#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PRSS30P	124221	genome.wustl.edu	37	16	2889857	2889857	+	RNA	SNP	C	C	T	rs539959574		TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr16:2889857C>T	ENST00000475030.1	-	0	463									protease, serine, 30, pseudogene																		CGGGCACAGCCGAATCCCCAG	0.627													ENSG00000172460	C|||	1	0.000199681	0.0008	0.0	5008	,	,		17319	0.0		0.0	False		,,,				2504	0.0																0																																												0			-			16p13.13	2012-12-07	2012-12-07	2010-04-21	ENSG00000172460	ENSG00000172460		"""Serine peptidases / Serine peptidases"""	28753	pseudogene	pseudogene			"""transmembrane protease, serine 8 homolog (mouse), pseudogene"", ""protease, serine, 30 homolog (mouse), pseudogene"""	TMPRSS8, TMPRSS8P		12477932	Standard	NR_026864		Approved	Disp, MGC5228	uc002crw.3		OTTHUMG00000128963		16.37:g.2889857C>T				R	SNP	-	NULL	ENST00000475030.1	37	NULL		16																																																																																			-	PRSS30P	-	-		0.627	PRSS30P-003	KNOWN	basic	processed_transcript	PRSS30P	HGNC	pseudogene	OTTHUMT00000250948.2	0	0	0	50	50	33	0.00	0.00	C	NM_178453		2889857	-1	14	5	38	24	tier1	no_errors	ENST00000475030	ensembl	human	known	74_37	rna	26.92	17.24	SNP	0.855	T	14	38
HNRNPD	3184	genome.wustl.edu	37	4	83278573	83278573	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr4:83278573C>G	ENST00000313899.7	-	5	923	c.646G>C	c.(646-648)Gac>Cac	p.D216H	HNRNPD_ENST00000508119.1_5'Flank|HNRNPD_ENST00000352301.4_Missense_Mutation_p.D197H|HNRNPD_ENST00000543098.1_Missense_Mutation_p.D164H|HNRNPD_ENST00000541060.1_Missense_Mutation_p.D62H|HNRNPD_ENST00000353341.4_Missense_Mutation_p.D216H	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	216	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						GTCTTGTTGTCCATGGGGAGC	0.368													ENSG00000138668																																					0													91.0	87.0	88.0					4																	83278573		2203	4300	6503	SO:0001583	missense	0			-	AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.646G>C	4.37:g.83278573C>G	ENSP00000313199:p.Asp216His		A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Missense_Mutation	SNP	pfam_RRM_dom,pfam_CARG-binding_factor_N,smart_RRM_dom,pfscan_RRM_dom	p.D216H	ENST00000313899.7	37	c.646	CCDS3592.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.98|16.98	3.270273|3.270273	0.59540|0.59540	.|.	.|.	ENSG00000138668|ENSG00000138668	ENST00000313899;ENST00000353341;ENST00000352301;ENST00000543098;ENST00000307213;ENST00000541060;ENST00000509263;ENST00000507010|ENST00000514671	D;D;D;D;D;D;D|.	0.92699|.	-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09|.	5.96|5.96	5.96|5.96	0.96718|0.96718	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.043104|.	0.85682|.	D|.	0.000000|.	D|D	0.83741|0.83741	0.5320|0.5320	M|M	0.84683|0.84683	2.71|2.71	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.43938|.	0.822;0.822;0.521;0.708|.	P;P;B;P|.	0.52793|.	0.709;0.709;0.379;0.513|.	D|D	0.83822|0.83822	0.0247|0.0247	10|5	0.87932|.	D|.	0|.	.|.	20.4008|20.4008	0.98991|0.98991	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	197;216;197;216|.	Q14103-4;Q14103-3;Q14103-2;Q14103|.	.;.;.;HNRPD_HUMAN|.	H|A	216;216;197;164;191;62;149;216|119	ENSP00000313199:D216H;ENSP00000313327:D216H;ENSP00000305860:D197H;ENSP00000439380:D164H;ENSP00000437416:D62H;ENSP00000420926:D149H;ENSP00000421952:D216H|.	ENSP00000307544:D191H|.	D|G	-|-	1|2	0|0	HNRNPD|HNRNPD	83497597|83497597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.487000|7.487000	0.81328|0.81328	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GAC|GGA	-	HNRNPD	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.368	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPD	HGNC	protein_coding	OTTHUMT00000252630.2	0	0	1	79	79	89	0.00	1.11	C	NM_031370		83278573	-1	18	22	85	81	tier1	no_errors	ENST00000313899	ensembl	human	known	74_37	missense	17.48	21.36	SNP	1.000	G	18	85
AGO2	27161	genome.wustl.edu	37	8	141545618	141545618	+	Silent	SNP	G	G	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr8:141545618G>A	ENST00000220592.5	-	17	2332	c.2220C>T	c.(2218-2220)atC>atT	p.I740I	AGO2_ENST00000519980.1_Intron	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	740	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										TGGGGTGGGTGATTTTCGTGT	0.592													ENSG00000123908																																					0													281.0	210.0	234.0					8																	141545618		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.2220C>T	8.37:g.141545618G>A			Q8TCZ5|Q8WV58|Q96ID1	Silent	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.I740	ENST00000220592.5	37	c.2220	CCDS6380.1	8																																																																																			-	AGO2	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi		0.592	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO2	HGNC	protein_coding	OTTHUMT00000377866.4	0	0	0	34	34	77	0.00	0.00	G			141545618	-1	12	9	45	74	tier1	no_errors	ENST00000220592	ensembl	human	known	74_37	silent	20.69	10.84	SNP	1.000	A	12	45
ITGB4	3691	genome.wustl.edu	37	17	73728050	73728050	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:73728050A>T	ENST00000200181.3	+	11	1560	c.1373A>T	c.(1372-1374)gAg>gTg	p.E458V	ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000579662.1_Missense_Mutation_p.E458V|ITGB4_ENST00000449880.2_Missense_Mutation_p.E458V|ITGB4_ENST00000339591.3_Missense_Mutation_p.E458V|ITGB4_ENST00000450894.3_Missense_Mutation_p.E458V	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	458	Cysteine-rich tandem repeats.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGCACCTGCGAGCTGGTACAA	0.617													ENSG00000132470																																					0													72.0	60.0	64.0					17																	73728050		2203	4300	6503	SO:0001583	missense	0			-		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.1373A>T	17.37:g.73728050A>T	ENSP00000200181:p.Glu458Val		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,prints_Integrin_bsu,pfscan_Fibronectin_type3	p.E458V	ENST00000200181.3	37	c.1373	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	A	7.946	0.743783	0.15642	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.78924	-1.22;-1.17;-1.17	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	D	0.86493	0.5946	M	0.79614	2.46	0.80722	D	1	D;P;D;D;D	0.89917	0.998;0.925;1.0;1.0;1.0	D;P;D;D;D	0.83275	0.969;0.792;0.996;0.988;0.988	D	0.87668	0.2539	10	0.87932	D	0	.	10.2463	0.43343	0.8521:0.0:0.0:0.1479	.	418;458;458;458;458	B4E3N0;P16144-5;P16144-3;A0AVL6;P16144	.;.;.;.;ITB4_HUMAN	V	374;458;458;458	ENSP00000200181:E458V;ENSP00000344079:E458V;ENSP00000400217:E458V	ENSP00000200181:E458V	E	+	2	0	ITGB4	71239645	0.947000	0.32204	1.000000	0.80357	0.166000	0.22503	2.880000	0.48530	1.878000	0.54408	0.529000	0.55759	GAG	-	ITGB4	-	pirsf_Integrin_bsu-4		0.617	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	0	0	0	45	45	42	0.00	0.00	A			73728050	+1	19	11	43	33	tier1	no_errors	ENST00000200181	ensembl	human	known	74_37	missense	30.65	24.44	SNP	1.000	T	19	43
CSMD3	114788	genome.wustl.edu	37	8	114326938	114326938	+	Missense_Mutation	SNP	C	C	A	rs139679166		TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr8:114326938C>A	ENST00000297405.5	-	2	507	c.263G>T	c.(262-264)gGt>gTt	p.G88V	CSMD3_ENST00000352409.3_Missense_Mutation_p.G88V|CSMD3_ENST00000343508.3_Missense_Mutation_p.G48V|CSMD3_ENST00000455883.2_Missense_Mutation_p.G88V	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	88	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G88D(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GCAGTTTGCACCATTTGGATA	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			ENSG00000164796																																					1	Substitution - Missense(1)	skin(1)											161.0	158.0	159.0					8																	114326938		2203	4300	6503	SO:0001583	missense	0			-	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.263G>T	8.37:g.114326938C>A	ENSP00000297405:p.Gly88Val		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.G88V	ENST00000297405.5	37	c.263	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750538	0.49257	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.72	5.72	0.89469	CUB (5);	0.000000	0.64402	D	0.000008	T	0.56187	0.1968	M	0.81497	2.545	0.52501	D	0.999958	P;P;D;D;B	0.89917	0.739;0.944;0.999;1.0;0.214	B;P;D;D;B	0.91635	0.318;0.646;0.982;0.999;0.322	T	0.57271	-0.7840	10	0.49607	T	0.09	.	12.2291	0.54478	0.0:0.9226:0.0:0.0774	.	88;88;88;88;48	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407;Q7Z407-2	.;.;.;CSMD3_HUMAN;.	V	48;88;88;88	ENSP00000345799:G48V;ENSP00000297405:G88V;ENSP00000412263:G88V;ENSP00000343124:G88V	ENSP00000297405:G88V	G	-	2	0	CSMD3	114396114	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	4.942000	0.63547	2.697000	0.92050	0.557000	0.71058	GGT	-	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.338	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	0	0	0	74	74	82	0.00	0.00	C	NM_052900		114326938	-1	17	23	47	50	tier1	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	26.56	31.51	SNP	1.000	A	17	47
SIGLEC11	114132	genome.wustl.edu	37	19	50462106	50462106	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr19:50462106C>A	ENST00000447370.2	-	7	1247	c.1157G>T	c.(1156-1158)aGc>aTc	p.S386I	SIGLEC11_ENST00000426971.2_Missense_Mutation_p.S386I|CTC-326K19.6_ENST00000451973.1_5'Flank	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	386	Ig-like C2-type 3.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CAGGCGCAGGCTTTGGCCCTC	0.682													ENSG00000161640																																					0													31.0	36.0	34.0					19																	50462106		2202	4300	6502	SO:0001583	missense	0			-	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1157G>T	19.37:g.50462106C>A	ENSP00000412361:p.Ser386Ile			Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S386I	ENST00000447370.2	37	c.1157	CCDS12790.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.69|17.69	3.451092|3.451092	0.63290|0.63290	.|.	.|.	ENSG00000161640|ENSG00000161640	ENST00000426971|ENST00000447370;ENST00000458019	.|T	.|0.27104	.|1.69	3.24|3.24	0.719|0.719	0.18208|0.18208	.|Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.|1.238520	.|0.05362	.|N	.|0.533920	T|T	0.60663|0.60663	0.2286|0.2286	H|H	0.95850|0.95850	3.73|3.73	0.09310|0.09310	N|N	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.994	T|T	0.25467|0.25467	-1.0131|-1.0131	5|10	.|0.66056	.|D	.|0.02	.|.	4.3257|4.3257	0.11039|0.11039	0.0:0.359:0.44:0.201|0.0:0.359:0.44:0.201	.|.	.|386;386	.|Q96RL6-2;Q96RL6	.|.;SIG11_HUMAN	S|I	376|386	.|ENSP00000412361:S386I	.|ENSP00000412361:S386I	A|S	-|-	1|2	0|0	SIGLEC11|SIGLEC11	55153918|55153918	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.736000|0.736000	0.42039|0.42039	-2.596000|-2.596000	0.00895|0.00895	0.654000|0.654000	0.30846|0.30846	0.556000|0.556000	0.70494|0.70494	GCC|AGC	-	SIGLEC11	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.682	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC11	HGNC	protein_coding	OTTHUMT00000347382.1	0	0	0	100	100	34	0.00	0.00	C	NM_052884		50462106	-1	21	5	91	32	tier1	no_errors	ENST00000447370	ensembl	human	known	74_37	missense	18.58	13.51	SNP	0.009	A	21	91
PLG	5340	genome.wustl.edu	37	6	161132490	161132490	+	Intron	SNP	T	T	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr6:161132490T>C	ENST00000308192.9	+	4	470				PLG_ENST00000462918.1_Intron|PLG_ENST00000366924.2_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ctgtcatctttttcaagtctt	0.294													ENSG00000122194																																					0																																										SO:0001627	intron_variant	0			-	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.407+267T>C	6.37:g.161132490T>C			Q15146|Q5TEH4|Q6PA00	R	SNP	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			-	PLG	-	-		0.294	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	0	0	0	102	102	58	0.00	0.00	T	NM_000301		161132490	+1	33	11	154	64	tier1	no_errors	ENST00000494325	ensembl	human	known	74_37	rna	17.65	14.67	SNP	0.001	C	33	154
