#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
HCN1	348980	genome.wustl.edu	37	5	45695937	45695937	+	Missense_Mutation	SNP	G	G	A	rs370113959		TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr5:45695937G>A	ENST00000303230.4	-	1	316	c.259C>T	c.(259-261)Ccc>Tcc	p.P87S		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	87					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TGCCGCCGGGGCCCCTCGGCG	0.706													ENSG00000164588																																					0								G	SER/PRO	1,4283		0,1,2141	14.0	17.0	16.0		259	2.4	1.0	5		16	0,8404		0,0,4202	no	missense	HCN1	NM_021072.3	74	0,1,6343	AA,AG,GG		0.0,0.0233,0.0079	benign	87/891	45695937	1,12687	2142	4202	6344	SO:0001583	missense	0			-	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.259C>T	5.37:g.45695937G>A	ENSP00000307342:p.Pro87Ser			Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.P87S	ENST00000303230.4	37	c.259	CCDS3952.1	5	.	.	.	.	.	.	.	.	.	.	G	6.641	0.486775	0.12641	2.33E-4	0.0	ENSG00000164588	ENST00000303230	D	0.97161	-4.27	4.18	2.36	0.29203	.	0.127977	0.32386	N	0.006162	D	0.89801	0.6820	N	0.12182	0.205	0.34515	D	0.707578	B	0.02656	0.0	B	0.01281	0.0	T	0.82831	-0.0263	10	0.08381	T	0.77	.	8.8148	0.34989	0.0848:0.1513:0.7639:0.0	.	87	O60741	HCN1_HUMAN	S	87	ENSP00000307342:P87S	ENSP00000307342:P87S	P	-	1	0	HCN1	45731694	0.981000	0.34729	0.996000	0.52242	0.521000	0.34408	1.913000	0.39956	0.382000	0.24878	-0.379000	0.06801	CCC	-	HCN1	-	NULL		0.706	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	0	0	0	37	37	31	0.00	0.00	G	NM_021072		45695937	-1	12	7	25	13	tier1	no_errors	ENST00000303230	ensembl	human	known	74_37	missense	31.58	35.00	SNP	1.000	A	12	25
ELL2	22936	genome.wustl.edu	37	5	95236750	95236750	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr5:95236750G>A	ENST00000237853.4	-	6	1125	c.776C>T	c.(775-777)aCc>aTc	p.T259I	ELL2_ENST00000431061.2_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	259					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		ATCCTTTAAGGTATATGAGAG	0.378													ENSG00000118985																																					0													70.0	73.0	72.0					5																	95236750		2202	4299	6501	SO:0001583	missense	0			-	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.776C>T	5.37:g.95236750G>A	ENSP00000237853:p.Thr259Ile		B4DNK7	Missense_Mutation	SNP	pfam_R_pol_II_elong_fac_ELL,pfam_Occludin_Rpol2_elong_fac_ELL	p.T259I	ENST00000237853.4	37	c.776	CCDS4080.1	5	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493790	0.84962	.	.	ENSG00000118985	ENST00000237853;ENST00000513343	T;T	0.32753	1.44;1.44	5.52	5.52	0.82312	.	0.098954	0.64402	D	0.000001	T	0.55862	0.1947	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	T	0.57388	-0.7820	10	0.72032	D	0.01	-5.0417	19.0238	0.92925	0.0:0.0:1.0:0.0	.	259	O00472	ELL2_HUMAN	I	259;77	ENSP00000237853:T259I;ENSP00000423915:T77I	ENSP00000237853:T259I	T	-	2	0	ELL2	95262506	1.000000	0.71417	0.989000	0.46669	0.989000	0.77384	3.870000	0.56070	2.580000	0.87095	0.561000	0.74099	ACC	-	ELL2	-	pfam_R_pol_II_elong_fac_ELL		0.378	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL2	HGNC	protein_coding	OTTHUMT00000242846.1	0	0	0	43	43	94	0.00	0.00	G	NM_012081		95236750	-1	25	31	29	57	tier1	no_errors	ENST00000237853	ensembl	human	known	74_37	missense	46.30	34.83	SNP	1.000	A	25	29
KIAA1217	56243	genome.wustl.edu	37	10	24832973	24832973	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr10:24832973G>A	ENST00000376454.3	+	19	4804	c.4774G>A	c.(4774-4776)Gga>Aga	p.G1592R	KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.G1275R|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000376452.3_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1592					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CATTCGCACCGGAACTAAAAC	0.468													ENSG00000120549																																					0													101.0	103.0	102.0					10																	24832973		2203	4300	6503	SO:0001583	missense	0			-	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4774G>A	10.37:g.24832973G>A	ENSP00000365637:p.Gly1592Arg		A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	pfam_AIP3_C	p.G1592R	ENST00000376454.3	37	c.4774	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835350	0.71373	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000450158;ENST00000376451	T;T	0.67865	0.16;-0.29	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.81418	0.4818	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82542	-0.0405	10	0.62326	D	0.03	.	19.0404	0.92997	0.0:0.0:1.0:0.0	.	1275;1275;1592	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	R	1275;1592;1275;1275	ENSP00000365637:G1592R;ENSP00000365634:G1275R	ENSP00000365634:G1275R	G	+	1	0	KIAA1217	24872979	1.000000	0.71417	0.844000	0.33320	0.540000	0.34992	9.407000	0.97325	2.495000	0.84180	0.561000	0.74099	GGA	-	KIAA1217	-	NULL		0.468	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	0	0	0	66	66	115	0.00	0.00	G	NM_019590		24832973	+1	41	52	74	100	tier1	no_errors	ENST00000376454	ensembl	human	known	74_37	missense	35.65	34.21	SNP	1.000	A	41	74
TCHHL1	126637	genome.wustl.edu	37	1	152057988	152057988	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr1:152057988G>T	ENST00000368806.1	-	3	2234	c.2170C>A	c.(2170-2172)Cta>Ata	p.L724I		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	724							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TCCTCATCTAGACTTTCTAAC	0.448													ENSG00000182898																																					0													157.0	162.0	160.0					1																	152057988		2203	4300	6503	SO:0001583	missense	0			-		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.2170C>A	1.37:g.152057988G>T	ENSP00000357796:p.Leu724Ile		B2RPK8|Q5VTJ9	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.L724I	ENST00000368806.1	37	c.2170	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	8.640	0.895752	0.17686	.	.	ENSG00000182898	ENST00000368806	T	0.25912	1.77	4.23	1.18	0.20946	.	0.839836	0.09491	N	0.794869	T	0.07098	0.0180	L	0.43152	1.355	0.09310	N	1	B	0.23591	0.088	B	0.21151	0.033	T	0.38607	-0.9653	10	0.37606	T	0.19	0.1945	4.845	0.13509	0.1038:0.0:0.5224:0.3738	.	724	Q5QJ38	TCHL1_HUMAN	I	724	ENSP00000357796:L724I	ENSP00000357796:L724I	L	-	1	2	TCHHL1	150324612	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.914000	0.28624	0.054000	0.16065	-0.899000	0.02877	CTA	-	TCHHL1	-	NULL		0.448	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2	0	0	0	33	33	112	0.00	0.00	G	XM_060104		152057988	-1	24	42	28	102	tier1	no_errors	ENST00000368806	ensembl	human	known	74_37	missense	46.15	29.17	SNP	0.000	T	24	28
