#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ASXL2	55252	genome.wustl.edu	37	2	25966165	25966165	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr2:25966165G>A	ENST00000435504.4	-	13	3334	c.3041C>T	c.(3040-3042)cCa>cTa	p.P1014L	ASXL2_ENST00000404843.1_Intron|ASXL2_ENST00000272341.4_Intron|ASXL2_ENST00000336112.4_Missense_Mutation_p.P986L			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	1014					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCGTAGCTGGATGGGACTG	0.532													ENSG00000143970																																					0													60.0	63.0	62.0					2																	25966165		1962	4166	6128	SO:0001583	missense	0			-			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.3041C>T	2.37:g.25966165G>A	ENSP00000391447:p.Pro1014Leu		Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.P1014L	ENST00000435504.4	37	c.3041		2	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.057432	0.00390	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	T;T	0.16597	2.33;2.33	6.07	1.7	0.24286	.	0.492413	0.22881	N	0.054519	T	0.09113	0.0225	N	0.16656	0.425	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.23511	-1.0186	10	0.87932	D	0	-1.8346	4.9635	0.14078	0.3668:0.1543:0.4788:0.0	.	1014	Q76L83	ASXL2_HUMAN	L	1014;986	ENSP00000391447:P1014L;ENSP00000337250:P986L	ENSP00000337250:P986L	P	-	2	0	ASXL2	25819669	0.001000	0.12720	0.042000	0.18584	0.019000	0.09904	1.088000	0.30877	0.429000	0.26202	-0.176000	0.13171	CCA	-	ASXL2	-	NULL		0.532	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	0	0	0	71	71	99	0.00	0.00	G	NM_018263		25966165	-1	35	30	36	33	tier1	no_errors	ENST00000435504	ensembl	human	known	74_37	missense	49.30	47.62	SNP	0.000	A	35	36
TTN	7273	genome.wustl.edu	37	2	179427807	179427807	+	Silent	SNP	C	C	T			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr2:179427807C>T	ENST00000591111.1	-	276	78353	c.78129G>A	c.(78127-78129)gtG>gtA	p.V26043V	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Silent_p.V18619V|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000589042.1_Silent_p.V27684V|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Silent_p.V18811V|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Silent_p.V25116V|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Silent_p.V18744V|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26043	Ig-like 126.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAGAACGACCACCTTTCTGA	0.483													ENSG00000155657																																					0													187.0	183.0	185.0					2																	179427807		1952	4148	6100	SO:0001819	synonymous_variant	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78129G>A	2.37:g.179427807C>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V25116	ENST00000591111.1	37	c.75348		2																																																																																			-	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like_dom		0.483	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	57	57	77	0.00	0.00	C	NM_133378		179427807	-1	34	28	20	27	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	62.96	50.91	SNP	0.295	T	34	20
ZNF592	9640	genome.wustl.edu	37	15	85327731	85327731	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr15:85327731C>T	ENST00000560079.2	+	4	2113	c.1825C>T	c.(1825-1827)Cgg>Tgg	p.R609W	ZNF592_ENST00000299927.3_Missense_Mutation_p.R609W	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	609					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTATGGCCGGCGGAGCGTCCA	0.602													ENSG00000166716																																					0													101.0	94.0	96.0					15																	85327731		2203	4299	6502	SO:0001583	missense	0			-	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.1825C>T	15.37:g.85327731C>T	ENSP00000452877:p.Arg609Trp		Q2M1T2|Q504Y9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R609W	ENST00000560079.2	37	c.1825	CCDS32317.1	15	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960763	0.53400	.	.	ENSG00000166716	ENST00000299927	T	0.60920	0.15	5.36	4.41	0.53225	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.051684	0.85682	D	0.000000	T	0.67021	0.2849	L	0.39397	1.21	0.50813	D	0.999892	D	0.89917	1.0	D	0.97110	1.0	T	0.68842	-0.5302	10	0.87932	D	0	-20.5984	13.3875	0.60803	0.157:0.843:0.0:0.0	.	609	Q92610	ZN592_HUMAN	W	609	ENSP00000299927:R609W	ENSP00000299927:R609W	R	+	1	2	ZNF592	83128735	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.301000	0.33447	2.774000	0.95407	0.655000	0.94253	CGG	-	ZNF592	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.602	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	0	0	0	20	20	59	0.00	0.00	C	NM_014630		85327731	+1	9	15	11	21	tier1	no_errors	ENST00000299927	ensembl	human	known	74_37	missense	45.00	41.67	SNP	1.000	T	9	11
SLC35A5	55032	genome.wustl.edu	37	3	112300122	112300122	+	Silent	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr3:112300122G>A	ENST00000492406.1	+	6	1441	c.1158G>A	c.(1156-1158)agG>agA	p.R386R	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	386					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						ACGCACCTAGGCAAGAAAGGA	0.453													ENSG00000138459																																					0													46.0	51.0	49.0					3																	112300122		2188	4251	6439	SO:0001819	synonymous_variant	0			-	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.1158G>A	3.37:g.112300122G>A			D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	pfam_Nuc_sug_transpt,pfam_DMT,pfam_UAA,pfam_Tpt_PEP_trans_dom	p.G229D	ENST00000492406.1	37	c.686	CCDS2967.1	3																																																																																			-	SLC35A5	-	NULL		0.453	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A5	HGNC	protein_coding	OTTHUMT00000354184.1	0	0	0	48	48	135	0.00	0.00	G	NM_017945		112300122	+1	20	39	27	48	tier1	no_errors	ENST00000261034	ensembl	human	known	74_37	missense	42.55	44.83	SNP	0.792	A	20	27
VPS13A	23230	genome.wustl.edu	37	9	79891096	79891096	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr9:79891096C>A	ENST00000360280.3	+	26	3043	c.2783C>A	c.(2782-2784)gCc>gAc	p.A928D	VPS13A_ENST00000357409.5_Missense_Mutation_p.A928D|VPS13A_ENST00000376636.3_Missense_Mutation_p.A928D|VPS13A_ENST00000376634.4_Missense_Mutation_p.A928D	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	928					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAAGCAAATGCCTTTTTGAAA	0.318													ENSG00000197969																																					0													88.0	89.0	88.0					9																	79891096		2203	4300	6503	SO:0001583	missense	0			-	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.2783C>A	9.37:g.79891096C>A	ENSP00000353422:p.Ala928Asp		Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.A928D	ENST00000360280.3	37	c.2783	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073424	0.76415	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.20463	2.07;2.07;2.07;2.07	6.04	5.13	0.70059	.	0.172300	0.51477	D	0.000087	T	0.37919	0.1021	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.76494	0.991;0.99;0.999;0.999	D;P;D;D	0.70016	0.937;0.761;0.967;0.967	T	0.09707	-1.0662	10	0.35671	T	0.21	.	9.5906	0.39543	0.0:0.7817:0.1438:0.0746	.	928;928;928;928	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	D	928	ENSP00000365821:A928D;ENSP00000365823:A928D;ENSP00000353422:A928D;ENSP00000349985:A928D	ENSP00000349985:A928D	A	+	2	0	VPS13A	79080916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.579000	0.46059	1.528000	0.49103	0.563000	0.77884	GCC	-	VPS13A	-	NULL		0.318	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	0	0	0	193	193	119	0.00	0.00	C	NM_015186		79891096	+1	87	29	108	44	tier1	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	44.62	39.73	SNP	1.000	A	87	108
CNGA3	1261	genome.wustl.edu	37	2	99012444	99012444	+	Missense_Mutation	SNP	C	C	A	rs149802213	byFrequency	TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr2:99012444C>A	ENST00000272602.2	+	7	850	c.811C>A	c.(811-813)Cca>Aca	p.P271T	CNGA3_ENST00000436404.2_Missense_Mutation_p.P253T|CNGA3_ENST00000393504.1_Missense_Mutation_p.P271T|CNGA3_ENST00000409937.1_Missense_Mutation_p.P275T			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	271					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						CACAAACTACCCAGAAGTGAG	0.517													ENSG00000144191																																					0													94.0	85.0	88.0					2																	99012444		2203	4300	6503	SO:0001583	missense	0			-	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.811C>A	2.37:g.99012444C>A	ENSP00000272602:p.Pro271Thr		E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.P271T	ENST00000272602.2	37	c.811	CCDS2034.1	2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080271	0.76528	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97811	-4.55;-4.55;-4.55;-4.55	5.42	5.42	0.78866	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98507	0.9502	M	0.85542	2.76	0.80722	D	1	P;P;P	0.52577	0.621;0.616;0.954	P;P;P	0.57152	0.688;0.574;0.814	D	0.99136	1.0854	10	0.66056	D	0.02	.	18.154	0.89686	0.0:1.0:0.0:0.0	.	275;253;271	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	T	271;253;271;275	ENSP00000377140:P271T;ENSP00000410070:P253T;ENSP00000272602:P271T;ENSP00000386761:P275T	ENSP00000272602:P271T	P	+	1	0	CNGA3	98378876	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.320000	0.79064	2.826000	0.97356	0.563000	0.77884	CCA	-	CNGA3	-	pfam_Ion_trans_dom		0.517	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	HGNC	protein_coding	OTTHUMT00000252986.1	0	0	0	55	55	131	0.00	0.00	C	NM_001298		99012444	+1	27	46	29	48	tier1	no_errors	ENST00000272602	ensembl	human	known	74_37	missense	48.21	48.42	SNP	1.000	A	27	29