TSPAN7	7102	genome.wustl.edu	37	X	38422291	38422291	+	Intron	SNP	T	T	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chrX:38422291T>A	ENST00000378482.2	+	1	258				TSPAN7_ENST00000422612.2_Missense_Mutation_p.N8K|TSPAN7_ENST00000286824.6_Intron|TM4SF2_ENST00000465127.1_Intron|TSPAN7_ENST00000545599.1_Intron	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7						viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						CTGTTTGCAATGGTCAAGGAA	0.448													ENSG00000156298																																					0																																										SO:0001627	intron_variant	0			-	D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.81+1411T>A	X.37:g.38422291T>A			B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.N8K	ENST00000378482.2	37	c.24	CCDS14248.1	X	.	.	.	.	.	.	.	.	.	.	T	5.875	0.345656	0.11126	.	.	ENSG00000156298	ENST00000422612	T	0.37915	1.17	4.71	0.805	0.18703	.	.	.	.	.	T	0.23492	0.0568	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24261	-1.0165	8	0.56958	D	0.05	.	3.3719	0.07224	0.0:0.2318:0.2023:0.5659	.	8	B4DEA5	.	K	8	ENSP00000388954:N8K	ENSP00000388954:N8K	N	+	3	2	TSPAN7	38307235	0.061000	0.20836	0.006000	0.13384	0.119000	0.20118	0.088000	0.14979	-0.047000	0.13423	0.417000	0.27973	AAT	-	TSPAN7	-	NULL		0.448	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN7	HGNC	protein_coding	OTTHUMT00000356412.1	0	0	0	57	57	83	0.00	0.00	T			38422291	+1	34	26	22	23	tier1	no_errors	ENST00000422612	ensembl	human	known	74_37	missense	60.71	53.06	SNP	0.016	A	34	22
KBTBD12	166348	genome.wustl.edu	37	3	127642390	127642390	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr3:127642390G>T	ENST00000405109.1	+	2	953	c.486G>T	c.(484-486)gaG>gaT	p.E162D	KBTBD12_ENST00000405256.1_Missense_Mutation_p.E162D|KBTBD12_ENST00000343941.4_5'UTR|KBTBD12_ENST00000407609.3_Intron			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	162	BACK.									endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						ACTTTGCCGAGGTGAGCTTAC	0.353													ENSG00000187715																																					0													41.0	38.0	39.0					3																	127642390		1837	4092	5929	SO:0001583	missense	0			-		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.486G>T	3.37:g.127642390G>T	ENSP00000385957:p.Glu162Asp		B5MCC6|Q6ZRK1	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.E162D	ENST00000405109.1	37	c.486	CCDS33848.2	3	.	.	.	.	.	.	.	.	.	.	G	16.19	3.052186	0.55218	.	.	ENSG00000187715	ENST00000405109;ENST00000405256	T;T	0.70749	-0.51;-0.51	5.75	3.98	0.46160	BTB/Kelch-associated (2);	.	.	.	.	T	0.72153	0.3425	L	0.56340	1.77	0.39633	D	0.970203	D	0.56968	0.978	P	0.54815	0.761	T	0.68492	-0.5394	9	0.20519	T	0.43	.	10.4461	0.44495	0.2082:0.0:0.7918:0.0	.	162	Q3ZCT8	KBTBC_HUMAN	D	162	ENSP00000385957:E162D;ENSP00000385879:E162D	ENSP00000385957:E162D	E	+	3	2	KBTBD12	129125080	1.000000	0.71417	0.989000	0.46669	0.978000	0.69477	1.222000	0.32515	0.795000	0.33922	0.460000	0.39030	GAG	-	KBTBD12	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin		0.353	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD12	HGNC	protein_coding	OTTHUMT00000318682.1	0	0	0	24	24	86	0.00	0.00	G	NM_207335		127642390	+1	17	17	46	62	tier1	no_errors	ENST00000405109	ensembl	human	known	74_37	missense	26.98	21.52	SNP	1.000	T	17	46
DOPEY1	23033	genome.wustl.edu	37	6	83877585	83877585	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr6:83877585A>C	ENST00000349129.2	+	39	7357	c.7097A>C	c.(7096-7098)aAt>aCt	p.N2366T	DOPEY1_ENST00000237163.5_Missense_Mutation_p.N2270T|DOPEY1_ENST00000369739.3_Missense_Mutation_p.N2377T|PGM3_ENST00000512866.1_Intron|DOPEY1_ENST00000484282.1_3'UTR|PGM3_ENST00000513973.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2366					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CTGCAGAAAAATCCAGAGGAA	0.428													ENSG00000083097																																					0													27.0	29.0	29.0					6																	83877585		2203	4300	6503	SO:0001583	missense	0			-	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.7097A>C	6.37:g.83877585A>C	ENSP00000195654:p.Asn2366Thr		Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.N2366T	ENST00000349129.2	37	c.7097	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	A	5.478	0.273187	0.10403	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.37584	1.19;1.62	5.76	3.21	0.36854	.	0.106709	0.64402	N	0.000009	T	0.14657	0.0354	N	0.25647	0.755	0.80722	D	1	P;P;P	0.35714	0.517;0.456;0.456	B;B;B	0.41894	0.369;0.365;0.365	T	0.04386	-1.0955	10	0.21014	T	0.42	.	11.3144	0.49383	0.7097:0.2903:0.0:0.0	.	2257;2357;2366	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	T	2366;2270;2270	ENSP00000195654:N2366T;ENSP00000237163:N2270T	ENSP00000237163:N2270T	N	+	2	0	DOPEY1	83934304	1.000000	0.71417	0.793000	0.32043	0.309000	0.27889	4.868000	0.63021	0.995000	0.38917	0.533000	0.62120	AAT	-	DOPEY1	-	NULL		0.428	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	0	0	0	47	47	83	0.00	0.00	A	NM_015018		83877585	+1	9	15	57	100	tier1	no_errors	ENST00000349129	ensembl	human	known	74_37	missense	13.43	13.04	SNP	0.976	C	9	57
TUBB4A	10382	genome.wustl.edu	37	19	6501350	6501350	+	Silent	SNP	A	A	G			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr19:6501350A>G	ENST00000264071.2	-	3	596	c.225T>C	c.(223-225)tcT>tcC	p.S75S	TUBB4A_ENST00000598006.1_Missense_Mutation_p.L61P|TUBB4A_ENST00000540257.1_Silent_p.S75S|TUBB4A_ENST00000596926.1_Silent_p.S75S|TUBB4A_ENST00000601152.1_Missense_Mutation_p.L50P			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	75					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										CAGAACGGACAGAGTCCATGG	0.587													ENSG00000104833																																					0													53.0	48.0	50.0					19																	6501350		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.225T>C	19.37:g.6501350A>G			B3KQP4|Q969E5	Missense_Mutation	SNP	superfamily_Tubulin_FtsZ_GTPase	p.L61P	ENST00000264071.2	37	c.182	CCDS12168.1	19																																																																																			-	TUBB4A	-	NULL		0.587	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB4A	HGNC	protein_coding	OTTHUMT00000457841.1	0	0	0	44	44	23	0.00	0.00	A	NM_006087		6501350	-1	14	7	73	32	tier1	no_errors	ENST00000598006	ensembl	human	putative	74_37	missense	16.09	17.95	SNP	0.184	G	14	73
C1S	716	genome.wustl.edu	37	12	7175059	7175059	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr12:7175059G>A	ENST00000406697.1	+	13	1807	c.1179G>A	c.(1177-1179)atG>atA	p.M393I	C1S_ENST00000402681.3_Missense_Mutation_p.M226I|C1S_ENST00000328916.3_Missense_Mutation_p.M393I|C1S_ENST00000360817.5_Missense_Mutation_p.M393I|C1S_ENST00000495061.1_3'UTR			P09871	C1S_HUMAN	complement component 1, s subcomponent	393	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	ATTACTACATGGAAAATGGAG	0.458													ENSG00000182326																									GBM(156;750 1943 12971 24779 31015)												0													116.0	119.0	118.0					12																	7175059		2203	4300	6503	SO:0001583	missense	0			-		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.1179G>A	12.37:g.7175059G>A	ENSP00000385035:p.Met393Ile		D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.M393I	ENST00000406697.1	37	c.1179	CCDS31735.1	12	.	.	.	.	.	.	.	.	.	.	G	13.92	2.381536	0.42207	.	.	ENSG00000182326	ENST00000406697;ENST00000328916;ENST00000360817;ENST00000382222;ENST00000402681	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.67	5.67	0.87782	Complement control module (2);Sushi/SCR/CCP (3);	0.126366	0.36482	N	0.002569	T	0.61223	0.2330	M	0.66506	2.035	0.29733	N	0.837764	B	0.18461	0.028	B	0.25614	0.062	T	0.58803	-0.7572	10	0.39692	T	0.17	.	12.606	0.56523	0.1181:0.0:0.8819:0.0	.	393	P09871	C1S_HUMAN	I	393;393;393;381;226	ENSP00000385035:M393I;ENSP00000328173:M393I;ENSP00000354057:M393I;ENSP00000384171:M226I	ENSP00000328173:M393I	M	+	3	0	C1S	7045320	0.965000	0.33210	0.987000	0.45799	0.716000	0.41182	1.443000	0.35057	2.669000	0.90835	0.655000	0.94253	ATG	-	C1S	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.458	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1S	HGNC	protein_coding	OTTHUMT00000317481.1	0	0	1	36	36	66	0.00	1.49	G	NM_001734		7175059	+1	11	35	17	77	tier1	no_errors	ENST00000328916	ensembl	human	known	74_37	missense	39.29	31.25	SNP	0.748	A	11	17
FAM9A	171482	genome.wustl.edu	37	X	8764385	8764385	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chrX:8764385T>C	ENST00000543214.1	-	6	547	c.412A>G	c.(412-414)Ata>Gta	p.I138V	FAM9A_ENST00000381003.3_Missense_Mutation_p.I138V	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	138						nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				TCTATTTTTATCATTTCTCTT	0.303													ENSG00000183304																																					0													143.0	110.0	121.0					X																	8764385		2203	4297	6500	SO:0001583	missense	0			-		CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.412A>G	X.37:g.8764385T>C	ENSP00000440163:p.Ile138Val		B7ZLH5|Q2M2D1	Missense_Mutation	SNP	NULL	p.I138V	ENST00000543214.1	37	c.412	CCDS14131.1	X	.	.	.	.	.	.	.	.	.	.	t	1.870	-0.460489	0.04508	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.678	-1.36	0.09085	.	.	.	.	.	T	0.14098	0.0341	L	0.34521	1.04	0.09310	N	1	P	0.40909	0.732	B	0.28232	0.087	T	0.15263	-1.0443	7	0.27785	T	0.31	.	.	.	.	.	138	Q8IZU1	FAM9A_HUMAN	V	138	.	ENSP00000370391:I138V	I	-	1	0	FAM9A	8724385	0.209000	0.23505	0.000000	0.03702	0.001000	0.01503	-0.385000	0.07379	-0.650000	0.05423	-0.763000	0.03452	ATA	-	FAM9A	-	NULL		0.303	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM9A	HGNC	protein_coding	OTTHUMT00000055697.1	0	0	0	86	86	81	0.00	0.00	T	NM_174951		8764385	-1	33	13	140	58	tier1	no_errors	ENST00000381003	ensembl	human	known	74_37	missense	19.08	18.06	SNP	0.000	C	33	140
TRPS1	7227	genome.wustl.edu	37	8	116616386	116616386	+	Missense_Mutation	SNP	T	T	C	rs370300182		TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr8:116616386T>C	ENST00000220888.5	-	3	1930	c.1771A>G	c.(1771-1773)Aat>Gat	p.N591D	TRPS1_ENST00000395715.3_Missense_Mutation_p.N604D|TRPS1_ENST00000519076.1_Intron|TRPS1_ENST00000520276.1_Missense_Mutation_p.N595D|TRPS1_ENST00000519674.1_Missense_Mutation_p.N591D			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	591					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TGGGAACAATTACTTTTTCTA	0.483									Langer-Giedion syndrome				ENSG00000104447																																					0								T	ASP/ASN	1,3915		0,1,1957	70.0	71.0	71.0		1810	5.9	1.0	8		71	0,8296		0,0,4148	no	missense	TRPS1	NM_014112.2	23	0,1,6105	CC,CT,TT		0.0,0.0255,0.0082	possibly-damaging	604/1295	116616386	1,12211	1958	4148	6106	SO:0001583	missense	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	-	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1771A>G	8.37:g.116616386T>C	ENSP00000220888:p.Asn591Asp		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.N604D	ENST00000220888.5	37	c.1810		8	.	.	.	.	.	.	.	.	.	.	T	16.19	3.054152	0.55218	2.55E-4	0.0	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	5.87	5.87	0.94306	.	0.104371	0.64402	D	0.000003	T	0.10723	0.0262	N	0.19112	0.55	0.38028	D	0.935072	P;P;P	0.50528	0.936;0.895;0.936	P;B;P	0.44394	0.448;0.262;0.448	T	0.10245	-1.0638	10	0.48119	T	0.1	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	595;591;604	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	D	604;591;595;591	ENSP00000379065:N604D;ENSP00000220888:N591D;ENSP00000428680:N595D;ENSP00000429174:N591D	ENSP00000220888:N591D	N	-	1	0	TRPS1	116685561	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.704000	0.61831	2.371000	0.80710	0.533000	0.62120	AAT	-	TRPS1	-	NULL		0.483	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	0	0	0	57	57	103	0.00	0.00	T	NM_014112		116616386	-1	11	22	54	54	tier1	no_errors	ENST00000395715	ensembl	human	known	74_37	missense	16.92	28.95	SNP	1.000	C	11	54
ZNF880	400713	genome.wustl.edu	37	19	52873225	52873225	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr19:52873225C>T	ENST00000422689.2	+	1	22	c.7C>T	c.(7-9)Cgg>Tgg	p.R3W	ZNF880_ENST00000344085.5_Missense_Mutation_p.R3W|ZNF880_ENST00000597976.1_Missense_Mutation_p.R3W|ZNF880_ENST00000600321.1_Missense_Mutation_p.R3W|ZNF880_ENST00000424032.2_Missense_Mutation_p.R3W	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	3					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						GGTCATGCTGCGGCGTGTGAG	0.602													ENSG00000221923																																					0													183.0	173.0	176.0					19																	52873225		692	1591	2283	SO:0001583	missense	0			-	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.7C>T	19.37:g.52873225C>T	ENSP00000406318:p.Arg3Trp		B4DNA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R3W	ENST00000422689.2	37	c.7	CCDS46164.1	19	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822957	0.50739	.	.	ENSG00000221923	ENST00000424032;ENST00000344085;ENST00000422689	T;T;T	0.06768	5.37;5.4;3.26	0.783	-1.57	0.08506	Krueppel-associated box (1);	.	.	.	.	T	0.04497	0.0123	N	0.14661	0.345	0.09310	N	1	D	0.69078	0.997	B	0.43701	0.428	T	0.27571	-1.0070	9	0.87932	D	0	.	2.1969	0.03913	0.0:0.3545:0.3416:0.3039	.	3	Q6PDB4	ZN880_HUMAN	W	3	ENSP00000414470:R3W;ENSP00000343625:R3W;ENSP00000406318:R3W	ENSP00000343625:R3W	R	+	1	2	ZNF880	57565037	0.000000	0.05858	0.011000	0.14972	0.789000	0.44602	-2.056000	0.01396	-0.884000	0.03976	0.289000	0.19496	CGG	-	ZNF880	-	superfamily_Krueppel-associated_box		0.602	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	0	0	0	84	84	38	0.00	0.00	C	NM_001145434		52873225	+1	38	23	72	28	tier1	no_errors	ENST00000422689	ensembl	human	known	74_37	missense	34.55	45.10	SNP	0.014	T	38	72
