#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TBC1D1	23216	genome.wustl.edu	37	4	37904119	37904119	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr4:37904119G>A	ENST00000261439.4	+	2	758	c.403G>A	c.(403-405)Gat>Aat	p.D135N	TBC1D1_ENST00000402522.1_Missense_Mutation_p.D135N|TBC1D1_ENST00000508802.1_Missense_Mutation_p.D135N	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	135					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						GTTCAAAGCCGATGATCAAAC	0.408													ENSG00000065882																																					0													49.0	52.0	51.0					4																	37904119		2203	4300	6503	SO:0001583	missense	0			-	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.403G>A	4.37:g.37904119G>A	ENSP00000261439:p.Asp135Asn		B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.D135N	ENST00000261439.4	37	c.403	CCDS33972.1	4	.	.	.	.	.	.	.	.	.	.	G	13.18	2.161329	0.38119	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000402522	T;T;T	0.14640	2.49;2.49;2.49	5.96	5.96	0.96718	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	0.000000	0.50627	D	0.000110	T	0.12902	0.0313	L	0.29908	0.895	0.32750	N	0.506501	D;B	0.58970	0.984;0.02	B;B	0.42495	0.389;0.007	T	0.08659	-1.0711	10	0.14252	T	0.57	-28.3396	20.0044	0.97430	0.0:0.0:1.0:0.0	.	135;135	E9PGH8;Q86TI0	.;TBCD1_HUMAN	N	135	ENSP00000423651:D135N;ENSP00000261439:D135N;ENSP00000383994:D135N	ENSP00000261439:D135N	D	+	1	0	TBC1D1	37580514	0.419000	0.25449	0.677000	0.29947	0.822000	0.46500	1.879000	0.39618	2.830000	0.97506	0.585000	0.79938	GAT	-	TBC1D1	-	smart_PTB/PI_dom		0.408	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	0	0	0	28	28	121	0.00	0.00	G	NM_015173		37904119	+1	5	20	28	57	tier1	no_errors	ENST00000261439	ensembl	human	known	74_37	missense	14.71	25.97	SNP	0.972	A	5	28
C7orf31	136895	genome.wustl.edu	37	7	25191226	25191226	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr7:25191226C>A	ENST00000409280.1	-	7	981	c.673G>T	c.(673-675)Gta>Tta	p.V225L	C7orf31_ENST00000283905.3_Missense_Mutation_p.V225L			Q8N865	CG031_HUMAN	chromosome 7 open reading frame 31	225										autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	14						TCATAATATACACCTTGACCT	0.318													ENSG00000153790																																					0													82.0	81.0	81.0					7																	25191226		2203	4300	6503	SO:0001583	missense	0			-	AK097248	CCDS5394.1	7p15.2	2011-11-24			ENSG00000153790	ENSG00000153790			21722	protein-coding gene	gene with protein product							Standard	NM_138811		Approved		uc003sxn.1	Q8N865	OTTHUMG00000128497	ENST00000409280.1:c.673G>T	7.37:g.25191226C>A	ENSP00000386604:p.Val225Leu		A4D165|Q6MZV8|Q6P989|Q7LE28|Q86XK1|Q8N1H5|Q96BN4	Missense_Mutation	SNP	NULL	p.V225L	ENST00000409280.1	37	c.673	CCDS5394.1	7	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763411	0.49574	.	.	ENSG00000153790	ENST00000409280;ENST00000283905	T;T	0.09630	2.96;2.96	4.63	3.74	0.42951	.	0.441170	0.20097	N	0.099307	T	0.09598	0.0236	L	0.38838	1.175	0.09310	N	0.999999	P	0.45715	0.865	P	0.45310	0.476	T	0.12993	-1.0526	10	0.09084	T	0.74	-7.2335	10.0934	0.42460	0.0:0.9004:0.0:0.0996	.	225	Q8N865	CG031_HUMAN	L	225	ENSP00000386604:V225L;ENSP00000283905:V225L	ENSP00000283905:V225L	V	-	1	0	C7orf31	25157751	0.105000	0.21958	0.752000	0.31206	0.955000	0.61496	0.722000	0.25925	2.515000	0.84797	0.563000	0.77884	GTA	-	C7orf31	-	NULL		0.318	C7orf31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C7orf31	HGNC	protein_coding	OTTHUMT00000326929.1	0	0	0	214	214	86	0.00	0.00	C	NM_138811		25191226	-1	34	15	280	97	tier1	no_errors	ENST00000283905	ensembl	human	known	74_37	missense	10.83	13.39	SNP	0.241	A	34	280
UBBP4	23666	genome.wustl.edu	37	17	21731081	21731081	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr17:21731081A>G	ENST00000578713.1	+	1	387	c.383A>G	c.(382-384)gAt>gGt	p.D128G	UBBP4_ENST00000584755.1_Missense_Mutation_p.D128G|UBBP4_ENST00000583708.1_3'UTR|UBBP4_ENST00000584398.1_3'UTR					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						CAGCTGGAAGATGGCCGCAGT	0.537													ENSG00000263563																																					0																																										SO:0001583	missense	0			-	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.383A>G	17.37:g.21731081A>G	ENSP00000464265:p.Asp128Gly			Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.D128G	ENST00000578713.1	37	c.383		17																																																																																			-	UBBP4	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin		0.537	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	UBBP4	HGNC	protein_coding	OTTHUMT00000444589.2	0	0	0	177	177	45	0.00	0.00	A			21731081	+1	29	7	143	27	tier1	no_errors	ENST00000578713	ensembl	human	putative	74_37	missense	16.86	20.59	SNP	1.000	G	29	143
RYR3	6263	genome.wustl.edu	37	15	34060884	34060884	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr15:34060884G>A	ENST00000389232.4	+	61	8801	c.8731G>A	c.(8731-8733)Gtt>Att	p.V2911I	RYR3_ENST00000415757.3_Missense_Mutation_p.V2911I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2911					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGCCGCTCTCGTTAGACACAG	0.443													ENSG00000198838																																					0													176.0	173.0	174.0					15																	34060884		1962	4158	6120	SO:0001583	missense	0			-		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8731G>A	15.37:g.34060884G>A	ENSP00000373884:p.Val2911Ile		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.V2911I	ENST00000389232.4	37	c.8731	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687548	0.88639	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96651	-4.08;-4.08	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.95758	0.8620	L	0.39397	1.21	0.80722	D	1	D;P	0.56746	0.977;0.935	P;B	0.51701	0.677;0.252	D	0.94855	0.8017	10	0.39692	T	0.17	.	19.3941	0.94598	0.0:0.0:1.0:0.0	.	2911;2911	Q15413-2;Q15413	.;RYR3_HUMAN	I	2911	ENSP00000373884:V2911I;ENSP00000399610:V2911I	ENSP00000354735:V2911I	V	+	1	0	RYR3	31848176	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.601000	0.98297	2.885000	0.99019	0.655000	0.94253	GTT	-	RYR3	-	superfamily_ARM-type_fold		0.443	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	0	0	0	94	94	134	0.00	0.00	G			34060884	+1	27	8	70	62	tier1	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	27.84	11.43	SNP	1.000	A	27	70
MACROD2	140733	genome.wustl.edu	37	20	15866410	15866410	+	Splice_Site	SNP	C	C	T	rs374819973	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr20:15866410C>T	ENST00000310348.4	+	10	729	c.729C>T	c.(727-729)gaC>gaT	p.D243D	MACROD2_ENST00000402914.1_Splice_Site_p.D8D|MACROD2_ENST00000217246.4_Splice_Site_p.D243D|MACROD2_ENST00000378058.3_Splice_Site_p.D8D			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	243					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.D243D(2)|p.D8D(2)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				TTTTAACAGACGATAATAATG	0.289													ENSG00000172264	C|||	2	0.000399361	0.0015	0.0	5008	,	,		15253	0.0		0.0	False		,,,				2504	0.0																4	Substitution - coding silent(4)	large_intestine(4)						C	,	2,4392	4.2+/-10.8	0,2,2195	71.0	85.0	80.0		24,729	4.2	1.0	20		80	0,8578		0,0,4289	no	coding-synonymous-near-splice,coding-synonymous-near-splice	MACROD2	NM_001033087.1,NM_080676.5	,	0,2,6484	TT,TC,CC		0.0,0.0455,0.0154	,	8/214,243/426	15866410	2,12970	2197	4289	6486	SO:0001630	splice_region_variant	0			-	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.728-1C>T	20.37:g.15866410C>T			A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Silent	SNP	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom	p.D243	ENST00000310348.4	37	c.729	CCDS13120.2	20																																																																																			-	MACROD2	-	NULL		0.289	MACROD2-201	KNOWN	basic|CCDS	protein_coding	MACROD2	HGNC	protein_coding		0	0	0	104	104	77	0.00	0.00	C	NM_080676	Silent	15866410	+1	50	21	120	53	tier1	no_errors	ENST00000310348	ensembl	human	known	74_37	silent	29.41	28.38	SNP	1.000	T	50	120
EGFL6	25975	genome.wustl.edu	37	X	13626473	13626473	+	Missense_Mutation	SNP	C	C	T	rs199623111		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chrX:13626473C>T	ENST00000361306.1	+	7	943	c.686C>T	c.(685-687)aCg>aTg	p.T229M	EGFL6_ENST00000380602.3_Missense_Mutation_p.T229M	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	229	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						GATAGCCATACGTGCAGCCAC	0.428													ENSG00000198759																																					0								C	MET/THR,MET/THR	0,3835		0,0,1632,571	191.0	153.0	166.0		686,686	2.0	0.0	X		166	1,6727		0,1,2427,1872	yes	missense,missense	EGFL6	NM_015507.3,NM_001167890.1	81,81	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	benign,benign	229/554,229/555	13626473	1,10562	2203	4300	6503	SO:0001583	missense	0			-	AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.686C>T	X.37:g.13626473C>T	ENSP00000355126:p.Thr229Met		B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Missense_Mutation	SNP	pfam_MAM_dom,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_MAM_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.T229M	ENST00000361306.1	37	c.686	CCDS14155.1	X	.	.	.	.	.	.	.	.	.	.	C	4.605	0.112444	0.08831	0.0	1.49E-4	ENSG00000198759	ENST00000361306;ENST00000380602	D;D	0.87809	-2.3;-2.3	5.18	2.01	0.26516	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.556047	0.20686	N	0.087549	T	0.69468	0.3114	N	0.17564	0.495	0.09310	N	0.999998	B;B	0.31655	0.281;0.334	B;B	0.24541	0.039;0.054	T	0.59830	-0.7380	10	0.45353	T	0.12	.	1.0998	0.01681	0.4205:0.2624:0.1258:0.1913	.	229;229	Q8IUX8-2;Q8IUX8	.;EGFL6_HUMAN	M	229	ENSP00000355126:T229M;ENSP00000369976:T229M	ENSP00000355126:T229M	T	+	2	0	EGFL6	13536394	0.784000	0.28713	0.006000	0.13384	0.035000	0.12851	1.407000	0.34657	0.382000	0.24878	-0.230000	0.12252	ACG	rs199623111	EGFL6	-	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.428	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EGFL6	HGNC	protein_coding	OTTHUMT00000055800.1	0	0	0	98	98	36	0.00	0.00	C	NM_015507		13626473	+1	32	16	181	44	tier1	no_errors	ENST00000380602	ensembl	human	known	74_37	missense	15.02	26.67	SNP	0.461	T	32	181
