#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
OR1G1	8390	genome.wustl.edu	37	17	3030438	3030438	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr17:3030438C>A	ENST00000328890.2	-	1	437	c.408G>T	c.(406-408)atG>atT	p.M136I		NM_003555.1	NP_003546.1	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G, member 1	136					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(3)|skin(3)	11						GCCCAGGGCTCATGATCAGAA	0.507													ENSG00000183024																									Colon(127;1481 1654 8243 19426 50557)												0													103.0	92.0	96.0					17																	3030438		2203	4300	6503	SO:0001583	missense	0			-	U04689	CCDS11020.1	17p13.3	2012-08-09			ENSG00000183024	ENSG00000183024		"""GPCR / Class A : Olfactory receptors"""	8204	protein-coding gene	gene with protein product				OR1G2		8004088, 9500546	Standard	NM_003555		Approved	OR17-209	uc002fvc.1	P47890	OTTHUMG00000090618	ENST00000328890.2:c.408G>T	17.37:g.3030438C>A	ENSP00000331545:p.Met136Ile		Q4VBM1|Q6IFL9|Q9UM76	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M136I	ENST00000328890.2	37	c.408	CCDS11020.1	17	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019956	0.75275	.	.	ENSG00000183024	ENST00000328890	T	0.00551	6.65	4.54	4.54	0.55810	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01254	0.0041	M	0.88241	2.94	0.28144	N	0.929655	P	0.43826	0.818	B	0.39419	0.299	T	0.22836	-1.0205	9	0.66056	D	0.02	.	16.1757	0.81847	0.0:1.0:0.0:0.0	.	136	P47890	OR1G1_HUMAN	I	136	ENSP00000331545:M136I	ENSP00000331545:M136I	M	-	3	0	OR1G1	2977188	1.000000	0.71417	0.820000	0.32676	0.965000	0.64279	3.391000	0.52530	2.392000	0.81423	0.530000	0.56133	ATG	-	OR1G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.507	OR1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1G1	HGNC	protein_coding	OTTHUMT00000207206.2	0	0	0	29	29	83	0.00	0.00	C			3030438	-1	19	29	14	29	tier1	no_errors	ENST00000328890	ensembl	human	known	74_37	missense	57.58	50.00	SNP	0.915	A	19	14
GPR98	84059	genome.wustl.edu	37	5	90001356	90001356	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr5:90001356A>G	ENST00000405460.2	+	37	8622	c.8526A>G	c.(8524-8526)atA>atG	p.I2842M		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2842	Calx-beta 20. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGGCTAACATAACAATTCAGC	0.373													ENSG00000164199																																					0													134.0	130.0	131.0					5																	90001356		1873	4103	5976	SO:0001583	missense	0			-	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.8526A>G	5.37:g.90001356A>G	ENSP00000384582:p.Ile2842Met		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.I2842M	ENST00000405460.2	37	c.8526	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	A	10.32	1.317333	0.23908	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.29142	1.58	6.05	-0.668	0.11392	Na-Ca exchanger/integrin-beta4 (1);	1.033940	0.07556	N	0.916233	T	0.15609	0.0376	N	0.08118	0	0.80722	D	1	B;B	0.19706	0.038;0.021	B;B	0.22152	0.038;0.038	T	0.05971	-1.0853	10	0.46703	T	0.11	.	6.1294	0.20197	0.54:0.2188:0.2412:0.0	.	2842;2842	E7ETI5;Q8WXG9	.;GPR98_HUMAN	M	2842	ENSP00000384582:I2842M	ENSP00000296619:I2842M	I	+	3	3	GPR98	90037112	0.001000	0.12720	0.001000	0.08648	0.890000	0.51754	0.045000	0.14013	-0.312000	0.08741	-0.263000	0.10527	ATA	-	GPR98	-	smart_Calx_beta		0.373	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	0	0	0	66	66	103	0.00	0.00	A	NM_032119		90001356	+1	6	17	37	48	tier1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	13.95	26.15	SNP	0.019	G	6	37
KIAA1467	57613	genome.wustl.edu	37	12	13237900	13237900	+	IGR	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr12:13237900G>T	ENST00000197268.8	+	0	4808				GSG1_ENST00000337630.6_Missense_Mutation_p.Q306K|GSG1_ENST00000324458.8_Missense_Mutation_p.Q342K|GSG1_ENST00000396302.3_3'UTR|GSG1_ENST00000537302.1_Missense_Mutation_p.Q278K|GSG1_ENST00000351606.6_3'UTR|GSG1_ENST00000457134.2_Missense_Mutation_p.Q255K|GSG1_ENST00000396310.2_Missense_Mutation_p.Q275K|GSG1_ENST00000432710.2_Missense_Mutation_p.Q319K	NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		GCCCCTCTTTGAAATCCCTTG	0.532													ENSG00000111305																																					0													89.0	97.0	94.0					12																	13237900		1285	2302	3587	SO:0001628	intergenic_variant	0			-	AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67			12.37:g.13237900G>T			Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Missense_Mutation	SNP	pfam_GSG-1	p.Q342K	ENST00000197268.8	37	c.1024	CCDS31750.1	12	.	.	.	.	.	.	.	.	.	.	G	4.796	0.148031	0.09134	.	.	ENSG00000111305	ENST00000337630;ENST00000324458;ENST00000396310;ENST00000457134;ENST00000432710;ENST00000537302;ENST00000405543	T;T;T;T;T;T	0.30714	1.56;1.54;1.52;1.52;1.55;1.52	5.38	4.48	0.54585	.	1.006700	0.08003	U	0.989100	T	0.32734	0.0839	M	0.67953	2.075	0.09310	N	1	B;B;B;B;B	0.32188	0.359;0.075;0.004;0.004;0.075	B;B;B;B;B	0.29716	0.106;0.03;0.005;0.005;0.049	T	0.17961	-1.0352	10	0.23302	T	0.38	.	10.7423	0.46160	0.146:0.0:0.854:0.0	.	319;329;255;278;306	Q2KHT4-6;Q2KHT4;Q2KHT4-5;Q2KHT4-2;F1T0A1	.;GSG1_HUMAN;.;.;.	K	306;342;275;255;319;278;320	ENSP00000336816:Q306K;ENSP00000320838:Q342K;ENSP00000379604:Q275K;ENSP00000398384:Q255K;ENSP00000405032:Q319K;ENSP00000441718:Q278K	ENSP00000320838:Q342K	Q	-	1	0	GSG1	13129167	0.957000	0.32711	0.006000	0.13384	0.017000	0.09413	4.664000	0.61540	2.524000	0.85096	0.561000	0.74099	CAA	-	GSG1	-	NULL		0.532	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG1	HGNC	protein_coding	OTTHUMT00000401007.1	0	0	0	70	70	97	0.00	0.00	G	NM_020853		13237900	-1	23	21	69	89	tier1	no_errors	ENST00000324458	ensembl	human	known	74_37	missense	25.00	18.75	SNP	0.001	T	23	69
EMR2	30817	genome.wustl.edu	37	19	14877108	14877108	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr19:14877108G>T	ENST00000315576.3	-	7	1024	c.573C>A	c.(571-573)tgC>tgA	p.C191*	EMR2_ENST00000346057.1_Intron|EMR2_ENST00000353005.1_Intron|EMR2_ENST00000392965.3_Nonsense_Mutation_p.C191*|EMR2_ENST00000595839.1_Intron|EMR2_ENST00000596991.2_Nonsense_Mutation_p.C191*|EMR2_ENST00000601345.1_Nonsense_Mutation_p.C191*|EMR2_ENST00000353876.1_Intron|EMR2_ENST00000392964.3_Intron|EMR2_ENST00000594076.1_Intron|EMR2_ENST00000594294.1_Intron|EMR2_ENST00000392967.2_Nonsense_Mutation_p.C191*|EMR2_ENST00000599423.1_5'Flank	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	191	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						AGCCCGGGCGGCAGCGGCACT	0.587													ENSG00000127507																																					0													84.0	87.0	86.0					19																	14877108		2203	4297	6500	SO:0001587	stop_gained	0			-	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.573C>A	19.37:g.14877108G>T	ENSP00000319883:p.Cys191*		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.C191*	ENST00000315576.3	37	c.573	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	G	38	6.741500	0.97805	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000360222;ENST00000392965	.	.	.	3.04	2.0	0.26442	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.201	0.20575	0.1414:0.0:0.8586:0.0	.	.	.	.	X	191	.	ENSP00000319883:C191X	C	-	3	2	EMR2	14738108	0.037000	0.19845	0.481000	0.27354	0.020000	0.10135	0.043000	0.13971	0.867000	0.35654	0.494000	0.49563	TGC	-	EMR2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.587	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	0	0	0	54	54	41	0.00	0.00	G			14877108	-1	39	10	27	12	tier1	no_errors	ENST00000315576	ensembl	human	known	74_37	nonsense	59.09	45.45	SNP	0.597	T	39	27
OBSCN	84033	genome.wustl.edu	37	1	228447341	228447341	+	Intron	SNP	C	C	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:228447341C>A	ENST00000422127.1	+	15	4629				OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000570156.2_Missense_Mutation_p.S1667R|OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000359599.6_Missense_Mutation_p.S139R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGAAGCTGAGCTCCAGCTTGA	0.622													ENSG00000154358																																					0													112.0	103.0	106.0					1																	228447341		876	1991	2867	SO:0001627	intron_variant	0			-	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4585+2714C>A	1.37:g.228447341C>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.S1667R	ENST00000422127.1	37	c.5001	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	.	9.168	1.020320	0.19433	.	.	ENSG00000154358	ENST00000359599	T	0.66815	-0.23	5.25	-1.83	0.07833	.	.	.	.	.	T	0.52565	0.1742	.	.	.	0.28459	N	0.915975	.	.	.	.	.	.	T	0.44682	-0.9312	6	0.13853	T	0.58	.	13.8397	0.63430	0.0:0.7619:0.0:0.2381	.	.	.	.	R	139	ENSP00000352613:S139R	ENSP00000352613:S139R	S	+	3	2	OBSCN	226513964	0.000000	0.05858	0.027000	0.17364	0.009000	0.06853	-0.224000	0.09164	-0.309000	0.08779	-0.140000	0.14226	AGC	-	OBSCN	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.622	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		0	0	0	79	79	44	0.00	0.00	C	NM_052843		228447341	+1	7	6	48	16	tier1	no_errors	ENST00000570156	ensembl	human	putative	74_37	missense	12.73	27.27	SNP	0.031	A	7	48
LARP6	55323	genome.wustl.edu	37	15	71124995	71124995	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr15:71124995A>G	ENST00000299213.8	-	3	942	c.872T>C	c.(871-873)aTt>aCt	p.I291T	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	291	RRM.				regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						CTTCATACCAATCAGGACAGC	0.498													ENSG00000166173																																					0													135.0	128.0	130.0					15																	71124995		2199	4297	6496	SO:0001583	missense	0			-	BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.872T>C	15.37:g.71124995A>G	ENSP00000299213:p.Ile291Thr		Q5XKE4|Q8N3N2|Q9NUR0	Missense_Mutation	SNP	pfam_Lupus_La_R-bd,smart_Lupus_La_R-bd,pfscan_Lupus_La_R-bd,prints_Lupus_La	p.I291T	ENST00000299213.8	37	c.872	CCDS32281.1	15	.	.	.	.	.	.	.	.	.	.	A	19.80	3.895641	0.72639	.	.	ENSG00000166173	ENST00000299213	T	0.48201	0.82	5.04	5.04	0.67666	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.56673	0.2001	L	0.60455	1.87	0.80722	D	1	D	0.57257	0.979	P	0.54270	0.747	T	0.60652	-0.7221	10	0.62326	D	0.03	-12.7028	12.7328	0.57206	1.0:0.0:0.0:0.0	.	291	Q9BRS8	LARP6_HUMAN	T	291	ENSP00000299213:I291T	ENSP00000299213:I291T	I	-	2	0	LARP6	68912049	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	8.811000	0.91954	1.905000	0.55150	0.454000	0.30748	ATT	-	LARP6	-	NULL		0.498	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP6	HGNC	protein_coding	OTTHUMT00000417197.2	0	0	1	88	88	101	0.00	0.98	A	NM_018357		71124995	-1	26	18	69	70	tier1	no_errors	ENST00000299213	ensembl	human	known	74_37	missense	27.37	20.45	SNP	1.000	G	26	69
PPFIA1	8500	genome.wustl.edu	37	11	70189796	70189796	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr11:70189796G>T	ENST00000253925.7	+	15	1944	c.1729G>T	c.(1729-1731)Gat>Tat	p.D577Y	AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.D577Y	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	577					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TAATGAGCAGGATTGGGAACG	0.403													ENSG00000131626																																					0													93.0	75.0	81.0					11																	70189796		2200	4294	6494	SO:0001583	missense	0			-	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.1729G>T	11.37:g.70189796G>T	ENSP00000253925:p.Asp577Tyr		A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.D577Y	ENST00000253925.7	37	c.1729	CCDS31627.1	11	.	.	.	.	.	.	.	.	.	.	G	28.3	4.907134	0.92107	.	.	ENSG00000131626	ENST00000253925;ENST00000389547;ENST00000544950	T;T	0.50813	0.73;0.73	5.3	5.3	0.74995	.	0.063084	0.64402	D	0.000008	T	0.68265	0.2982	M	0.72894	2.215	0.58432	D	0.999998	D;D	0.76494	0.993;0.999	P;D	0.65987	0.873;0.94	T	0.71928	-0.4444	10	0.87932	D	0	.	18.9692	0.92708	0.0:0.0:1.0:0.0	.	577;577	Q13136;Q13136-2	LIPA1_HUMAN;.	Y	577;577;64	ENSP00000253925:D577Y;ENSP00000374198:D577Y	ENSP00000253925:D577Y	D	+	1	0	PPFIA1	69867444	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	9.577000	0.98196	2.484000	0.83849	0.561000	0.74099	GAT	-	PPFIA1	-	NULL		0.403	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA1	HGNC	protein_coding	OTTHUMT00000393905.1	0	0	0	43	43	88	0.00	0.00	G	NM_003626		70189796	+1	11	25	21	44	tier1	no_errors	ENST00000253925	ensembl	human	known	74_37	missense	34.38	36.23	SNP	1.000	T	11	21
MEG3	55384	genome.wustl.edu	37	14	101300787	101300787	+	RNA	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr14:101300787C>T	ENST00000554041.1	-	0	270																											TAACTCCCCACGTCCCCATCC	0.572													ENSG00000214548																																					0																																												0			-																													14.37:g.101300787C>T				R	SNP	-	NULL	ENST00000554041.1	37	NULL		14																																																																																			-	MEG3	-	-		0.572	RP11-123M6.2-001	KNOWN	basic	antisense	MEG3	HGNC	antisense	OTTHUMT00000414687.1	0	0	0	78	78	170	0.00	0.00	C			101300787	+1	9	17	66	106	tier1	no_errors	ENST00000398461	ensembl	human	known	74_37	rna	12.00	13.82	SNP	0.001	T	9	66
NDST4	64579	genome.wustl.edu	37	4	115997952	115997952	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr4:115997952G>A	ENST00000264363.2	-	2	919	c.241C>T	c.(241-243)Ctt>Ttt	p.L81F		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	81	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		ACGAAGAGAAGGACAGTAGGG	0.433													ENSG00000138653																																					0													166.0	184.0	178.0					4																	115997952		2203	4300	6503	SO:0001583	missense	0			-	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.241C>T	4.37:g.115997952G>A	ENSP00000264363:p.Leu81Phe		Q2KHM8	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.L81F	ENST00000264363.2	37	c.241	CCDS3706.1	4	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350954	0.41599	.	.	ENSG00000138653	ENST00000264363	T	0.59083	0.29	5.41	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.75671	0.3881	M	0.85373	2.75	0.53688	D	0.99997	D	0.89917	1.0	D	0.91635	0.999	T	0.78735	-0.2088	10	0.87932	D	0	.	9.8691	0.41164	0.1523:0.0:0.8477:0.0	.	81	Q9H3R1	NDST4_HUMAN	F	81	ENSP00000264363:L81F	ENSP00000264363:L81F	L	-	1	0	NDST4	116217401	1.000000	0.71417	0.964000	0.40570	0.381000	0.30169	4.080000	0.57620	2.524000	0.85096	0.467000	0.42956	CTT	-	NDST4	-	pfam_Heparan_SO4_deacetylase		0.433	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	HGNC	protein_coding	OTTHUMT00000256427.1	0	0	0	94	94	116	0.00	0.00	G	NM_022569		115997952	-1	25	28	52	69	tier1	no_errors	ENST00000264363	ensembl	human	known	74_37	missense	32.05	28.87	SNP	0.968	A	25	52
SPIN4	139886	genome.wustl.edu	37	X	62570182	62570182	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chrX:62570182C>T	ENST00000335144.3	-	1	1036	c.517G>A	c.(517-519)Gat>Aat	p.D173N	SPIN4-AS1_ENST00000451979.1_RNA|SPIN4_ENST00000374884.2_Missense_Mutation_p.D155N	NM_001012968.2	NP_001012986.2	Q56A73	SPIN4_HUMAN	spindlin family, member 4	173					gamete generation (GO:0007276)					endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	11						AAGTCACCATCTTTGTAGTCA	0.483													ENSG00000186767																																					0													150.0	140.0	143.0					X																	62570182		2025	4173	6198	SO:0001583	missense	0			-	AK126931	CCDS43964.1	Xq11.1	2008-02-05			ENSG00000186767	ENSG00000186767			27040	protein-coding gene	gene with protein product						12477932	Standard	NM_001012968		Approved	FLJ44984	uc004dvf.3	Q56A73	OTTHUMG00000021696	ENST00000335144.3:c.517G>A	X.37:g.62570182C>T	ENSP00000334163:p.Asp173Asn		B3KX90|Q5JUL2	Missense_Mutation	SNP	pfam_Spin_Ssty	p.D173N	ENST00000335144.3	37	c.517	CCDS43964.1	X	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210508	0.79240	.	.	ENSG00000186767	ENST00000374884;ENST00000335144	T;T	0.46451	0.88;0.87	3.76	3.76	0.43208	.	0.000000	0.85682	D	0.000000	T	0.37073	0.0990	L	0.43152	1.355	0.47621	D	0.999473	P	0.41420	0.749	B	0.40602	0.334	T	0.42050	-0.9474	10	0.87932	D	0	-36.6044	12.6174	0.56584	0.0:1.0:0.0:0.0	.	173	Q56A73	SPIN4_HUMAN	N	155;173	ENSP00000364018:D155N;ENSP00000334163:D173N	ENSP00000334163:D173N	D	-	1	0	SPIN4	62486907	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	6.280000	0.72626	2.130000	0.65690	0.544000	0.68410	GAT	-	SPIN4	-	NULL		0.483	SPIN4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN4	HGNC	protein_coding		0	0	0	44	44	113	0.00	0.00	C	NM_001012968		62570182	-1	9	31	30	60	tier1	no_errors	ENST00000335144	ensembl	human	known	74_37	missense	23.08	34.07	SNP	1.000	T	9	30
OR51F1	256892	genome.wustl.edu	37	11	4790430	4790430	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr11:4790430A>G	ENST00000380383.1	-	1	738	c.739T>C	c.(739-741)Ttc>Ctc	p.F247L	OR51F1_ENST00000343430.3_Missense_Mutation_p.F240L|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		CAGGTGCTGAAGACCTTGTGC	0.493													ENSG00000188069																																					0													110.0	100.0	103.0					11																	4790430		2201	4298	6499	SO:0001583	missense	0			-	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.739T>C	11.37:g.4790430A>G	ENSP00000369744:p.Phe247Leu			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F247L	ENST00000380383.1	37	c.739		11	.	.	.	.	.	.	.	.	.	.	A	3.087	-0.187782	0.06299	.	.	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.00269	8.37;8.37	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000018	T	0.00144	0.0004	N	0.13235	0.315	0.27264	N	0.958553	B	0.25486	0.127	B	0.34590	0.186	T	0.35226	-0.9797	10	0.02654	T	1	.	14.0937	0.65006	1.0:0.0:0.0:0.0	.	247	A6NGY5	O51F1_HUMAN	L	240;247	ENSP00000345163:F240L;ENSP00000369744:F247L	ENSP00000345163:F240L	F	-	1	0	OR51F1	4747006	0.005000	0.15991	0.483000	0.27378	0.872000	0.50106	0.139000	0.16036	2.202000	0.70862	0.533000	0.62120	TTC	-	OR51F1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.493	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	OR51F1	HGNC	protein_coding		0	0	0	71	71	134	0.00	0.00	A	NM_001004752		4790430	-1	5	14	30	44	tier1	no_errors	ENST00000380383	ensembl	human	known	74_37	missense	14.29	24.14	SNP	0.829	G	5	30