FBXO5	26271	genome.wustl.edu	37	6	153292351	153292351	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr6:153292351T>C	ENST00000229758.3	-	5	1349	c.1291A>G	c.(1291-1293)Ata>Gta	p.I431V	FBXO5_ENST00000367241.3_Missense_Mutation_p.I385V|FBXO5_ENST00000477822.1_5'UTR	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	431					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		AGGGGACCTATTTTACAACTG	0.353													ENSG00000112029																									NSCLC(121;372 1757 17721 17977 29669)												0													121.0	115.0	117.0					6																	153292351		2203	4300	6503	SO:0001583	missense	0			-	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.1291A>G	6.37:g.153292351T>C	ENSP00000229758:p.Ile431Val		B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom	p.I431V	ENST00000229758.3	37	c.1291	CCDS5242.1	6	.	.	.	.	.	.	.	.	.	.	T	3.044	-0.196955	0.06259	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.28454	1.61;1.61	5.57	2.76	0.32466	.	1.077680	0.06894	N	0.804738	T	0.02649	0.0080	N	0.02539	-0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38265	-0.9669	10	0.02654	T	1	0.0496	6.1694	0.20408	0.0:0.2257:0.1425:0.6318	.	431	Q9UKT4	FBX5_HUMAN	V	431;385	ENSP00000229758:I431V;ENSP00000356210:I385V	ENSP00000229758:I431V	I	-	1	0	FBXO5	153334044	0.000000	0.05858	0.978000	0.43139	0.954000	0.61252	-0.614000	0.05604	0.905000	0.36596	0.533000	0.62120	ATA	-	FBXO5	-	NULL		0.353	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	HGNC	protein_coding	OTTHUMT00000042757.1	0	0	0	83	83	92	0.00	0.00	T			153292351	-1	33	38	317	236	tier1	no_errors	ENST00000229758	ensembl	human	known	74_37	missense	9.43	13.82	SNP	0.304	C	33	317
PEG3	5178	genome.wustl.edu	37	19	57336013	57336013	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr19:57336013G>A	ENST00000326441.9	-	4	374	c.11C>T	c.(10-12)cCa>cTa	p.P4L	PEG3_ENST00000594706.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.P4L|PEG3_ENST00000593695.1_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Intron|ZIM2_ENST00000593931.1_5'Flank|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	4					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAAGTGCTTTGGAGGCAGCAT	0.488													ENSG00000198300																																					0													51.0	57.0	55.0					19																	57336013		2200	4299	6499	SO:0001583	missense	0			-	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.11C>T	19.37:g.57336013G>A	ENSP00000326581:p.Pro4Leu		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.P4L	ENST00000326441.9	37	c.11	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	G	18.19	3.568903	0.65765	.	.	ENSG00000198300	ENST00000326441;ENST00000423103;ENST00000292074	T;T	0.02258	4.37;4.37	4.66	1.33	0.21861	.	0.408245	0.18199	N	0.148576	T	0.01661	0.0053	N	0.24115	0.695	.	.	.	B	0.15719	0.014	B	0.12156	0.007	T	0.36601	-0.9741	8	.	.	.	-0.1795	7.1053	0.25360	0.2979:0.0:0.7021:0.0	.	4	Q9GZU2	PEG3_HUMAN	L	4	ENSP00000326581:P4L;ENSP00000403051:P4L	.	P	-	2	0	ZIM2	62027825	0.596000	0.26866	0.892000	0.35008	0.986000	0.74619	0.743000	0.26231	0.273000	0.22049	0.655000	0.94253	CCA	-	PEG3	-	NULL		0.488	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	0	0	0	36	36	141	0.00	0.00	G			57336013	-1	12	59	43	101	tier1	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	21.82	36.88	SNP	0.932	A	12	43
PTCHD2	57540	genome.wustl.edu	37	1	11595642	11595642	+	Missense_Mutation	SNP	G	G	A	rs200620988	byFrequency	TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr1:11595642G>A	ENST00000294484.6	+	20	3895	c.3757G>A	c.(3757-3759)Gtc>Atc	p.V1253I	PTCHD2_ENST00000389575.3_Missense_Mutation_p.V1253I|PTCHD2_ENST00000304391.6_Missense_Mutation_p.R139H	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1253					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGATTACTGCGTCCACCTGGT	0.647													ENSG00000204624	G|||	3	0.000599042	0.0	0.0	5008	,	,		16876	0.0		0.003	False		,,,				2504	0.0																0								G	ILE/VAL	0,4272		0,0,2136	66.0	79.0	75.0		3757	4.6	1.0	1		75	1,8467		0,1,4233	no	missense	PTCHD2	NM_020780.1	29	0,1,6369	AA,AG,GG		0.0118,0.0,0.0078	benign	1253/1393	11595642	1,12739	2136	4234	6370	SO:0001583	missense	0			-	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3757G>A	1.37:g.11595642G>A	ENSP00000294484:p.Val1253Ile		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.V1253I	ENST00000294484.6	37	c.3757	CCDS41247.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.33|17.33	3.361984|3.361984	0.61403|0.61403	0.0|0.0	1.18E-4|1.18E-4	ENSG00000204624|ENSG00000204624	ENST00000304391|ENST00000294484;ENST00000389575	.|D;D	.|0.89681	.|-2.55;-2.55	5.55|5.55	4.64|4.64	0.57946|0.57946	.|Membrane transport protein, MMPL type (1);	.|0.190105	.|0.35067	.|N	.|0.003476	T|T	0.82098|0.82098	0.4963|0.4963	L|L	0.31476|0.31476	0.935|0.935	0.41867|0.41867	D|D	0.990257|0.990257	.|B	.|0.25105	.|0.118	.|B	.|0.21360	.|0.034	T|T	0.77627|0.77627	-0.2517|-0.2517	6|10	0.87932|0.31617	D|T	0|0.26	-37.0059|-37.0059	13.2863|13.2863	0.60245|0.60245	0.0762:0.0:0.9238:0.0|0.0762:0.0:0.9238:0.0	.|.	.|1253	.|Q9P2K9	.|PTHD2_HUMAN	H|I	139|1253	.|ENSP00000294484:V1253I;ENSP00000374226:V1253I	ENSP00000303400:R139H|ENSP00000294484:V1253I	R|V	+|+	2|1	0|0	PTCHD2|PTCHD2	11518229|11518229	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.791000|0.791000	0.44710|0.44710	4.877000|4.877000	0.63086|0.63086	1.343000|1.343000	0.45638|0.45638	0.655000|0.655000	0.94253|0.94253	CGT|GTC	rs200620988	PTCHD2	-	pfam_Patched,pfam_MMPL_dom		0.647	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	0	0	0	87	87	46	0.00	0.00	G	XM_052561		11595642	+1	31	11	57	19	tier1	no_errors	ENST00000294484	ensembl	human	known	74_37	missense	35.23	36.67	SNP	1.000	A	31	57
KHNYN	23351	genome.wustl.edu	37	14	24911572	24911572	+	IGR	SNP	C	C	T			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr14:24911572C>T	ENST00000251343.5	+	0	6225				SDR39U1_ENST00000553930.1_5'UTR|SDR39U1_ENST00000399395.3_Missense_Mutation_p.G35R|SDR39U1_ENST00000554698.1_5'UTR|SDR39U1_ENST00000399390.1_5'Flank|SDR39U1_ENST00000555561.1_5'Flank|SDR39U1_ENST00000555365.1_5'UTR|SDR39U1_ENST00000538105.2_5'UTR			O15037	KHNYN_HUMAN	KH and NYN domain containing								RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						CGGCCGGGCCCGGGCTTTCGG	0.642													ENSG00000100445																																					0													20.0	23.0	22.0					14																	24911572		1912	4113	6025	SO:0001628	intergenic_variant	0			-	AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037			14.37:g.24911572C>T			Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	pfam_DUF1731_C,pfam_Epimerase_deHydtase,tigrfam_Sugar_nucleotide_Epase_put	p.G35R	ENST00000251343.5	37	c.103	CCDS32058.1	14	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064699	0.55432	.	.	ENSG00000100445	ENST00000399395;ENST00000336353;ENST00000556249	D	0.92397	-3.03	5.54	4.66	0.58398	.	0.153604	0.64402	D	0.000019	D	0.90359	0.6983	N	0.12887	0.27	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	D	0.89881	0.4030	10	0.36615	T	0.2	-11.0864	12.1474	0.54031	0.0:0.9183:0.0:0.0817	.	35	Q9NRG7-2	.	R	35;61;26	ENSP00000382327:G35R	ENSP00000336854:G61R	G	-	1	0	SDR39U1	23981412	0.993000	0.37304	0.036000	0.18154	0.336000	0.28762	4.603000	0.61105	1.590000	0.49995	0.650000	0.86243	GGG	-	SDR39U1	-	pfam_Epimerase_deHydtase,tigrfam_Sugar_nucleotide_Epase_put		0.642	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SDR39U1	HGNC	protein_coding	OTTHUMT00000412928.1	0	0	0	74	74	71	0.00	0.00	C			24911572	-1	29	21	73	36	tier1	no_errors	ENST00000399395	ensembl	human	known	74_37	missense	28.43	36.84	SNP	0.697	T	29	73
