#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
FMNL2	114793	genome.wustl.edu	37	2	153475473	153475473	+	Silent	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475473G>A	ENST00000288670.9	+	14	1795	c.1428G>A	c.(1426-1428)gaG>gaA	p.E476E	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	476					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						ATGAGCTAGAGAAACAAGGGA	0.408													ENSG00000157827																																					0													75.0	73.0	74.0					2																	153475473		1865	4097	5962	SO:0001819	synonymous_variant	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1428G>A	2.37:g.153475473G>A			B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.E476	ENST00000288670.9	37	c.1428	CCDS46429.1	2																																																																																			-	FMNL2	-	NULL		0.408	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	0	48	48	92	0.00	0.00	G	NM_052905		153475473	+1	12	28	66	141	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	silent	15.38	16.57	SNP	1.000	A	12	66
FMNL2	114793	genome.wustl.edu	37	2	153475531	153475531	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475531G>A	ENST00000288670.9	+	14	1853	c.1486G>A	c.(1486-1488)Gtt>Att	p.V496I	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	496					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CATACTGCCAGTTGTGGCTTC	0.512													ENSG00000157827																																					0													72.0	74.0	74.0					2																	153475531		1924	4129	6053	SO:0001583	missense	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1486G>A	2.37:g.153475531G>A	ENSP00000288670:p.Val496Ile		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.V496I	ENST00000288670.9	37	c.1486	CCDS46429.1	2	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777129	0.70107	.	.	ENSG00000157827	ENST00000288670	D	0.90133	-2.62	5.57	5.57	0.84162	.	0.415706	0.29692	N	0.011445	T	0.80959	0.4724	N	0.08118	0	0.80722	D	1	B	0.22683	0.073	B	0.21917	0.037	T	0.76719	-0.2856	10	0.36615	T	0.2	.	12.8339	0.57761	0.0745:0.0:0.9255:0.0	.	496	Q96PY5-3	.	I	496	ENSP00000288670:V496I	ENSP00000288670:V496I	V	+	1	0	FMNL2	153183777	1.000000	0.71417	0.293000	0.24932	0.974000	0.67602	5.805000	0.69143	2.612000	0.88384	0.650000	0.86243	GTT	-	FMNL2	-	NULL		0.512	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	0	39	39	89	0.00	0.00	G	NM_052905		153475531	+1	13	32	76	119	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	14.61	21.19	SNP	0.896	A	13	76
ATP2C2	9914	genome.wustl.edu	37	16	84444193	84444193	+	Missense_Mutation	SNP	C	C	T	rs371336541		TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr16:84444193C>T	ENST00000262429.4	+	5	526	c.437C>T	c.(436-438)aCt>aTt	p.T146I	ATP2C2_ENST00000416219.2_Missense_Mutation_p.T146I|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	146					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						GTCGTGGTCACTGTCGCCTTC	0.592													ENSG00000064270	C|||	1	0.000199681	0.0	0.0	5008	,	,		16839	0.001		0.0	False		,,,				2504	0.0																0								C	ILE/THR	0,4140		0,0,2070	108.0	106.0	107.0		437	4.6	0.9	16		107	1,8433		0,1,4216	no	missense	ATP2C2	NM_014861.2	89	0,1,6286	TT,TC,CC		0.0119,0.0,0.0080	probably-damaging	146/947	84444193	1,12573	2070	4217	6287	SO:0001583	missense	0			-	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.437C>T	16.37:g.84444193C>T	ENSP00000262429:p.Thr146Ile		B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	p.T146I	ENST00000262429.4	37	c.437	CCDS42207.1	16	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820369	0.50633	0.0	1.19E-4	ENSG00000064270	ENST00000416219;ENST00000262429	D;D	0.90620	-2.7;-2.7	4.57	4.57	0.56435	ATPase, P-type, ATPase-associated domain (1);ATPase, P-type,  transmembrane domain (1);	0.266885	0.31370	N	0.007763	D	0.91570	0.7337	L	0.46614	1.455	0.49213	D	0.999761	P;D;D	0.89917	0.931;1.0;1.0	P;D;D	0.91635	0.884;0.997;0.999	D	0.88041	0.2781	10	0.06625	T	0.88	.	12.8442	0.57821	0.0:1.0:0.0:0.0	.	146;163;146	E7ES94;O75185-2;O75185	.;.;AT2C2_HUMAN	I	146	ENSP00000397925:T146I;ENSP00000262429:T146I	ENSP00000262429:T146I	T	+	2	0	ATP2C2	83001694	0.999000	0.42202	0.916000	0.36221	0.256000	0.26092	5.277000	0.65586	2.090000	0.63153	0.585000	0.79938	ACT	-	ATP2C2	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Ca-transp_PMR1		0.592	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2C2	HGNC	protein_coding	OTTHUMT00000433404.1	0	0	0	22	22	68	0.00	0.00	C	NM_014861		84444193	+1	8	11	34	33	tier1	no_errors	ENST00000262429	ensembl	human	known	74_37	missense	19.05	25.00	SNP	0.993	T	8	34
FMNL2	114793	genome.wustl.edu	37	2	153475615	153475615	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475615G>A	ENST00000288670.9	+	14	1937	c.1570G>A	c.(1570-1572)Gga>Aga	p.G524R	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	524					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CGCTTCCTCAGGACCCTTGCC	0.552													ENSG00000157827																																					0													48.0	52.0	51.0					2																	153475615		1963	4142	6105	SO:0001583	missense	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1570G>A	2.37:g.153475615G>A	ENSP00000288670:p.Gly524Arg		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.G524R	ENST00000288670.9	37	c.1570	CCDS46429.1	2	.	.	.	.	.	.	.	.	.	.	G	10.90	1.482125	0.26598	.	.	ENSG00000157827	ENST00000288670;ENST00000421344	T	0.41758	0.99	5.57	4.68	0.58851	.	0.878476	0.10412	N	0.677833	T	0.24699	0.0599	N	0.08118	0	0.80722	D	1	B	0.16603	0.018	B	0.15870	0.014	T	0.04796	-1.0926	10	0.13470	T	0.59	.	13.845	0.63461	0.0731:0.0:0.9269:0.0	.	524	Q96PY5-3	.	R	524;21	ENSP00000288670:G524R	ENSP00000288670:G524R	G	+	1	0	FMNL2	153183861	0.950000	0.32346	0.156000	0.22583	0.036000	0.12997	3.749000	0.55150	2.612000	0.88384	0.650000	0.86243	GGA	-	FMNL2	-	NULL		0.552	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	0	31	31	57	0.00	0.00	G	NM_052905		153475615	+1	21	22	119	105	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	15.00	17.32	SNP	0.686	A	21	119
BRWD3	254065	genome.wustl.edu	37	X	79989633	79989633	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chrX:79989633T>G	ENST00000373275.4	-	11	1286	c.1070A>C	c.(1069-1071)gAa>gCa	p.E357A		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	357					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TGACTCTAATTCAGCAATTTT	0.333													ENSG00000165288																																					0													118.0	109.0	112.0					X																	79989633		2203	4298	6501	SO:0001583	missense	0			-		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1070A>C	X.37:g.79989633T>G	ENSP00000362372:p.Glu357Ala		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.E357A	ENST00000373275.4	37	c.1070	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	T	23.3	4.396578	0.83011	.	.	ENSG00000165288	ENST00000373275	T	0.60299	0.2	5.34	5.34	0.76211	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.60090	0.2242	N	0.20685	0.6	0.58432	D	0.999994	D	0.64830	0.994	D	0.66602	0.945	T	0.59616	-0.7421	9	.	.	.	-16.9539	14.3934	0.66996	0.0:0.0:0.0:1.0	.	357	Q6RI45	BRWD3_HUMAN	A	357	ENSP00000362372:E357A	.	E	-	2	0	BRWD3	79876289	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.716000	0.68437	1.976000	0.57569	0.441000	0.28932	GAA	-	BRWD3	-	pfam_WD40_repeat,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.333	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	0	0	0	177	177	94	0.00	0.00	T	NM_153252		79989633	-1	29	30	89	66	tier1	no_errors	ENST00000373275	ensembl	human	known	74_37	missense	24.58	31.25	SNP	1.000	G	29	89