PIK3C2G	5288	genome.wustl.edu	37	12	18649044	18649044	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr12:18649044A>G	ENST00000266497.5	+	19	2757	c.2719A>G	c.(2719-2721)Atc>Gtc	p.I907V	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.I948V|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.I907V			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	907					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				GATTACTTTCATCAATGCTAA	0.333													ENSG00000139144																																					0													109.0	95.0	99.0					12																	18649044		1821	4072	5893	SO:0001583	missense	0			-	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.2719A>G	12.37:g.18649044A>G	ENSP00000266497:p.Ile907Val		A1L3U0	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.I948V	ENST00000266497.5	37	c.2842	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	A	3.858	-0.030521	0.07543	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.80738	-1.41;-1.41;-1.41	4.47	0.677	0.17964	Protein kinase-like domain (1);	0.202582	0.40469	N	0.001093	T	0.67059	0.2853	L	0.27053	0.805	0.34306	D	0.684946	P;P;P	0.45283	0.773;0.855;0.773	B;P;B	0.47915	0.358;0.561;0.358	T	0.65134	-0.6242	10	0.21014	T	0.42	-2.9402	2.593	0.04847	0.4816:0.2967:0.0791:0.1425	.	947;948;907	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	V	907;907;948	ENSP00000404845:I907V;ENSP00000266497:I907V;ENSP00000445381:I948V	ENSP00000266497:I907V	I	+	1	0	PIK3C2G	18540311	0.005000	0.15991	0.999000	0.59377	0.997000	0.91878	-0.547000	0.06055	0.102000	0.17638	0.528000	0.53228	ATC	-	PIK3C2G	-	superfamily_Kinase-like_dom		0.333	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	0	0	0	59	59	48	0.00	0.00	A	NM_004570		18649044	+1	17	27	63	68	tier1	no_errors	ENST00000538779	ensembl	human	known	74_37	missense	21.25	28.12	SNP	0.987	G	17	63
NCALD	83988	genome.wustl.edu	37	8	102731522	102731522	+	Silent	SNP	T	T	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr8:102731522T>C	ENST00000311028.3	-	5	714	c.336A>G	c.(334-336)ggA>ggG	p.G112G	NCALD_ENST00000521599.1_Silent_p.G112G|NCALD_ENST00000522951.1_Silent_p.G112G|NCALD_ENST00000395923.1_Silent_p.G112G|NCALD_ENST00000519508.2_Silent_p.G112G|NCALD_ENST00000220931.6_Silent_p.G112G	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta	112	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			TATAGCCATTTCCGTCCAGGT	0.458													ENSG00000104490																																					0													129.0	122.0	124.0					8																	102731522		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.336A>G	8.37:g.102731522T>C			P29554|Q8IYC3|Q9H0W2	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.G112	ENST00000311028.3	37	c.336	CCDS6292.1	8																																																																																			-	NCALD	-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom		0.458	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NCALD	HGNC	protein_coding	OTTHUMT00000380732.2	0	0	0	33	33	94	0.00	0.00	T			102731522	-1	18	26	34	38	tier1	no_errors	ENST00000311028	ensembl	human	known	74_37	silent	34.62	40.62	SNP	0.099	C	18	34
TRPC4AP	26133	genome.wustl.edu	37	20	33588591	33588591	+	IGR	SNP	G	G	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr20:33588591G>C	ENST00000252015.2	-	0	3226				MYH7B_ENST00000262873.7_Missense_Mutation_p.Q1775H			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TCCTAAACCAGAAGAAGAAGC	0.632													ENSG00000078814																																					0													29.0	37.0	34.0					20																	33588591		2025	4179	6204	SO:0001628	intergenic_variant	0			-	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319		20.37:g.33588591G>C			E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tR-bd_arm,superfamily_t-SRE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1775H	ENST00000252015.2	37	c.5325	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	G	11.36	1.614974	0.28712	.	.	ENSG00000078814	ENST00000262873	T	0.79141	-1.24	4.24	3.3	0.37823	Myosin tail (1);	0.000000	0.34628	N	0.003816	D	0.83792	0.5331	M	0.71206	2.165	0.34649	D	0.721464	D	0.71674	0.998	D	0.80764	0.994	D	0.85902	0.1435	10	0.59425	D	0.04	.	5.9741	0.19369	0.1869:0.1567:0.6564:0.0	.	1733	A7E2Y1	MYH7B_HUMAN	H	1775	ENSP00000262873:Q1775H	ENSP00000262873:Q1775H	Q	+	3	2	MYH7B	33052252	1.000000	0.71417	1.000000	0.80357	0.413000	0.31143	1.177000	0.31969	0.983000	0.38602	-0.700000	0.03674	CAG	-	MYH7B	-	pfam_Myosin_tail		0.632	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078832.2	0	0	0	35	35	54	0.00	0.00	G	NM_015638		33588591	+1	32	28	32	38	tier1	no_errors	ENST00000262873	ensembl	human	novel	74_37	missense	50.00	42.42	SNP	1.000	C	32	32
FBN1	2200	genome.wustl.edu	37	15	48729275	48729275	+	Splice_Site	SNP	C	C	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr15:48729275C>G	ENST00000316623.5	-	53	6835		c.e53-1			NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TCGTCCATATCTTAAGCAAGA	0.333													ENSG00000166147																																					0													80.0	78.0	79.0					15																	48729275		2198	4296	6494	SO:0001630	splice_region_variant	0			-	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.6380-1G>C	15.37:g.48729275C>G			B2RUU0|D2JYH6|Q15972|Q75N87	Splice_Site	SNP	-	e52-1	ENST00000316623.5	37	c.6380-1	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812170	0.90707	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9576	0.97228	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBN1	46516567	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	7.776000	0.85560	2.885000	0.99019	0.655000	0.94253	.	-	FBN1	-	-		0.333	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	0	0	0	112	112	77	0.00	0.00	C		Intron	48729275	-1	31	24	62	70	tier1	no_errors	ENST00000316623	ensembl	human	known	74_37	splice_site	33.33	25.53	SNP	1.000	G	31	62
TMEM217	221468	genome.wustl.edu	37	6	37186447	37186447	+	Missense_Mutation	SNP	G	G	T	rs376324772		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr6:37186447G>T	ENST00000336655.2	-	2	399	c.360C>A	c.(358-360)gaC>gaA	p.D120E	TMEM217_ENST00000497775.1_Intron|TMEM217_ENST00000356757.2_Missense_Mutation_p.D120E	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217	120						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						CCTCTTTAATGTCAAAGTCAT	0.428													ENSG00000172738																																					0													150.0	147.0	148.0					6																	37186447		2203	4300	6503	SO:0001583	missense	0			-		CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.360C>A	6.37:g.37186447G>T	ENSP00000338164:p.Asp120Glu		Q8TC54	Missense_Mutation	SNP	NULL	p.D120E	ENST00000336655.2	37	c.360	CCDS4831.1	6	.	.	.	.	.	.	.	.	.	.	G	0.385	-0.926542	0.02377	.	.	ENSG00000172738	ENST00000356757;ENST00000336655	.	.	.	4.45	1.57	0.23409	.	.	.	.	.	T	0.03564	0.0102	N	0.08118	0	0.09310	N	1	B;B	0.16396	0.017;0.001	B;B	0.16722	0.016;0.005	T	0.44097	-0.9350	8	0.02654	T	1	-0.6489	3.117	0.06377	0.2228:0.0:0.5632:0.214	.	120;120	Q8N7C4-2;Q8N7C4	.;TM217_HUMAN	E	120	.	ENSP00000338164:D120E	D	-	3	2	TMEM217	37294425	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.249000	0.18216	0.561000	0.29186	0.543000	0.68304	GAC	-	TMEM217	-	NULL		0.428	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM217	HGNC	protein_coding	OTTHUMT00000357542.1	0	0	0	48	48	151	0.00	0.00	G	NM_145316		37186447	-1	11	16	56	89	tier1	no_errors	ENST00000336655	ensembl	human	known	74_37	missense	16.42	15.09	SNP	0.000	T	11	56
C5orf42	65250	genome.wustl.edu	37	5	37239051	37239051	+	Silent	SNP	T	T	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr5:37239051T>A	ENST00000508244.1	-	7	939	c.846A>T	c.(844-846)gtA>gtT	p.V282V	C5orf42_ENST00000274258.7_5'UTR|C5orf42_ENST00000425232.2_Silent_p.V282V			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	282						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TTATAAATAATACCTGAGTTG	0.318													ENSG00000197603																																					0													75.0	64.0	67.0					5																	37239051		692	1591	2283	SO:0001819	synonymous_variant	0			-		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.846A>T	5.37:g.37239051T>A			A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Silent	SNP	superfamily_Quino_amine_DH_bsu	p.V282	ENST00000508244.1	37	c.846	CCDS34146.2	5																																																																																			-	C5orf42	-	superfamily_Quino_amine_DH_bsu		0.318	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	0	0	0	135	135	35	0.00	0.00	T	NM_023073		37239051	-1	16	10	74	49	tier1	no_errors	ENST00000425232	ensembl	human	known	74_37	silent	17.78	16.95	SNP	0.995	A	16	74
ASIC5	51802	genome.wustl.edu	37	4	156773430	156773430	+	Silent	SNP	A	A	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr4:156773430A>G	ENST00000537611.2	-	4	670	c.624T>C	c.(622-624)ttT>ttC	p.F208F		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	208					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										GATTAAAAGTAAAACAATTTC	0.333													ENSG00000256394																																					0													98.0	98.0	98.0					4																	156773430		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.624T>C	4.37:g.156773430A>G				Silent	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.F208	ENST00000537611.2	37	c.624	CCDS3793.1	4																																																																																			-	ASIC5	-	pfam_Na+channel_ASC,prints_Na+channel_ASC		0.333	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC5	HGNC	protein_coding	OTTHUMT00000366464.1	0	0	0	151	151	51	0.00	0.00	A			156773430	-1	16	18	61	50	tier1	no_errors	ENST00000537611	ensembl	human	known	74_37	silent	20.78	26.47	SNP	1.000	G	16	61
TNXB	7148	genome.wustl.edu	37	6	32056601	32056601	+	Missense_Mutation	SNP	G	G	A	rs542966732		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr6:32056601G>A	ENST00000375244.3	-	6	2941	c.2740C>T	c.(2740-2742)Cgg>Tgg	p.R914W	TNXB_ENST00000375247.2_Missense_Mutation_p.R914W			P22105	TENX_HUMAN	tenascin XB	1014					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTGACTGCCCGGCCCCGCTCC	0.622													ENSG00000168477	G|||	1	0.000199681	0.0	0.0014	5008	,	,		18877	0.0		0.0	False		,,,				2504	0.0																0													26.0	30.0	29.0					6																	32056601		2044	4194	6238	SO:0001583	missense	0			-	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.2740C>T	6.37:g.32056601G>A	ENSP00000364393:p.Arg914Trp		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.R914W	ENST00000375244.3	37	c.2740		6	.	.	.	.	.	.	.	.	.	.	G	19.75	3.886198	0.72410	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.57907	0.37;0.37	5.39	5.39	0.77823	.	0.567347	0.15303	N	0.269534	T	0.60392	0.2265	L	0.61036	1.89	0.20196	N	0.999921	D	0.76494	0.999	D	0.64042	0.921	T	0.56817	-0.7916	10	0.66056	D	0.02	.	16.643	0.85134	0.0:0.0:1.0:0.0	.	914	P22105-3	.	W	914	ENSP00000364393:R914W;ENSP00000364396:R914W	ENSP00000364393:R914W	R	-	1	2	TNXB	32164579	0.665000	0.27466	1.000000	0.80357	0.990000	0.78478	2.081000	0.41596	2.548000	0.85928	0.561000	0.74099	CGG	-	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.622	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	0	0	0	83	83	48	0.00	0.00	G	NM_019105		32056601	-1	24	4	59	31	tier1	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	28.57	11.43	SNP	0.914	A	24	59
PLEKHA2	59339	genome.wustl.edu	37	8	38827160	38827160	+	Silent	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr8:38827160C>T	ENST00000420274.1	+	12	1371	c.1137C>T	c.(1135-1137)ttC>ttT	p.F379F	CTD-2544N14.3_ENST00000520863.1_RNA|PLEKHA2_ENST00000521746.1_Intron|PLEKHA2_ENST00000388745.4_3'UTR	NM_021623.1	NP_067636.1	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	379					positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			ACTCCTTGTTCACGCCTCGTC	0.652													ENSG00000169499																																					0													17.0	20.0	19.0					8																	38827160		1896	4104	6000	SO:0001819	synonymous_variant	0			-	AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000420274.1:c.1137C>T	8.37:g.38827160C>T				Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.F379	ENST00000420274.1	37	c.1137		8																																																																																			-	PLEKHA2	-	NULL		0.652	PLEKHA2-201	KNOWN	basic|appris_principal	protein_coding	PLEKHA2	HGNC	protein_coding		0	0	0	99	99	26	0.00	0.00	C	NM_021623		38827160	+1	188	44	98	30	tier1	no_errors	ENST00000420274	ensembl	human	known	74_37	silent	65.73	59.46	SNP	0.148	T	188	98
CTBP1	1487	genome.wustl.edu	37	4	1244275	1244275	+	5'Flank	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr4:1244275G>T	ENST00000290921.6	-	0	0				CTBP1-AS2_ENST00000505364.1_RNA|CTBP1-AS2_ENST00000507044.1_RNA|CTBP1_ENST00000382952.3_5'Flank|CTBP1-AS2_ENST00000357591.2_RNA|CTBP1-AS2_ENST00000581398.1_RNA|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000578730.1_RNA	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		CCAGAAAAATGAGCAGCAACC	0.597													ENSG00000196810																																					0																																										SO:0001631	upstream_gene_variant	0			-	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259		4.37:g.1244275G>T	Exception_encountered		Q4W5N3|Q7Z2Q5	R	SNP	-	NULL	ENST00000290921.6	37	NULL	CCDS3348.1	4																																																																																			-	CTBP1-AS2	-	-		0.597	CTBP1-001	KNOWN	basic|CCDS	protein_coding	CTBP1-AS2	HGNC	protein_coding	OTTHUMT00000202938.1	0	0	0	28	28	34	0.00	0.00	G	NM_001328		1244275	+1	5	6	21	45	tier1	no_errors	ENST00000578730	ensembl	human	known	74_37	rna	19.23	11.76	SNP	0.022	T	5	21
SGIP1	84251	genome.wustl.edu	37	1	67206385	67206385	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:67206385C>T	ENST00000371037.4	+	23	2356	c.2279C>T	c.(2278-2280)tCt>tTt	p.S760F	SGIP1_ENST00000371039.1_Missense_Mutation_p.S563F|SGIP1_ENST00000371035.3_Missense_Mutation_p.S550F|SGIP1_ENST00000371036.3_Missense_Mutation_p.S562F|SGIP1_ENST00000237247.6_Missense_Mutation_p.S791F|SGIP1_ENST00000435165.2_Missense_Mutation_p.S265F	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	760	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Necessary and sufficient to mediate interaction with CANX. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						CCTGATATCTCTCAGAAGTCA	0.313													ENSG00000118473																																					0													50.0	51.0	50.0					1																	67206385		2203	4295	6498	SO:0001583	missense	0			-	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.2279C>T	1.37:g.67206385C>T	ENSP00000360076:p.Ser760Phe		A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	p.S791F	ENST00000371037.4	37	c.2372	CCDS30744.1	1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833739	0.91036	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037;ENST00000435165	T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83	5.86	5.86	0.93980	Muniscin C-terminal mu homology domain (1);	0.000000	0.85682	D	0.000000	T	0.71829	0.3386	M	0.87456	2.885	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.998;0.994	D;D;D;D;D	0.87578	0.986;0.998;0.998;0.996;0.986	T	0.74740	-0.3563	10	0.87932	D	0	-19.5572	20.5632	0.99335	0.0:1.0:0.0:0.0	.	790;265;362;550;760	A6NEV3;Q6ZV33;B3KR01;B7Z5H8;Q9BQI5	.;.;.;.;SGIP1_HUMAN	F	791;563;550;790;763;562;760;265	ENSP00000237247:S791F;ENSP00000360078:S563F;ENSP00000360074:S550F;ENSP00000360075:S562F;ENSP00000360076:S760F;ENSP00000395525:S265F	ENSP00000237247:S791F	S	+	2	0	SGIP1	66978973	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.214000	0.77958	2.937000	0.99478	0.650000	0.86243	TCT	-	SGIP1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C		0.313	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	0	0	0	169	169	43	0.00	0.00	C	NM_032291		67206385	+1	40	32	66	45	tier1	no_errors	ENST00000237247	ensembl	human	known	74_37	missense	37.74	41.56	SNP	1.000	T	40	66
CHST14	113189	genome.wustl.edu	37	15	40764365	40764365	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr15:40764365A>T	ENST00000306243.5	+	1	1206	c.953A>T	c.(952-954)cAc>cTc	p.H318L	CHST14_ENST00000559991.1_Missense_Mutation_p.H293L	NM_130468.3	NP_569735.1	Q8NCH0	CHSTE_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14	318					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|dermatan sulfate proteoglycan metabolic process (GO:0050655)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|phosphate ion binding (GO:0042301)			cervix(1)|large_intestine(1)|prostate(2)	4		all_cancers(109;2.34e-14)|all_epithelial(112;1.08e-11)|Lung NSC(122;2.95e-09)|all_lung(180;6.03e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0781)		GCACCACCTCACGTCCGATTT	0.627													ENSG00000169105																																					0													85.0	81.0	82.0					15																	40764365		2203	4300	6503	SO:0001583	missense	0			-	AF401222	CCDS10059.1	15q15.1	2014-09-17	2007-03-27	2007-03-27	ENSG00000169105	ENSG00000169105		"""Sulfotransferases, membrane-bound"""	24464	protein-coding gene	gene with protein product		608429	"""dermatan 4 sulfotransferase 1"""	D4ST1		11470797	Standard	NM_130468		Approved	HD4ST, D4ST-1	uc001zlw.3	Q8NCH0	OTTHUMG00000129985	ENST00000306243.5:c.953A>T	15.37:g.40764365A>T	ENSP00000307297:p.His318Leu		Q6PJ31|Q6UXA0|Q96P94	Missense_Mutation	SNP	pfam_Sulfotransferase	p.H318L	ENST00000306243.5	37	c.953	CCDS10059.1	15	.	.	.	.	.	.	.	.	.	.	A	3.332	-0.136434	0.06711	.	.	ENSG00000169105	ENST00000306243	T	0.73047	-0.71	4.76	3.61	0.41365	.	0.921050	0.09221	N	0.831870	T	0.42765	0.1217	N	0.04768	-0.165	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.41698	-0.9494	10	0.07325	T	0.83	-27.5264	4.5847	0.12277	0.547:0.1664:0.0:0.2866	.	318	Q8NCH0	CHSTE_HUMAN	L	318	ENSP00000307297:H318L	ENSP00000307297:H318L	H	+	2	0	CHST14	38551657	0.021000	0.18746	0.993000	0.49108	0.718000	0.41266	1.760000	0.38430	2.004000	0.58718	0.533000	0.62120	CAC	-	CHST14	-	pfam_Sulfotransferase		0.627	CHST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST14	HGNC	protein_coding	OTTHUMT00000252251.1	0	0	0	84	84	66	0.00	0.00	A	NM_130468		40764365	+1	14	9	62	46	tier1	no_errors	ENST00000306243	ensembl	human	known	74_37	missense	18.42	16.36	SNP	0.115	T	14	62
MYT1L	23040	genome.wustl.edu	37	2	1921033	1921033	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr2:1921033T>C	ENST00000399161.2	-	11	2309	c.1562A>G	c.(1561-1563)tAc>tGc	p.Y521C	MYT1L_ENST00000428368.2_Missense_Mutation_p.Y519C	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	521					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GTGATGTGGGTACAGCCCAGT	0.562													ENSG00000186487																																					0													193.0	203.0	200.0					2																	1921033		2006	4190	6196	SO:0001583	missense	0			-	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1562A>G	2.37:g.1921033T>C	ENSP00000382114:p.Tyr521Cys		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.Y521C	ENST00000399161.2	37	c.1562		2	.	.	.	.	.	.	.	.	.	.	T	25.5	4.647020	0.87958	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.70869	-0.48;-0.52	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.86226	0.5882	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88685	0.3205	10	0.87932	D	0	-39.597	16.0193	0.80468	0.0:0.0:0.0:1.0	.	521;519	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	C	521;467;519	ENSP00000382114:Y521C;ENSP00000396103:Y519C	ENSP00000295067:Y467C	Y	-	2	0	MYT1L	1900040	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.975000	0.88055	2.190000	0.69967	0.533000	0.62120	TAC	-	MYT1L	-	pfam_Znf_C2HC		0.562	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	0	0	0	75	75	158	0.00	0.00	T	NM_015025		1921033	-1	18	21	35	95	tier1	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	33.96	18.10	SNP	1.000	C	18	35