PRKCB	5579	genome.wustl.edu	37	16	24192129	24192129	+	Silent	SNP	C	C	T			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr16:24192129C>T	ENST00000321728.7	+	13	1588	c.1413C>T	c.(1411-1413)aaC>aaT	p.N471N	PRKCB_ENST00000303531.7_Silent_p.N471N	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	471	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	AACTTGACAACGTGATGCTCG	0.418													ENSG00000166501																																					0													201.0	176.0	184.0					16																	24192129		2197	4300	6497	SO:0001819	synonymous_variant	0			-	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1413C>T	16.37:g.24192129C>T			C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.N471	ENST00000321728.7	37	c.1413	CCDS10618.1	16																																																																																			-	PRKCB	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_dom		0.418	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	0	0	0	56	56	109	0.00	0.00	C	NM_212535		24192129	+1	30	27	67	74	tier1	no_errors	ENST00000303531	ensembl	human	known	74_37	silent	30.93	26.73	SNP	0.577	T	30	67
DNAH9	1770	genome.wustl.edu	37	17	11725755	11725755	+	Splice_Site	SNP	G	G	T			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr17:11725755G>T	ENST00000262442.4	+	47	8919	c.8851G>T	c.(8851-8853)Gtg>Ttg	p.V2951L	DNAH9_ENST00000454412.2_Splice_Site_p.V2951L	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2951	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GACTTCTCAGGTGACTCTCTG	0.537													ENSG00000007174																																					0													115.0	106.0	109.0					17																	11725755		2203	4300	6503	SO:0001630	splice_region_variant	0			-	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8851-1G>T	17.37:g.11725755G>T			A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.V2951L	ENST00000262442.4	37	c.8851	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135627	0.56828	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.39592	1.07;1.07	3.68	2.71	0.32032	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.64402	U	0.000005	T	0.48114	0.1482	M	0.78456	2.415	0.80722	D	1	B	0.22983	0.078	B	0.36766	0.232	T	0.44726	-0.9309	9	.	.	.	.	11.2998	0.49298	0.0908:0.0:0.9092:0.0	.	2951	Q9NYC9	DYH9_HUMAN	L	2951;2951;1533	ENSP00000262442:V2951L;ENSP00000414874:V2951L	.	V	+	1	0	DNAH9	11666480	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.142000	0.71750	0.893000	0.36288	0.563000	0.77884	GTG	-	DH9	-	superfamily_P-loop_NTPase		0.537	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH9	HGNC	protein_coding	OTTHUMT00000252756.2	0	0	0	39	39	95	0.00	0.00	G	NM_001372	Missense_Mutation	11725755	+1	22	35	36	70	tier1	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	37.93	33.33	SNP	1.000	T	22	36
MPO	4353	genome.wustl.edu	37	17	56348017	56348017	+	Nonstop_Mutation	SNP	C	C	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr17:56348017C>A	ENST00000225275.3	-	12	2414	c.2238G>T	c.(2236-2238)taG>taT	p.*746Y	MPO_ENST00000340482.3_Nonstop_Mutation_p.*778Y	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	0					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	TACCTGGCCTCTAGGAGGCTT	0.552													ENSG00000005381																																					0													58.0	53.0	55.0					17																	56348017		2202	4298	6500	SO:0001578	stop_lost	0			-		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.2238G>T	17.37:g.56348017C>A			A1L4B8|Q14862|Q4PJH5|Q9UCL7	Nonstop_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.*778Y	ENST00000225275.3	37	c.2334	CCDS11604.1	17	.	.	.	.	.	.	.	.	.	.	C	9.060	0.994172	0.19043	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	.	.	.	5.46	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6169	0.51094	0.0:0.9185:0.0:0.0815	.	.	.	.	Y	778;746	.	.	X	-	3	2	MPO	53703016	0.002000	0.14202	0.962000	0.40283	0.018000	0.09664	0.760000	0.26475	1.434000	0.47414	0.655000	0.94253	TAG	-	MPO	-	NULL		0.552	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	0	0	0	26	26	88	0.00	0.00	C			56348017	-1	13	43	22	71	tier1	no_errors	ENST00000340482	ensembl	human	known	74_37	nonstop	37.14	37.72	SNP	0.724	A	13	22
GPRASP2	114928	genome.wustl.edu	37	X	101970023	101970023	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chrX:101970023A>T	ENST00000535209.1	+	4	1057	c.226A>T	c.(226-228)Act>Tct	p.T76S	GPRASP2_ENST00000543253.1_Missense_Mutation_p.T76S|GPRASP2_ENST00000332262.5_Missense_Mutation_p.T76S			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	76						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AAGGCCCAAAACTGAGGTCCA	0.592													ENSG00000158301																																					0													82.0	78.0	80.0					X																	101970023		2203	4300	6503	SO:0001583	missense	0			-	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.226A>T	X.37:g.101970023A>T	ENSP00000437394:p.Thr76Ser		D3DXA0|Q8NAB4	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.T76S	ENST00000535209.1	37	c.226	CCDS14501.1	X	.	.	.	.	.	.	.	.	.	.	A	8.860	0.946750	0.18356	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.07327	3.2;3.2;3.2	4.58	3.3	0.37823	.	0.360661	0.20220	N	0.096717	T	0.03095	0.0091	N	0.19112	0.55	0.22081	N	0.999374	P	0.43750	0.816	B	0.31442	0.13	T	0.32025	-0.9922	10	0.12430	T	0.62	.	3.5566	0.07866	0.6508:0.2293:0.1199:0.0	.	76	Q96D09	GASP2_HUMAN	S	76	ENSP00000437872:T76S;ENSP00000437394:T76S;ENSP00000339057:T76S	ENSP00000339057:T76S	T	+	1	0	GPRASP2	101856679	0.000000	0.05858	0.948000	0.38648	0.584000	0.36387	0.354000	0.20146	1.766000	0.52107	0.486000	0.48141	ACT	-	GPRASP2	-	NULL		0.592	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	HGNC	protein_coding	OTTHUMT00000057626.2	0	0	0	12	12	73	0.00	0.00	A	NM_138437		101970023	+1	19	65	8	28	tier1	no_errors	ENST00000332262	ensembl	human	known	74_37	missense	70.37	69.89	SNP	0.894	T	19	8