OR6T1	219874	genome.wustl.edu	37	11	123813912	123813912	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr11:123813912C>A	ENST00000321252.2	-	1	668	c.634G>T	c.(634-636)Gct>Tct	p.A212S		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GAGGTCAGAGCCAGTGAGCCC	0.552													ENSG00000181499																																					0													81.0	75.0	77.0					11																	123813912		2202	4299	6501	SO:0001583	missense	0			-	AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.634G>T	11.37:g.123813912C>A	ENSP00000325203:p.Ala212Ser		Q6IFE7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A212S	ENST00000321252.2	37	c.634	CCDS31700.1	11	.	.	.	.	.	.	.	.	.	.	C	0.469	-0.885376	0.02511	.	.	ENSG00000181499	ENST00000321252	T	0.37411	1.2	3.7	-2.5	0.06384	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.19366	0.0465	N	0.16016	0.355	0.09310	N	1	B	0.24186	0.099	B	0.25405	0.06	T	0.21930	-1.0231	9	0.59425	D	0.04	-1.0142	6.6296	0.22849	0.0:0.4763:0.1293:0.3945	.	212	Q8NGN1	OR6T1_HUMAN	S	212	ENSP00000325203:A212S	ENSP00000325203:A212S	A	-	1	0	OR6T1	123319122	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-2.650000	0.00858	-0.746000	0.04766	-1.119000	0.02030	GCT	-	OR6T1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.552	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6T1	HGNC	protein_coding	OTTHUMT00000387264.1	0	0	0	35	35	69	0.00	0.00	C	NM_001005187		123813912	-1	24	46	5	19	tier1	no_errors	ENST00000321252	ensembl	human	known	74_37	missense	82.76	70.77	SNP	0.000	A	24	5
TMPRSS15	5651	genome.wustl.edu	37	21	19732162	19732162	+	Silent	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr21:19732162G>A	ENST00000284885.3	-	8	825	c.792C>T	c.(790-792)tcC>tcT	p.S264S		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	264	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TCAGTTTAATGGAAAGTCCTT	0.264													ENSG00000154646																																					0													29.0	34.0	33.0					21																	19732162		2182	4260	6442	SO:0001819	synonymous_variant	0			-		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.792C>T	21.37:g.19732162G>A			Q2NKL7	Silent	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_MAM_dom,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA_dom,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.S264	ENST00000284885.3	37	c.792	CCDS13571.1	21																																																																																			-	TMPRSS15	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.264	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	1	1	0	141	141	86	0.70	0.00	G	NM_002772		19732162	-1	23	28	42	54	tier1	no_errors	ENST00000284885	ensembl	human	known	74_37	silent	35.38	34.15	SNP	0.954	A	23	42
FMNL2	114793	genome.wustl.edu	37	2	153475465	153475465	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475465G>A	ENST00000288670.9	+	14	1787	c.1420G>A	c.(1420-1422)Gag>Aag	p.E474K	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	474					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						AAAGATTCATGAGCTAGAGAA	0.403													ENSG00000157827																																					0													70.0	68.0	68.0					2																	153475465		1854	4089	5943	SO:0001583	missense	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1420G>A	2.37:g.153475465G>A	ENSP00000288670:p.Glu474Lys		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.E474K	ENST00000288670.9	37	c.1420	CCDS46429.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.059527	0.93846	.	.	ENSG00000157827	ENST00000288670	T	0.44881	0.91	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.68044	0.2958	M	0.81497	2.545	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.67051	-0.5768	10	0.40728	T	0.16	.	19.68	0.95958	0.0:0.0:1.0:0.0	.	474	Q96PY5-3	.	K	474	ENSP00000288670:E474K	ENSP00000288670:E474K	E	+	1	0	FMNL2	153183711	1.000000	0.71417	0.992000	0.48379	0.942000	0.58702	9.550000	0.98110	2.641000	0.89580	0.650000	0.86243	GAG	-	FMNL2	-	pfam_FH3_dom		0.403	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	0	50	50	97	0.00	0.00	G	NM_052905		153475465	+1	11	24	67	131	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	14.10	15.48	SNP	1.000	A	11	67
EIF4G3	8672	genome.wustl.edu	37	1	21167469	21167469	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr1:21167469A>G	ENST00000264211.8	-	24	3967	c.3773T>C	c.(3772-3774)tTt>tCt	p.F1258S	EIF4G3_ENST00000374937.3_Missense_Mutation_p.F1264S|EIF4G3_ENST00000400422.1_Missense_Mutation_p.F1258S|EIF4G3_ENST00000537738.1_Missense_Mutation_p.F748S|EIF4G3_ENST00000374935.3_Missense_Mutation_p.F978S|RNU7-200P_ENST00000516105.1_RNA|EIF4G3_ENST00000536266.1_Missense_Mutation_p.F862S|EIF4G3_ENST00000602326.1_Missense_Mutation_p.F1264S	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1258	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CACTCTCACAAAAACATGTAG	0.478													ENSG00000075151																																					0													101.0	95.0	97.0					1																	21167469		2203	4300	6503	SO:0001583	missense	0			-	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3773T>C	1.37:g.21167469A>G	ENSP00000264211:p.Phe1258Ser		B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.F1264S	ENST00000264211.8	37	c.3791	CCDS214.1	1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615493	0.87359	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266;ENST00000435383	T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34	5.48	5.48	0.80851	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64080	0.2566	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.70223	-0.4931	10	0.87932	D	0	-11.9593	15.5579	0.76213	1.0:0.0:0.0:0.0	.	1453;978;862;1264;1258	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	S	1258;1454;1258;978;748;1264;862;24	ENSP00000264211:F1258S;ENSP00000383274:F1258S;ENSP00000364071:F978S;ENSP00000442010:F748S;ENSP00000364073:F1264S;ENSP00000444693:F862S	ENSP00000264211:F1258S	F	-	2	0	EIF4G3	21040056	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	8.923000	0.92808	2.083000	0.62718	0.260000	0.18958	TTT	-	EIF4G3	-	pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_Initiation_fac_eIF4g_MI		0.478	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	HGNC	protein_coding	OTTHUMT00000007467.3	0	0	0	47	47	94	0.00	0.00	A	NM_003760		21167469	-1	32	34	54	67	tier1	no_errors	ENST00000374937	ensembl	human	known	74_37	missense	37.21	33.66	SNP	1.000	G	32	54
FMNL2	114793	genome.wustl.edu	37	2	153475500	153475500	+	Silent	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475500G>A	ENST00000288670.9	+	14	1822	c.1455G>A	c.(1453-1455)aaG>aaA	p.K485K	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	485					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						AAATTCAGAAGAAAGGGGATG	0.443													ENSG00000157827																																					0													79.0	78.0	78.0					2																	153475500		1886	4101	5987	SO:0001819	synonymous_variant	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1455G>A	2.37:g.153475500G>A			B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.K485	ENST00000288670.9	37	c.1455	CCDS46429.1	2																																																																																			-	FMNL2	-	NULL		0.443	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	1	40	40	91	0.00	1.09	G	NM_052905		153475500	+1	15	32	69	132	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	silent	17.86	19.51	SNP	1.000	A	15	69
SIX4	51804	genome.wustl.edu	37	14	61180804	61180804	+	Missense_Mutation	SNP	G	G	A	rs536442725		TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr14:61180804G>A	ENST00000216513.4	-	3	1726	c.1667C>T	c.(1666-1668)aCg>aTg	p.T556M		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	556					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		ATTAGGAACCGTGTATACCAC	0.458													ENSG00000100625	G|||	1	0.000199681	0.0	0.0	5008	,	,		18667	0.001		0.0	False		,,,				2504	0.0																0													45.0	44.0	44.0					14																	61180804		2203	4300	6503	SO:0001583	missense	0			-	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.1667C>T	14.37:g.61180804G>A	ENSP00000216513:p.Thr556Met		Q4QQH5|Q4V764	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.T556M	ENST00000216513.4	37	c.1667	CCDS9749.2	14	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517452	0.64634	.	.	ENSG00000100625	ENST00000216513;ENST00000554079	D;T	0.92299	-3.01;0.61	5.55	5.55	0.83447	.	0.323164	0.28515	N	0.015070	D	0.93220	0.7840	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94431	0.7649	10	0.87932	D	0	.	19.5144	0.95157	0.0:0.0:1.0:0.0	.	556	Q9UIU6	SIX4_HUMAN	M	556;229	ENSP00000216513:T556M;ENSP00000451537:T229M	ENSP00000216513:T556M	T	-	2	0	SIX4	60250557	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.778000	0.75043	2.618000	0.88619	0.655000	0.94253	ACG	-	SIX4	-	NULL		0.458	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX4	HGNC	protein_coding	OTTHUMT00000072397.2	0	0	0	42	42	75	0.00	0.00	G			61180804	-1	14	32	32	52	tier1	no_errors	ENST00000216513	ensembl	human	known	74_37	missense	30.43	38.10	SNP	1.000	A	14	32
