+	12	1260	c.1098C>T	c.(1096-1098)ttC>ttT	p.F366F	AC010907.5_ENST00000441632.1_RNA	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	385					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TCCGGGGCTTCCCCAGCTCCA	0.607										HNSCC(21;0.051)			ENSG00000151360																																					0													23.0	26.0	25.0					2																	3750075		1872	4089	5961	SO:0001819	synonymous_variant	0			-	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.1098C>T	2.37:g.3750075C>T			Q53T95|Q5RL81|Q96RE6|Q9NZA7	Silent	SNP	pfam_Allantoicase_dom,superfamily_Galactose-bd-like,tigrfam_Allantoicase	p.F366	ENST00000252505.3	37	c.1098	CCDS46223.1	2																																																																																			-	ALLC	-	superfamily_Galactose-bd-like		0.607	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALLC	HGNC	protein_coding	OTTHUMT00000322855.1	0	0	0	19	19	12	0.00	0.00	C			3750075	+1	5	2	12	7	tier1	no_errors	ENST00000252505	ensembl	human	known	74_37	silent	29.41	22.22	SNP	0.993	T	5	12
C16orf86	388284	genome.wustl.edu	37	16	67700794	67700794	+	5'UTR	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:67700794G>A	ENST00000403458.4	+	0	76				C16orf86_ENST00000602974.1_3'UTR|ENKD1_ENST00000602644.1_5'Flank|ENKD1_ENST00000243878.4_5'Flank|ENKD1_ENST00000602409.1_5'Flank	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86											endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GCCGGTCTCCGGGGTCAGCGC	0.721													ENSG00000159761																																					0																																										SO:0001623	5_prime_UTR_variant	0			-		CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	ENST00000403458.4:c.-80G>A	16.37:g.67700794G>A			B5MCW6	R	SNP	-	NULL	ENST00000403458.4	37	NULL	CCDS32468.2	16																																																																																			-	C16orf86	-	-		0.721	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf86	HGNC	protein_coding	OTTHUMT00000318767.2	0	0	0	8	8	9	0.00	0.00	G	NM_001012984		67700794	+1	11	2	16	3	tier1	no_errors	ENST00000602974	ensembl	human	known	74_37	rna	40.74	40.00	SNP	0.000	A	11	16
MISP	126353	genome.wustl.edu	37	19	758081	758081	+	Missense_Mutation	SNP	G	G	A	rs372474785		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:758081G>A	ENST00000215582.6	+	2	1238	c.1135G>A	c.(1135-1137)Gac>Aac	p.D379N		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	379					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GTCCACACCCGACTGGGTCTC	0.706													ENSG00000099812	G|||	1	0.000199681	0.0	0.0	5008	,	,		12358	0.0		0.0	False		,,,				2504	0.001																0								G	ASN/ASP	1,4353		0,1,2176	9.0	11.0	11.0		1135	-0.6	0.0	19		11	1,8549		0,1,4274	no	missense	C19orf21	NM_173481.2	23	0,2,6450	AA,AG,GG		0.0117,0.023,0.0155	probably-damaging	379/680	758081	2,12902	2177	4275	6452	SO:0001583	missense	0			-	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1135G>A	19.37:g.758081G>A	ENSP00000215582:p.Asp379Asn			Missense_Mutation	SNP	NULL	p.D379N	ENST00000215582.6	37	c.1135	CCDS12042.1	19	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342716	0.24339	2.3E-4	1.17E-4	ENSG00000099812	ENST00000215582	T	0.32023	1.47	4.54	-0.563	0.11778	.	2.041910	0.02376	N	0.078335	T	0.26738	0.0654	M	0.64997	1.995	0.09310	N	1	P	0.37276	0.589	B	0.29663	0.105	T	0.35176	-0.9799	10	0.72032	D	0.01	-7.7437	2.6482	0.04991	0.1759:0.1453:0.5299:0.149	.	379	Q8IVT2	CS021_HUMAN	N	379	ENSP00000215582:D379N	ENSP00000215582:D379N	D	+	1	0	C19orf21	709081	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.069000	0.14552	0.437000	0.26423	-0.500000	0.04577	GAC	-	MISP	-	NULL		0.706	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MISP	HGNC	protein_coding	OTTHUMT00000457600.2	0	0	0	37	37	12	0.00	0.00	G	NM_173481		758081	+1	10	7	33	8	tier1	no_errors	ENST00000215582	ensembl	human	known	74_37	missense	23.26	46.67	SNP	0.000	A	10	33
