#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TGFBR1	7046	genome.wustl.edu	37	9	101894898	101894898	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr9:101894898C>G	ENST00000374994.4	+	3	568	c.451C>G	c.(451-453)Cgc>Ggc	p.R151G	TGFBR1_ENST00000550253.1_Missense_Mutation_p.R82G|TGFBR1_ENST00000374990.2_Intron|TGFBR1_ENST00000552516.1_Missense_Mutation_p.R155G	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	151					activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CTGCCACAACCGCACTGTCAT	0.463													ENSG00000106799																																					0													174.0	145.0	154.0					9																	101894898		2203	4300	6503	SO:0001583	missense	0			-		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.451C>G	9.37:g.101894898C>G	ENSP00000364133:p.Arg151Gly		Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,superfamily_Quinolinate_PRibosylTrfase_C,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R151G	ENST00000374994.4	37	c.451	CCDS6738.1	9	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960322	0.74016	.	.	ENSG00000106799	ENST00000547314;ENST00000552573;ENST00000374994;ENST00000540092;ENST00000552516;ENST00000548365;ENST00000550253;ENST00000546584	T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05	6.02	6.02	0.97574	.	0.095446	0.85682	D	0.000000	T	0.78610	0.4310	M	0.73217	2.22	0.80722	D	1	D;P	0.67145	0.996;0.843	D;B	0.65573	0.936;0.415	T	0.78043	-0.2358	10	0.56958	D	0.05	.	19.3122	0.94192	0.0:1.0:0.0:0.0	.	86;151	F8VRH6;P36897	.;TGFR1_HUMAN	G	82;86;151;151;155;86;82;148	ENSP00000449934:R82G;ENSP00000447182:R86G;ENSP00000364133:R151G;ENSP00000447297:R155G;ENSP00000448518:R86G;ENSP00000450052:R82G;ENSP00000447707:R148G	ENSP00000364133:R151G	R	+	1	0	TGFBR1	100934719	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.003000	0.70701	2.865000	0.98341	0.655000	0.94253	CGC	-	TGFBR1	-	superfamily_Quinolinate_PRibosylTrfase_C		0.463	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR1	HGNC	protein_coding	OTTHUMT00000053390.3	0	0	0	49	49	72	0.00	0.00	C			101894898	+1	13	24	22	47	tier1	no_errors	ENST00000374994	ensembl	human	known	74_37	missense	37.14	33.33	SNP	1.000	G	13	22
VPS13D	55187	genome.wustl.edu	37	1	12382770	12382770	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:12382770G>A	ENST00000358136.3	+	34	8012	c.7882G>A	c.(7882-7884)Gaa>Aaa	p.E2628K	VPS13D_ENST00000356315.4_Missense_Mutation_p.E2628K	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GGAAATCAGAGAAGGGACAAG	0.468													ENSG00000048707																																					0													87.0	88.0	88.0					1																	12382770		2203	4300	6503	SO:0001583	missense	0			-	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7882G>A	1.37:g.12382770G>A	ENSP00000350854:p.Glu2628Lys			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.E2628K	ENST00000358136.3	37	c.7882	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070425	0.76301	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.53640	0.63;0.61	5.86	5.86	0.93980	UBA-like (1);	0.292909	0.31312	N	0.007866	T	0.35307	0.0927	N	0.22421	0.69	0.80722	D	1	B;B;B	0.27559	0.181;0.015;0.09	B;B;B	0.24541	0.054;0.019;0.024	T	0.17776	-1.0358	10	0.09590	T	0.72	.	20.1802	0.98196	0.0:0.0:1.0:0.0	.	535;2628;2628	B1AJZ2;Q5THJ4-2;Q5THJ4	.;.;VP13D_HUMAN	K	2628	ENSP00000348666:E2628K;ENSP00000350854:E2628K	ENSP00000348666:E2628K	E	+	1	0	VPS13D	12305357	1.000000	0.71417	0.986000	0.45419	0.910000	0.53928	4.395000	0.59678	2.777000	0.95525	0.655000	0.94253	GAA	-	VPS13D	-	superfamily_UBA-like		0.468	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	0	0	0	30	30	107	0.00	0.00	G	NM_015378		12382770	+1	24	41	29	113	tier1	no_errors	ENST00000358136	ensembl	human	known	74_37	missense	45.28	26.28	SNP	0.993	A	24	29
PTPRC	5788	genome.wustl.edu	37	1	198608430	198608430	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:198608430C>G	ENST00000367376.2	+	2	197	c.26C>G	c.(25-27)gCa>gGa	p.A9G	PTPRC_ENST00000367364.1_Missense_Mutation_p.A11G|PTPRC_ENST00000442510.2_Missense_Mutation_p.A11G|PTPRC_ENST00000598951.1_Missense_Mutation_p.A9G|PTPRC_ENST00000348564.6_Missense_Mutation_p.A11G|PTPRC_ENST00000413409.2_Missense_Mutation_p.A11G|PTPRC_ENST00000594404.1_Missense_Mutation_p.A9G|PTPRC_ENST00000391970.3_3'UTR|PTPRC_ENST00000352140.3_Missense_Mutation_p.A9G	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	9					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						AAACTCTTGGCATTTGGCTTT	0.358													ENSG00000081237																																					0													123.0	118.0	120.0					1																	198608430		2203	4300	6503	SO:0001583	missense	0			-	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.26C>G	1.37:g.198608430C>G	ENSP00000356346:p.Ala9Gly		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.A11G	ENST00000367376.2	37	c.32		1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588034	0.86851	.	.	ENSG00000081237	ENST00000367379;ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000271610;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564;ENST00000367364;ENST00000413409;ENST00000418674	T	0.03272	3.99	6.02	6.02	0.97574	Protein tyrosine phosphatase, receptor type, N terminal (1);	0.173638	0.27720	N	0.018139	T	0.15305	0.0369	L	0.52573	1.65	0.35103	D	0.765449	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.83275	0.984;0.996;0.991;0.994;0.962;0.977;0.977;0.991	T	0.00443	-1.1736	10	0.87932	D	0	.	17.703	0.88301	0.0:1.0:0.0:0.0	.	11;11;11;9;11;9;9;9	F5GXZ3;B4DSZ5;Q5T9M4;Q6Q1P2;B1ALS3;E9PC28;P08575;Q0VAE8	.;.;.;.;.;.;PTPRC_HUMAN;.	G	9;11;11;9;9;9;9;9;9;9;9;9;9	ENSP00000193532:A9G	ENSP00000271610:A9G	A	+	2	0	PTPRC	196875053	0.992000	0.36948	0.964000	0.40570	0.937000	0.57800	3.238000	0.51352	2.850000	0.98022	0.650000	0.86243	GCA	-	PTPRC	-	pirsf_Leukocyte_common_ag,pfam_PTP_recept_N		0.358	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		0	0	0	81	81	109	0.00	0.00	C			198608430	+1	38	36	45	42	tier1	no_errors	ENST00000442510	ensembl	human	known	74_37	missense	45.78	46.15	SNP	0.992	G	38	45
LINC00238	440184	genome.wustl.edu	37	14	66965126	66965126	+	lincRNA	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:66965126T>C	ENST00000556874.1	-	0	498				LINC00238_ENST00000389594.3_RNA																							ggaagtcagcttgataataca	0.393													ENSG00000196553																																					0																																												0			-																													14.37:g.66965126T>C				R	SNP	-	NULL	ENST00000556874.1	37	NULL		14																																																																																			-	LINC00238	-	-		0.393	RP11-72M17.1-001	KNOWN	basic	lincRNA	LINC00238	HGNC	lincRNA	OTTHUMT00000412209.1	0	0	0	29	29	104	0.00	0.00	T			66965126	+1	5	16	18	44	tier1	no_errors	ENST00000359454	ensembl	human	known	74_37	rna	21.74	26.67	SNP	0.745	C	5	18
ERH	2079	genome.wustl.edu	37	14	69847207	69847207	+	3'UTR	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:69847207C>A	ENST00000557016.1	-	0	756				ERH_ENST00000216520.6_5'UTR	NM_004450.2	NP_004441.1	P84090	ERH_HUMAN	enhancer of rudimentary homolog (Drosophila)						cell cycle (GO:0007049)|nucleobase-containing compound metabolic process (GO:0006139)|osteoblast differentiation (GO:0001649)|pyrimidine nucleoside metabolic process (GO:0006213)	membrane (GO:0016020)|midbody (GO:0030496)	poly(A) RNA binding (GO:0044822)								all cancers(60;0.00365)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0507)		ACGCTGTACACACCTGTGTTC	0.468													ENSG00000100632																																					0													80.0	81.0	81.0					14																	69847207		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	BC014301	CCDS9794.1	14q24.1	2011-05-18	2001-11-28		ENSG00000100632	ENSG00000100632			3447	protein-coding gene	gene with protein product		601191	"""enhancer of rudimentary (Drosophila) homolog"""			8786099, 9074495	Standard	NM_004450		Approved	DROER	uc001xlc.2	P84090		ENST00000557016.1:c.*48G>T	14.37:g.69847207C>A			B2R5H2|P70659|Q14259	R	SNP	-	NULL	ENST00000557016.1	37	NULL	CCDS9794.1	14																																																																																			-	ERH	-	-		0.468	ERH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERH	HGNC	protein_coding	OTTHUMT00000412990.1	0	0	0	41	41	82	0.00	0.00	C	NM_004450		69847207	-1	17	35	21	24	tier1	no_errors	ENST00000216520	ensembl	human	putative	74_37	rna	44.74	59.32	SNP	1.000	A	17	21