DOPEY1	23033	genome.wustl.edu	37	6	83877852	83877852	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr6:83877852A>G	ENST00000349129.2	+	39	7624	c.7364A>G	c.(7363-7365)gAa>gGa	p.E2455G	DOPEY1_ENST00000237163.5_Missense_Mutation_p.E2359G|DOPEY1_ENST00000369739.3_Missense_Mutation_p.E2466G|PGM3_ENST00000512866.1_Intron|DOPEY1_ENST00000484282.1_3'UTR|PGM3_ENST00000513973.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2455					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		GAGATGGTAGAAAAAGATTTT	0.383													ENSG00000083097																																					0													51.0	50.0	50.0					6																	83877852		2203	4300	6503	SO:0001583	missense	0			-	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.7364A>G	6.37:g.83877852A>G	ENSP00000195654:p.Glu2455Gly		Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.E2455G	ENST00000349129.2	37	c.7364	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	A	24.2	4.501811	0.85176	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T;T	0.35048	1.41;1.33;1.87	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.49133	0.1539	M	0.62723	1.935	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77557	0.99;0.986;0.986	T	0.53718	-0.8399	10	0.72032	D	0.01	.	14.6387	0.68708	1.0:0.0:0.0:0.0	.	2346;2446;2455	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	G	2455;2359;2359	ENSP00000195654:E2455G;ENSP00000237163:E2359G;ENSP00000358754:E2359G	ENSP00000237163:E2359G	E	+	2	0	DOPEY1	83934571	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.201000	0.70794	0.533000	0.62120	GAA	-	DOPEY1	-	NULL		0.383	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	0	0	0	47	47	101	0.00	0.00	A	NM_015018		83877852	+1	19	14	98	116	tier1	no_errors	ENST00000349129	ensembl	human	known	74_37	missense	16.24	10.77	SNP	1.000	G	19	98
IPO5	3843	genome.wustl.edu	37	13	98666439	98666439	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr13:98666439C>T	ENST00000490680.1	+	19	2361	c.2296C>T	c.(2296-2298)Ctc>Ttc	p.L766F	IPO5_ENST00000539640.1_Missense_Mutation_p.L641F|IPO5_ENST00000261574.5_Missense_Mutation_p.L784F			O00410	IPO5_HUMAN	importin 5	766					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						TTCAGACGTCCTCTCAGAAAT	0.353													ENSG00000065150																																					0													109.0	105.0	107.0					13																	98666439		2203	4300	6503	SO:0001583	missense	0			-	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2296C>T	13.37:g.98666439C>T	ENSP00000418393:p.Leu766Phe		B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_Importin-beta_N	p.L784F	ENST00000490680.1	37	c.2350		13	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250369	0.80024	.	.	ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640	T;T;T;T	0.12774	2.65;2.65;2.65;2.68	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.44180	0.1281	M	0.86953	2.85	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.44128	-0.9348	10	0.66056	D	0.02	-8.0403	16.3718	0.83365	0.1323:0.8677:0.0:0.0	.	784	O00410-3	.	F	784;766;766;641	ENSP00000261574:L784F;ENSP00000350219:L766F;ENSP00000418393:L766F;ENSP00000445126:L641F	ENSP00000261574:L784F	L	+	1	0	IPO5	97464440	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.672000	0.68102	2.756000	0.94617	0.655000	0.94253	CTC	-	IPO5	-	superfamily_ARM-type_fold		0.353	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	IPO5	HGNC	protein_coding	OTTHUMT00000354655.1	0	0	0	66	66	41	0.00	0.00	C	NM_002271		98666439	+1	23	14	113	53	tier1	no_errors	ENST00000261574	ensembl	human	known	74_37	missense	16.91	20.59	SNP	1.000	T	23	113
USH1C	10083	genome.wustl.edu	37	11	17542934	17542934	+	Silent	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr11:17542934C>T	ENST00000318024.4	-	13	1152	c.1044G>A	c.(1042-1044)aaG>aaA	p.K348K	USH1C_ENST00000005226.7_Silent_p.K348K|USH1C_ENST00000527720.1_Silent_p.K317K|USH1C_ENST00000527020.1_Silent_p.K329K	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	348					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CCTCTGCTGCCTTCTGGGCAA	0.468													ENSG00000006611																																					0													273.0	222.0	240.0					11																	17542934		2200	4293	6493	SO:0001819	synonymous_variant	0			-	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1044G>A	11.37:g.17542934C>T			A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K348	ENST00000318024.4	37	c.1044	CCDS31438.1	11																																																																																			-	USH1C	-	NULL		0.468	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	HGNC	protein_coding	OTTHUMT00000389146.1	0	0	0	113	113	89	0.00	0.00	C	NM_005709		17542934	-1	40	27	21	28	tier1	no_errors	ENST00000005226	ensembl	human	known	74_37	silent	65.57	49.09	SNP	1.000	T	40	21
DSCAM	1826	genome.wustl.edu	37	21	42080608	42080608	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr21:42080608G>T	ENST00000400454.1	-	2	610	c.133C>A	c.(133-135)Ccc>Acc	p.P45T		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	45	Ig-like C2-type 1.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GCGGGGCAGGGCACCAGAGTC	0.577													ENSG00000171587																									Melanoma(134;970 1778 1785 21664 32388)												0													104.0	110.0	108.0					21																	42080608		2031	4180	6211	SO:0001583	missense	0			-	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.133C>A	21.37:g.42080608G>T	ENSP00000383303:p.Pro45Thr		O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P45T	ENST00000400454.1	37	c.133	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266168	0.80358	.	.	ENSG00000171587	ENST00000400454	T	0.09350	2.99	5.1	5.1	0.69264	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.28928	0.0718	L	0.56396	1.775	0.51482	D	0.99992	D	0.76494	0.999	D	0.85130	0.997	T	0.00855	-1.1539	10	0.24483	T	0.36	.	17.0669	0.86561	0.0:0.0:1.0:0.0	.	45	O60469	DSCAM_HUMAN	T	45	ENSP00000383303:P45T	ENSP00000383303:P45T	P	-	1	0	DSCAM	41002478	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.302000	0.96175	2.547000	0.85894	0.585000	0.79938	CCC	-	DSCAM	-	smart_Ig_sub2		0.577	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	0	0	0	49	49	36	0.00	0.00	G	NM_001389		42080608	-1	25	15	45	25	tier1	no_errors	ENST00000400454	ensembl	human	known	74_37	missense	35.21	37.50	SNP	1.000	T	25	45
ABCA9	10350	genome.wustl.edu	37	17	66986977	66986978	+	Splice_Site	DNP	CC	CC	TT	rs576565979		TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:66986977_66986978CC>TT	ENST00000340001.4	-	29	4048_4049	c.3837_3838GG>AA	c.(3835-3840)gaGGca>gaAAca	p.A1280T	ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000453985.2_Splice_Site_p.A1242T|ABCA9_ENST00000370732.2_Splice_Site_p.A1280T	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1280					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CTGAGTTCTACCTCATCAAAGT	0.381													ENSG00000154258																																					0																																										SO:0001630	splice_region_variant	0			-	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3837_3838delinsTT	17.37:g.66986977_66986978delinsTT			Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Splice_Site|Silent	SNP	-|pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	e28+1|p.E1279	ENST00000340001.4	37	c.3837+1|c.3837	CCDS11681.1	17																																																																																			-	ABCA9	-	-|NULL		0.381	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	0	0	0	69	70|69	73|74	0.00	0.00	C	NM_172386	Missense_Mutation	66986977|66986978	-1	24	18	75|73	53	tier1	no_errors	ENST00000340001	ensembl	human	known	74_37	splice_site|silent	24.24|24.49	25.35	SNP	1.000	T	24	73
RNF113B	140432	genome.wustl.edu	37	13	98828591	98828591	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr13:98828591G>C	ENST00000267291.6	-	1	928	c.900C>G	c.(898-900)atC>atG	p.I300M	FARP1_ENST00000376586.2_Intron|FARP1_ENST00000595437.1_Intron|FARP1_ENST00000376581.5_Intron|FARP1_ENST00000319562.6_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	300							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			CGGGGTTAAAGATGCCGCCGG	0.577													ENSG00000139797																																					0													78.0	83.0	82.0					13																	98828591		2203	4300	6503	SO:0001583	missense	0			-	AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.900C>G	13.37:g.98828591G>C	ENSP00000267291:p.Ile300Met		Q8WWF9|Q96QY9	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.I300M	ENST00000267291.6	37	c.900	CCDS9486.1	13	.	.	.	.	.	.	.	.	.	.	G	1.763	-0.486224	0.04352	.	.	ENSG00000139797	ENST00000267291	T	0.33654	1.4	1.57	1.57	0.23409	Zinc finger, RING/FYVE/PHD-type (1);	0.074362	0.53938	U	0.000060	T	0.25195	0.0612	L	0.43152	1.355	0.28848	N	0.896189	B	0.18310	0.027	B	0.23150	0.044	T	0.11767	-1.0574	10	0.48119	T	0.1	.	3.9617	0.09413	0.2258:0.0:0.7742:0.0	.	300	Q8IZP6	R113B_HUMAN	M	300	ENSP00000267291:I300M	ENSP00000267291:I300M	I	-	3	3	RNF113B	97626592	1.000000	0.71417	0.708000	0.30435	0.024000	0.10985	0.774000	0.26675	1.176000	0.42840	0.591000	0.81541	ATC	-	RNF113B	-	NULL		0.577	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF113B	HGNC	protein_coding	OTTHUMT00000045536.3	0	0	0	78	78	49	0.00	0.00	G	NM_178861		98828591	-1	10	10	91	59	tier1	no_errors	ENST00000267291	ensembl	human	known	74_37	missense	9.90	14.49	SNP	1.000	C	10	91
TNFRSF10B	8795	genome.wustl.edu	37	8	22888375	22888375	+	Silent	SNP	G	G	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr8:22888375G>T	ENST00000276431.4	-	3	545	c.261C>A	c.(259-261)atC>atA	p.I87I	TNFRSF10B_ENST00000542226.1_5'UTR|TNFRSF10B_ENST00000519910.1_5'UTR|TNFRSF10B_ENST00000347739.3_Silent_p.I87I	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b	87					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)			NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		CGTCTTCTGAGATATGGTGTC	0.522													ENSG00000120889																									GBM(94;1064 1342 1839 21060 42553)												0													97.0	82.0	87.0					8																	22888375		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.261C>A	8.37:g.22888375G>T			O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Missense_Mutation	SNP	NULL	p.S52Y	ENST00000276431.4	37	c.155	CCDS6035.1	8																																																																																			-	TNFRSF10B	-	NULL		0.522	TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNFRSF10B	HGNC	protein_coding	OTTHUMT00000215099.2	0	0	0	20	20	46	0.00	0.00	G	NM_147187		22888375	-1	4	8	10	29	tier1	no_errors	ENST00000523504	ensembl	human	known	74_37	missense	28.57	21.62	SNP	0.000	T	4	10
GPS2	2874	genome.wustl.edu	37	17	7216578	7216578	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:7216578G>C	ENST00000380728.2	-	9	1057	c.757C>G	c.(757-759)Caa>Gaa	p.Q253E	GPS2_ENST00000391950.3_Missense_Mutation_p.Q253E|GPS2_ENST00000389167.5_Missense_Mutation_p.Q253E|RP11-542C16.2_ENST00000575474.1_3'UTR			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	253					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				ATCTGCTTTTGCAAGGACAGG	0.547											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000132522																																					0													128.0	124.0	125.0					17																	7216578		2203	4300	6503	SO:0001583	missense	0			-	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.757C>G	17.37:g.7216578G>C	ENSP00000370104:p.Gln253Glu	640	B4DXA1|Q6FHM8	Missense_Mutation	SNP	NULL	p.Q253E	ENST00000380728.2	37	c.757	CCDS11100.1	17	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212773	0.58452	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	T;T	0.59364	0.27;0.27	4.72	3.75	0.43078	.	0.000000	0.64402	U	0.000001	T	0.62183	0.2407	L	0.29908	0.895	0.58432	D	0.999996	P	0.52577	0.954	D	0.65140	0.932	T	0.65397	-0.6178	10	0.87932	D	0	1.6449	11.8193	0.52228	0.0867:0.0:0.9133:0.0	.	253	Q13227	GPS2_HUMAN	E	253	ENSP00000370104:Q253E;ENSP00000379841:Q253E	ENSP00000319371:Q253E	Q	-	1	0	GPS2	7157302	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.500000	0.90498	1.204000	0.43247	0.643000	0.83706	CAA	-	GPS2	-	NULL		0.547	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	0	0	0	42	42	41	0.00	0.00	G	NM_004489		7216578	-1	8	8	39	28	tier1	no_errors	ENST00000380728	ensembl	human	known	74_37	missense	17.02	22.22	SNP	1.000	C	8	39