UGT3A2	167127	genome.wustl.edu	37	5	36035888	36035888	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr5:36035888A>T	ENST00000282507.3	-	7	1585	c.1484T>A	c.(1483-1485)cTc>cAc	p.L495H	UGT3A2_ENST00000513300.1_Missense_Mutation_p.L461H|UGT3A2_ENST00000545528.1_Missense_Mutation_p.L193H	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	495					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCCCAGAGTGAGCCCCAGCAG	0.597													ENSG00000168671																																					0													67.0	59.0	62.0					5																	36035888		2203	4300	6503	SO:0001583	missense	0			-		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.1484T>A	5.37:g.36035888A>T	ENSP00000282507:p.Leu495His		B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L495H	ENST00000282507.3	37	c.1484	CCDS3914.1	5	.	.	.	.	.	.	.	.	.	.	A	9.320	1.057771	0.19907	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000545528	T;T;T	0.60797	0.16;0.16;0.16	2.74	2.74	0.32292	.	1.439330	0.05584	U	0.573498	T	0.71643	0.3364	M	0.75264	2.295	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.66716	0.946;0.946	T	0.52990	-0.8501	10	0.87932	D	0	.	3.1377	0.06444	0.6096:0.2542:0.1362:0.0	.	461;495	E9PFK7;Q3SY77	.;UD3A2_HUMAN	H	495;461;193	ENSP00000282507:L495H;ENSP00000427404:L461H;ENSP00000445367:L193H	ENSP00000282507:L495H	L	-	2	0	UGT3A2	36071645	0.364000	0.24997	0.412000	0.26496	0.148000	0.21650	0.907000	0.28531	1.492000	0.48499	0.460000	0.39030	CTC	-	UGT3A2	-	pfam_UDP_glucos_trans		0.597	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A2	HGNC	protein_coding	OTTHUMT00000253771.2	0	0	0	17	17	46	0.00	0.00	A	NM_174914		36035888	-1	15	23	26	46	tier1	no_errors	ENST00000282507	ensembl	human	known	74_37	missense	36.59	33.33	SNP	0.019	T	15	26
IGDCC3	9543	genome.wustl.edu	37	15	65621811	65621811	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr15:65621811C>A	ENST00000327987.4	-	13	2373	c.2122G>T	c.(2122-2124)Gac>Tac	p.D708Y	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	708					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CGTTTCTCGTCTCGGCCCAGC	0.657													ENSG00000174498																																					0													51.0	61.0	57.0					15																	65621811		2199	4293	6492	SO:0001583	missense	0			-	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2122G>T	15.37:g.65621811C>A	ENSP00000332773:p.Asp708Tyr		O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D708Y	ENST00000327987.4	37	c.2122	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	9.482	1.098435	0.20552	.	.	ENSG00000174498	ENST00000327987	T	0.66638	-0.22	5.29	3.41	0.39046	.	0.491946	0.21418	N	0.074866	T	0.47619	0.1455	N	0.24115	0.695	0.09310	N	1	P	0.39624	0.681	B	0.37601	0.254	T	0.43180	-0.9407	10	0.59425	D	0.04	-4.9476	5.6062	0.17381	0.0:0.6802:0.0:0.3198	.	708	Q8IVU1	IGDC3_HUMAN	Y	708	ENSP00000332773:D708Y	ENSP00000332773:D708Y	D	-	1	0	IGDCC3	63408864	0.027000	0.19231	0.162000	0.22713	0.001000	0.01503	1.724000	0.38064	1.232000	0.43678	-0.137000	0.14449	GAC	-	IGDCC3	-	NULL		0.657	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	0	0	0	60	60	15	0.00	0.00	C	NM_004884		65621811	-1	31	8	50	10	tier1	no_errors	ENST00000327987	ensembl	human	known	74_37	missense	38.27	44.44	SNP	0.007	A	31	50
KIAA0355	9710	genome.wustl.edu	37	19	34819042	34819042	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr19:34819042C>G	ENST00000299505.6	+	6	1963	c.1090C>G	c.(1090-1092)Ctg>Gtg	p.L364V		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	364										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					CGCCGACAATCTGAAACTTAA	0.507													ENSG00000166398																																					0													52.0	54.0	53.0					19																	34819042		2203	4300	6503	SO:0001583	missense	0			-		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.1090C>G	19.37:g.34819042C>G	ENSP00000299505:p.Leu364Val		Q2M3W4	Missense_Mutation	SNP	NULL	p.L364V	ENST00000299505.6	37	c.1090	CCDS12436.1	19	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268133	0.80469	.	.	ENSG00000166398	ENST00000299505;ENST00000543188	.	.	.	5.55	4.52	0.55395	.	0.000000	0.64402	D	0.000002	T	0.60728	0.2291	N	0.14661	0.345	0.58432	D	0.999999	D	0.67145	0.996	D	0.75484	0.986	T	0.67952	-0.5537	9	0.87932	D	0	-33.3309	14.5447	0.68020	0.0:0.9296:0.0:0.0704	.	364	O15063	K0355_HUMAN	V	364;67	.	ENSP00000299505:L364V	L	+	1	2	KIAA0355	39510882	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.648000	0.61425	1.358000	0.45922	0.544000	0.68410	CTG	-	KIAA0355	-	NULL		0.507	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0355	HGNC	protein_coding	OTTHUMT00000451678.4	0	0	0	30	30	77	0.00	0.00	C	NM_014686		34819042	+1	9	10	49	42	tier1	no_errors	ENST00000299505	ensembl	human	known	74_37	missense	15.52	19.23	SNP	1.000	G	9	49
FMNL2	114793	genome.wustl.edu	37	2	153475423	153475423	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475423G>A	ENST00000288670.9	+	14	1745	c.1378G>A	c.(1378-1380)Gaa>Aaa	p.E460K	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	460	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						AGAAAAAGAAGAAGCAATTCA	0.363													ENSG00000157827																																					0													47.0	45.0	46.0					2																	153475423		1845	4077	5922	SO:0001583	missense	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1378G>A	2.37:g.153475423G>A	ENSP00000288670:p.Glu460Lys		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.E460K	ENST00000288670.9	37	c.1378	CCDS46429.1	2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574492	0.86542	.	.	ENSG00000157827	ENST00000288670	T	0.36699	1.24	5.63	5.63	0.86233	.	0.092494	0.85682	D	0.000000	T	0.43634	0.1256	L	0.41961	1.31	0.80722	D	1	D	0.56968	0.978	P	0.50659	0.647	T	0.08126	-1.0737	10	0.27785	T	0.31	.	19.68	0.95958	0.0:0.0:1.0:0.0	.	460	Q96PY5-3	.	K	460	ENSP00000288670:E460K	ENSP00000288670:E460K	E	+	1	0	FMNL2	153183669	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.571000	0.82399	2.641000	0.89580	0.650000	0.86243	GAA	-	FMNL2	-	pfam_FH3_dom		0.363	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	0	50	50	79	0.00	0.00	G	NM_052905		153475423	+1	12	17	58	123	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	17.14	11.89	SNP	1.000	A	12	58
FMNL2	114793	genome.wustl.edu	37	2	153475564	153475564	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475564G>A	ENST00000288670.9	+	14	1886	c.1519G>A	c.(1519-1521)Gaa>Aaa	p.E507K	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	507					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CATGGGGTCAGAAGTGGTAGC	0.552													ENSG00000157827																																					0													64.0	68.0	67.0					2																	153475564		1948	4143	6091	SO:0001583	missense	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1519G>A	2.37:g.153475564G>A	ENSP00000288670:p.Glu507Lys		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.E507K	ENST00000288670.9	37	c.1519	CCDS46429.1	2	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425964	0.43020	.	.	ENSG00000157827	ENST00000288670;ENST00000421344	D	0.90004	-2.6	5.57	5.57	0.84162	.	0.371852	0.32608	N	0.005862	T	0.80919	0.4716	N	0.19112	0.55	0.53005	D	0.999964	B	0.18310	0.027	B	0.16289	0.015	T	0.75766	-0.3202	10	0.06236	T	0.91	.	19.5452	0.95291	0.0:0.0:1.0:0.0	.	507	Q96PY5-3	.	K	507;4	ENSP00000288670:E507K	ENSP00000288670:E507K	E	+	1	0	FMNL2	153183810	1.000000	0.71417	0.045000	0.18777	0.048000	0.14542	9.114000	0.94329	2.612000	0.88384	0.650000	0.86243	GAA	-	FMNL2	-	prints_Wilms_tumour		0.552	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	0	28	28	71	0.00	0.00	G	NM_052905		153475564	+1	13	30	78	120	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	14.29	20.00	SNP	0.085	A	13	78