ZNF695	57116	genome.wustl.edu	37	1	247150681	247150681	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:247150681G>T	ENST00000339986.7	-	4	1283	c.1136C>A	c.(1135-1137)cCa>cAa	p.P379Q	ZNF695_ENST00000498046.2_Intron|ZNF695_ENST00000487338.2_Intron	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	379					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ACATTTGTATGGTTTCTCACC	0.408													ENSG00000197472																																					0													50.0	54.0	53.0					1																	247150681		2161	4274	6435	SO:0001583	missense	0			-		CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.1136C>A	1.37:g.247150681G>T	ENSP00000341236:p.Pro379Gln		Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P379Q	ENST00000339986.7	37	c.1136	CCDS44344.1	1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875128	0.51695	.	.	ENSG00000197472	ENST00000339986	T	0.17213	2.29	0.642	-0.575	0.11734	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20941	0.0504	M	0.87038	2.855	0.29547	N	0.851655	B	0.28971	0.229	B	0.21546	0.035	T	0.18587	-1.0332	9	0.87932	D	0	.	5.0372	0.14440	0.2669:0.0:0.7331:0.0	.	379	Q8IW36	ZN695_HUMAN	Q	379	ENSP00000341236:P379Q	ENSP00000341236:P379Q	P	-	2	0	ZNF695	245217304	0.992000	0.36948	0.002000	0.10522	0.793000	0.44817	2.118000	0.41949	-0.247000	0.09597	0.205000	0.17691	CCA	-	ZNF695	-	pfscan_Znf_C2H2		0.408	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF695	HGNC	protein_coding	OTTHUMT00000097823.5	0	0	0	42	42	30	0.00	0.00	G	NM_020394		247150681	-1	23	11	23	19	tier1	no_errors	ENST00000339986	ensembl	human	known	74_37	missense	50.00	36.67	SNP	0.990	T	23	23
DMXL2	23312	genome.wustl.edu	37	15	51791871	51791871	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr15:51791871T>A	ENST00000251076.5	-	18	3837	c.3550A>T	c.(3550-3552)Aca>Tca	p.T1184S	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Intron|DMXL2_ENST00000543779.2_Missense_Mutation_p.T1184S	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1184						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ACTCCCACTGTAAGAATGTGG	0.418													ENSG00000104093																																					0													67.0	63.0	64.0					15																	51791871		2195	4292	6487	SO:0001583	missense	0			-	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.3550A>T	15.37:g.51791871T>A	ENSP00000251076:p.Thr1184Ser		B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T1184S	ENST00000251076.5	37	c.3550	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	T	19.55	3.847967	0.71603	.	.	ENSG00000104093	ENST00000251076;ENST00000543779	T;T	0.35048	1.33;1.33	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.62696	0.2449	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.978	T	0.68428	-0.5411	10	0.72032	D	0.01	.	15.1326	0.72536	0.0:0.0:0.0:1.0	.	1184;1184	F5GWF1;Q8TDJ6	.;DMXL2_HUMAN	S	1184	ENSP00000251076:T1184S;ENSP00000441858:T1184S	ENSP00000251076:T1184S	T	-	1	0	DMXL2	49579163	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.671000	0.83941	1.973000	0.57446	0.482000	0.46254	ACA	-	DMXL2	-	NULL		0.418	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	0	0	0	28	28	76	0.00	0.00	T	NM_015263		51791871	-1	6	10	22	66	tier1	no_errors	ENST00000543779	ensembl	human	known	74_37	missense	21.43	13.16	SNP	1.000	A	6	22
SH2D7	646892	genome.wustl.edu	37	15	78393658	78393658	+	Missense_Mutation	SNP	G	G	A	rs202061655		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr15:78393658G>A	ENST00000328828.5	+	5	1063	c.1063G>A	c.(1063-1065)Ggg>Agg	p.G355R	SH2D7_ENST00000409568.2_Missense_Mutation_p.G219R	NM_001101404.1	NP_001094874.1	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	355										endometrium(2)|kidney(2)|lung(3)	7						TGAGTTCATCGGGACAGAAGG	0.622													ENSG00000183476																																					0													20.0	21.0	21.0					15																	78393658		1923	4123	6046	SO:0001583	missense	0			-		CCDS45315.1	15q25.1	2013-02-14			ENSG00000183476	ENSG00000183476		"""SH2 domain containing"""	34549	protein-coding gene	gene with protein product							Standard	NM_001101404		Approved	LOC646892	uc010blb.1	A6NKC9	OTTHUMG00000154271	ENST00000328828.5:c.1063G>A	15.37:g.78393658G>A	ENSP00000327846:p.Gly355Arg			Missense_Mutation	SNP	NULL	p.G219R	ENST00000328828.5	37	c.655	CCDS45315.1	15	.	.	.	.	.	.	.	.	.	.	G	2.423	-0.332678	0.05314	.	.	ENSG00000183476	ENST00000409568;ENST00000328828	T;T	0.29655	1.56;1.72	4.86	-2.43	0.06522	.	2.867590	0.01057	N	0.004566	T	0.12305	0.0299	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.06405	0.002	T	0.14868	-1.0457	10	0.06757	T	0.87	-0.0103	2.6451	0.04982	0.1876:0.4385:0.2359:0.138	.	355	A6NKC9	SH2D7_HUMAN	R	219;355	ENSP00000386676:G219R;ENSP00000327846:G355R	ENSP00000327846:G355R	G	+	1	0	SH2D7	76180713	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.214000	0.17541	-0.073000	0.12842	-0.150000	0.13652	GGG	rs202061655	SH2D7	-	NULL		0.622	SH2D7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SH2D7	HGNC	protein_coding	OTTHUMT00000334660.2	0	0	0	32	32	45	0.00	0.00	G	NM_001101404		78393658	+1	10	22	29	29	tier1	no_errors	ENST00000409568	ensembl	human	putative	74_37	missense	25.64	43.14	SNP	0.000	A	10	29
DROSHA	29102	genome.wustl.edu	37	5	31526229	31526229	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr5:31526229G>A	ENST00000511367.2	-	4	1055	c.811C>T	c.(811-813)Cga>Tga	p.R271*	DROSHA_ENST00000442743.1_Nonsense_Mutation_p.R271*|DROSHA_ENST00000344624.3_Nonsense_Mutation_p.R271*|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000513349.1_Nonsense_Mutation_p.R271*	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	271	Arg-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						GTTCTCCCTCGGTCATAATCA	0.582													ENSG00000113360																																					0													101.0	103.0	102.0					5																	31526229		2082	4211	6293	SO:0001587	stop_gained	0			-	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.811C>T	5.37:g.31526229G>A	ENSP00000425979:p.Arg271*		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Nonsense_Mutation	SNP	pfam_RNase_III_dom,pfam_dsR-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsR-bd_dom,pfscan_dsR-bd_dom,pfscan_RNase_III_dom	p.R271*	ENST00000511367.2	37	c.811	CCDS47195.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.43|13.43	2.233697|2.233697	0.39498|0.39498	.|.	.|.	ENSG00000113360|ENSG00000113360	ENST00000512076|ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000512302	.|.	.|.	.|.	4.55|4.55	3.6|3.6	0.41247|0.41247	.|.	.|0.185968	.|0.36338	.|N	.|0.002655	T|.	0.26484|.	0.0647|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.24799|.	-1.0150|.	3|.	.|0.02654	.|T	.|1	-9.5588|-9.5588	12.0614|12.0614	0.53564|0.53564	0.0:0.0:0.7578:0.2422|0.0:0.0:0.7578:0.2422	.|.	.|.	.|.	.|.	L|X	100|271;271;271;271;264;264;69	.|.	.|ENSP00000265075:R264X	P|R	-|-	2|1	0|2	DROSHA|DROSHA	31561986|31561986	1.000000|1.000000	0.71417|0.71417	0.292000|0.292000	0.24919|0.24919	0.251000|0.251000	0.25915|0.25915	2.416000|2.416000	0.44644|0.44644	2.348000|2.348000	0.79779|0.79779	0.650000|0.650000	0.86243|0.86243	CCG|CGA	-	DROSHA	-	NULL		0.582	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	0	0	0	39	39	65	0.00	0.00	G	NM_013235		31526229	-1	8	16	50	93	tier1	no_errors	ENST00000344624	ensembl	human	known	74_37	nonsense	13.79	14.68	SNP	0.881	A	8	50