EFR3A	23167	genome.wustl.edu	37	8	132957003	132957003	+	Silent	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr8:132957003G>A	ENST00000254624.5	+	3	324	c.99G>A	c.(97-99)gtG>gtA	p.V33V	EFR3A_ENST00000519656.1_5'UTR|EFR3A_ENST00000334503.4_Silent_p.V33V	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	33						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ATGGCCTTGTGAAAACTGATA	0.348													ENSG00000132294																																					0													71.0	69.0	70.0					8																	132957003		2202	4299	6501	SO:0001819	synonymous_variant	0			-	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.99G>A	8.37:g.132957003G>A			A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	superfamily_ARM-type_fold	p.V33	ENST00000254624.5	37	c.99	CCDS34942.2	8																																																																																			-	EFR3A	-	NULL		0.348	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	0	0	0	245	245	76	0.00	0.00	G	NM_015137		132957003	+1	63	15	240	80	tier1	no_errors	ENST00000254624	ensembl	human	known	74_37	silent	20.79	15.79	SNP	0.999	A	63	240
PSORS1C1	170679	genome.wustl.edu	37	6	31084477	31084477	+	Intron	SNP	A	A	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr6:31084477A>T	ENST00000259881.9	+	1	61				CDSN_ENST00000376288.2_Missense_Mutation_p.S305R|PSORS1C1_ENST00000467107.1_3'UTR	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1											kidney(1)|ovary(2)|prostate(1)|skin(1)	5						GAACCAGATAACTGTCAGAGG	0.542													ENSG00000204539																																					0													35.0	34.0	34.0					6																	31084477		1962	3952	5914	SO:0001627	intron_variant	0			-	AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+1809A>T	6.37:g.31084477A>T			B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	NULL	p.S305R	ENST00000259881.9	37	c.915	CCDS34390.1	6	.	.	.	.	.	.	.	.	.	.	A	16.67	3.188729	0.57909	.	.	ENSG00000204539	ENST00000376288	T	0.08896	3.04	4.76	-3.64	0.04515	.	0.318664	0.27155	N	0.020668	T	0.03095	0.0091	L	0.34521	1.04	0.21386	N	0.999702	P	0.48016	0.904	P	0.47573	0.55	T	0.31336	-0.9947	10	0.66056	D	0.02	-5.9144	10.7298	0.46089	0.421:0.0:0.579:0.0	.	305	Q15517	CDSN_HUMAN	R	305	ENSP00000365465:S305R	ENSP00000365465:S305R	S	-	3	2	CDSN	31192456	0.017000	0.18338	0.321000	0.25320	0.890000	0.51754	-0.199000	0.09491	-0.723000	0.04915	-0.463000	0.05309	AGT	-	CDSN	-	NULL		0.542	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDSN	HGNC	protein_coding	OTTHUMT00000076110.3	0	0	0	44	44	101	0.00	0.00	A	NM_014068		31084477	-1	8	12	31	36	tier1	no_errors	ENST00000376288	ensembl	human	known	74_37	missense	20.51	25.00	SNP	0.412	T	8	31
ZNF17	7565	genome.wustl.edu	37	19	57924999	57924999	+	Intron	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:57924999G>A	ENST00000601808.1	+	1	228				AC004076.7_ENST00000597410.1_Intron|AC003002.6_ENST00000596400.1_Intron|ZNF17_ENST00000595206.1_3'UTR|ZNF17_ENST00000307658.7_Missense_Mutation_p.G6R	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		TATGGATGCTGGACAGGTGAG	0.493													ENSG00000186272																									Melanoma(149;1637 1853 29914 42869 44988)												0																																										SO:0001627	intron_variant	0			-	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.15+2225G>A	19.37:g.57924999G>A			B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G6R	ENST00000601808.1	37	c.16	CCDS42636.1	19																																																																																			-	ZNF17	-	superfamily_Krueppel-associated_box		0.493	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF17	HGNC	protein_coding	OTTHUMT00000466384.1	1	1	0	107	107	105	0.93	0.00	G	NM_006959		57924999	+1	18	19	129	121	tier1	no_errors	ENST00000307658	ensembl	human	putative	74_37	missense	12.24	13.48	SNP	0.001	A	18	129
CD1A	909	genome.wustl.edu	37	1	158226589	158226589	+	Silent	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr1:158226589C>T	ENST00000289429.5	+	4	1151	c.618C>T	c.(616-618)gcC>gcT	p.A206A		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	206	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	AGCCCGAGGCCTGGCTGTCCC	0.507													ENSG00000158477																																					0													65.0	66.0	65.0					1																	158226589		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.618C>T	1.37:g.158226589C>T			D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Silent	SNP	pfam_Ig_C1-set,pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A206	ENST00000289429.5	37	c.618	CCDS1174.1	1																																																																																			-	CD1A	-	pfscan_Ig-like_dom		0.507	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1A	HGNC	protein_coding	OTTHUMT00000046349.2	0	0	0	101	101	56	0.00	0.00	C	NM_001763		158226589	+1	16	12	56	33	tier1	no_errors	ENST00000289429	ensembl	human	known	74_37	silent	22.22	26.67	SNP	0.984	T	16	56
SLC9A7P1	121456	genome.wustl.edu	37	12	98848980	98848980	+	RNA	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr12:98848980C>A	ENST00000554295.1	-	0	1943					NR_033801.1				solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 pseudogene 1																		TGGCGGGGAGCCGCTTTGTCT	0.612													ENSG00000227825																																					0																																												0			-			12q23.1	2013-05-22	2012-03-22		ENSG00000227825	ENSG00000227825		"""Solute carriers"""	32679	pseudogene	pseudogene			"""solute carrier family 9 (sodium/hydrogen exchanger), member 7 pseudogene 1"""				Standard	NR_033801		Approved		uc009ztm.2		OTTHUMG00000170629		12.37:g.98848980C>A				R	SNP	-	NULL	ENST00000554295.1	37	NULL		12																																																																																			-	SLC9A7P1	-	-		0.612	SLC9A7P1-002	PUTATIVE	basic	processed_transcript	SLC9A7P1	HGNC	pseudogene	OTTHUMT00000409869.1	0	0	0	43	43	65	0.00	0.00	C			98848980	-1	30	34	36	31	tier1	no_errors	ENST00000554295	ensembl	human	putative	74_37	rna	45.45	52.31	SNP	0.538	A	30	36
LAMA2	3908	genome.wustl.edu	37	6	129380936	129380936	+	Silent	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr6:129380936C>T	ENST00000421865.2	+	3	340	c.291C>T	c.(289-291)caC>caT	p.H97H		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	97	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TAGAGAGACACCCGATTACAA	0.328													ENSG00000196569																																					0													97.0	90.0	92.0					6																	129380936		2203	4300	6503	SO:0001819	synonymous_variant	0			-	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.291C>T	6.37:g.129380936C>T			Q14736|Q5VUM2|Q93022	Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SRE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.H97	ENST00000421865.2	37	c.291	CCDS5138.1	6																																																																																			-	LAMA2	-	pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,pfscan_Laminin_N		0.328	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	0	0	0	120	120	84	0.00	0.00	C			129380936	+1	23	11	93	30	tier1	no_errors	ENST00000421865	ensembl	human	known	74_37	silent	19.83	26.83	SNP	1.000	T	23	93
ANO5	203859	genome.wustl.edu	37	11	22283767	22283767	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr11:22283767G>A	ENST00000324559.8	+	16	2040	c.1723G>A	c.(1723-1725)Gta>Ata	p.V575I	CTD-3064C13.1_ENST00000526935.1_RNA	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	575					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTGCTTCTACGTAGCTTTCTT	0.363													ENSG00000171714																																					0													148.0	144.0	146.0					11																	22283767		2203	4300	6503	SO:0001583	missense	0			-	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.1723G>A	11.37:g.22283767G>A	ENSP00000315371:p.Val575Ile			Missense_Mutation	SNP	pfam_Anoctamin	p.V575I	ENST00000324559.8	37	c.1723	CCDS31444.1	11	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963749	0.53507	.	.	ENSG00000171714	ENST00000324559	T	0.57273	0.41	6.04	4.15	0.48705	.	0.051383	0.85682	N	0.000000	T	0.47340	0.1440	N	0.26130	0.795	0.58432	D	0.999991	D	0.69078	0.997	P	0.57720	0.826	T	0.46205	-0.9208	10	0.02654	T	1	.	11.2044	0.48760	0.0655:0.0:0.8056:0.1289	.	575	Q75V66	ANO5_HUMAN	I	575	ENSP00000315371:V575I	ENSP00000315371:V575I	V	+	1	0	ANO5	22240343	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	4.210000	0.58500	0.862000	0.35528	0.561000	0.74099	GTA	-	ANO5	-	pfam_Anoctamin		0.363	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO5	HGNC	protein_coding	OTTHUMT00000387615.1	0	0	0	191	191	116	0.00	0.00	G	NM_213599		22283767	+1	36	8	145	46	tier1	no_errors	ENST00000324559	ensembl	human	known	74_37	missense	19.89	14.55	SNP	1.000	A	36	145
DENND2A	27147	genome.wustl.edu	37	7	140301490	140301490	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr7:140301490T>A	ENST00000275884.6	-	2	1125	c.708A>T	c.(706-708)aaA>aaT	p.K236N	DENND2A_ENST00000492720.1_Missense_Mutation_p.K236N|DENND2A_ENST00000537639.1_Missense_Mutation_p.K236N|DENND2A_ENST00000496613.1_Missense_Mutation_p.K236N			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	236					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TGCATGAACCTTTCCTGTCCT	0.622													ENSG00000146966																																					0													101.0	102.0	101.0					7																	140301490		1891	4106	5997	SO:0001583	missense	0			-	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.708A>T	7.37:g.140301490T>A	ENSP00000275884:p.Lys236Asn		C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.K236N	ENST00000275884.6	37	c.708	CCDS43659.1	7	.	.	.	.	.	.	.	.	.	.	T	2.074	-0.412429	0.04799	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	T;T;T;T	0.10668	3.57;3.57;3.57;2.85	3.97	0.192	0.15134	.	3.456300	0.00582	N	0.000329	T	0.12944	0.0314	L	0.47716	1.5	0.09310	N	1	P;P	0.39665	0.682;0.462	B;B	0.39531	0.302;0.258	T	0.30592	-0.9973	10	0.33141	T	0.24	-4.2042	7.9637	0.30087	0.0:0.2496:0.0:0.7504	.	236;236	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	N	236	ENSP00000275884:K236N;ENSP00000442245:K236N;ENSP00000419654:K236N;ENSP00000419464:K236N	ENSP00000275884:K236N	K	-	3	2	DENND2A	139947959	0.895000	0.30542	0.016000	0.15963	0.110000	0.19582	0.982000	0.29539	-0.121000	0.11787	0.379000	0.24179	AAA	-	DENND2A	-	NULL		0.622	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	HGNC	protein_coding	OTTHUMT00000348742.1	0	0	0	56	56	66	0.00	0.00	T	NM_015689		140301490	-1	11	11	62	57	tier1	no_errors	ENST00000275884	ensembl	human	known	74_37	missense	15.07	16.18	SNP	0.036	A	11	62