CD86	942	genome.wustl.edu	37	3	121822505	121822505	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr3:121822505G>C	ENST00000330540.2	+	3	327	c.211G>C	c.(211-213)Ggc>Cgc	p.G71R	CD86_ENST00000493101.1_Intron|CD86_ENST00000469710.1_5'UTR|CD86_ENST00000264468.5_Intron|CD86_ENST00000393627.2_Missense_Mutation_p.G65R	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	71	Ig-like V-type.				aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	GGTATACTTAGGCAAAGAGAA	0.433													ENSG00000114013																									GBM(67;1379 1389 36064 39806)												0													142.0	142.0	142.0					3																	121822505		2203	4300	6503	SO:0001583	missense	0			-		CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.211G>C	3.37:g.121822505G>C	ENSP00000332049:p.Gly71Arg		A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.G71R	ENST00000330540.2	37	c.211	CCDS3009.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.25|17.25	3.340913|3.340913	0.60963|0.60963	.|.	.|.	ENSG00000114013|ENSG00000114013	ENST00000330540;ENST00000482356;ENST00000393627|ENST00000478741	T;T;T|.	0.64085|.	-0.08;-0.08;-0.08|.	5.54|5.54	5.54|5.54	0.83059|0.83059	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.64402|.	D|.	0.000013|.	T|T	0.80502|0.80502	0.4635|0.4635	M|M	0.88450|0.88450	2.955|2.955	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.82882|0.82882	-0.0237|-0.0237	10|5	0.87932|.	D|.	0|.	-21.6932|-21.6932	14.8575|14.8575	0.70351|0.70351	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	71|.	P42081|.	CD86_HUMAN|.	R|T	71;65;65|66	ENSP00000332049:G71R;ENSP00000419116:G65R;ENSP00000377248:G65R|.	ENSP00000332049:G71R|.	G|R	+|+	1|2	0|0	CD86|CD86	123305195|123305195	0.998000|0.998000	0.40836|0.40836	0.355000|0.355000	0.25773|0.25773	0.400000|0.400000	0.30750|0.30750	4.887000|4.887000	0.63156|0.63156	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GGC|AGG	-	CD86	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.433	CD86-001	KNOWN	basic|CCDS	protein_coding	CD86	HGNC	protein_coding	OTTHUMT00000355671.1	0	0	0	74	74	102	0.00	0.00	G	NM_006889		121822505	+1	21	24	49	70	tier1	no_errors	ENST00000330540	ensembl	human	known	74_37	missense	30.00	25.53	SNP	0.603	C	21	49
OTOA	146183	genome.wustl.edu	37	16	21702929	21702929	+	Silent	SNP	C	C	T	rs139292090		TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr16:21702929C>T	ENST00000286149.4	+	8	661	c.660C>T	c.(658-660)taC>taT	p.Y220Y	OTOA_ENST00000388958.3_Silent_p.Y220Y|OTOA_ENST00000388956.4_Silent_p.Y141Y			Q7RTW8	OTOAN_HUMAN	otoancorin	220					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		AAGATCTCTACGACAAAACCT	0.478													ENSG00000155719	C|||	1	0.000199681	0.0	0.0	5008	,	,		20277	0.0		0.001	False		,,,				2504	0.0																0								C	,	3,4395	6.2+/-15.9	0,3,2196	107.0	97.0	100.0		423,660	-10.5	0.1	16	dbSNP_134	100	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	OTOA	NM_001161683.1,NM_144672.3	,	0,5,6494	TT,TC,CC		0.0233,0.0682,0.0385	,	141/1061,220/1140	21702929	5,12993	2199	4300	6499	SO:0001819	synonymous_variant	0			GMAF=0.0005	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.660C>T	16.37:g.21702929C>T			A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Silent	SNP	NULL	p.Y220	ENST00000286149.4	37	c.660		16																																																																																			rs139292090	OTOA	-	NULL		0.478	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	0	0	0	54	54	70	0.00	0.00	C			21702929	+1	23	31	22	61	tier1	no_errors	ENST00000286149	ensembl	human	known	74_37	silent	51.11	33.70	SNP	0.567	T	23	22
SLC19A1	6573	genome.wustl.edu	37	21	46935022	46935022	+	3'UTR	SNP	A	A	G			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr21:46935022A>G	ENST00000311124.4	-	0	2478				SLC19A1_ENST00000468508.1_5'UTR|SLC19A1_ENST00000380010.4_Silent_p.H446H|SLC19A1_ENST00000567670.1_Intron	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1						folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	CCAACCTGAGATGGCTTTTCC	0.502													ENSG00000173638																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.*550T>C	21.37:g.46935022A>G			B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Silent	SNP	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.H446	ENST00000311124.4	37	c.1338	CCDS13725.1	21																																																																																			-	SLC19A1	-	pirsf_Folate_carrier		0.502	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206796.1	0	0	0	18	18	40	0.00	0.00	A			46935022	-1	11	16	29	18	tier1	no_errors	ENST00000380010	ensembl	human	putative	74_37	silent	27.50	47.06	SNP	0.000	G	11	29
ZNF182	7569	genome.wustl.edu	37	X	47842772	47842772	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chrX:47842772G>T	ENST00000396965.1	-	5	462	c.112C>A	c.(112-114)Cag>Aag	p.Q38K	ZNF182_ENST00000305127.6_Missense_Mutation_p.Q38K|ZNF182_ENST00000376943.3_Missense_Mutation_p.Q19K	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	38	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						CACTCCTCCTGGGTGAAATCC	0.453													ENSG00000147118																																					0													117.0	100.0	106.0					X																	47842772		2203	4300	6503	SO:0001583	missense	0			-	AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.112C>A	X.37:g.47842772G>T	ENSP00000380165:p.Gln38Lys		A2IDD7|Q3KP67|Q96QH7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q38K	ENST00000396965.1	37	c.112	CCDS35236.1	X	.	.	.	.	.	.	.	.	.	.	G	3.239	-0.155675	0.06544	.	.	ENSG00000147118	ENST00000376943;ENST00000396965;ENST00000305127	T;T;T	0.02085	4.46;4.46;4.46	3.84	0.867	0.19085	Krueppel-associated box (4);	.	.	.	.	T	0.02970	0.0088	M	0.75884	2.315	0.51767	D	0.999939	B;B;B	0.23185	0.081;0.053;0.0	B;B;B	0.26969	0.038;0.075;0.001	T	0.40478	-0.9561	9	0.20046	T	0.44	.	2.7249	0.05211	0.2339:0.0:0.3662:0.3999	.	19;19;38	B4DRM0;Q96QH7;P17025	.;.;ZN182_HUMAN	K	19;38;38	ENSP00000366142:Q19K;ENSP00000380165:Q38K;ENSP00000306351:Q38K	ENSP00000306351:Q38K	Q	-	1	0	ZNF182	47727716	0.002000	0.14202	0.857000	0.33713	0.554000	0.35429	-0.181000	0.09740	0.044000	0.15775	0.513000	0.50165	CAG	-	ZNF182	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.453	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF182	HGNC	protein_coding	OTTHUMT00000277055.1	0	0	0	70	70	76	0.00	0.00	G	NM_006962		47842772	-1	24	19	62	47	tier1	no_errors	ENST00000305127	ensembl	human	known	74_37	missense	27.91	28.79	SNP	0.877	T	24	62
MMP26	56547	genome.wustl.edu	37	11	5013310	5013310	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr11:5013310T>C	ENST00000380390.1	+	6	928	c.712T>C	c.(712-714)Ttc>Ctc	p.F238L	MMP26_ENST00000300762.1_Missense_Mutation_p.F238L			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26	238					collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	CCCTAGAACCTTCCAGCTCAG	0.488													ENSG00000167346																																					0													87.0	77.0	80.0					11																	5013310		2201	4298	6499	SO:0001583	missense	0			-	AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.712T>C	11.37:g.5013310T>C	ENSP00000369753:p.Phe238Leu		Q3MJ78|Q9GZS2|Q9NR87	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,prints_Pept_M10A	p.F238L	ENST00000380390.1	37	c.712	CCDS7752.1	11	.	.	.	.	.	.	.	.	.	.	T	12.42	1.932776	0.34096	.	.	ENSG00000167346	ENST00000380390;ENST00000300762	T;T	0.50277	0.75;0.75	3.79	3.79	0.43588	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.47455	D	0.000228	T	0.63486	0.2515	M	0.66439	2.03	0.36492	D	0.86846	D	0.76494	0.999	D	0.79784	0.993	T	0.72354	-0.4319	10	0.87932	D	0	-10.5885	10.5334	0.44990	0.0:0.0:0.0:1.0	.	238	Q9NRE1	MMP26_HUMAN	L	238	ENSP00000369753:F238L;ENSP00000300762:F238L	ENSP00000300762:F238L	F	+	1	0	MMP26	4969886	0.995000	0.38212	0.598000	0.28837	0.210000	0.24377	5.489000	0.66875	1.587000	0.49959	0.459000	0.35465	TTC	-	MMP26	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo		0.488	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP26	HGNC	protein_coding	OTTHUMT00000142058.3	0	0	0	35	35	98	0.00	0.00	T	NM_021801		5013310	+1	9	7	32	43	tier1	no_errors	ENST00000300762	ensembl	human	known	74_37	missense	21.95	14.00	SNP	0.898	C	9	32