DDI1	414301	genome.wustl.edu	37	11	103908420	103908420	+	Silent	SNP	T	T	C			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr11:103908420T>C	ENST00000302259.3	+	1	1113	c.870T>C	c.(868-870)gcT>gcC	p.A290A	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	290							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		CTGGGGTTGCTAAAGGAGTGG	0.502													ENSG00000170967																																					0													112.0	104.0	107.0					11																	103908420		2202	4299	6501	SO:0001819	synonymous_variant	0			-		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.870T>C	11.37:g.103908420T>C			Q7Z4U6|Q8WTS3	Silent	SNP	pfam_Peptidase_aspartic_DDI1-type,pfam_Ubiquitin_dom,pfam_RVP_2,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.A290	ENST00000302259.3	37	c.870	CCDS31660.1	11																																																																																			-	DDI1	-	pfam_Peptidase_aspartic_DDI1-type,pfam_RVP_2,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic_dom		0.502	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDI1	HGNC	protein_coding	OTTHUMT00000387326.1	0	0	0	22	22	61	0.00	0.00	T	NM_001001711		103908420	+1	11	18	16	24	tier1	no_errors	ENST00000302259	ensembl	human	known	74_37	silent	40.74	42.86	SNP	0.928	C	11	16
KIF21A	55605	genome.wustl.edu	37	12	39727019	39727019	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr12:39727019C>T	ENST00000361418.5	-	18	2497	c.2482G>A	c.(2482-2484)Gaa>Aaa	p.E828K	KIF21A_ENST00000361961.3_Missense_Mutation_p.E815K|KIF21A_ENST00000395670.3_Missense_Mutation_p.E828K|KIF21A_ENST00000544797.2_Missense_Mutation_p.E815K|KIF21A_ENST00000541463.2_Intron			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	828					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TGTACCTCTTCAGTTTTGCGA	0.348													ENSG00000139116																																					0													243.0	241.0	242.0					12																	39727019		2203	4300	6503	SO:0001583	missense	0			-	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.2482G>A	12.37:g.39727019C>T	ENSP00000354878:p.Glu828Lys		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.E828K	ENST00000361418.5	37	c.2482	CCDS53776.1	12	.	.	.	.	.	.	.	.	.	.	C	25.7	4.665753	0.88251	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	5.38	5.38	0.77491	.	0.000000	0.51477	D	0.000083	T	0.36331	0.0963	M	0.77486	2.375	0.80722	D	1	B;P;P;P	0.51057	0.287;0.658;0.461;0.941	B;B;B;P	0.51170	0.085;0.196;0.164;0.661	T	0.17048	-1.0382	10	0.54805	T	0.06	.	19.1305	0.93404	0.0:1.0:0.0:0.0	.	815;828;815;828	F5H219;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3	.;KI21A_HUMAN;.;.	K	815;828;828;815;828	ENSP00000354851:E815K;ENSP00000379029:E828K;ENSP00000445606:E815K;ENSP00000354878:E828K	ENSP00000344501:E828K	E	-	1	0	KIF21A	38013286	1.000000	0.71417	0.955000	0.39395	0.945000	0.59286	7.138000	0.77305	2.531000	0.85337	0.557000	0.71058	GAA	-	KIF21A	-	NULL		0.348	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	HGNC	protein_coding	OTTHUMT00000403581.1	0	0	1	74	74	93	0.00	1.05	C	NM_017641		39727019	-1	375	466	405	526	tier1	no_errors	ENST00000395670	ensembl	human	known	74_37	missense	48.08	46.98	SNP	1.000	T	375	405
USP20	10868	genome.wustl.edu	37	9	132637674	132637674	+	Missense_Mutation	SNP	G	G	A	rs368117192		TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr9:132637674G>A	ENST00000315480.4	+	20	2292	c.2134G>A	c.(2134-2136)Gtg>Atg	p.V712M	USP20_ENST00000372429.3_Missense_Mutation_p.V712M|USP20_ENST00000358355.1_Missense_Mutation_p.V712M			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	712	DUSP 1. {ECO:0000255|PROSITE- ProRule:PRU00613}.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GCGGTTCTACGTGTCCCGCGA	0.667													ENSG00000136878																																					0								G	MET/VAL,MET/VAL,MET/VAL	2,4138		0,2,2068	38.0	47.0	44.0		2134,2134,2134	4.3	1.0	9		44	0,8418		0,0,4209	no	missense,missense,missense	USP20	NM_001008563.3,NM_001110303.2,NM_006676.6	21,21,21	0,2,6277	AA,AG,GG		0.0,0.0483,0.0159	possibly-damaging,possibly-damaging,possibly-damaging	712/915,712/915,712/915	132637674	2,12556	2070	4209	6279	SO:0001583	missense	0			-	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2134G>A	9.37:g.132637674G>A	ENSP00000313811:p.Val712Met		Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.V712M	ENST00000315480.4	37	c.2134	CCDS43892.1	9	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375539	0.61735	4.83E-4	0.0	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.23552	1.9;1.9;1.9	5.33	4.32	0.51571	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (2);	0.268996	0.35378	N	0.003257	T	0.22399	0.0540	M	0.64170	1.965	0.47476	D	0.999433	P	0.43662	0.814	B	0.36719	0.231	T	0.04811	-1.0925	10	0.87932	D	0	.	6.6632	0.23027	0.2745:0.0:0.7255:0.0	.	712	Q9Y2K6	UBP20_HUMAN	M	712	ENSP00000361506:V712M;ENSP00000313811:V712M;ENSP00000351122:V712M	ENSP00000313811:V712M	V	+	1	0	USP20	131677495	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.114000	0.71560	2.495000	0.84180	0.561000	0.74099	GTG	-	USP20	-	smart_Pept_C19_DUSP		0.667	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	USP20	HGNC	protein_coding	OTTHUMT00000054604.2	0	0	0	69	69	63	0.00	0.00	G			132637674	+1	22	13	22	21	tier1	no_errors	ENST00000315480	ensembl	human	known	74_37	missense	50.00	38.24	SNP	1.000	A	22	22
MAGEC3	139081	genome.wustl.edu	37	X	140983153	140983153	+	Silent	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chrX:140983153G>A	ENST00000298296.1	+	5	1008	c.1008G>A	c.(1006-1008)agG>agA	p.R336R	MAGEC3_ENST00000409007.1_5'Flank|MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000544766.1_5'UTR|MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000448920.1_Silent_p.R88R	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	336	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGACTCAGGTCAGCAGAGG	0.577													ENSG00000165509																																					0													122.0	107.0	112.0					X																	140983153		2202	4300	6502	SO:0001819	synonymous_variant	0			-	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1008G>A	X.37:g.140983153G>A			Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.R336	ENST00000298296.1	37	c.1008	CCDS14676.1	X																																																																																			-	MAGEC3	-	NULL		0.577	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	0	0	0	84	84	66	0.00	0.00	G	NM_138702		140983153	+1	35	37	32	41	tier1	no_errors	ENST00000298296	ensembl	human	known	74_37	silent	52.24	47.44	SNP	0.006	A	35	32
ENPP5	59084	genome.wustl.edu	37	6	46135503	46135503	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr6:46135503C>G	ENST00000371383.2	-	3	757	c.497G>C	c.(496-498)aGa>aCa	p.R166T	ENPP5_ENST00000230565.3_Missense_Mutation_p.R166T|ENPP5_ENST00000492313.1_5'Flank					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						TTTGGCAACTCTATCTTCAAA	0.423													ENSG00000112796																																					0													99.0	110.0	106.0					6																	46135503		2203	4300	6503	SO:0001583	missense	0			-	AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.497G>C	6.37:g.46135503C>G	ENSP00000360436:p.Arg166Thr			Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.R166T	ENST00000371383.2	37	c.497	CCDS4915.1	6	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497789	0.85069	.	.	ENSG00000112796	ENST00000371383;ENST00000230565	T;T	0.74421	-0.84;-0.84	5.33	5.33	0.75918	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.90728	0.7090	H	0.96889	3.9	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93347	0.6715	10	0.87932	D	0	-23.681	19.4129	0.94683	0.0:1.0:0.0:0.0	.	166;166	A8K9X7;Q9UJA9	.;ENPP5_HUMAN	T	166	ENSP00000360436:R166T;ENSP00000230565:R166T	ENSP00000230565:R166T	R	-	2	0	ENPP5	46243462	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.409000	0.80053	2.652000	0.90054	0.655000	0.94253	AGA	-	ENPP5	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core		0.423	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP5	HGNC	protein_coding	OTTHUMT00000040779.2	0	0	0	32	32	76	0.00	0.00	C			46135503	-1	13	18	21	28	tier1	no_errors	ENST00000230565	ensembl	human	known	74_37	missense	38.24	39.13	SNP	1.000	G	13	21
C6	729	genome.wustl.edu	37	5	41195968	41195968	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr5:41195968C>G	ENST00000263413.3	-	5	777	c.513G>C	c.(511-513)agG>agC	p.R171S	C6_ENST00000337836.5_Missense_Mutation_p.R171S	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	171	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TCCCACAGTCCCTTTCATCTG	0.423													ENSG00000039537																																					0													251.0	221.0	231.0					5																	41195968		2203	4300	6503	SO:0001583	missense	0			-	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.513G>C	5.37:g.41195968C>G	ENSP00000263413:p.Arg171Ser			Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.R171S	ENST00000263413.3	37	c.513	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	16.82	3.227587	0.58668	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	D;D	0.95238	-3.65;-3.65	5.65	3.86	0.44501	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.080957	0.85682	D	0.000000	D	0.94272	0.8160	L	0.41236	1.265	0.43207	D	0.995061	D	0.62365	0.991	D	0.63957	0.92	D	0.92148	0.5726	10	0.38643	T	0.18	-11.8919	9.6617	0.39958	0.0:0.7708:0.0:0.2292	.	171	P13671	CO6_HUMAN	S	171	ENSP00000338861:R171S;ENSP00000263413:R171S	ENSP00000263413:R171S	R	-	3	2	C6	41231725	0.352000	0.24895	0.648000	0.29521	0.828000	0.46876	0.809000	0.27168	0.729000	0.32403	-0.142000	0.14014	AGG	-	C6	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.423	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	0	0	0	78	78	97	0.00	0.00	C			41195968	-1	36	26	41	50	tier1	no_errors	ENST00000263413	ensembl	human	known	74_37	missense	46.75	34.21	SNP	0.622	G	36	41