UGT3A2	167127	genome.wustl.edu	37	5	36049323	36049323	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr5:36049323C>T	ENST00000282507.3	-	4	612	c.511G>A	c.(511-513)Ggc>Agc	p.G171S	UGT3A2_ENST00000504954.1_Intron|UGT3A2_ENST00000545528.1_Intron|UGT3A2_ENST00000513300.1_Missense_Mutation_p.G137S	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	171					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCCAAAGAGCCGAATGAAGTG	0.453													ENSG00000168671																																					0													88.0	82.0	84.0					5																	36049323		2203	4300	6503	SO:0001583	missense	0			-		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.511G>A	5.37:g.36049323C>T	ENSP00000282507:p.Gly171Ser		B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.G171S	ENST00000282507.3	37	c.511	CCDS3914.1	5	.	.	.	.	.	.	.	.	.	.	C	9.757	1.169039	0.21621	.	.	ENSG00000168671	ENST00000282507;ENST00000513300	T;T	0.61040	0.14;0.14	3.03	1.19	0.21007	.	4.099320	0.01208	N	0.007777	T	0.48003	0.1476	L	0.31578	0.945	0.09310	N	1	B;B	0.15719	0.0;0.014	B;B	0.16722	0.001;0.016	T	0.34527	-0.9825	10	0.48119	T	0.1	.	7.0067	0.24840	0.0:0.675:0.0:0.325	.	137;171	E9PFK7;Q3SY77	.;UD3A2_HUMAN	S	171;137	ENSP00000282507:G171S;ENSP00000427404:G137S	ENSP00000282507:G171S	G	-	1	0	UGT3A2	36085080	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.231000	0.09069	0.300000	0.22699	-0.137000	0.14449	GGC	-	UGT3A2	-	pfam_UDP_glucos_trans		0.453	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A2	HGNC	protein_coding	OTTHUMT00000253771.2	0	0	0	173	173	109	0.00	0.00	C	NM_174914		36049323	-1	61	23	178	115	tier1	no_errors	ENST00000282507	ensembl	human	known	74_37	missense	25.52	16.55	SNP	0.001	T	61	178
MUC17	140453	genome.wustl.edu	37	7	100675057	100675057	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr7:100675057A>T	ENST00000306151.4	+	3	424	c.360A>T	c.(358-360)gaA>gaT	p.E120D		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	120	Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACTTCAGAATCTACCAGTG	0.502													ENSG00000169876																																					0													148.0	138.0	141.0					7																	100675057		2203	4300	6503	SO:0001583	missense	0			-	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.360A>T	7.37:g.100675057A>T	ENSP00000302716:p.Glu120Asp		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.E120D	ENST00000306151.4	37	c.360	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	A	5.203	0.222892	0.09863	.	.	ENSG00000169876	ENST00000306151	T	0.02552	4.25	0.678	0.678	0.17969	.	.	.	.	.	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	P	0.51933	0.949	B	0.34138	0.176	T	0.47959	-0.9076	8	0.12766	T	0.61	.	.	.	.	.	120	Q685J3	MUC17_HUMAN	D	120	ENSP00000302716:E120D	ENSP00000302716:E120D	E	+	3	2	MUC17	100461777	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-2.806000	0.00758	0.554000	0.29061	0.333000	0.21579	GAA	-	MUC17	-	NULL		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	0	0	0	80	80	146	0.00	0.00	A	NM_001040105		100675057	+1	25	21	101	132	tier1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	19.84	13.64	SNP	0.015	T	25	101
C1QTNF2	114898	genome.wustl.edu	37	5	159776711	159776711	+	Missense_Mutation	SNP	G	G	A	rs554501129		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr5:159776711G>A	ENST00000393975.3	-	3	460	c.457C>T	c.(457-459)Cgt>Tgt	p.R153C		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	108	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTGGGGCCACGGGGGCCAGCC	0.687													ENSG00000145861	G|||	1	0.000199681	0.0	0.0	5008	,	,		17246	0.001		0.0	False		,,,				2504	0.0																0													33.0	39.0	37.0					5																	159776711		2200	4296	6496	SO:0001583	missense	0			-	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.457C>T	5.37:g.159776711G>A	ENSP00000377545:p.Arg153Cys			Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.R153C	ENST00000393975.3	37	c.457	CCDS4351.2	5	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767241	0.49574	.	.	ENSG00000145861	ENST00000393975	D	0.94330	-3.4	5.67	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.96595	0.8889	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96482	0.9357	10	0.56958	D	0.05	.	15.2343	0.73416	0.0:0.0:0.7799:0.2201	.	108	Q9BXJ5	C1QT2_HUMAN	C	153	ENSP00000377545:R153C	ENSP00000377545:R153C	R	-	1	0	C1QTNF2	159709289	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	3.388000	0.52509	2.687000	0.91594	0.543000	0.68304	CGT	-	C1QTNF2	-	pfam_Collagen		0.687	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF2	HGNC	protein_coding	OTTHUMT00000252672.2	0	0	0	72	72	21	0.00	0.00	G			159776711	-1	19	8	115	36	tier1	no_errors	ENST00000393975	ensembl	human	known	74_37	missense	14.18	18.18	SNP	0.973	A	19	115
E2F5	1875	genome.wustl.edu	37	8	86127289	86127289	+	IGR	SNP	T	T	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr8:86127289T>G	ENST00000416274.2	+	0	1728				C8orf59_ENST00000458398.2_Intron|E2F5_ENST00000519128.1_3'UTR|C8orf59_ENST00000431163.2_Intron|C8orf59_ENST00000421308.2_Intron|C8orf59_ENST00000524353.1_Intron|C8orf59_ENST00000417663.2_Intron|C8orf59_ENST00000518562.1_Intron|C8orf59_ENST00000518091.1_Intron	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding						gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						AAAAAAGCATTAATCTATGAT	0.254													ENSG00000133740																																					0													16.0	15.0	16.0					8																	86127289		1757	3988	5745	SO:0001628	intergenic_variant	0			-	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785		8.37:g.86127289T>G			E9PBN9|Q16601|Q92756	R	SNP	-	NULL	ENST00000416274.2	37	NULL	CCDS47885.1	8																																																																																			-	E2F5	-	-		0.254	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	E2F5	HGNC	protein_coding	OTTHUMT00000380274.1	0	0	0	65	65	56	0.00	0.00	T	NM_001951		86127289	+1	15	6	24	14	tier1	no_errors	ENST00000519128	ensembl	human	known	74_37	rna	38.46	30.00	SNP	0.159	G	15	24
NKX2-2	4821	genome.wustl.edu	37	20	21492156	21492156	+	3'UTR	SNP	G	G	A	rs541305592		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr20:21492156G>A	ENST00000377142.4	-	0	1583				NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2						astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						TGACAATATCGCTACTCACAC	0.363													ENSG00000258197																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.*405C>T	20.37:g.21492156G>A				R	SNP	-	NULL	ENST00000377142.4	37	NULL	CCDS13145.1	20																																																																																			-	NKX2-2-AS1	-	-		0.363	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-2-AS1	HGNC	protein_coding	OTTHUMT00000078278.9	0	0	0	153	153	85	0.00	0.00	G			21492156	+1	36	18	186	91	tier1	no_errors	ENST00000549659	ensembl	human	known	74_37	rna	16.22	16.51	SNP	0.999	A	36	186
SEZ6L	23544	genome.wustl.edu	37	22	26736438	26736438	+	Silent	SNP	C	C	T	rs138699202		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr22:26736438C>T	ENST00000248933.6	+	10	2147	c.2052C>T	c.(2050-2052)taC>taT	p.Y684Y	SEZ6L_ENST00000404234.3_Silent_p.Y684Y|SEZ6L_ENST00000343706.4_Silent_p.Y684Y|SEZ6L_ENST00000402979.1_Silent_p.Y457Y|SEZ6L_ENST00000360929.3_Silent_p.Y684Y|SEZ6L_ENST00000403121.1_Silent_p.Y457Y|SEZ6L_ENST00000529632.2_Silent_p.Y684Y			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	684	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						TGACCATCTACGATGGCGACG	0.517													ENSG00000100095																																					0								C	,,,,,	0,4406		0,0,2203	158.0	148.0	152.0		2052,2052,2052,2052,2052,2052	-5.5	0.2	22	dbSNP_134	152	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEZ6L	NM_001184773.1,NM_001184774.1,NM_001184775.1,NM_001184776.1,NM_001184777.1,NM_021115.4	,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,	684/1024,684/1014,684/1012,684/950,684/949,684/1025	26736438	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2052C>T	22.37:g.26736438C>T			A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.Y684	ENST00000248933.6	37	c.2052	CCDS13833.1	22																																																																																			rs138699202	SEZ6L	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.517	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	HGNC	protein_coding	OTTHUMT00000320359.3	0	0	0	95	95	69	0.00	0.00	C			26736438	+1	20	17	74	75	tier1	no_errors	ENST00000248933	ensembl	human	known	74_37	silent	21.28	18.48	SNP	0.111	T	20	74
TMEM163	81615	genome.wustl.edu	37	2	135470828	135470828	+	Silent	SNP	T	T	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr2:135470828T>A	ENST00000281924.6	-	2	328	c.264A>T	c.(262-264)gcA>gcT	p.A88A		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	88						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		ACACCCACAATGCCTTCTTCC	0.517													ENSG00000152128																																					0													231.0	189.0	203.0					2																	135470828		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.264A>T	2.37:g.135470828T>A			Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Silent	SNP	NULL	p.A88	ENST00000281924.6	37	c.264	CCDS2172.1	2																																																																																			-	TMEM163	-	NULL		0.517	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM163	HGNC	protein_coding	OTTHUMT00000254631.2	0	0	0	91	91	98	0.00	0.00	T	NM_030923		135470828	-1	7	11	75	65	tier1	no_errors	ENST00000281924	ensembl	human	known	74_37	silent	8.54	14.47	SNP	0.018	A	7	75