GRHL2	79977	genome.wustl.edu	37	8	102570802	102570802	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr8:102570802C>T	ENST00000251808.3	+	4	778	c.440C>T	c.(439-441)tCt>tTt	p.S147F	GRHL2_ENST00000395927.1_Missense_Mutation_p.S131F	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	147					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			CCCGAGAGCTCTGCCATCATC	0.527													ENSG00000083307																																					0													119.0	115.0	117.0					8																	102570802		2203	4300	6503	SO:0001583	missense	0			-	AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.440C>T	8.37:g.102570802C>T	ENSP00000251808:p.Ser147Phe		A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	pfam_CP2	p.S147F	ENST00000251808.3	37	c.440	CCDS34931.1	8	.	.	.	.	.	.	.	.	.	.	C	13.09	2.131912	0.37630	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.12361	2.69;2.7	5.1	5.1	0.69264	.	0.491341	0.22165	N	0.063727	T	0.17662	0.0424	L	0.29908	0.895	0.41607	D	0.988883	B;P	0.35944	0.412;0.529	B;B	0.42738	0.188;0.396	T	0.04537	-1.0944	10	0.56958	D	0.05	-2.2035	18.5219	0.90956	0.0:1.0:0.0:0.0	.	147;147	B4DL28;Q6ISB3	.;GRHL2_HUMAN	F	147;131;147	ENSP00000251808:S147F;ENSP00000379260:S131F	ENSP00000251808:S147F	S	+	2	0	GRHL2	102639978	0.994000	0.37717	0.786000	0.31890	0.142000	0.21351	6.648000	0.74359	2.366000	0.80165	0.637000	0.83480	TCT	-	GRHL2	-	NULL		0.527	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL2	HGNC	protein_coding	OTTHUMT00000313882.1	0	0	0	37	37	64	0.00	0.00	C	NM_024915		102570802	+1	19	23	15	31	tier1	no_errors	ENST00000251808	ensembl	human	known	74_37	missense	54.29	42.59	SNP	0.803	T	19	15
PCDHA7	56141	genome.wustl.edu	37	5	140214891	140214891	+	Missense_Mutation	SNP	T	T	A	rs565146954		TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr5:140214891T>A	ENST00000525929.1	+	1	923	c.923T>A	c.(922-924)aTg>aAg	p.M308K	PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.M308K|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	308	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATAGGACATATGGATTTTGAA	0.453													ENSG00000204963																									NSCLC(160;258 2013 5070 22440 28951)												0													73.0	66.0	68.0					5																	140214891		2202	4280	6482	SO:0001583	missense	0			-	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.923T>A	5.37:g.140214891T>A	ENSP00000436426:p.Met308Lys		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.M308K	ENST00000525929.1	37	c.923	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	T	11.11	1.540994	0.27563	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.51817	0.69;0.69	4.04	4.04	0.47022	Cadherin (4);Cadherin-like (1);	0.358244	0.15682	U	0.249876	T	0.53997	0.1831	L	0.46157	1.445	0.09310	N	1	B;B	0.32010	0.159;0.351	B;P	0.45971	0.024;0.499	T	0.55749	-0.8092	10	0.87932	D	0	.	13.2918	0.60274	0.0:0.0:0.0:1.0	.	308;308	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	K	308	ENSP00000436426:M308K;ENSP00000367365:M308K	ENSP00000367365:M308K	M	+	2	0	PCDHA7	140195075	0.982000	0.34865	0.024000	0.17045	0.660000	0.38997	7.958000	0.87877	1.592000	0.50018	0.254000	0.18369	ATG	-	PCDHA7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.453	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	0	0	0	55	55	56	0.00	0.00	T	NM_018910		140214891	+1	6	6	22	32	tier1	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	21.43	15.79	SNP	0.079	A	6	22
ABCA3	21	genome.wustl.edu	37	16	2329036	2329036	+	Silent	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr16:2329036G>A	ENST00000301732.5	-	29	5155	c.4455C>T	c.(4453-4455)ggC>ggT	p.G1485G	ABCA3_ENST00000382381.3_Silent_p.G1427G	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1485	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GCTCAGGGATGCCCCGGAGCC	0.652													ENSG00000167972																																					0													62.0	64.0	63.0					16																	2329036		2198	4300	6498	SO:0001819	synonymous_variant	0			-	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.4455C>T	16.37:g.2329036G>A			B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G1485	ENST00000301732.5	37	c.4455	CCDS10466.1	16																																																																																			-	ABCA3	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.652	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	0	0	0	94	94	16	0.00	0.00	G	NM_001089		2329036	-1	58	15	106	15	tier1	no_errors	ENST00000301732	ensembl	human	known	74_37	silent	34.73	50.00	SNP	0.995	A	58	106
FMNL2	114793	genome.wustl.edu	37	2	153475623	153475623	+	Silent	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475623G>A	ENST00000288670.9	+	14	1945	c.1578G>A	c.(1576-1578)ttG>ttA	p.L526L	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	526	Pro-rich.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CAGGACCCTTGCCCCCTCCTC	0.542													ENSG00000157827																																					0													45.0	48.0	47.0					2																	153475623		1965	4143	6108	SO:0001819	synonymous_variant	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1578G>A	2.37:g.153475623G>A			B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.L526	ENST00000288670.9	37	c.1578	CCDS46429.1	2																																																																																			-	FMNL2	-	NULL		0.542	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	0	30	30	54	0.00	0.00	G	NM_052905		153475623	+1	23	21	114	100	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	silent	16.79	17.21	SNP	0.733	A	23	114
MYH6	4624	genome.wustl.edu	37	14	23853824	23853824	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr14:23853824G>A	ENST00000356287.3	-	35	5421	c.5392C>T	c.(5392-5394)Cgg>Tgg	p.R1798W	MYH6_ENST00000405093.3_Missense_Mutation_p.R1798W			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1798					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCGTCCAGCCGGTGCTGCAGG	0.632													ENSG00000197616																																					0													76.0	76.0	76.0					14																	23853824		2203	4300	6503	SO:0001583	missense	0			-	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.5392C>T	14.37:g.23853824G>A	ENSP00000348634:p.Arg1798Trp		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1798W	ENST00000356287.3	37	c.5392	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	g	20.2	3.951639	0.73787	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.82711	-1.64;-1.64	4.82	3.92	0.45320	Myosin tail (1);	.	.	.	.	D	0.93769	0.8008	H	0.96996	3.92	0.53688	D	0.999979	D	0.89917	1.0	D	0.97110	1.0	D	0.95323	0.8422	9	0.87932	D	0	.	13.9069	0.63841	0.0:0.0:0.7244:0.2756	.	1798	P13533	MYH6_HUMAN	W	1798	ENSP00000386041:R1798W;ENSP00000348634:R1798W	ENSP00000348634:R1798W	R	-	1	2	MYH6	22923664	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.974000	0.56852	1.148000	0.42385	0.561000	0.74099	CGG	-	MYH6	-	pfam_Myosin_tail		0.632	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	0	0	0	33	33	21	0.00	0.00	G			23853824	-1	35	8	58	14	tier1	no_errors	ENST00000356287	ensembl	human	known	74_37	missense	37.63	34.78	SNP	1.000	A	35	58
POT1	25913	genome.wustl.edu	37	7	124493077	124493077	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr7:124493077C>T	ENST00000357628.3	-	10	1416	c.818G>A	c.(817-819)cGg>cAg	p.R273Q	POT1_ENST00000393329.1_Missense_Mutation_p.R142Q	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	273	DNA binding.		R -> L (in CMM10; complete abolition of POT1-DNA complex formation, thus disrupting the interaction with telomeres and leading to elongated telomeres). {ECO:0000269|PubMed:24686849}.		DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						CCTGATTCCCCGACCGTAACT	0.363													ENSG00000128513																									Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)												0													114.0	108.0	110.0					7																	124493077		2203	4300	6503	SO:0001583	missense	0			-	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.818G>A	7.37:g.124493077C>T	ENSP00000350249:p.Arg273Gln		O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13	p.R273Q	ENST00000357628.3	37	c.818	CCDS5793.1	7	.	.	.	.	.	.	.	.	.	.	C	34	5.355751	0.95854	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391	T;T	0.73469	-0.23;-0.75	6.07	6.07	0.98685	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	D	0.86928	0.6051	M	0.79475	2.455	0.58432	D	0.999993	D	0.89917	1.0	D	0.83275	0.996	D	0.87081	0.2166	10	0.66056	D	0.02	-12.026	18.1532	0.89682	0.0:1.0:0.0:0.0	.	273	Q9NUX5	POTE1_HUMAN	Q	273;142;273;273;273;272	ENSP00000350249:R273Q;ENSP00000377002:R142Q	ENSP00000265391:R272Q	R	-	2	0	POT1	124280313	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.800000	0.62524	2.885000	0.99019	0.655000	0.94253	CGG	-	POT1	-	superfamily_-bd_OB-fold		0.363	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	HGNC	protein_coding	OTTHUMT00000347861.1	0	0	0	108	108	105	0.00	0.00	C			124493077	-1	12	16	67	95	tier1	no_errors	ENST00000357628	ensembl	human	known	74_37	missense	15.19	14.41	SNP	1.000	T	12	67