COL5A3	50509	genome.wustl.edu	37	19	10089586	10089586	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr19:10089586T>C	ENST00000264828.3	-	40	3030	c.2945A>G	c.(2944-2946)aAa>aGa	p.K982R		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	982	Collagen-like 5.|Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			AGGGCCCCCTTTGGGGCCGGG	0.617													ENSG00000080573																																					0													11.0	13.0	13.0					19																	10089586		2195	4288	6483	SO:0001583	missense	0			-	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2945A>G	19.37:g.10089586T>C	ENSP00000264828:p.Lys982Arg		Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.K982R	ENST00000264828.3	37	c.2945	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	t	0.011	-1.697069	0.00725	.	.	ENSG00000080573	ENST00000264828	D	0.94232	-3.38	4.58	2.14	0.27477	.	0.339243	0.26578	U	0.023588	T	0.78065	0.4225	N	0.05574	-0.02	0.22253	N	0.999251	B	0.02656	0.0	B	0.04013	0.001	T	0.64373	-0.6423	10	0.02654	T	1	.	2.3218	0.04212	0.0:0.2676:0.2943:0.4381	.	982	P25940	CO5A3_HUMAN	R	982	ENSP00000264828:K982R	ENSP00000264828:K982R	K	-	2	0	COL5A3	9950586	0.694000	0.27738	0.455000	0.27031	0.020000	0.10135	2.453000	0.44970	0.569000	0.29329	0.370000	0.22315	AAA	-	COL5A3	-	NULL		0.617	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	0	0	0	83	83	55	0.00	0.00	T	NM_015719		10089586	-1	45	17	45	24	tier1	no_errors	ENST00000264828	ensembl	human	known	74_37	missense	50.00	38.64	SNP	0.906	C	45	45
LRRC8B	23507	genome.wustl.edu	37	1	90050305	90050305	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr1:90050305A>C	ENST00000330947.2	+	5	2456	c.2096A>C	c.(2095-2097)cAg>cCg	p.Q699P	RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Missense_Mutation_p.Q699P|LRRC8B_ENST00000358200.4_Missense_Mutation_p.Q699P	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	699					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		GAAGAAATCCAGTATCTGAGT	0.348													ENSG00000197147																																					0													75.0	73.0	74.0					1																	90050305		2203	4300	6503	SO:0001583	missense	0			-	AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.2096A>C	1.37:g.90050305A>C	ENSP00000332674:p.Gln699Pro		D3DT28|Q6UY21|Q8N106|Q92627	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Q699P	ENST00000330947.2	37	c.2096	CCDS724.1	1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.657937	0.47467	.	.	ENSG00000197147	ENST00000330947;ENST00000358200;ENST00000439853	T;T;T	0.58940	0.3;0.3;0.3	5.39	5.39	0.77823	.	0.182760	0.38720	N	0.001587	T	0.33118	0.0852	L	0.28192	0.835	0.39360	D	0.965903	D	0.55385	0.971	P	0.46026	0.501	T	0.19778	-1.0295	9	.	.	.	.	10.4578	0.44561	0.9171:0.0:0.0829:0.0	.	699	Q6P9F7	LRC8B_HUMAN	P	699	ENSP00000332674:Q699P;ENSP00000350933:Q699P;ENSP00000400704:Q699P	.	Q	+	2	0	LRRC8B	89822893	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.333000	0.59285	2.165000	0.68154	0.459000	0.35465	CAG	-	LRRC8B	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.348	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8B	HGNC	protein_coding	OTTHUMT00000028008.1	0	0	1	13	13	50	0.00	1.96	A	NM_015350		90050305	+1	6	13	15	21	tier1	no_errors	ENST00000330947	ensembl	human	known	74_37	missense	28.57	38.24	SNP	1.000	C	6	15
NUTM2B	729262	genome.wustl.edu	37	10	81471859	81471859	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr10:81471859C>A	ENST00000429828.1	+	7	2638	c.2255C>A	c.(2254-2256)tCa>tAa	p.S752*	NUTM2B_ENST00000372321.1_Intron|RP11-119F19.2_ENST00000600376.1_RNA|RP11-119F19.2_ENST00000601369.1_RNA|RP11-119F19.2_ENST00000596088.1_RNA|NUTM2B_ENST00000448135.1_Intron	NM_001278495.1	NP_001265424.1	A6NNL0	NTM2B_HUMAN	NUT family member 2B	752																	GCTCAGGGGTCAAGTGAGGAG	0.647													ENSG00000188199																																					0																																										SO:0001587	stop_gained	0			-		CCDS60574.1	10q22.3	2014-08-13	2013-03-14	2013-03-14	ENSG00000188199	ENSG00000188199			23445	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member B"""	FAM22B			Standard	NM_001278495		Approved	bA119F19.1		A6NNL0	OTTHUMG00000018572	ENST00000429828.1:c.2255C>A	10.37:g.81471859C>A	ENSP00000394623:p.Ser752*		A6NM73	Nonsense_Mutation	SNP	NULL	p.S752*	ENST00000429828.1	37	c.2255		10	.	.	.	.	.	.	.	.	.	.	c	16.22	3.062601	0.55432	.	.	ENSG00000188199	ENST00000429828;ENST00000342531	.	.	.	1.33	0.306	0.15806	.	2.683430	0.00819	N	0.001574	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	5.2918	0.15731	0.0:0.6318:0.3682:0.0	.	.	.	.	X	752;495	.	ENSP00000344811:S495X	S	+	2	0	FAM22B	81141865	0.000000	0.05858	0.005000	0.12908	0.141000	0.21300	-0.517000	0.06275	0.123000	0.18342	0.064000	0.15345	TCA	-	NUTM2B	-	NULL		0.647	NUTM2B-201	KNOWN	basic|appris_principal	protein_coding	NUTM2B	HGNC	protein_coding		0	0	0	142	142	35	0.00	0.00	C	NG_012780		81471859	+1	22	7	112	21	tier1	no_errors	ENST00000429828	ensembl	human	known	74_37	nonsense	16.42	25.00	SNP	0.006	A	22	112
DDB2	1643	genome.wustl.edu	37	11	47236754	47236754	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr11:47236754A>G	ENST00000256996.4	+	1	262	c.67A>G	c.(67-69)Agg>Ggg	p.R23G	DDB2_ENST00000378600.3_Missense_Mutation_p.R23G|DDB2_ENST00000378603.3_Missense_Mutation_p.R23G|DDB2_ENST00000378601.3_Missense_Mutation_p.R23G	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	23					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						CAGGAACAAGAGGAGCAGGAG	0.572			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum				ENSG00000134574																											yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	0													136.0	148.0	144.0					11																	47236754		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	-		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.67A>G	11.37:g.47236754A>G	ENSP00000256996:p.Arg23Gly		B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R23G	ENST00000256996.4	37	c.67	CCDS7927.1	11	.	.	.	.	.	.	.	.	.	.	A	15.69	2.907287	0.52333	.	.	ENSG00000134574	ENST00000256996;ENST00000378603;ENST00000378600;ENST00000378601	T;T;T;T	0.79749	-0.85;-0.47;-1.3;0.59	3.76	2.59	0.31030	.	0.288817	0.35772	N	0.002986	T	0.66458	0.2791	L	0.36672	1.1	0.28593	N	0.909547	B;P;B	0.36909	0.253;0.573;0.164	B;B;B	0.33521	0.06;0.165;0.027	T	0.58188	-0.7680	10	0.30854	T	0.27	-16.4641	7.0857	0.25255	0.7685:0.2315:0.0:0.0	.	23;23;23	Q92466-4;Q92466-2;Q92466	.;.;DDB2_HUMAN	G	23	ENSP00000256996:R23G;ENSP00000367866:R23G;ENSP00000367863:R23G;ENSP00000367864:R23G	ENSP00000256996:R23G	R	+	1	2	DDB2	47193330	1.000000	0.71417	0.956000	0.39512	0.993000	0.82548	2.041000	0.41213	0.763000	0.33175	0.533000	0.62120	AGG	-	DDB2	-	NULL		0.572	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DDB2	HGNC	protein_coding		0	0	0	54	54	76	0.00	0.00	A	NM_000107		47236754	+1	26	20	29	25	tier1	no_errors	ENST00000256996	ensembl	human	known	74_37	missense	47.27	43.48	SNP	0.979	G	26	29
SCNN1G	6340	genome.wustl.edu	37	16	23200982	23200982	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr16:23200982G>T	ENST00000300061.2	+	3	751	c.608G>T	c.(607-609)gGa>gTa	p.G203V		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	203					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CAAGTGGTGGGATTCCAACTG	0.527													ENSG00000166828																																					0													140.0	139.0	139.0					16																	23200982		2197	4300	6497	SO:0001583	missense	0			-	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.608G>T	16.37:g.23200982G>T	ENSP00000300061:p.Gly203Val		P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.G203V	ENST00000300061.2	37	c.608	CCDS10608.1	16	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555235	0.65425	.	.	ENSG00000166828	ENST00000300061	T	0.76968	-1.06	5.75	5.75	0.90469	.	0.071824	0.56097	N	0.000021	D	0.89406	0.6706	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90530	0.4495	10	0.87932	D	0	-10.6745	17.1001	0.86647	0.0:0.0:1.0:0.0	.	203	P51170	SCNNG_HUMAN	V	203	ENSP00000300061:G203V	ENSP00000300061:G203V	G	+	2	0	SCNN1G	23108483	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	6.144000	0.71762	2.721000	0.93114	0.511000	0.50034	GGA	-	SCNN1G	-	pfam_Na+channel_ASC,tigrfam_EnaC		0.527	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	HGNC	protein_coding	OTTHUMT00000254496.1	0	0	0	45	45	98	0.00	0.00	G	NM_001039		23200982	+1	21	34	23	28	tier1	no_errors	ENST00000300061	ensembl	human	known	74_37	missense	47.73	53.97	SNP	1.000	T	21	23
ANKRD18B	441459	genome.wustl.edu	37	9	33566231	33566231	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr9:33566231G>A	ENST00000290943.6	+	13	2385	c.2289G>A	c.(2287-2289)atG>atA	p.M763I		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	763										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						ATGATCTTATGGCCGAGAAGG	0.323													ENSG00000230453																																					0																																										SO:0001583	missense	0			-			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.2289G>A	9.37:g.33566231G>A	ENSP00000290943:p.Met763Ile			Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M763I	ENST00000290943.6	37	c.2289		9	.	.	.	.	.	.	.	.	.	.	g	2.274	-0.366262	0.05069	.	.	ENSG00000230453	ENST00000290943;ENST00000357927	T;T	0.26810	1.71;3.16	1.64	0.18	0.15068	.	.	.	.	.	T	0.18257	0.0438	.	.	.	0.21105	N	0.999784	.	.	.	.	.	.	T	0.28681	-1.0036	5	0.33141	T	0.24	.	3.4674	0.07554	0.7631:0.0:0.2369:0.0	.	.	.	.	I	763;144	ENSP00000290943:M763I;ENSP00000350607:M144I	ENSP00000290943:M763I	M	+	3	0	ANKRD18B	33556231	0.024000	0.19004	0.025000	0.17156	0.003000	0.03518	0.421000	0.21280	0.091000	0.17302	-0.691000	0.03719	ATG	-	ANKRD18B	-	NULL		0.323	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	ANKRD18B	HGNC	protein_coding	OTTHUMT00000313729.2	0	0	0	139	139	12	0.00	0.00	G	XM_001718334		33566231	+1	68	4	76	11	tier1	no_errors	ENST00000290943	ensembl	human	known	74_37	missense	47.22	26.67	SNP	0.054	A	68	76