ABCA9	10350	genome.wustl.edu	37	17	66986980	66986980	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:66986980C>T	ENST00000340001.4	-	29	4046	c.3835G>A	c.(3835-3837)Gag>Aag	p.E1279K	ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000453985.2_Missense_Mutation_p.E1241K|ABCA9_ENST00000370732.2_Missense_Mutation_p.E1279K	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1279					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					AGTTCTACCTCATCAAAGTCT	0.388													ENSG00000154258																																					0													171.0	147.0	156.0					17																	66986980		2203	4300	6503	SO:0001583	missense	0			-	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3835G>A	17.37:g.66986980C>T	ENSP00000342216:p.Glu1279Lys		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E1279K	ENST00000340001.4	37	c.3835	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276150	0.59649	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732	D;D	0.88586	-2.25;-2.4	5.4	4.42	0.53409	.	0.145067	0.30723	N	0.009003	D	0.94009	0.8081	M	0.79123	2.44	0.39576	D	0.969351	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.94854	0.8016	10	0.62326	D	0.03	.	14.7835	0.69784	0.0:0.8545:0.1454:0.0	.	1279;1279	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	K	1279;1224;1279	ENSP00000342216:E1279K;ENSP00000359767:E1279K	ENSP00000342216:E1279K	E	-	1	0	ABCA9	64498575	0.995000	0.38212	0.840000	0.33206	0.024000	0.10985	3.412000	0.52679	1.262000	0.44165	0.655000	0.94253	GAG	-	ABCA9	-	NULL		0.388	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	0	0	0	68	68	73	0.00	0.00	C	NM_172386		66986980	-1	24	18	73	52	tier1	no_errors	ENST00000340001	ensembl	human	known	74_37	missense	24.49	25.71	SNP	0.993	T	24	73
OCLN	100506658	genome.wustl.edu	37	5	68809856	68809856	+	Missense_Mutation	SNP	A	A	G	rs559132071		TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr5:68809856A>G	ENST00000355237.2	+	4	1247	c.811A>G	c.(811-813)Atg>Gtg	p.M271V	OCLN_ENST00000380766.2_Intron|OCLN_ENST00000396442.2_Missense_Mutation_p.M271V|OCLN_ENST00000542132.1_Intron|OCLN_ENST00000538151.1_Missense_Mutation_p.M20V	NM_002538.3	NP_002529.1	Q16625	OCLN_HUMAN	occludin	271					apoptotic process (GO:0006915)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|protein complex assembly (GO:0006461)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethionine metabolic process (GO:0046500)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)|structural molecule activity (GO:0005198)|thiopurine S-methyltransferase activity (GO:0008119)			endometrium(2)|large_intestine(1)|liver(1)|prostate(1)|skin(1)	6		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		TCGAAGAAAGATGGACAGGTA	0.388													ENSG00000197822																																					0													119.0	113.0	115.0					5																	68809856		2203	4300	6503	SO:0001583	missense	0			-	U49184	CCDS4006.1, CCDS54864.1	5q13.1	2014-06-13			ENSG00000197822	ENSG00000197822			8104	protein-coding gene	gene with protein product	"""tight junction protein occludin TM4 minus"", ""phosphatase 1, regulatory subunit 115"""	602876				8601611	Standard	NM_002538		Approved	PPP1R115	uc003jwu.3	Q16625	OTTHUMG00000099356	ENST00000355237.2:c.811A>G	5.37:g.68809856A>G	ENSP00000347379:p.Met271Val		B5BU70|D2DU64|D2DU65|D2IGC0|D2IGC1|E2CYV9|Q5U1V4|Q8N6K1	Missense_Mutation	SNP	pfam_Occludin_Rpol2_elong_fac_ELL,pfam_Marvel,pirsf_Occludin,prints_Occludin	p.M271V	ENST00000355237.2	37	c.811	CCDS4006.1	5	.	.	.	.	.	.	.	.	.	.	A	16.62	3.173717	0.57692	.	.	ENSG00000197822	ENST00000355237;ENST00000396442;ENST00000538151	T;T	0.74842	-0.88;-0.88	5.84	5.84	0.93424	.	0.178624	0.64402	D	0.000010	T	0.72170	0.3427	L	0.57536	1.79	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.69296	-0.5182	10	0.66056	D	0.02	-34.8304	15.1881	0.73020	1.0:0.0:0.0:0.0	.	271	Q16625	OCLN_HUMAN	V	271;271;20	ENSP00000347379:M271V;ENSP00000379719:M271V	ENSP00000347379:M271V	M	+	1	0	OCLN	68845612	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.955000	0.76007	2.226000	0.72624	0.482000	0.46254	ATG	-	OCLN	-	pirsf_Occludin		0.388	OCLN-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OCLN	HGNC	protein_coding	OTTHUMT00000216794.1	0	0	0	103	103	94	0.00	0.00	A	NM_002538		68809856	+1	51	47	106	63	tier1	no_errors	ENST00000355237	ensembl	human	known	74_37	missense	32.48	42.73	SNP	1.000	G	51	106
ABCA9	10350	genome.wustl.edu	37	17	66987021	66987021	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:66987021C>T	ENST00000340001.4	-	29	4005	c.3794G>A	c.(3793-3795)aGa>aAa	p.R1265K	ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000453985.2_Missense_Mutation_p.R1227K|ABCA9_ENST00000370732.2_Missense_Mutation_p.R1265K	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1265					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TGTTCTCATTCTTTCCATCTG	0.388													ENSG00000154258																																					0													202.0	170.0	181.0					17																	66987021		2203	4300	6503	SO:0001583	missense	0			-	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3794G>A	17.37:g.66987021C>T	ENSP00000342216:p.Arg1265Lys		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1265K	ENST00000340001.4	37	c.3794	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480236	0.63849	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732	D;D	0.89875	-2.39;-2.58	5.4	5.4	0.78164	.	0.000000	0.51477	D	0.000091	D	0.93588	0.7953	L	0.61387	1.9	0.38275	D	0.942253	D;D	0.89917	1.0;0.975	D;P	0.97110	1.0;0.751	D	0.94638	0.7828	10	0.62326	D	0.03	.	17.7247	0.88362	0.0:1.0:0.0:0.0	.	1265;1265	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	K	1265;1210;1265	ENSP00000342216:R1265K;ENSP00000359767:R1265K	ENSP00000342216:R1265K	R	-	2	0	ABCA9	64498616	0.993000	0.37304	0.962000	0.40283	0.342000	0.28953	3.059000	0.49947	2.541000	0.85698	0.655000	0.94253	AGA	-	ABCA9	-	NULL		0.388	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	0	0	0	75	75	78	0.00	0.00	C	NM_172386		66987021	-1	27	22	69	52	tier1	no_errors	ENST00000340001	ensembl	human	known	74_37	missense	27.84	29.73	SNP	0.997	T	27	69
DOPEY1	23033	genome.wustl.edu	37	6	83877837	83877837	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr6:83877837T>C	ENST00000349129.2	+	39	7609	c.7349T>C	c.(7348-7350)aTa>aCa	p.I2450T	DOPEY1_ENST00000237163.5_Missense_Mutation_p.I2354T|DOPEY1_ENST00000369739.3_Missense_Mutation_p.I2461T|PGM3_ENST00000512866.1_Intron|DOPEY1_ENST00000484282.1_3'UTR|PGM3_ENST00000513973.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2450					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AGGCAAAAAATAGAAGAGATG	0.388													ENSG00000083097																																					0													57.0	55.0	56.0					6																	83877837		2203	4300	6503	SO:0001583	missense	0			-	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.7349T>C	6.37:g.83877837T>C	ENSP00000195654:p.Ile2450Thr		Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.I2450T	ENST00000349129.2	37	c.7349	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	T	21.5	4.153682	0.78114	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.30182	1.56;1.54	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.39784	0.1091	L	0.48642	1.525	0.80722	D	1	D;D;D	0.64830	0.994;0.993;0.993	D;P;P	0.74348	0.983;0.88;0.88	T	0.34403	-0.9830	10	0.87932	D	0	.	14.6387	0.68708	0.0:0.0:0.0:1.0	.	2341;2441;2450	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	T	2450;2354;2354	ENSP00000195654:I2450T;ENSP00000237163:I2354T	ENSP00000237163:I2354T	I	+	2	0	DOPEY1	83934556	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.201000	0.70794	0.533000	0.62120	ATA	-	DOPEY1	-	NULL		0.388	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	0	0	0	47	47	108	0.00	0.00	T	NM_015018		83877837	+1	21	18	99	120	tier1	no_errors	ENST00000349129	ensembl	human	known	74_37	missense	17.50	13.04	SNP	1.000	C	21	99
ELTD1	64123	genome.wustl.edu	37	1	79403555	79403555	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr1:79403555T>C	ENST00000370742.3	-	6	760	c.697A>G	c.(697-699)Act>Gct	p.T233A		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	233					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		ATCCTTAAAGTAGCTTGTTCA	0.348													ENSG00000162618																																					0													182.0	170.0	173.0					1																	79403555		1856	4100	5956	SO:0001583	missense	0			-	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.697A>G	1.37:g.79403555T>C	ENSP00000359778:p.Thr233Ala		B1AR71|Q5KU34	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T233A	ENST00000370742.3	37	c.697	CCDS41352.1	1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.661744	0.00772	.	.	ENSG00000162618	ENST00000370742	T	0.05649	3.41	5.79	5.79	0.91817	Domain of unknown function DUF3497 (1);	0.203205	0.52532	D	0.000061	T	0.01905	0.0060	L	0.34521	1.04	0.20074	N	0.999939	B	0.10296	0.003	B	0.15052	0.012	T	0.41574	-0.9501	9	.	.	.	.	10.4746	0.44657	0.0:0.0723:0.0:0.9277	.	233	Q9HBW9	ELTD1_HUMAN	A	233	ENSP00000359778:T233A	.	T	-	1	0	ELTD1	79176143	0.518000	0.26234	0.701000	0.30321	0.074000	0.17049	1.443000	0.35057	2.200000	0.70718	0.455000	0.32223	ACT	-	ELTD1	-	pfam_DUF3497		0.348	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELTD1	HGNC	protein_coding	OTTHUMT00000026859.1	0	0	0	42	42	146	0.00	0.00	T	NM_022159		79403555	-1	36	63	70	127	tier1	no_errors	ENST00000370742	ensembl	human	known	74_37	missense	33.96	33.16	SNP	0.186	C	36	70
MYH7	4625	genome.wustl.edu	37	14	23884311	23884311	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr14:23884311G>A	ENST00000355349.3	-	37	5614	c.5452C>T	c.(5452-5454)Cgg>Tgg	p.R1818W	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1818					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCCCGCACCCGCGCTTCCAGC	0.622													ENSG00000092054																																					0													85.0	85.0	85.0					14																	23884311		2203	4300	6503	SO:0001583	missense	0			-	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5452C>T	14.37:g.23884311G>A	ENSP00000347507:p.Arg1818Trp		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1818W	ENST00000355349.3	37	c.5452	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927708	0.73327	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.84944	-1.92	5.27	5.27	0.74061	Myosin tail (1);	.	.	.	.	D	0.95541	0.8551	H	0.97682	4.055	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.96828	0.9609	9	0.87932	D	0	.	19.075	0.93158	0.0:0.0:1.0:0.0	.	1818	P12883	MYH7_HUMAN	W	1818;1823	ENSP00000347507:R1818W	ENSP00000347507:R1818W	R	-	1	2	MYH7	22954151	0.863000	0.29885	0.999000	0.59377	0.769000	0.43574	2.169000	0.42434	2.750000	0.94351	0.563000	0.77884	CGG	-	MYH7	-	pfam_Myosin_tail		0.622	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	0	0	0	72	72	20	0.00	0.00	G	NM_000257		23884311	-1	10	6	32	10	tier1	no_errors	ENST00000355349	ensembl	human	known	74_37	missense	23.81	37.50	SNP	1.000	A	10	32
CD99L2	83692	genome.wustl.edu	37	X	149984546	149984546	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chrX:149984546A>T	ENST00000370377.3	-	3	253	c.136T>A	c.(136-138)Tgg>Agg	p.W46R	CD99L2_ENST00000355149.3_Intron|CD99L2_ENST00000437787.2_Missense_Mutation_p.W46R|CD99L2_ENST00000466436.1_Intron|CD99L2_ENST00000346693.4_5'UTR	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	46					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GTGTGGTCCCATGGCTCTAAA	0.517													ENSG00000102181																																					0													277.0	214.0	235.0					X																	149984546		2203	4300	6503	SO:0001583	missense	0			-	BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.136T>A	X.37:g.149984546A>T	ENSP00000359403:p.Trp46Arg		A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	Missense_Mutation	SNP	pfam_CD99L2	p.W46R	ENST00000370377.3	37	c.136	CCDS35427.1	X	.	.	.	.	.	.	.	.	.	.	A	13.81	2.348903	0.41599	.	.	ENSG00000102181	ENST00000370377;ENST00000438086;ENST00000437787;ENST00000418547	T	0.20200	2.09	2.37	1.2	0.21068	.	.	.	.	.	T	0.36608	0.0973	M	0.71581	2.175	0.09310	N	0.999999	B;D	0.64830	0.204;0.994	P;D	0.67725	0.471;0.953	T	0.13176	-1.0519	8	.	.	.	.	3.4908	0.07637	0.7873:0.0:0.2127:0.0	.	46;46	E9PD27;Q8TCZ2	.;C99L2_HUMAN	R	46;46;46;9	ENSP00000394858:W46R	.	W	-	1	0	CD99L2	149735204	0.949000	0.32298	0.054000	0.19295	0.434000	0.31775	1.285000	0.33261	0.238000	0.21222	0.242000	0.17961	TGG	-	CD99L2	-	NULL		0.517	CD99L2-001	KNOWN	basic|CCDS	protein_coding	CD99L2	HGNC	protein_coding	OTTHUMT00000061199.1	0	0	0	113	113	111	0.00	0.00	A	NM_031462		149984546	-1	57	24	100	59	tier1	no_errors	ENST00000370377	ensembl	human	known	74_37	missense	36.31	28.92	SNP	0.048	T	57	100