STXBP2	6813	genome.wustl.edu	37	19	7711208	7711208	+	Missense_Mutation	SNP	C	C	T	rs121918540		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:7711208C>T	ENST00000221283.5	+	16	1461	c.1430C>T	c.(1429-1431)cCg>cTg	p.P477L	STXBP2_ENST00000441779.2_Missense_Mutation_p.P488L|STXBP2_ENST00000602355.1_Missense_Mutation_p.P12L|STXBP2_ENST00000414284.2_Missense_Mutation_p.P474L	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	477			P -> L (in FHL5; leads to a complete loss of the ability to interact with STX11). {ECO:0000269|PubMed:19804848, ECO:0000269|PubMed:19884660}.		leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						CGCTGGACCCCGGTCATCAAG	0.677													ENSG00000076944																																					0													39.0	33.0	35.0					19																	7711208		2203	4299	6502	SO:0001583	missense	0			-	U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.1430C>T	19.37:g.7711208C>T	ENSP00000221283:p.Pro477Leu		B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.P477L	ENST00000221283.5	37	c.1430	CCDS12181.1	19	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768383	0.69878	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	D;D;D	0.90844	-2.74;-2.74;-2.74	4.61	3.55	0.40652	.	0.135295	0.50627	D	0.000114	D	0.93779	0.8011	M	0.71581	2.175	0.80722	A	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79784	0.988;0.993;0.979;0.988	D	0.95539	0.8610	9	0.87932	D	0	-4.2608	10.9897	0.47543	0.0:0.9045:0.0:0.0955	.	488;488;474;477	E7EQD5;B4E175;Q15833-2;Q15833	.;.;.;STXB2_HUMAN	L	477;474;488;477	ENSP00000221283:P477L;ENSP00000409471:P474L;ENSP00000413606:P488L	ENSP00000221283:P477L	P	+	2	0	STXBP2	7617208	1.000000	0.71417	0.845000	0.33349	0.435000	0.31806	5.558000	0.67319	2.143000	0.66587	0.555000	0.69702	CCG	rs121918540	STXBP2	-	pfam_Sec1-like,superfamily_Sec1-like		0.677	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP2	HGNC	protein_coding	OTTHUMT00000460963.1	0	0	0	170	170	56	0.00	0.00	C	NM_006949		7711208	+1	27	13	217	65	tier1	no_errors	ENST00000221283	ensembl	human	known	74_37	missense	11.07	16.67	SNP	0.993	T	27	217
SNTG2	54221	genome.wustl.edu	37	2	1204841	1204841	+	Missense_Mutation	SNP	G	G	A	rs202078642		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr2:1204841G>A	ENST00000308624.5	+	9	773	c.644G>A	c.(643-645)cGc>cAc	p.R215H	SNTG2_ENST00000467759.1_3'UTR|SNTG2_ENST00000407292.1_Missense_Mutation_p.R88H	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	215					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TATGAGAAGCGCTGGCTGGAC	0.547													ENSG00000172554																																					0								G	HIS/ARG	1,4067		0,1,2033	106.0	115.0	112.0		644	1.1	1.0	2		112	6,8372		0,6,4183	yes	missense	SNTG2	NM_018968.3	29	0,7,6216	AA,AG,GG		0.0716,0.0246,0.0562	benign	215/540	1204841	7,12439	2034	4189	6223	SO:0001583	missense	0			-	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.644G>A	2.37:g.1204841G>A	ENSP00000311837:p.Arg215His		Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R215H	ENST00000308624.5	37	c.644	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494833	0.44352	2.46E-4	7.16E-4	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.56776	0.44;0.44	4.03	1.13	0.20643	.	0.110925	0.64402	N	0.000006	T	0.39733	0.1089	L	0.42245	1.32	0.58432	D	0.999993	B;B	0.24651	0.108;0.066	B;B	0.17098	0.017;0.005	T	0.21280	-1.0250	10	0.49607	T	0.09	.	8.5974	0.33723	0.2654:0.0:0.7346:0.0	.	88;215	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	H	215;88	ENSP00000311837:R215H;ENSP00000385020:R88H	ENSP00000311837:R215H	R	+	2	0	SNTG2	1194841	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	2.845000	0.48254	0.282000	0.22254	-0.397000	0.06425	CGC	rs202078642	SNTG2	-	NULL		0.547	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	0	0	0	44	44	70	0.00	0.00	G	NM_018968		1204841	+1	11	10	39	35	tier1	no_errors	ENST00000308624	ensembl	human	known	74_37	missense	22.00	22.22	SNP	1.000	A	11	39
GRIN1	2902	genome.wustl.edu	37	9	140058109	140058109	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr9:140058109A>G	ENST00000371561.3	+	17	3529	c.2432A>G	c.(2431-2433)gAg>gGg	p.E811G	GRIN1_ENST00000315048.3_Missense_Mutation_p.E811G|GRIN1_ENST00000371555.4_Missense_Mutation_p.E832G|GRIN1_ENST00000371546.4_Missense_Mutation_p.E832G|GRIN1_ENST00000371550.4_Missense_Mutation_p.E811G|GRIN1_ENST00000371560.3_Missense_Mutation_p.E832G|GRIN1_ENST00000350902.5_Missense_Mutation_p.E811G|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371553.3_Missense_Mutation_p.E832G|GRIN1_ENST00000371559.4_Missense_Mutation_p.E811G	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	811					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTTACTTTTGAGAACATGGCC	0.602													ENSG00000176884																									NSCLC(113;717 1653 2089 20474 37618)												0													85.0	72.0	77.0					9																	140058109		2202	4300	6502	SO:0001583	missense	0			-		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.2432A>G	9.37:g.140058109A>G	ENSP00000360616:p.Glu811Gly		A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_CaM-bd_C0_NMDA_rcpt_NR1,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E811G	ENST00000371561.3	37	c.2432	CCDS7031.1	9	.	.	.	.	.	.	.	.	.	.	A	18.21	3.573783	0.65765	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	T;T;T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5	3.97	3.97	0.46021	Ionotropic glutamate receptor (1);	0.183710	0.47852	N	0.000208	T	0.49115	0.1538	L	0.33710	1.025	0.80722	D	1	B;B;B;B;B;B	0.31256	0.196;0.25;0.163;0.218;0.196;0.316	B;B;B;B;B;B	0.41894	0.212;0.351;0.135;0.135;0.212;0.369	T	0.55464	-0.8137	10	0.66056	D	0.02	.	12.1099	0.53834	1.0:0.0:0.0:0.0	.	832;832;811;811;811;811	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	G	811;811;811;811;832;832;832;811;832	ENSP00000360616:E811G;ENSP00000316696:E811G;ENSP00000316915:E811G;ENSP00000360605:E811G;ENSP00000360601:E832G;ENSP00000360610:E832G;ENSP00000360608:E832G;ENSP00000360614:E811G;ENSP00000360615:E832G	ENSP00000316696:E811G	E	+	2	0	GRIN1	139177930	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	3.095000	0.50235	1.804000	0.52760	0.379000	0.24179	GAG	-	GRIN1	-	pfam_Iontro_glu_rcpt		0.602	GRIN1-002	KNOWN	basic|CCDS	protein_coding	GRIN1	HGNC	protein_coding	OTTHUMT00000055267.3	0	0	0	73	73	107	0.00	0.00	A	NM_007327		140058109	+1	68	58	19	20	tier1	no_errors	ENST00000371561	ensembl	human	known	74_37	missense	78.16	73.42	SNP	1.000	G	68	19
CAPN11	11131	genome.wustl.edu	37	6	44137260	44137260	+	Missense_Mutation	SNP	C	C	T	rs545825579	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr6:44137260C>T	ENST00000398776.1	+	3	369	c.331C>T	c.(331-333)Cgg>Tgg	p.R111W	CAPN11_ENST00000542245.1_Missense_Mutation_p.R111W	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	111	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTCCTGGCAGCGGCCCAAGGT	0.547													ENSG00000137225	C|||	2	0.000399361	0.0	0.0	5008	,	,		18612	0.0		0.0	False		,,,				2504	0.002																0													15.0	17.0	17.0					6																	44137260		1891	4125	6016	SO:0001583	missense	0			-	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.331C>T	6.37:g.44137260C>T	ENSP00000381758:p.Arg111Trp		B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.R111W	ENST00000398776.1	37	c.331	CCDS47436.1	6	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555756	0.65425	.	.	ENSG00000137225	ENST00000398776;ENST00000542245;ENST00000532171	D;D;D	0.99239	-5.61;-5.61;-5.61	4.31	2.5	0.30297	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.43919	D	0.000514	D	0.99718	0.9891	H	0.99931	4.975	0.42463	D	0.992798	D	0.89917	1.0	D	0.97110	1.0	D	0.97450	1.0027	10	0.87932	D	0	.	12.0844	0.53690	0.4483:0.5517:0.0:0.0	.	111	Q9UMQ6	CAN11_HUMAN	W	111;111;141	ENSP00000381758:R111W;ENSP00000441078:R111W;ENSP00000432420:R141W	ENSP00000381758:R111W	R	+	1	2	CAPN11	44245238	1.000000	0.71417	0.999000	0.59377	0.894000	0.52154	1.162000	0.31786	0.740000	0.32651	0.650000	0.86243	CGG	-	CAPN11	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease		0.547	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPN11	HGNC	protein_coding	OTTHUMT00000040714.3	0	0	1	50	50	133	0.00	0.75	C			44137260	+1	38	77	17	30	tier1	no_errors	ENST00000398776	ensembl	human	known	74_37	missense	69.09	71.96	SNP	1.000	T	38	17
UNC45B	146862	genome.wustl.edu	37	17	33475325	33475325	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr17:33475325C>T	ENST00000268876.5	+	2	140	c.43C>T	c.(43-45)Cgg>Tgg	p.R15W	UNC45B_ENST00000433649.1_Missense_Mutation_p.R15W|UNC45B_ENST00000378449.1_Missense_Mutation_p.R15W|UNC45B_ENST00000591048.1_Missense_Mutation_p.R15W|UNC45B_ENST00000394570.2_Missense_Mutation_p.R15W	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	15					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				GGAAGGAAACCGGCATTTCCA	0.597													ENSG00000141161																																					0													79.0	72.0	74.0					17																	33475325		2203	4300	6503	SO:0001583	missense	0			-	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.43C>T	17.37:g.33475325C>T	ENSP00000268876:p.Arg15Trp		Q495Q8|Q495Q9	Missense_Mutation	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,smart_Armadillo,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R15W	ENST00000268876.5	37	c.43	CCDS11292.1	17	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555765	0.65425	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	4.79	1.32	0.21799	Elongated TPR repeat-containing domain (1);Tetratricopeptide repeat-containing (1);	0.899451	0.09560	N	0.785753	T	0.59211	0.2177	L	0.35542	1.07	0.25650	N	0.986108	B;P;B	0.40266	0.152;0.71;0.0	B;B;B	0.26864	0.074;0.035;0.001	T	0.50083	-0.8869	10	0.87932	D	0	-5.326	11.9547	0.52974	0.67:0.33:0.0:0.0	.	15;15;15	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	W	15	ENSP00000378071:R15W;ENSP00000268876:R15W;ENSP00000412840:R15W;ENSP00000367710:R15W	ENSP00000268876:R15W	R	+	1	2	UNC45B	30499438	0.001000	0.12720	0.403000	0.26384	0.900000	0.52787	0.858000	0.27845	0.574000	0.29417	0.551000	0.68910	CGG	-	UNC45B	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.597	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45B	HGNC	protein_coding	OTTHUMT00000256458.2	0	0	0	142	142	120	0.00	0.00	C	NM_173167		33475325	+1	22	35	97	79	tier1	no_errors	ENST00000268876	ensembl	human	known	74_37	missense	18.49	30.70	SNP	0.584	T	22	97