LTK	4058	genome.wustl.edu	37	15	41797191	41797191	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr15:41797191C>T	ENST00000263800.6	-	16	2093	c.1997G>A	c.(1996-1998)gGg>gAg	p.G666E	LTK_ENST00000453182.2_Missense_Mutation_p.G536E|LTK_ENST00000561619.1_Missense_Mutation_p.G364E|LTK_ENST00000355166.5_Missense_Mutation_p.G605E	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	666	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TCGTGCCATCCCAAAGTCCCC	0.572										TSP Lung(18;0.14)			ENSG00000062524																																					0													45.0	45.0	45.0					15																	41797191		2203	4300	6503	SO:0001583	missense	0			-	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1997G>A	15.37:g.41797191C>T	ENSP00000263800:p.Gly666Glu		A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G666E	ENST00000263800.6	37	c.1997	CCDS10077.1	15	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883965	0.91814	.	.	ENSG00000062524	ENST00000355166;ENST00000263800;ENST00000453182	D;D;D	0.99264	-5.65;-5.65;-3.12	4.71	4.71	0.59529	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.32987	U	0.005420	D	0.99684	0.9881	H	0.98612	4.28	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.998;0.97;0.998;1.0	D	0.97196	0.9861	10	0.87932	D	0	.	16.6171	0.84919	0.0:1.0:0.0:0.0	.	536;536;605;666	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	E	605;666;536	ENSP00000347293:G605E;ENSP00000263800:G666E;ENSP00000392196:G536E	ENSP00000263800:G666E	G	-	2	0	LTK	39584483	0.973000	0.33851	0.817000	0.32601	0.977000	0.68977	5.173000	0.65010	2.451000	0.82905	0.650000	0.86243	GGG	-	LTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.572	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2	0	0	0	50	50	93	0.00	0.00	C			41797191	-1	7	14	39	58	tier1	no_errors	ENST00000263800	ensembl	human	known	74_37	missense	15.22	19.18	SNP	0.995	T	7	39
SPAG17	200162	genome.wustl.edu	37	1	118509355	118509355	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:118509355C>T	ENST00000336338.5	-	47	6474	c.6409G>A	c.(6409-6411)Gaa>Aaa	p.E2137K		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	2137						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATATTCAGTTCTGTCTGCATA	0.428													ENSG00000155761																																					0													111.0	103.0	106.0					1																	118509355		2203	4300	6503	SO:0001583	missense	0			-		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.6409G>A	1.37:g.118509355C>T	ENSP00000337804:p.Glu2137Lys		Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.E2137K	ENST00000336338.5	37	c.6409	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162880	0.78226	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.18502	2.21	5.45	5.45	0.79879	.	0.239076	0.33496	N	0.004860	T	0.13114	0.0318	L	0.39397	1.21	0.28884	N	0.894235	P	0.49961	0.93	P	0.50440	0.641	T	0.02797	-1.1109	10	0.35671	T	0.21	.	16.2164	0.82224	0.0:1.0:0.0:0.0	.	2137	Q6Q759	SPG17_HUMAN	K	2137;617	ENSP00000337804:E2137K	ENSP00000337804:E2137K	E	-	1	0	SPAG17	118310878	0.983000	0.35010	0.962000	0.40283	0.667000	0.39255	4.450000	0.60041	2.555000	0.86185	0.655000	0.94253	GAA	-	SPAG17	-	NULL		0.428	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	0	0	0	73	73	117	0.00	0.00	C	NM_206996		118509355	-1	6	31	25	48	tier1	no_errors	ENST00000336338	ensembl	human	known	74_37	missense	19.35	39.24	SNP	0.856	T	6	25
NUB1	51667	genome.wustl.edu	37	7	151049238	151049238	+	Intron	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr7:151049238G>T	ENST00000355851.4	+	5	421				NUB1_ENST00000566856.1_Intron|NUB1_ENST00000413040.2_Intron|NUB1_ENST00000568733.1_Intron	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1						positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AGACCCTGTGGATCAGCCCCC	0.502													ENSG00000013374																																					0																																										SO:0001627	intron_variant	0			-	AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.345-660G>T	7.37:g.151049238G>T			O95422|Q75MR9|Q8IX22|Q9BXR2	Missense_Mutation	SNP	NULL	p.G135V	ENST00000355851.4	37	c.404		7																																																																																			-	NUB1	-	NULL		0.502	NUB1-201	KNOWN	basic|appris_principal	protein_coding	NUB1	HGNC	protein_coding		0	0	0	64	64	118	0.00	0.00	G	NM_016118		151049238	+1	8	13	17	17	tier1	no_errors	ENST00000470316	ensembl	human	known	74_37	missense	32.00	43.33	SNP	0.000	T	8	17
DAPK1	1612	genome.wustl.edu	37	9	90283512	90283512	+	Splice_Site	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr9:90283512G>A	ENST00000408954.3	+	19	2259	c.1924G>A	c.(1924-1926)Gac>Aac	p.D642N	DAPK1_ENST00000358077.5_Splice_Site_p.D642N|DAPK1_ENST00000469640.2_Splice_Site_p.D642N|DAPK1_ENST00000466188.1_3'UTR|DAPK1_ENST00000491893.1_Splice_Site_p.D642N|DAPK1_ENST00000472284.1_Splice_Site_p.D642N	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	642					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TCTCCAACAGGACGGAAAGAC	0.468									Chronic Lymphocytic Leukemia, Familial Clustering of				ENSG00000196730																																					0													234.0	237.0	236.0					9																	90283512		1955	4150	6105	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial CLL	-	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.1924-1G>A	9.37:g.90283512G>A			B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.D642N	ENST00000408954.3	37	c.1924	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	G	15.48	2.847569	0.51164	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35	4.73	4.73	0.59995	Ankyrin repeat-containing domain (3);	0.000000	0.48767	D	0.000168	T	0.33089	0.0851	L	0.55481	1.735	0.58432	D	0.999999	P;P;D	0.58268	0.679;0.913;0.982	B;P;P	0.59825	0.371;0.864;0.528	T	0.02202	-1.1196	10	0.66056	D	0.02	.	15.0605	0.71947	0.0:0.0:1.0:0.0	.	642;196;642	B7ZLE7;P53355-2;P53355	.;.;DAPK1_HUMAN	N	642	ENSP00000350785:D642N;ENSP00000417076:D642N;ENSP00000418885:D642N;ENSP00000386135:D642N;ENSP00000419026:D642N	ENSP00000350785:D642N	D	+	1	0	DAPK1	89473332	1.000000	0.71417	1.000000	0.80357	0.416000	0.31233	5.697000	0.68295	2.601000	0.87937	0.491000	0.48974	GAC	-	DAPK1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.468	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	0	0	0	43	43	68	0.00	0.00	G	NM_004938	Missense_Mutation	90283512	+1	11	14	26	33	tier1	no_errors	ENST00000469640	ensembl	human	known	74_37	missense	29.73	29.79	SNP	1.000	A	11	26
TNRC6C	57690	genome.wustl.edu	37	17	76047077	76047077	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr17:76047077C>A	ENST00000588061.1	+	5	2661	c.1934C>A	c.(1933-1935)aCa>aAa	p.T645K	TNRC6C_ENST00000301624.4_Missense_Mutation_p.T645K|TNRC6C_ENST00000335749.4_Missense_Mutation_p.T645K|TNRC6C_ENST00000588847.1_Missense_Mutation_p.T645K|TNRC6C_ENST00000544502.1_Missense_Mutation_p.T645K|TNRC6C_ENST00000541771.1_Missense_Mutation_p.T645K			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	645	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GGCAACAGCACAAATACAAAG	0.498													ENSG00000078687																																					0													39.0	41.0	41.0					17																	76047077		1940	4132	6072	SO:0001583	missense	0			-	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1934C>A	17.37:g.76047077C>A	ENSP00000468647:p.Thr645Lys		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.T645K	ENST00000588061.1	37	c.1934	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	C	6.362	0.434810	0.12045	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.13778	2.57;2.56;2.56;2.57	6.08	6.08	0.98989	.	0.275050	0.43260	D	0.000599	T	0.17619	0.0423	L	0.56769	1.78	0.80722	D	1	P;P;B	0.37663	0.604;0.604;0.004	B;B;B	0.38842	0.283;0.156;0.008	T	0.04017	-1.0984	10	0.06099	T	0.92	-11.9722	20.6634	0.99662	0.0:1.0:0.0:0.0	.	645;645;645	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	K	645	ENSP00000336783:T645K;ENSP00000301624:T645K;ENSP00000440310:T645K;ENSP00000442421:T645K	ENSP00000301624:T645K	T	+	2	0	TNRC6C	73558672	1.000000	0.71417	0.972000	0.41901	0.769000	0.43574	3.662000	0.54510	2.894000	0.99253	0.655000	0.94253	ACA	-	TNRC6C	-	NULL		0.498	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	0	0	0	86	86	112	0.00	0.00	C	NM_018996		76047077	+1	27	29	106	82	tier1	no_errors	ENST00000335749	ensembl	human	known	74_37	missense	20.30	26.13	SNP	1.000	A	27	106
GRID1	2894	genome.wustl.edu	37	10	87482894	87482894	+	Silent	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr10:87482894G>A	ENST00000327946.7	-	12	1948	c.1863C>T	c.(1861-1863)ggC>ggT	p.G621G	GRID1_ENST00000536331.1_Silent_p.G192G	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	621					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CGGAAGATTCGCCACCTGCGG	0.602										Multiple Myeloma(13;0.14)			ENSG00000182771																																					0													97.0	72.0	80.0					10																	87482894		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1863C>T	10.37:g.87482894G>A			B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G621	ENST00000327946.7	37	c.1863	CCDS31236.1	10																																																																																			-	GRID1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.602	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	0	0	0	36	36	59	0.00	0.00	G	XM_043613		87482894	-1	10	13	19	30	tier1	no_errors	ENST00000327946	ensembl	human	known	74_37	silent	34.48	30.23	SNP	0.000	A	10	19
MKI67	4288	genome.wustl.edu	37	10	129901119	129901119	+	Silent	SNP	G	G	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr10:129901119G>C	ENST00000368654.3	-	13	9360	c.8985C>G	c.(8983-8985)ccC>ccG	p.P2995P	MKI67_ENST00000368653.3_Silent_p.P2635P	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2995					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CCCTCTTGAAGGGCAGTGGGG	0.567													ENSG00000148773																																					0													89.0	80.0	83.0					10																	129901119		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.8985C>G	10.37:g.129901119G>C			Q5VWH2	Silent	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.P2995	ENST00000368654.3	37	c.8985	CCDS7659.1	10																																																																																			-	MKI67	-	NULL		0.567	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	0	0	0	80	80	105	0.00	0.00	G	NM_002417		129901119	-1	12	40	44	62	tier1	no_errors	ENST00000368654	ensembl	human	known	74_37	silent	21.43	38.46	SNP	0.012	C	12	44
ANKRD11	29123	genome.wustl.edu	37	16	89347362	89347362	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr16:89347362T>C	ENST00000301030.4	-	9	6048	c.5588A>G	c.(5587-5589)gAc>gGc	p.D1863G	ANKRD11_ENST00000378330.2_Missense_Mutation_p.D1863G	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1863	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GTGCAAAGCGTCGACTTTGGG	0.627													ENSG00000167522																																					0													41.0	45.0	44.0					16																	89347362		2198	4300	6498	SO:0001583	missense	0			-	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.5588A>G	16.37:g.89347362T>C	ENSP00000301030:p.Asp1863Gly		Q6NTG1|Q6QMF8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D1863G	ENST00000301030.4	37	c.5588	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	t	11.61	1.691064	0.30052	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.42513	0.97;0.97	4.58	4.58	0.56647	.	0.513913	0.17481	N	0.172701	T	0.31670	0.0804	N	0.24115	0.695	0.43000	D	0.99451	B	0.06786	0.001	B	0.04013	0.001	T	0.12372	-1.0550	10	0.62326	D	0.03	.	13.6397	0.62243	0.0:0.0:0.0:1.0	.	1863	Q6UB99	ANR11_HUMAN	G	1863	ENSP00000301030:D1863G;ENSP00000367581:D1863G	ENSP00000301030:D1863G	D	-	2	0	ANKRD11	87874863	0.838000	0.29461	0.018000	0.16275	0.002000	0.02628	1.850000	0.39328	1.706000	0.51276	0.370000	0.22315	GAC	-	ANKRD11	-	NULL		0.627	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	0	0	0	79	79	56	0.00	0.00	T	NM_013275		89347362	-1	12	6	38	39	tier1	no_errors	ENST00000301030	ensembl	human	known	74_37	missense	24.00	13.33	SNP	0.085	C	12	38
CDK11B	984	genome.wustl.edu	37	1	1576445	1576445	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:1576445C>T	ENST00000407249.3	-	11	1047	c.1048G>A	c.(1048-1050)Gat>Aat	p.D350N	CDK11B_ENST00000341832.6_Missense_Mutation_p.D303N|CDK11B_ENST00000340677.5_Missense_Mutation_p.D337N|CDK11B_ENST00000317673.7_Missense_Mutation_p.D348N			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B	360	Glu-rich.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						CGTTCTTCATCTTCACTCATT	0.552													ENSG00000248333																																					0													48.0	44.0	45.0					1																	1576445		1796	4033	5829	SO:0001583	missense	0			-	AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.1048G>A	1.37:g.1576445C>T	ENSP00000464036:p.Asp350Asn		O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D350N	ENST00000407249.3	37	c.1048		1																																																																																			-	CDK11B	-	NULL		0.552	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding		0	0	0	31	31	45	0.00	0.00	C	NM_001787		1576445	-1	8	12	20	30	tier1	no_errors	ENST00000407249	ensembl	human	known	74_37	missense	28.57	28.57	SNP	0.267	T	8	20
TEX11	56159	genome.wustl.edu	37	X	69830390	69830390	+	Silent	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chrX:69830390C>T	ENST00000395889.2	-	22	1955	c.1800G>A	c.(1798-1800)aaG>aaA	p.K600K	TEX11_ENST00000344304.3_Silent_p.K600K|TEX11_ENST00000374320.2_Silent_p.K275K|TEX11_ENST00000374333.2_Silent_p.K585K	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	600				K -> E (in Ref. 1; BAB71465). {ECO:0000305}.	chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					CCATTTCTTTCTTCCTAAAAA	0.338													ENSG00000120498																																					0													124.0	123.0	123.0					X																	69830390		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1800G>A	X.37:g.69830390C>T			A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Silent	SNP	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.K600	ENST00000395889.2	37	c.1800	CCDS35323.1	X																																																																																			-	TEX11	-	NULL		0.338	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	HGNC	protein_coding	OTTHUMT00000359072.1	0	0	0	201	201	71	0.00	0.00	C			69830390	-1	24	13	99	43	tier1	no_errors	ENST00000344304	ensembl	human	known	74_37	silent	19.51	23.21	SNP	0.815	T	24	99
EPHA3	2042	genome.wustl.edu	37	3	89259017	89259017	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr3:89259017A>G	ENST00000336596.2	+	3	386	c.161A>G	c.(160-162)gAg>gGg	p.E54G	EPHA3_ENST00000452448.2_Missense_Mutation_p.E54G|EPHA3_ENST00000494014.1_Missense_Mutation_p.E54G	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	54	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CAGTGGGAAGAGATCAGTGGT	0.408										TSP Lung(6;0.00050)			ENSG00000044524																																					0													44.0	44.0	44.0					3																	89259017		2203	4300	6503	SO:0001583	missense	0			-	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.161A>G	3.37:g.89259017A>G	ENSP00000337451:p.Glu54Gly		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.E54G	ENST00000336596.2	37	c.161	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	A	21.1	4.105161	0.77096	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.12569	2.67;2.67;2.67	5.34	5.34	0.76211	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.44329	0.1288	M	0.89163	3.01	0.80722	D	1	D;D	0.69078	0.997;0.969	D;P	0.79108	0.992;0.851	T	0.52756	-0.8533	9	.	.	.	.	15.3238	0.74144	1.0:0.0:0.0:0.0	.	54;54	P29320;P29320-2	EPHA3_HUMAN;.	G	54	ENSP00000337451:E54G;ENSP00000399926:E54G;ENSP00000419190:E54G	.	E	+	2	0	EPHA3	89341707	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	9.339000	0.96797	2.020000	0.59435	0.460000	0.39030	GAG	-	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom		0.408	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	0	0	0	50	50	72	0.00	0.00	A	NM_005233		89259017	+1	8	23	17	40	tier1	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	32.00	36.51	SNP	1.000	G	8	17
MPDZ	8777	genome.wustl.edu	37	9	13217183	13217183	+	Silent	SNP	T	T	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr9:13217183T>C	ENST00000319217.7	-	9	1444	c.1197A>G	c.(1195-1197)aaA>aaG	p.K399K	MPDZ_ENST00000536827.1_Silent_p.K399K|MPDZ_ENST00000381022.2_Silent_p.K399K|MPDZ_ENST00000381015.4_Silent_p.K399K|MPDZ_ENST00000447879.1_Silent_p.K399K|MPDZ_ENST00000546205.1_Silent_p.K399K|MPDZ_ENST00000541718.1_Silent_p.K399K	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	399	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		AATTACCCAATTTTTTATCTC	0.303													ENSG00000107186																																					0													57.0	53.0	54.0					9																	13217183		1790	4052	5842	SO:0001819	synonymous_variant	0			-	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.1197A>G	9.37:g.13217183T>C			A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.K399	ENST00000319217.7	37	c.1197		9																																																																																			-	MPDZ	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.303	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	HGNC	protein_coding	OTTHUMT00000055485.2	0	0	0	149	149	48	0.00	0.00	T	NM_003829		13217183	-1	24	28	62	21	tier1	no_errors	ENST00000319217	ensembl	human	known	74_37	silent	27.91	57.14	SNP	0.998	C	24	62
CNTRL	11064	genome.wustl.edu	37	9	123912674	123912674	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr9:123912674G>A	ENST00000373855.1	+	25	4136	c.3876G>A	c.(3874-3876)atG>atA	p.M1292I	CNTRL_ENST00000238341.5_Missense_Mutation_p.M1292I|CNTRL_ENST00000373847.1_Missense_Mutation_p.M740I|CNTRL_ENST00000373850.1_Missense_Mutation_p.M740I			Q7Z7A1	CNTRL_HUMAN	centriolin	1292	Pro-rich.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GGGCCCCCATGGTGTATGGGC	0.567													ENSG00000119397																																					0													91.0	83.0	86.0					9																	123912674		2203	4300	6503	SO:0001583	missense	0			-	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.3876G>A	9.37:g.123912674G>A	ENSP00000362962:p.Met1292Ile		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tR-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.M1292I	ENST00000373855.1	37	c.3876	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.096871	0.00364	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	5.71	-11.4	0.00090	.	.	.	.	.	T	0.05868	0.0153	N	0.00823	-1.155	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16958	-1.0385	9	0.02654	T	1	.	8.7202	0.34436	0.0726:0.0782:0.2262:0.623	.	1292;1292	F5GZN0;Q7Z7A1	.;CNTRL_HUMAN	I	1292;1292;1292;48;774;740;740	ENSP00000362962:M1292I;ENSP00000238341:M1292I;ENSP00000362956:M740I;ENSP00000362953:M740I	ENSP00000238341:M1292I	M	+	3	0	CNTRL	122952495	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.368000	0.02580	-2.594000	0.00455	-1.352000	0.01234	ATG	-	CNTRL	-	NULL		0.567	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	0	0	0	58	58	158	0.00	0.00	G	NM_007018		123912674	+1	20	24	27	43	tier1	no_errors	ENST00000238341	ensembl	human	known	74_37	missense	42.55	35.82	SNP	0.000	A	20	27