CIITA	4261	genome.wustl.edu	37	16	10971191	10971191	+	Missense_Mutation	SNP	C	C	T	rs375497479		TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr16:10971191C>T	ENST00000324288.8	+	1	137	c.4C>T	c.(4-6)Cgt>Tgt	p.R2C	CIITA_ENST00000381835.5_Missense_Mutation_p.R2C|RP11-876N24.2_ENST00000572017.1_RNA|CIITA_ENST00000537380.1_3'UTR|RP11-876N24.2_ENST00000573071.1_RNA	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	2					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CTACACAATGCGTTGCCTGGC	0.607			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """								ENSG00000179583																												Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	0								C	CYS/ARG	0,4394		0,0,2197	59.0	53.0	55.0		4	2.9	1.0	16		55	1,8599	1.2+/-3.3	0,1,4299	no	missense	CIITA	NM_000246.3	180	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	2/1131	10971191	1,12993	2197	4300	6497	SO:0001583	missense	0			-	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.4C>T	16.37:g.10971191C>T	ENSP00000316328:p.Arg2Cys		A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,prints_MHC_II_transact	p.R2C	ENST00000324288.8	37	c.4	CCDS10544.1	16	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799948	0.50208	0.0	1.16E-4	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	T;T	0.74209	-0.82;1.5	2.94	2.94	0.34122	.	.	.	.	.	T	0.76579	0.4007	L	0.29908	0.895	0.36555	D	0.872078	D;D;D;D;D;D	0.89917	1.0;1.0;0.997;0.997;1.0;1.0	D;D;B;B;D;D	0.83275	0.996;0.985;0.446;0.446;0.996;0.973	T	0.80355	-0.1417	9	0.87932	D	0	.	9.6023	0.39612	0.0:1.0:0.0:0.0	.	2;2;2;2;2;2	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	C	2	ENSP00000316328:R2C;ENSP00000371257:R2C	ENSP00000316328:R2C	R	+	1	0	CIITA	10878692	1.000000	0.71417	1.000000	0.80357	0.469000	0.32828	2.921000	0.48852	1.964000	0.57103	0.313000	0.20887	CGT	-	CIITA	-	NULL		0.607	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIITA	HGNC	protein_coding	OTTHUMT00000251966.2	0	0	0	69	69	46	0.00	0.00	C	NM_000246		10971191	+1	32	24	33	26	tier1	no_errors	ENST00000324288	ensembl	human	known	74_37	missense	49.23	48.00	SNP	1.000	T	32	33
SLC16A11	162515	genome.wustl.edu	37	17	6946314	6946314	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:6946314C>T	ENST00000308009.1	-	2	690	c.353G>A	c.(352-354)gGc>gAc	p.G118D	SLC16A11_ENST00000447225.1_Missense_Mutation_p.G94D	NM_153357.1	NP_699188.1	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	118					lipid metabolic process (GO:0006629)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(2)|ovary(1)|skin(2)	9						GAAGACGAAGCCCAGCGAGGC	0.697													ENSG00000174326																																					0													21.0	26.0	25.0					17																	6946314		2196	4296	6492	SO:0001583	missense	0			-	AK074674	CCDS11086.1	17p13.2	2013-07-18	2013-07-18		ENSG00000174326	ENSG00000174326		"""Solute carriers"""	23093	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 11"""	615765	"""solute carrier family 16 (monocarboxylic acid transporters), member 11"""				Standard	NM_153357		Approved	FLJ90193, MCT11	uc002gei.1	Q8NCK7	OTTHUMG00000102087	ENST00000308009.1:c.353G>A	17.37:g.6946314C>T	ENSP00000310490:p.Gly118Asp			Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G118D	ENST00000308009.1	37	c.353	CCDS11086.1	17	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038626	0.93630	.	.	ENSG00000174326	ENST00000308009;ENST00000447225	T;T	0.62364	0.03;0.03	5.18	5.18	0.71444	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.83261	0.5216	M	0.91872	3.25	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.86784	0.1981	10	0.87932	D	0	.	16.2712	0.82622	0.0:1.0:0.0:0.0	.	118	Q8NCK7	MOT11_HUMAN	D	118;94	ENSP00000310490:G118D;ENSP00000394449:G94D	ENSP00000310490:G118D	G	-	2	0	SLC16A11	6887038	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.097000	0.57741	2.708000	0.92522	0.555000	0.69702	GGC	-	SLC16A11	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.697	SLC16A11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC16A11	HGNC	protein_coding	OTTHUMT00000219921.1	0	0	0	75	75	15	0.00	0.00	C	NM_153357		6946314	-1	13	7	33	10	tier1	no_errors	ENST00000308009	ensembl	human	known	74_37	missense	28.26	41.18	SNP	1.000	T	13	33
LRFN2	57497	genome.wustl.edu	37	6	40400756	40400756	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr6:40400756A>G	ENST00000338305.6	-	2	639	c.97T>C	c.(97-99)Tca>Cca	p.S33P		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	33	LRRNT.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GTCCCCAGTGACTCAGACAGA	0.612													ENSG00000156564																																					0													45.0	50.0	48.0					6																	40400756		2203	4300	6503	SO:0001583	missense	0			-	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.97T>C	6.37:g.40400756A>G	ENSP00000345985:p.Ser33Pro		A5PKU3|Q5SYP9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S33P	ENST00000338305.6	37	c.97	CCDS34443.1	6	.	.	.	.	.	.	.	.	.	.	A	15.48	2.844784	0.51164	.	.	ENSG00000156564	ENST00000338305	T	0.02395	4.31	5.67	5.67	0.87782	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.01558	0.0050	L	0.27053	0.805	0.80722	D	1	P	0.36495	0.556	B	0.38458	0.274	T	0.62964	-0.6742	10	0.45353	T	0.12	.	14.7394	0.69442	1.0:0.0:0.0:0.0	.	33	Q9ULH4	LRFN2_HUMAN	P	33	ENSP00000345985:S33P	ENSP00000345985:S33P	S	-	1	0	LRFN2	40508734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.184000	0.72008	2.178000	0.69098	0.533000	0.62120	TCA	-	LRFN2	-	NULL		0.612	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1	0	0	0	56	56	61	0.00	0.00	A	XM_166372		40400756	-1	12	12	45	43	tier1	no_errors	ENST00000338305	ensembl	human	known	74_37	missense	21.05	21.82	SNP	1.000	G	12	45
FRMPD4	9758	genome.wustl.edu	37	X	12736510	12736510	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chrX:12736510C>T	ENST00000380682.1	+	16	4071	c.3565C>T	c.(3565-3567)Cgc>Tgc	p.R1189C		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1189					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GAGTGTGGCCCGCCTTTGTGA	0.552													ENSG00000169933																																					0													129.0	117.0	121.0					X																	12736510		2203	4300	6503	SO:0001583	missense	0			-	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3565C>T	X.37:g.12736510C>T	ENSP00000370057:p.Arg1189Cys		A8K0X9|O15032	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_dom	p.R1189C	ENST00000380682.1	37	c.3565	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241500	0.39598	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.11604	2.76	5.5	5.5	0.81552	.	0.328804	0.32002	N	0.006724	T	0.20820	0.0501	M	0.67953	2.075	0.41016	D	0.985049	D;D	0.71674	0.998;0.998	P;P	0.51355	0.667;0.667	T	0.00731	-1.1590	10	0.87932	D	0	-1.4847	11.2102	0.48793	0.2453:0.7547:0.0:0.0	.	1181;1189	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	C	1189;1180;1178	ENSP00000370057:R1189C	ENSP00000304583:R1178C	R	+	1	0	FRMPD4	12646431	1.000000	0.71417	0.924000	0.36721	0.305000	0.27757	2.698000	0.47068	2.295000	0.77249	0.600000	0.82982	CGC	-	FRMPD4	-	NULL		0.552	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1	0	0	0	59	59	39	0.00	0.00	C	XM_045712		12736510	+1	11	8	53	44	tier1	no_errors	ENST00000380682	ensembl	human	known	74_37	missense	17.19	15.38	SNP	0.906	T	11	53
QSOX2	169714	genome.wustl.edu	37	9	139100668	139100668	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr9:139100668T>A	ENST00000358701.5	-	12	2040	c.2003A>T	c.(2002-2004)tAc>tTc	p.Y668F		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	668					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TGAAGCCACGTACAGCACGAC	0.632													ENSG00000165661																																					0													158.0	137.0	144.0					9																	139100668		2203	4300	6503	SO:0001583	missense	0			-	AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.2003A>T	9.37:g.139100668T>A	ENSP00000351536:p.Tyr668Phe		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	pfam_ERV/ALR_sulphydryl_oxidase,pfam_Thioredoxin_domain,superfamily_ERV/ALR_sulphydryl_oxidase,superfamily_Thioredoxin-like_fold	p.Y668F	ENST00000358701.5	37	c.2003	CCDS35178.1	9	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878733	0.72294	.	.	ENSG00000165661	ENST00000358701	T	0.25912	1.77	4.97	4.97	0.65823	.	0.000000	0.64402	D	0.000001	T	0.48589	0.1508	M	0.66939	2.045	0.48511	D	0.999665	D	0.76494	0.999	D	0.80764	0.994	T	0.50550	-0.8815	10	0.62326	D	0.03	-29.2375	13.8861	0.63710	0.0:0.0:0.0:1.0	.	668	Q6ZRP7	QSOX2_HUMAN	F	668	ENSP00000351536:Y668F	ENSP00000351536:Y668F	Y	-	2	0	QSOX2	138240489	1.000000	0.71417	0.964000	0.40570	0.841000	0.47740	7.324000	0.79115	1.859000	0.53934	0.456000	0.33151	TAC	-	QSOX2	-	NULL		0.632	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX2	HGNC	protein_coding	OTTHUMT00000055046.2	0	0	0	70	70	44	0.00	0.00	T	NM_181701		139100668	-1	31	24	80	36	tier1	no_errors	ENST00000358701	ensembl	human	known	74_37	missense	27.93	40.00	SNP	1.000	A	31	80
NDST3	9348	genome.wustl.edu	37	4	118975296	118975296	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr4:118975296C>A	ENST00000296499.5	+	2	634	c.231C>A	c.(229-231)gaC>gaA	p.D77E	NDST3_ENST00000433996.2_Missense_Mutation_p.D77E	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	77	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						CAAGGACAGACCCCACAGTCC	0.423													ENSG00000164100																																					0													98.0	96.0	97.0					4																	118975296		2203	4300	6503	SO:0001583	missense	0			-	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.231C>A	4.37:g.118975296C>A	ENSP00000296499:p.Asp77Glu		B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.D77E	ENST00000296499.5	37	c.231	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	C	10.94	1.491950	0.26774	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.48201	1.14;0.82	5.53	1.79	0.24919	.	0.045924	0.85682	D	0.000000	T	0.30696	0.0773	L	0.31371	0.925	0.30384	N	0.781622	B;B;B	0.20550	0.008;0.046;0.009	B;B;B	0.30495	0.028;0.116;0.016	T	0.18524	-1.0334	10	0.29301	T	0.29	.	2.7622	0.05310	0.1992:0.4736:0.0976:0.2295	.	77;77;77	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	E	77	ENSP00000296499:D77E;ENSP00000396625:D77E	ENSP00000296499:D77E	D	+	3	2	NDST3	119194744	0.004000	0.15560	0.158000	0.22627	0.880000	0.50808	-1.181000	0.03085	-0.190000	0.10465	-0.813000	0.03139	GAC	-	NDST3	-	pfam_Heparan_SO4_deacetylase		0.423	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	HGNC	protein_coding	OTTHUMT00000256517.4	0	0	0	37	37	96	0.00	0.00	C	NM_004784		118975296	+1	9	25	58	69	tier1	no_errors	ENST00000296499	ensembl	human	known	74_37	missense	13.43	26.60	SNP	0.876	A	9	58
RANBP10	57610	genome.wustl.edu	37	16	67763633	67763633	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr16:67763633G>A	ENST00000317506.3	-	9	1212	c.1097C>T	c.(1096-1098)cCc>cTc	p.P366L	RANBP10_ENST00000536251.1_Missense_Mutation_p.P137L|RANBP10_ENST00000448631.2_Missense_Mutation_p.P310L|RANBP10_ENST00000602677.1_Missense_Mutation_p.P366L|RANBP10_ENST00000411657.2_Missense_Mutation_p.P249L	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	366	Ser-rich.				microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		ACTGAGGCTGGGGGAGCCAGG	0.607													ENSG00000141084																																					0													69.0	70.0	70.0					16																	67763633		2198	4300	6498	SO:0001583	missense	0			-	AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.1097C>T	16.37:g.67763633G>A	ENSP00000316589:p.Pro366Leu		A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_CTLH/CRA,pfam_LisH_dimerisation_subgr,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,smart_CTLH_C,smart_CRA_dom,pfscan_B30.2/SPRY,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.P366L	ENST00000317506.3	37	c.1097	CCDS32469.1	16	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355659	0.82243	.	.	ENSG00000141084	ENST00000317506;ENST00000448631;ENST00000536251;ENST00000411657	.	.	.	5.7	5.7	0.88788	.	0.109438	0.64402	D	0.000005	T	0.79851	0.4517	M	0.76574	2.34	0.80722	D	1	B;D;D	0.89917	0.013;1.0;0.996	B;D;D	0.87578	0.018;0.998;0.983	T	0.77728	-0.2479	9	0.39692	T	0.17	-16.554	19.4289	0.94756	0.0:0.0:1.0:0.0	.	249;310;366	B4DID0;B4DQH9;Q6VN20	.;.;RBP10_HUMAN	L	366;310;137;249	.	ENSP00000316589:P366L	P	-	2	0	RANBP10	66321134	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.017000	0.93651	2.700000	0.92200	0.563000	0.77884	CCC	-	RANBP10	-	NULL		0.607	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP10	HGNC	protein_coding	OTTHUMT00000467896.1	0	0	0	95	95	39	0.00	0.00	G	NM_020850		67763633	-1	13	12	23	32	tier1	no_errors	ENST00000317506	ensembl	human	known	74_37	missense	36.11	27.27	SNP	1.000	A	13	23