NXN	64359	genome.wustl.edu	37	17	708474	708474	+	Silent	SNP	G	G	A	rs193165884		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:708474G>A	ENST00000336868.3	-	6	925	c.834C>T	c.(832-834)ctC>ctT	p.L278L	NXN_ENST00000538650.1_Intron|NXN_ENST00000575801.1_Silent_p.L170L|NXN_ENST00000537628.2_Silent_p.L29L	NM_022463.4	NP_071908.2	Q6DKJ4	NXN_HUMAN	nucleoredoxin	278	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cardiovascular system development (GO:0072358)|cell differentiation (GO:0030154)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-disulfide reductase activity (GO:0047134)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		CCAGCATGATGAGCGTGGGGA	0.726													ENSG00000167693	G|||	1	0.000199681	0.0	0.0	5008	,	,		11343	0.001		0.0	False		,,,				2504	0.0																0													21.0	19.0	19.0					17																	708474		2201	4297	6498	SO:0001819	synonymous_variant	0			GMAF=0.0005		CCDS10998.1, CCDS56013.1	17p13	2007-08-10			ENSG00000167693	ENSG00000167693			18008	protein-coding gene	gene with protein product		612895					Standard	NM_022463		Approved	FLJ12614, NRX	uc002fsa.3	Q6DKJ4	OTTHUMG00000090307	ENST00000336868.3:c.834C>T	17.37:g.708474G>A			B4DXQ0|D3DTH2|Q3SWW6|Q6P3U6|Q7L4C6|Q9H9Q1	Silent	SNP	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.L278	ENST00000336868.3	37	c.834	CCDS10998.1	17																																																																																			rs193165884	NXN	-	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold		0.726	NXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXN	HGNC	protein_coding	OTTHUMT00000206669.1	0	0	0	113	113	10	0.00	0.00	G			708474	-1	83	11	101	9	tier1	no_errors	ENST00000336868	ensembl	human	known	74_37	silent	44.86	55.00	SNP	1.000	A	83	101
ARMC10	83787	genome.wustl.edu	37	7	102738973	102738973	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:102738973G>T	ENST00000323716.3	+	7	1397	c.1005G>T	c.(1003-1005)aaG>aaT	p.K335N	ARMC10_ENST00000428183.2_Missense_Mutation_p.K276N|ARMC10_ENST00000425331.1_Missense_Mutation_p.K276N|ARMC10_ENST00000441711.2_Missense_Mutation_p.K300N|ARMC10_ENST00000541300.1_Missense_Mutation_p.K217N|ARMC10_ENST00000454559.1_Missense_Mutation_p.K241N	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	335					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						TGAAGGAAAAGGTTGTAACAA	0.363													ENSG00000170632																																					0													47.0	49.0	48.0					7																	102738973		2195	4272	6467	SO:0001583	missense	0			-	AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.1005G>T	7.37:g.102738973G>T	ENSP00000319412:p.Lys335Asn		A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.K335N	ENST00000323716.3	37	c.1005	CCDS5728.1	7	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501148	0.64298	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000431642	T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.49;1.49;1.49	5.68	2.56	0.30785	Armadillo-type fold (1);	0.096550	0.64402	D	0.000001	T	0.53769	0.1817	M	0.75264	2.295	0.22940	N	0.998537	D;D;D;D;D;D	0.89917	0.998;0.996;0.997;1.0;1.0;0.999	D;D;P;D;D;D	0.87578	0.982;0.99;0.892;0.998;0.983;0.984	T	0.42932	-0.9422	10	0.87932	D	0	-31.9836	6.2663	0.20928	0.6404:0.0:0.3596:0.0	.	