RP11-65D24.2	0	genome.wustl.edu	37	13	112278380	112278380	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr13:112278380A>T	ENST00000375713.1	+	2	101	c.38A>T	c.(37-39)aAg>aTg	p.K13M	RP11-65D24.1_ENST00000401043.3_RNA																							TCCAGCAGGAAGTGGTGGCGG	0.478													ENSG00000204398																																					0																																										SO:0001583	missense	0			-																												ENST00000375713.1:c.38A>T	13.37:g.112278380A>T	ENSP00000364865:p.Lys13Met			Missense_Mutation	SNP	NULL	p.K13M	ENST00000375713.1	37	c.38		13	.	.	.	.	.	.	.	.	.	.	A	4.764	0.142034	0.09083	.	.	ENSG00000204398	ENST00000375713	.	.	.	1.8	-3.6	0.04570	.	.	.	.	.	T	0.35799	0.0944	.	.	.	.	.	.	.	.	.	.	.	.	T	0.44128	-0.9348	4	0.87932	D	0	.	4.2206	0.10556	0.3651:0.1899:0.445:0.0	.	.	.	.	M	13	.	ENSP00000364865:K13M	K	+	2	0	RP11-65D24.2	111076381	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.485000	0.06520	-1.486000	0.01851	-0.475000	0.04921	AAG	-	RP11-65D24.2	-	NULL		0.478	RP11-65D24.2-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000204398	Clone_based_vega_gene	protein_coding	OTTHUMT00000045814.2	0	0	0	110	110	79	0.00	0.00	A			112278380	+1	30	17	32	31	tier1	no_errors	ENST00000375713	ensembl	human	putative	74_37	missense	48.39	35.42	SNP	0.000	T	30	32
SLC4A7	9497	genome.wustl.edu	37	3	27442283	27442283	+	Missense_Mutation	SNP	T	T	C	rs200933810		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr3:27442283T>C	ENST00000295736.5	-	16	2442	c.2372A>G	c.(2371-2373)aAt>aGt	p.N791S	SLC4A7_ENST00000446700.1_Missense_Mutation_p.N783S|SLC4A7_ENST00000437179.1_Missense_Mutation_p.N672S|SLC4A7_ENST00000428386.1_Missense_Mutation_p.N667S|SLC4A7_ENST00000445684.1_Missense_Mutation_p.N787S|SLC4A7_ENST00000454389.1_Missense_Mutation_p.N800S|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000455077.1_Missense_Mutation_p.N672S|SLC4A7_ENST00000440156.1_Missense_Mutation_p.N787S|SLC4A7_ENST00000388777.4_Missense_Mutation_p.N341S|SLC4A7_ENST00000435667.2_Missense_Mutation_p.N676S	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	791					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	CCAGGAAATATTGTGTGCTGT	0.333													ENSG00000033867	T|||	1	0.000199681	0.0	0.0	5008	,	,		17814	0.0		0.001	False		,,,				2504	0.0																0													149.0	149.0	149.0					3																	27442283		2203	4297	6500	SO:0001583	missense	0			GMAF=0.0005	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.2372A>G	3.37:g.27442283T>C	ENSP00000295736:p.Asn791Ser		A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.N800S	ENST00000295736.5	37	c.2399	CCDS33721.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	4.223	0.040322	0.08148	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	5.43	-7.92	0.01160	Bicarbonate transporter, C-terminal (1);	0.851184	0.10692	N	0.645096	T	0.46521	0.1397	N	0.02830	-0.485	0.09310	N	1	B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B	0.04013	0.001;0.001;0.0;0.001;0.001;0.001;0.001;0.001;0.001	T	0.39742	-0.9599	10	0.23302	T	0.38	.	10.3214	0.43769	0.0:0.4091:0.2279:0.3629	.	787;672;783;787;800;341;667;791;672	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	S	342;791;667;800;787;672;783;672;787;676;341;687	ENSP00000411031:N342S;ENSP00000295736:N791S;ENSP00000416368:N667S;ENSP00000390394:N800S;ENSP00000414797:N787S;ENSP00000394252:N672S;ENSP00000406605:N783S;ENSP00000407382:N672S;ENSP00000406804:N787S;ENSP00000395336:N676S;ENSP00000373429:N341S;ENSP00000388703:N687S	ENSP00000295736:N791S	N	-	2	0	SLC4A7	27417287	0.000000	0.05858	0.001000	0.08648	0.109000	0.19521	-0.558000	0.05978	-1.237000	0.02539	-1.377000	0.01181	AAT	rs200933810	SLC4A7	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk		0.333	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	HGNC	protein_coding	OTTHUMT00000341230.2	0	0	0	95	95	42	0.00	0.00	T	NM_003615		27442283	-1	20	26	53	53	tier1	no_errors	ENST00000454389	ensembl	human	known	74_37	missense	27.40	32.50	SNP	0.000	C	20	53
SCYL1	57410	genome.wustl.edu	37	11	65305961	65305961	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr11:65305961G>A	ENST00000270176.5	+	18	2428	c.2351G>A	c.(2350-2352)cGg>cAg	p.R784Q	SCYL1_ENST00000534462.1_3'UTR|SCYL1_ENST00000279270.6_Missense_Mutation_p.G766R|SCYL1_ENST00000533862.1_Missense_Mutation_p.G772R|SCYL1_ENST00000524944.1_3'UTR|SCYL1_ENST00000420247.2_Missense_Mutation_p.R767Q|SCYL1_ENST00000525364.1_Missense_Mutation_p.G765R|SCYL1_ENST00000527009.1_Missense_Mutation_p.R641Q	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	784					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						GAGCGGCGGCGGGAGATGGAG	0.701													ENSG00000142186																																					0													11.0	21.0	18.0					11																	65305961		1976	4139	6115	SO:0001583	missense	0			-	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.2351G>A	11.37:g.65305961G>A	ENSP00000270176:p.Arg784Gln		A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.R784Q	ENST00000270176.5	37	c.2351	CCDS41672.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.77|16.77	3.213767|3.213767	0.58452|0.58452	.|.	.|.	ENSG00000142186|ENSG00000142186	ENST00000525364;ENST00000533862;ENST00000279270|ENST00000270176;ENST00000420247;ENST00000527630;ENST00000349495;ENST00000527009;ENST00000528545	T;T;T|T;T;T;T;T	0.07327|0.33216	3.2;3.68;3.2|3.16;2.98;2.78;2.17;1.42	4.82|4.82	1.81|1.81	0.25067|0.25067	.|.	.|0.256921	.|0.35235	.|N	.|0.003360	T|T	0.17066|0.17066	0.0410|0.0410	L|L	0.40543|0.40543	1.245|1.245	0.20403|0.20403	N|N	0.999905|0.999905	B;B|B;B	0.15930|0.31459	0.015;0.007|0.324;0.057	B;B|B;B	0.12837|0.24269	0.008;0.002|0.052;0.009	T|T	0.08027|0.08027	-1.0742|-1.0742	9|10	0.66056|0.25106	D|T	0.02|0.35	-26.6623|-26.6623	3.5856|3.5856	0.07970|0.07970	0.2439:0.0:0.5594:0.1967|0.2439:0.0:0.5594:0.1967	.|.	766;772|767;784	Q96KG9-4;Q96KG9-6|Q96KG9-2;Q96KG9	.;.|.;NTKL_HUMAN	R|Q	765;772;766|784;767;683;683;641;256	ENSP00000431635:G765R;ENSP00000437254:G772R;ENSP00000279270:G766R|ENSP00000270176:R784Q;ENSP00000408192:R767Q;ENSP00000433450:R683Q;ENSP00000436993:R641Q;ENSP00000433604:R256Q	ENSP00000279270:G766R|ENSP00000270176:R784Q	G|R	+|+	1|2	0|0	SCYL1|SCYL1	65062537|65062537	1.000000|1.000000	0.71417|0.71417	0.614000|0.614000	0.29051|0.29051	0.993000|0.993000	0.82548|0.82548	2.993000|2.993000	0.49425|0.49425	1.009000|1.009000	0.39289|0.39289	0.462000|0.462000	0.41574|0.41574	GGG|CGG	-	SCYL1	-	NULL		0.701	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL1	HGNC	protein_coding	OTTHUMT00000389159.2	0	0	0	9	9	12	0.00	0.00	G	NM_020680		65305961	+1	5	5	16	14	tier1	no_errors	ENST00000270176	ensembl	human	known	74_37	missense	23.81	26.32	SNP	0.840	A	5	16
KCNK13	56659	genome.wustl.edu	37	14	90651110	90651110	+	Silent	SNP	C	C	T	rs139112374		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr14:90651110C>T	ENST00000282146.4	+	2	1431	c.990C>T	c.(988-990)gaC>gaT	p.D330D		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	330					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				TAGAGACAGACGGGGTGGCAG	0.622													ENSG00000152315																																					0								C		1,4405	2.1+/-5.4	0,1,2202	62.0	64.0	63.0		990	-6.9	0.1	14	dbSNP_134	63	0,8600		0,0,4300	no	coding-synonymous	KCNK13	NM_022054.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		330/409	90651110	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.990C>T	14.37:g.90651110C>T			B5TJL8|Q96E79	Silent	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.D330	ENST00000282146.4	37	c.990	CCDS9889.1	14																																																																																			rs139112374	KCNK13	-	NULL		0.622	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	HGNC	protein_coding	OTTHUMT00000411251.1	0	0	0	87	87	53	0.00	0.00	C	NM_022054		90651110	+1	33	13	57	25	tier1	no_errors	ENST00000282146	ensembl	human	known	74_37	silent	36.67	34.21	SNP	0.129	T	33	57
BCL11A	53335	genome.wustl.edu	37	2	60687183	60687183	+	3'UTR	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr2:60687183G>T	ENST00000335712.6	-	0	3091				BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Intron|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Intron	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)						B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TGCTGTCTAAGTTTAAAAAAA	0.353			T	IGH@	B-CLL								ENSG00000119866																												Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	0																																										SO:0001624	3_prime_UTR_variant	0			-	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.*356C>A	2.37:g.60687183G>T			D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	R	SNP	-	NULL	ENST00000335712.6	37	NULL	CCDS1862.1	2																																																																																			-	BCL11A	-	-		0.353	BCL11A-001	KNOWN	basic|CCDS	protein_coding	BCL11A	HGNC	protein_coding	OTTHUMT00000251579.2	0	0	1	62	62	80	0.00	1.19	G	NM_022893		60687183	-1	5	13	44	71	tier1	no_errors	ENST00000477659	ensembl	human	known	74_37	rna	10.20	15.12	SNP	1.000	T	5	44
PPP1R12A	4659	genome.wustl.edu	37	12	80199528	80199528	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr12:80199528G>A	ENST00000450142.2	-	14	2110	c.1844C>T	c.(1843-1845)gCt>gTt	p.A615V	PPP1R12A_ENST00000261207.5_Missense_Mutation_p.A615V|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.A615V|AC073569.1_ENST00000598624.1_Intron|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.A559V|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.A528V	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	615	Ser/Thr-rich.				centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						ACTATCCTCAGCCCACAAACG	0.423													ENSG00000058272																																					0													111.0	103.0	106.0					12																	80199528		2025	4180	6205	SO:0001583	missense	0			-	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1844C>T	12.37:g.80199528G>A	ENSP00000389168:p.Ala615Val		B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A615V	ENST00000450142.2	37	c.1844	CCDS44947.1	12	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307082	0.81247	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107	T;T;T;T;T	0.38887	1.17;1.17;1.18;1.19;1.11	5.54	5.54	0.83059	.	0.108661	0.64402	D	0.000005	T	0.60766	0.2294	L	0.50333	1.59	0.58432	D	0.999997	D;D;P	0.67145	0.965;0.996;0.941	P;D;P	0.70935	0.655;0.971;0.453	T	0.59963	-0.7355	10	0.54805	T	0.06	.	19.4766	0.94991	0.0:0.0:1.0:0.0	.	615;559;615	O14974-2;O14974-3;O14974	.;.;MYPT1_HUMAN	V	615;615;615;559;615;615;528;559	ENSP00000261207:A615V;ENSP00000389168:A615V;ENSP00000416769:A615V;ENSP00000449514:A528V;ENSP00000446855:A559V	ENSP00000261207:A615V	A	-	2	0	PPP1R12A	78723659	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.121000	0.89582	2.585000	0.87301	0.591000	0.81541	GCT	-	PPP1R12A	-	pirsf_Pase-1_reg_su_12A/B/C_euk		0.423	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	HGNC	protein_coding	OTTHUMT00000407254.2	0	0	0	48	48	141	0.00	0.00	G	NM_002480		80199528	-1	11	24	26	44	tier1	no_errors	ENST00000261207	ensembl	human	known	74_37	missense	29.73	35.29	SNP	1.000	A	11	26
OR51D1	390038	genome.wustl.edu	37	11	4661029	4661029	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr11:4661029G>T	ENST00000357605.2	+	1	85	c.9G>T	c.(7-9)aaG>aaT	p.K3N		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTATGCAGAAGCCCCAGCTCT	0.473													ENSG00000197428																																					0													133.0	130.0	131.0					11																	4661029		2201	4298	6499	SO:0001583	missense	0			-	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.9G>T	11.37:g.4661029G>T	ENSP00000350222:p.Lys3Asn		B9EIK4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K3N	ENST00000357605.2	37	c.9	CCDS31357.1	11	.	.	.	.	.	.	.	.	.	.	G	6.067	0.380746	0.11466	.	.	ENSG00000197428	ENST00000357605	T	0.00006	9.74	4.31	-0.0754	0.13727	.	0.564619	0.15074	N	0.282046	T	0.00039	0.0001	N	0.08118	0	0.09310	N	0.999999	P	0.41313	0.745	B	0.38803	0.282	T	0.00231	-1.1896	10	0.56958	D	0.05	.	2.8081	0.05433	0.3515:0.0:0.4465:0.2019	.	3	Q8NGF3	O51D1_HUMAN	N	3	ENSP00000350222:K3N	ENSP00000350222:K3N	K	+	3	2	OR51D1	4617605	0.000000	0.05858	0.255000	0.24374	0.170000	0.22686	-0.567000	0.05916	0.180000	0.19960	-0.259000	0.10710	AAG	-	OR51D1	-	NULL		0.473	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51D1	HGNC	protein_coding	OTTHUMT00000385956.1	0	0	0	62	62	134	0.00	0.00	G	NM_001004751		4661029	+1	19	38	26	49	tier1	no_errors	ENST00000357605	ensembl	human	known	74_37	missense	42.22	43.18	SNP	0.067	T	19	26
IFT52	51098	genome.wustl.edu	37	20	42275733	42275733	+	3'UTR	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr20:42275733G>A	ENST00000373030.3	+	0	1554				IFT52_ENST00000373039.4_3'UTR|IFT52_ENST00000471199.1_3'UTR	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52						cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TTTCCTCCATGAGCTCTGGAA	0.303													ENSG00000101052																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.*110G>A	20.37:g.42275733G>A			B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	R	SNP	-	NULL	ENST00000373030.3	37	NULL	CCDS33470.1	20																																																																																			-	IFT52	-	-		0.303	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	HGNC	protein_coding	OTTHUMT00000079317.1	0	0	0	38	38	50	0.00	0.00	G	NM_016004		42275733	+1	45	113	43	97	tier1	no_errors	ENST00000461012	ensembl	human	known	74_37	rna	51.14	53.81	SNP	0.000	A	45	43
PLP1	5354	genome.wustl.edu	37	X	103041725	103041725	+	Intron	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chrX:103041725G>A	ENST00000303958.2	+	3	599				PLP1_ENST00000418604.1_Intron|PLP1_ENST00000361621.2_Intron	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1						astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						CTGTGGCCTCGTCCCCACCCA	0.572													ENSG00000123560																																					0																																										SO:0001627	intron_variant	0			-	M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.453+70G>A	X.37:g.103041725G>A			P04400|P06905|Q502Y1|Q6FHZ6	R	SNP	-	NULL	ENST00000303958.2	37	NULL	CCDS14513.1	X																																																																																			-	PLP1	-	-		0.572	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLP1	HGNC	protein_coding	OTTHUMT00000057743.2	0	0	0	18	18	49	0.00	0.00	G			103041725	+1	47	120	7	27	tier1	no_errors	ENST00000465975	ensembl	human	putative	74_37	rna	87.04	81.63	SNP	0.103	A	47	7
SCUBE1	80274	genome.wustl.edu	37	22	43604213	43604213	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr22:43604213T>A	ENST00000360835.4	-	20	2725	c.2599A>T	c.(2599-2601)Acc>Tcc	p.T867S		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	867	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TCATAGGTGGTGATGGACGTG	0.612													ENSG00000159307																																					0													225.0	170.0	189.0					22																	43604213		2203	4300	6503	SO:0001583	missense	0			-		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2599A>T	22.37:g.43604213T>A	ENSP00000354080:p.Thr867Ser		Q5R336	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.T867S	ENST00000360835.4	37	c.2599	CCDS14048.1	22	.	.	.	.	.	.	.	.	.	.	T	16.28	3.077452	0.55753	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	T	0.34072	1.38	3.76	3.76	0.43208	CUB (5);	0.000000	0.85682	D	0.000000	T	0.49474	0.1559	L	0.39245	1.2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.53078	-0.8489	10	0.87932	D	0	.	12.9257	0.58258	0.0:0.0:0.0:1.0	.	867	Q8IWY4	SCUB1_HUMAN	S	867;497	ENSP00000354080:T867S	ENSP00000354080:T867S	T	-	1	0	SCUBE1	41934157	1.000000	0.71417	0.998000	0.56505	0.161000	0.22273	7.724000	0.84798	1.708000	0.51301	0.260000	0.18958	ACC	-	SCUBE1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.612	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	0	0	0	33	33	71	0.00	0.00	T	NM_173050		43604213	-1	16	16	63	87	tier1	no_errors	ENST00000360835	ensembl	human	known	74_37	missense	20.25	15.53	SNP	1.000	A	16	63
PTPRU	10076	genome.wustl.edu	37	1	29618406	29618406	+	Missense_Mutation	SNP	A	A	G	rs527888616		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:29618406A>G	ENST00000345512.3	+	16	2503	c.2374A>G	c.(2374-2376)Acc>Gcc	p.T792A	PTPRU_ENST00000373779.3_Missense_Mutation_p.T782A|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000428026.2_Missense_Mutation_p.T782A|PTPRU_ENST00000356870.3_Missense_Mutation_p.T782A|PTPRU_ENST00000460170.2_Missense_Mutation_p.T782A|PTPRU_ENST00000323874.8_Missense_Mutation_p.T782A	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	792	Mediates interaction with CTNNB1. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GACCAAGGCCACCGTCAACTA	0.647													ENSG00000060656																																					0													75.0	59.0	65.0					1																	29618406		2203	4300	6503	SO:0001583	missense	0			-	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2374A>G	1.37:g.29618406A>G	ENSP00000334941:p.Thr792Ala		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.T792A	ENST00000345512.3	37	c.2374	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.825757	0.32237	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.32515	1.47;1.51;1.52;1.52;1.45;1.52	4.36	4.36	0.52297	.	0.134342	0.50627	D	0.000108	T	0.19604	0.0471	N	0.21194	0.64	0.31014	N	0.718954	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.0	B;B;B;B;B	0.06405	0.002;0.002;0.002;0.001;0.001	T	0.10359	-1.0633	9	.	.	.	.	11.7359	0.51765	1.0:0.0:0.0:0.0	.	782;782;782;782;792	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	A	792;782;782;782;782;782	ENSP00000334941:T792A;ENSP00000362884:T782A;ENSP00000349333:T782A;ENSP00000314987:T782A;ENSP00000392332:T782A;ENSP00000432906:T782A	.	T	+	1	0	PTPRU	29490993	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	3.953000	0.56699	1.959000	0.56917	0.533000	0.62120	ACC	-	PTPRU	-	NULL		0.647	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	0	0	0	62	62	64	0.00	0.00	A			29618406	+1	4	3	41	19	tier1	no_errors	ENST00000345512	ensembl	human	known	74_37	missense	8.89	13.64	SNP	0.992	G	4	41