SLC4A4	8671	genome.wustl.edu	37	4	72332163	72332163	+	Silent	SNP	C	C	T	rs373128647		TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr4:72332163C>T	ENST00000264485.5	+	13	1617	c.1500C>T	c.(1498-1500)ggC>ggT	p.G500G	SLC4A4_ENST00000340595.3_Silent_p.G456G|SLC4A4_ENST00000351898.6_Silent_p.G500G|SLC4A4_ENST00000425175.1_Silent_p.G500G|SLC4A4_ENST00000512686.1_Silent_p.G456G|SLC4A4_ENST00000514331.1_3'UTR	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	500					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.G500G(1)|p.G456G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TATTTTAGGGCGTGTTGGAGA	0.413													ENSG00000080493																																					2	Substitution - coding silent(2)	lung(2)						C	,,	0,4406		0,0,2203	161.0	157.0	158.0		1500,1500,1368	-2.5	1.0	4		158	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	SLC4A4	NM_001098484.2,NM_001134742.1,NM_003759.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	500/1080,500/1095,456/1036	72332163	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1500C>T	4.37:g.72332163C>T			C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.G500	ENST00000264485.5	37	c.1500	CCDS43236.1	4																																																																																			-	SLC4A4	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk		0.413	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	HGNC	protein_coding	OTTHUMT00000362090.1	0	0	0	79	79	52	0.00	0.00	C	NM_003759		72332163	+1	23	28	41	26	tier1	no_errors	ENST00000425175	ensembl	human	known	74_37	silent	35.94	51.85	SNP	0.754	T	23	41
GPR101	83550	genome.wustl.edu	37	X	136113605	136113605	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chrX:136113605C>A	ENST00000298110.1	-	1	228	c.229G>T	c.(229-231)Gac>Tac	p.D77Y		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					TGCAGCAGGTCGGTGACGAGG	0.607													ENSG00000165370																																					0													57.0	55.0	56.0					X																	136113605		2203	4300	6503	SO:0001583	missense	0			-	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.229G>T	X.37:g.136113605C>A	ENSP00000298110:p.Asp77Tyr		Q5JSM8|Q8NG93	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.D77Y	ENST00000298110.1	37	c.229	CCDS14662.1	X	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938638	0.73557	.	.	ENSG00000165370	ENST00000298110	D	0.88896	-2.44	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.95544	0.8552	M	0.92738	3.34	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.96569	0.9421	9	0.87932	D	0	-26.4374	14.4369	0.67287	0.0:1.0:0.0:0.0	.	77	Q96P66	GP101_HUMAN	Y	77	ENSP00000298110:D77Y	ENSP00000298110:D77Y	D	-	1	0	GPR101	135941271	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.555000	0.67301	1.985000	0.57927	0.544000	0.68410	GAC	-	GPR101	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.607	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR101	HGNC	protein_coding	OTTHUMT00000058519.1	0	0	0	53	53	70	0.00	0.00	C			136113605	-1	23	18	35	26	tier1	no_errors	ENST00000298110	ensembl	human	known	74_37	missense	39.66	40.91	SNP	0.999	A	23	35
GLCCI1	113263	genome.wustl.edu	37	7	8099754	8099754	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr7:8099754C>A	ENST00000223145.5	+	5	1399	c.842C>A	c.(841-843)cCa>cAa	p.P281Q	GLCCI1_ENST00000474269.1_3'UTR	NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	281						cytoplasm (GO:0005737)				endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		GTTCCTATGCCACTGTCAAAT	0.358													ENSG00000106415																																					0													129.0	119.0	122.0					7																	8099754		2203	4300	6503	SO:0001583	missense	0			-	BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.842C>A	7.37:g.8099754C>A	ENSP00000223145:p.Pro281Gln		A4D103|Q96FD0	Missense_Mutation	SNP	NULL	p.P281Q	ENST00000223145.5	37	c.842	CCDS34601.1	7	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233501	0.79688	.	.	ENSG00000106415	ENST00000223145;ENST00000414914	.	.	.	5.14	5.14	0.70334	.	0.159595	0.56097	D	0.000030	T	0.72669	0.3489	M	0.64170	1.965	0.58432	D	0.999999	D	0.56521	0.976	P	0.54060	0.741	T	0.74957	-0.3487	9	0.62326	D	0.03	-29.1835	19.5458	0.95297	0.0:1.0:0.0:0.0	.	281	Q86VQ1	GLCI1_HUMAN	Q	281;139	.	ENSP00000223145:P281Q	P	+	2	0	GLCCI1	8066279	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.081000	0.64444	2.788000	0.95919	0.585000	0.79938	CCA	-	GLCCI1	-	NULL		0.358	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCCI1	HGNC	protein_coding	OTTHUMT00000324672.1	0	0	0	92	92	73	0.00	0.00	C	NM_138426		8099754	+1	56	21	78	24	tier1	no_errors	ENST00000223145	ensembl	human	known	74_37	missense	41.79	46.67	SNP	1.000	A	56	78
PCDH7	5099	genome.wustl.edu	37	4	30725638	30725638	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr4:30725638T>C	ENST00000361762.2	+	1	3602	c.2594T>C	c.(2593-2595)aTa>aCa	p.I865T	PCDH7_ENST00000543491.1_Missense_Mutation_p.I865T	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	865					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						ACCCAGGATATAGCTGGTGAC	0.433													ENSG00000169851																																					0													90.0	89.0	89.0					4																	30725638		2203	4300	6503	SO:0001583	missense	0			-	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2594T>C	4.37:g.30725638T>C	ENSP00000355243:p.Ile865Thr		O60246|O60247|Q4W5C4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I865T	ENST00000361762.2	37	c.2594	CCDS33971.1	4	.	.	.	.	.	.	.	.	.	.	T	15.06	2.722216	0.48728	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.39592	1.07;1.07	4.96	4.96	0.65561	Protocadherin (1);	.	.	.	.	T	0.59998	0.2235	L	0.56769	1.78	0.52501	D	0.999956	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.994;0.994;0.997	T	0.59423	-0.7457	9	0.41790	T	0.15	.	14.7983	0.69894	0.0:0.0:0.0:1.0	.	865;818;865	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	T	865;865;818	ENSP00000355243:I865T;ENSP00000441802:I865T	ENSP00000330302:I818T	I	+	2	0	PCDH7	30334736	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.868000	0.87116	2.084000	0.62774	0.533000	0.62120	ATA	-	PCDH7	-	pfam_Protocadherin		0.433	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	HGNC	protein_coding	OTTHUMT00000360366.1	0	0	0	37	37	77	0.00	0.00	T	NM_032457, NM_002589		30725638	+1	17	35	24	51	tier1	no_errors	ENST00000543491	ensembl	human	known	74_37	missense	41.46	40.70	SNP	1.000	C	17	24
PDE3B	5140	genome.wustl.edu	37	11	14891166	14891166	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr11:14891166A>C	ENST00000282096.4	+	16	3652	c.3299A>C	c.(3298-3300)gAt>gCt	p.D1100A	PDE3B_ENST00000455098.2_Missense_Mutation_p.D1049A	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	1100					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	CCTCAAGCAGATGAGATTCAG	0.428													ENSG00000152270																																					0													100.0	100.0	100.0					11																	14891166		2200	4294	6494	SO:0001583	missense	0			-	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.3299A>C	11.37:g.14891166A>C	ENSP00000282096:p.Asp1100Ala		B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.D1100A	ENST00000282096.4	37	c.3299	CCDS7817.1	11	.	.	.	.	.	.	.	.	.	.	A	17.08	3.298419	0.60195	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.67171	-0.25;-0.17	6.03	4.87	0.63330	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.498735	0.21716	N	0.070186	T	0.65154	0.2664	M	0.72894	2.215	0.46356	D	0.999004	P;P	0.42871	0.792;0.657	B;B	0.37650	0.255;0.255	T	0.72228	-0.4354	10	0.72032	D	0.01	.	13.5498	0.61726	0.8707:0.1293:0.0:0.0	.	1049;1100	B7ZM37;Q13370	.;PDE3B_HUMAN	A	1100;1049	ENSP00000282096:D1100A;ENSP00000388644:D1049A	ENSP00000282096:D1100A	D	+	2	0	PDE3B	14847742	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.135000	0.77276	2.313000	0.78055	0.455000	0.32223	GAT	-	PDE3B	-	NULL		0.428	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1	0	0	0	63	63	72	0.00	0.00	A	NM_000922		14891166	+1	34	26	29	30	tier1	no_errors	ENST00000282096	ensembl	human	known	74_37	missense	53.97	46.43	SNP	1.000	C	34	29
GLCCI1	113263	genome.wustl.edu	37	7	8099753	8099753	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr7:8099753C>A	ENST00000223145.5	+	5	1398	c.841C>A	c.(841-843)Cca>Aca	p.P281T	GLCCI1_ENST00000474269.1_3'UTR	NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	281						cytoplasm (GO:0005737)				endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		AGTTCCTATGCCACTGTCAAA	0.358													ENSG00000106415																																					0													128.0	118.0	122.0					7																	8099753		2203	4300	6503	SO:0001583	missense	0			-	BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.841C>A	7.37:g.8099753C>A	ENSP00000223145:p.Pro281Thr		A4D103|Q96FD0	Missense_Mutation	SNP	NULL	p.P281T	ENST00000223145.5	37	c.841	CCDS34601.1	7	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897540	0.91962	.	.	ENSG00000106415	ENST00000223145;ENST00000414914	.	.	.	5.14	5.14	0.70334	.	0.159595	0.56097	D	0.000030	T	0.77671	0.4165	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	T	0.78663	-0.2116	9	0.66056	D	0.02	-29.1835	19.5458	0.95297	0.0:1.0:0.0:0.0	.	281	Q86VQ1	GLCI1_HUMAN	T	281;139	.	ENSP00000223145:P281T	P	+	1	0	GLCCI1	8066278	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.817000	0.75252	2.788000	0.95919	0.585000	0.79938	CCA	-	GLCCI1	-	NULL		0.358	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCCI1	HGNC	protein_coding	OTTHUMT00000324672.1	0	0	0	91	91	73	0.00	0.00	C	NM_138426		8099753	+1	54	21	77	24	tier1	no_errors	ENST00000223145	ensembl	human	known	74_37	missense	41.22	46.67	SNP	1.000	A	54	77
DYNC2H1	79659	genome.wustl.edu	37	11	103025517	103025517	+	Silent	SNP	A	A	G			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr11:103025517A>G	ENST00000375735.2	+	24	3696	c.3552A>G	c.(3550-3552)caA>caG	p.Q1184Q	DYNC2H1_ENST00000398093.3_Silent_p.Q1184Q|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1184	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGAAATTACAATCAGAGGTTG	0.303													ENSG00000187240																																					0													50.0	45.0	47.0					11																	103025517		1815	4060	5875	SO:0001819	synonymous_variant	0			-	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3552A>G	11.37:g.103025517A>G			O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Q1184	ENST00000375735.2	37	c.3552	CCDS53701.1	11																																																																																			-	DYNC2H1	-	pfam_Dynein_heavy_dom-2		0.303	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	0	0	0	84	84	92	0.00	0.00	A	XM_370652		103025517	+1	50	27	59	50	tier1	no_errors	ENST00000398093	ensembl	human	known	74_37	silent	45.87	35.06	SNP	0.995	G	50	59