WNK3	65267	genome.wustl.edu	37	X	54319436	54319436	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chrX:54319436A>T	ENST00000375159.2	-	9	1921	c.1922T>A	c.(1921-1923)aTt>aAt	p.I641N	WNK3_ENST00000354646.2_Missense_Mutation_p.I641N|WNK3_ENST00000375169.3_Missense_Mutation_p.I641N			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	641					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CAAAGGCAAAATCTGCGGCTG	0.393													ENSG00000196632																																					0													91.0	78.0	82.0					X																	54319436		2203	4300	6503	SO:0001583	missense	0			-	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1922T>A	X.37:g.54319436A>T	ENSP00000364301:p.Ile641Asn		B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I641N	ENST00000375159.2	37	c.1922	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	A	3.268	-0.149630	0.06585	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.70516	-0.46;-0.49;-0.49	5.45	2.98	0.34508	.	0.485871	0.18860	N	0.129180	T	0.48960	0.1529	N	0.24115	0.695	0.18873	N	0.999983	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.24977	-1.0145	10	0.19147	T	0.46	-0.2663	3.9896	0.09532	0.6988:0.0:0.1014:0.1998	.	641;641	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	N	641	ENSP00000364312:I641N;ENSP00000346667:I641N;ENSP00000364301:I641N	ENSP00000346667:I641N	I	-	2	0	WNK3	54336161	0.598000	0.26882	0.314000	0.25224	0.865000	0.49528	1.250000	0.32850	0.273000	0.22049	0.451000	0.29950	ATT	-	WNK3	-	NULL		0.393	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	0	0	0	113	113	104	0.00	0.00	A	NM_020922		54319436	-1	13	21	74	100	tier1	no_errors	ENST00000354646	ensembl	human	known	74_37	missense	14.94	17.36	SNP	0.410	T	13	74
FMNL2	114793	genome.wustl.edu	37	2	153475589	153475589	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:153475589G>A	ENST00000288670.9	+	14	1911	c.1544G>A	c.(1543-1545)gGa>gAa	p.G515E	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	515					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						AACTCTGTGGGACCCACAATG	0.557													ENSG00000157827																																					0													58.0	61.0	60.0					2																	153475589		1953	4138	6091	SO:0001583	missense	0			-	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1544G>A	2.37:g.153475589G>A	ENSP00000288670:p.Gly515Glu		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.G515E	ENST00000288670.9	37	c.1544	CCDS46429.1	2	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446730	0.63178	.	.	ENSG00000157827	ENST00000288670;ENST00000421344	T	0.20738	2.05	5.34	5.34	0.76211	.	0.530504	0.18732	N	0.132716	T	0.16981	0.0408	N	0.19112	0.55	0.80722	D	1	D	0.53619	0.961	P	0.48189	0.57	T	0.01432	-1.1356	10	0.02654	T	1	.	15.6493	0.77078	0.0:0.1469:0.8531:0.0	.	515	Q96PY5-3	.	E	515;12	ENSP00000288670:G515E	ENSP00000288670:G515E	G	+	2	0	FMNL2	153183835	1.000000	0.71417	0.834000	0.33040	0.128000	0.20619	5.793000	0.69060	2.497000	0.84241	0.650000	0.86243	GGA	-	FMNL2	-	prints_Wilms_tumour		0.557	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333582.2	0	0	0	32	32	64	0.00	0.00	G	NM_052905		153475589	+1	17	28	107	124	tier1	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	13.71	18.42	SNP	0.991	A	17	107
CHRM2	1129	genome.wustl.edu	37	7	136700328	136700328	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr7:136700328G>A	ENST00000445907.2	+	3	1244	c.716G>A	c.(715-717)aGg>aAg	p.R239K	hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.R239K|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000439694.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.R239K|CHRM2_ENST00000401861.1_Missense_Mutation_p.R239K|CHRM2_ENST00000453373.1_Missense_Mutation_p.R239K|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.R239K	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	239					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GTACAAGGAAGGATAGTGAAG	0.502													ENSG00000181072																																					0													52.0	50.0	50.0					7																	136700328		2203	4300	6503	SO:0001583	missense	0			-		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.716G>A	7.37:g.136700328G>A	ENSP00000399745:p.Arg239Lys		Q4VBK6|Q9P1X9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.R239K	ENST00000445907.2	37	c.716	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	G	0.972	-0.699735	0.03279	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17	5.4	2.64	0.31445	GPCR, rhodopsin-like superfamily (1);	0.436404	0.27139	N	0.020744	T	0.31796	0.0808	N	0.16903	0.455	0.22591	N	0.998957	B	0.02656	0.0	B	0.04013	0.001	T	0.26916	-1.0089	10	0.02654	T	1	-3.3293	7.564	0.27868	0.4607:0.0:0.5393:0.0	.	239	P08172	ACM2_HUMAN	K	239	ENSP00000399745:R239K;ENSP00000415386:R239K;ENSP00000319984:R239K;ENSP00000380733:R239K;ENSP00000384937:R239K;ENSP00000384401:R239K	ENSP00000319984:R239K	R	+	2	0	CHRM2	136350868	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	1.017000	0.29989	0.278000	0.22164	0.655000	0.94253	AGG	-	CHRM2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt		0.502	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	0	0	0	24	24	106	0.00	0.00	G			136700328	+1	10	51	30	63	tier1	no_errors	ENST00000320658	ensembl	human	known	74_37	missense	25.00	44.74	SNP	0.862	A	10	30
CADM3	57863	genome.wustl.edu	37	1	159170734	159170734	+	3'UTR	SNP	G	G	A			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr1:159170734G>A	ENST00000368125.4	+	0	1376				CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000497636.1_3'UTR|DARC_ENST00000537147.1_5'Flank|CTA-134P22.2_ENST00000609696.1_RNA|CADM3_ENST00000368124.4_3'UTR	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CACTTCCTGCGCCCCCCAGGG	0.662													ENSG00000225670																																					0													33.0	35.0	34.0					1																	159170734		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.*22G>A	1.37:g.159170734G>A			Q8IZQ9|Q9NVJ5|Q9UJP1	R	SNP	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			-	CTA-134P22.2	-	-		0.662	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1	0	0	0	49	49	32	0.00	0.00	G	NM_021189		159170734	-1	22	11	42	19	tier1	no_errors	ENST00000415675	ensembl	human	known	74_37	rna	34.38	36.67	SNP	0.123	A	22	42
ZIM2	23619	genome.wustl.edu	37	19	57301291	57301291	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr19:57301291delT	ENST00000391708.3	-	9	968	c.426delA	c.(424-426)gcafs	p.A142fs	AC006115.3_ENST00000597946.1_RNA|AC006115.3_ENST00000594400.1_RNA|ZIM2_ENST00000601070.1_Frame_Shift_Del_p.A142fs|AC006115.3_ENST00000595954.1_RNA|ZIM2_ENST00000599935.1_Frame_Shift_Del_p.A142fs|ZIM2_ENST00000221722.5_Frame_Shift_Del_p.A142fs|ZIM2_ENST00000593711.1_Frame_Shift_Del_p.A142fs	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		TCCTCTTTTCTGCAGGGACAG	0.498													ENSG00000269699																																					0													74.0	62.0	66.0					19																	57301291		2203	4300	6503	SO:0001589	frameshift_variant	0				AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.426delA	19.37:g.57301291delT	ENSP00000375589:p.Ala142fs		Q2M3K1	Frame_Shift_Del	DEL	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E143fs	ENST00000391708.3	37	c.426	CCDS33123.1	19																																																																																				ZIM2	-	NULL		0.498	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM2	HGNC	protein_coding	OTTHUMT00000416094.2	0	0	0	37	37	58	0.00	0.00	T			57301291	-1	16	20	76	114	tier1	no_errors	ENST00000221722	ensembl	human	known	74_37	frame_shift_del	17.39	14.93	DEL	0.000	-	16	76