PKD1L1	168507	genome.wustl.edu	37	7	47894630	47894630	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr7:47894630C>G	ENST00000289672.2	-	30	4759	c.4709G>C	c.(4708-4710)aGg>aCg	p.R1570T		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1570	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TTTATTTCTCCTATTATCCTG	0.353													ENSG00000158683																																					0													69.0	70.0	69.0					7																	47894630		2203	4300	6503	SO:0001583	missense	0			-	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4709G>C	7.37:g.47894630C>G	ENSP00000289672:p.Arg1570Thr		Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_PLAT/LH2_dom,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like	p.R1570T	ENST00000289672.2	37	c.4709	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	10.39	1.336187	0.24253	.	.	ENSG00000158683	ENST00000289672	T	0.19105	2.17	4.94	-2.75	0.05914	Egg jelly receptor, REJ-like (1);	2.641920	0.01148	N	0.006347	T	0.16085	0.0387	L	0.51422	1.61	0.09310	N	1	B	0.34015	0.435	B	0.27608	0.081	T	0.15321	-1.0441	10	0.13470	T	0.59	-0.395	6.0521	0.19790	0.1385:0.2825:0.0:0.579	.	1570	Q8TDX9	PK1L1_HUMAN	T	1570	ENSP00000289672:R1570T	ENSP00000289672:R1570T	R	-	2	0	PKD1L1	47861155	0.000000	0.05858	0.000000	0.03702	0.748000	0.42578	-1.432000	0.02430	-0.366000	0.08064	0.655000	0.94253	AGG	-	PKD1L1	-	pfscan_REJ-like		0.353	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	0	0	0	109	109	84	0.00	0.00	C	NM_138295		47894630	-1	16	8	43	63	tier1	no_errors	ENST00000289672	ensembl	human	known	74_37	missense	27.12	11.27	SNP	0.000	G	16	43
OR2H1	26716	genome.wustl.edu	37	6	29429643	29429643	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr6:29429643T>A	ENST00000377136.1	+	4	562	c.97T>A	c.(97-99)Tac>Aac	p.Y33N	OR2H1_ENST00000377133.1_Missense_Mutation_p.Y33N|OR2H1_ENST00000442615.1_Missense_Mutation_p.Y33N|OR2H1_ENST00000473369.1_Intron|OR2H1_ENST00000396792.2_Missense_Mutation_p.Y33N|OR2H1_ENST00000377132.1_Missense_Mutation_p.Y33N			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						CTTCACTTCCTACCTCTTGAC	0.527													ENSG00000204688																																					0													212.0	205.0	207.0					6																	29429643		1511	2709	4220	SO:0001583	missense	0			-	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.97T>A	6.37:g.29429643T>A	ENSP00000366340:p.Tyr33Asn		B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y33N	ENST00000377136.1	37	c.97	CCDS4660.1	6	.	.	.	.	.	.	.	.	.	.	T	14.95	2.687507	0.48097	.	.	ENSG00000204688	ENST00000377136;ENST00000377133;ENST00000442615;ENST00000377132;ENST00000396792	T;T;T;T;T	0.04654	3.58;3.58;3.58;3.58;3.58	2.88	2.88	0.33553	.	0.000000	0.36854	N	0.002378	T	0.22322	0.0538	H	0.97635	4.045	0.32984	D	0.524051	D	0.89917	1.0	D	0.91635	0.999	T	0.40553	-0.9557	10	0.87932	D	0	.	11.6835	0.51472	0.0:0.0:0.0:1.0	.	33	Q9GZK4	OR2H1_HUMAN	N	33	ENSP00000366340:Y33N;ENSP00000366337:Y33N;ENSP00000393254:Y33N;ENSP00000366336:Y33N;ENSP00000380010:Y33N	ENSP00000366336:Y33N	Y	+	1	0	OR2H1	29537622	0.895000	0.30542	0.550000	0.28217	0.248000	0.25809	4.071000	0.57556	1.556000	0.49512	0.491000	0.48974	TAC	-	OR2H1	-	prints_GPCR_Rhodpsn		0.527	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2H1	HGNC	protein_coding	OTTHUMT00000194014.3	0	0	0	74	74	40	0.00	0.00	T			29429643	+1	16	4	35	22	tier1	no_errors	ENST00000377132	ensembl	human	known	74_37	missense	31.37	15.38	SNP	0.987	A	16	35
GTF2B	2959	genome.wustl.edu	37	1	89325834	89325834	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:89325834G>A	ENST00000370500.5	-	4	512	c.394C>T	c.(394-396)Cga>Tga	p.R132*	GTF2B_ENST00000494819.1_5'UTR	NM_001514.5	NP_001505.1	Q00403	TF2B_HUMAN	general transcription factor IIB	132			R -> Q (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)	core promoter binding (GO:0001047)|thyroid hormone receptor binding (GO:0046966)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		ACTATATTTCGAGGTAGATTG	0.363													ENSG00000137947																																					0													148.0	135.0	140.0					1																	89325834		2203	4300	6503	SO:0001587	stop_gained	0			-	M76766	CCDS715.1	1p22-p21	2010-03-23			ENSG00000137947	ENSG00000137947		"""General transcription factors"""	4648	protein-coding gene	gene with protein product		189963				1876184, 8162052	Standard	NM_001514		Approved	TFIIB	uc001dmo.4	Q00403	OTTHUMG00000010611	ENST00000370500.5:c.394C>T	1.37:g.89325834G>A	ENSP00000359531:p.Arg132*		A8K1A7|Q5JS30	Nonsense_Mutation	SNP	pfam_TFIIB_cyclin,pfam_Znf_TFIIB,pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pfscan_Znf_TFIIB,prints_TFIIB	p.R132*	ENST00000370500.5	37	c.394	CCDS715.1	1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706380	0.68615	.	.	ENSG00000137947	ENST00000370500;ENST00000448623;ENST00000418217	.	.	.	5.38	3.32	0.38043	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-21.7317	14.1977	0.65682	0.0:0.0:0.6381:0.3619	.	.	.	.	X	132;131;127	.	ENSP00000359531:R132X	R	-	1	2	GTF2B	89098422	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.393000	0.34497	1.339000	0.45563	0.591000	0.81541	CGA	-	GTF2B	-	pfam_TFIIB_cyclin,pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like		0.363	GTF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2B	HGNC	protein_coding	OTTHUMT00000029279.1	0	0	1	69	69	66	0.00	1.49	G	NM_001514		89325834	-1	19	24	33	58	tier1	no_errors	ENST00000370500	ensembl	human	known	74_37	nonsense	36.54	29.27	SNP	0.993	A	19	33
PARD6B	84612	genome.wustl.edu	37	20	49366862	49366862	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr20:49366862C>T	ENST00000371610.2	+	3	1199	c.956C>T	c.(955-957)tCa>tTa	p.S319L	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	319					axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						AGCCTGGAGTCATTAACACAG	0.443													ENSG00000124171																																					0													113.0	106.0	108.0					20																	49366862		2203	4300	6503	SO:0001583	missense	0			-	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.956C>T	20.37:g.49366862C>T	ENSP00000360672:p.Ser319Leu		A2A2A7|Q9Y510	Missense_Mutation	SNP	pfam_OPR_PB1,pfam_PDZ,superfamily_PDZ,smart_OPR_PB1,smart_PDZ,pfscan_PDZ	p.S319L	ENST00000371610.2	37	c.956	CCDS33485.1	20	.	.	.	.	.	.	.	.	.	.	C	18.17	3.563900	0.65651	.	.	ENSG00000124171	ENST00000371610	T	0.15487	2.42	5.73	5.73	0.89815	.	0.183393	0.41001	D	0.000972	T	0.26738	0.0654	M	0.63428	1.95	0.80722	D	1	P	0.48764	0.915	P	0.45343	0.477	T	0.00939	-1.1507	10	0.28530	T	0.3	-23.8856	19.8928	0.96935	0.0:1.0:0.0:0.0	.	319	Q9BYG5	PAR6B_HUMAN	L	319	ENSP00000360672:S319L	ENSP00000360672:S319L	S	+	2	0	PARD6B	48800269	0.999000	0.42202	0.751000	0.31187	0.271000	0.26615	4.740000	0.62087	2.713000	0.92767	0.591000	0.81541	TCA	-	PARD6B	-	NULL		0.443	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARD6B	HGNC	protein_coding	OTTHUMT00000079697.2	0	0	0	69	69	139	0.00	0.00	C	NM_032521		49366862	+1	28	38	43	113	tier1	no_errors	ENST00000371610	ensembl	human	known	74_37	missense	39.44	25.17	SNP	0.991	T	28	43
EMX1	2016	genome.wustl.edu	37	2	73161038	73161038	+	Silent	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr2:73161038G>A	ENST00000258106.6	+	3	1206	c.828G>A	c.(826-828)acG>acA	p.T276T	EMX1_ENST00000394111.5_3'UTR	NM_004097.2	NP_004088.2	Q04741	EMX1_HUMAN	empty spiracles homeobox 1	243					brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|in utero embryonic development (GO:0001701)|neuron projection extension (GO:1990138)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			cervix(1)|large_intestine(2)|lung(3)	6						GCATTGCCACGAAGCAGGCCA	0.597													ENSG00000135638																																					0													68.0	78.0	75.0					2																	73161038		2135	4252	6387	SO:0001819	synonymous_variant	0			-	X68879	CCDS1921.2	2p13.2	2011-06-20	2007-02-15		ENSG00000135638	ENSG00000135638		"""Homeoboxes / ANTP class : NKL subclass"""	3340	protein-coding gene	gene with protein product		600034	"""empty spiracles homolog 1 (Drosophila)"""			7959790	Standard	XM_005264203		Approved		uc002sin.1	Q04741	OTTHUMG00000129778	ENST00000258106.6:c.828G>A	2.37:g.73161038G>A			Q0D2P0|Q53T30|Q86XB0	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.T276	ENST00000258106.6	37	c.828	CCDS1921.2	2																																																																																			-	EMX1	-	NULL		0.597	EMX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMX1	HGNC	protein_coding	OTTHUMT00000251994.3	0	0	0	62	62	113	0.00	0.00	G			73161038	+1	25	16	52	70	tier1	no_errors	ENST00000258106	ensembl	human	known	74_37	silent	32.05	18.60	SNP	1.000	A	25	52
SPAG5	10615	genome.wustl.edu	37	17	26925903	26925903	+	Intron	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr17:26925903C>T	ENST00000321765.5	-	1	384				SPAG5-AS1_ENST00000414744.1_RNA|SPAG5-AS1_ENST00000554154.1_RNA|SPAG5-AS1_ENST00000556050.1_RNA|RP11-192H23.8_ENST00000582858.1_RNA	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5						chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CGCCAGAGATCTCCCGCTTAC	0.627													ENSG00000227543																																					0													54.0	57.0	56.0					17																	26925903		2203	4300	6503	SO:0001627	intron_variant	0			-	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.51+10G>A	17.37:g.26925903C>T			O95213|Q9BWE8|Q9NT17|Q9UFE6	R	SNP	-	NULL	ENST00000321765.5	37	NULL	CCDS32594.1	17																																																																																			-	SPAG5-AS1	-	-		0.627	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG5-AS1	HGNC	protein_coding	OTTHUMT00000390564.2	0	0	0	127	127	38	0.00	0.00	C	NM_006461		26925903	+1	48	6	82	16	tier1	no_errors	ENST00000414744	ensembl	human	known	74_37	rna	36.92	27.27	SNP	0.011	T	48	82
RSU1P2	100133308	genome.wustl.edu	37	10	45602152	45602152	+	RNA	SNP	G	G	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr10:45602152G>C	ENST00000423875.1	-	0	1284									Ras suppressor protein 1 pseudogene 2																		TAAGCAGTGAGATCAGGTCTT	0.448													ENSG00000232554																																					0																																												0			-			10q11.21	2013-06-03			ENSG00000242848	ENSG00000232554			44391	pseudogene	pseudogene							Standard	NR_024472		Approved		uc009xmq.2		OTTHUMG00000185442		10.37:g.45602152G>C				R	SNP	-	NULL	ENST00000423875.1	37	NULL		10																																																																																			-	RSU1P2	-	-		0.448	RSU1P2-002	KNOWN	basic	processed_transcript	RSU1P2	HGNC	pseudogene	OTTHUMT00000471233.1	0	0	0	109	109	59	0.00	0.00	G			45602152	-1	18	18	73	36	tier1	no_errors	ENST00000423875	ensembl	human	known	74_37	rna	19.78	33.33	SNP	1.000	C	18	73
SNX29P2	440352	genome.wustl.edu	37	16	29339873	29339873	+	lincRNA	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr16:29339873G>A	ENST00000398878.3	+	0	861							Q8IUI4	S29P2_HUMAN	sorting nexin 29 pseudogene 2																		TCTTACTGCGGATCCCACAGG	0.483													ENSG00000198106																																					0																																												0			-	BX648280		16p11.2	2014-03-21	2011-08-16	2011-08-16	ENSG00000198106	ENSG00000198106			31914	pseudogene	pseudogene			"""RUN domain containing 2C"""	RUNDC2C			Standard	NR_002939		Approved		uc021tfw.1	Q8IUI4			16.37:g.29339873G>A				Splice_Site	SNP	-	NULL	ENST00000398878.3	37	c.NULL		16																																																																																			-	SNX29P2	-	-		0.483	SNX29P2-202	KNOWN	basic	lincRNA	SNX29P2	HGNC	lincRNA		0	0	0	52	52	4	0.00	0.00	G	NR_002939		29339873	+1	11	8	78	10	tier1	no_errors	ENST00000398878	ensembl	human	known	74_37	splice_site	12.36	44.44	SNP	1.000	A	11	78
EP300	2033	genome.wustl.edu	37	22	41513493	41513493	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr22:41513493T>G	ENST00000263253.7	+	2	1616	c.397T>G	c.(397-399)Tct>Gct	p.S133A		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	133	Interaction with ALX1.|Interaction with RORA.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AGGCTTGACTTCTCCCAACAT	0.512			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome				ENSG00000100393																												Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													64.0	59.0	61.0					22																	41513493		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	-	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.397T>G	22.37:g.41513493T>G	ENSP00000263253:p.Ser133Ala		B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.S133A	ENST00000263253.7	37	c.397	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	T	13.26	2.183841	0.38609	.	.	ENSG00000100393	ENST00000263253	D	0.83250	-1.7	5.89	5.89	0.94794	.	0.000000	0.46758	D	0.000279	T	0.76941	0.4058	L	0.43152	1.355	0.36180	D	0.849348	B	0.25667	0.131	B	0.27715	0.082	T	0.74544	-0.3630	10	0.07990	T	0.79	-8.5901	16.3043	0.82842	0.0:0.0:0.0:1.0	.	133	Q09472	EP300_HUMAN	A	133	ENSP00000263253:S133A	ENSP00000263253:S133A	S	+	1	0	EP300	39843439	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.793000	0.55484	2.231000	0.72958	0.533000	0.62120	TCT	-	EP300	-	NULL		0.512	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	0	0	0	29	29	125	0.00	0.00	T	NM_001429		41513493	+1	6	22	31	133	tier1	no_errors	ENST00000263253	ensembl	human	known	74_37	missense	16.22	14.19	SNP	1.000	G	6	31
PCDHB15	56121	genome.wustl.edu	37	5	140625567	140625567	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr5:140625567A>G	ENST00000231173.3	+	1	421	c.421A>G	c.(421-423)Aaa>Gaa	p.K141E		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	141	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATGACCCTGAAAATCCCAGA	0.413													ENSG00000113248																																					0													70.0	75.0	73.0					5																	140625567		2203	4300	6503	SO:0001583	missense	0			-	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.421A>G	5.37:g.140625567A>G	ENSP00000231173:p.Lys141Glu		Q8IUX5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K141E	ENST00000231173.3	37	c.421	CCDS4257.1	5	.	.	.	.	.	.	.	.	.	.	A	7.360	0.624724	0.14193	.	.	ENSG00000113248	ENST00000231173	T	0.48522	0.81	4.76	3.55	0.40652	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.35970	0.0950	N	0.25245	0.725	0.30126	N	0.805255	B	0.18166	0.026	B	0.34779	0.189	T	0.40496	-0.9560	9	0.51188	T	0.08	.	4.8939	0.13740	0.6752:0.1643:0.1605:0.0	.	141	Q9Y5E8	PCDBF_HUMAN	E	141	ENSP00000231173:K141E	ENSP00000231173:K141E	K	+	1	0	PCDHB15	140605751	0.000000	0.05858	1.000000	0.80357	0.681000	0.39784	0.312000	0.19397	0.739000	0.32628	0.260000	0.18958	AAA	-	PCDHB15	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.413	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB15	HGNC	protein_coding	OTTHUMT00000251804.2	0	0	0	48	48	127	0.00	0.00	A	NM_018935		140625567	+1	19	21	22	58	tier1	no_errors	ENST00000231173	ensembl	human	known	74_37	missense	46.34	26.58	SNP	1.000	G	19	22
HECTD3	79654	genome.wustl.edu	37	1	45469037	45469037	+	3'UTR	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:45469037C>T	ENST00000372172.4	-	0	2784				HECTD3_ENST00000486132.1_5'UTR|HECTD3_ENST00000372168.3_3'UTR	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					CAACTGCACACAGGAGCAGGG	0.632													ENSG00000126107																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.*127G>A	1.37:g.45469037C>T			B3KPV7|B3KRH4|Q5T448|Q9H783	R	SNP	-	NULL	ENST00000372172.4	37	NULL	CCDS41318.1	1																																																																																			-	HECTD3	-	-		0.632	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD3	HGNC	protein_coding	OTTHUMT00000023734.1	0	0	0	25	25	56	0.00	0.00	C	NM_024602		45469037	-1	10	17	21	28	tier1	no_errors	ENST00000486132	ensembl	human	known	74_37	rna	32.26	37.78	SNP	0.000	T	10	21
SMC5	23137	genome.wustl.edu	37	9	72882851	72882851	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr9:72882851G>A	ENST00000361138.5	+	3	398	c.340G>A	c.(340-342)Gtg>Atg	p.V114M		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	114					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						TGGGTTTTTTGTGAAGAGAGG	0.313													ENSG00000198887																																					0													260.0	258.0	259.0					9																	72882851		2203	4300	6503	SO:0001583	missense	0			-	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.340G>A	9.37:g.72882851G>A	ENSP00000354957:p.Val114Met		A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	p.V114M	ENST00000361138.5	37	c.340	CCDS6632.1	9	.	.	.	.	.	.	.	.	.	.	G	26.5	4.747057	0.89663	.	.	ENSG00000198887	ENST00000361138	T	0.70986	-0.53	5.8	5.8	0.92144	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.86372	0.5917	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87310	0.2311	10	0.87932	D	0	-14.1397	20.0493	0.97618	0.0:0.0:1.0:0.0	.	114	Q8IY18	SMC5_HUMAN	M	114	ENSP00000354957:V114M	ENSP00000354957:V114M	V	+	1	0	SMC5	72072671	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.053000	0.93860	2.745000	0.94114	0.491000	0.48974	GTG	-	SMC5	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase		0.313	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	HGNC	protein_coding	OTTHUMT00000052603.1	0	0	0	125	125	111	0.00	0.00	G	NM_015110		72882851	+1	32	29	71	122	tier1	no_errors	ENST00000361138	ensembl	human	known	74_37	missense	31.07	19.21	SNP	1.000	A	32	71
AKAP9	10142	genome.wustl.edu	37	7	91641895	91641895	+	Silent	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr7:91641895G>A	ENST00000359028.2	+	10	3732	c.3507G>A	c.(3505-3507)aaG>aaA	p.K1169K	AKAP9_ENST00000356239.3_Silent_p.K1157K|AKAP9_ENST00000358100.2_Silent_p.K1169K			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1169					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AAGAGGAAAAGATCAAGGAAC	0.333			T	BRAF	papillary thyroid								ENSG00000127914																												Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													79.0	82.0	81.0					7																	91641895		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3507G>A	7.37:g.91641895G>A			A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.K1169	ENST00000359028.2	37	c.3507		7																																																																																			-	AKAP9	-	NULL		0.333	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		0	0	0	72	72	40	0.00	0.00	G	NM_005751		91641895	+1	48	68	45	44	tier1	no_errors	ENST00000359028	ensembl	human	known	74_37	silent	51.61	60.71	SNP	1.000	A	48	45