276;217;241;276;300;335	B4DWJ8;F5GX65;Q8N2F6-4;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;ARM10_HUMAN	N	335;276;300;241;276;217;177	ENSP00000319412:K335N;ENSP00000396654:K276N;ENSP00000413619:K300N;ENSP00000405612:K241N;ENSP00000397969:K276N;ENSP00000440463:K217N;ENSP00000406840:K177N	ENSP00000319412:K335N	K	+	3	2	ARMC10	102526209	1.000000	0.71417	0.968000	0.41197	0.900000	0.52787	2.355000	0.44107	0.346000	0.23899	0.591000	0.81541	AAG	-	ARMC10	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold		0.363	ARMC10-001	KNOWN	basic|CCDS	protein_coding	ARMC10	HGNC	protein_coding	OTTHUMT00000347882.1	0	0	0	127	127	107	0.00	0.00	G	NM_031905		102738973	+1	13	7	69	80	tier1	no_errors	ENST00000323716	ensembl	human	known	74_37	missense	15.85	8.05	SNP	0.996	T	13	69
SNX16	64089	genome.wustl.edu	37	8	82727640	82727641	+	Intron	INS	-	-	A	rs55997432	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:82727640_82727641insA	ENST00000345957.4	-	5	890				RP13-923O23.6_ENST00000524337.1_RNA|SNX16_ENST00000353788.4_Intron|SNX16_ENST00000396330.2_Intron	NM_152836.2	NP_690049.1	P57768	SNX16_HUMAN	sorting nexin 16						early endosome to late endosome transport (GO:0045022)|endosome to lysosome transport (GO:0008333)|protein targeting to lysosome (GO:0006622)	early endosome (GO:0005769)|extrinsic component of endosome membrane (GO:0031313)|late endosome (GO:0005770)|lysosome (GO:0005764)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			large_intestine(1)|ovary(1)|pancreas(1)|skin(2)	5						CTTTTCAAAGGAAAAAAAAAAT	0.347													ENSG00000253334																																					0																																										SO:0001627	intron_variant	0				AF305779	CCDS6234.1, CCDS6235.1	8q21.13	2011-05-03			ENSG00000104497	ENSG00000104497		"""Sorting nexins"""	14980	protein-coding gene	gene with protein product		614903				12461558, 12813048	Standard	NM_152837		Approved		uc003ycn.3	P57768	OTTHUMG00000164727	ENST00000345957.4:c.612-11->T	8.37:g.82727650_82727650dupA			A8K4D8|Q658L0|Q8N4U3	R	INS	-	NULL	ENST00000345957.4	37	NULL	CCDS6234.1	8																																																																																				RP13-923O23.6	-	-		0.347	SNX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253334	Clone_based_vega_gene	protein_coding	OTTHUMT00000379929.1	0	0	1	20	20	115	0.00	0.86	-	NM_022133		82727641	+1	4	5	34	122	tier1	no_errors	ENST00000524337	ensembl	human	known	74_37	rna	10.53	3.94	INS	0.000:0.496	A	4	34
HOOK3	84376	genome.wustl.edu	37	8	42873625	42873625	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:42873625C>T	ENST00000307602.4	+	22	2341	c.2141C>T	c.(2140-2142)cCg>cTg	p.P714L	RP11-598P20.5_ENST00000534420.1_Missense_Mutation_p.P20L	NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	714	Required for association with Golgi.|Required for interaction with MSR1.				cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			CACGTGCAGCCGGCCACAGCA	0.542			T	RET	papillary thyroid								ENSG00000168172																												Dom	yes		8	8p11.21	84376	hook homolog 3		E	0													73.0	69.0	71.0					8																	42873625		2203	4300	6503	SO:0001583	missense	0			-	AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.2141C>T	8.37:g.42873625C>T	ENSP00000305699:p.Pro714Leu		D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_t-SRE	p.P714L	ENST00000307602.4	37	c.2141	CCDS6139.1	8	.	