FOXS1	2307	genome.wustl.edu	37	20	30432800	30432800	+	Silent	SNP	A	A	G	rs369259178		TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr20:30432800A>G	ENST00000375978.3	-	1	620	c.546T>C	c.(544-546)acT>acC	p.T182T		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	182					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						GCCTGCCATCAGTGGTTGCTG	0.637													ENSG00000179772																																					0													45.0	42.0	43.0					20																	30432800		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.546T>C	20.37:g.30432800A>G			Q96D28	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.T182	ENST00000375978.3	37	c.546	CCDS13192.1	20																																																																																			-	FOXS1	-	NULL		0.637	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXS1	HGNC	protein_coding	OTTHUMT00000078560.2	0	0	0	51	51	41	0.00	0.00	A	NM_004118		30432800	-1	15	10	45	36	tier1	no_errors	ENST00000375978	ensembl	human	known	74_37	silent	25.00	21.74	SNP	0.527	G	15	45
THBS3	7059	genome.wustl.edu	37	1	155176138	155176138	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr1:155176138G>A	ENST00000368378.3	-	2	159	c.139C>T	c.(139-141)Cgg>Tgg	p.R47W	MTX1_ENST00000368376.3_5'Flank|THBS3_ENST00000457183.2_Missense_Mutation_p.R47W|RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000430312.1_RNA|MTX1_ENST00000316721.4_5'Flank|MTX1_ENST00000609421.1_5'Flank|THBS3_ENST00000541990.1_5'UTR|RP11-263K19.4_ENST00000422665.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	47	Laminin G-like.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AAGGCTGTCCGGATCTTCTCT	0.557													ENSG00000169231																																					0													112.0	101.0	105.0					1																	155176138		2203	4300	6503	SO:0001583	missense	0			-	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.139C>T	1.37:g.155176138G>A	ENSP00000357362:p.Arg47Trp		B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.R47W	ENST00000368378.3	37	c.139	CCDS1099.1	1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843422	0.91197	.	.	ENSG00000169231	ENST00000368378;ENST00000457183;ENST00000428962	T;D;T	0.82255	-1.46;-1.59;-1.15	5.63	5.63	0.86233	Laminin G, thrombospondin-type, N-terminal (1);	0.139644	0.51477	D	0.000094	T	0.81163	0.4765	L	0.29908	0.895	0.29065	N	0.883681	D;D;D;D;D	0.89917	0.993;1.0;0.997;0.997;0.997	P;D;P;P;P	0.64687	0.639;0.928;0.776;0.776;0.613	T	0.76231	-0.3035	10	0.37606	T	0.19	-14.0698	17.5362	0.87832	0.0:0.0:1.0:0.0	.	47;47;47;47;47	B4DQ20;B4DQH6;Q53FK6;Q2HIZ0;P49746	.;.;.;.;TSP3_HUMAN	W	47	ENSP00000357362:R47W;ENSP00000392207:R47W;ENSP00000404040:R47W	ENSP00000357362:R47W	R	-	1	2	THBS3	153442762	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.208000	0.51114	2.815000	0.96918	0.561000	0.74099	CGG	-	THBS3	-	smart_Laminin_G		0.557	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS3	HGNC	protein_coding	OTTHUMT00000086856.1	0	0	0	25	25	90	0.00	0.00	G	NM_007112		155176138	-1	17	20	25	55	tier1	no_errors	ENST00000368378	ensembl	human	known	74_37	missense	40.48	26.32	SNP	1.000	A	17	25
DUSP27	92235	genome.wustl.edu	37	1	167097263	167097263	+	Silent	SNP	G	G	T	rs201251775		TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr1:167097263G>T	ENST00000361200.2	+	6	3061	c.2895G>T	c.(2893-2895)tcG>tcT	p.S965S	DUSP27_ENST00000443333.1_Silent_p.S965S|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Silent_p.S965S			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	965	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACACCAGATCGTCCCTGCTCA	0.498													ENSG00000198842																																					0													63.0	57.0	59.0					1																	167097263		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2895G>T	1.37:g.167097263G>T			A0AUM4|Q9C074	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.S965	ENST00000361200.2	37	c.2895	CCDS30932.1	1																																																																																			-	DUSP27	-	NULL		0.498	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	0	0	0	45	45	129	0.00	0.00	G	NM_001080426		167097263	+1	24	35	50	96	tier1	no_errors	ENST00000271385	ensembl	human	known	74_37	silent	32.43	26.72	SNP	0.003	T	24	50
GRIN2A	2903	genome.wustl.edu	37	16	10273944	10273944	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr16:10273944C>T	ENST00000396573.2	-	3	634	c.325G>A	c.(325-327)Gta>Ata	p.V109I	GRIN2A_ENST00000330684.3_Missense_Mutation_p.V109I|GRIN2A_ENST00000562109.1_Missense_Mutation_p.V109I|GRIN2A_ENST00000404927.2_Missense_Mutation_p.V109I|GRIN2A_ENST00000396575.2_Missense_Mutation_p.V109I	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	109					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ATCTGGGCTACGGCCTCCTGG	0.612													ENSG00000183454																																					0													85.0	81.0	82.0					16																	10273944		2197	4300	6497	SO:0001583	missense	0			-		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.325G>A	16.37:g.10273944C>T	ENSP00000379818:p.Val109Ile		O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V109I	ENST00000396573.2	37	c.325	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	C	7.439	0.640383	0.14386	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	4.54	3.46	0.39613	Extracellular ligand-binding receptor (1);	0.152333	0.38897	N	0.001532	T	0.67906	0.2943	N	0.04116	-0.275	0.80722	D	1	B;B;B	0.17268	0.021;0.002;0.001	B;B;B	0.17433	0.018;0.004;0.002	T	0.61352	-0.7080	9	.	.	.	.	6.8525	0.24022	0.0:0.747:0.0:0.253	.	109;109;109	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	I	109	ENSP00000379818:V109I;ENSP00000385872:V109I;ENSP00000332549:V109I;ENSP00000379820:V109I	.	V	-	1	0	GRIN2A	10181445	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.091000	0.57700	2.088000	0.63022	0.561000	0.74099	GTA	-	GRIN2A	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.612	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	0	0	0	49	49	83	0.00	0.00	C			10273944	-1	29	29	55	48	tier1	no_errors	ENST00000330684	ensembl	human	known	74_37	missense	34.52	37.66	SNP	1.000	T	29	55