TBL3	10607	genome.wustl.edu	37	16	2026921	2026921	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr16:2026921A>T	ENST00000568546.1	+	14	1527	c.1399A>T	c.(1399-1401)Atc>Ttc	p.I467F		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	467					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CAACGGCCCTATCCTCCTGCA	0.617													ENSG00000183751																									Melanoma(118;616 1651 35077 38081 48633)												0													110.0	89.0	96.0					16																	2026921		2198	4300	6498	SO:0001583	missense	0			-	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.1399A>T	16.37:g.2026921A>T	ENSP00000454836:p.Ile467Phe		Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp13,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I467F	ENST00000568546.1	37	c.1399	CCDS10453.1	16	.	.	.	.	.	.	.	.	.	.	A	1.642	-0.516208	0.04200	.	.	ENSG00000183751	ENST00000332704	.	.	.	5.27	-10.5	0.00291	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	2.017890	0.02164	N	0.059108	T	0.19725	0.0474	N	0.16368	0.405	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.001	T	0.06552	-1.0820	9	0.15066	T	0.55	-6.9127	5.8343	0.18599	0.5042:0.1422:0.2819:0.0717	.	229;467	A0JLS5;Q12788	.;TBL3_HUMAN	F	467	.	ENSP00000331815:I467F	I	+	1	0	TBL3	1966922	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.534000	0.06150	-2.355000	0.00614	-2.200000	0.00306	ATC	-	TBL3	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.617	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL3	HGNC	protein_coding	OTTHUMT00000250615.3	0	0	0	46	46	88	0.00	0.00	A	NM_006453		2026921	+1	21	22	26	42	tier1	no_errors	ENST00000568546	ensembl	human	known	74_37	missense	44.68	34.38	SNP	0.000	T	21	26
ZBED4	9889	genome.wustl.edu	37	22	50278947	50278948	+	Frame_Shift_Ins	INS	-	-	A	rs202191291|rs145958586		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr22:50278947_50278948insA	ENST00000216268.5	+	2	2114_2115	c.1637_1638insA	c.(1636-1641)acaaaafs	p.TK546fs		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	546						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		ACAGTGGTCACAAAAAACAATC	0.446													ENSG00000100426																																					0																																										SO:0001589	frameshift_variant	0				AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.1643dupA	22.37:g.50278953_50278953dupA	ENSP00000216268:p.Thr546fs		B2RZH1|Q1ECU0|Q9UGG8	Frame_Shift_Ins	INS	pfam_Znf_BED_prd,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.N548fs	ENST00000216268.5	37	c.1637_1638	CCDS33677.1	22																																																																																				ZBED4	-	NULL		0.446	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED4	HGNC	protein_coding	OTTHUMT00000317408.2	0	0	0	56	56	132	0.00	0.00	-	NM_014838		50278948	+1	13	20	77	174	tier1	no_errors	ENST00000216268	ensembl	human	known	74_37	frame_shift_ins	14.44	10.31	INS	0.005:0.000	A	13	77
TENM4	26011	genome.wustl.edu	37	11	78807973	78807974	+	Intron	INS	-	-	CA	rs2510132|rs375036597|rs546308100	byFrequency	TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	-	-	-	CA	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr11:78807973_78807974insCA	ENST00000278550.7	-	5	398				CTD-2337I7.1_ENST00000526091.1_lincRNA	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4						cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										gcgcgcgcgcgcacacacacac	0.46													ENSG00000255345																																					0																																										SO:0001627	intron_variant	0				AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.65-26919->TG	11.37:g.78807982_78807983dupCA			A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	R	INS	-	NULL	ENST00000278550.7	37	NULL	CCDS44688.1	11																																																																																				CTD-2337I7.1	-	-		0.460	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928921	Clone_based_vega_gene	protein_coding	OTTHUMT00000391406.2	0	0	0	8	8	7	0.00	0.00	-			78807974	+1	5	7	34	11	tier1	no_errors	ENST00000526091	ensembl	human	known	74_37	rna	12.82	38.89	INS	0.002:0.002	CA	5	34
TSHZ2	128553	genome.wustl.edu	37	20	51870078	51870080	+	In_Frame_Del	DEL	AAA	AAA	-	rs552810975	byFrequency	TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	AAA	AAA	AAA	-	AAA	AAA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr20:51870078_51870080delAAA	ENST00000371497.5	+	2	968_970	c.81_83delAAA	c.(79-84)ataaaa>ata	p.K28del	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_In_Frame_Del_p.K25del|TSHZ2_ENST00000603338.2_In_Frame_Del_p.K25del	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	28					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			aggaggaaataaaagaagaggag	0.502													ENSG00000182463																																					0									,	29,4235		0,29,2103					,	5.7	1.0			38	1,8253		0,1,4126	no	coding,coding	TSHZ2	NM_173485.5,NM_001193421.1	,	0,30,6229	A1A1,A1R,RR		0.0121,0.6801,0.2397	,	,		30,12488				SO:0001651	inframe_deletion	0				AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.81_83delAAA	20.37:g.51870078_51870080delAAA	ENSP00000360552:p.Lys28del		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	In_Frame_Del	DEL	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.K28in_frame_del	ENST00000371497.5	37	c.81_83	CCDS33490.1	20																																																																																				TSHZ2	-	NULL		0.502	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	0	0	0	50	50	92	0.00	0.00	AAA	NM_173485		51870080	+1	14	13	67	87	tier1	no_errors	ENST00000371497	ensembl	human	known	74_37	in_frame_del	17.28	13.00	DEL	0.466:0.989:1.000	-	14	67
GLA	2717	genome.wustl.edu	37	X	100653780	100653780	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chrX:100653780delG	ENST00000218516.3	-	5	815	c.794delC	c.(793-795)ccafs	p.P265fs	GLA_ENST00000479445.1_5'Flank|RPL36A-HNRNPH2_ENST00000409170.3_Intron	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	265			P -> R (in FD). {ECO:0000269|PubMed:8931708}.		glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)	p.P265Q(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						TACCATATCTGGGTCATTCCA	0.428													ENSG00000102393																									Colon(193;776 2816 31189 44474)												1	Substitution - Missense(1)	lung(1)	GRCh37	CM051528|CM960770	GLA	M							136.0	126.0	129.0					X																	100653780		2203	4300	6503	SO:0001589	frameshift_variant	0				X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.794delC	X.37:g.100653780delG	ENSP00000218516:p.Pro265fs		Q6LER7	Frame_Shift_Del	DEL	pfam_Glyco_hydro_GHD,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_27	p.P265fs	ENST00000218516.3	37	c.794	CCDS14484.1	X																																																																																				GLA	-	superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_27		0.428	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLA	HGNC	protein_coding	OTTHUMT00000057540.1	0	0	0	189	189	173	0.00	0.00	G			100653780	-1	29	46	48	32	tier1	no_errors	ENST00000218516	ensembl	human	known	74_37	frame_shift_del	37.66	58.97	DEL	1.000	-	29	48
OR2A25	392138	genome.wustl.edu	37	7	143771448	143771448	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr7:143771448G>T	ENST00000408898.2	+	1	174	c.136G>T	c.(136-138)Ggg>Tgg	p.G46W		NM_001004488.1	NP_001004488.1	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A, member 25	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(16)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	24	Melanoma(164;0.0783)					GACAATCCTGGGGCTCATCTC	0.562													ENSG00000221933																																					0													81.0	84.0	83.0					7																	143771448		2203	4300	6503	SO:0001583	missense	0			-		CCDS43669.1	7q35	2012-08-09		2004-03-10	ENSG00000221933	ENSG00000221933		"""GPCR / Class A : Olfactory receptors"""	19562	protein-coding gene	gene with protein product				OR2A25P, OR2A27			Standard	NM_001004488		Approved		uc011ktx.2	A4D2G3	OTTHUMG00000158013	ENST00000408898.2:c.136G>T	7.37:g.143771448G>T	ENSP00000386167:p.Gly46Trp		B2RNC9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G46W	ENST00000408898.2	37	c.136	CCDS43669.1	7	.	.	.	.	.	.	.	.	.	.	G	6.763	0.509650	0.12883	.	.	ENSG00000221933	ENST00000408898	T	0.01084	5.36	4.88	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03520	0.0101	L	0.47716	1.5	0.09310	N	1	D	0.76494	0.999	D	0.72075	0.976	T	0.46091	-0.9216	9	0.49607	T	0.09	-2.2318	6.2267	0.20711	0.0937:0.0:0.724:0.1823	.	46	A4D2G3	O2A25_HUMAN	W	46	ENSP00000386167:G46W	ENSP00000386167:G46W	G	+	1	0	OR2A25	143402381	0.000000	0.05858	0.916000	0.36221	0.031000	0.12232	-0.655000	0.05348	1.276000	0.44395	0.563000	0.77884	GGG	-	OR2A25	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.562	OR2A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A25	HGNC	protein_coding	OTTHUMT00000350000.1	0	0	0	140	140	23	0.00	0.00	G			143771448	+1	30	7	24	4	tier1	no_errors	ENST00000408898	ensembl	human	known	74_37	missense	55.56	63.64	SNP	0.014	T	30	24
LRG1	116844	genome.wustl.edu	37	19	4538293	4538293	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr19:4538293G>A	ENST00000306390.6	-	2	1163	c.703C>T	c.(703-705)Cag>Tag	p.Q235*	CTB-50L17.14_ENST00000586020.1_Intron|LRG1_ENST00000586883.1_5'Flank	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	235					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTCCGGCTGCGGCAAGAGG	0.597													ENSG00000171236																																					0													212.0	230.0	224.0					19																	4538293		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.703C>T	19.37:g.4538293G>A	ENSP00000302621:p.Gln235*		Q8N4F5|Q96QZ4	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Q235*	ENST00000306390.6	37	c.703	CCDS12130.1	19	.	.	.	.	.	.	.	.	.	.	.	18.89	3.719247	0.68844	.	.	ENSG00000171236	ENST00000306390;ENST00000538589	.	.	.	5.14	4.05	0.47172	.	0.000000	0.38548	N	0.001644	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-28.6216	10.9661	0.47414	0.0:0.0:0.8145:0.1855	.	.	.	.	X	235;218	.	ENSP00000302621:Q235X	Q	-	1	0	LRG1	4489293	0.000000	0.05858	0.479000	0.27329	0.010000	0.07245	0.469000	0.22067	2.674000	0.91012	0.655000	0.94253	CAG	-	LRG1	-	NULL		0.597	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRG1	HGNC	protein_coding	OTTHUMT00000458654.2	0	0	0	50	50	127	0.00	0.00	G	NM_052972		4538293	-1	12	4	65	81	tier1	no_errors	ENST00000306390	ensembl	human	known	74_37	nonsense	15.58	4.71	SNP	0.029	A	12	65
APMAP	57136	genome.wustl.edu	37	20	24949549	24949549	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr20:24949549C>T	ENST00000217456.2	-	8	1310	c.1020G>A	c.(1018-1020)tgG>tgA	p.W340*	APMAP_ENST00000447138.1_Intron	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	340					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										TCCTTTTAATCCAGGGTCTCT	0.423													ENSG00000101474																																					0													57.0	60.0	59.0					20																	24949549		2203	4300	6503	SO:0001587	stop_gained	0			-	AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.1020G>A	20.37:g.24949549C>T	ENSP00000217456:p.Trp340*		A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Nonsense_Mutation	SNP	pfam_Strictosidine_synth_cons-reg,pfam_SGL	p.W340*	ENST00000217456.2	37	c.1020	CCDS13166.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.599715|5.599715	0.96614|0.96614	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000451442|ENST00000217456	.|.	.|.	.|.	5.54|5.54	-2.18|-2.18	0.07037|0.07037	.|.	.|0.725798	.|0.15490	.|N	.|0.259606	T|.	0.32675|.	0.0837|.	.|.	.|.	.|.	0.23376|0.23376	N|N	0.9978|0.9978	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.31280|.	-0.9949|.	4|.	.|0.27082	.|T	.|0.32	10.012|10.012	10.1724|10.1724	0.42917|0.42917	0.1621:0.5655:0.2724:0.0|0.1621:0.5655:0.2724:0.0	.|.	.|.	.|.	.|.	E|X	325|340	.|.	.|ENSP00000217456:W340X	G|W	-|-	2|3	0|0	C20orf3|C20orf3	24897549|24897549	1.000000|1.000000	0.71417|0.71417	0.000000|0.000000	0.03702|0.03702	0.726000|0.726000	0.41606|0.41606	2.338000|2.338000	0.43957|0.43957	-0.660000|-0.660000	0.05352|0.05352	-0.397000|-0.397000	0.06425|0.06425	GGA|TGG	-	APMAP	-	NULL		0.423	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APMAP	HGNC	protein_coding	OTTHUMT00000078380.2	0	0	0	86	86	97	0.00	0.00	C	NM_020531		24949549	-1	9	5	61	62	tier1	no_errors	ENST00000217456	ensembl	human	known	74_37	nonsense	12.86	7.46	SNP	0.324	T	9	61
GOLT1B	51026	genome.wustl.edu	37	12	21661451	21661451	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr12:21661451G>C	ENST00000229314.5	+	3	361	c.252G>C	c.(250-252)ttG>ttC	p.L84F	GOLT1B_ENST00000540141.1_Missense_Mutation_p.L84F|GOLT1B_ENST00000542038.1_Missense_Mutation_p.L20F|GOLT1B_ENST00000535593.1_Intron	NM_016072.4	NP_057156.1	Q9Y3E0	GOT1B_HUMAN	golgi transport 1B	84	Phe-rich.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|signal transduction (GO:0007165)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	signal transducer activity (GO:0004871)			large_intestine(2)|lung(3)	5						GTTGGCCTTTGATAGGCATGA	0.333													ENSG00000111711																																					0													114.0	113.0	113.0					12																	21661451		2203	4299	6502	SO:0001583	missense	0			-	AB097020	CCDS8689.1	12p13.1	2010-06-24	2010-06-24		ENSG00000111711	ENSG00000111711			20175	protein-coding gene	gene with protein product		615078	"""golgi transport 1 homolog B (S. cerevisiae)"""			12414650, 10810093	Standard	NM_016072		Approved	CGI-141, YMR292W, GOT1	uc001rez.2	Q9Y3E0	OTTHUMG00000169133	ENST00000229314.5:c.252G>C	12.37:g.21661451G>C	ENSP00000229314:p.Leu84Phe		B2R4R4|Q54A40|Q6I9W6|Q9P1R9	Missense_Mutation	SNP	pfam_Vesicle_transpt_Got1/SFT2	p.L84F	ENST00000229314.5	37	c.252	CCDS8689.1	12	.	.	.	.	.	.	.	.	.	.	G	9.120	1.008814	0.19199	.	.	ENSG00000111711	ENST00000542038;ENST00000540141;ENST00000229314	.	.	.	5.9	5.9	0.94986	.	0.066487	0.64402	D	0.000017	T	0.38558	0.1045	N	0.21448	0.665	0.44816	D	0.997827	B	0.06786	0.001	B	0.11329	0.006	T	0.30031	-0.9992	9	0.19147	T	0.46	-4.1732	6.9293	0.24432	0.1086:0.1744:0.7169:0.0	.	84	Q9Y3E0	GOT1B_HUMAN	F	20;84;84	.	ENSP00000229314:L84F	L	+	3	2	GOLT1B	21552718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.986000	0.29590	2.788000	0.95919	0.650000	0.86243	TTG	-	GOLT1B	-	pfam_Vesicle_transpt_Got1/SFT2		0.333	GOLT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLT1B	HGNC	protein_coding	OTTHUMT00000402384.2	0	0	0	99	99	75	0.00	0.00	G	NM_016072		21661451	+1	12	10	112	126	tier1	no_errors	ENST00000229314	ensembl	human	known	74_37	missense	9.68	7.35	SNP	1.000	C	12	112
FBXO42	54455	genome.wustl.edu	37	1	16578257	16578257	+	Silent	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:16578257G>A	ENST00000375592.3	-	10	1278	c.1062C>T	c.(1060-1062)ttC>ttT	p.F354F		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	354										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		GAGCCTGGCTGAAGACCACCA	0.512													ENSG00000037637																																					0													64.0	65.0	65.0					1																	16578257		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1062C>T	1.37:g.16578257G>A			B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Silent	SNP	pfam_Kelch_2,pfam_Kelch_1,pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.F354	ENST00000375592.3	37	c.1062	CCDS30613.1	1																																																																																			-	FBXO42	-	NULL		0.512	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO42	HGNC	protein_coding	OTTHUMT00000006285.1	0	0	0	21	21	96	0.00	0.00	G			16578257	-1	6	7	23	91	tier1	no_errors	ENST00000375592	ensembl	human	known	74_37	silent	20.69	7.07	SNP	1.000	A	6	23
HSP90AA1	3320	genome.wustl.edu	37	14	102549597	102549597	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr14:102549597C>A	ENST00000216281.8	-	9	1734	c.1529G>T	c.(1528-1530)cGt>cTt	p.R510L	HSP90AA1_ENST00000441629.2_Missense_Mutation_p.R331L|HSP90AA1_ENST00000334701.7_Missense_Mutation_p.R632L	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	510					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	TTTCCGAAGACGTTCCACAAA	0.413													ENSG00000080824																																					0													130.0	124.0	126.0					14																	102549597		2203	4300	6503	SO:0001583	missense	0			-	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.1529G>T	14.37:g.102549597C>A	ENSP00000216281:p.Arg510Leu		A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	pirsf_Hsp90_fam,pfam_Hsp90_fam,pfam_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,prints_Hsp90_N	p.R632L	ENST00000216281.8	37	c.1895	CCDS9967.1	14	.	.	.	.	.	.	.	.	.	.	c	28.7	4.946614	0.92593	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000441629	T;T;T	0.10382	2.88;2.88;2.88	4.44	4.44	0.53790	Ribosomal protein S5 domain 2-type fold (1);	0.000000	0.85682	U	0.000000	T	0.24851	0.0603	M	0.78049	2.395	0.80722	D	1	P;P;P	0.48350	0.909;0.459;0.788	P;B;B	0.48901	0.594;0.107;0.41	T	0.10042	-1.0647	10	0.72032	D	0.01	-14.5992	17.4478	0.87583	0.0:1.0:0.0:0.0	.	331;632;510	Q86U12;P07900-2;P07900	.;.;HS90A_HUMAN	L	510;632;331	ENSP00000216281:R510L;ENSP00000335153:R632L;ENSP00000396189:R331L	ENSP00000216281:R510L	R	-	2	0	HSP90AA1	101619350	1.000000	0.71417	0.902000	0.35471	0.994000	0.84299	7.565000	0.82337	2.192000	0.70111	0.655000	0.94253	CGT	-	HSP90AA1	-	pirsf_Hsp90_fam,pfam_Hsp90_fam,superfamily_Ribosomal_S5_D2-typ_fold		0.413	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HSP90AA1	HGNC	protein_coding	OTTHUMT00000414952.2	0	0	0	91	91	88	0.00	0.00	C	NM_005348		102549597	-1	14	5	96	64	tier1	no_errors	ENST00000334701	ensembl	human	known	74_37	missense	12.73	7.25	SNP	1.000	A	14	96
TRIM38	10475	genome.wustl.edu	37	6	25966859	25966859	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr6:25966859C>T	ENST00000357085.3	+	3	585	c.109C>T	c.(109-111)Cac>Tac	p.H37Y	TRIM38_ENST00000349458.3_Missense_Mutation_p.H37Y	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	37					negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						CAGCTACTGCCACTTGTGTAT	0.498													ENSG00000112343																																					0													95.0	91.0	93.0					6																	25966859		2203	4300	6503	SO:0001583	missense	0			-	U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.109C>T	6.37:g.25966859C>T	ENSP00000349596:p.His37Tyr		B2R862	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.H37Y	ENST00000357085.3	37	c.109	CCDS4568.1	6	.	.	.	.	.	.	.	.	.	.	c	11.28	1.590789	0.28357	.	.	ENSG00000112343	ENST00000540262;ENST00000349458;ENST00000357085	T;T;T	0.07567	3.18;3.18;3.18	4.37	-5.93	0.02254	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	1.976990	0.02232	N	0.064974	T	0.00998	0.0033	N	0.05534	-0.03	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.40701	-0.9549	10	0.52906	T	0.07	.	1.8723	0.03211	0.4282:0.227:0.2022:0.1426	.	37;37	B2R862;O00635	.;TRI38_HUMAN	Y	37	ENSP00000443976:H37Y;ENSP00000230099:H37Y;ENSP00000349596:H37Y	ENSP00000230099:H37Y	H	+	1	0	TRIM38	26074838	0.002000	0.14202	0.001000	0.08648	0.007000	0.05969	-0.244000	0.08903	-1.345000	0.02214	-0.237000	0.12165	CAC	-	TRIM38	-	smart_Znf_RING,pfscan_Znf_RING		0.498	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM38	HGNC	protein_coding	OTTHUMT00000040076.2	0	0	0	55	55	97	0.00	0.00	C			25966859	+1	5	5	55	61	tier1	no_errors	ENST00000349458	ensembl	human	known	74_37	missense	8.33	7.58	SNP	0.004	T	5	55