.	.	.	.	.	.	.	.	.	C	9.589	1.125731	0.20959	.	.	ENSG00000168172;ENSG00000254673	ENST00000307602;ENST00000534420	T	0.17054	2.3	5.96	5.96	0.96718	.	0.094893	0.85682	D	0.000000	T	0.21062	0.0507	L	0.52573	1.65	0.80722	D	1	P	0.35612	0.512	B	0.32090	0.14	T	0.01301	-1.1391	10	0.72032	D	0.01	-9.5408	20.422	0.99049	0.0:1.0:0.0:0.0	.	714	Q86VS8	HOOK3_HUMAN	L	714;20	ENSP00000305699:P714L	ENSP00000305699:P714L	P	+	2	0	RP11-598P20.5;HOOK3	42992782	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	5.618000	0.67722	2.832000	0.97577	0.655000	0.94253	CCG	-	HOOK3	-	pfam_Hook-related_fam		0.542	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK3	HGNC	protein_coding	OTTHUMT00000383172.2	0	0	1	43	43	48	0.00	2.04	C	NM_032410		42873625	+1	18	26	27	33	tier1	no_errors	ENST00000307602	ensembl	human	known	74_37	missense	40.00	43.33	SNP	1.000	T	18	27
OR2B11	127623	genome.wustl.edu	37	1	247614903	247614903	+	Missense_Mutation	SNP	C	C	T	rs375546848		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:247614903C>T	ENST00000318749.6	-	1	405	c.382G>A	c.(382-384)Gtg>Atg	p.V128M		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V128M(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CAGATGGCCACGTAGCGGTCC	0.612													ENSG00000177535																																					1	Substitution - Missense(1)	upper_aerodigestive_tract(1)						C	MET/VAL	0,4406		0,0,2203	84.0	69.0	74.0		382	3.0	0.6	1		74	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR2B11	NM_001004492.1	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	128/318	247614903	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.382G>A	1.37:g.247614903C>T	ENSP00000325682:p.Val128Met		B2RP03	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V128M	ENST00000318749.6	37	c.382	CCDS31090.1	1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221795	0.39300	0.0	1.16E-4	ENSG00000177535	ENST00000318749	T	0.01455	4.87	4.96	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.420814	0.19979	N	0.101813	T	0.02455	0.0075	L	0.55743	1.74	0.24069	N	0.995989	B	0.23735	0.09	B	0.17979	0.02	T	0.35574	-0.9783	10	0.62326	D	0.03	.	9.1849	0.37165	0.0:0.814:0.0:0.186	.	128	Q5JQS5	OR2BB_HUMAN	M	128	ENSP00000325682:V128M	ENSP00000325682:V128M	V	-	1	0	OR2B11	245681526	0.000000	0.05858	0.645000	0.29479	0.706000	0.40770	-0.524000	0.06222	0.766000	0.33244	-0.234000	0.12200	GTG	-	OR2B11	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.612	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B11	HGNC	protein_coding	OTTHUMT00000097620.1	0	0	1	32	32	47	0.00	2.08	C	NM_001004492		247614903	-1	9	8	14	21	tier1	no_errors	ENST00000318749	ensembl	human	known	74_37	missense	39.13	27.59	SNP	0.666	T	9	14
PYROXD1	79912	genome.wustl.edu	37	12	21590706	21590715	+	Frame_Shift_Del	DEL	GGTGGTCGGC	GGTGGTCGGC	-	rs140096937		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	GGTGGTCGGC	GGTGGTCGGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:21590706_21590715delGGTGGTCGGC	ENST00000240651.9	+	1	96_105	c.42_51delGGTGGTCGGC	c.