SELP	6403	genome.wustl.edu	37	1	169586354	169586354	+	Silent	SNP	G	G	A	rs374152128		TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr1:169586354G>A	ENST00000263686.6	-	3	430	c.393C>T	c.(391-393)tgC>tgT	p.C131C	SELP_ENST00000367793.2_Silent_p.C131C|SELP_ENST00000367788.2_Silent_p.C131C|SELP_ENST00000367791.2_Silent_p.C131C|SELP_ENST00000458599.2_Silent_p.C131C|SELP_ENST00000367792.2_Silent_p.C131C|SELP_ENST00000367794.2_Silent_p.C131C|SELP_ENST00000367786.2_Silent_p.C131C	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	131	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.C131C(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	ATATCTCCACGCAGTCCTCGT	0.483													ENSG00000174175	G|||	1	0.000199681	0.0	0.0	5008	,	,		17112	0.001		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	large_intestine(1)						G		1,4405	2.1+/-5.4	0,1,2202	255.0	233.0	240.0		393	-8.3	0.9	1		240	0,8600		0,0,4300	no	coding-synonymous	SELP	NM_003005.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		131/831	169586354	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.393C>T	1.37:g.169586354G>A			Q5R344|Q8IVD1	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.C131	ENST00000263686.6	37	c.393	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	G	9.885	1.202544	0.22121	2.27E-4	0.0	ENSG00000174175	ENST00000446728	.	.	.	5.79	-8.26	0.01021	.	.	.	.	.	T	0.50446	0.1616	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67409	-0.5678	4	.	.	.	-19.8016	17.3003	0.87181	0.8117:0.0:0.1883:0.0	.	.	.	.	C	131	.	.	R	-	1	0	SELP	167852978	0.000000	0.05858	0.887000	0.34795	0.867000	0.49689	-1.695000	0.01913	-1.454000	0.01926	-0.251000	0.11542	CGT	-	SELP	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.483	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4	0	0	0	76	76	99	0.00	0.00	G	NM_003005		169586354	-1	33	47	70	101	tier1	no_errors	ENST00000263686	ensembl	human	known	74_37	silent	32.04	31.76	SNP	0.801	A	33	70
CTBP2	1488	genome.wustl.edu	37	10	126715438	126715438	+	Intron	SNP	C	C	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr10:126715438C>A	ENST00000337195.5	-	3	458				CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000309035.6_Silent_p.L297L|CTBP2_ENST00000411419.2_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CCTCCGCCCGCAGAAAGGCCA	0.632													ENSG00000175029																																					0													45.0	46.0	45.0					10																	126715438		2203	4300	6503	SO:0001627	intron_variant	0			-	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12127G>T	10.37:g.126715438C>A			A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	pfam_D-isomer_2_OHA_DH_D-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.L297	ENST00000337195.5	37	c.891	CCDS7643.1	10																																																																																			-	CTBP2	-	NULL		0.632	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	HGNC	protein_coding	OTTHUMT00000050900.3	0	0	0	19	19	42	0.00	0.00	C	NM_001083914		126715438	-1	7	15	8	24	tier1	no_errors	ENST00000309035	ensembl	human	known	74_37	silent	46.67	38.46	SNP	1.000	A	7	8
KIAA1456	57604	genome.wustl.edu	37	8	12879396	12879396	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr8:12879396T>C	ENST00000524591.2	+	5	1697	c.1208T>C	c.(1207-1209)tTg>tCg	p.L403S	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	403							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						ACTGATGTTTTGGACTCCACA	0.453													ENSG00000250305																																					0													74.0	70.0	71.0					8																	12879396		1926	4149	6075	SO:0001583	missense	0			-	BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.1208T>C	8.37:g.12879396T>C	ENSP00000432695:p.Leu403Ser		Q96AW6	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransferase-rel	p.L403S	ENST00000524591.2	37	c.1208	CCDS47808.1	8	.	.	.	.	.	.	.	.	.	.	T	3.581	-0.085583	0.07097	.	.	ENSG00000250305	ENST00000524591;ENST00000529978	T	0.12879	2.64	4.36	-5.49	0.02584	.	1.181070	0.05971	N	0.642432	T	0.07413	0.0187	L	0.31120	0.905	0.32675	N	0.516283	B	0.14805	0.011	B	0.10450	0.005	T	0.45366	-0.9266	10	0.09084	T	0.74	2.4057	5.4213	0.16402	0.1075:0.15:0.5468:0.1957	.	403	Q9P272	K1456_HUMAN	S	403;316	ENSP00000432695:L403S	ENSP00000432695:L403S	L	+	2	0	AC135352.2	12923767	0.006000	0.16342	0.002000	0.10522	0.025000	0.11179	-0.146000	0.10250	-1.116000	0.02969	-0.316000	0.08728	TTG	-	KIAA1456	-	NULL		0.453	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1456	HGNC	protein_coding	OTTHUMT00000383262.2	0	0	0	20	20	61	0.00	0.00	T	NM_001099677		12879396	+1	13	19	21	53	tier1	no_errors	ENST00000524591	ensembl	human	known	74_37	missense	38.24	26.39	SNP	0.001	C	13	21
HHLA1	10086	genome.wustl.edu	37	8	133090154	133090154	+	Silent	SNP	C	C	T	rs571983359		TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr8:133090154C>T	ENST00000414222.1	-	11	989	c.990G>A	c.(988-990)tcG>tcA	p.S330S	HHLA1_ENST00000434736.2_Silent_p.S366S|OC90_ENST00000262283.5_Silent_p.S72S	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	330						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						AGGGCACGGACGATATGGAAG	0.552													ENSG00000132297	C|||	1	0.000199681	0.0	0.0	5008	,	,		15976	0.0		0.001	False		,,,				2504	0.0																0													91.0	83.0	85.0					8																	133090154		692	1591	2283	SO:0001819	synonymous_variant	0			-	AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.990G>A	8.37:g.133090154C>T				Silent	SNP	NULL	p.S330	ENST00000414222.1	37	c.990		8																																																																																			-	HHLA1	-	NULL		0.552	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	HHLA1	HGNC	protein_coding		0	0	1	42	42	71	0.00	1.37	C	XR_017860		133090154	-1	14	35	27	58	tier1	no_errors	ENST00000414222	ensembl	human	known	74_37	silent	34.15	37.63	SNP	0.000	T	14	27
OR5J2	282775	genome.wustl.edu	37	11	55944659	55944659	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr11:55944659G>A	ENST00000312298.1	+	1	566	c.566G>A	c.(565-567)tGt>tAt	p.C189Y		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					AAGCTGTCATGTTCTGACACC	0.443													ENSG00000174957																																					0													171.0	136.0	148.0					11																	55944659		2201	4295	6496	SO:0001583	missense	0			-	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.566G>A	11.37:g.55944659G>A	ENSP00000310788:p.Cys189Tyr		Q6IEU5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.C189Y	ENST00000312298.1	37	c.566	CCDS31522.1	11	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102375	0.56183	.	.	ENSG00000174957	ENST00000312298	T	0.00462	7.26	4.73	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	T	0.02571	0.0078	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.30534	-0.9975	10	0.72032	D	0.01	.	17.7183	0.88344	0.0:0.0:1.0:0.0	.	189	Q8NH18	OR5J2_HUMAN	Y	189	ENSP00000310788:C189Y	ENSP00000310788:C189Y	C	+	2	0	OR5J2	55701235	1.000000	0.71417	0.771000	0.31576	0.156000	0.22039	4.943000	0.63554	2.355000	0.79922	0.591000	0.81541	TGT	-	OR5J2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.443	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5J2	HGNC	protein_coding	OTTHUMT00000391544.1	0	0	0	51	51	30	0.00	0.00	G	NM_001005492		55944659	+1	21	15	32	39	tier1	no_errors	ENST00000312298	ensembl	human	known	74_37	missense	39.62	27.78	SNP	0.993	A	21	32