PITPNM1	9600	genome.wustl.edu	37	11	67263036	67263036	+	Silent	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:67263036C>T	ENST00000534749.1	-	15	2543	c.2355G>A	c.(2353-2355)gaG>gaA	p.E785E	PITPNM1_ENST00000356404.3_Silent_p.E785E|PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000436757.2_Silent_p.E784E			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	785	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						TCTCCAGCTCCTCCAGAAAGA	0.662													ENSG00000110697																									GBM(28;144 709 4607 5525)												0													23.0	23.0	23.0					11																	67263036		2198	4289	6487	SO:0001819	synonymous_variant	0			-	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2355G>A	11.37:g.67263036C>T			A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.E785	ENST00000534749.1	37	c.2355	CCDS31620.1	11																																																																																			-	PITPNM1	-	pfam_DDHD,pfscan_DDHD		0.662	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	0	0	0	59	59	14	0.00	0.00	C	NM_004910		67263036	-1	52	7	45	12	tier1	no_errors	ENST00000356404	ensembl	human	known	74_37	silent	53.61	36.84	SNP	0.996	T	52	45
COL5A3	50509	genome.wustl.edu	37	19	10079110	10079110	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr19:10079110T>C	ENST00000264828.3	-	59	4350	c.4265A>G	c.(4264-4266)gAt>gGt	p.D1422G		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1422	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CAACCCCTGATCTCCTTTCTC	0.607													ENSG00000080573																																					0													106.0	119.0	115.0					19																	10079110		2203	4300	6503	SO:0001583	missense	0			-	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4265A>G	19.37:g.10079110T>C	ENSP00000264828:p.Asp1422Gly		Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.D1422G	ENST00000264828.3	37	c.4265	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	T	11.13	1.547765	0.27652	.	.	ENSG00000080573	ENST00000264828	D	0.93426	-3.22	4.13	3.08	0.35506	.	0.000000	0.64402	D	0.000001	D	0.95781	0.8627	M	0.89287	3.02	0.49582	D	0.999807	D	0.67145	0.996	P	0.60609	0.877	D	0.94226	0.7472	10	0.52906	T	0.07	.	7.9718	0.30132	0.1829:0.0:0.0:0.8171	.	1422	P25940	CO5A3_HUMAN	G	1422	ENSP00000264828:D1422G	ENSP00000264828:D1422G	D	-	2	0	COL5A3	9940110	1.000000	0.71417	0.895000	0.35142	0.103000	0.19146	5.557000	0.67313	0.596000	0.29794	0.482000	0.46254	GAT	-	COL5A3	-	NULL		0.607	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	0	0	0	29	29	40	0.00	0.00	T	NM_015719		10079110	-1	15	15	34	16	tier1	no_errors	ENST00000264828	ensembl	human	known	74_37	missense	30.61	48.39	SNP	1.000	C	15	34
WDYHV1	55093	genome.wustl.edu	37	8	124453718	124453718	+	3'UTR	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr8:124453718C>A	ENST00000287387.2	+	0	806				WDYHV1_ENST00000517609.1_3'UTR|WDYHV1_ENST00000523356.1_3'UTR|WDYHV1_ENST00000523984.1_3'UTR|WDYHV1_ENST00000518125.1_3'UTR	NM_018024.1	NP_060494.1	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1						cellular protein modification process (GO:0006464)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein-N-terminal glutamine amidohydrolase activity (GO:0070773)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(3)	17						ATCCTTTCATCGAGGACAGCA	0.368													ENSG00000156795																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK001066	CCDS6344.1, CCDS64965.1	8q24.13	2008-10-01	2008-10-01	2008-10-01		ENSG00000156795			25490	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 32"""	C8orf32		12477932	Standard	NM_018024		Approved	FLJ10204	uc003yqn.1	Q96HA8		ENST00000287387.2:c.*63C>A	8.37:g.124453718C>A			B4DE68|Q9NW95	R	SNP	-	NULL	ENST00000287387.2	37	NULL	CCDS6344.1	8																																																																																			-	WDYHV1	-	-		0.368	WDYHV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDYHV1	HGNC	protein_coding	OTTHUMT00000381772.1	0	0	0	32	32	123	0.00	0.00	C	NM_018024		124453718	+1	9	54	18	95	tier1	no_errors	ENST00000517609	ensembl	human	known	74_37	rna	33.33	36.24	SNP	0.000	A	9	18
NNT	23530	genome.wustl.edu	37	5	43702778	43702778	+	Silent	SNP	A	A	G			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr5:43702778A>G	ENST00000264663.5	+	21	3272	c.3051A>G	c.(3049-3051)caA>caG	p.Q1017Q	NNT_ENST00000512996.2_Silent_p.Q886Q|NNT_ENST00000344920.4_Silent_p.Q1017Q	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	1017					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					CAGCAGCTCAAGAAGATCCCA	0.348													ENSG00000112992																																					0													81.0	77.0	79.0					5																	43702778		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.3051A>G	5.37:g.43702778A>G			Q16796|Q2TB60|Q8N3V4	Silent	SNP	pfam_DH_DH_b,pfam_AlaDH/PNT_D(H)-bd,pfam_AlaDH/PNT_N,tigrfam_DP_transhyd_a	p.Q1017	ENST00000264663.5	37	c.3051	CCDS3949.1	5																																																																																			-	NNT	-	pfam_DH_DH_b		0.348	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNT	HGNC	protein_coding	OTTHUMT00000214026.1	0	0	0	88	88	100	0.00	0.00	A	NM_182977		43702778	+1	53	47	58	59	tier1	no_errors	ENST00000264663	ensembl	human	known	74_37	silent	47.75	44.34	SNP	0.944	G	53	58
GRIK3	2899	genome.wustl.edu	37	1	37271869	37271869	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:37271869G>A	ENST00000373091.3	-	14	2166	c.2150C>T	c.(2149-2151)gCg>gTg	p.A717V	GRIK3_ENST00000373093.4_Missense_Mutation_p.A717V	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	717					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CTTCACCAGCGCCGATGGCTT	0.592													ENSG00000163873																																					0													106.0	92.0	97.0					1																	37271869		2203	4300	6503	SO:0001583	missense	0			-	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2150C>T	1.37:g.37271869G>A	ENSP00000362183:p.Ala717Val		A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A717V	ENST00000373091.3	37	c.2150	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134634	0.21123	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.09073	3.02;3.02	5.48	5.48	0.80851	Ionotropic glutamate receptor (2);	0.069574	0.64402	D	0.000013	T	0.03095	0.0091	N	0.00966	-1.09	0.49130	D	0.999752	B;B	0.15473	0.002;0.013	B;B	0.09377	0.003;0.004	T	0.38802	-0.9644	10	0.02654	T	1	.	19.3336	0.94306	0.0:0.0:1.0:0.0	.	717;717	A9Z1Z8;Q13003	.;GRIK3_HUMAN	V	717	ENSP00000362183:A717V;ENSP00000362185:A717V	ENSP00000362183:A717V	A	-	2	0	GRIK3	37044456	0.999000	0.42202	0.999000	0.59377	0.979000	0.70002	6.604000	0.74150	2.566000	0.86566	0.549000	0.68633	GCG	-	GRIK3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.592	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	0	0	0	26	26	80	0.00	0.00	G	NM_000831		37271869	-1	33	57	13	36	tier1	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	70.21	61.29	SNP	1.000	A	33	13