(40-51)gtggtggtcggcfs	p.VVVG14fs	PYROXD1_ENST00000545178.1_Frame_Shift_Del_p.VVVG14fs|PYROXD1_ENST00000538582.1_5'Flank	NM_024854.3	NP_079130.2	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 1	14							oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|soft_tissue(1)	18						GGAAGTTCGTGGTGGTCGGCGGCGGCATCG	0.671													ENSG00000121350																																					0																																										SO:0001589	frameshift_variant	0				AL832441	CCDS31755.1	12p12.1	2014-02-12			ENSG00000121350	ENSG00000121350			26162	protein-coding gene	gene with protein product						12477932	Standard	NM_024854		Approved	DKFZp762G094, FLJ22028	uc001rew.3	Q8WU10	OTTHUMG00000169129	ENST00000240651.9:c.42_51delGGTGGTCGGC	12.37:g.21590706_21590715delGGTGGTCGGC	ENSP00000240651:p.Val14fs		A6NKI6|B3KWN8|Q9H6P1	Frame_Shift_Del	DEL	pfam_Pyr_nucl-diS_OxRdtase_FAD/D,prints_FAD_pyr_nucl-diS_OxRdtase	p.V15fs	ENST00000240651.9	37	c.42_51	CCDS31755.1	12																																																																																				PYROXD1	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/D,prints_FAD_pyr_nucl-diS_OxRdtase		0.671	PYROXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYROXD1	HGNC	protein_coding	OTTHUMT00000402363.1	0	0	0	6	6	6	0.00	0.00	GGTGGTCGGC	NM_024854		21590715	+1	0	0	0	0	tier1	no_errors	ENST00000240651	ensembl	human	known	74_37	frame_shift_del	0.00	0.00	DEL	1.000:1.000:1.000:1.000:1.000:0.995:0.789:0.996:0.998:0.978	-	0	0
SSPO	23145	genome.wustl.edu	37	7	149509072	149509072	+	RNA	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:149509072G>A	ENST00000378016.2	+	0	9618							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGTGCCATCGGCACCGGTTCT	0.697													ENSG00000197558																																					0													27.0	32.0	31.0					7																	149509072		1998	4153	6151			0			-	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149509072G>A			Q76B61	R	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	SSPO	-	-		0.697	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		0	0	0	32	32	18	0.00	0.00	G			149509072	+1	4	0	32	7	tier1	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	11.11	0.00	SNP	0.998	A	4	32
YWHAE	7531	genome.wustl.edu	37	17	1265304	1265305	+	Splice_Site	INS	-	-	A	rs543499657|rs34985093	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:1265304_1265305insA	ENST00000264335.8	-	3	532		c.e3-2		YWHAE_ENST00000573026.1_Intron|YWHAE_ENST00000571732.1_Splice_Site|YWHAE_ENST00000575977.1_Intron	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)			kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		AGTCTCAACCtaaaaaaaaaaa	0.322			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome						ENSG00000108953	|||unknown(HR)	578	0.115415	0.3669	0.0346	5008	,	,		19509	0.0188		0.0099	False		,,,				2504	0.0409							Dom	yes		17	17p13.3	7531	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes	M	0																																										SO:0001630	splice_region_variant	0				U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.265-2->T	17.37:g.1265315_1265315dupA			B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Splice_Site	INS	-	e3-2	ENST00000264335.8	37	c.265-3_265-2	CCDS11001.1	17																																																																																				YWHAE	-	-		0.322	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAE	HGNC	protein_coding	OTTHUMT00000259354.3	0	0	0	35	35	8	0.00	0.00	-	NM_006761	Intron	1265305	-1	5	0	40	7	tier1	no_errors	ENST00000264335	ensembl	human	known	74_37	splice_site_ins	11.11	0.00	INS	1.000:0.895	A	5	40