GPS2	2874	genome.wustl.edu	37	17	7216153	7216153	+	Silent	SNP	G	G	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:7216153G>C	ENST00000380728.2	-	11	1206	c.906C>G	c.(904-906)ggC>ggG	p.G302G	GPS2_ENST00000391950.3_Intron|GPS2_ENST00000389167.5_Silent_p.G302G|RP11-542C16.2_ENST00000575474.1_3'UTR			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	302					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				TAGCTGCAAAGCCCGACTGGT	0.512													ENSG00000132522																																					0													153.0	151.0	152.0					17																	7216153		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.906C>G	17.37:g.7216153G>C			B4DXA1|Q6FHM8	Silent	SNP	NULL	p.G302	ENST00000380728.2	37	c.906	CCDS11100.1	17																																																																																			-	GPS2	-	NULL		0.512	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	0	0	0	43	43	83	0.00	0.00	G	NM_004489		7216153	-1	10	14	21	70	tier1	no_errors	ENST00000380728	ensembl	human	known	74_37	silent	32.26	16.67	SNP	1.000	C	10	21
FOLH1	2346	genome.wustl.edu	37	11	49208258	49208258	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr11:49208258T>A	ENST00000256999.2	-	5	837	c.577A>T	c.(577-579)Aaa>Taa	p.K193*	FOLH1_ENST00000533034.1_Nonsense_Mutation_p.K178*|FOLH1_ENST00000356696.3_Nonsense_Mutation_p.K193*|FOLH1_ENST00000340334.7_Nonsense_Mutation_p.K178*|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	193					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	CAATTGATTTTCATGTCCCGT	0.363													ENSG00000086205																																					0													76.0	81.0	80.0					11																	49208258		2201	4298	6499	SO:0001587	stop_gained	0			-	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.577A>T	11.37:g.49208258T>A	ENSP00000256999:p.Lys193*		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Nonsense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.K193*	ENST00000256999.2	37	c.577	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	T	38	6.833635	0.97873	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	.	.	.	3.05	1.93	0.25924	.	0.250905	0.27375	N	0.019643	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	6.1314	0.20207	0.0:0.1361:0.0:0.8639	.	.	.	.	X	193;193;178;178;193	.	ENSP00000256999:K193X	K	-	1	0	FOLH1	49164834	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	2.140000	0.42159	1.425000	0.47237	0.352000	0.21897	AAA	-	FOLH1	-	pfam_Protease-assoc_domain		0.363	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	0	0	0	83	83	22	0.00	0.00	T	NM_004476		49208258	-1	33	6	155	25	tier1	no_errors	ENST00000256999	ensembl	human	known	74_37	nonsense	17.55	19.35	SNP	0.996	A	33	155
FAM64A	54478	genome.wustl.edu	37	17	6350862	6350862	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:6350862C>T	ENST00000250056.8	+	3	457	c.374C>T	c.(373-375)gCa>gTa	p.A125V	FAM64A_ENST00000570337.2_Missense_Mutation_p.A125V|FAM64A_ENST00000571373.1_Missense_Mutation_p.A125V|FAM64A_ENST00000572595.2_Missense_Mutation_p.A156V|FAM64A_ENST00000576056.1_Missense_Mutation_p.A125V|FAM64A_ENST00000572447.1_Missense_Mutation_p.A125V	NM_001195228.1	NP_001182157.1	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	125					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				COAD - Colon adenocarcinoma(228;0.141)		AAGAGAGGAGCACAGAAGGGC	0.622													ENSG00000129195																																					0													63.0	70.0	68.0					17																	6350862		2203	4300	6503	SO:0001583	missense	0			-		CCDS32541.1, CCDS56016.1	17p13.2	2013-10-11			ENSG00000129195	ENSG00000129195			25483	protein-coding gene	gene with protein product	"""CALM interacting protein expressed in thymus and spleen"""					19383357, 16491119	Standard	NM_019013		Approved	FLJ10156, FLJ10491, CATS	uc002gcw.2	Q9BSJ6	OTTHUMG00000177832	ENST00000250056.8:c.374C>T	17.37:g.6350862C>T	ENSP00000250056:p.Ala125Val		Q96CT4|Q9NVV1|Q9NWB5	Missense_Mutation	SNP	pfam_DUF1466	p.A125V	ENST00000250056.8	37	c.374	CCDS56016.1	17	.	.	.	.	.	.	.	.	.	.	C	12.28	1.889749	0.33348	.	.	ENSG00000129195	ENST00000250056;ENST00000308855	T	0.56776	0.44	4.58	1.08	0.20341	.	1.205350	0.05906	N	0.630892	T	0.45074	0.1324	L	0.50919	1.6	0.09310	N	1	B;B	0.33612	0.043;0.419	B;B	0.33690	0.026;0.168	T	0.29731	-1.0002	10	0.27785	T	0.31	0.0761	6.0726	0.19897	0.0:0.6127:0.0:0.3873	.	125;125	Q9BSJ6;Q9BSJ6-2	FA64A_HUMAN;.	V	125	ENSP00000250056:A125V	ENSP00000250056:A125V	A	+	2	0	FAM64A	6291586	0.269000	0.24143	0.001000	0.08648	0.276000	0.26787	0.802000	0.27069	0.153000	0.19213	0.563000	0.77884	GCA	-	FAM64A	-	pfam_DUF1466		0.622	FAM64A-008	KNOWN	basic|CCDS	protein_coding	FAM64A	HGNC	protein_coding	OTTHUMT00000439156.1	0	0	0	74	74	16	0.00	0.00	C	NM_019013		6350862	+1	42	8	48	25	tier1	no_errors	ENST00000250056	ensembl	human	known	74_37	missense	45.65	24.24	SNP	0.001	T	42	48
ARAP3	64411	genome.wustl.edu	37	5	141059359	141059359	+	Silent	SNP	G	G	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr5:141059359G>T	ENST00000239440.4	-	3	620	c.555C>A	c.(553-555)ccC>ccA	p.P185P	ARAP3_ENST00000508305.1_Silent_p.P107P	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	185					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GGGCAGGGGTGGGGGCAGAGA	0.587													ENSG00000120318																																					0													66.0	70.0	69.0					5																	141059359		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.555C>A	5.37:g.141059359G>T			B4DIT1|D3DQE3	Silent	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.P185	ENST00000239440.4	37	c.555	CCDS4266.1	5																																																																																			-	ARAP3	-	NULL		0.587	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	0	0	0	60	60	42	0.00	0.00	G	NM_022481		141059359	-1	11	8	61	54	tier1	no_errors	ENST00000239440	ensembl	human	known	74_37	silent	15.28	12.90	SNP	0.991	T	11	61
FAM64A	54478	genome.wustl.edu	37	17	6350925	6350925	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:6350925C>T	ENST00000250056.8	+	3	520	c.437C>T	c.(436-438)gCc>gTc	p.A146V	FAM64A_ENST00000570337.2_Missense_Mutation_p.A146V|FAM64A_ENST00000571373.1_Missense_Mutation_p.A146V|FAM64A_ENST00000572595.2_Missense_Mutation_p.A177V|FAM64A_ENST00000576056.1_Missense_Mutation_p.A146V|FAM64A_ENST00000572447.1_Missense_Mutation_p.A146V	NM_001195228.1	NP_001182157.1	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	146					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				COAD - Colon adenocarcinoma(228;0.141)		CTGTCTGGAGCCGCCCCTGCC	0.652													ENSG00000129195																																					0													27.0	32.0	30.0					17																	6350925		2203	4300	6503	SO:0001583	missense	0			-		CCDS32541.1, CCDS56016.1	17p13.2	2013-10-11			ENSG00000129195	ENSG00000129195			25483	protein-coding gene	gene with protein product	"""CALM interacting protein expressed in thymus and spleen"""					19383357, 16491119	Standard	NM_019013		Approved	FLJ10156, FLJ10491, CATS	uc002gcw.2	Q9BSJ6	OTTHUMG00000177832	ENST00000250056.8:c.437C>T	17.37:g.6350925C>T	ENSP00000250056:p.Ala146Val		Q96CT4|Q9NVV1|Q9NWB5	Missense_Mutation	SNP	pfam_DUF1466	p.A146V	ENST00000250056.8	37	c.437	CCDS56016.1	17	.	.	.	.	.	.	.	.	.	.	C	16.72	3.200109	0.58126	.	.	ENSG00000129195	ENST00000250056;ENST00000308855	T	0.52057	0.68	4.9	4.9	0.64082	.	0.936787	0.08991	N	0.864373	T	0.58235	0.2108	M	0.63428	1.95	0.09310	N	1	P;P	0.47253	0.892;0.78	P;B	0.51974	0.686;0.38	T	0.48043	-0.9069	10	0.24483	T	0.36	-8.0434	13.4474	0.61148	0.0:1.0:0.0:0.0	.	146;146	Q9BSJ6;Q9BSJ6-2	FA64A_HUMAN;.	V	146	ENSP00000250056:A146V	ENSP00000250056:A146V	A	+	2	0	FAM64A	6291649	0.000000	0.05858	0.059000	0.19551	0.454000	0.32378	0.885000	0.28227	2.564000	0.86499	0.563000	0.77884	GCC	-	FAM64A	-	pfam_DUF1466		0.652	FAM64A-008	KNOWN	basic|CCDS	protein_coding	FAM64A	HGNC	protein_coding	OTTHUMT00000439156.1	0	0	0	95	95	9	0.00	0.00	C	NM_019013		6350925	+1	39	4	58	15	tier1	no_errors	ENST00000250056	ensembl	human	known	74_37	missense	39.80	20.00	SNP	0.142	T	39	58
SLC9C1	285335	genome.wustl.edu	37	3	111887771	111887771	+	Nonsense_Mutation	SNP	G	G	A	rs202229232		TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr3:111887771G>A	ENST00000305815.5	-	25	3442	c.3190C>T	c.(3190-3192)Cga>Tga	p.R1064*	SLC9C1_ENST00000487372.1_Nonsense_Mutation_p.R1016*	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	1064					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TAAGTTTTTCGTAACAGACAA	0.318													ENSG00000172139	G|||	1	0.000199681	0.0	0.0	5008	,	,		20735	0.001		0.0	False		,,,				2504	0.0																0								G	stop/ARG	3,4401	6.2+/-15.9	0,3,2199	127.0	133.0	131.0		3190	6.1	0.1	3		131	0,8598		0,0,4299	yes	stop-gained	SLC9A10	NM_183061.1		0,3,6498	AA,AG,GG		0.0,0.0681,0.0231		1064/1178	111887771	3,12999	2202	4299	6501	SO:0001587	stop_gained	0			-	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.3190C>T	3.37:g.111887771G>A	ENSP00000306627:p.Arg1064*		Q6ZRP4|Q7RTP2	Nonsense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.R1064*	ENST00000305815.5	37	c.3190	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	G	38	7.284194	0.98186	6.81E-4	0.0	ENSG00000172139	ENST00000305815;ENST00000487372	.	.	.	6.06	6.06	0.98353	.	0.677608	0.13656	N	0.371958	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.5387	16.1398	0.81515	0.0:0.0:1.0:0.0	.	.	.	.	X	1064;1016	.	ENSP00000306627:R1064X	R	-	1	2	SLC9A10	113370461	0.449000	0.25689	0.124000	0.21820	0.021000	0.10359	2.673000	0.46858	2.880000	0.98712	0.650000	0.86243	CGA	rs202229232	SLC9C1	-	NULL		0.318	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1	0	0	0	29	29	72	0.00	0.00	G	NM_183061		111887771	-1	5	9	52	78	tier1	no_errors	ENST00000305815	ensembl	human	known	74_37	nonsense	8.77	10.34	SNP	0.631	A	5	52
LRRIQ1	84125	genome.wustl.edu	37	12	85638644	85638644	+	Silent	SNP	A	A	G			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr12:85638644A>G	ENST00000393217.2	+	27	5155	c.5094A>G	c.(5092-5094)agA>agG	p.R1698R	LRRIQ1_ENST00000528777.3_3'UTR	NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1698										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CTGTGAACAGAGAAAAAAAAA	0.393													ENSG00000133640																																					0													93.0	85.0	87.0					12																	85638644		1838	4090	5928	SO:0001819	synonymous_variant	0			-	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.5094A>G	12.37:g.85638644A>G			Q567P4|Q9BS17|Q9HA36	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.R1698	ENST00000393217.2	37	c.5094	CCDS41816.1	12																																																																																			-	LRRIQ1	-	NULL		0.393	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	0	0	0	41	41	54	0.00	0.00	A	NM_032165		85638644	+1	24	15	32	19	tier1	no_errors	ENST00000393217	ensembl	human	known	74_37	silent	42.86	44.12	SNP	1.000	G	24	32
ELMO2	63916	genome.wustl.edu	37	20	45000515	45000515	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr20:45000515A>T	ENST00000290246.6	-	17	1704	c.1510T>A	c.(1510-1512)Tac>Aac	p.Y504N	ELMO2_ENST00000454865.2_Missense_Mutation_p.Y236N|ELMO2_ENST00000445496.2_Missense_Mutation_p.Y321N|ELMO2_ENST00000352077.2_Missense_Mutation_p.Y502N|ELMO2_ENST00000372176.1_Missense_Mutation_p.Y416N|ELMO2_ENST00000488853.1_5'Flank|ELMO2_ENST00000396391.1_Missense_Mutation_p.Y504N|ELMO2_ENST00000439931.2_Missense_Mutation_p.Y516N	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	504					apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				ATCTCAGAGTAACTCAGGCTA	0.517													ENSG00000062598																																					0													83.0	79.0	80.0					20																	45000515		2203	4300	6503	SO:0001583	missense	0			-	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.1510T>A	20.37:g.45000515A>T	ENSP00000290246:p.Tyr504Asn		E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.Y516N	ENST00000290246.6	37	c.1546	CCDS13398.1	20	.	.	.	.	.	.	.	.	.	.	A	24.0	4.478482	0.84747	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000452857;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000454865;ENST00000352077	T;T;T;T;T;T;T;T	0.55588	2.05;1.79;0.51;2.05;2.02;1.49;1.53;2.05	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.73466	0.3590	M	0.83483	2.645	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;1.0;1.0	D;D;D;D	0.91635	0.935;0.999;0.993;0.996	T	0.78463	-0.2194	10	0.87932	D	0	-19.4805	13.5889	0.61948	1.0:0.0:0.0:0.0	.	516;236;321;504	B4DRL5;B4DZ20;B7Z1S8;Q96JJ3	.;.;.;ELMO2_HUMAN	N	504;416;71;504;516;321;236;502	ENSP00000290246:Y504N;ENSP00000361249:Y416N;ENSP00000414329:Y71N;ENSP00000379673:Y504N;ENSP00000396519:Y516N;ENSP00000409920:Y321N;ENSP00000415641:Y236N;ENSP00000326172:Y502N	ENSP00000290246:Y504N	Y	-	1	0	ELMO2	44433922	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.087000	0.94110	2.042000	0.60477	0.533000	0.62120	TAC	-	ELMO2	-	NULL		0.517	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELMO2	HGNC	protein_coding	OTTHUMT00000080466.1	0	0	0	19	19	66	0.00	0.00	A	NM_022086		45000515	-1	13	9	38	68	tier1	no_errors	ENST00000439931	ensembl	human	known	74_37	missense	25.00	11.69	SNP	1.000	T	13	38