DGKB	1607	genome.wustl.edu	37	7	14647116	14647116	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr7:14647116T>A	ENST00000403951.2	-	17	1798	c.1379A>T	c.(1378-1380)cAg>cTg	p.Q460L	DGKB_ENST00000407950.1_Missense_Mutation_p.Q452L|DGKB_ENST00000406247.3_Missense_Mutation_p.Q460L|DGKB_ENST00000444700.2_Missense_Mutation_p.Q441L|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000402815.1_Missense_Mutation_p.Q459L|DGKB_ENST00000399322.3_Missense_Mutation_p.Q460L|DGKB_ENST00000258767.5_Missense_Mutation_p.Q460L			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	460	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TAATAGATACTGGAATTTTCT	0.289													ENSG00000136267																																					0													44.0	42.0	43.0					7																	14647116		1779	4044	5823	SO:0001583	missense	0			-	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1379A>T	7.37:g.14647116T>A	ENSP00000385780:p.Gln460Leu		A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.Q460L	ENST00000403951.2	37	c.1379	CCDS47547.1	7	.	.	.	.	.	.	.	.	.	.	T	22.8	4.337526	0.81911	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91;1.91	5.6	5.6	0.85130	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.42291	0.1196	L	0.46157	1.445	0.58432	D	0.999995	P;P;P;P	0.51933	0.866;0.949;0.949;0.837	P;P;P;P	0.60473	0.665;0.875;0.875;0.516	T	0.15780	-1.0425	10	0.51188	T	0.08	.	16.0737	0.80955	0.0:0.0:0.0:1.0	.	459;441;460;460	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	L	460;460;460;459;452;441;460	ENSP00000385780:Q460L;ENSP00000382260:Q460L;ENSP00000258767:Q460L;ENSP00000384909:Q459L;ENSP00000385031:Q452L;ENSP00000388451:Q441L;ENSP00000386066:Q460L	ENSP00000258767:Q460L	Q	-	2	0	DGKB	14613641	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.812000	0.75226	2.248000	0.74166	0.459000	0.35465	CAG	-	DGKB	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom		0.289	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKB	HGNC	protein_coding	OTTHUMT00000326356.2	0	0	0	342	342	47	0.00	0.00	T	NM_004080		14647116	-1	29	6	276	92	tier1	no_errors	ENST00000258767	ensembl	human	known	74_37	missense	9.51	6.12	SNP	1.000	A	29	276
DLGAP2	9228	genome.wustl.edu	37	8	1639774	1639774	+	Missense_Mutation	SNP	G	G	C	rs376702358		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr8:1639774G>C	ENST00000421627.2	+	10	2672	c.2538G>C	c.(2536-2538)tgG>tgC	p.W846C		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	925					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		AGTTTTATTGGCTTTGCCAAC	0.413													ENSG00000198010																																					0													77.0	82.0	80.0					8																	1639774		2022	4226	6248	SO:0001583	missense	0			-	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2538G>C	8.37:g.1639774G>C	ENSP00000400258:p.Trp846Cys		A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	pfam_GKAP	p.W846C	ENST00000421627.2	37	c.2538	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.03|17.03	3.285127|3.285127	0.59867|0.59867	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000520901|ENST00000356067;ENST00000421627	.|T	.|0.16897	.|2.31	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|0.059578	.|0.64402	.|D	.|0.000001	T|T	0.38214|0.38214	0.1032|0.1032	L|L	0.50919|0.50919	1.6|1.6	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.991	.|D;D	.|0.85130	.|0.997;0.988	T|T	0.17992|0.17992	-1.0351|-1.0351	5|10	.|0.66056	.|D	.|0.02	-7.3573|-7.3573	17.9404|17.9404	0.89025|0.89025	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|911;925	.|Q9P1A6-2;Q9P1A6	.|.;DLGP2_HUMAN	A|C	849|877;846	.|ENSP00000400258:W846C	.|ENSP00000348366:W877C	G|W	+|+	2|3	0|0	DLGAP2|DLGAP2	1627181|1627181	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	5.207000|5.207000	0.65197|0.65197	2.214000|2.214000	0.71695|0.71695	0.655000|0.655000	0.94253|0.94253	GGC|TGG	-	DLGAP2	-	pfam_GKAP		0.413	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	HGNC	protein_coding	OTTHUMT00000374478.1	0	0	0	52	52	82	0.00	0.00	G	NM_004745		1639774	+1	16	9	38	84	tier1	no_errors	ENST00000421627	ensembl	human	known	74_37	missense	29.63	9.68	SNP	1.000	C	16	38
ADAM28	10863	genome.wustl.edu	37	8	24184147	24184147	+	Splice_Site	SNP	A	A	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr8:24184147A>T	ENST00000265769.4	+	10	1081	c.971A>T	c.(970-972)cAg>cTg	p.Q324L	RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000437154.2_Splice_Site_p.Q324L|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000518516.1_3'UTR|ADAM28_ENST00000397649.3_Splice_Site_p.Q71L|ADAM28_ENST00000540823.1_Splice_Site_p.Q91L|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000518988.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	324	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		GGCGTTGTTCAGGTCTGTATG	0.343													ENSG00000042980																									NSCLC(193;488 2149 22258 34798 40734)												0													303.0	262.0	276.0					8																	24184147		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.972+1A>T	8.37:g.24184147A>T			B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q324L	ENST00000265769.4	37	c.971	CCDS34865.1	8	.	.	.	.	.	.	.	.	.	.	A	16.00	2.999326	0.54147	.	.	ENSG00000042980	ENST00000265769;ENST00000397649;ENST00000540823;ENST00000437154	T;T;T;T	0.09163	3.01;3.01;3.01;3.01	5.51	5.51	0.81932	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.29652	0.0740	M	0.85462	2.755	0.58432	D	0.999997	B;P;P;P	0.47484	0.372;0.896;0.896;0.696	B;P;P;P	0.53224	0.403;0.721;0.721;0.535	T	0.04281	-1.0963	9	0.51188	T	0.08	.	13.8671	0.63594	1.0:0.0:0.0:0.0	.	91;324;324;324	B4DDY3;B2RMV5;Q9UKQ2;Q9UKQ2-2	.;.;ADA28_HUMAN;.	L	324;71;91;324	ENSP00000265769:Q324L;ENSP00000380770:Q71L;ENSP00000443743:Q91L;ENSP00000393699:Q324L	ENSP00000265769:Q324L	Q	+	2	0	ADAM28	24240092	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	4.342000	0.59341	2.210000	0.71456	0.533000	0.62120	CAG	-	ADAM28	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B		0.343	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	HGNC	protein_coding	OTTHUMT00000375441.2	0	0	0	131	131	99	0.00	0.00	A	NM_021778	Missense_Mutation	24184147	+1	12	6	128	91	tier1	no_errors	ENST00000265769	ensembl	human	known	74_37	missense	8.57	6.19	SNP	1.000	T	12	128
ALG1L	200810	genome.wustl.edu	37	3	125652482	125652482	+	Silent	SNP	C	C	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr3:125652482C>A	ENST00000340333.3	-	2	199	c.36G>T	c.(34-36)ggG>ggT	p.G12G		NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like	12							transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						CCAGCCTGCTCCCAGCATCCA	0.622													ENSG00000189366																																					0													28.0	27.0	27.0					3																	125652482		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.36G>T	3.37:g.125652482C>A			D3DNA5	Silent	SNP	NULL	p.G12	ENST00000340333.3	37	c.36	CCDS33840.1	3																																																																																			-	ALG1L	-	NULL		0.622	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1L	HGNC	protein_coding	OTTHUMT00000356347.1	0	0	0	56	56	8	0.00	0.00	C	NM_001015050		125652482	-1	7	0	45	7	tier1	no_errors	ENST00000340333	ensembl	human	known	74_37	silent	13.46	0.00	SNP	0.000	A	7	45
DNAAF3	352909	genome.wustl.edu	37	19	55672542	55672542	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr19:55672542A>G	ENST00000524407.2	-	8	836	c.803T>C	c.(802-804)gTg>gCg	p.V268A	CTD-2587H24.4_ENST00000587871.1_5'Flank|DNAAF3_ENST00000391720.4_Missense_Mutation_p.V315A|DNAAF3_ENST00000527223.2_Missense_Mutation_p.V336A|DNAAF3_ENST00000455045.1_Missense_Mutation_p.V214A|CTD-2587H24.5_ENST00000591665.1_RNA|DNAAF3_ENST00000587789.2_5'Flank			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	268					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											GCGCGCTGCCACGCGCTCCCC	0.687													ENSG00000167646																																					0													8.0	11.0	10.0					19																	55672542		2107	4210	6317	SO:0001583	missense	0			-	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.803T>C	19.37:g.55672542A>G	ENSP00000432046:p.Val268Ala		A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	NULL	p.V336A	ENST00000524407.2	37	c.1007	CCDS59422.1	19	.	.	.	.	.	.	.	.	.	.	A	17.45	3.392145	0.62066	.	.	ENSG00000167646	ENST00000301249;ENST00000455045;ENST00000391720	T;T	0.19532	2.14;2.14	4.39	4.39	0.52855	.	0.073892	0.53938	D	0.000053	T	0.33847	0.0877	M	0.76170	2.325	0.20196	N	0.99993	P;D;P;D	0.55385	0.93;0.971;0.93;0.971	P;P;P;P	0.50934	0.561;0.654;0.459;0.654	T	0.22591	-1.0212	10	0.56958	D	0.05	-25.6895	11.4881	0.50365	1.0:0.0:0.0:0.0	.	336;214;289;268	E9PAX5;E3W9A1;Q8N9W5-3;Q8N9W5	.;.;.;CS051_HUMAN	A	336;214;315	ENSP00000394343:V214A;ENSP00000375600:V315A	ENSP00000301249:V336A	V	-	2	0	C19orf51	60364354	0.725000	0.28048	0.966000	0.40874	0.964000	0.63967	5.527000	0.67123	1.766000	0.52107	0.454000	0.30748	GTG	-	DAF3	-	NULL		0.687	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DAF3	HGNC	protein_coding	OTTHUMT00000250388.5	0	0	0	71	71	18	0.00	0.00	A	NM_178837		55672542	-1	37	1	45	5	tier1	no_errors	ENST00000527223	ensembl	human	known	74_37	missense	45.12	16.67	SNP	0.242	G	37	45
HP09025	100652929	genome.wustl.edu	37	17	77681418	77681418	+	lincRNA	SNP	G	G	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr17:77681418G>C	ENST00000397549.2	+	0	344				MIR4739_ENST00000577633.1_RNA																							CGCAGCAATCGCCAGGCCCTG	0.667													ENSG00000214105																																					0																																												0			-																													17.37:g.77681418G>C				R	SNP	-	NULL	ENST00000397549.2	37	NULL		17																																																																																			-	CTD-2116F7.1	-	-		0.667	CTD-2116F7.1-001	KNOWN	basic	lincRNA	ENSG00000214105	Clone_based_vega_gene	lincRNA	OTTHUMT00000437037.1	0	0	0	91	91	12	0.00	0.00	G			77681418	+1	8	0	85	9	tier1	no_errors	ENST00000397549	ensembl	human	known	74_37	rna	8.60	0.00	SNP	0.000	C	8	85
BCAN	63827	genome.wustl.edu	37	1	156616443	156616449	+	Intron	DEL	CCCTGGC	CCCTGGC	-	rs113490499|rs368082583|rs200291408|rs200678440	byFrequency	TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	CCCTGGC	CCCTGGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr1:156616443_156616449delCCCTGGC	ENST00000329117.5	+	3	427				BCAN_ENST00000361588.5_Intron|RP11-284F21.7_ENST00000448869.1_RNA|RP11-284F21.10_ENST00000605886.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican						carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTGCAGGAccctggcccctggcccc	0.686													ENSG00000229953		1575	0.314497	0.1377	0.4352	5008	,	,		12797	0.3532		0.3549	False		,,,				2504	0.3865																0																																										SO:0001627	intron_variant	0				BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.92-144CCCTGGC>-	1.37:g.156616450_156616456delCCCTGGC			D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	R	DEL	-	NULL	ENST00000329117.5	37	NULL	CCDS1149.1	1																																																																																				RP11-284F21.7	-	-		0.686	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000229953	Clone_based_vega_gene	protein_coding	OTTHUMT00000081844.2	0	0	0	13	13	13	0.00	0.00	CCCTGGC	NM_021948		156616449	-1	1	1	6	6	tier1	no_errors	ENST00000448869	ensembl	human	known	74_37	rna	14.29	14.29	DEL	0.040:0.040:0.040:0.039:0.037:0.036:0.008	-	1	6
PLEKHG4B	153478	genome.wustl.edu	37	5	139924	139924	+	5'Flank	SNP	C	C	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr5:139924C>A	ENST00000283426.6	+	0	0				CTD-2231H16.1_ENST00000512035.1_lincRNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B								Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TCCACCGAGCCCCGTGGAGCG	0.667													ENSG00000249430																																					0																																										SO:0001631	upstream_gene_variant	0			-	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570		5.37:g.139924C>A	Exception_encountered			R	SNP	-	NULL	ENST00000283426.6	37	NULL	CCDS34124.1	5																																																																																			-	CTD-2231H16.1	-	-		0.667	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000249430	Clone_based_vega_gene	protein_coding	OTTHUMT00000365359.1	0	0	0	25	25	15	0.00	0.00	C	NM_052909		139924	+1	7	1	43	7	tier1	no_errors	ENST00000512035	ensembl	human	known	74_37	rna	14.00	12.50	SNP	1.000	A	7	43
KIR3DL1	3811	genome.wustl.edu	37	19	55340890	55340890	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr19:55340890C>A	ENST00000391728.4	+	7	1108	c.1075C>A	c.(1075-1077)Ctc>Atc	p.L359I	KIR3DL1_ENST00000538269.1_Missense_Mutation_p.L359I|KIR3DL1_ENST00000358178.4_Missense_Mutation_p.L264I|KIR3DL1_ENST00000541392.1_Missense_Mutation_p.L342I|KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.L342I	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	359					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		cctcttctttctccttcatct	0.532													ENSG00000167633																																					0													220.0	168.0	186.0					19																	55340890		2172	4155	6327	SO:0001583	missense	0			-	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.1075C>A	19.37:g.55340890C>A	ENSP00000375608:p.Leu359Ile		O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.L359I	ENST00000391728.4	37	c.1075	CCDS42621.1	19	.	.	.	.	.	.	.	.	.	.	-	7.893	0.732681	0.15507	.	.	ENSG00000167633	ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	T;T;T;T;T	0.00527	6.79;6.95;6.79;6.95;6.8	0.743	-1.49	0.08718	.	1.832190	0.04320	U	0.350505	T	0.01092	0.0036	M	0.85462	2.755	0.09310	N	1	P;P;P	0.46952	0.614;0.772;0.887	B;P;P	0.51385	0.263;0.541;0.668	T	0.35525	-0.9785	10	0.66056	D	0.02	.	1.6777	0.02825	0.3283:0.4101:0.0:0.2616	.	342;264;359	Q15702;Q14946;P43629	.;.;KI3L1_HUMAN	I	359;342;337;359;342;264	ENSP00000443350:L359I;ENSP00000442355:L342I;ENSP00000375608:L359I;ENSP00000326868:L342I;ENSP00000350901:L264I	ENSP00000326868:L342I	L	+	1	0	KIR3DL1	60032702	0.031000	0.19500	0.001000	0.08648	0.006000	0.05464	1.299000	0.33424	-0.684000	0.05183	-1.123000	0.02005	CTC	-	KIR3DL1	-	NULL		0.532	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIR3DL1	HGNC	protein_coding	OTTHUMT00000141238.1	0	0	0	85	85	7	0.00	0.00	C	NM_013289		55340890	+1	27	1	48	2	tier1	no_errors	ENST00000391728	ensembl	human	known	74_37	missense	35.53	33.33	SNP	0.001	A	27	48
MEOX2	4223	genome.wustl.edu	37	7	15725770	15725770	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr7:15725770C>G	ENST00000262041.5	-	1	667	c.258G>C	c.(256-258)caG>caC	p.Q86H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	86	Poly-Gln.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		TTTGCAGAGCCtggtgctgct	0.647													ENSG00000106511																									Esophageal Squamous(140;197 1769 16409 18257 29929)												0													21.0	22.0	22.0					7																	15725770		2202	4298	6500	SO:0001583	missense	0			-		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.258G>C	7.37:g.15725770C>G	ENSP00000262041:p.Gln86His		B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.Q86H	ENST00000262041.5	37	c.258	CCDS34605.1	7	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079521	0.36662	.	.	ENSG00000106511	ENST00000262041	D	0.90563	-2.69	5.33	0.803	0.18691	.	0.150709	0.43260	D	0.000597	T	0.81645	0.4866	N	0.22421	0.69	0.33251	D	0.558461	P	0.44734	0.842	B	0.41571	0.36	T	0.80944	-0.1156	10	0.45353	T	0.12	-18.9261	7.8321	0.29349	0.1152:0.6562:0.0:0.2286	.	86	P50222	MEOX2_HUMAN	H	86	ENSP00000262041:Q86H	ENSP00000262041:Q86H	Q	-	3	2	MEOX2	15692295	0.970000	0.33590	1.000000	0.80357	0.993000	0.82548	0.250000	0.18235	0.119000	0.18210	0.655000	0.94253	CAG	-	MEOX2	-	NULL		0.647	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX2	HGNC	protein_coding	OTTHUMT00000326058.2	0	0	0	73	73	13	0.00	0.00	C	NM_005924		15725770	-1	14	1	72	9	tier1	no_errors	ENST00000262041	ensembl	human	known	74_37	missense	16.09	10.00	SNP	1.000	G	14	72
TNPO1	3842	genome.wustl.edu	37	5	72184001	72184001	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr5:72184001G>T	ENST00000337273.5	+	13	1826	c.1400G>T	c.(1399-1401)tGc>tTc	p.C467F	TNPO1_ENST00000506351.2_Missense_Mutation_p.C459F|TNPO1_ENST00000454282.1_Missense_Mutation_p.C417F|TNPO1_ENST00000523768.1_Missense_Mutation_p.C417F	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	467					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TCCATAACATGCTGGACTCTT	0.502													ENSG00000083312																																					0													124.0	121.0	122.0					5																	72184001		2203	4300	6503	SO:0001583	missense	0			-	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.1400G>T	5.37:g.72184001G>T	ENSP00000336712:p.Cys467Phe		B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.C467F	ENST00000337273.5	37	c.1400	CCDS43329.1	5	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665952	0.88251	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73466	0.3590	H	0.95745	3.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	T	0.81404	-0.0948	10	0.87932	D	0	-7.096	19.8805	0.96895	0.0:0.0:1.0:0.0	.	417;467	Q92973-3;Q92973	.;TNPO1_HUMAN	F	467;417;417;459	ENSP00000336712:C467F;ENSP00000398524:C417F;ENSP00000428899:C417F;ENSP00000425118:C459F	ENSP00000336712:C467F	C	+	2	0	TNPO1	72219757	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.384000	0.97219	2.778000	0.95560	0.655000	0.94253	TGC	-	TNPO1	-	pfam_HEAT,superfamily_ARM-type_fold		0.502	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	HGNC	protein_coding	OTTHUMT00000218577.3	0	0	0	27	27	23	0.00	0.00	G	NM_002270		72184001	+1	4	0	27	8	tier1	no_errors	ENST00000337273	ensembl	human	known	74_37	missense	12.90	0.00	SNP	1.000	T	4	27