AGPS	8540	genome.wustl.edu	37	2	178257538	178257538	+	Silent	SNP	A	A	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:178257538A>G	ENST00000264167.4	+	1	167	c.21A>G	c.(19-21)gcA>gcG	p.A7A	NFE2L2_ENST00000464747.1_5'Flank|AGPS_ENST00000409888.1_Silent_p.A7A|AC074286.1_ENST00000397057.2_RNA	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	7	Poly-Ala.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			CGGCGGCTGCAGCGGGTGGGA	0.766													ENSG00000018510																																					0													2.0	3.0	3.0					2																	178257538		1222	2857	4079	SO:0001819	synonymous_variant	0			-	Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.21A>G	2.37:g.178257538A>G			A5D8U9|Q2TU35	Silent	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.A7	ENST00000264167.4	37	c.21	CCDS2275.1	2																																																																																			-	AGPS	-	NULL		0.766	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPS	HGNC	protein_coding	OTTHUMT00000255730.2	0	0	0	27	27	3	0.00	0.00	A			178257538	+1	5	0	23	5	tier1	no_errors	ENST00000264167	ensembl	human	known	74_37	silent	17.86	0.00	SNP	0.895	G	5	23
GRAMD1A	57655	genome.wustl.edu	37	19	35491326	35491327	+	5'UTR	INS	-	-	GCCCT	rs71165697|rs3072398|rs34397853	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:35491326_35491327insGCCCT	ENST00000317991.5	+	0	136_137				CTD-2527I21.7_ENST00000600959.1_RNA|GRAMD1A_ENST00000599564.1_Intron|GRAMD1A_ENST00000504615.2_5'UTR|GRAMD1A_ENST00000411896.2_5'Flank|GRAMD1A_ENST00000424536.2_5'Flank	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A							integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			cgcgcagcccagccctgccctg	0.782													ENSG00000089351		4907	0.979832	0.9561	0.9885	5008	,	,		4111	0.998		0.994	False		,,,				2504	0.9724																0									,	616,100		305,6,47					,	0.6	1.0		dbSNP_102	1	1569,189		780,9,90	no	utr-5,utr-5	GRAMD1A	NM_020895.3,NM_001136199.1	,	1085,15,137	A1A1,A1R,RR		10.7509,13.9665,11.6815	,	,		2185,289				SO:0001623	5_prime_UTR_variant	0				AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.-56->GCCCT	19.37:g.35491332_35491336dupGCCCT			A6NKY7|Q8NC77|Q9P1Z5	R	INS	-	NULL	ENST00000317991.5	37	NULL	CCDS42546.1	19																																																																																				GRAMD1A	-	-		0.782	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	GRAMD1A	HGNC	protein_coding	OTTHUMT00000461557.1	0	0	0	0	0	0	0.00	0.00	-	NM_020895		35491327	+1	0	0	0	0	tier1	no_errors	ENST00000603669	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.780:0.776	GCCCT	0	0
IL17B	27190	genome.wustl.edu	37	5	148753976	148753976	+	Missense_Mutation	SNP	C	C	T	rs528081511		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:148753976C>T	ENST00000261796.3	-	3	549	c.499G>A	c.(499-501)Gca>Aca	p.A167T	RP11-394O4.3_ENST00000521756.1_RNA|IL17B_ENST00000505432.1_5'UTR	NM_014443.2	NP_055258.1	Q9UHF5	IL17B_HUMAN	interleukin 17B	167					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|urinary_tract(1)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCATGACTGCGCGCTGGCGG	0.677													ENSG00000127743	C|||	1	0.000199681	0.0	0.0014	5008	,	,		15617	0.0		0.0	False		,,,				2504	0.0																0													28.0	30.0	29.0					5																	148753976		2199	4291	6490	SO:0001583	missense	0			-	AF184969	CCDS4297.1	5q33.1	2011-07-14			ENSG00000127743	ENSG00000127743		"""Interleukins and interleukin receptors"""	5982	protein-coding gene	gene with protein product	"""neuronal interleukin-17-related factor"""	604627				10639155	Standard	NM_014443		Approved	IL-17B, ZCYTO7, IL-20, MGC138900, MGC138901, NIRF	uc003lqo.3	Q9UHF5	OTTHUMG00000130051	ENST00000261796.3:c.499G>A	5.37:g.148753976C>T	ENSP00000261796:p.Ala167Thr		Q14CE5	Missense_Mutation	SNP	pfam_IL-17_fam,prints_IL-17_chr	p.A167T	ENST00000261796.3	37	c.499	CCDS4297.1	5	.	