ADAM21P1	145241	genome.wustl.edu	37	14	70713492	70713492	+	RNA	SNP	G	G	T			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr14:70713492G>T	ENST00000530196.1	-	0	1026					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		ATGAACGTATGTGCAGCACCA	0.383													ENSG00000235812																																					0																																												0			-			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713492G>T				R	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	ADAM21P1	-	-		0.383	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	0	0	0	76	76	74	0.00	0.00	G	NG_002467		70713492	-1	31	27	57	24	tier1	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	35.23	52.94	SNP	0.369	T	31	57
PCDHA6	56142	genome.wustl.edu	37	5	140208442	140208442	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr5:140208442G>C	ENST00000529310.1	+	1	880	c.766G>C	c.(766-768)Gac>Cac	p.D256H	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.D256H|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	256	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAAAATGCAGACAACGGAAC	0.438													ENSG00000081842																																					0													90.0	85.0	87.0					5																	140208442		2203	4300	6503	SO:0001583	missense	0			-	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.766G>C	5.37:g.140208442G>C	ENSP00000433378:p.Asp256His		O75283|Q9NRT8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D256H	ENST00000529310.1	37	c.766	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	G	1.731	-0.494228	0.04322	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.01887	4.58;4.58	3.7	1.65	0.23941	Cadherin (4);Cadherin-like (1);	1.513640	0.05183	U	0.501775	T	0.04318	0.0119	L	0.58510	1.815	0.09310	N	1	B;B;B	0.13594	0.004;0.008;0.001	B;B;B	0.22601	0.004;0.04;0.001	T	0.42749	-0.9433	10	0.87932	D	0	.	8.4005	0.32583	0.0:0.1444:0.572:0.2836	.	256;256;256	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	H	256	ENSP00000433378:D256H;ENSP00000434113:D256H	ENSP00000434113:D256H	D	+	1	0	PCDHA6	140188626	0.000000	0.05858	0.006000	0.13384	0.273000	0.26683	-0.715000	0.04997	0.861000	0.35504	0.313000	0.20887	GAC	-	PCDHA6	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.438	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	0	0	0	92	92	85	0.00	0.00	G	NM_018909		140208442	+1	46	27	58	33	tier1	no_errors	ENST00000529310	ensembl	human	known	74_37	missense	43.81	45.00	SNP	0.000	C	46	58
TSPAN19	144448	genome.wustl.edu	37	12	85409741	85409741	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr12:85409741T>A	ENST00000532498.2	-	8	684	c.604A>T	c.(604-606)Aat>Tat	p.N202Y	TSPAN19_ENST00000547403.2_5'Flank	NM_001100917.1	NP_001094387.1	P0C672	TSN19_HUMAN	tetraspanin 19	202						integral component of membrane (GO:0016021)				ovary(1)	1						CTGATTTTATTTTCACAACCC	0.284													ENSG00000231738																																					0													36.0	34.0	35.0					12																	85409741		1778	4017	5795	SO:0001583	missense	0			-		CCDS44949.1	12q21.31	2013-02-14			ENSG00000231738	ENSG00000231738		"""Tetraspanins"""	31886	protein-coding gene	gene with protein product							Standard	NM_001100917		Approved		uc009zsj.3	P0C672	OTTHUMG00000166181	ENST00000532498.2:c.604A>T	12.37:g.85409741T>A	ENSP00000433816:p.Asn202Tyr			Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.N202Y	ENST00000532498.2	37	c.604	CCDS44949.1	12	.	.	.	.	.	.	.	.	.	.	T	7.948	0.744308	0.15710	.	.	ENSG00000231738	ENST00000532498	T	0.79554	-1.28	4.06	-2.39	0.06602	Tetraspanin, EC2 domain (1);	.	.	.	.	T	0.68979	0.3060	N	0.14661	0.345	0.09310	N	0.999998	D	0.55385	0.971	P	0.52109	0.69	T	0.60791	-0.7193	9	0.66056	D	0.02	.	4.2716	0.10789	0.1912:0.4547:0.0:0.3541	.	202	P0C672	TSN19_HUMAN	Y	202	ENSP00000433816:N202Y	ENSP00000433816:N202Y	N	-	1	0	TSPAN19	83933872	0.728000	0.28080	0.404000	0.26397	0.019000	0.09904	-0.141000	0.10327	-0.330000	0.08514	-0.262000	0.10625	AAT	-	TSPAN19	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2		0.284	TSPAN19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN19	HGNC	protein_coding	OTTHUMT00000388240.2	0	0	0	102	102	93	0.00	0.00	T	NM_001100917		85409741	-1	409	336	1361	1169	tier1	no_errors	ENST00000532498	ensembl	human	known	74_37	missense	23.09	22.30	SNP	0.449	A	409	1361
CCDC68	80323	genome.wustl.edu	37	18	52604167	52604167	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr18:52604167C>T	ENST00000591504.1	-	6	642	c.368G>A	c.(367-369)gGa>gAa	p.G123E	CCDC68_ENST00000432185.1_Missense_Mutation_p.G123E|CCDC68_ENST00000337363.4_Missense_Mutation_p.G123E	NM_025214.2	NP_079490.1	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68	123										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|stomach(1)	14				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		AGCTGCTGCTCCTGCTTCTCT	0.418													ENSG00000166510																																					0													121.0	106.0	111.0					18																	52604167		2203	4300	6503	SO:0001583	missense	0			-		CCDS11959.1	18q21	2006-02-07			ENSG00000166510	ENSG00000166510			24350	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma associated antigen"""					11149944, 15142679	Standard	NM_025214		Approved	SE57-1	uc002lft.3	Q9H2F9	OTTHUMG00000132708	ENST00000591504.1:c.368G>A	18.37:g.52604167C>T	ENSP00000466690:p.Gly123Glu		B2R9I3	Missense_Mutation	SNP	superfamily_Prefoldin	p.G123E	ENST00000591504.1	37	c.368	CCDS11959.1	18	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449933	0.84101	.	.	ENSG00000166510	ENST00000337363;ENST00000432185	T;T	0.39997	1.05;1.05	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000008	T	0.63510	0.2517	M	0.73598	2.24	0.45541	D	0.998494	D	0.89917	1.0	D	0.97110	1.0	T	0.57154	-0.7860	10	0.20519	T	0.43	-28.4592	16.7359	0.85447	0.0:1.0:0.0:0.0	.	123	Q9H2F9	CCD68_HUMAN	E	123	ENSP00000337209:G123E;ENSP00000413406:G123E	ENSP00000337209:G123E	G	-	2	0	CCDC68	50755165	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.102000	0.57776	2.775000	0.95449	0.650000	0.86243	GGA	-	CCDC68	-	NULL		0.418	CCDC68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC68	HGNC	protein_coding	OTTHUMT00000256006.1	0	0	0	59	59	42	0.00	0.00	C	NM_025214		52604167	-1	31	22	40	15	tier1	no_errors	ENST00000337363	ensembl	human	known	74_37	missense	43.66	59.46	SNP	1.000	T	31	40
DDX27	55661	genome.wustl.edu	37	20	47852789	47852789	+	Intron	SNP	T	T	G			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr20:47852789T>G	ENST00000371764.4	+	13	1611				DDX27_ENST00000484427.1_Intron|ZNFX1_ENST00000469991.1_5'Flank	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACTATCTTCCTTGGACTTTTG	0.498													ENSG00000124228																																					0													123.0	108.0	113.0					20																	47852789		2203	4300	6503	SO:0001627	intron_variant	0			-	AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.1602+21T>G	20.37:g.47852789T>G			A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	R	SNP	-	NULL	ENST00000371764.4	37	NULL	CCDS13416.1	20																																																																																			-	DDX27	-	-		0.498	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX27	HGNC	protein_coding	OTTHUMT00000080485.1	0	0	0	69	69	114	0.00	0.00	T			47852789	+1	32	33	32	45	tier1	no_errors	ENST00000471144	ensembl	human	known	74_37	rna	50.00	42.31	SNP	0.003	G	32	32
TMEM217	221468	genome.wustl.edu	37	6	37186252	37186252	+	Silent	SNP	C	C	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr6:37186252C>A	ENST00000336655.2	-	2	594	c.555G>T	c.(553-555)tcG>tcT	p.S185S	TMEM217_ENST00000356757.2_Silent_p.S185S|TMEM217_ENST00000497775.1_Intron	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217	185						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						tgaacccACTCGAAATTGATA	0.478													ENSG00000172738																																					0													52.0	55.0	54.0					6																	37186252		2203	4299	6502	SO:0001819	synonymous_variant	0			-		CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.555G>T	6.37:g.37186252C>A			Q8TC54	Silent	SNP	NULL	p.S185	ENST00000336655.2	37	c.555	CCDS4831.1	6																																																																																			-	TMEM217	-	NULL		0.478	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM217	HGNC	protein_coding	OTTHUMT00000357542.1	0	0	0	40	40	26	0.00	0.00	C	NM_145316		37186252	-1	29	9	24	10	tier1	no_errors	ENST00000336655	ensembl	human	known	74_37	silent	54.72	47.37	SNP	0.001	A	29	24
DCLRE1A	9937	genome.wustl.edu	37	10	115608781	115608796	+	Frame_Shift_Del	DEL	CTCCTACATTAGATGA	CTCCTACATTAGATGA	-	rs539091187|rs550338406|rs571779693	byFrequency	TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	CTCCTACATTAGATGA	CTCCTACATTAGATGA	CTCCTACATTAGATGA	-	CTCCTACATTAGATGA	CTCCTACATTAGATGA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr10:115608781_115608796delCTCCTACATTAGATGA	ENST00000361384.2	-	2	2985_3000	c.2068_2083delTCATCTAATGTAGGAG	c.(2068-2085)tcatctaatgtaggaggafs	p.SSNVGG690fs	DCLRE1A_ENST00000369305.1_Frame_Shift_Del_p.SSNVGG690fs	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	690					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		TTTCTTGATCCTCCTACATTAGATGACTCTGGGATT	0.352								Other identified genes with known or suspected DNA repair function					ENSG00000198924																																					0																																										SO:0001589	frameshift_variant	0					CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.2068_2083delTCATCTAATGTAGGAG	10.37:g.115608781_115608796delCTCCTACATTAGATGA	ENSP00000355185:p.Ser690fs		D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Frame_Shift_Del	DEL	pfam_DRMBL	p.S690fs	ENST00000361384.2	37	c.2083_2068	CCDS7584.1	10																																																																																				DCLRE1A	-	NULL		0.352	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1A	HGNC	protein_coding	OTTHUMT00000050444.1	0	0	0	70	70	70	0.00	0.00	CTCCTACATTAGATGA	NM_014881		115608796	-1	5	5	35	35	tier1	no_errors	ENST00000361384	ensembl	human	known	74_37	frame_shift_del	12.50	12.50	DEL	0.633:0.630:0.691:0.807:0.800:0.633:0.529:0.443:0.034:0.005:0.003:0.001:0.000:0.006:0.095:0.131	-	5	35