CABP2	51475	genome.wustl.edu	37	11	67288529	67288529	+	Missense_Mutation	SNP	C	C	T	rs140767804	byFrequency	TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr11:67288529C>T	ENST00000294288.4	-	4	415	c.346G>A	c.(346-348)Gag>Aag	p.E116K	CABP2_ENST00000353903.5_Missense_Mutation_p.E59K	NM_016366.2	NP_057450.2	Q9NPB3	CABP2_HUMAN	calcium binding protein 2	116	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	9						AGCTCCATCTCGGTGGGCATG	0.627													ENSG00000167791																																					0								C	LYS/GLU	2,4398	4.2+/-10.8	0,2,2198	152.0	144.0	147.0		346	4.4	1.0	11	dbSNP_134	147	0,8590		0,0,4295	yes	missense	CABP2	NM_016366.2	56	0,2,6493	TT,TC,CC		0.0,0.0455,0.0154	probably-damaging	116/221	67288529	2,12988	2200	4295	6495	SO:0001583	missense	0			-	AF169154	CCDS8170.1	11q13.1	2013-01-10			ENSG00000167791	ENSG00000167791		"""EF-hand domain containing"""	1385	protein-coding gene	gene with protein product		607314				10625670	Standard	NM_016366		Approved		uc001omc.1	Q9NPB3	OTTHUMG00000168014	ENST00000294288.4:c.346G>A	11.37:g.67288529C>T	ENSP00000294288:p.Glu116Lys			Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.E116K	ENST00000294288.4	37	c.346	CCDS8170.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.436028	0.96168	4.55E-4	0.0	ENSG00000167791	ENST00000353903;ENST00000294288	T;T	0.08370	3.1;3.1	4.4	4.4	0.53042	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.26629	0.0651	L	0.61218	1.895	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.989;0.998	T	0.01053	-1.1467	10	0.72032	D	0.01	-29.9606	16.0747	0.80960	0.0:1.0:0.0:0.0	.	122;59;116	F1T0K2;Q9NPB3-2;Q9NPB3	.;.;CABP2_HUMAN	K	59;116	ENSP00000312037:E59K;ENSP00000294288:E116K	ENSP00000294288:E116K	E	-	1	0	CABP2	67045105	1.000000	0.71417	0.985000	0.45067	0.987000	0.75469	7.543000	0.82106	2.445000	0.82738	0.455000	0.32223	GAG	rs140767804	CABP2	-	NULL		0.627	CABP2-002	KNOWN	basic|CCDS	protein_coding	CABP2	HGNC	protein_coding	OTTHUMT00000397516.1	0	0	0	35	35	17	0.00	0.00	C			67288529	-1	25	5	25	8	tier1	no_errors	ENST00000294288	ensembl	human	known	74_37	missense	50.00	38.46	SNP	1.000	T	25	25
FHDC1	85462	genome.wustl.edu	37	4	153875437	153875437	+	Missense_Mutation	SNP	G	G	A	rs371895499		TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr4:153875437G>A	ENST00000511601.1	+	4	817	c.629G>A	c.(628-630)cGa>cAa	p.R210Q	FHDC1_ENST00000260008.3_Missense_Mutation_p.R210Q			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	210	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.								ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					GAGACCTTGCGAGAATTTCTT	0.363													ENSG00000137460																																					0								G	GLN/ARG	0,4406		0,0,2203	104.0	109.0	108.0		629	5.0	0.7	4		108	1,8599	1.2+/-3.3	0,1,4299	no	missense	FHDC1	NM_033393.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	210/1144	153875437	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.629G>A	4.37:g.153875437G>A	ENSP00000427567:p.Arg210Gln			Missense_Mutation	SNP	pfam_FH2_Formin,smart_FH2_Formin	p.R210Q	ENST00000511601.1	37	c.629	CCDS34081.1	4	.	.	.	.	.	.	.	.	.	.	G	17.53	3.412856	0.62511	0.0	1.16E-4	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.62788	0.0;0.0	5.86	5.02	0.67125	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.297635	0.33457	N	0.004898	T	0.58032	0.2094	L	0.39020	1.185	0.27235	N	0.959307	D	0.56746	0.977	P	0.50405	0.64	T	0.52749	-0.8534	10	0.32370	T	0.25	.	10.4163	0.44325	0.2039:0.0:0.7961:0.0	.	210	Q9C0D6	FHDC1_HUMAN	Q	210	ENSP00000427567:R210Q;ENSP00000260008:R210Q	ENSP00000260008:R210Q	R	+	2	0	FHDC1	154094887	0.996000	0.38824	0.709000	0.30452	0.682000	0.39822	1.194000	0.32174	1.499000	0.48617	0.650000	0.86243	CGA	-	FHDC1	-	pfam_FH2_Formin,smart_FH2_Formin		0.363	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	0	0	0	28	28	64	0.00	0.00	G	NM_033393		153875437	+1	24	32	3	9	tier1	no_errors	ENST00000260008	ensembl	human	known	74_37	missense	88.89	78.05	SNP	0.960	A	24	3
SEC16A	9919	genome.wustl.edu	37	9	139360765	139360765	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr9:139360765delG	ENST00000371706.3	-	5	3578	c.3545delC	c.(3544-3546)gcafs	p.A1182fs	SEC16A_ENST00000431893.2_Frame_Shift_Del_p.A1182fs|SEC16A_ENST00000313050.7_Frame_Shift_Del_p.A1360fs|SEC16A_ENST00000290037.6_Frame_Shift_Del_p.A1182fs			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1182	Required for endoplasmic reticulum localization.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CAGGCTGTGTGCGCTGTGCAG	0.657													ENSG00000148396																																					0													9.0	12.0	11.0					9																	139360765		2167	4243	6410	SO:0001589	frameshift_variant	0				AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.3545delC	9.37:g.139360765delG	ENSP00000360771:p.Ala1182fs		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Frame_Shift_Del	DEL	NULL	p.A1360fs	ENST00000371706.3	37	c.4079		9																																																																																				SEC16A	-	NULL		0.657	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	0	0	0	59	59	5	0.00	0.00	G	XM_088459		139360765	-1	35	3	85	4	tier1	no_errors	ENST00000313050	ensembl	human	known	74_37	frame_shift_del	29.17	42.86	DEL	0.006	-	35	85
DKK1	22943	genome.wustl.edu	37	10	54074610	54074610	+	Intron	SNP	C	C	T			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr10:54074610C>T	ENST00000373970.3	+	2	382				PRKG1-AS1_ENST00000420193.1_RNA|DKK1_ENST00000467359.1_3'UTR	NM_012242.2	NP_036374.1	O94907	DKK1_HUMAN	dickkopf WNT signaling pathway inhibitor 1						cell morphogenesis involved in differentiation (GO:0000904)|embryonic limb morphogenesis (GO:0030326)|endoderm formation (GO:0001706)|extracellular negative regulation of signal transduction (GO:1900116)|face morphogenesis (GO:0060325)|forebrain development (GO:0030900)|hair follicle development (GO:0001942)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901296)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of heart induction by negative regulation of canonical Wnt signaling pathway (GO:0090082)|regulation of endodermal cell fate specification (GO:0042663)|regulation of receptor internalization (GO:0002090)|response to retinoic acid (GO:0032526)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(4)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	16						GGACTGTGATCAGCGCCCGGG	0.602											OREG0020191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000107984																																					0																																										SO:0001627	intron_variant	0			-		CCDS7246.1	10q11.2	2013-05-15	2013-05-15		ENSG00000107984	ENSG00000107984			2891	protein-coding gene	gene with protein product		605189	"""dickkopf (Xenopus laevis) homolog 1"", ""dickkopf 1 homolog (Xenopus laevis)"""				Standard	NM_012242		Approved	SK, DKK-1	uc001jjr.3	O94907	OTTHUMG00000018247	ENST00000373970.3:c.244-73C>T	10.37:g.54074610C>T		997	B2RC19	R	SNP	-	NULL	ENST00000373970.3	37	NULL	CCDS7246.1	10																																																																																			-	DKK1	-	-		0.602	DKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DKK1	HGNC	protein_coding	OTTHUMT00000048100.1	0	0	0	48	48	90	0.00	0.00	C			54074610	+1	5	5	42	66	tier1	no_errors	ENST00000467359	ensembl	human	known	74_37	rna	10.64	7.04	SNP	0.002	T	5	42