SYCP2	10388	genome.wustl.edu	37	20	58470515	58470515	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr20:58470515G>A	ENST00000357552.3	-	20	1867	c.1642C>T	c.(1642-1644)Cat>Tat	p.H548Y	SYCP2_ENST00000371001.2_Missense_Mutation_p.H548Y			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	548					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TCTCTTCTATGTCTTCCTTCT	0.323													ENSG00000196074																																					0													184.0	171.0	175.0					20																	58470515		2203	4300	6503	SO:0001583	missense	0			-	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1642C>T	20.37:g.58470515G>A	ENSP00000350162:p.His548Tyr		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.H548Y	ENST00000357552.3	37	c.1642	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	G	2.548	-0.304630	0.05495	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.17054	2.57;2.57;2.3	4.71	0.97	0.19692	.	1.413040	0.04063	N	0.306758	T	0.11750	0.0286	N	0.14661	0.345	0.09310	N	1	B	0.15930	0.015	B	0.22601	0.04	T	0.34750	-0.9816	10	0.52906	T	0.07	-0.1464	5.6449	0.17584	0.1601:0.0:0.3624:0.4775	.	548	Q9BX26	SYCP2_HUMAN	Y	548	ENSP00000360040:H548Y;ENSP00000350162:H548Y;ENSP00000402456:H548Y	ENSP00000350162:H548Y	H	-	1	0	SYCP2	57903910	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.242000	0.18087	0.034000	0.15491	-0.485000	0.04761	CAT	-	SYCP2	-	NULL		0.323	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	0	0	0	107	107	29	0.00	0.00	G	NM_014258		58470515	-1	20	4	106	10	tier1	no_errors	ENST00000357552	ensembl	human	known	74_37	missense	15.87	28.57	SNP	0.000	A	20	106
ACTBL2	345651	genome.wustl.edu	37	5	56777651	56777651	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr5:56777651T>G	ENST00000423391.1	-	1	985	c.884A>C	c.(883-885)tAt>tCt	p.Y295S	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	295						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		GGTGTTGGCATAGAGATCCTT	0.483													ENSG00000169067																																					0													123.0	109.0	114.0					5																	56777651		2203	4300	6503	SO:0001583	missense	0			-		CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.884A>C	5.37:g.56777651T>G	ENSP00000416706:p.Tyr295Ser		B2RPJ1|Q562R2|Q562S9|Q562X8	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.Y295S	ENST00000423391.1	37	c.884	CCDS34163.1	5	.	.	.	.	.	.	.	.	.	.	T	13.42	2.231104	0.39399	.	.	ENSG00000169067	ENST00000423391	D	0.94862	-3.54	4.91	3.72	0.42706	.	0.095677	0.43110	D	0.000610	D	0.97917	0.9315	H	0.97440	4.005	0.41599	D	0.988842	D	0.61080	0.989	D	0.72625	0.978	D	0.97504	1.0062	10	0.87932	D	0	.	9.395	0.38397	0.159:0.0:0.0:0.841	.	295	Q562R1	ACTBL_HUMAN	S	295	ENSP00000416706:Y295S	ENSP00000416706:Y295S	Y	-	2	0	ACTBL2	56813408	1.000000	0.71417	0.945000	0.38365	0.987000	0.75469	4.985000	0.63845	0.857000	0.35407	0.533000	0.62120	TAT	-	ACTBL2	-	pfam_Actin-related,smart_Actin-related		0.483	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTBL2	HGNC	protein_coding	OTTHUMT00000368579.1	0	0	0	51	51	62	0.00	0.00	T	NM_001017992		56777651	-1	16	13	71	78	tier1	no_errors	ENST00000423391	ensembl	human	known	74_37	missense	18.39	14.13	SNP	1.000	G	16	71
NIT1	4817	genome.wustl.edu	37	1	161089680	161089680	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr1:161089680G>A	ENST00000368009.2	+	5	605	c.529G>A	c.(529-531)Gaa>Aaa	p.E177K	NIT1_ENST00000368007.4_Missense_Mutation_p.E162K|DEDD_ENST00000489249.1_5'Flank|NIT1_ENST00000368008.1_Missense_Mutation_p.E177K|NIT1_ENST00000392190.5_Missense_Mutation_p.E141K|NIT1_ENST00000496861.1_3'UTR|PFDN2_ENST00000368010.3_5'Flank|PFDN2_ENST00000468311.1_5'Flank	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	177	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)			NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCCTATGTGTGAAAGCAACTC	0.522											OREG0013937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000158793																																					0													84.0	81.0	82.0					1																	161089680		2203	4300	6503	SO:0001583	missense	0			-	AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.529G>A	1.37:g.161089680G>A	ENSP00000356988:p.Glu177Lys	1814	B1AQP3|D3DVF4|O76091	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.E177K	ENST00000368009.2	37	c.529	CCDS1218.1	1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677448	0.88445	.	.	ENSG00000158793	ENST00000368009;ENST00000368007;ENST00000368008;ENST00000392190	D;D;D;D	0.92348	-3.02;-3.02;-2.7;-3.02	4.85	4.85	0.62838	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.85682	D	0.000000	D	0.97269	0.9107	H	0.97131	3.945	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.79108	0.987;0.979;0.992	D	0.98278	1.0507	10	0.87932	D	0	-13.0921	15.5014	0.75700	0.0:0.0:1.0:0.0	.	162;177;177	Q86X76-4;B1AQP4;Q86X76	.;.;NIT1_HUMAN	K	177;162;177;141	ENSP00000356988:E177K;ENSP00000356986:E162K;ENSP00000356987:E177K;ENSP00000376028:E141K	ENSP00000356986:E162K	E	+	1	0	NIT1	159356304	1.000000	0.71417	0.965000	0.40720	0.965000	0.64279	8.341000	0.90046	2.505000	0.84491	0.563000	0.77884	GAA	-	NIT1	-	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase		0.522	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIT1	HGNC	protein_coding	OTTHUMT00000077060.1	0	0	0	141	141	95	0.00	0.00	G			161089680	+1	21	10	127	73	tier1	no_errors	ENST00000368009	ensembl	human	known	74_37	missense	14.19	12.05	SNP	1.000	A	21	127
ZNF729	100287226	genome.wustl.edu	37	19	22499499	22499499	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:22499499C>T	ENST00000601693.1	+	4	3398	c.3280C>T	c.(3280-3282)Cat>Tat	p.H1094Y	ZNF729_ENST00000357491.6_Missense_Mutation_p.H1066Y			A6NN14	ZN729_HUMAN	zinc finger protein 729	1094					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						CCTTAGAAAACATAAGGTAAT	0.358													ENSG00000196350																																					0																																										SO:0001583	missense	0			-		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3280C>T	19.37:g.22499499C>T	ENSP00000469582:p.His1094Tyr		M0QY45	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H1094Y	ENST00000601693.1	37	c.3280	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	11.44	1.638927	0.29157	.	.	ENSG00000196350	ENST00000357491	D	0.86769	-2.17	0.96	-1.18	0.09617	.	.	.	.	.	D	0.91952	0.7451	M	0.93763	3.455	.	.	.	.	.	.	.	.	.	D	0.89798	0.3973	6	0.87932	D	0	.	6.1602	0.20360	0.0:0.7903:0.0:0.2097	.	.	.	.	Y	1066	ENSP00000350085:H1066Y	ENSP00000350085:H1066Y	H	+	1	0	ZNF729	22291339	0.921000	0.31238	0.002000	0.10522	0.001000	0.01503	3.454000	0.52986	-0.502000	0.06596	-0.499000	0.04595	CAT	-	ZNF729	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	0	0	0	119	119	42	0.00	0.00	C	XM_496301		22499499	+1	20	11	171	22	tier1	no_errors	ENST00000601693	ensembl	human	novel	74_37	missense	10.47	31.43	SNP	0.850	T	20	171
EFR3A	23167	genome.wustl.edu	37	8	132957097	132957097	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr8:132957097G>A	ENST00000254624.5	+	3	418	c.193G>A	c.(193-195)Gat>Aat	p.D65N	EFR3A_ENST00000519656.1_Missense_Mutation_p.D29N|EFR3A_ENST00000334503.4_Missense_Mutation_p.D65N	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	65						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			GTTGAGCAGGGATGTTGTCAG	0.363													ENSG00000132294																																					0													102.0	93.0	96.0					8																	132957097		2203	4299	6502	SO:0001583	missense	0			-	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.193G>A	8.37:g.132957097G>A	ENSP00000254624:p.Asp65Asn		A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D65N	ENST00000254624.5	37	c.193	CCDS34942.2	8	.	.	.	.	.	.	.	.	.	.	G	33	5.224772	0.95173	.	.	ENSG00000132294	ENST00000254624;ENST00000522709;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	M	0.79011	2.435	0.80722	D	1	D	0.58268	0.982	P	0.60012	0.867	T	0.46317	-0.9200	10	0.87932	D	0	-17.939	18.9014	0.92444	0.0:0.0:1.0:0.0	.	65	Q14156	EFR3A_HUMAN	N	65;29;65;65;29	ENSP00000254624:D65N;ENSP00000430512:D29N;ENSP00000334769:D65N;ENSP00000428086:D29N	ENSP00000254624:D65N	D	+	1	0	EFR3A	133026279	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	9.869000	0.99810	2.721000	0.93114	0.655000	0.94253	GAT	-	EFR3A	-	NULL		0.363	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	0	0	0	220	220	98	0.00	0.00	G	NM_015137		132957097	+1	49	16	252	85	tier1	no_errors	ENST00000254624	ensembl	human	known	74_37	missense	16.28	15.84	SNP	1.000	A	49	252
ZDHHC15	158866	genome.wustl.edu	37	X	74649796	74649796	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chrX:74649796G>A	ENST00000373367.3	-	6	699	c.469C>T	c.(469-471)Cat>Tat	p.H157Y	ZDHHC15_ENST00000373361.3_Missense_Mutation_p.H157Y|ZDHHC15_ENST00000541184.1_Missense_Mutation_p.H148Y	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	157					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						GGGCAGTGATGATCCATTTTT	0.388													ENSG00000102383																																					0													161.0	120.0	134.0					X																	74649796		2203	4300	6503	SO:0001583	missense	0			-	AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.469C>T	X.37:g.74649796G>A	ENSP00000362465:p.His157Tyr		B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.H157Y	ENST00000373367.3	37	c.469	CCDS14430.1	X	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397273	0.83120	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	T;T;T	0.38887	1.11;1.11;1.11	5.52	5.52	0.82312	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.044474	0.85682	D	0.000000	T	0.81408	0.4816	H	0.99697	4.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.90318	0.4342	10	0.87932	D	0	-16.4127	17.2818	0.87130	0.0:0.0:1.0:0.0	.	148;157	B3KVG7;Q96MV8	.;ZDH15_HUMAN	Y	157;148;157	ENSP00000362465:H157Y;ENSP00000445420:H148Y;ENSP00000362459:H157Y	ENSP00000362459:H157Y	H	-	1	0	ZDHHC15	74566521	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.257000	0.95545	2.293000	0.77203	0.600000	0.82982	CAT	-	ZDHHC15	-	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase		0.388	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC15	HGNC	protein_coding	OTTHUMT00000057283.1	0	0	0	160	160	56	0.00	0.00	G	NM_144969		74649796	-1	77	17	275	68	tier1	no_errors	ENST00000373367	ensembl	human	known	74_37	missense	21.81	19.32	SNP	1.000	A	77	275
GOLGA6L2	283685	genome.wustl.edu	37	15	23686793	23686793	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr15:23686793G>T	ENST00000567107.1	-	8	881	c.829C>A	c.(829-831)Cag>Aag	p.Q277K	GOLGA6L2_ENST00000345070.5_Missense_Mutation_p.Q4K|GOLGA6L2_ENST00000312015.5_Missense_Mutation_p.Q277K			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	277	Glu-rich.									breast(1)|endometrium(7)	8						tcctcctcctgcctcCACATC	0.458													ENSG00000174450																																					0																																										SO:0001583	missense	0			-	AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.829C>A	15.37:g.23686793G>T	ENSP00000454407:p.Gln277Lys		A1L301	Missense_Mutation	SNP	prints_Tropomyosin	p.Q277K	ENST00000567107.1	37	c.829		15	.	.	.	.	.	.	.	.	.	.	g	4.525	0.097409	0.08681	.	.	ENSG00000174450	ENST00000345070;ENST00000312015	T;T	0.51574	0.7;2.82	.	.	.	.	.	.	.	.	T	0.28234	0.0697	.	.	.	0.09310	N	1	B	0.28667	0.219	B	0.28638	0.092	T	0.20538	-1.0272	6	0.22706	T	0.39	.	.	.	.	.	277	Q8N9W4	GG6L2_HUMAN	K	4;277	ENSP00000344626:Q4K;ENSP00000307928:Q277K	ENSP00000307928:Q277K	Q	-	1	0	GOLGA6L2	21237886	0.004000	0.15560	0.006000	0.13384	0.006000	0.05464	0.038000	0.13862	0.151000	0.19162	0.154000	0.16183	CAG	-	GOLGA6L2	-	prints_Tropomyosin		0.458	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	1	1	0	119	119	22	0.83	0.00	G	NM_182561		23686793	-1	54	5	59	12	tier1	no_errors	ENST00000312015	ensembl	human	known	74_37	missense	47.37	29.41	SNP	0.006	T	54	59