.	.	.	.	.	.	.	.	.	C	3.164	-0.171532	0.06421	.	.	ENSG00000127743	ENST00000261796	T	0.54866	0.55	5.2	-0.66	0.11421	.	0.559855	0.17855	N	0.159740	T	0.22244	0.0536	N	0.04686	-0.185	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.20207	-1.0282	10	0.11485	T	0.65	-23.0732	5.8117	0.18469	0.0:0.3046:0.3798:0.3156	.	167	Q9UHF5	IL17B_HUMAN	T	167	ENSP00000261796:A167T	ENSP00000261796:A167T	A	-	1	0	IL17B	148734169	0.000000	0.05858	0.049000	0.19019	0.037000	0.13140	0.288000	0.18939	0.205000	0.20568	-0.305000	0.09177	GCA	-	IL17B	-	pfam_IL-17_fam,prints_IL-17_chr		0.677	IL17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17B	HGNC	protein_coding	OTTHUMT00000252330.1	0	0	0	28	28	4	0.00	0.00	C	NM_014443		148753976	-1	16	0	33	4	tier1	no_errors	ENST00000261796	ensembl	human	known	74_37	missense	32.65	0.00	SNP	0.002	T	16	33
MMP17	4326	genome.wustl.edu	37	12	132313098	132313099	+	In_Frame_Ins	INS	-	-	GCTGCCGCT	rs559842978|rs201578983|rs71072797	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:132313098_132313099insGCTGCCGCT	ENST00000360564.1	+	1	161_162	c.59_60insGCTGCCGCT	c.(58-63)cggctg>cgGCTGCCGCTgctg	p.21_22insPLL		NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	21					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	ggactctcgcggctgccgctgc	0.837													ENSG00000198598		4777	0.953874	0.8797	0.9741	5008	,	,		2816	0.999		0.9702	False		,,,				2504	0.9765																0																																										SO:0001652	inframe_insertion	0				X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.60_68dupGCTGCCGCT	12.37:g.132313099_132313107dupGCTGCCGCT	ENSP00000353767:p.Leu21_Pro22insProLeuLeu		Q14850	In_Frame_Ins	INS	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.24in_frame_insLPL	ENST00000360564.1	37	c.59_60	CCDS31927.1	12																																																																																				MMP17	-	pirsf_Pept_M10A_Metazoans		0.837	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP17	HGNC	protein_coding	OTTHUMT00000397757.1	0	0	0	0	0	0	0.00	0.00	-	NM_016155		132313099	+1	0	0	0	0	tier1	no_errors	ENST00000360564	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.023:0.052	GCTGCCGCT	0	0
MT-CO2	4513	genome.wustl.edu	37	M	7988	7988	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chrM:7988C>T	ENST00000361739.1	+	1	403	c.403C>T	c.(403-405)Ctc>Ttc	p.L135F	MT-ND4L_ENST00000361335.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	135					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						GCGACCTGCGACTCCTTGACG	0.488													ENSG00000198712																																					0																																										SO:0001583	missense	0			-			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.403C>T	M.37:g.7988C>T	ENSP00000354876:p.Leu135Phe		Q37526	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.L135F	ENST00000361739.1	37	c.403		MT																																																																																			-	MT-CO2	-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2		0.488	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		0	0	0	252	252	0	0.00	0.00	C	YP_003024029		7988	+1	122	0	55	0	tier1	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	68.93	0.00	SNP	NULL	T	122	55