ITPR1	3708	genome.wustl.edu	37	3	4853082	4853082	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr3:4853082delT	ENST00000443694.2	+	53	7361	c.7361delT	c.(7360-7362)cttfs	p.L2454fs	ITPR1_ENST00000423119.2_Frame_Shift_Del_p.L2421fs|ITPR1_ENST00000544951.1_Frame_Shift_Del_p.L432fs|ITPR1_ENST00000354582.6_Frame_Shift_Del_p.L2454fs|ITPR1_ENST00000302640.8_Frame_Shift_Del_p.L2454fs|ITPR1_ENST00000357086.4_Frame_Shift_Del_p.L2421fs|ITPR1_ENST00000456211.2_Frame_Shift_Del_p.L2406fs|ITPR1_ENST00000463980.1_3'UTR|AC018816.3_ENST00000489771.1_5'Flank			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2469					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GTGGGCTATCTTTTCTTCAAG	0.428													ENSG00000150995																																					0													141.0	141.0	141.0					3																	4853082		1965	4147	6112	SO:0001589	frameshift_variant	0				D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.7361delT	3.37:g.4853082delT	ENSP00000401671:p.Leu2454fs		E7EPX7|E9PDE9|Q14660|Q99897	Frame_Shift_Del	DEL	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.F2455fs	ENST00000443694.2	37	c.7361	CCDS54551.1	3																																																																																				ITPR1	-	pfam_Ion_trans_dom		0.428	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	0	0	0	92	92	98	0.00	0.00	T	NM_002222		4853082	+1	41	27	59	60	tier1	no_errors	ENST00000302640	ensembl	human	known	74_37	frame_shift_del	41.00	31.03	DEL	0.999	-	41	59
HR	55806	genome.wustl.edu	37	8	21977962	21977965	+	Frame_Shift_Del	DEL	GCTT	GCTT	-			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	GCTT	GCTT	GCTT	-	GCTT	GCTT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr8:21977962_21977965delGCTT	ENST00000381418.4	-	12	4146_4149	c.2666_2669delAAGC	c.(2665-2670)gaagctfs	p.EA889fs	HR_ENST00000312841.8_Frame_Shift_Del_p.EA889fs	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	889					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		TGCCCCAAGAGCTTCTGTCCCCCA	0.632													ENSG00000168453																																					0																																										SO:0001589	frameshift_variant	0				AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.2666_2669delAAGC	8.37:g.21977962_21977965delGCTT	ENSP00000370826:p.Glu889fs		Q6GS30|Q96H33|Q9NPE1	Frame_Shift_Del	DEL	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.E889fs	ENST00000381418.4	37	c.2669_2666	CCDS6022.1	8																																																																																				HR	-	NULL		0.632	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HR	HGNC	protein_coding	OTTHUMT00000214213.1	0	0	0	38	38	48	0.00	0.00	GCTT			21977965	-1	12	11	18	20	tier1	no_errors	ENST00000381418	ensembl	human	known	74_37	frame_shift_del	40.00	35.48	DEL	0.757:0.809:0.811:0.884	-	12	18
EXOSC8	11340	genome.wustl.edu	37	13	37580294	37580294	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr13:37580294delA	ENST00000389704.3	+	7	652	c.387delA	c.(385-387)ggafs	p.G129fs		NM_181503.2	NP_852480.1	Q96B26	EXOS8_HUMAN	exosome component 8	129					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)			biliary_tract(1)|breast(1)|kidney(2)|pancreas(1)|prostate(1)|skin(1)	7		Lung NSC(96;6.57e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.67e-07)|Epithelial(112;1.31e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00699)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0411)		TTTCTCCAGGAAAGGTAAGAG	0.323													ENSG00000120699																																					0													51.0	52.0	52.0					13																	37580294		2197	4295	6492	SO:0001589	frameshift_variant	0				AF025438	CCDS31958.1	13q13.1	2010-05-07			ENSG00000120699	ENSG00000120699	3.1.13.-		17035	protein-coding gene	gene with protein product	"""CBP-interacting protein 3"", ""Opa interacting protein 2"""	606019				9466265, 11929972	Standard	NM_181503		Approved	OIP2, RRP43, bA421P11.3, Rrp43p, EAP2, p9, CIP3	uc001uwa.3	Q96B26	OTTHUMG00000016742	ENST00000389704.3:c.387delA	13.37:g.37580294delA	ENSP00000374354:p.Gly129fs		O43480|Q5TBA5	Frame_Shift_Del	DEL	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2	p.K130fs	ENST00000389704.3	37	c.387	CCDS31958.1	13																																																																																				EXOSC8	-	pfam_ExoRNase_PH_dom1,superfamily_Ribosomal_S5_D2-typ_fold		0.323	EXOSC8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC8	HGNC	protein_coding	OTTHUMT00000044535.2	0	0	0	107	107	53	0.00	0.00	A	NM_181503		37580294	+1	39	25	55	39	tier1	no_errors	ENST00000389704	ensembl	human	known	74_37	frame_shift_del	41.49	39.06	DEL	0.870	-	39	55
MAP2K1	5604	genome.wustl.edu	37	15	66784398	66784398	+	3'UTR	DEL	A	A	-			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr15:66784398delA	ENST00000307102.5	+	0	3158				SNAPC5_ENST00000395589.2_Intron|CTD-3185P2.2_ENST00000602360.1_RNA|CTD-3185P2.1_ENST00000565387.1_RNA|SNAPC5_ENST00000563480.2_Intron	NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	GACATTAAGCAATGGTTTCCC	0.522													ENSG00000261351																																					0																																										SO:0001624	3_prime_UTR_variant	0				L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.*1445A>-	15.37:g.66784398delA				R	DEL	-	NULL	ENST00000307102.5	37	NULL	CCDS10216.1	15																																																																																				CTD-3185P2.1	-	-		0.522	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261351	Clone_based_vega_gene	protein_coding	OTTHUMT00000256906.4	0	0	0	66	66	121	0.00	0.00	A			66784398	-1	19	42	25	40	tier1	no_errors	ENST00000565387	ensembl	human	known	74_37	rna	43.18	51.22	DEL	0.002	-	19	25
R3HDM1	23518	genome.wustl.edu	37	2	136437847	136437860	+	Frame_Shift_Del	DEL	GCCTGTTTACTATA	GCCTGTTTACTATA	-			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	GCCTGTTTACTATA	GCCTGTTTACTATA	GCCTGTTTACTATA	-	GCCTGTTTACTATA	GCCTGTTTACTATA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr2:136437847_136437860delGCCTGTTTACTATA	ENST00000264160.4	+	20	2677_2690	c.2307_2320delGCCTGTTTACTATA	c.(2305-2322)atgcctgtttactatagtfs	p.PVYYS770fs	R3HDM1_ENST00000410054.1_Frame_Shift_Del_p.PVYYS715fs|R3HDM1_ENST00000329971.3_Frame_Shift_Del_p.PVYYS641fs|R3HDM1_ENST00000409606.1_Frame_Shift_Del_p.PVYYS771fs|R3HDM1_ENST00000409478.1_Frame_Shift_Del_p.PVYYS642fs	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	770							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		CAACAGGAATGCCTGTTTACTATAGTGTCATTCC	0.416													ENSG00000048991																																					0																																										SO:0001589	frameshift_variant	0				D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.2307_2320delGCCTGTTTACTATA	2.37:g.136437847_136437860delGCCTGTTTACTATA	ENSP00000264160:p.Pro770fs		A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Frame_Shift_Del	DEL	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.P770fs	ENST00000264160.4	37	c.2307_2320	CCDS2177.1	2																																																																																				R3HDM1	-	NULL		0.416	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM1	HGNC	protein_coding	OTTHUMT00000254659.1	0	0	0	99	99	99	0.00	0.00	GCCTGTTTACTATA	NM_015361		136437860	+1	10	10	45	45	tier1	no_errors	ENST00000264160	ensembl	human	known	74_37	frame_shift_del	18.18	18.18	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	10	45
CALCR	799	genome.wustl.edu	37	7	93055785	93055785	+	Silent	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr7:93055785G>A	ENST00000394441.1	-	13	1623	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	CALCR_ENST00000360249.4_Silent_p.G452G|CALCR_ENST00000421592.1_Silent_p.G452G|CALCR_ENST00000426151.1_Silent_p.G436G|CALCR_ENST00000359558.2_Silent_p.G470G	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	470					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	TTGGGATGTCGCCAGCCTCCG	0.572													ENSG00000004948																																					0													110.0	109.0	109.0					7																	93055785		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.1308C>T	7.37:g.93055785G>A			A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GCPR_2_calcitonin_rcpt_fam,prints_GPCR_2_secretin-like,prints_GPCR_2_calcitonin_rcpt	p.G470	ENST00000394441.1	37	c.1410	CCDS5631.1	7																																																																																			-	CALCR	-	prints_GPCR_2_calcitonin_rcpt		0.572	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CALCR	HGNC	protein_coding	OTTHUMT00000254661.2	0	0	0	35	35	27	0.00	0.00	G	NM_001742		93055785	-1	23	5	25	7	tier1	no_errors	ENST00000359558	ensembl	human	known	74_37	silent	47.92	41.67	SNP	0.000	A	23	25
COL4A3	1285	genome.wustl.edu	37	2	228122337	228122337	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr2:228122337G>T	ENST00000396578.3	+	18	1168	c.1006G>T	c.(1006-1008)Ggc>Tgc	p.G336C	AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000437673.1_RNA|AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000606119.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	336	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AGGGGACATTGGCCCTCCAGG	0.353													ENSG00000169031																																					0													144.0	135.0	138.0					2																	228122337		1861	4090	5951	SO:0001583	missense	0			-		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.1006G>T	2.37:g.228122337G>T	ENSP00000379823:p.Gly336Cys		Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G336C	ENST00000396578.3	37	c.1006	CCDS42829.1	2	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126521	0.56721	.	.	ENSG00000169031	ENST00000396578	D	0.99637	-6.29	5.96	5.96	0.96718	.	.	.	.	.	D	0.99789	0.9911	H	0.97291	3.975	0.47994	D	0.999567	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79784	0.988;0.988;0.988;0.993	D	0.97222	0.9878	9	0.87932	D	0	.	15.9124	0.79482	0.0:0.0:1.0:0.0	.	336;336;336;336	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	C	336	ENSP00000379823:G336C	ENSP00000379823:G336C	G	+	1	0	COL4A3	227830581	1.000000	0.71417	0.969000	0.41365	0.386000	0.30323	5.591000	0.67536	2.824000	0.97209	0.655000	0.94253	GGC	-	COL4A3	-	pfam_Collagen		0.353	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3	HGNC	protein_coding	OTTHUMT00000331409.2	0	0	0	109	109	104	0.00	0.00	G	NM_000091		228122337	+1	50	37	6	3	tier1	no_errors	ENST00000396578	ensembl	human	known	74_37	missense	89.29	92.50	SNP	0.988	T	50	6