WARS	7453	genome.wustl.edu	37	14	100828076	100828076	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:100828076A>C	ENST00000355338.2	-	3	900	c.282T>G	c.(280-282)agT>agG	p.S94R	WARS_ENST00000557135.1_Missense_Mutation_p.S94R|WARS_ENST00000392882.2_Missense_Mutation_p.S94R|WARS_ENST00000344102.5_Missense_Mutation_p.S53R|WARS_ENST00000554084.1_5'UTR|WARS_ENST00000358655.4_Missense_Mutation_p.S53R|WARS_ENST00000556645.1_Missense_Mutation_p.S53R	NM_173701.1	NP_776049.1	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase	94					angiogenesis (GO:0001525)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|regulation of angiogenesis (GO:0045765)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)			breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	TGCCTTTTGCACTGCTTGTCT	0.478													ENSG00000140105																																					0													326.0	292.0	303.0					14																	100828076		2203	4300	6503	SO:0001583	missense	0			-	M61715	CCDS9960.1, CCDS9961.1	14q32.2	2014-03-19			ENSG00000140105	ENSG00000140105	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12729	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 1, cytoplasmic"""	191050		IFI53		1537332, 1763065	Standard	NM_004184		Approved	IFP53	uc001yhl.1	P23381	OTTHUMG00000171572	ENST00000355338.2:c.282T>G	14.37:g.100828076A>C	ENSP00000347495:p.Ser94Arg		A6NGN1|A6NID3|P78535|Q502Y0|Q53XB6|Q9UDI5|Q9UDL3	Missense_Mutation	SNP	pfam_aa-tR-synth_Ic,pfam_WHEP-TRS,superfamily_S15_NS1_R-bd,pfscan_WHEP-TRS,prints_Trp-tR-ligase,tigrfam_Trp-tR-ligase	p.S94R	ENST00000355338.2	37	c.282	CCDS9960.1	14	.	.	.	.	.	.	.	.	.	.	A	11.48	1.650593	0.29336	.	.	ENSG00000140105	ENST00000392882;ENST00000358655;ENST00000355338;ENST00000344102;ENST00000557135;ENST00000556645;ENST00000553395;ENST00000556504;ENST00000557722;ENST00000557297;ENST00000556435;ENST00000556338;ENST00000556698;ENST00000553524;ENST00000555410;ENST00000554772;ENST00000556660;ENST00000553413;ENST00000553769;ENST00000553545	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;1.84;1.78;1.82;1.8	5.91	-3.3	0.05003	.	0.102621	0.85682	D	0.000000	T	0.63010	0.2475	L	0.61387	1.9	0.47441	D	0.999426	B	0.13145	0.007	B	0.04013	0.001	T	0.51718	-0.8670	10	0.31617	T	0.26	-0.3145	15.3044	0.73982	0.4038:0.0:0.5962:0.0	.	94	P23381	SYWC_HUMAN	R	94;53;94;53;94;53;53;53;94;53;53;53;94;94;128;94;94;94;94;94	ENSP00000376620:S94R;ENSP00000351481:S53R;ENSP00000347495:S94R;ENSP00000339485:S53R;ENSP00000451460:S94R;ENSP00000451887:S53R;ENSP00000451490:S53R;ENSP00000451251:S53R;ENSP00000450500:S94R;ENSP00000451599:S53R;ENSP00000452519:S53R;ENSP00000451544:S53R;ENSP00000450427:S94R;ENSP00000451349:S94R;ENSP00000450934:S128R;ENSP00000451469:S94R;ENSP00000451402:S94R;ENSP00000452550:S94R;ENSP00000451906:S94R;ENSP00000451716:S94R	ENSP00000339485:S53R	S	-	3	2	WARS	99897829	0.486000	0.25980	0.918000	0.36340	0.345000	0.29048	-0.137000	0.10389	-0.626000	0.05596	-0.290000	0.09829	AGT	-	WARS	-	NULL		0.478	WARS-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WARS	HGNC	protein_coding	OTTHUMT00000414236.1	0	0	0	72	72	76	0.00	0.00	A	NM_004184		100828076	-1	19	14	36	69	tier1	no_errors	ENST00000355338	ensembl	human	known	74_37	missense	34.55	16.87	SNP	0.939	C	19	36
MYO18B	84700	genome.wustl.edu	37	22	26286800	26286800	+	Silent	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr22:26286800G>A	ENST00000407587.2	+	26	4564	c.4395G>A	c.(4393-4395)cgG>cgA	p.R1465R	CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000597614.2_RNA|CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000608507.1_RNA|MYO18B_ENST00000536101.1_Silent_p.R1464R|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|MYO18B_ENST00000335473.7_Silent_p.R1464R			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1464	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AGAGTGAGCGGGCAGAGCGGC	0.602													ENSG00000133454																																					0													57.0	63.0	61.0					22																	26286800		2110	4235	6345	SO:0001819	synonymous_variant	0			-	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4395G>A	22.37:g.26286800G>A			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tR-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1464	ENST00000407587.2	37	c.4392		22																																																																																			-	MYO18B	-	superfamily_tR-bd_arm		0.602	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	0	0	0	48	48	31	0.00	0.00	G	NM_032608		26286800	+1	28	15	26	13	tier1	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	51.85	53.57	SNP	0.998	A	28	26
CRB1	23418	genome.wustl.edu	37	1	197398635	197398635	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:197398635T>A	ENST00000367400.3	+	8	2868	c.2733T>A	c.(2731-2733)tgT>tgA	p.C911*	CRB1_ENST00000535699.1_Nonsense_Mutation_p.C887*|CRB1_ENST00000367397.1_Nonsense_Mutation_p.C292*|CRB1_ENST00000544212.1_Nonsense_Mutation_p.C392*|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367399.2_Nonsense_Mutation_p.C799*	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	911	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ACTTCTCCTGTTCCTGTCCTG	0.537													ENSG00000134376																																					0													177.0	158.0	165.0					1																	197398635		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2733T>A	1.37:g.197398635T>A	ENSP00000356370:p.Cys911*		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Nonsense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.C911*	ENST00000367400.3	37	c.2733	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	T	38	6.745526	0.97809	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	.	.	.	5.55	0.493	0.16878	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8936	0.63755	0.0:0.8558:0.0:0.1442	.	.	.	.	X	887;911;799;392;292;560	.	ENSP00000356367:C292X	C	+	3	2	CRB1	195665258	0.996000	0.38824	0.854000	0.33618	0.737000	0.42083	0.447000	0.21710	0.087000	0.17167	0.533000	0.62120	TGT	-	CRB1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.537	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	0	0	0	47	47	92	0.00	0.00	T	NM_201253		197398635	+1	33	23	45	39	tier1	no_errors	ENST00000367400	ensembl	human	known	74_37	nonsense	42.31	36.51	SNP	1.000	A	33	45
ADAM21P1	145241	genome.wustl.edu	37	14	70713103	70713103	+	RNA	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:70713103T>C	ENST00000530196.1	-	0	1415					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		CACACTGCTGTACGGATCCAC	0.483													ENSG00000235812																																					0																																												0			-			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713103T>C				R	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	ADAM21P1	-	-		0.483	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	0	0	0	69	69	40	0.00	0.00	T	NG_002467		70713103	-1	18	11	40	24	tier1	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	31.03	31.43	SNP	0.002	C	18	40
FAR2P1	440905	genome.wustl.edu	37	2	130792055	130792055	+	RNA	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr2:130792055T>C	ENST00000325390.3	-	0	2743					NR_026758.1																						ATAATTCATCTGATTAAAGCA	0.299													ENSG00000180178																																					0																																												0			-																													2.37:g.130792055T>C				R	SNP	-	NULL	ENST00000325390.3	37	NULL		2																																																																																			-	AC018865.8	-	-		0.299	AC018865.8-002	KNOWN	basic	processed_transcript	LOC440905	Clone_based_vega_gene	pseudogene	OTTHUMT00000331630.3	0	0	0	52	52	35	0.00	0.00	T			130792055	-1	16	4	42	28	tier1	no_errors	ENST00000444030	ensembl	human	known	74_37	rna	27.59	12.50	SNP	0.298	C	16	42