C11orf63	79864	genome.wustl.edu	37	11	122774688	122774688	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr11:122774688A>T	ENST00000531316.1	+	2	492	c.400A>T	c.(400-402)Agt>Tgt	p.S134C	C11orf63_ENST00000227349.2_Missense_Mutation_p.S134C|C11orf63_ENST00000307257.6_Missense_Mutation_p.S134C			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	134					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GAACTGGAAGAGTAAGAAGGA	0.493													ENSG00000109944																																					0													132.0	148.0	143.0					11																	122774688		2202	4299	6501	SO:0001583	missense	0			-	BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.400A>T	11.37:g.122774688A>T	ENSP00000431669:p.Ser134Cys		A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	NULL	p.S134C	ENST00000531316.1	37	c.400	CCDS8438.1	11	.	.	.	.	.	.	.	.	.	.	A	16.47	3.133321	0.56828	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.48522	0.81;0.81	5.73	4.57	0.56435	.	0.974930	0.08441	N	0.945424	T	0.58047	0.2095	L	0.57536	1.79	0.23309	N	0.997935	D;D	0.63046	0.992;0.992	P;P	0.53146	0.634;0.719	T	0.44267	-0.9339	10	0.48119	T	0.1	-0.1744	11.5515	0.50723	0.8505:0.1495:0.0:0.0	.	134;134	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	C	134	ENSP00000227349:S134C;ENSP00000431669:S134C	ENSP00000227349:S134C	S	+	1	0	C11orf63	122279898	0.817000	0.29147	0.377000	0.26055	0.387000	0.30353	2.086000	0.41643	0.948000	0.37687	0.533000	0.62120	AGT	-	C11orf63	-	NULL		0.493	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf63	HGNC	protein_coding	OTTHUMT00000387511.1	0	0	0	64	64	76	0.00	0.00	A	NM_024806		122774688	+1	19	17	32	37	tier1	no_errors	ENST00000227349	ensembl	human	known	74_37	missense	37.25	31.48	SNP	0.753	T	19	32
MAPT	4137	genome.wustl.edu	37	17	44049253	44049253	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr17:44049253C>A	ENST00000571987.1	+	2	162	c.162C>A	c.(160-162)gaC>gaA	p.D54E	MAPT_ENST00000574436.1_Missense_Mutation_p.D54E|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000576518.1_5'Flank|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000535772.1_Missense_Mutation_p.D54E|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000262410.5_Missense_Mutation_p.D54E|MAPT_ENST00000347967.5_5'UTR|MAPT_ENST00000431008.3_Missense_Mutation_p.D54E|MAPT_ENST00000351559.5_Missense_Mutation_p.D54E|MAPT_ENST00000344290.5_Missense_Mutation_p.D54E|MAPT_ENST00000420682.2_Missense_Mutation_p.D54E|MAPT_ENST00000340799.5_Missense_Mutation_p.D54E|MAPT_ENST00000415613.2_Missense_Mutation_p.D54E			P10636	TAU_HUMAN	microtubule-associated protein tau	54					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	CCACTGAGGACGGATCTGAGG	0.607													ENSG00000186868																																					0													67.0	62.0	64.0					17																	44049253		2203	4300	6503	SO:0001583	missense	0			-	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.162C>A	17.37:g.44049253C>A	ENSP00000458742:p.Asp54Glu		P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	pfam_MAP_tubulin-bd_rpt,prints_Tau	p.D54E	ENST00000571987.1	37	c.162	CCDS11501.1	17	.	.	.	.	.	.	.	.	.	.	C	13.91	2.377100	0.42105	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000351559;ENST00000340799;ENST00000535772;ENST00000354326;ENST00000420682;ENST00000415613	T;T;T;T;T;T;T	0.36340	1.83;1.86;1.26;1.58;1.49;1.58;1.83	5.67	-4.82	0.03171	.	0.000000	0.45867	D	0.000328	T	0.47820	0.1466	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.85130	0.997;0.993;0.997;0.995;0.996	T	0.47947	-0.9077	10	0.62326	D	0.03	-15.2846	12.7704	0.57417	0.0:0.5201:0.0:0.4799	.	54;54;54;54;54	P10636-9;P10636-7;F8WAB2;P10636-8;P10636	.;.;.;.;TAU_HUMAN	E	54	ENSP00000340820:D54E;ENSP00000262410:D54E;ENSP00000303214:D54E;ENSP00000340438:D54E;ENSP00000443028:D54E;ENSP00000413056:D54E;ENSP00000410838:D54E	ENSP00000262410:D54E	D	+	3	2	MAPT	41405089	0.225000	0.23685	0.821000	0.32701	0.702000	0.40608	-1.174000	0.03105	-1.377000	0.02123	-0.219000	0.12488	GAC	-	MAPT	-	NULL		0.607	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MAPT	HGNC	protein_coding	OTTHUMT00000440133.1	0	0	0	115	115	105	0.00	0.00	C	NM_016835		44049253	+1	26	15	93	54	tier1	no_errors	ENST00000344290	ensembl	human	known	74_37	missense	21.85	21.74	SNP	0.951	A	26	93
COL12A1	1303	genome.wustl.edu	37	6	75893827	75893827	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr6:75893827T>A	ENST00000322507.8	-	9	1340	c.1031A>T	c.(1030-1032)gAa>gTa	p.E344V	COL12A1_ENST00000416123.2_Missense_Mutation_p.E344V|COL12A1_ENST00000483888.2_Missense_Mutation_p.E344V|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	344	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGAAGAGACTTCCATGGCAAT	0.398													ENSG00000111799																																					0													51.0	48.0	49.0					6																	75893827		1878	4106	5984	SO:0001583	missense	0			-	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1031A>T	6.37:g.75893827T>A	ENSP00000325146:p.Glu344Val		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.E344V	ENST00000322507.8	37	c.1031	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	T	17.80	3.478251	0.63849	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.58797	0.31;0.31;0.31	5.69	5.69	0.88448	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.251709	0.33144	N	0.005237	T	0.59445	0.2194	M	0.63428	1.95	0.49798	D	0.999821	P;P	0.47106	0.89;0.89	P;P	0.51945	0.685;0.685	T	0.65376	-0.6183	10	0.72032	D	0.01	.	15.9513	0.79840	0.0:0.0:0.0:1.0	.	344;344	D6RGG3;Q99715	.;COCA1_HUMAN	V	344	ENSP00000325146:E344V;ENSP00000412864:E344V;ENSP00000421216:E344V	ENSP00000325146:E344V	E	-	2	0	COL12A1	75950547	1.000000	0.71417	0.996000	0.52242	0.331000	0.28603	7.698000	0.84413	2.163000	0.67991	0.533000	0.62120	GAA	-	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.398	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	0	0	0	76	76	119	0.00	0.00	T	NM_004370		75893827	-1	22	12	70	37	tier1	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	23.91	24.49	SNP	1.000	A	22	70
IFNE	338376	genome.wustl.edu	37	9	21481377	21481377	+	Missense_Mutation	SNP	G	G	A	rs147289613		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr9:21481377G>A	ENST00000448696.3	-	1	935	c.317C>T	c.(316-318)aCg>aTg	p.T106M	MIR31HG_ENST00000304425.3_RNA	NM_176891.4	NP_795372.1	Q86WN2	IFNE_HUMAN	interferon, epsilon	106					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(2)|lung(1)|skin(1)	4						GAATTTCTCCGTGTGGTTTTC	0.453													ENSG00000184995	A|||	1	0.000199681	0.0	0.0	5008	,	,		20727	0.0		0.001	False		,,,				2504	0.0																0								A	MET/THR	1,4405	826.1+/-416.6	0,1,2202	150.0	144.0	146.0		317	-0.1	0.0	9	dbSNP_134	146	1,8599	819.0+/-406.8	0,1,4299	yes	missense	IFNE	NM_176891.4	81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	106/209	21481377	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AY190045	CCDS34997.1	9p21.1	2008-12-12			ENSG00000184995	ENSG00000184995			18163	protein-coding gene	gene with protein product		615223				15546383, 17287131	Standard	NM_176891		Approved	IFNE1	uc003zpg.3	Q86WN2	OTTHUMG00000019672	ENST00000448696.3:c.317C>T	9.37:g.21481377G>A	ENSP00000418018:p.Thr106Met			Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.T106M	ENST00000448696.3	37	c.317	CCDS34997.1	9	.	.	.	.	.	.	.	.	.	.	A	1.537	-0.542857	0.04053	2.27E-4	1.16E-4	ENSG00000184995	ENST00000448696	T	0.03272	3.99	4.93	-0.101	0.13618	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.543885	0.17478	N	0.172840	T	0.01695	0.0054	N	0.04297	-0.235	0.09310	N	1	B	0.22851	0.076	B	0.20767	0.031	T	0.43909	-0.9362	10	0.52906	T	0.07	.	4.5513	0.12114	0.5519:0.0:0.3097:0.1384	.	106	Q86WN2	IFNE_HUMAN	M	106	ENSP00000418018:T106M	ENSP00000418018:T106M	T	-	2	0	IFNE	21471377	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.384000	0.20668	-0.359000	0.08150	-0.254000	0.11334	ACG	rs147289613	IFNE	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta		0.453	IFNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNE	HGNC	protein_coding	OTTHUMT00000051901.2	0	0	0	60	60	117	0.00	0.00	G	NM_176891		21481377	-1	9	17	43	77	tier1	no_errors	ENST00000448696	ensembl	human	known	74_37	missense	17.31	18.09	SNP	0.000	A	9	43
ZPLD1	131368	genome.wustl.edu	37	3	102187922	102187922	+	Silent	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr3:102187922C>T	ENST00000491959.1	+	15	1758	c.876C>T	c.(874-876)gtC>gtT	p.V292V	ZPLD1_ENST00000306176.1_Silent_p.V308V|ZPLD1_ENST00000466937.1_Silent_p.V292V			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	292	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						TGTCCACTGTCTTCTTGCACT	0.453													ENSG00000170044																																					0													138.0	133.0	135.0					3																	102187922		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.876C>T	3.37:g.102187922C>T			Q49AS1|Q8WU36	Silent	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	p.V308	ENST00000491959.1	37	c.924		3																																																																																			-	ZPLD1	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom		0.453	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	ZPLD1	HGNC	protein_coding	OTTHUMT00000353984.1	0	0	0	131	131	63	0.00	0.00	C	NM_175056		102187922	+1	26	8	123	35	tier1	no_errors	ENST00000306176	ensembl	human	known	74_37	silent	17.45	18.60	SNP	1.000	T	26	123