ESYT1	23344	genome.wustl.edu	37	12	56522182	56522182	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr12:56522182delC	ENST00000394048.5	+	1	343	c.79delC	c.(79-81)cccfs	p.P28fs	ESYT1_ENST00000267113.4_Frame_Shift_Del_p.P28fs|RP11-603J24.5_ENST00000549438.1_RNA|RP11-603J24.5_ENST00000550947.1_RNA|ESYT1_ENST00000541590.1_Frame_Shift_Del_p.P28fs	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	28					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CACTGACCAGCCCCCCGCTGC	0.697													ENSG00000139641																																					0													37.0	40.0	39.0					12																	56522182		2200	4299	6499	SO:0001589	frameshift_variant	0				AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.79delC	12.37:g.56522182delC	ENSP00000377612:p.Pro28fs		A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Frame_Shift_Del	DEL	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_C2_dom,pfscan_C2_dom	p.A29fs	ENST00000394048.5	37	c.79	CCDS8904.1	12																																																																																				ESYT1	-	NULL		0.697	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ESYT1	HGNC	protein_coding	OTTHUMT00000407906.1	0	0	0	80	80	14	0.00	0.00	C	NM_015292		56522182	+1	27	5	42	5	tier1	no_errors	ENST00000267113	ensembl	human	known	74_37	frame_shift_del	39.13	50.00	DEL	0.130	-	27	42
ESYT1	23344	genome.wustl.edu	37	12	56522184	56522184	+	Silent	SNP	C	C	G			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr12:56522184C>G	ENST00000394048.5	+	1	345	c.81C>G	c.(79-81)ccC>ccG	p.P27P	ESYT1_ENST00000267113.4_Silent_p.P27P|RP11-603J24.5_ENST00000549438.1_RNA|RP11-603J24.5_ENST00000550947.1_RNA|ESYT1_ENST00000541590.1_Silent_p.P27P	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	27					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CTGACCAGCCCCCCGCTGCTC	0.697													ENSG00000139641																																					0													38.0	41.0	40.0					12																	56522184		2200	4299	6499	SO:0001819	synonymous_variant	0			-	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.81C>G	12.37:g.56522184C>G			A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_C2_dom,pfscan_C2_dom	p.P27	ENST00000394048.5	37	c.81	CCDS8904.1	12																																																																																			-	ESYT1	-	NULL		0.697	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ESYT1	HGNC	protein_coding	OTTHUMT00000407906.1	0	0	0	76	76	14	0.00	0.00	C	NM_015292		56522184	+1	27	5	40	3	tier1	no_errors	ENST00000267113	ensembl	human	known	74_37	silent	40.30	62.50	SNP	0.807	G	27	40
FEZF2	55079	genome.wustl.edu	37	3	62358026	62358026	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr3:62358026T>C	ENST00000283268.3	-	2	812	c.518A>G	c.(517-519)aAc>aGc	p.N173S	FEZF2_ENST00000475839.1_Missense_Mutation_p.N173S|FEZF2_ENST00000486811.1_Missense_Mutation_p.N173S	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	173					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		GTCCAGGTAGTTGAAGTAGTA	0.706													ENSG00000153266																									NSCLC(170;1772 2053 12525 15604 23984)												0													16.0	23.0	20.0					3																	62358026		2202	4283	6485	SO:0001583	missense	0			-	AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.518A>G	3.37:g.62358026T>C	ENSP00000283268:p.Asn173Ser		A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N173S	ENST00000283268.3	37	c.518	CCDS2897.1	3	.	.	.	.	.	.	.	.	.	.	T	16.53	3.150282	0.57151	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	T;T;T	0.08634	3.07;3.07;3.07	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.13500	0.0327	M	0.72894	2.215	0.58432	D	0.999998	B	0.19583	0.037	B	0.15870	0.014	T	0.01553	-1.1326	10	0.66056	D	0.02	-21.4248	14.6274	0.68632	0.0:0.0:0.0:1.0	.	173	Q8TBJ5	FEZF2_HUMAN	S	173	ENSP00000418589:N173S;ENSP00000283268:N173S;ENSP00000418804:N173S	ENSP00000283268:N173S	N	-	2	0	FEZF2	62333066	.	.	1.000000	0.80357	0.997000	0.91878	.	.	1.953000	0.56701	0.454000	0.30748	AAC	-	FEZF2	-	NULL		0.706	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF2	HGNC	protein_coding	OTTHUMT00000351813.1	0	0	0	44	44	30	0.00	0.00	T	NM_018008		62358026	-1	11	11	20	7	tier1	no_errors	ENST00000283268	ensembl	human	known	74_37	missense	35.48	61.11	SNP	1.000	C	11	20
GAB4	128954	genome.wustl.edu	37	22	17447244	17447244	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr22:17447244G>A	ENST00000400588.1	-	6	1141	c.1034C>T	c.(1033-1035)aCg>aTg	p.T345M	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	345										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GCCCACAAGCGTTCTTCCTGG	0.517													ENSG00000215568																																					0													24.0	26.0	26.0					22																	17447244		1979	4185	6164	SO:0001583	missense	0			-	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.1034C>T	22.37:g.17447244G>A	ENSP00000383431:p.Thr345Met			Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T345M	ENST00000400588.1	37	c.1034	CCDS42976.1	22	.	.	.	.	.	.	.	.	.	.	G	9.047	0.991016	0.18966	.	.	ENSG00000215568	ENST00000400588	T	0.17054	2.3	2.96	2.96	0.34315	.	0.664569	0.15254	N	0.272190	T	0.07369	0.0186	N	0.08118	0	0.09310	N	1	D	0.54047	0.964	B	0.34452	0.183	T	0.19516	-1.0303	10	0.46703	T	0.11	.	12.0813	0.53671	0.0:0.0:1.0:0.0	.	345	Q2WGN9	GAB4_HUMAN	M	345	ENSP00000383431:T345M	ENSP00000383431:T345M	T	-	2	0	GAB4	15827244	0.384000	0.25164	0.002000	0.10522	0.001000	0.01503	3.224000	0.51238	1.582000	0.49881	0.411000	0.27672	ACG	-	GAB4	-	NULL		0.517	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB4	HGNC	protein_coding	OTTHUMT00000315426.1	0	0	0	39	39	54	0.00	0.00	G	XM_372882		17447244	-1	11	23	0	2	tier1	no_errors	ENST00000400588	ensembl	human	known	74_37	missense	100.00	92.00	SNP	0.233	A	11	0
HPGD	3248	genome.wustl.edu	37	4	175429244	175429244	+	Intron	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr4:175429244G>A	ENST00000296522.6	-	4	868				HPGD_ENST00000542498.1_Intron|HPGD_ENST00000296521.7_Intron|HPGD_ENST00000510901.1_Intron|HPGD_ENST00000504433.1_Missense_Mutation_p.A171V|HPGD_ENST00000541923.1_Intron|HPGD_ENST00000422112.2_Intron	NM_000860.5|NM_001145816.2|NM_001256301.1|NM_001256307.1	NP_000851.2|NP_001139288.1|NP_001243230.1|NP_001243236.1	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)						arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|ductus arteriosus closure (GO:0097070)|female pregnancy (GO:0007565)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|ovulation (GO:0030728)|parturition (GO:0007567)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|thrombin receptor signaling pathway (GO:0070493)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|catalytic activity (GO:0003824)|NAD binding (GO:0051287)|NAD+ binding (GO:0070403)|prostaglandin E receptor activity (GO:0004957)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(3)|prostate(3)	7		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)		aaggaatccagcagttctaaa	0.483													ENSG00000164120																																					0																																										SO:0001627	intron_variant	0			-		CCDS3821.1, CCDS54821.1, CCDS58933.1, CCDS58934.1, CCDS58935.1	4q34-q35	2011-09-14			ENSG00000164120	ENSG00000164120	1.1.1.141	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	5154	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 36C, member 1"""	601688				19027726	Standard	NM_000860		Approved	SDR36C1	uc003itu.3	P15428	OTTHUMG00000160772	ENST00000296522.6:c.421+602C>T	4.37:g.175429244G>A			B4DTA4|B4DU74|B4DV57|D3DP43|E7EV11|O00749|Q06F08|Q12998	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_ADH_insect,prints_DH_sc/Rdtase_SDR	p.A171V	ENST00000296522.6	37	c.512	CCDS3821.1	4	.	.	.	.	.	.	.	.	.	.	G	6.226	0.409904	0.11812	.	.	ENSG00000164120	ENST00000504433	T	0.74002	-0.8	3.57	-0.389	0.12455	.	.	.	.	.	T	0.53481	0.1799	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34625	-0.9821	8	0.33940	T	0.23	.	1.1748	0.01833	0.1727:0.4397:0.1754:0.2122	.	171	E9PBZ2	.	V	171	ENSP00000420892:A171V	ENSP00000420892:A171V	A	-	2	0	HPGD	175665819	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.117000	0.10708	-0.110000	0.12022	-1.096000	0.02151	GCT	-	HPGD	-	NULL		0.483	HPGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPGD	HGNC	protein_coding	OTTHUMT00000362228.3	0	0	0	124	124	46	0.00	0.00	G			175429244	-1	49	6	5	1	tier1	no_errors	ENST00000504433	ensembl	human	putative	74_37	missense	90.74	85.71	SNP	0.000	A	49	5
LBP	3929	genome.wustl.edu	37	20	36977952	36977952	+	Splice_Site	DEL	G	G	-	rs147682433		TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr20:36977952delG	ENST00000217407.2	+	2	287	c.126delG	c.(124-126)gcg>gc	p.A43fs		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	43					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				TTTCCACAGCGGCCCAGGAGG	0.627													ENSG00000129988																																					0													23.0	22.0	23.0					20																	36977952		2203	4299	6502	SO:0001630	splice_region_variant	0					CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.125-1G>-	20.37:g.36977952delG			B2R938|O43438|Q92672|Q9H403|Q9UD66	Frame_Shift_Del	DEL	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.A43fs	ENST00000217407.2	37	c.126	CCDS13304.1	20																																																																																				LBP	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N		0.627	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LBP	HGNC	protein_coding	OTTHUMT00000079174.2	0	0	0	9	9	21	0.00	0.00	G	NM_004139	Frame_Shift_Del	36977952	+1	4	2	5	5	tier1	no_errors	ENST00000217407	ensembl	human	known	74_37	frame_shift_del	44.44	28.57	DEL	0.870	-	4	5