TBX3	6926	genome.wustl.edu	37	12	115109883	115109883	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:115109883C>T	ENST00000257566.3	-	8	2384	c.1995G>A	c.(1993-1995)gcG>gcA	p.A665A	TBX3_ENST00000349155.2_Silent_p.A645A	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	665	Transcription repression.				anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GCCCCGCGGCCGCCGCCATGG	0.741													ENSG00000135111																																					0													5.0	6.0	6.0					12																	115109883		2045	3934	5979	SO:0001819	synonymous_variant	0			-	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1995G>A	12.37:g.115109883C>T			Q8TB20|Q9UKF8	Silent	SNP	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_D-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.A665	ENST00000257566.3	37	c.1995	CCDS9176.1	12																																																																																			-	TBX3	-	NULL		0.741	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	0	0	0	33	33	4	0.00	0.00	C	NM_016569, NM_005996		115109883	-1	6	1	37	2	tier1	no_errors	ENST00000257566	ensembl	human	known	74_37	silent	13.95	33.33	SNP	0.509	T	6	37
LOC100190940	100190940	genome.wustl.edu	37	12	130521234	130521235	+	lincRNA	INS	-	-	AAA	rs386378253|rs386378254|rs34472041|rs200802994	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:130521234_130521235insAAA	ENST00000567788.1	-	0	1466_1467				RP11-474D1.4_ENST00000561864.1_lincRNA																							gactctgtctcaaaaaaaaaag	0.431													ENSG00000214039		2691	0.53734	0.329	0.6556	5008	,	,		27040	0.5645		0.7167	False		,,,				2504	0.5225																0																																												0																																12.37:g.130521241_130521243dupAAA				R	INS	-	NULL	ENST00000567788.1	37	NULL		12																																																																																				RP11-474D1.3	-	-		0.431	RP11-474D1.3-001	KNOWN	basic	lincRNA	LOC100190940	Clone_based_vega_gene	lincRNA	OTTHUMT00000399498.1	0	0	0	9	9	3	0.00	0.00	-			130521235	-1	13	3	23	8	tier1	no_errors	ENST00000291374	ensembl	human	known	74_37	rna	36.11	27.27	INS	0.029:0.046	AAA	13	23
SSNA1	8636	genome.wustl.edu	37	9	140083505	140083505	+	Intron	SNP	T	T	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:140083505T>G	ENST00000322310.5	+	2	132				ANAPC2_ENST00000323927.2_5'Flank|SSNA1_ENST00000459860.1_3'UTR	NM_003731.2	NP_003722.2	O43805	SSNA1_HUMAN	Sjogren syndrome nuclear autoantigen 1						ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport (GO:0042073)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(1)|lung(2)	6	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.43e-05)|Epithelial(140;0.00087)		GCGCCGCCCCTCCCGGCCCCC	0.726													ENSG00000176101																																					0													4.0	5.0	5.0					9																	140083505		2040	4054	6094	SO:0001627	intron_variant	0			-	Z96932	CCDS7034.1	9q34.3	2008-02-05	2007-10-04		ENSG00000176101	ENSG00000176101			11321	protein-coding gene	gene with protein product		610882	"""Sjogren's syndrome nuclear autoantigen 1"""			9430706	Standard	NM_003731		Approved	NA14, N14	uc004cls.2	O43805	OTTHUMG00000020982	ENST00000322310.5:c.53-13T>G	9.37:g.140083505T>G			Q5VSG0|Q6FG70|Q9BVW8	R	SNP	-	NULL	ENST00000322310.5	37	NULL	CCDS7034.1	9																																																																																			-	SS1	-	-		0.726	SSNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SS1	HGNC	protein_coding	OTTHUMT00000055311.1	0	0	0	31	31	2	0.00	0.00	T	NM_003731		140083505	+1	11	4	35	8	tier1	no_errors	ENST00000459860	ensembl	human	known	74_37	rna	23.91	33.33	SNP	0.000	G	11	35