BCLAF1	9774	genome.wustl.edu	37	6	136599135	136599135	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr6:136599135A>T	ENST00000531224.1	-	4	1136	c.884T>A	c.(883-885)aTc>aAc	p.I295N	BCLAF1_ENST00000527759.1_Missense_Mutation_p.I293N|BCLAF1_ENST00000527536.1_Missense_Mutation_p.I295N|BCLAF1_ENST00000392348.2_Missense_Mutation_p.I293N|BCLAF1_ENST00000530767.1_Missense_Mutation_p.I295N|BCLAF1_ENST00000353331.4_Missense_Mutation_p.I293N	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	295					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCGTGAAGGGATGTGATGAAT	0.468													ENSG00000029363																									Colon(142;1534 1789 5427 7063 28491)												0													95.0	83.0	87.0					6																	136599135		2203	4300	6503	SO:0001583	missense	0			-	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.884T>A	6.37:g.136599135A>T	ENSP00000435210:p.Ile295Asn		A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	NULL	p.I295N	ENST00000531224.1	37	c.884	CCDS5177.1	6	.	.	.	.	.	.	.	.	.	.	A	15.57	2.873082	0.51695	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.14640	2.94;2.94;2.94;2.49;2.94;2.94;2.75	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000002	T	0.09202	0.0227	N	0.08118	0	0.80722	D	1	D;D;D;D	0.64830	0.987;0.994;0.987;0.987	P;P;P;P	0.56960	0.696;0.81;0.696;0.696	T	0.34925	-0.9809	10	0.49607	T	0.09	-1.3166	16.182	0.81915	1.0:0.0:0.0:0.0	.	293;293;295;295	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	N	295;293;295;295;293;293;295	ENSP00000435210:I295N;ENSP00000229446:I293N;ENSP00000435441:I295N;ENSP00000436501:I295N;ENSP00000434826:I293N;ENSP00000376159:I293N;ENSP00000431734:I295N	ENSP00000229446:I293N	I	-	2	0	BCLAF1	136640828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.067000	0.64357	2.222000	0.72286	0.528000	0.53228	ATC	-	BCLAF1	-	NULL		0.468	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	HGNC	protein_coding	OTTHUMT00000042375.2	0	0	0	227	227	166	0.00	0.00	A	NM_014739		136599135	-1	31	64	153	130	tier1	no_errors	ENST00000531224	ensembl	human	known	74_37	missense	16.76	32.99	SNP	1.000	T	31	153
UGGT2	55757	genome.wustl.edu	37	13	96513064	96513064	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr13:96513064G>C	ENST00000376747.3	-	32	3788	c.3718C>G	c.(3718-3720)Cat>Gat	p.H1240D		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1240	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TCATATAAATGACCAGAAGCA	0.239													ENSG00000102595																																					0													52.0	53.0	53.0					13																	96513064		2194	4255	6449	SO:0001583	missense	0			-	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3718C>G	13.37:g.96513064G>C	ENSP00000365938:p.His1240Asp		A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.H1240D	ENST00000376747.3	37	c.3718	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114157	0.77210	.	.	ENSG00000102595	ENST00000376747	T	0.19394	2.15	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.59998	0.2235	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72697	-0.4215	10	0.87932	D	0	-14.9908	17.9944	0.89178	0.0:0.0:1.0:0.0	.	1240	Q9NYU1	UGGG2_HUMAN	D	1240	ENSP00000365938:H1240D	ENSP00000365938:H1240D	H	-	1	0	UGGT2	95311065	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	8.699000	0.91316	2.548000	0.85928	0.655000	0.94253	CAT	-	UGGT2	-	NULL		0.239	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	0	0	0	300	300	73	0.00	0.00	G	NM_020121		96513064	-1	64	14	455	122	tier1	no_errors	ENST00000376747	ensembl	human	known	74_37	missense	12.31	10.14	SNP	1.000	C	64	455
OR6C3	254786	genome.wustl.edu	37	12	55725940	55725940	+	Silent	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr12:55725940C>A	ENST00000379667.1	+	1	456	c.456C>A	c.(454-456)acC>acA	p.T152T		NM_054104.1	NP_473445.1	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C, member 3	152					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						GGTTTCTGACCATTTTCCCAC	0.463													ENSG00000205329																																					0													251.0	206.0	221.0					12																	55725940		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF179770	CCDS31819.1	12q13.2	2013-09-23			ENSG00000205329	ENSG00000205329		"""GPCR / Class A : Olfactory receptors"""	15437	protein-coding gene	gene with protein product							Standard	NM_054104		Approved	OST709	uc010spj.2	Q9NZP0	OTTHUMG00000169861	ENST00000379667.1:c.456C>A	12.37:g.55725940C>A				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T152	ENST00000379667.1	37	c.456	CCDS31819.1	12																																																																																			-	OR6C3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.463	OR6C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C3	HGNC	protein_coding	OTTHUMT00000406309.1	0	0	0	53	53	99	0.00	0.00	C			55725940	+1	8	17	53	65	tier1	no_errors	ENST00000379667	ensembl	human	known	74_37	silent	13.11	20.73	SNP	0.000	A	8	53
DNAH11	8701	genome.wustl.edu	37	7	21698459	21698459	+	Missense_Mutation	SNP	C	C	T	rs202034810		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr7:21698459C>T	ENST00000409508.3	+	30	5169	c.5138C>T	c.(5137-5139)aCg>aTg	p.T1713M	DNAH11_ENST00000328843.6_Missense_Mutation_p.T1718M	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1718	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ATGCAAGAAACGGTGCGTCAT	0.423									Kartagener syndrome				ENSG00000105877	C|||	1	0.000199681	0.0008	0.0	5008	,	,		18250	0.0		0.0	False		,,,				2504	0.0																0								C	MET/THR	3,3769		0,3,1883	48.0	45.0	46.0		5153	5.9	0.2	7		46	0,8204		0,0,4102	yes	missense	DNAH11	NM_003777.3	81	0,3,5985	TT,TC,CC		0.0,0.0795,0.0251	probably-damaging	1718/4524	21698459	3,11973	1886	4102	5988	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5138C>T	7.37:g.21698459C>T	ENSP00000475939:p.Thr1713Met		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T1718M	ENST00000409508.3	37	c.5153		7	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474402	0.43942	7.95E-4	0.0	ENSG00000105877	ENST00000328843	T	0.57752	0.38	5.92	5.92	0.95590	Dynein heavy chain, domain-2 (1);	0.161766	0.52532	D	0.000068	T	0.71091	0.3299	.	.	.	0.34212	D	0.67438	D	0.64830	0.994	P	0.58331	0.837	T	0.78797	-0.2063	9	0.87932	D	0	.	19.983	0.97336	0.0:1.0:0.0:0.0	.	1718	Q96DT5	DYH11_HUMAN	M	1718	ENSP00000330671:T1718M	ENSP00000330671:T1718M	T	+	2	0	DNAH11	21664984	0.766000	0.28496	0.214000	0.23707	0.237000	0.25408	3.556000	0.53734	2.826000	0.97356	0.603000	0.83216	ACG	rs202034810	DH11	-	pfam_Dynein_heavy_dom-2		0.423	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DH11	HGNC	protein_coding	OTTHUMT00000326582.6	0	0	1	70	70	85	0.00	1.16	C	NM_003777		21698459	+1	39	40	20	33	tier1	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	66.10	54.79	SNP	0.655	T	39	20
NPTX2	4885	genome.wustl.edu	37	7	98256582	98256582	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr7:98256582C>A	ENST00000265634.3	+	4	1159	c.994C>A	c.(994-996)Ctg>Atg	p.L332M		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	332	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CGGAGAGAAGCTGGGCACTGG	0.647													ENSG00000106236																																					0													96.0	78.0	84.0					7																	98256582		2203	4300	6503	SO:0001583	missense	0			-		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.994C>A	7.37:g.98256582C>A	ENSP00000265634:p.Leu332Met		A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.L332M	ENST00000265634.3	37	c.994	CCDS5657.1	7	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690980	0.88735	.	.	ENSG00000106236	ENST00000265634	T	0.59772	0.24	5.39	5.39	0.77823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.060211	0.64402	D	0.000001	T	0.67088	0.2856	L	0.37507	1.11	0.80722	D	1	D	0.71674	0.998	D	0.66979	0.948	T	0.63278	-0.6673	10	0.33940	T	0.23	-15.4276	18.4968	0.90867	0.0:1.0:0.0:0.0	.	332	P47972	NPTX2_HUMAN	M	332	ENSP00000265634:L332M	ENSP00000265634:L332M	L	+	1	2	NPTX2	98094518	1.000000	0.71417	0.995000	0.50966	0.828000	0.46876	4.874000	0.63064	2.682000	0.91365	0.655000	0.94253	CTG	-	NPTX2	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.647	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX2	HGNC	protein_coding	OTTHUMT00000334982.1	0	0	0	43	43	54	0.00	0.00	C	NM_002523		98256582	+1	21	10	29	33	tier1	no_errors	ENST00000265634	ensembl	human	known	74_37	missense	42.00	23.26	SNP	1.000	A	21	29