ARHGAP35	2909	genome.wustl.edu	37	19	47424544	47424544	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr19:47424544G>T	ENST00000404338.3	+	1	2612	c.2612G>T	c.(2611-2613)cGt>cTt	p.R871L		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	871					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.R871P(2)									GCTATGTTACGTGCCTTTCTT	0.438													ENSG00000160007																																					2	Substitution - Missense(2)	endometrium(2)											138.0	134.0	135.0					19																	47424544		1931	4148	6079	SO:0001583	missense	0			-	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2612G>T	19.37:g.47424544G>T	ENSP00000385720:p.Arg871Leu		A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R871L	ENST00000404338.3	37	c.2612	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420144	0.62622	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.42131	0.98	5.79	5.79	0.91817	.	0.094092	0.85682	D	0.000000	T	0.39937	0.1097	L	0.41824	1.3	0.58432	D	0.999999	P	0.45212	0.853	B	0.40285	0.325	T	0.30179	-0.9987	10	0.56958	D	0.05	-9.825	18.8035	0.92028	0.0:0.0:1.0:0.0	.	871	Q9NRY4-2	.	L	871	ENSP00000385720:R871L	ENSP00000324820:R871L	R	+	2	0	ARHGAP35	52116384	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.866000	0.99616	2.743000	0.94032	0.655000	0.94253	CGT	-	ARHGAP35	-	NULL		0.438	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	0	0	0	82	82	96	0.00	0.00	G	NM_004491		47424544	+1	48	48	79	71	tier1	no_errors	ENST00000404338	ensembl	human	known	74_37	missense	37.80	40.00	SNP	1.000	T	48	79
GRM4	2914	genome.wustl.edu	37	6	34100900	34100900	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr6:34100900G>A	ENST00000538487.2	-	2	817	c.374C>T	c.(373-375)gCg>gTg	p.A125V	GRM4_ENST00000374177.3_Intron|GRM4_ENST00000374181.4_Missense_Mutation_p.A125V	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	125					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTCGATGAGCGCCTGCACAAA	0.637													ENSG00000124493																																					0													63.0	53.0	56.0					6																	34100900		2203	4300	6503	SO:0001583	missense	0			-	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.374C>T	6.37:g.34100900G>A	ENSP00000440556:p.Ala125Val		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_GABA_rcpt_B	p.A125V	ENST00000538487.2	37	c.374	CCDS4787.1	6	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951308	0.92660	.	.	ENSG00000124493	ENST00000374181;ENST00000538487	D;D	0.86297	-2.1;-2.1	3.99	3.99	0.46301	Extracellular ligand-binding receptor (1);	0.076271	0.51477	D	0.000096	D	0.92564	0.7638	M	0.82517	2.595	0.80722	D	1	D;D;D	0.76494	0.987;0.999;0.999	P;D;D	0.81914	0.753;0.995;0.995	D	0.93264	0.6646	10	0.59425	D	0.04	.	16.2077	0.82141	0.0:0.0:1.0:0.0	.	125;125;125	B7ZLU9;A1L4F9;Q14833	.;.;GRM4_HUMAN	V	125	ENSP00000363296:A125V;ENSP00000440556:A125V	ENSP00000363296:A125V	A	-	2	0	GRM4	34208878	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.475000	0.97721	2.230000	0.72887	0.467000	0.42956	GCG	-	GRM4	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.637	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	HGNC	protein_coding	OTTHUMT00000040213.2	0	0	0	78	78	31	0.00	0.00	G			34100900	-1	12	5	67	26	tier1	no_errors	ENST00000374181	ensembl	human	known	74_37	missense	15.19	16.13	SNP	1.000	A	12	67
BTBD10	84280	genome.wustl.edu	37	11	13424802	13424803	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	TA	TA	TA	-	TA	TA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr11:13424802_13424803delTA	ENST00000278174.5	-	8	1274_1275	c.1029_1030delTA	c.(1027-1032)tatagafs	p.YR343fs	BTBD10_ENST00000530907.1_Frame_Shift_Del_p.YR351fs|BTBD10_ENST00000528120.1_Frame_Shift_Del_p.YR295fs	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	343	Interaction with AKT family members. {ECO:0000250|UniProtKB:Q80X66}.					nucleus (GO:0005634)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		TTGAAAAATCTATATAATTTTG	0.272													ENSG00000148925																																					0																																										SO:0001589	frameshift_variant	0				AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.1029_1030delTA	11.37:g.13424806_13424807delTA	ENSP00000278174:p.Tyr343fs		B7Z228|Q86WG1	Frame_Shift_Del	DEL	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.Y343fs	ENST00000278174.5	37	c.1030_1029	CCDS7811.1	11																																																																																				BTBD10	-	NULL		0.272	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD10	HGNC	protein_coding	OTTHUMT00000386200.1	0	0	0	107	107	58	0.00	0.00	TA	NM_032320		13424803	-1	88	20	76	21	tier1	no_errors	ENST00000278174	ensembl	human	known	74_37	frame_shift_del	53.66	48.78	DEL	1.000:1.000	-	88	76
FOLH1	2346	genome.wustl.edu	37	11	49208259	49208259	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr11:49208259C>A	ENST00000256999.2	-	5	836	c.576G>T	c.(574-576)atG>atT	p.M192I	FOLH1_ENST00000533034.1_Missense_Mutation_p.M177I|FOLH1_ENST00000356696.3_Missense_Mutation_p.M192I|FOLH1_ENST00000340334.7_Missense_Mutation_p.M177I|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	192					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	AATTGATTTTCATGTCCCGTT	0.363													ENSG00000086205																																					0													77.0	82.0	80.0					11																	49208259		2201	4298	6499	SO:0001583	missense	0			-	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.576G>T	11.37:g.49208259C>A	ENSP00000256999:p.Met192Ile		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.M192I	ENST00000256999.2	37	c.576	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	13.13	2.146333	0.37923	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.06687	3.27;3.27;3.27;3.27	3.05	2.12	0.27331	Protease-associated domain, PA (1);	0.496506	0.18364	N	0.143492	T	0.08044	0.0201	L	0.60904	1.88	0.80722	D	1	B;B;B;B	0.34147	0.438;0.192;0.077;0.007	B;B;B;B	0.31751	0.135;0.022;0.037;0.013	T	0.14671	-1.0464	10	0.62326	D	0.03	.	4.3709	0.11247	0.0:0.715:0.0:0.285	.	177;177;192;192	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	I	192;192;177;177;192	ENSP00000256999:M192I;ENSP00000349129:M192I;ENSP00000344131:M177I;ENSP00000431463:M177I	ENSP00000256999:M192I	M	-	3	0	FOLH1	49164835	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	4.161000	0.58170	1.746000	0.51805	0.430000	0.28490	ATG	-	FOLH1	-	pfam_Protease-assoc_domain		0.363	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	0	0	0	83	83	22	0.00	0.00	C	NM_004476		49208259	-1	33	6	156	25	tier1	no_errors	ENST00000256999	ensembl	human	known	74_37	missense	17.46	19.35	SNP	0.997	A	33	156
RB1	5925	genome.wustl.edu	37	13	48955550	48955556	+	Frame_Shift_Del	DEL	CGAATCA	CGAATCA	-	rs121913304		TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	CGAATCA	CGAATCA	CGAATCA	-	CGAATCA	CGAATCA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr13:48955550_48955556delCGAATCA	ENST00000267163.4	+	17	1804_1810	c.1666_1672delCGAATCA	c.(1666-1674)cgaatcatgfs	p.RIM556fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	556	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.R556*(5)|p.C553fs*53(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATGTGAACATCGAATCATGGAATCCCT	0.329		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	29	Whole gene deletion(15)|Unknown(8)|Substitution - Nonsense(5)|Deletion - Frameshift(1)	bone(11)|breast(5)|eye(4)|central_nervous_system(4)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|ovary(1)	GRCh37	CD075538|CM942039	RB1	D|M	rs121913304																																			SO:0001589	frameshift_variant	0	Familial Cancer Database			M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1666_1672delCGAATCA	13.37:g.48955550_48955556delCGAATCA	ENSP00000267163:p.Arg556fs		A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R556fs	ENST00000267163.4	37	c.1666_1672	CCDS31973.1	13																																																																																				RB1	-	pfam_RB_A,superfamily_Cyclin-like		0.329	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	89	89	89	0.00	0.00	CGAATCA			48955556	+1	15	15	18	18	tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	45.45	45.45	DEL	1.000:1.000:0.999:1.000:1.000:1.000:1.000	-	15	18
XRN1	54464	genome.wustl.edu	37	3	142051879	142051879	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr3:142051879delT	ENST00000264951.4	-	35	4109	c.3992delA	c.(3991-3993)aatfs	p.N1331fs	XRN1_ENST00000392981.2_Frame_Shift_Del_p.N1331fs	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1331					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CTGTACTTCATTTTCTTTGGA	0.363													ENSG00000114127																																					0													108.0	100.0	103.0					3																	142051879		2203	4300	6503	SO:0001589	frameshift_variant	0				AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.3992delA	3.37:g.142051879delT	ENSP00000264951:p.Asn1331fs		Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Frame_Shift_Del	DEL	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.N1331fs	ENST00000264951.4	37	c.3992	CCDS3123.1	3																																																																																				XRN1	-	pirsf_5_3_exoribonuclease_1		0.363	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	0	0	0	28	28	71	0.00	0.00	T	NM_019001		142051879	-1	17	60	56	66	tier1	no_errors	ENST00000264951	ensembl	human	known	74_37	frame_shift_del	23.29	47.62	DEL	0.876	-	17	56
CX3CL1	6376	genome.wustl.edu	37	16	57416226	57416226	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr16:57416226C>T	ENST00000006053.6	+	3	587	c.476C>T	c.(475-477)aCg>aTg	p.T159M	CX3CL1_ENST00000563383.1_Missense_Mutation_p.T165M|CX3CL1_ENST00000564948.1_3'UTR|CX3CL1_ENST00000565912.1_Missense_Mutation_p.T121M	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	159	Mucin-like stalk.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GAGCTGCCGACGGGCGTGACT	0.672													ENSG00000006210																																					0													27.0	30.0	29.0					16																	57416226		2194	4276	6470	SO:0001583	missense	0			-	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.476C>T	16.37:g.57416226C>T	ENSP00000006053:p.Thr159Met		O00672	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CX3CL1	p.T159M	ENST00000006053.6	37	c.476	CCDS10779.1	16	.	.	.	.	.	.	.	.	.	.	C	13.39	2.222171	0.39300	.	.	ENSG00000006210	ENST00000006053	T	0.04970	3.52	4.8	-4.73	0.03259	.	20.404600	0.00465	N	0.000101	T	0.05318	0.0141	L	0.29908	0.895	0.09310	N	1	B	0.26081	0.141	B	0.14023	0.01	T	0.36841	-0.9731	10	0.87932	D	0	-11.3807	6.3603	0.21425	0.1318:0.2918:0.0:0.5764	.	159	P78423	X3CL1_HUMAN	M	159	ENSP00000006053:T159M	ENSP00000006053:T159M	T	+	2	0	CX3CL1	55973727	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.567000	0.05916	-1.251000	0.02494	-1.128000	0.01989	ACG	-	CX3CL1	-	NULL		0.672	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CL1	HGNC	protein_coding	OTTHUMT00000257345.3	0	0	0	38	38	31	0.00	0.00	C	NM_002996		57416226	+1	18	27	8	9	tier1	no_errors	ENST00000006053	ensembl	human	known	74_37	missense	69.23	75.00	SNP	0.000	T	18	8
DDX52	11056	genome.wustl.edu	37	17	36003427	36003427	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr17:36003427C>T	ENST00000349699.2	-	1	66	c.23G>A	c.(22-24)cGc>cAc	p.R8H	RP11-697E22.2_ENST00000586950.1_RNA|DDX52_ENST00000394367.3_5'UTR|RP11-697E22.2_ENST00000586163.1_RNA	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	8						membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				GCCGAGCCGGCGAAAGAGATC	0.632													ENSG00000141141																																					0													45.0	46.0	46.0					17																	36003427		2203	4300	6503	SO:0001583	missense	0			-	AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.23G>A	17.37:g.36003427C>T	ENSP00000268854:p.Arg8His		Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_R_helicase_DEAD_Q_motif	p.R8H	ENST00000349699.2	37	c.23	CCDS11323.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.150916	0.94645	.	.	ENSG00000141141	ENST00000349699	T	0.18174	2.23	5.5	5.5	0.81552	.	1.579570	0.03037	N	0.152895	T	0.46619	0.1402	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	T	0.01444	-1.1353	10	0.72032	D	0.01	.	14.7704	0.69671	0.0:1.0:0.0:0.0	.	8	Q9Y2R4	DDX52_HUMAN	H	8	ENSP00000268854:R8H	ENSP00000268854:R8H	R	-	2	0	DDX52	33077540	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	3.716000	0.54904	2.861000	0.98227	0.655000	0.94253	CGC	-	DDX52	-	NULL		0.632	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX52	HGNC	protein_coding	OTTHUMT00000256795.1	0	0	0	83	83	40	0.00	0.00	C	NM_152300		36003427	-1	34	21	22	5	tier1	no_errors	ENST00000349699	ensembl	human	known	74_37	missense	60.71	80.77	SNP	1.000	T	34	22