SLC16A2	6567	genome.wustl.edu	37	X	73641840	73641840	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chrX:73641840T>A	ENST00000587091.1	+	1	545	c.368T>A	c.(367-369)aTc>aAc	p.I123N	SLC16A2_ENST00000276033.5_Missense_Mutation_p.I197N	NM_006517.4	NP_006508.2	P36021	MOT8_HUMAN	solute carrier family 16, member 2 (thyroid hormone transporter)	123					monocarboxylic acid transport (GO:0015718)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)|transporter activity (GO:0005215)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	21					L-Leucine(DB00149)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|Levothyroxine(DB00451)|Liotrix(DB01583)|Pyruvic acid(DB00119)	TCTGTCGGGATCCTCTACTCC	0.592													ENSG00000147100																																					0													32.0	34.0	33.0					X																	73641840		2203	4299	6502	SO:0001583	missense	0			-		CCDS14426.1, CCDS14426.2	Xq13.2	2013-05-22	2012-03-20		ENSG00000147100	ENSG00000147100		"""Solute carriers"""	10923	protein-coding gene	gene with protein product		300095	"""solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)"", ""Allan-Herndon-Dudley syndrome"", ""solute carrier family 16 (monocarboxylic acid transporters), member 2"", ""mental retardation, X-linked 22"", ""solute carrier family 16, member 2 (monocarboxylic acid transporter 8)"""	DXS128, AHDS, MRX22		7981683, 12871948, 15889350	Standard	NM_006517		Approved	XPCT, MCT8, MCT7	uc031tjy.1	P36021	OTTHUMG00000021857	ENST00000587091.1:c.368T>A	X.37:g.73641840T>A	ENSP00000465734:p.Ile123Asn		Q7Z797	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I197N	ENST00000587091.1	37	c.590	CCDS14426.2	X	.	.	.	.	.	.	.	.	.	.	T	20.7	4.039857	0.75732	.	.	ENSG00000147100	ENST00000276033	T	0.60672	0.17	4.24	4.24	0.50183	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.70718	0.3256	M	0.65975	2.015	0.53005	D	0.999965	D	0.67145	0.996	D	0.70487	0.969	T	0.73639	-0.3919	10	0.87932	D	0	.	10.3801	0.44106	0.0:0.0:0.0:1.0	.	123	P36021	MOT8_HUMAN	N	197	ENSP00000276033:I197N	ENSP00000276033:I197N	I	+	2	0	SLC16A2	73558565	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.753000	0.74904	1.569000	0.49696	0.486000	0.48141	ATC	-	SLC16A2	-	superfamily_MFS_dom_general_subst_transpt		0.592	SLC16A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A2	HGNC	protein_coding	OTTHUMT00000057266.3	0	0	0	207	207	51	0.00	0.00	T			73641840	+1	84	19	344	72	tier1	no_errors	ENST00000276033	ensembl	human	known	74_37	missense	19.63	20.88	SNP	1.000	A	84	344
UPF2	26019	genome.wustl.edu	37	10	11984753	11984753	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr10:11984753T>C	ENST00000356352.2	-	17	3762	c.3289A>G	c.(3289-3291)Att>Gtt	p.I1097V	UPF2_ENST00000397053.2_Missense_Mutation_p.I1097V|UPF2_ENST00000357604.5_Missense_Mutation_p.I1097V			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	1097	Sufficient for interaction with EIF4A1 and EIF1.|Sufficient for interaction with UPF1 C- terminus.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CCGCCTTTAATCATTACCTCC	0.333													ENSG00000151461																																					0													98.0	102.0	101.0					10																	11984753		2203	4300	6503	SO:0001583	missense	0			-	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.3289A>G	10.37:g.11984753T>C	ENSP00000348708:p.Ile1097Val		A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.I1097V	ENST00000356352.2	37	c.3289	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700459	0.48307	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053;ENST00000359268	T;T;T	0.39229	1.09;1.09;1.09	5.1	5.1	0.69264	Up-frameshift suppressor 2 (1);	0.000000	0.85682	D	0.000000	T	0.45438	0.1342	N	0.21194	0.64	0.47698	D	0.999497	P	0.40032	0.699	P	0.55087	0.768	T	0.29336	-1.0015	10	0.22109	T	0.4	.	15.1623	0.72793	0.0:0.0:0.0:1.0	.	1097	Q9HAU5	RENT2_HUMAN	V	1097;1097;1097;2	ENSP00000348708:I1097V;ENSP00000350221:I1097V;ENSP00000380244:I1097V	ENSP00000348708:I1097V	I	-	1	0	UPF2	12024759	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.405000	0.80007	2.049000	0.60858	0.455000	0.32223	ATT	-	UPF2	-	pfam_Up-fram_suppressor-2		0.333	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	0	0	0	102	102	72	0.00	0.00	T			11984753	-1	32	17	67	37	tier1	no_errors	ENST00000356352	ensembl	human	known	74_37	missense	32.32	31.48	SNP	1.000	C	32	67
CDH19	28513	genome.wustl.edu	37	18	64172372	64172372	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr18:64172372G>A	ENST00000262150.2	-	12	2288	c.1996C>T	c.(1996-1998)Cgg>Tgg	p.R666W	CDH19_ENST00000540086.1_3'UTR	NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TTGCGTTCCCGCATTATGGTA	0.458													ENSG00000071991																																					0													192.0	183.0	186.0					18																	64172372		2203	4300	6503	SO:0001583	missense	0			-	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.1996C>T	18.37:g.64172372G>A	ENSP00000262150:p.Arg666Trp		O15098	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R666W	ENST00000262150.2	37	c.1996	CCDS11994.1	18	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931944	0.34096	.	.	ENSG00000071991	ENST00000262150	T	0.58506	0.33	5.18	-4.1	0.03940	Cadherin, cytoplasmic domain (1);	0.302743	0.30492	N	0.009508	T	0.75162	0.3812	M	0.80982	2.52	0.24470	N	0.994391	D	0.89917	1.0	D	0.87578	0.998	T	0.75365	-0.3343	10	0.72032	D	0.01	.	21.0284	0.99944	0.0:0.0:0.2362:0.7638	.	666	Q9H159	CAD19_HUMAN	W	666	ENSP00000262150:R666W	ENSP00000262150:R666W	R	-	1	2	CDH19	62323352	0.001000	0.12720	0.032000	0.17829	0.027000	0.11550	-0.064000	0.11636	-0.642000	0.05480	-0.188000	0.12872	CGG	-	CDH19	-	pfam_Cadherin_cytoplasmic-dom		0.458	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000256219.1	0	0	0	53	53	95	0.00	0.00	G	NM_021153		64172372	-1	22	36	48	38	tier1	no_errors	ENST00000262150	ensembl	human	known	74_37	missense	31.43	48.65	SNP	0.048	A	22	48
FAM13A	10144	genome.wustl.edu	37	4	89660243	89660243	+	Silent	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr4:89660243G>A	ENST00000264344.5	-	20	2707	c.2500C>T	c.(2500-2502)Cta>Tta	p.L834L	FAM13A_ENST00000503556.1_Silent_p.L494L|FAM13A_ENST00000511976.1_Silent_p.L420L|FAM13A_ENST00000508369.1_Silent_p.L508L|FAM13A_ENST00000395002.2_Silent_p.L508L|FAM13A_ENST00000513837.1_Silent_p.L480L	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	834					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						CTGTCGTATAGTGGCTTCATC	0.498													ENSG00000138640																																					0													170.0	136.0	147.0					4																	89660243		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.2500C>T	4.37:g.89660243G>A			B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L834	ENST00000264344.5	37	c.2500	CCDS34029.1	4																																																																																			-	FAM13A	-	NULL		0.498	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13A	HGNC	protein_coding	OTTHUMT00000363371.1	0	0	0	108	108	115	0.00	0.00	G			89660243	-1	41	30	58	65	tier1	no_errors	ENST00000264344	ensembl	human	known	74_37	silent	41.41	31.58	SNP	0.092	A	41	58
HSPBAP1	79663	genome.wustl.edu	37	3	122459105	122459105	+	3'UTR	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr3:122459105C>T	ENST00000306103.2	-	0	1697				HSPBAP1_ENST00000383659.1_3'UTR	NM_024610.5	NP_078886.2	Q96EW2	HBAP1_HUMAN	HSPB (heat shock 27kDa) associated protein 1							cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(114;0.0531)		GCAAACTGACCTTTTGCTGGT	0.313													ENSG00000169087																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF400663	CCDS3017.1	3q21.1	2008-07-18	2002-08-29		ENSG00000169087	ENSG00000169087			16389	protein-coding gene	gene with protein product		608263	"""HSPB (heat shock 27kD) associated protein 1"""			11978969	Standard	NM_024610		Approved	FLJ22623, PASS1	uc003efu.2	Q96EW2	OTTHUMG00000159550	ENST00000306103.2:c.*87G>A	3.37:g.122459105C>T			Q6P476|Q8N8J4|Q8NHH6|Q8WWF0	R	SNP	-	NULL	ENST00000306103.2	37	NULL	CCDS3017.1	3																																																																																			-	HSPBAP1	-	-		0.313	HSPBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPBAP1	HGNC	protein_coding	OTTHUMT00000356161.1	0	0	0	43	43	82	0.00	0.00	C	NM_024610		122459105	-1	6	8	15	43	tier1	no_errors	ENST00000471534	ensembl	human	known	74_37	rna	28.57	15.69	SNP	0.000	T	6	15
BAI1	575	genome.wustl.edu	37	8	143566042	143566042	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr8:143566042T>A	ENST00000517894.1	+	13	3119	c.2225T>A	c.(2224-2226)tTc>tAc	p.F742Y	BAI1_ENST00000323289.5_Missense_Mutation_p.F742Y			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	742					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AAGGAGCTGTTCCGGCTGGTG	0.657													ENSG00000181790																																					0													28.0	37.0	34.0					8																	143566042		2052	4193	6245	SO:0001583	missense	0			-	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2225T>A	8.37:g.143566042T>A	ENSP00000430945:p.Phe742Tyr			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.F742Y	ENST00000517894.1	37	c.2225		8	.	.	.	.	.	.	.	.	.	.	T	25.8	4.674583	0.88445	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.09723	2.95;2.95	4.66	4.66	0.58398	.	0.070349	0.56097	U	0.000022	T	0.26557	0.0649	L	0.56769	1.78	0.52501	D	0.999956	D	0.69078	0.997	D	0.65140	0.932	T	0.01195	-1.1422	10	0.87932	D	0	.	12.9132	0.58190	0.0:0.0:0.0:1.0	.	742	E9PBK0	.	Y	742	ENSP00000430945:F742Y;ENSP00000313046:F742Y	ENSP00000313046:F742Y	F	+	2	0	BAI1	143563044	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	5.813000	0.69201	1.723000	0.51488	0.260000	0.18958	TTC	-	BAI1	-	pfam_DUF3497		0.657	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	0	0	0	171	171	47	0.00	0.00	T	NM_001702		143566042	+1	30	10	168	39	tier1	no_errors	ENST00000323289	ensembl	human	known	74_37	missense	15.15	20.00	SNP	1.000	A	30	168
NLRP4	147945	genome.wustl.edu	37	19	56370522	56370522	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:56370522T>C	ENST00000301295.6	+	3	2185	c.1763T>C	c.(1762-1764)gTt>gCt	p.V588A	NLRP4_ENST00000587891.1_Missense_Mutation_p.V513A|NLRP4_ENST00000346986.5_Missense_Mutation_p.V588A	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	588					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GACTTGGTGGTTTCTGCCTAC	0.428													ENSG00000160505																																					0													80.0	72.0	75.0					19																	56370522		2203	4300	6503	SO:0001583	missense	0			-	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1763T>C	19.37:g.56370522T>C	ENSP00000301295:p.Val588Ala		Q86W87|Q96AY6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.V588A	ENST00000301295.6	37	c.1763	CCDS12936.1	19	.	.	.	.	.	.	.	.	.	.	T	14.16	2.451946	0.43531	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.89617	-2.54;-2.54	3.47	1.36	0.22044	.	.	.	.	.	D	0.87018	0.6073	L	0.47190	1.495	0.09310	N	1	P;D;P	0.52996	0.92;0.957;0.928	P;P;P	0.53593	0.73;0.689;0.468	T	0.75351	-0.3348	9	0.27785	T	0.31	.	5.1632	0.15071	0.0:0.251:0.0:0.749	.	588;513;588	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	A	588	ENSP00000301295:V588A;ENSP00000344787:V588A	ENSP00000301295:V588A	V	+	2	0	NLRP4	61062334	0.002000	0.14202	0.000000	0.03702	0.168000	0.22595	0.758000	0.26447	0.218000	0.20820	0.482000	0.46254	GTT	-	NLRP4	-	NULL		0.428	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	0	0	0	101	101	190	0.00	0.00	T	NM_134444		56370522	+1	21	26	152	160	tier1	no_errors	ENST00000301295	ensembl	human	known	74_37	missense	12.14	13.98	SNP	0.001	C	21	152