RUSC1	23623	genome.wustl.edu	37	1	155290825	155290825	+	Intron	SNP	G	G	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:155290825G>C	ENST00000368352.5	+	1	65				RUSC1_ENST00000368354.3_Intron|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368347.4_5'Flank|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000543656.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			ATGGACCTGGGCACGAGGGGC	0.642													ENSG00000225855																																					0													51.0	61.0	57.0					1																	155290825		2021	4156	6177	SO:0001627	intron_variant	0			-	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.-87+43G>C	1.37:g.155290825G>C			B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	R	SNP	-	NULL	ENST00000368352.5	37	NULL	CCDS41410.1	1																																																																																			-	RUSC1-AS1	-	-		0.642	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1-AS1	HGNC	protein_coding	OTTHUMT00000039071.1	0	0	0	23	23	52	0.00	0.00	G			155290825	-1	19	20	14	22	tier1	no_errors	ENST00000450199	ensembl	human	known	74_37	rna	57.58	47.62	SNP	0.007	C	19	14
DNAH6	1768	genome.wustl.edu	37	2	84885458	84885458	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr2:84885458C>T	ENST00000237449.6	+	35	5808	c.5800C>T	c.(5800-5802)Cgt>Tgt	p.R1934C	DNAH6_ENST00000602588.1_5'UTR|DNAH6_ENST00000398278.2_Missense_Mutation_p.R1934C|DNAH6_ENST00000389394.3_Missense_Mutation_p.R1934C			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1934	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TCTTTTCCAACGTTATGTTGA	0.323													ENSG00000115423																																					0													104.0	89.0	94.0					2																	84885458		692	1590	2282	SO:0001583	missense	0			-	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.5800C>T	2.37:g.84885458C>T	ENSP00000237449:p.Arg1934Cys		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1934C	ENST00000237449.6	37	c.5800	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	C	18.49	3.636419	0.67130	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	D;D;D	0.87491	-2.26;-2.26;-2.26	4.92	3.97	0.46021	.	.	.	.	.	D	0.88142	0.6357	L	0.56769	1.78	0.45439	D	0.998415	D	0.61697	0.99	P	0.51657	0.676	D	0.88346	0.2978	9	0.51188	T	0.08	.	13.2167	0.59865	0.16:0.84:0.0:0.0	.	1934	Q9C0G6	DYH6_HUMAN	C	1934	ENSP00000374045:R1934C;ENSP00000381326:R1934C;ENSP00000237449:R1934C	ENSP00000237449:R1934C	R	+	1	0	DNAH6	84738969	0.988000	0.35896	1.000000	0.80357	0.996000	0.88848	2.581000	0.46077	2.415000	0.81967	0.544000	0.68410	CGT	-	DH6	-	NULL		0.323	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH6	HGNC	protein_coding	OTTHUMT00000328537.2	0	0	0	94	94	90	0.00	0.00	C	NM_001370		84885458	+1	47	43	95	79	tier1	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	33.10	35.25	SNP	0.996	T	47	95
RP11-359E19.1	0	genome.wustl.edu	37	8	39961703	39961703	+	lincRNA	SNP	A	A	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr8:39961703A>T	ENST00000524098.1	+	0	16																											caacacaaaaaaaatgtggct	0.408													ENSG00000253381																																					0													148.0	117.0	126.0					8																	39961703		692	1591	2283			0			-																													8.37:g.39961703A>T				R	SNP	-	NULL	ENST00000524098.1	37	NULL		8																																																																																			-	RP11-359E19.1	-	-		0.408	RP11-359E19.1-001	KNOWN	basic	lincRNA	ENSG00000253381	Clone_based_vega_gene	lincRNA	OTTHUMT00000376941.1	0	0	0	74	74	76	0.00	0.00	A			39961703	+1	37	46	56	61	tier1	no_errors	ENST00000524098	ensembl	human	known	74_37	rna	39.78	42.99	SNP	0.004	T	37	56
KALRN	8997	genome.wustl.edu	37	3	124160810	124160810	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr3:124160810C>T	ENST00000240874.3	+	19	3368	c.3211C>T	c.(3211-3213)Cgg>Tgg	p.R1071W	KALRN_ENST00000460856.1_Missense_Mutation_p.R1062W|KALRN_ENST00000360013.3_Missense_Mutation_p.R1071W	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1071					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CCTGGCTCGGCGGAATGCTGA	0.567													ENSG00000160145																																					0													57.0	53.0	54.0					3																	124160810		2203	4300	6503	SO:0001583	missense	0			-	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3211C>T	3.37:g.124160810C>T	ENSP00000240874:p.Arg1071Trp		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.R1071W	ENST00000240874.3	37	c.3211	CCDS3027.1	3	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174674	0.78452	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.44482	0.92;0.92;0.92	5.22	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.997;0.99;1.0	T	0.66681	-0.5862	10	0.87932	D	0	.	11.4421	0.50102	0.3348:0.6652:0.0:0.0	.	1062;417;1071;1071	C9IZQ6;F2Z3Q6;O60229;O60229-2	.;.;KALRN_HUMAN;.	W	1062;1071;1071	ENSP00000418611:R1062W;ENSP00000240874:R1071W;ENSP00000353109:R1071W	ENSP00000240874:R1071W	R	+	1	2	KALRN	125643500	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.055000	0.57441	2.872000	0.98467	0.650000	0.86243	CGG	-	KALRN	-	NULL		0.567	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258843.4	0	0	0	71	71	64	0.00	0.00	C	NM_003947		124160810	+1	12	11	52	49	tier1	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	18.75	18.33	SNP	1.000	T	12	52
ELSPBP1	64100	genome.wustl.edu	37	19	48517529	48517529	+	Missense_Mutation	SNP	G	G	A	rs145096514	byFrequency	TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr19:48517529G>A	ENST00000339841.2	+	3	350	c.172G>A	c.(172-174)Gtg>Atg	p.V58M	ELSPBP1_ENST00000597519.1_Intron	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	58	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				single fertilization (GO:0007338)	extracellular region (GO:0005576)				NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CACCAGAGCCGTGTACAACGG	0.483													ENSG00000169393	g|||	3	0.000599042	0.0008	0.0	5008	,	,		16494	0.002		0.0	False		,,,				2504	0.0																0													162.0	140.0	148.0					19																	48517529		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.172G>A	19.37:g.48517529G>A	ENSP00000340660:p.Val58Met		Q96RT0|Q9H4C8	Missense_Mutation	SNP	pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.V58M	ENST00000339841.2	37	c.172	CCDS12708.1	19	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	10.17	1.276506	0.23307	.	.	ENSG00000169393	ENST00000339841	T	0.49720	0.77	3.27	-3.13	0.05266	Fibronectin, type II, collagen-binding (4);Kringle-like fold (1);	0.831139	0.09799	N	0.754340	T	0.39860	0.1094	L	0.51914	1.62	0.09310	N	1	P	0.38922	0.651	B	0.41666	0.363	T	0.36040	-0.9764	10	0.33940	T	0.23	.	7.7531	0.28909	0.6183:0.0:0.3817:0.0	.	58	Q96BH3	ESPB1_HUMAN	M	58	ENSP00000340660:V58M	ENSP00000340660:V58M	V	+	1	0	ELSPBP1	53209341	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.847000	0.04331	-0.535000	0.06307	0.544000	0.68410	GTG	rs145096514	ELSPBP1	-	pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd		0.483	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ELSPBP1	HGNC	protein_coding	OTTHUMT00000465207.1	0	0	0	51	51	83	0.00	0.00	G			48517529	+1	36	64	28	47	tier1	no_errors	ENST00000339841	ensembl	human	known	74_37	missense	56.25	57.66	SNP	0.000	A	36	28