ZNF891	101060200	genome.wustl.edu	37	12	133697279	133697279	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr12:133697279C>A	ENST00000537226.1	-	2	1578	c.1226G>T	c.(1225-1227)tGt>tTt	p.C409F	ZNF891_ENST00000397313.2_Missense_Mutation_p.C409F|CTD-2140B24.6_ENST00000606110.1_RNA	NM_001277291.1	NP_001264220.1	A8MT65	ZN891_HUMAN	zinc finger protein 891	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1						GGATTTTCCACACTGATTACA	0.388													ENSG00000214029																																					0																																										SO:0001583	missense	0			-		CCDS59238.1	12q24.33	2014-01-23			ENSG00000214029	ENSG00000214029		"""Zinc fingers, C2H2-type"", ""-"""	38709	protein-coding gene	gene with protein product							Standard	NM_001277291		Approved		uc031qkm.1	A8MT65	OTTHUMG00000167943	ENST00000537226.1:c.1226G>T	12.37:g.133697279C>A	ENSP00000437590:p.Cys409Phe			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C409F	ENST00000537226.1	37	c.1226	CCDS59238.1	12	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353707	0.61293	.	.	ENSG00000214029	ENST00000537226;ENST00000397313	D;D	0.85861	-2.04;-2.04	3.62	3.62	0.41486	.	.	.	.	.	D	0.89515	0.6737	.	.	.	.	.	.	.	.	.	.	.	.	D	0.93212	0.6601	5	0.87932	D	0	.	14.2198	0.65818	0.0:1.0:0.0:0.0	.	.	.	.	F	409	ENSP00000437590:C409F;ENSP00000380480:C409F	ENSP00000380480:C409F	C	-	2	0	ZNF891	132207352	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	5.000000	0.63940	1.848000	0.53677	0.655000	0.94253	TGT	-	ZNF891	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.388	ZNF891-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF891	HGNC	protein_coding	OTTHUMT00000397179.1	0	0	0	105	105	41	0.00	0.00	C			133697279	-1	33	15	30	8	tier1	no_errors	ENST00000397313	ensembl	human	known	74_37	missense	52.38	65.22	SNP	1.000	A	33	30
LAMA2	3908	genome.wustl.edu	37	6	129634035	129634035	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr6:129634035G>T	ENST00000421865.2	+	23	3253	c.3204G>T	c.(3202-3204)ttG>ttT	p.L1068F		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1068	Laminin EGF-like 12. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGGGATCCTTGGATTTCCAAT	0.388													ENSG00000196569																																					0													82.0	80.0	81.0					6																	129634035		2203	4300	6503	SO:0001583	missense	0			-	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.3204G>T	6.37:g.129634035G>T	ENSP00000400365:p.Leu1068Phe		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SRE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.L1068F	ENST00000421865.2	37	c.3204	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	g	5.115	0.206846	0.09704	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.56611	0.45	5.92	1.83	0.25207	EGF-like, laminin (3);	0.401128	0.22777	N	0.055762	T	0.18841	0.0452	L	0.48642	1.525	0.39256	D	0.96412	B;B	0.14805	0.011;0.011	B;B	0.17433	0.018;0.018	T	0.11397	-1.0589	10	0.27082	T	0.32	.	0.478	0.00543	0.2099:0.2354:0.2776:0.2772	.	1068;1068	A6NF00;P24043	.;LAMA2_HUMAN	F	1068	ENSP00000400365:L1068F	ENSP00000346769:L1068F	L	+	3	2	LAMA2	129675728	0.755000	0.28372	0.998000	0.56505	0.974000	0.67602	-0.130000	0.10498	0.858000	0.35431	-0.127000	0.14921	TTG	-	LAMA2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin		0.388	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	0	0	0	67	67	77	0.00	0.00	G			129634035	+1	29	11	113	107	tier1	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	20.42	9.32	SNP	0.978	T	29	113
POMZP3	22932	genome.wustl.edu	37	7	76256109	76256110	+	5'UTR	INS	-	-	GCGGTGTGGAGC			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr7:76256109_76256110insGCGGTGTGGAGC	ENST00000310842.4	-	0	448_449				UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000419923.2_Intron|POMZP3_ENST00000275569.4_5'UTR	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion											kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				CGGCGGGGAGGGCGGTGTGGAg	0.743													ENSG00000205485																																					0																																										SO:0001623	5_prime_UTR_variant	0				U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.-237->GCTCCACACCGC	7.37:g.76256109_76256110insGCGGTGTGGAGC			F6STJ3|Q12903|Q9BWB4	R	INS	-	NULL	ENST00000310842.4	37	NULL	CCDS43606.1	7																																																																																				AC004980.7	-	-		0.743	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133091	Clone_based_vega_gene	protein_coding	OTTHUMT00000341775.1	0	0	0	5	5	5	0.00	0.00	-	NM_012230		76256110	+1	0	0	5	5	tier1	no_errors	ENST00000418663	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.011:0.010	GCGGTGTGGAGC	0	5
STX16	8675	genome.wustl.edu	37	20	57244444	57244444	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr20:57244444C>G	ENST00000371141.4	+	5	1215	c.491C>G	c.(490-492)tCg>tGg	p.S164W	STX16_ENST00000361830.3_Missense_Mutation_p.S164W|STX16_ENST00000359617.4_Missense_Mutation_p.S111W|STX16_ENST00000355957.5_Missense_Mutation_p.S147W|STX16_ENST00000358029.4_Missense_Mutation_p.S160W|STX16_ENST00000371132.4_Missense_Mutation_p.S143W|STX16_ENST00000496003.1_Intron|STX16_ENST00000361770.5_Missense_Mutation_p.S147W|STX16-NPEPL1_ENST00000530122.1_Missense_Mutation_p.S164W	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	164					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			GTGGTGGCCTCGCTGGCGCAG	0.677													ENSG00000254995																																					0													16.0	19.0	18.0					20																	57244444		2195	4286	6481	SO:0001583	missense	0			-	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.491C>G	20.37:g.57244444C>G	ENSP00000360183:p.Ser164Trp		A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Missense_Mutation	SNP	pfam_T_SRE_dom,pfam_Syntaxin_N,superfamily_t-SRE,smart_T_SRE_dom,pfscan_T_SRE_dom	p.S164W	ENST00000371141.4	37	c.491	CCDS13468.1	20	.	.	.	.	.	.	.	.	.	.	C	34	5.304822	0.95601	.	.	ENSG00000124222	ENST00000458280;ENST00000355957;ENST00000361770;ENST00000312283;ENST00000412911;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000438253	T;T;T;T;T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19	5.87	5.87	0.94306	t-SNARE (1);Syntaxin, N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.56934	0.2019	M	0.91818	3.245	0.80722	D	1	D;D;D;D	0.67145	0.987;0.992;0.996;0.995	D;P;D;D	0.69479	0.936;0.834;0.964;0.958	T	0.65055	-0.6261	10	0.72032	D	0.01	.	19.1915	0.93669	0.0:1.0:0.0:0.0	.	160;147;143;164	Q6GMS8;O14662-4;O14662-2;O14662	.;.;.;STX16_HUMAN	W	111;147;147;111;111;111;164;111;143;160;164;106	ENSP00000388348:S111W;ENSP00000348229:S147W;ENSP00000355408:S147W;ENSP00000312086:S111W;ENSP00000416852:S111W;ENSP00000352634:S111W;ENSP00000360183:S164W;ENSP00000360173:S143W;ENSP00000350723:S160W;ENSP00000354445:S164W;ENSP00000401801:S106W	ENSP00000360180:S111W	S	+	2	0	STX16	56677850	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	4.552000	0.60747	2.779000	0.95612	0.655000	0.94253	TCG	-	STX16-NPEPL1	-	pfam_Syntaxin_N,superfamily_t-SRE		0.677	STX16-002	KNOWN	basic|CCDS	protein_coding	STX16-NPEPL1	HGNC	protein_coding	OTTHUMT00000080517.2	0	0	0	105	105	8	0.00	0.00	C	NM_001001433		57244444	+1	41	0	91	5	tier1	no_errors	ENST00000530122	ensembl	human	known	74_37	missense	31.06	0.00	SNP	1.000	G	41	91
DNM1P47	100216544	genome.wustl.edu	37	15	102294455	102294455	+	RNA	SNP	A	A	C			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr15:102294455A>C	ENST00000561463.1	+	0	2501									DNM1 pseudogene 47																		TCGGCAGAGCAGGCACAGCGG	0.587													ENSG00000259660																																					0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294455A>C				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	1	1	0	117	117	0	0.84	0.00	A	NG_009149		102294455	+1	9	0	73	0	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	10.98	0.00	SNP	1.000	C	9	73
FBXL16	146330	genome.wustl.edu	37	16	747263	747265	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	TGG	TGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr16:747263_747265delTGG	ENST00000397621.1	-	2	472_474	c.141_143delCCA	c.(139-144)tgccag>tgg	p.47_48CQ>W	FBXL16_ENST00000324361.5_In_Frame_Del_p.47_48CQ>W|FBXL16_ENST00000562563.1_5'Flank|FBXL16_ENST00000562585.1_5'Flank	NM_153350.3	NP_699181.2	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	47	Pro-rich.									endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)	10		Hepatocellular(780;0.0218)				GGGTGGTGGCTGGCAGGGGCGGT	0.729													ENSG00000127585																																					0																																										SO:0001651	inframe_deletion	0				BC036680	CCDS10421.1	16p13.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000127585	ENSG00000127585		"""F-boxes / Leucine-rich repeats"""	14150	protein-coding gene	gene with protein product		609082	"""chromosome 16 open reading frame 22"""	C16orf22		11157797	Standard	NM_153350		Approved	MGC33974, Fbl16	uc021taa.1	Q8N461	OTTHUMG00000090420	ENST00000397621.1:c.141_143delCCA	16.37:g.747263_747265delTGG	ENSP00000380746:p.Cys47_Gln48delinsTrp		B3KR59|D3DU60|Q2MHR2|Q96S14|Q9UJI0	In_Frame_Del	DEL	superfamily_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp	p.CQ47in_frame_delW	ENST00000397621.1	37	c.143_141	CCDS10421.1	16																																																																																				FBXL16	-	NULL		0.729	FBXL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL16	HGNC	protein_coding	OTTHUMT00000206851.2	0	0	0	8	8	2	0.00	0.00	TGG	NM_153350		747265	-1	3	0	6	2	tier1	no_errors	ENST00000324361	ensembl	human	known	74_37	in_frame_del	33.33	0.00	DEL	1.000:1.000:1.000	-	3	6
LINC00200	399706	genome.wustl.edu	37	10	1205708	1205708	+	lincRNA	SNP	G	G	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr10:1205708G>A	ENST00000425630.1	+	0	1					NR_015376.2				long intergenic non-protein coding RNA 200																		AGGCCTGAGCGTCGCACGCTT	0.672													ENSG00000229205																																					0																																												0			-	AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1205708G>A				R	SNP	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			-	LINC00200	-	-		0.672	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	HGNC	lincRNA	OTTHUMT00000046417.2	0	0	0	41	41	0	0.00	0.00	G	NR_015376		1205708	+1	4	0	20	0	tier1	no_errors	ENST00000425630	ensembl	human	known	74_37	rna	16.67	0.00	SNP	0.003	A	4	20
PCDHB3	56132	genome.wustl.edu	37	5	140482079	140482079	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2T-01A-11D-A387-09	TCGA-DX-AB2T-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	38c27e85-9f63-432f-9f40-f13eb3b26250	134d8858-9c2e-406f-8d0c-2fc7433f4cb5	g.chr5:140482079G>A	ENST00000231130.2	+	1	1846	c.1846G>A	c.(1846-1848)Ggc>Agc	p.G616S	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	616	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGGCTGTTCGGCGTGTGGGC	0.687													ENSG00000113205																																					0													26.0	28.0	27.0					5																	140482079		2076	4062	6138	SO:0001583	missense	0			-	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1846G>A	5.37:g.140482079G>A	ENSP00000231130:p.Gly616Ser		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G616S	ENST00000231130.2	37	c.1846	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	G	3.261	-0.151272	0.06585	.	.	ENSG00000113205	ENST00000231130	T	0.48201	0.82	4.38	-3.96	0.04106	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.08626	0.0214	N	0.00095	-2.16	0.24424	N	0.99461	B	0.17038	0.02	B	0.17098	0.017	T	0.41215	-0.9521	9	0.02654	T	1	.	8.1319	0.31033	0.6547:0.233:0.1123:0.0	.	616	Q9Y5E6	PCDB3_HUMAN	S	616	ENSP00000231130:G616S	ENSP00000231130:G616S	G	+	1	0	PCDHB3	140462263	0.000000	0.05858	0.994000	0.49952	0.984000	0.73092	-2.316000	0.01123	-0.517000	0.06461	-0.378000	0.06908	GGC	-	PCDHB3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.687	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	0	0	0	215	215	0	0.00	0.00	G	NM_018937		140482079	+1	32	0	160	0	tier1	no_errors	ENST00000231130	ensembl	human	known	74_37	missense	16.67	0.00	SNP	0.778	A	32	160