TMEM178B	100507421	genome.wustl.edu	37	7	141170396	141170396	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr7:141170396G>A	ENST00000565468.1	+	4	774	c.695G>A	c.(694-696)cGc>cAc	p.R232H		NM_001195278.1	NP_001182207.1	H3BS89	T178B_HUMAN	transmembrane protein 178B	232						integral component of membrane (GO:0016021)											GAGCTGTCACGCTACCCACGC	0.562													ENSG00000261115																																					0																																										SO:0001583	missense	0			-		CCDS59086.1	7q34	2012-06-29			ENSG00000261115	ENSG00000261115			44112	protein-coding gene	gene with protein product							Standard	NM_001195278		Approved	DKFZp547G036	uc003vwg.2	H3BS89	OTTHUMG00000172737	ENST00000565468.1:c.695G>A	7.37:g.141170396G>A	ENSP00000456594:p.Arg232His			Missense_Mutation	SNP	NULL	p.R232H	ENST00000565468.1	37	c.695	CCDS59086.1	7																																																																																			-	TMEM178B	-	NULL		0.562	TMEM178B-001	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TMEM178B	HGNC	protein_coding	OTTHUMT00000420337.4	0	0	0	28	28	79	0.00	0.00	G			141170396	+1	13	22	50	55	tier1	no_errors	ENST00000565468	ensembl	human	putative	74_37	missense	20.63	28.57	SNP	1.000	A	13	50
MROH2B	133558	genome.wustl.edu	37	5	41015559	41015559	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr5:41015559C>T	ENST00000399564.4	-	29	3356	c.2906G>A	c.(2905-2907)aGa>aAa	p.R969K	MROH2B_ENST00000506092.2_Missense_Mutation_p.R524K	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	969																	ACCCTGCAGTCTTTCCACTTC	0.413													ENSG00000171495																																					0													79.0	79.0	79.0					5																	41015559		1864	4094	5958	SO:0001583	missense	0			-		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2906G>A	5.37:g.41015559C>T	ENSP00000382476:p.Arg969Lys		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R969K	ENST00000399564.4	37	c.2906	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	9.217	1.032374	0.19590	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.64618	-0.11;-0.11	5.9	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.34411	U	0.003990	T	0.37758	0.1015	N	0.12182	0.205	0.26344	N	0.97731	B	0.16603	0.018	B	0.10450	0.005	T	0.11131	-1.0600	10	0.18276	T	0.48	.	6.8974	0.24262	0.0:0.8591:0.0:0.1409	.	969	Q7Z745	HTRB2_HUMAN	K	524;674;969	ENSP00000441504:R524K;ENSP00000382476:R969K	ENSP00000296803:R674K	R	-	2	0	HEATR7B2	41051316	0.999000	0.42202	0.903000	0.35520	0.334000	0.28698	1.350000	0.34010	2.806000	0.96561	0.655000	0.94253	AGA	-	MROH2B	-	superfamily_ARM-type_fold		0.413	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	0	0	0	59	59	134	0.00	0.00	C	NM_173489		41015559	-1	27	34	48	77	tier1	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	36.00	30.36	SNP	0.817	T	27	48
ZNF280A	129025	genome.wustl.edu	37	22	22869108	22869108	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr22:22869108G>C	ENST00000302097.3	-	2	1099	c.847C>G	c.(847-849)Cag>Gag	p.Q283E		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CCTTTATGCTGTCCATAGTAA	0.398													ENSG00000169548																																					0													122.0	111.0	115.0					22																	22869108		2203	4300	6503	SO:0001583	missense	0			-	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.847C>G	22.37:g.22869108G>C	ENSP00000302855:p.Gln283Glu			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q283E	ENST00000302097.3	37	c.847	CCDS13800.1	22	.	.	.	.	.	.	.	.	.	.	G	10.13	1.264647	0.23136	.	.	ENSG00000169548	ENST00000302097	T	0.01152	5.26	3.67	1.4	0.22301	.	.	.	.	.	T	0.01421	0.0046	L	0.43701	1.375	0.09310	N	1	B	0.22851	0.076	B	0.19666	0.026	T	0.43278	-0.9401	9	0.37606	T	0.19	.	9.5621	0.39376	0.0:0.4223:0.5777:0.0	.	283	P59817	Z280A_HUMAN	E	283	ENSP00000302855:Q283E	ENSP00000302855:Q283E	Q	-	1	0	ZNF280A	21199108	0.993000	0.37304	0.051000	0.19133	0.955000	0.61496	1.250000	0.32850	0.458000	0.26988	0.655000	0.94253	CAG	-	ZNF280A	-	NULL		0.398	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280A	HGNC	protein_coding	OTTHUMT00000075433.3	0	0	0	91	91	45	0.00	0.00	G	NM_080740		22869108	-1	18	7	60	37	tier1	no_errors	ENST00000302097	ensembl	human	known	74_37	missense	23.08	15.91	SNP	0.262	C	18	60
ACSBG1	23205	genome.wustl.edu	37	15	78500436	78500436	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr15:78500436G>A	ENST00000258873.4	-	2	345	c.140C>T	c.(139-141)aCt>aTt	p.T47I	ACSBG1_ENST00000558828.1_5'UTR|ACSBG1_ENST00000541759.1_Intron|ACSBG1_ENST00000560817.1_Intron	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	47					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CTGCCTGTCAGTCAGTGAGCT	0.577													ENSG00000103740																																					0													58.0	48.0	51.0					15																	78500436		2196	4293	6489	SO:0001583	missense	0			-	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.140C>T	15.37:g.78500436G>A	ENSP00000258873:p.Thr47Ile		B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.T47I	ENST00000258873.4	37	c.140	CCDS10298.1	15	.	.	.	.	.	.	.	.	.	.	G	10.24	1.295893	0.23564	.	.	ENSG00000103740	ENST00000258873	T	0.27720	1.65	4.66	1.55	0.23275	.	0.469026	0.18109	N	0.151439	T	0.14056	0.0340	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.23833	-1.0177	10	0.23891	T	0.37	-5.7454	6.1428	0.20269	0.1047:0.3703:0.525:0.0	.	47;47	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	I	47	ENSP00000258873:T47I	ENSP00000258873:T47I	T	-	2	0	ACSBG1	76287491	0.954000	0.32549	0.001000	0.08648	0.313000	0.28021	1.056000	0.30480	0.232000	0.21100	0.491000	0.48974	ACT	-	ACSBG1	-	NULL		0.577	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	HGNC	protein_coding	OTTHUMT00000289802.2	0	0	0	33	33	87	0.00	0.00	G	NM_015162		78500436	-1	14	18	20	48	tier1	no_errors	ENST00000258873	ensembl	human	known	74_37	missense	41.18	27.27	SNP	0.002	A	14	20
EPG5	57724	genome.wustl.edu	37	18	43432446	43432446	+	Missense_Mutation	SNP	C	C	G	rs200967600		TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr18:43432446C>G	ENST00000282041.5	-	44	7760	c.7726G>C	c.(7726-7728)Gac>Cac	p.D2576H		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2576					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CGTATGTGGTCCAAATAATGC	0.408													ENSG00000152223																																					0													118.0	107.0	110.0					18																	43432446		1868	4116	5984	SO:0001583	missense	0			-	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7726G>C	18.37:g.43432446C>G	ENSP00000282041:p.Asp2576His		A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.D2576H	ENST00000282041.5	37	c.7726	CCDS11926.2	18	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065886	0.55539	.	.	ENSG00000152223	ENST00000282041;ENST00000540322	T	0.10860	2.83	6.07	6.07	0.98685	.	0.101127	0.39615	U	0.001308	T	0.11324	0.0276	L	0.42245	1.32	0.45183	D	0.998192	P	0.40332	0.713	B	0.36845	0.234	T	0.01608	-1.1313	10	0.51188	T	0.08	-16.1305	13.8	0.63194	0.0:0.9304:0.0:0.0696	.	2576	Q9HCE0	EPG5_HUMAN	H	2576;504	ENSP00000282041:D2576H	ENSP00000282041:D2576H	D	-	1	0	EPG5	41686444	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.005000	0.63972	2.890000	0.99128	0.585000	0.79938	GAC	-	EPG5	-	NULL		0.408	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	0	0	0	68	68	164	0.00	0.00	C	NM_020964		43432446	-1	49	86	158	199	tier1	no_errors	ENST00000282041	ensembl	human	known	74_37	missense	23.56	30.07	SNP	1.000	G	49	158