TLL2	7093	genome.wustl.edu	37	10	98240208	98240208	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr10:98240208delA	ENST00000357947.3	-	2	409	c.184delT	c.(184-186)tggfs	p.W62fs	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	62					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		ATGTCTCCCCAAAAGACAGCT	0.473													ENSG00000095587																																					0													179.0	156.0	163.0					10																	98240208		2203	4300	6503	SO:0001589	frameshift_variant	0				AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.184delT	10.37:g.98240208delA	ENSP00000350630:p.Trp62fs		A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Frame_Shift_Del	DEL	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,prints_Peptidase_M12A,pfscan_CUB_dom,pfscan_EG-like_dom	p.W62fs	ENST00000357947.3	37	c.184	CCDS7449.1	10																																																																																				TLL2	-	pirsf_BMP_1/tolloid-like		0.473	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1	0	0	0	84	84	101	0.00	0.00	A			98240208	-1	24	15	52	59	tier1	no_errors	ENST00000357947	ensembl	human	known	74_37	frame_shift_del	31.58	20.27	DEL	1.000	-	24	52
KMT2A	4297	genome.wustl.edu	37	11	118352703	118352709	+	Frame_Shift_Del	DEL	TGGTCAT	TGGTCAT	-			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	TGGTCAT	TGGTCAT	TGGTCAT	-	TGGTCAT	TGGTCAT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:118352703_118352709delTGGTCAT	ENST00000389506.5	+	7	3908_3914	c.3908_3914delTGGTCAT	c.(3907-3915)ctggtcatcfs	p.LVI1303fs	KMT2A_ENST00000420751.2_3'UTR|KMT2A_ENST00000354520.4_Frame_Shift_Del_p.LVI1303fs|KMT2A_ENST00000534358.1_Frame_Shift_Del_p.LVI1303fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1303					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CAGCCAGCACTGGTCATCCCGCCTCAG	0.556													ENSG00000118058																																					0																																										SO:0001589	frameshift_variant	0				L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3908_3914delTGGTCAT	11.37:g.118352703_118352709delTGGTCAT	ENSP00000374157:p.Leu1303fs		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.L1303fs	ENST00000389506.5	37	c.3908_3914	CCDS31686.1	11																																																																																				KMT2A	-	pirsf_MeTrfase_trithorax		0.556	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	0	0	0	105	105	105	0.00	0.00	TGGTCAT	NM_005933		118352709	+1	11	11	26	26	tier1	no_errors	ENST00000389506	ensembl	human	known	74_37	frame_shift_del	29.73	29.73	DEL	0.014:0.002:0.006:0.000:0.001:0.000:0.001	-	11	26
ADAD2	161931	genome.wustl.edu	37	16	84230349	84230349	+	Silent	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr16:84230349C>T	ENST00000315906.5	+	9	1675	c.1623C>T	c.(1621-1623)gcC>gcT	p.A541A	ADAD2_ENST00000268624.3_Silent_p.A623A|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	541	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						ACCTCCTGGCCTTGAAGACCT	0.692													ENSG00000140955																																					0													52.0	52.0	52.0					16																	84230349		2200	4300	6500	SO:0001819	synonymous_variant	0			-	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1623C>T	16.37:g.84230349C>T			B2RCL6|Q8NA94	Silent	SNP	pfam_A_deamin,pfam_dsR-bd_dom,smart_A_deamin,pfscan_dsR-bd_dom,pfscan_A_deamin	p.A623	ENST00000315906.5	37	c.1869	CCDS45536.1	16																																																																																			-	ADAD2	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.692	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD2	HGNC	protein_coding	OTTHUMT00000433385.1	0	0	0	23	23	43	0.00	0.00	C	NM_139174		84230349	+1	21	22	8	2	tier1	no_errors	ENST00000268624	ensembl	human	known	74_37	silent	72.41	91.67	SNP	0.996	T	21	8
ATRX	546	genome.wustl.edu	37	X	76952083	76952084	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chrX:76952083_76952084insA	ENST00000373344.5	-	5	565_566	c.351_352insT	c.(349-354)actatgfs	p.M118fs	ATRX_ENST00000373341.1_Frame_Shift_Ins_p.M79fs|ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Frame_Shift_Ins_p.M118fs	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	118					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAGCTCTGCATAGTAATATCAT	0.272			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								SO:0001589	frameshift_variant	0				U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.352dupT	X.37:g.76952084_76952084dupA	ENSP00000362441:p.Met118fs		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Ins	INS	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M117fs	ENST00000373344.5	37	c.352_351	CCDS14434.1	X																																																																																				ATRX	-	NULL		0.272	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	36	36	41	0.00	0.00	-	NM_000489		76952084	-1	25	41	10	6	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_ins	71.43	87.23	INS	1.000:1.000	A	25	10
OR51D1	390038	genome.wustl.edu	37	11	4661964	4661964	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:4661964T>C	ENST00000357605.2	+	1	1020	c.944T>C	c.(943-945)gTc>gCc	p.V315A	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTTCAAGGGTCCTCTGTATG	0.463													ENSG00000197428																																					0													73.0	72.0	72.0					11																	4661964		2201	4298	6499	SO:0001583	missense	0			-	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.944T>C	11.37:g.4661964T>C	ENSP00000350222:p.Val315Ala		B9EIK4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V315A	ENST00000357605.2	37	c.944	CCDS31357.1	11	.	.	.	.	.	.	.	.	.	.	T	5.831	0.337477	0.11013	.	.	ENSG00000197428	ENST00000357605	T	0.39056	1.1	4.7	3.55	0.40652	.	0.176010	0.27302	N	0.019987	T	0.40522	0.1120	M	0.66439	2.03	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.41502	-0.9505	10	0.66056	D	0.02	.	9.6765	0.40043	0.0:0.0:0.1747:0.8253	.	315	Q8NGF3	O51D1_HUMAN	A	315	ENSP00000350222:V315A	ENSP00000350222:V315A	V	+	2	0	OR51D1	4618540	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	0.118000	0.15605	0.905000	0.36596	0.460000	0.39030	GTC	-	OR51D1	-	NULL		0.463	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51D1	HGNC	protein_coding	OTTHUMT00000385956.1	0	0	0	49	49	95	0.00	0.00	T	NM_001004751		4661964	+1	6	6	54	56	tier1	no_errors	ENST00000357605	ensembl	human	known	74_37	missense	9.84	9.68	SNP	0.008	C	6	54
OR6A2	8590	genome.wustl.edu	37	11	6816255	6816255	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:6816255C>A	ENST00000332601.3	-	1	873	c.685G>T	c.(685-687)Gct>Tct	p.A229S		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	229					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGCATCACAGCACCAGTAATG	0.483													ENSG00000184933																																					0													99.0	103.0	102.0					11																	6816255		2201	4296	6497	SO:0001583	missense	0			-	AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.685G>T	11.37:g.6816255C>A	ENSP00000330384:p.Ala229Ser		Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A229S	ENST00000332601.3	37	c.685	CCDS7772.1	11	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609940	0.66558	.	.	ENSG00000184933	ENST00000332601	T	0.00224	8.51	5.07	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.111264	0.39759	N	0.001272	T	0.00210	0.0006	L	0.31526	0.94	0.27349	N	0.956302	P	0.46020	0.871	P	0.51550	0.673	T	0.51276	-0.8726	10	0.41790	T	0.15	.	7.2672	0.26235	0.0:0.7319:0.0:0.2681	.	229	O95222	OR6A2_HUMAN	S	229	ENSP00000330384:A229S	ENSP00000330384:A229S	A	-	1	0	OR6A2	6772831	0.000000	0.05858	0.949000	0.38748	0.964000	0.63967	-0.886000	0.04157	0.842000	0.35045	0.655000	0.94253	GCT	-	OR6A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.483	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6A2	HGNC	protein_coding	OTTHUMT00000385981.1	0	0	0	35	35	112	0.00	0.00	C	NM_003696		6816255	-1	5	4	40	86	tier1	no_errors	ENST00000332601	ensembl	human	known	74_37	missense	11.11	4.44	SNP	0.968	A	5	40