USP7	7874	genome.wustl.edu	37	16	8988658	8988658	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr16:8988658C>T	ENST00000344836.4	-	29	3292	c.3094G>A	c.(3094-3096)Gag>Aag	p.E1032K	USP7_ENST00000381886.4_Missense_Mutation_p.E1016K|USP7_ENST00000535863.1_Missense_Mutation_p.E933K	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	1032					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						AACTCCTTCTCCTGGATGTCC	0.577													ENSG00000187555																																					0													105.0	102.0	103.0					16																	8988658		2197	4300	6497	SO:0001583	missense	0			-	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.3094G>A	16.37:g.8988658C>T	ENSP00000343535:p.Glu1032Lys		A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_MATH,pfam_USP7_ICP0-binding_dom,superfamily_TRAF-like,smart_MATH,pfscan_MATH,pfscan_Peptidase_C19/C67	p.E1032K	ENST00000344836.4	37	c.3094	CCDS32385.1	16	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892273	0.91889	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863	T;T	0.07216	3.21;3.22	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	M	0.61703	1.905	0.80722	D	1	P;P	0.40083	0.702;0.702	B;B	0.37015	0.239;0.239	T	0.03315	-1.1049	10	0.34782	T	0.22	.	19.3482	0.94373	0.0:1.0:0.0:0.0	.	1032;1016	Q93009;B7Z815	UBP7_HUMAN;.	K	1032;1040;933	ENSP00000343535:E1032K;ENSP00000443646:E933K	ENSP00000343535:E1032K	E	-	1	0	USP7	8896159	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.345000	0.79337	2.577000	0.86979	0.455000	0.32223	GAG	-	USP7	-	NULL		0.577	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	HGNC	protein_coding	OTTHUMT00000434268.2	0	0	0	23	23	34	0.00	0.00	C			8988658	-1	10	5	59	51	tier1	no_errors	ENST00000344836	ensembl	human	known	74_37	missense	14.49	8.93	SNP	1.000	T	10	59
DNM1P51	0	genome.wustl.edu	37	15	84954198	84954212	+	RNA	DEL	ATGGGCATGCTGACG	ATGGGCATGCTGACG	-	rs573074632|rs190461010|rs555718846|rs541998372|rs201174466|rs200218409|rs141150768	byFrequency	TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	ATGGGCATGCTGACG	ATGGGCATGCTGACG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr15:84954198_84954212delATGGGCATGCTGACG	ENST00000558801.1	-	0	7553_7567									DNM1 pseudogene 51																		GGGCAGGGGCATGGGCATGCTGACGGTGGTCCTGG	0.651													ENSG00000235370		581	0.116014	0.0106	0.1441	5008	,	,		19911	0.1071		0.2306	False		,,,				2504	0.1299																0																																												0						15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84954198_84954212delATGGGCATGCTGACG				R	DEL	-	NULL	ENST00000558801.1	37	NULL		15																																																																																				DNM1P51	-	-		0.651	DNM1P51-001	KNOWN	basic	processed_transcript	DNM1P51	HGNC	pseudogene	OTTHUMT00000471721.1	0	0	0	1	1	1	0.00	0.00	ATGGGCATGCTGACG			84954212	-1	0	0	3	3	tier1	no_errors	ENST00000558801	ensembl	human	known	74_37	rna	0.00	0.00	DEL	1.000:0.996:0.997:0.997:0.990:0.993:1.000:1.000:1.000:0.991:0.992:0.989:0.996:0.997:1.000	-	0	3
AGAP1	116987	genome.wustl.edu	37	2	236480576	236480577	+	Intron	INS	-	-	TGTGTGTGTG	rs141898525|rs371400174	byFrequency	TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr2:236480576_236480577insTGTGTGTGTG	ENST00000304032.8	+	1	743				AGAP1_ENST00000409457.1_Intron|AGAP1_ENST00000336665.5_Intron|AC012305.1_ENST00000408777.1_RNA	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1						protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TGCCCACACTTtgtgtgtgtgt	0.441													ENSG00000221704																																					0																																										SO:0001627	intron_variant	0				AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.163+77083->TGTGTGTGTG	2.37:g.236480577_236480586dupTGTGTGTGTG			B2RTX7|Q541S5|Q6P9D7|Q9NV93	R	INS	-	NULL	ENST00000304032.8	37	NULL	CCDS33408.1	2																																																																																				AC012305.1	-	-		0.441	AGAP1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000221704	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000257076.2	0	0	0	0	0	0	0.00	0.00	-	NM_014914		236480577	+1	0	0	0	0	tier1	no_errors	ENST00000408777	ensembl	human	novel	74_37	rna	0.00	0.00	INS	0.083:0.055	TGTGTGTGTG	0	0
LOR	4014	genome.wustl.edu	37	1	153233991	153233992	+	In_Frame_Ins	INS	-	-	CTCTGGCGGCGG	rs11272549|rs547333583|rs561634896	byFrequency	TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr1:153233991_153233992insCTCTGGCGGCGG	ENST00000368742.3	+	2	623_624	c.566_567insCTCTGGCGGCGG	c.(565-570)tactct>taCTCTGGCGGCGGctct	p.194_195insGGGS		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	194					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggcg	0.743													ENSG00000203782		3247	0.648363	0.6664	0.7954	5008	,	,		5032	0.4563		0.7147	False		,,,				2504	0.6493																0										178,190		86,6,92						-7.1	0.0		dbSNP_120	1	749,435		350,49,193	no	coding	LOR	NM_000427.2		436,55,285	A1A1,A1R,RR		36.7399,48.3696,40.2706				927,625				SO:0001652	inframe_insertion	0				M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.567_578dupCTCTGGCGGCGG	1.37:g.153233991_153233992insCTCTGGCGGCGG	ENSP00000357731:p.Gly191_Ser194dup		Q5T869|Q5XKF8	In_Frame_Ins	INS	NULL	p.193in_frame_insGSGG	ENST00000368742.3	37	c.566_567	CCDS30870.1	1																																																																																				LOR	-	NULL		0.743	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	HGNC	protein_coding	OTTHUMT00000039107.1	0	0	0	2	2	2	0.00	0.00	-	NM_000427		153233992	+1	0	0	3	3	tier1	no_errors	ENST00000368742	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.014:0.200	CTCTGGCGGCGG	0	3
SEPT5	5413	genome.wustl.edu	37	22	19706405	19706474	+	Intron	DEL	GGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCA	GGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCA	-	rs114221790|rs540232044|rs145126962	byFrequency	TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	GGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCA	GGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr22:19706405_19706474delGGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCA	ENST00000455784.2	+	3	179				SEPT5_ENST00000406395.1_Intron|SEPT5_ENST00000490204.1_3'UTR|SEPT5_ENST00000438754.2_Intron|SEPT5_ENST00000383045.3_Intron	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5						cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					CTCGGCATGGGGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCAGGTCCGCGGC	0.752													ENSG00000184702																																					0																																										SO:0001627	intron_variant	0				Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.55-651GGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCA>-	22.37:g.19706405_19706474delGGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCA			O15251|Q96MY5	Splice_Site	DEL	-	NULL	ENST00000455784.2	37	c.NULL	CCDS13764.1	22																																																																																				SEPT5	-	-		0.752	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT5	HGNC	protein_coding	OTTHUMT00000317937.1	0	0	0	2	2	2	0.00	0.00	GGTCCCCGTCCCCGCGCGCCACGGCCCGCCAGCGCCTAGGCTCAGCCCTTCCCTCCGCAGCGGCCTCGCA	NM_002688		19706474	+1	0	0	0	0	tier1	no_errors	ENST00000490204	ensembl	human	putative	74_37	splice_site_del	0.00	0.00	DEL	0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.001:0.000:0.228:0.234:0.241:0.322:0.327:0.699:0.694:0.703:0.739:0.769:0.806:0.810:0.791:0.694:0.664:0.665:0.662:0.840:0.858:0.920:0.932:0.929:0.905:0.868:0.689:0.525:0.473:0.458:0.371:0.369:0.365:0.319:0.270:0.205:0.118:0.062:0.038:0.026:0.037:0.153:0.410:0.429:0.415:0.344:0.328:0.109:0.017:0.008:0.013:0.016:0.014:0.010:0.028:0.026:0.027:0.003:0.000:0.000	-	0	0
LOC642361	642361	genome.wustl.edu	37	10	81586763	81586764	+	lincRNA	INS	-	-	TCGCCTCGCC	rs376141844|rs564141310|rs57348880	byFrequency	TCGA-DX-AB2F-01A-11D-A387-09	TCGA-DX-AB2F-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1dbf015e-3809-436e-b7c4-d2b40266bd0f	b9ce481f-768d-40b6-aa4a-b571e5069c27	g.chr10:81586763_81586764insTCGCCTCGCC	ENST00000605920.1	+	0	1106_1107				RP11-773D16.1_ENST00000495430.1_lincRNA	NR_029407.1|NR_029408.1																						CCTCGCTCACGTCGCCTCGCCT	0.708													ENSG00000272447		3577	0.714257	0.5431	0.732	5008	,	,		8252	0.8155		0.8698	False		,,,				2504	0.6687																0																																												0																																10.37:g.81586764_81586773dupTCGCCTCGCC				R	INS	-	NULL	ENST00000605920.1	37	NULL		10																																																																																				RP11-182L21.6	-	-		0.708	RP11-182L21.6-001	KNOWN	basic	lincRNA	LOC642361	Clone_based_vega_gene	lincRNA	OTTHUMT00000470940.1	0	0	0	2	2	2	0.00	0.00	-			81586764	+1	2	2	6	6	tier1	no_errors	ENST00000605920	ensembl	human	known	74_37	rna	25.00	25.00	INS	0.302:0.319	TCGCCTCGCC	2	6