KLF6	1316	genome.wustl.edu	37	10	3824222	3824223	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr10:3824222_3824223insA	ENST00000497571.1	-	2	546_547	c.286_287insT	c.(286-288)tgtfs	p.C96fs	KLF6_ENST00000469435.1_Frame_Shift_Ins_p.C96fs|KLF6_ENST00000542957.1_Frame_Shift_Ins_p.C96fs|KLF6_ENST00000173785.4_5'UTR	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	96					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		TAAGTTGTAACAAAAGCTCGGG	0.51											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000067082																																					0																																										SO:0001589	frameshift_variant	0				U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.287dupT	10.37:g.3824226_3824226dupA	ENSP00000419923:p.Cys96fs	614	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C96fs	ENST00000497571.1	37	c.287_286	CCDS7060.1	10																																																																																				KLF6	-	NULL		0.510	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF6	HGNC	protein_coding	OTTHUMT00000046495.1	0	0	0	34	34	86	0.00	0.00	-			3824223	-1	22	22	27	83	tier1	no_errors	ENST00000497571	ensembl	human	known	74_37	frame_shift_ins	44.90	20.95	INS	0.628:0.578	A	22	27
KDM2A	22992	genome.wustl.edu	37	11	67023822	67023823	+	3'UTR	INS	-	-	A	rs112132478		TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr11:67023822_67023823insA	ENST00000529006.2	+	0	5231_5232				KDM2A_ENST00000530342.1_3'UTR|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000308783.5_3'UTR|KDM2A_ENST00000398645.2_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						TTTTGCACTTTAAAAAAAAAAA	0.446													ENSG00000173120																																					0																																										SO:0001624	3_prime_UTR_variant	0				BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.*1297->A	11.37:g.67023833_67023833dupA			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	R	INS	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																				KDM2A	-	-		0.446	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	0	0	0	22	22	18	0.00	0.00	-	NM_012308		67023823	+1	6	3	29	23	tier1	no_errors	ENST00000524657	ensembl	human	known	74_37	rna	17.14	11.54	INS	1.000:1.000	A	6	29
NPTN	27020	genome.wustl.edu	37	15	73858110	73858110	+	Intron	DEL	C	C	-			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr15:73858110delC	ENST00000345330.4	-	7	1312				NPTN_ENST00000542234.1_Intron|NPTN_ENST00000545878.1_Splice_Site|NPTN_ENST00000563691.1_Intron|NPTN_ENST00000562924.1_Intron|NPTN_ENST00000351217.6_Intron	NM_001161363.1|NM_012428.3	NP_001154835.1|NP_036560.1	Q9Y639	NPTN_HUMAN	neuroplastin						homophilic cell adhesion (GO:0007156)|long-term synaptic potentiation (GO:0060291)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)	cell adhesion molecule binding (GO:0050839)|type 1 fibroblast growth factor receptor binding (GO:0005105)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	13						AGTGAAGTTACCGGTGGAACT	0.498													ENSG00000156642																									Pancreas(101;1519 1568 9459 19537 41286)|Esophageal Squamous(143;1278 1787 35254 36835 44843)												0																																										SO:0001627	intron_variant	0				AF035287	CCDS10249.1, CCDS10250.1, CCDS58379.1, CCDS58380.1	15q24.1	2013-01-29	2006-02-22	2006-02-22	ENSG00000156642	ENSG00000156642		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17867	protein-coding gene	gene with protein product		612820	"""stromal cell derived factor receptor 1"""	SDFR1		8619474, 9110174	Standard	NM_012428		Approved	SDR1, GP55, GP65, np65, np55	uc002avs.3	Q9Y639	OTTHUMG00000137586	ENST00000345330.4:c.1115-2512G>-	15.37:g.73858110delC			B2RAL7|B7Z4D3|B7ZLL2|Q17R52|Q59EJ9|Q6NVX7|Q9Y640	Splice_Site	DEL	-	e7+1	ENST00000345330.4	37	c.1122+1	CCDS10249.1	15																																																																																				NPTN	-	-		0.498	NPTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPTN	HGNC	protein_coding	OTTHUMT00000268980.1	0	0	0	48	48	136	0.00	0.00	C	NM_012428		73858110	-1	25	30	45	78	tier1	no_errors	ENST00000545878	ensembl	human	known	74_37	splice_site_del	35.71	27.78	DEL	0.000	-	25	45
RIC1	57589	genome.wustl.edu	37	9	5774107	5774107	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr9:5774107delG	ENST00000414202.2	+	26	4324	c.4133delG	c.(4132-4134)aggfs	p.R1378fs	KIAA1432_ENST00000449720.2_Frame_Shift_Del_p.R1262fs|KIAA1432_ENST00000418622.3_Frame_Shift_Del_p.R1299fs	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GAGGAGAGCAGGGGCTCCTCC	0.557													ENSG00000107036																																					0													66.0	63.0	64.0					9																	5774107		2203	4300	6503	SO:0001589	frameshift_variant	0																															ENST00000414202.2:c.4133delG	9.37:g.5774107delG	ENSP00000416696:p.Arg1378fs			Frame_Shift_Del	DEL	pfam_Ribosome_control_1,superfamily_WD40_repeat_dom	p.G1300fs	ENST00000414202.2	37	c.3896	CCDS34982.2	9																																																																																				KIAA1432	-	NULL		0.557	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1432	HGNC	protein_coding	OTTHUMT00000051636.3	0	0	0	56	56	62	0.00	0.00	G			5774107	+1	31	19	39	29	tier1	no_errors	ENST00000418622	ensembl	human	known	74_37	frame_shift_del	44.29	39.58	DEL	1.000	-	31	39
FHDC1	85462	genome.wustl.edu	37	4	153897251	153897251	+	Silent	SNP	T	T	C			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr4:153897251T>C	ENST00000511601.1	+	12	2996	c.2808T>C	c.(2806-2808)gaT>gaC	p.D936D	FHDC1_ENST00000260008.3_Silent_p.D936D			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	936									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					GCAGCACAGATACTGTGTGGT	0.692													ENSG00000137460																																					0													22.0	25.0	24.0					4																	153897251		2203	4298	6501	SO:0001819	synonymous_variant	0			-	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2808T>C	4.37:g.153897251T>C				Silent	SNP	pfam_FH2_Formin,smart_FH2_Formin	p.D936	ENST00000511601.1	37	c.2808	CCDS34081.1	4																																																																																			-	FHDC1	-	NULL		0.692	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	0	0	0	52	52	28	0.00	0.00	T	NM_033393		153897251	+1	7	4	19	9	tier1	no_errors	ENST00000260008	ensembl	human	known	74_37	silent	26.92	30.77	SNP	0.000	C	7	19