CDRT15L2	256223	genome.wustl.edu	37	17	20483754	20483754	+	Silent	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr17:20483754C>T	ENST00000399044.1	+	2	578	c.558C>T	c.(556-558)ggC>ggT	p.G186G	RP11-434D2.12_ENST00000580931.1_lincRNA	NM_001190790.1	NP_001177719.1	A8MXV6	CD15L_HUMAN	CMT1A duplicated region transcript 15-like 2	186						integral component of membrane (GO:0016021)				central_nervous_system(1)	1						AACATGGAGGCGGAGACCAGG	0.612													ENSG00000214819																																					0																																										SO:0001819	synonymous_variant	0			-		CCDS54096.1	17p11.2	2008-10-30			ENSG00000214819	ENSG00000214819			34075	protein-coding gene	gene with protein product							Standard	NM_001190790		Approved		uc021tsn.1	A8MXV6	OTTHUMG00000059557	ENST00000399044.1:c.558C>T	17.37:g.20483754C>T				Silent	SNP	NULL	p.G186	ENST00000399044.1	37	c.558	CCDS54096.1	17																																																																																			-	CDRT15L2	-	NULL		0.612	CDRT15L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT15L2	HGNC	protein_coding	OTTHUMT00000132432.3	0	0	1	13	13	35	0.00	2.78	C	XM_170840		20483754	+1	11	28	30	36	tier1	no_errors	ENST00000399044	ensembl	human	known	74_37	silent	26.83	43.75	SNP	0.007	T	11	30
C9orf62	157927	genome.wustl.edu	37	9	138235877	138235877	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr9:138235877T>C	ENST00000320778.2	+	2	233	c.83T>C	c.(82-84)cTc>cCc	p.L28P		NM_173520.2	NP_775791.1	Q8N4C0	CI062_HUMAN	chromosome 9 open reading frame 62	28																	GGGAGGGGACTCGTCCCCGCC	0.647											OREG0019607	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000178243																																					0																																										SO:0001583	missense	0			-	BC034752	CCDS59154.1	9q34.3	2008-02-05			ENSG00000178243	ENSG00000178243			28581	protein-coding gene	gene with protein product						12477932	Standard	NM_173520		Approved	MGC35463	uc004cfo.3	Q8N4C0	OTTHUMG00000020900	ENST00000320778.2:c.83T>C	9.37:g.138235877T>C	ENSP00000326574:p.Leu28Pro	1639	Q5T7E2	Missense_Mutation	SNP	NULL	p.L28P	ENST00000320778.2	37	c.83	CCDS59154.1	9	.	.	.	.	.	.	.	.	.	.	T	8.414	0.844940	0.16963	.	.	ENSG00000178243	ENST00000320778	.	.	.	2.58	0.49	0.16861	.	.	.	.	.	T	0.28896	0.0717	.	.	.	0.09310	N	0.999999	B	0.28713	0.22	B	0.26310	0.068	T	0.26643	-1.0097	7	0.87932	D	0	.	4.6375	0.12531	0.0:0.6609:0.0:0.3391	.	28	Q8N4C0	CI062_HUMAN	P	28	.	ENSP00000326574:L28P	L	+	2	0	C9orf62	137375698	0.001000	0.12720	0.001000	0.08648	0.036000	0.12997	0.318000	0.19504	0.101000	0.17610	0.459000	0.35465	CTC	-	C9orf62	-	NULL		0.647	C9orf62-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C9orf62	HGNC	protein_coding	OTTHUMT00000054980.2	0	0	1	31	31	17	0.00	5.26	T	NM_173520		138235877	+1	12	9	21	11	tier1	no_errors	ENST00000320778	ensembl	human	putative	74_37	missense	36.36	45.00	SNP	0.001	C	12	21
FAM109A	144717	genome.wustl.edu	37	12	111800949	111800949	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr12:111800949C>T	ENST00000547838.2	-	2	380	c.283G>A	c.(283-285)Gct>Act	p.A95T	FAM109A_ENST00000450786.2_Silent_p.P75P|FAM109A_ENST00000361483.3_Missense_Mutation_p.A108T|FAM109A_ENST00000548163.1_Missense_Mutation_p.A95T|FAM109A_ENST00000392658.5_Missense_Mutation_p.A95T			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	95	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.A108T(1)|p.A95T(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						TGACTCTCAGCGGCCAGCACG	0.692													ENSG00000198324																																					2	Substitution - Missense(2)	endometrium(2)											17.0	19.0	18.0					12																	111800949		2199	4292	6491	SO:0001583	missense	0			-	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.283G>A	12.37:g.111800949C>T	ENSP00000447353:p.Ala95Thr		J3KP50|Q6PJL9|Q96MH8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A108T	ENST00000547838.2	37	c.322	CCDS9152.1	12	.	.	.	.	.	.	.	.	.	.	C	25.9	4.680211	0.88542	.	.	ENSG00000198324	ENST00000547838;ENST00000361483;ENST00000392658;ENST00000548163;ENST00000547710	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	4.38	4.38	0.52667	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.	.	.	.	T	0.73385	0.3580	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.78886	-0.2027	9	0.48119	T	0.1	.	16.949	0.86239	0.0:1.0:0.0:0.0	.	95;95	Q8N4B1;B4DRN3	SESQ1_HUMAN;.	T	95;108;95;95;95	ENSP00000447353:A95T;ENSP00000354461:A108T;ENSP00000376426:A95T;ENSP00000449994:A95T;ENSP00000447349:A95T	ENSP00000354461:A108T	A	-	1	0	FAM109A	110285332	1.000000	0.71417	0.194000	0.23346	0.761000	0.43186	7.639000	0.83342	1.982000	0.57802	0.561000	0.74099	GCT	-	FAM109A	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.692	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM109A	HGNC	protein_coding	OTTHUMT00000404768.2	0	0	0	27	27	4	0.00	0.00	C	NM_144671		111800949	-1	3	0	14	9	tier1	no_errors	ENST00000361483	ensembl	human	known	74_37	missense	17.65	0.00	SNP	0.999	T	3	14
FRMPD3	84443	genome.wustl.edu	37	X	106846480	106846480	+	Silent	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chrX:106846480G>A	ENST00000276185.4	+	16	5310	c.5310G>A	c.(5308-5310)caG>caA	p.Q1770Q				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1770	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						aacaacaacagcagcagcagc	0.582													ENSG00000147234																																					0													3.0	2.0	2.0					X																	106846480		690	1560	2250	SO:0001819	synonymous_variant	0			-	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5310G>A	X.37:g.106846480G>A			Q96JK8	Silent	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.Q1770	ENST00000276185.4	37	c.5310		X																																																																																			-	FRMPD3	-	NULL		0.582	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	HGNC	protein_coding		0	0	0	29	29	0	0.00	0.00	G	XM_042978		106846480	+1	4	0	39	6	tier1	no_errors	ENST00000276185	ensembl	human	known	74_37	silent	9.30	0.00	SNP	0.516	A	4	39
TCERG1	10915	genome.wustl.edu	37	5	145890060	145890060	+	Nonsense_Mutation	SNP	T	T	G			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr5:145890060T>G	ENST00000296702.5	+	22	3190	c.3152T>G	c.(3151-3153)tTa>tGa	p.L1051*	TCERG1_ENST00000394421.2_Nonsense_Mutation_p.L1030*	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	1051	FF 6.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAAAAATTTTACAGAATGAC	0.413													ENSG00000113649																																					0													89.0	88.0	89.0					5																	145890060		2203	4300	6503	SO:0001587	stop_gained	0			-	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.3152T>G	5.37:g.145890060T>G	ENSP00000296702:p.Leu1051*		Q2NKN2|Q59EA1	Nonsense_Mutation	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.L1051*	ENST00000296702.5	37	c.3152	CCDS4282.1	5	.	.	.	.	.	.	.	.	.	.	T	38	7.273512	0.98179	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7956	16.8061	0.85666	0.0:0.0:0.0:1.0	.	.	.	.	X	1051;1030	.	ENSP00000296702:L1051X	L	+	2	0	TCERG1	145870253	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.990000	0.88215	2.367000	0.80283	0.528000	0.53228	TTA	-	TCERG1	-	pfam_FF_domain,smart_FF_domain		0.413	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	HGNC	protein_coding	OTTHUMT00000251886.1	0	0	0	39	39	54	0.00	0.00	T	NM_001040006		145890060	+1	8	2	71	50	tier1	no_errors	ENST00000296702	ensembl	human	known	74_37	nonsense	10.13	3.85	SNP	1.000	G	8	71