STYK1	55359	genome.wustl.edu	37	12	10772806	10772806	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr12:10772806T>G	ENST00000075503.3	-	11	1726	c.1206A>C	c.(1204-1206)gaA>gaC	p.E402D		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	402						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						CTGCATACAGTTCAGGTACCA	0.502										HNSCC(73;0.22)			ENSG00000060140																																					0													184.0	175.0	178.0					12																	10772806		2203	4300	6503	SO:0001583	missense	0			-	AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.1206A>C	12.37:g.10772806T>G	ENSP00000075503:p.Glu402Asp		B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E402D	ENST00000075503.3	37	c.1206	CCDS8629.1	12	.	.	.	.	.	.	.	.	.	.	T	15.67	2.903236	0.52333	.	.	ENSG00000060140	ENST00000075503	T	0.78816	-1.21	4.96	-6.26	0.02033	Protein kinase-like domain (1);	0.276103	0.29730	N	0.011357	T	0.60431	0.2268	L	0.41824	1.3	0.37866	D	0.929881	B	0.25390	0.125	B	0.22753	0.041	T	0.26155	-1.0111	10	0.59425	D	0.04	-4.1553	7.7231	0.28744	0.0:0.4083:0.3736:0.218	.	402	Q6J9G0	STYK1_HUMAN	D	402	ENSP00000075503:E402D	ENSP00000075503:E402D	E	-	3	2	STYK1	10664073	0.278000	0.24230	0.961000	0.40146	0.986000	0.74619	-0.913000	0.04042	-0.725000	0.04901	0.460000	0.39030	GAA	-	STYK1	-	superfamily_Kinase-like_dom		0.502	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STYK1	HGNC	protein_coding	OTTHUMT00000399622.1	0	0	0	18	18	60	0.00	0.00	T	NM_018423		10772806	-1	16	32	2	2	tier1	no_errors	ENST00000075503	ensembl	human	known	74_37	missense	88.89	94.12	SNP	0.642	G	16	2
XKR8	55113	genome.wustl.edu	37	1	28293381	28293381	+	Silent	SNP	C	C	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr1:28293381C>A	ENST00000373884.5	+	3	1466	c.858C>A	c.(856-858)atC>atA	p.I286I		NM_018053.2	NP_060523.2	Q9H6D3	XKR8_HUMAN	XK, Kell blood group complex subunit-related family, member 8	286					engulfment of apoptotic cell (GO:0043652)|phosphatidylserine exposure on apoptotic cell surface (GO:0070782)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(1)	4		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;4.72e-24)|Colorectal(126;1.52e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00572)|READ - Rectum adenocarcinoma(331;0.0526)		GCCGGGCCATCATCCACTTCG	0.642													ENSG00000158156																																					0													33.0	33.0	33.0					1																	28293381		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AK091615	CCDS315.1	1p35.3	2008-02-05	2006-01-12		ENSG00000158156	ENSG00000158156			25508	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 8"""			12477932	Standard	NM_018053		Approved	FLJ10307	uc001bph.1	Q9H6D3	OTTHUMG00000003912	ENST00000373884.5:c.858C>A	1.37:g.28293381C>A				Silent	SNP	pfam_Transport_prot_XK	p.I286	ENST00000373884.5	37	c.858	CCDS315.1	1																																																																																			-	XKR8	-	pfam_Transport_prot_XK		0.642	XKR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR8	HGNC	protein_coding	OTTHUMT00000011175.1	0	0	0	55	55	22	0.00	0.00	C	NM_018053		28293381	+1	28	3	24	6	tier1	no_errors	ENST00000373884	ensembl	human	known	74_37	silent	53.85	33.33	SNP	0.999	A	28	24
ZBTB7A	51341	genome.wustl.edu	37	19	4048115	4048115	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr19:4048115G>A	ENST00000322357.4	-	3	1668	c.1390C>T	c.(1390-1392)Cgc>Tgc	p.R464C	ZBTB7A_ENST00000601588.1_Missense_Mutation_p.R464C	NM_015898.2	NP_056982.1	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	464					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTAGGGGCGCAGGCCCGTG	0.657													ENSG00000178951																																					0													67.0	61.0	63.0					19																	4048115		2203	4300	6503	SO:0001583	missense	0			-	AF000561	CCDS12119.1	19p13.3	2013-01-08		2005-04-07		ENSG00000178951		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18078	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 7A, HIV-1 inducer of short transcripts binding protein"", ""lymphoma related factor"""	605878	"""zinc finger and BTB domain containing 7"""	ZBTB7		9973611, 9927193	Standard	NM_015898		Approved	FBI-1, LRF, DKFZp547O146, pokemon, ZNF857A	uc002lzi.3	O95365		ENST00000322357.4:c.1390C>T	19.37:g.4048115G>A	ENSP00000323670:p.Arg464Cys		D6W619|O00456|Q14D41|Q5XG86	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R464C	ENST00000322357.4	37	c.1390	CCDS12119.1	19	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979621	0.74360	.	.	ENSG00000178951	ENST00000322357	T	0.20463	2.07	4.0	4.0	0.46444	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000002	T	0.47432	0.1445	M	0.80982	2.52	0.54753	D	0.999988	D	0.89917	1.0	D	0.79784	0.993	T	0.55075	-0.8197	10	0.87932	D	0	.	13.6099	0.62071	0.0:0.0:1.0:0.0	.	464	O95365	ZBT7A_HUMAN	C	464	ENSP00000323670:R464C	ENSP00000323670:R464C	R	-	1	0	ZBTB7A	3999115	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.328000	0.65887	1.785000	0.52413	0.549000	0.68633	CGC	-	ZBTB7A	-	pfscan_Znf_C2H2		0.657	ZBTB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB7A	HGNC	protein_coding	OTTHUMT00000457621.2	0	0	0	70	70	24	0.00	0.00	G	NM_015898		4048115	-1	27	11	29	5	tier1	no_errors	ENST00000322357	ensembl	human	known	74_37	missense	48.21	68.75	SNP	1.000	A	27	29
YEATS2	55689	genome.wustl.edu	37	3	183520323	183520324	+	Intron	INS	-	-	TATATATATACACGTGTATATATATACACGTGTA	rs11276625|rs74710373	byFrequency	TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr3:183520323_183520324insTATATATATACACGTGTATATATATACACGTGTA	ENST00000305135.5	+	26	3697				AC131160.1_ENST00000401347.1_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			atatacacgtgtatatacacac	0.332													ENSG00000216166																																					0																																										SO:0001627	intron_variant	0				AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3503-720->TATATATATACACGTGTATATATATACACGTGTA	3.37:g.183520323_183520324insTATATATATACACGTGTATATATATACACGTGTA			A7E2B9|D3DNS9|Q641P6|Q9NW96	R	INS	-	NULL	ENST00000305135.5	37	NULL	CCDS43175.1	3																																																																																				AC131160.1	-	-		0.332	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216166	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000346507.2	0	0	0	9	9	9	0.00	0.00	-	NM_018023		183520324	-1	0	0	6	6	tier1	no_errors	ENST00000401347	ensembl	human	novel	74_37	rna	0.00	0.00	INS	0.000:0.000	TATATATATACACGTGTATATATATACACGTGTA	0	6
RP11-782C8.2	0	genome.wustl.edu	37	1	143210640	143210640	+	lincRNA	SNP	C	C	T	rs369337495		TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr1:143210640C>T	ENST00000412204.2	-	0	430				RP11-782C8.1_ENST00000438000.1_lincRNA																							CCCTGAATTACAACAAACTCA	0.269													ENSG00000232274																																					0																																												0			-																													1.37:g.143210640C>T				R	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	RP11-782C8.2	-	-		0.269	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	0	0	0	18	18	1	0.00	0.00	C			143210640	-1	6	0	13	2	tier1	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	31.58	0.00	SNP	0.011	T	6	13
PGS1	9489	genome.wustl.edu	37	17	76374748	76374749	+	Start_Codon_Ins	INS	-	-	GGCGGTGGC			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr17:76374748_76374749insGGCGGTGGC	ENST00000262764.6	+	0	28_29				PGS1_ENST00000329897.7_5'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			CGAGTCTCCATGGCGGTGGCGG	0.738													ENSG00000087157																									Esophageal Squamous(45;182 1126 10685 43198)												0																																										SO:0001582	initiator_codon_variant	0					CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.3_11dupGGCGGTGGC	17.37:g.76374749_76374757dupGGCGGTGGC			B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	In_Frame_Ins	INS	pirsf_PLipase-D_PtdSer-synthase-type,pfscan_PLipase_D/transphosphatidylase	p.5in_frame_insAVA	ENST00000262764.6	37	c.2_3	CCDS42391.1	17																																																																																				PGS1	-	NULL		0.738	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGS1	HGNC	protein_coding	OTTHUMT00000437301.1	0	0	0	0	0	0	0.00	0.00	-	NM_024419		76374749	+1	0	0	0	0	tier1	no_errors	ENST00000262764	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	1.000:1.000	GGCGGTGGC	0	0
TMEM194B	100131211	genome.wustl.edu	37	2	191379397	191379397	+	Silent	SNP	G	G	A			TCGA-DX-AB2H-01A-11D-A38Z-09	TCGA-DX-AB2H-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	82d85c9a-bd66-46f7-b1c3-9554056923aa	d6e07cf0-90ff-4c30-a9f5-733751378913	g.chr2:191379397G>A	ENST00000409150.3	-	7	801	c.735C>T	c.(733-735)gtC>gtT	p.V245V		NM_001142645.1	NP_001136117.1	A6NFY4	T194B_HUMAN	transmembrane protein 194B	245						integral component of membrane (GO:0016021)											CAACTATCAAGACATAGCCTG	0.398													ENSG00000189362																																					0													79.0	73.0	75.0					2																	191379397		692	1591	2283	SO:0001819	synonymous_variant	0			-		CCDS46476.1	2q32.2	2008-06-10			ENSG00000189362	ENSG00000189362			33700	protein-coding gene	gene with protein product							Standard	NM_001142645		Approved		uc010zgf.2	A6NFY4	OTTHUMG00000154454	ENST00000409150.3:c.735C>T	2.37:g.191379397G>A			B4DYG6	Missense_Mutation	SNP	pfam_TMEM194	p.S138F	ENST00000409150.3	37	c.413	CCDS46476.1	2																																																																																			-	TMEM194B	-	NULL		0.398	TMEM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM194B	HGNC	protein_coding	OTTHUMT00000335299.1	0	0	0	67	67	72	0.00	0.00	G	XM_001723498		191379397	-1	32	3	46	36	tier1	no_errors	ENST00000414176	ensembl	human	known	74_37	missense	41.03	7.69	SNP	0.000	A	32	46