CDX2	1045	genome.wustl.edu	37	13	28542874	28542874	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr13:28542874G>C	ENST00000381020.7	-	1	2402	c.270C>G	c.(268-270)aaC>aaG	p.N90K	CDX2_ENST00000548877.1_5'Flank	NM_001265.4	NP_001256.3	Q99626	CDX2_HUMAN	caudal type homeobox 2	90	Poly-Ala.				anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|endosome to lysosome transport (GO:0008333)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(1)|lung(6)	9	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		GAGCCACGGCGTTggcggcgg	0.751			T	ETV6	AML								ENSG00000165556																												Dom	yes		13	13q12.3	1045	caudal type homeo box transcription factor 2		L	0													14.0	19.0	17.0					13																	28542874		1717	3285	5002	SO:0001583	missense	0			-	Y13709	CCDS9328.1	13q12.2	2012-03-09	2007-07-09		ENSG00000165556	ENSG00000165556		"""Homeoboxes / ANTP class : HOXL subclass"""	1806	protein-coding gene	gene with protein product		600297	"""caudal type homeo box transcription factor 2"""	CDX3		7698771	Standard	NM_001265		Approved		uc001urv.4	Q99626	OTTHUMG00000016640	ENST00000381020.7:c.270C>G	13.37:g.28542874G>C	ENSP00000370408:p.Asn90Lys		O00503|Q5VTU7|Q969L8|Q9UD92	Missense_Mutation	SNP	pfam_Caudal_activation_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.N90K	ENST00000381020.7	37	c.270	CCDS9328.1	13	.	.	.	.	.	.	.	.	.	.	G	9.032	0.987600	0.18966	.	.	ENSG00000165556	ENST00000381020	T	0.40756	1.02	4.39	1.42	0.22433	Caudal-like activation domain (1);	0.595395	0.15865	N	0.240813	T	0.26557	0.0649	L	0.29908	0.895	0.20196	N	0.99993	P	0.44380	0.834	B	0.43916	0.436	T	0.14783	-1.0460	10	0.05721	T	0.95	-26.7989	7.3941	0.26926	0.3354:0.0:0.6646:0.0	.	90	Q99626	CDX2_HUMAN	K	90	ENSP00000370408:N90K	ENSP00000370408:N90K	N	-	3	2	CDX2	27440874	0.014000	0.17966	0.998000	0.56505	0.658000	0.38924	0.565000	0.23578	0.485000	0.27652	0.407000	0.27541	AAC	-	CDX2	-	pfam_Caudal_activation_dom		0.751	CDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDX2	HGNC	protein_coding	OTTHUMT00000044312.5	0	0	0	15	15	4	0.00	0.00	G			28542874	-1	5	0	3	0	tier1	no_errors	ENST00000381020	ensembl	human	known	74_37	missense	62.50	0.00	SNP	0.875	C	5	3
DNAJA3	9093	genome.wustl.edu	37	16	4475871	4475871	+	5'UTR	DEL	C	C	-			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr16:4475871delC	ENST00000262375.6	+	0	66				DNAJA3_ENST00000355296.4_5'UTR|DNAJA3_ENST00000431375.2_5'UTR	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						GGCGCAGAGTCCCCGGGCCAA	0.751													ENSG00000103423																																					0													4.0	6.0	5.0					16																	4475871		1888	3680	5568	SO:0001623	5_prime_UTR_variant	0				AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.-12C>-	16.37:g.4475871delC			B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	R	DEL	-	NULL	ENST00000262375.6	37	NULL	CCDS10515.1	16																																																																																				DJA3	-	-		0.751	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DJA3	HGNC	protein_coding	OTTHUMT00000251633.1	0	0	0	30	30	3	0.00	0.00	C			4475871	+1	3	0	21	0	tier1	no_errors	ENST00000572974	ensembl	human	putative	74_37	rna	12.50	0.00	DEL	1.000	-	3	21
ISLR2	57611	genome.wustl.edu	37	15	74425761	74425761	+	Silent	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr15:74425761G>A	ENST00000361742.3	+	4	1435	c.666G>A	c.(664-666)gtG>gtA	p.V222V	ISLR2_ENST00000565540.1_Silent_p.V222V|ISLR2_ENST00000435464.1_Silent_p.V222V|ISLR2_ENST00000419208.1_Silent_p.V222V|ISLR2_ENST00000453268.2_Silent_p.V222V|ISLR2_ENST00000445793.1_Silent_p.V222V|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000565159.1_Silent_p.V222V	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	222	LRRCT.				positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						GGGTGCCGGTGTACCGCCTGC	0.716													ENSG00000167178																																					0													24.0	27.0	26.0					15																	74425761		2195	4278	6473	SO:0001819	synonymous_variant	0			-		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.666G>A	15.37:g.74425761G>A			A8K352|Q9P263	Silent	SNP	pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Ig-like_dom	p.V222	ENST00000361742.3	37	c.666	CCDS10259.1	15																																																																																			-	ISLR2	-	smart_Cys-rich_flank_reg_C		0.716	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISLR2	HGNC	protein_coding	OTTHUMT00000269046.1	0	0	0	34	34	0	0.00	0.00	G	NM_020851		74425761	+1	4	0	18	0	tier1	no_errors	ENST00000361742	ensembl	human	known	74_37	silent	18.18	0.00	SNP	0.746	A	4	18
MT-CO1	4512	genome.wustl.edu	37	M	7306	7306	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chrM:7306T>C	ENST00000361624.2	+	1	1403	c.1403T>C	c.(1402-1404)aTa>aCa	p.I468T	MT-ND3_ENST00000361227.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TD_ENST00000387419.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	468					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AGTAATATTAATAATTTTCAT	0.443													ENSG00000198804																																					0																																										SO:0001583	missense	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1403T>C	M.37:g.7306T>C	ENSP00000354499:p.Ile468Thr		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.M468T	ENST00000361624.2	37	c.1403		MT																																																																																			-	MT-CO1	-	superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom		0.443	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		0	0	0	148	148	1	0.00	0.00	T	YP_003024028		7306	+1	54	1	6	0	tier1	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	90.00	100.00	SNP	NULL	C	54	6
OR7E14P	10819	genome.wustl.edu	37	11	17073832	17073832	+	RNA	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr11:17073832G>A	ENST00000530490.1	+	0	624				AC116533.2_ENST00000583154.1_RNA					olfactory receptor, family 7, subfamily E, member 14 pseudogene																		CCTCCACCATGGTCCCCAAGA	0.532													ENSG00000184669																																					0																																												0			-	AF065856		11p15.1	2012-08-09			ENSG00000184669	ENSG00000184669		"""GPCR / Class A : Olfactory receptors"""	8385	pseudogene	pseudogene				OR7E151P		9787077	Standard	NR_045002		Approved	OR11-5	uc021qeh.1		OTTHUMG00000165955		11.37:g.17073832G>A				R	SNP	-	NULL	ENST00000530490.1	37	NULL		11																																																																																			-	OR7E14P	-	-		0.532	OR7E14P-002	KNOWN	basic	processed_transcript	OR7E14P	HGNC	pseudogene	OTTHUMT00000387319.1	0	0	0	66	66	0	0.00	0.00	G			17073832	+1	18	1	51	0	tier1	no_errors	ENST00000530490	ensembl	human	known	74_37	rna	26.09	100.00	SNP	0.004	A	18	51
OR7E14P	10819	genome.wustl.edu	37	11	17073884	17073884	+	RNA	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr11:17073884G>A	ENST00000530490.1	+	0	676				AC116533.2_ENST00000583154.1_RNA					olfactory receptor, family 7, subfamily E, member 14 pseudogene																		TCTCCTATGCGGGCTGCCTGA	0.512													ENSG00000184669																																					0																																												0			-	AF065856		11p15.1	2012-08-09			ENSG00000184669	ENSG00000184669		"""GPCR / Class A : Olfactory receptors"""	8385	pseudogene	pseudogene				OR7E151P		9787077	Standard	NR_045002		Approved	OR11-5	uc021qeh.1		OTTHUMG00000165955		11.37:g.17073884G>A				R	SNP	-	NULL	ENST00000530490.1	37	NULL		11																																																																																			-	OR7E14P	-	-		0.512	OR7E14P-002	KNOWN	basic	processed_transcript	OR7E14P	HGNC	pseudogene	OTTHUMT00000387319.1	0	0	0	70	70	0	0.00	0.00	G			17073884	+1	12	0	59	0	tier1	no_errors	ENST00000530490	ensembl	human	known	74_37	rna	16.90	0.00	SNP	0.003	A	12	59
PCDHB14	56122	genome.wustl.edu	37	5	140605261	140605261	+	Silent	SNP	C	C	T			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr5:140605261C>T	ENST00000239449.4	+	1	2184	c.2184C>T	c.(2182-2184)ccC>ccT	p.P728P	PCDHB14_ENST00000515856.2_Silent_p.P575P	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	728					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCGGTGCCCGAGGGTCCCT	0.662													ENSG00000120327																									Ovarian(141;50 1831 27899 33809 37648)												0													72.0	86.0	82.0					5																	140605261		2203	4297	6500	SO:0001819	synonymous_variant	0			-	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2184C>T	5.37:g.140605261C>T			B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P728	ENST00000239449.4	37	c.2184	CCDS4256.1	5																																																																																			-	PCDHB14	-	NULL		0.662	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	0	0	0	65	65	0	0.00	0.00	C	NM_018934		140605261	+1	13	0	23	0	tier1	no_errors	ENST00000239449	ensembl	human	known	74_37	silent	36.11	0.00	SNP	0.014	T	13	23
PKD1	5310	genome.wustl.edu	37	16	2156948	2156948	+	Splice_Site	SNP	A	A	C			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr16:2156948A>C	ENST00000262304.4	-	17	7275	c.7067T>G	c.(7066-7068)gTg>gGg	p.V2356G	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Splice_Site_p.V2356G	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2356	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCGGATCAGCACCTGGCGTGG	0.602													ENSG00000008710																																					0													13.0	18.0	16.0					16																	2156948		1303	2300	3603	SO:0001630	splice_region_variant	0			-	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7066-1T>G	16.37:g.2156948A>C			Q15140|Q15141	Missense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_PLAT/LH2_dom,prints_PKD_1,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,pfscan_WSC_carb-bd,tigrfam_Polycystin_cat	p.V2356G	ENST00000262304.4	37	c.7067	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	A	18.26	3.583747	0.65992	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.73363	-0.74;-0.74	4.61	4.61	0.57282	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);Polycystin cation channel (1);	0.000000	0.85682	D	0.000000	D	0.86096	0.5851	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88326	0.2965	10	0.87932	D	0	.	14.5179	0.67830	1.0:0.0:0.0:0.0	.	2356;2356	P98161-3;P98161	.;PKD1_HUMAN	G	2356;2356;1707;635	ENSP00000262304:V2356G;ENSP00000399501:V2356G	ENSP00000262304:V2356G	V	-	2	0	PKD1	2096949	1.000000	0.71417	1.000000	0.80357	0.469000	0.32828	8.619000	0.90938	2.088000	0.63022	0.445000	0.29226	GTG	-	PKD1	-	pfam_PKD/REJ-like,pfscan_REJ-like,tigrfam_Polycystin_cat		0.602	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	0	0	0	129	129	0	0.00	0.00	A		Missense_Mutation	2156948	-1	17	0	121	0	tier1	no_errors	ENST00000262304	ensembl	human	known	74_37	missense	12.32	0.00	SNP	1.000	C	17	121
ARSD	414	genome.wustl.edu	37	X	2827908	2827908	+	Silent	SNP	G	G	A			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chrX:2827908G>A	ENST00000381154.1	-	8	1323	c.1248C>T	c.(1246-1248)gaC>gaT	p.D416D		NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	416					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TAGGGAACACGTCCATCAGGC	0.602													ENSG00000006756																																					0													48.0	42.0	44.0					X																	2827908		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.1248C>T	X.37:g.2827908G>A			Q9UHJ8	Silent	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.D416	ENST00000381154.1	37	c.1248	CCDS35196.1	X																																																																																			-	ARSD	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core		0.602	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSD	HGNC	protein_coding	OTTHUMT00000055636.1	0	0	0	77	77	3	0.00	0.00	G			2827908	-1	15	3	65	0	tier1	no_errors	ENST00000381154	ensembl	human	known	74_37	silent	18.75	100.00	SNP	0.992	A	15	65
UNC13B	10497	genome.wustl.edu	37	9	35386248	35386248	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr9:35386248C>G	ENST00000378495.3	+	23	3027	c.2805C>G	c.(2803-2805)atC>atG	p.I935M	UNC13B_ENST00000378496.4_Missense_Mutation_p.I935M|UNC13B_ENST00000396787.1_Missense_Mutation_p.I947M	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	935					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ATGAATATATCTTCAACAACT	0.493													ENSG00000198722																																					0													60.0	61.0	60.0					9																	35386248		2203	4300	6503	SO:0001583	missense	0			-	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.2805C>G	9.37:g.35386248C>G	ENSP00000367756:p.Ile935Met		Q5VYM8	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.I935M	ENST00000378495.3	37	c.2805	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179523	0.57800	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.85171	-1.83;-1.76;-1.95	4.76	3.71	0.42584	Calcium-dependent secretion activator (1);	0.045892	0.85682	D	0.000000	D	0.87970	0.6312	L	0.52905	1.665	0.48511	D	0.999667	D;D	0.59767	0.986;0.984	P;D	0.67382	0.839;0.951	D	0.85757	0.1347	10	0.38643	T	0.18	-17.7143	8.9394	0.35720	0.0:0.7702:0.0:0.2298	.	935;935	F8W8M9;O14795	.;UN13B_HUMAN	M	947;935;935;522	ENSP00000380006:I947M;ENSP00000367756:I935M;ENSP00000367757:I935M	ENSP00000367756:I935M	I	+	3	3	UNC13B	35376248	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.354000	0.34056	1.105000	0.41606	0.655000	0.94253	ATC	-	UNC13B	-	pfam_Ca-dep_secretion_activator		0.493	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1	0	0	0	48	48	122	0.00	0.00	C	NM_006377		35386248	+1	5	3	42	82	tier1	no_errors	ENST00000378496	ensembl	human	known	74_37	missense	10.64	3.53	SNP	1.000	G	5	42
GPRC5C	55890	genome.wustl.edu	37	17	72443158	72443158	+	Silent	SNP	G	G	T	rs151031492		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr17:72443158G>T	ENST00000392627.1	+	4	2578	c.1452G>T	c.(1450-1452)gtG>gtT	p.V484V	GPRC5C_ENST00000342648.5_Silent_p.V124V|GPRC5C_ENST00000392629.2_Silent_p.V451V|GPRC5C_ENST00000582873.1_3'UTR|GPRC5C_ENST00000481232.1_3'UTR	NM_022036.2	NP_071319.2	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	439					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						ACCCCTACGTGTGGGACTGAG	0.662													ENSG00000170412																																					0													64.0	71.0	68.0					17																	72443158		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000392627.1:c.1452G>T	17.37:g.72443158G>T			B5BUN4|Q2NL85|Q9NZG5	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.V484	ENST00000392627.1	37	c.1452	CCDS11699.1	17																																																																																			-	GPRC5C	-	NULL		0.662	GPRC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5C	HGNC	protein_coding	OTTHUMT00000145094.2	0	0	0	61	61	61	0.00	0.00	G			72443158	+1	6	3	56	31	tier1	no_errors	ENST00000392627	ensembl	human	known	74_37	silent	9.68	8.82	SNP	0.924	T	6	56
PSPH	5723	genome.wustl.edu	37	7	56088848	56088848	+	Missense_Mutation	SNP	C	C	T	rs549748554		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr7:56088848C>T	ENST00000395471.3	-	4	863	c.58G>A	c.(58-60)Gat>Aat	p.D20N	PSPH_ENST00000275605.3_Missense_Mutation_p.D20N|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	20					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTGTCAACATCAAAACACACA	0.438													ENSG00000146733																																					0													115.0	84.0	94.0					7																	56088848		2203	4300	6503	SO:0001583	missense	0			-	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.58G>A	7.37:g.56088848C>T	ENSP00000378854:p.Asp20Asn		B2RCR5|Q7Z3S5	Missense_Mutation	SNP	pfam_HAD-like_dom,pfam_Pyrimidine_nucleotidase_eu,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	p.D20N	ENST00000395471.3	37	c.58	CCDS5522.1	7	.	.	.	.	.	.	.	.	.	.	C	23.4	4.405723	0.83230	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626;ENST00000419984;ENST00000421312	D;D;D;D;D	0.99849	-7.15;-7.15;-7.15;-7.15;-7.15	5.6	5.6	0.85130	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.99915	0.9960	H	0.99117	4.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96129	0.9091	10	0.87932	D	0	-28.3175	18.5962	0.91230	0.0:1.0:0.0:0.0	.	20;20	Q53EY1;P78330	.;SERB_HUMAN	N	20	ENSP00000275605:D20N;ENSP00000378854:D20N;ENSP00000398653:D20N;ENSP00000399660:D20N;ENSP00000390952:D20N	ENSP00000275605:D20N	D	-	1	0	PSPH	56056342	1.000000	0.71417	0.948000	0.38648	0.099000	0.18886	7.629000	0.83207	2.652000	0.90054	0.591000	0.81541	GAT	-	PSPH	-	pfam_HAD-like_dom,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like		0.438	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PSPH	HGNC	protein_coding	OTTHUMT00000343304.1	0	0	0	65	65	26	0.00	0.00	C	NM_004577		56088848	-1	22	3	155	50	tier1	no_errors	ENST00000275605	ensembl	human	known	74_37	missense	12.43	5.66	SNP	1.000	T	22	155
MYH15	22989	genome.wustl.edu	37	3	108182019	108182020	+	Frame_Shift_Ins	INS	-	-	AATACAG			TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr3:108182019_108182020insAATACAG	ENST00000273353.3	-	17	1918_1919	c.1862_1863insCTGTATT	c.(1861-1863)tttfs	p.-621fs	MYH15_ENST00000495753.2_5'Flank	NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15							cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						AAGACTTCTGAAATACAGCTAC	0.396													ENSG00000144821																																					0																																										SO:0001589	frameshift_variant	0				AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1856_1862dupCTGTATT	3.37:g.108182020_108182026dupAATACAG	ENSP00000273353:p.Phe621fs			Frame_Shift_Ins	INS	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Lambda_D-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.Q622fs	ENST00000273353.3	37	c.1863_1862	CCDS43127.1	3																																																																																				MYH15	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.396	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	0	0	0	125	125	125	0.00	0.00	-	XM_036988		108182020	-1	2	2	63	63	tier1	no_errors	ENST00000273353	ensembl	human	known	74_37	frame_shift_ins	3.08	3.08	INS	0.999:0.977	AATACAG	2	63
GPX8	493869	genome.wustl.edu	37	5	54460112	54460113	+	3'UTR	INS	-	-	T	rs552883936		TCGA-DX-AB2Q-01A-11D-A38Z-09	TCGA-DX-AB2Q-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2efcaa60-02fc-4a76-b706-d8e466b8a002	550cb351-7d6a-45f1-a370-c8fee525d3a6	g.chr5:54460112_54460113insT	ENST00000503787.1	+	0	771_772				GPX8_ENST00000506123.1_3'UTR|CDC20B_ENST00000334206.5_Intron|CDC20B_ENST00000322374.6_Intron|CDC20B_ENST00000331730.3_Intron|CDC20B_ENST00000296733.1_Intron|GPX8_ENST00000296734.6_3'UTR|CDC20B_ENST00000381375.2_Intron|GPX8_ENST00000515370.1_3'UTR	NM_001008397.2	NP_001008398.2	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8 (putative)						response to oxidative stress (GO:0006979)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	glutathione peroxidase activity (GO:0004602)|peroxidase activity (GO:0004601)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)	11					Glutathione(DB00143)	CATTTTAAACAttttttttttg	0.396													ENSG00000164294																																					0																																										SO:0001624	3_prime_UTR_variant	0				BC029424	CCDS34156.1	5q11.2	2008-09-29				ENSG00000164294			33100	protein-coding gene	gene with protein product							Standard	NM_001008397		Approved	UNQ847, EPLA847	uc003jpq.2	Q8TED1		ENST00000503787.1:c.*67->T	5.37:g.54460122_54460122dupT				R	INS	-	NULL	ENST00000503787.1	37	NULL	CCDS34156.1	5																																																																																				GPX8	-	-		0.396	GPX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPX8	HGNC	protein_coding	OTTHUMT00000369717.1	0	0	0	23	23	36	0.00	0.00	-	NM_001008397		54460113	+1	3	2	22	35	tier1	no_errors	ENST00000506123	ensembl	human	known	74_37	rna	12.00	5.41	INS	0.000:0.000	T	3	22