AC136188.1	0	genome.wustl.edu	37	12	74293705	74293712	+	RNA	DEL	CACACACA	CACACACA	-	rs61932868|rs146159159|rs142009105|rs71437008|rs61932867	byFrequency	TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	CACACACA	CACACACA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr12:74293705_74293712delCACACACA	ENST00000606199.1	+	0	56_63																											cacatacacacacacacacacacacaca	0.288													ENSG00000272231																																					0																																												0																																12.37:g.74293713_74293720delCACACACA				R	DEL	-	NULL	ENST00000606199.1	37	NULL		12																																																																																				AC136188.1	-	-		0.288	AC136188.1-201	NOVEL	basic	miRNA	ENSG00000272231	Clone_based_ensembl_gene	miRNA		0	0	0	0	0	0	0.00	0.00	CACACACA			74293712	+1	0	0	0	0	tier1	no_errors	ENST00000606199	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.029:0.033:0.036:0.039:0.041:0.043:0.044:0.045	-	0	0
FRG2B	441581	genome.wustl.edu	37	10	135439803	135439803	+	Silent	SNP	C	C	T	rs202189720		TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr10:135439803C>T	ENST00000425520.1	-	2	235	c.183G>A	c.(181-183)tcG>tcA	p.S61S	FRG2B_ENST00000443774.1_Silent_p.S62S	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	61						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GATTGGGCTCCGATCCTGCTG	0.488													ENSG00000225899																																					0													1.0	1.0	1.0					10																	135439803		23	64	87	SO:0001819	synonymous_variant	0			-	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.183G>A	10.37:g.135439803C>T			Q5VSQ1	Silent	SNP	NULL	p.S61	ENST00000425520.1	37	c.183	CCDS44502.1	10																																																																																			rs202189720	FRG2B	-	NULL		0.488	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	HGNC	protein_coding	OTTHUMT00000467780.1	0	0	0	8	8	0	0.00	0.00	C	NM_001080998		135439803	-1	6	0	8	0	tier1	no_errors	ENST00000425520	ensembl	human	known	74_37	silent	42.86	0.00	SNP	0.213	T	6	8
SPEG	10290	genome.wustl.edu	37	2	220330658	220330661	+	Intron	DEL	TGCA	TGCA	-	rs530065772|rs1976617	byFrequency	TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	TGCA	TGCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr2:220330658_220330661delTGCA	ENST00000312358.7	+	10	3013				SPEG_ENST00000485813.1_Intron|SPEG_ENST00000396698.1_Intron|SPEG_ENST00000396686.1_Intron|SPEG_ENST00000396695.2_Intron|SPEG_ENST00000396688.1_Intron|SPEG_ENST00000396689.2_Intron	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus						cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		cgcgtgtgcgtgcacgtgtgcgtg	0.593													ENSG00000072195																																					0																																										SO:0001627	intron_variant	0				BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2882-1235TGCA>-	2.37:g.220330658_220330661delTGCA			A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	R	DEL	-	NULL	ENST00000312358.7	37	NULL	CCDS42824.1	2																																																																																				SPEG	-	-		0.593	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	0	0	0	12	12	0	0.00	0.00	TGCA	NM_005876		220330661	+1	7	0	15	0	tier1	no_errors	ENST00000462545	ensembl	human	known	74_37	rna	31.82	0.00	DEL	0.004:0.005:0.000:0.000	-	7	15
SRRM4	84530	genome.wustl.edu	37	12	119594485	119594485	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr12:119594485G>A	ENST00000267260.4	+	13	2106	c.1718G>A	c.(1717-1719)cGc>cAc	p.R573H		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	573	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						TCTAGCTCCCGCAGCCCTAGT	0.726													ENSG00000139767																																					0													4.0	5.0	5.0					12																	119594485		1837	3878	5715	SO:0001583	missense	0			-	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1718G>A	12.37:g.119594485G>A	ENSP00000267260:p.Arg573His		A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	NULL	p.R573H	ENST00000267260.4	37	c.1718	CCDS44994.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062146	0.76187	.	.	ENSG00000139767	ENST00000267260	T	0.25749	1.78	5.61	5.61	0.85477	.	0.169932	0.41938	D	0.000788	T	0.27832	0.0685	N	0.08118	0	0.40612	D	0.981687	D	0.71674	0.998	P	0.58660	0.843	T	0.17992	-1.0351	9	.	.	.	-5.8001	19.2425	0.93889	0.0:0.0:1.0:0.0	.	573	A7MD48	SRRM4_HUMAN	H	573	ENSP00000267260:R573H	.	R	+	2	0	SRRM4	118078868	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	6.488000	0.73637	2.658000	0.90341	0.650000	0.86243	CGC	-	SRRM4	-	NULL		0.726	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM4	HGNC	protein_coding	OTTHUMT00000401640.2	0	0	0	15	15	0	0.00	0.00	G	NM_194286		119594485	+1	17	0	20	0	tier1	no_errors	ENST00000267260	ensembl	human	known	74_37	missense	45.95	0.00	SNP	1.000	A	17	20
CFAP46	54777	genome.wustl.edu	37	10	134660723	134660723	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2G-01A-11D-A38Z-09	TCGA-DX-AB2G-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b779d1d-4305-4534-bbce-2ed53f2269c0	b525edfb-1ff0-4bbb-8c86-4c4f1f38d5d4	g.chr10:134660723C>T	ENST00000368586.5	-	42	6155	c.6055G>A	c.(6055-6057)Gag>Aag	p.E2019K	TTC40_ENST00000263170.5_Missense_Mutation_p.E180K	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CAGTGCTCCTCCGGGGCTGCC	0.697													ENSG00000171811																																					0													44.0	51.0	49.0					10																	134660723		2203	4299	6502	SO:0001583	missense	0			-																												ENST00000368586.5:c.6055G>A	10.37:g.134660723C>T	ENSP00000357575:p.Glu2019Lys			Missense_Mutation	SNP	NULL	p.E180K	ENST00000368586.5	37	c.538	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834278	0.50951	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.12984	2.81;2.63	3.57	-1.57	0.08506	.	1.785610	0.03454	N	0.211157	T	0.12732	0.0309	L	0.60455	1.87	0.09310	N	1	B	0.17038	0.02	B	0.15484	0.013	T	0.29336	-1.0015	10	0.13853	T	0.58	.	3.8077	0.08783	0.0:0.3537:0.1909:0.4553	.	180	Q8IYW2	CJ092_HUMAN	K	2019;180	ENSP00000357575:E2019K;ENSP00000263170:E180K	ENSP00000263170:E180K	E	-	1	0	C10orf93	134510713	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.029000	0.12329	-0.471000	0.06891	-0.339000	0.08088	GAG	-	TTC40	-	NULL		0.697	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	0	0	0	46	46	1	0.00	0.00	C			134660723	-1	24	1	52	2	tier1	no_errors	ENST00000263170	ensembl	human	known	74_37	missense	31.58	33.33	SNP	0.003	T	24	52