GRIA1	2890	genome.wustl.edu	37	5	153078482	153078482	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr5:153078482G>A	ENST00000285900.5	+	10	1644	c.1301G>A	c.(1300-1302)cGt>cAt	p.R434H	GRIA1_ENST00000340592.5_Missense_Mutation_p.R434H|GRIA1_ENST00000448073.4_Missense_Mutation_p.R444H|GRIA1_ENST00000518783.1_Missense_Mutation_p.R444H|GRIA1_ENST00000521843.2_Missense_Mutation_p.R365H|GRIA1_ENST00000518142.1_Missense_Mutation_p.R354H	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	434					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.R434H(3)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GGCAATGACCGTTACGAGGGC	0.507													ENSG00000155511																																					3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)											134.0	117.0	123.0					5																	153078482		2203	4300	6503	SO:0001583	missense	0			-		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1301G>A	5.37:g.153078482G>A	ENSP00000285900:p.Arg434His		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R444H	ENST00000285900.5	37	c.1331	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340721	0.81911	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.78481	1.64;1.64;-1.18;1.64;1.64;1.64;-1.18	5.44	5.44	0.79542	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.100313	0.64402	D	0.000011	D	0.86481	0.5943	M	0.72118	2.19	0.54753	D	0.999982	D;D;D;D;P;B	0.61697	0.965;0.965;0.99;0.965;0.897;0.065	P;P;P;P;P;B	0.61800	0.787;0.787;0.894;0.787;0.565;0.052	D	0.87526	0.2449	10	0.66056	D	0.02	.	18.2393	0.89961	0.0:0.0:1.0:0.0	.	444;444;354;444;434;434	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	H	434;434;354;388;434;365;365;444;444	ENSP00000285900:R434H;ENSP00000427920:R354H;ENSP00000339343:R434H;ENSP00000427864:R365H;ENSP00000442108:R365H;ENSP00000428994:R444H;ENSP00000415569:R444H	ENSP00000285900:R434H	R	+	2	0	GRIA1	153058675	0.986000	0.35501	1.000000	0.80357	0.975000	0.68041	4.198000	0.58419	2.548000	0.85928	0.655000	0.94253	CGT	-	GRIA1	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd		0.507	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	0	0	0	124	124	99	0.00	0.00	G			153078482	+1	30	10	166	80	tier1	no_errors	ENST00000448073	ensembl	human	known	74_37	missense	15.31	10.99	SNP	1.000	A	30	166
CHMP2B	25978	genome.wustl.edu	37	3	87294950	87294950	+	Silent	SNP	G	G	A	rs139126268		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr3:87294950G>A	ENST00000263780.4	+	3	451	c.213G>A	c.(211-213)caG>caA	p.Q71Q	CHMP2B_ENST00000471660.1_Silent_p.Q30Q|CHMP2B_ENST00000494980.1_Silent_p.Q71Q|CHMP2B_ENST00000472024.1_3'UTR	NM_014043.3	NP_054762.2	Q9UQN3	CHM2B_HUMAN	charged multivesicular body protein 2B	71					cell death (GO:0008219)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	12	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		TACGGAAACAGAAGACGAGAA	0.358													ENSG00000083937																																					0													84.0	89.0	87.0					3																	87294950		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC001553	CCDS2918.1, CCDS58840.1	3p12.1	2011-09-21	2011-09-21		ENSG00000083937	ENSG00000083937		"""Charged multivesicular body proteins"""	24537	protein-coding gene	gene with protein product	"""VPS2 homolog B (S. cerevisiae)"""	609512	"""chromatin modifying protein 2B"""			11559748	Standard	NM_014043		Approved	DKFZP564O123, CHMP2.5, VPS2B	uc003dqp.4	Q9UQN3	OTTHUMG00000158982	ENST00000263780.4:c.213G>A	3.37:g.87294950G>A			B4DJG8|Q53HC7|Q9Y4U6	Silent	SNP	pfam_Snf7	p.Q71	ENST00000263780.4	37	c.213	CCDS2918.1	3																																																																																			-	CHMP2B	-	pfam_Snf7		0.358	CHMP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP2B	HGNC	protein_coding	OTTHUMT00000352779.2	0	0	0	198	198	97	0.00	0.00	G	NM_014043		87294950	+1	72	26	302	95	tier1	no_errors	ENST00000263780	ensembl	human	known	74_37	silent	19.25	21.49	SNP	1.000	A	72	302
ERICH3	127254	genome.wustl.edu	37	1	75037896	75037896	+	Silent	SNP	C	C	T	rs200380141		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr1:75037896C>T	ENST00000326665.5	-	14	3716	c.3498G>A	c.(3496-3498)tcG>tcA	p.S1166S	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1166	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TGTTTTCCAGCGACTTTTCAA	0.478													ENSG00000178965																																					0													92.0	93.0	93.0					1																	75037896		2203	4300	6503	SO:0001819	synonymous_variant	0			-																												ENST00000326665.5:c.3498G>A	1.37:g.75037896C>T			Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	NULL	p.S1166	ENST00000326665.5	37	c.3498	CCDS30755.1	1																																																																																			rs200380141	C1orf173	-	NULL		0.478	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	0	0	0	41	41	93	0.00	0.00	C			75037896	-1	5	10	33	53	tier1	no_errors	ENST00000326665	ensembl	human	known	74_37	silent	13.16	15.87	SNP	0.003	T	5	33
UTRN	7402	genome.wustl.edu	37	6	145157027	145157027	+	Silent	SNP	A	A	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr6:145157027A>G	ENST00000367545.3	+	69	9777	c.9777A>G	c.(9775-9777)gaA>gaG	p.E3259E	UTRN_ENST00000367526.4_Silent_p.E814E	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3259					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AGAGGGAAGAACGTGGAGAAC	0.512													ENSG00000152818																																					0													112.0	107.0	109.0					6																	145157027		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.9777A>G	6.37:g.145157027A>G			Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.E3259	ENST00000367545.3	37	c.9777	CCDS34547.1	6																																																																																			-	UTRN	-	pirsf_Dystrophin/utrophin		0.512	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	0	0	0	94	94	71	0.00	0.00	A			145157027	+1	21	8	91	44	tier1	no_errors	ENST00000367545	ensembl	human	known	74_37	silent	18.75	15.38	SNP	0.992	G	21	91
NCSTN	23385	genome.wustl.edu	37	1	160325530	160325530	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr1:160325530G>T	ENST00000294785.5	+	12	1563	c.1438G>T	c.(1438-1440)Gta>Tta	p.V480L	NCSTN_ENST00000368065.4_Missense_Mutation_p.V222L|NCSTN_ENST00000368063.1_Missense_Mutation_p.V460L|NCSTN_ENST00000459963.1_3'UTR|NCSTN_ENST00000535857.1_Missense_Mutation_p.V342L|NCSTN_ENST00000392212.4_Missense_Mutation_p.V460L	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	480					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCTGAACTTTGTAACAGACAC	0.517													ENSG00000162736																																					0													88.0	86.0	87.0					1																	160325530		2203	4300	6503	SO:0001583	missense	0			-	AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.1438G>T	1.37:g.160325530G>T	ENSP00000294785:p.Val480Leu		Q5T207|Q5T208|Q86VV5	Missense_Mutation	SNP	pfam_Nicastrin	p.V480L	ENST00000294785.5	37	c.1438	CCDS1203.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.34|16.34	3.096630|3.096630	0.56075|0.56075	.|.	.|.	ENSG00000162736|ENSG00000162736	ENST00000424645;ENST00000435149|ENST00000294785;ENST00000368063;ENST00000535857;ENST00000368067;ENST00000392212;ENST00000368065	.|T;T;T;T;T	.|0.71103	.|-0.54;-0.54;-0.54;-0.54;-0.54	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.126462	.|0.52532	.|D	.|0.000071	T|T	0.46464|0.46464	0.1394|0.1394	L|L	0.38838|0.38838	1.175|1.175	0.47994|0.47994	D|D	0.999561|0.999561	.|P;B;B	.|0.39352	.|0.669;0.015;0.037	.|B;B;B	.|0.30943	.|0.122;0.023;0.115	T|T	0.51694|0.51694	-0.8673|-0.8673	5|10	.|0.32370	.|T	.|0.25	-16.1456|-16.1456	16.6474|16.6474	0.85180|0.85180	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|342;460;480	.|F6Y097;Q92542-2;Q92542	.|.;.;NICA_HUMAN	F|L	315;156|480;460;342;187;460;222	.|ENSP00000294785:V480L;ENSP00000357042:V460L;ENSP00000442605:V342L;ENSP00000376047:V460L;ENSP00000357044:V222L	.|ENSP00000294785:V480L	L|V	+|+	3|1	2|0	NCSTN|NCSTN	158592154|158592154	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	3.757000|3.757000	0.55212|0.55212	2.732000|2.732000	0.93576|0.93576	0.650000|0.650000	0.86243|0.86243	TTG|GTA	-	NCSTN	-	pfam_Nicastrin		0.517	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCSTN	HGNC	protein_coding	OTTHUMT00000080622.1	0	0	0	64	64	64	0.00	0.00	G	NM_015331		160325530	+1	9	11	59	51	tier1	no_errors	ENST00000294785	ensembl	human	known	74_37	missense	13.24	17.74	SNP	1.000	T	9	59
SCN9A	6335	genome.wustl.edu	37	2	167133735	167133735	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr2:167133735A>G	ENST00000409435.1	-	15	2631	c.2632T>C	c.(2632-2634)Ttc>Ctc	p.F878L	SCN9A_ENST00000375387.4_Missense_Mutation_p.F879L|SCN9A_ENST00000303354.6_Missense_Mutation_p.F879L|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.F867L			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	878					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCAAAAATGAAGACGATGATG	0.463													ENSG00000169432																																					0													180.0	170.0	173.0					2																	167133735		2203	4300	6503	SO:0001583	missense	0			-	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.2632T>C	2.37:g.167133735A>G	ENSP00000386330:p.Phe878Leu		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.F879L	ENST00000409435.1	37	c.2635	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	A	33	5.196530	0.94960	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98602	-5.02;-5.02;-5.02;-5.02	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000001	D	0.98579	0.9525	M	0.81112	2.525	0.58432	D	0.999999	D	0.67145	0.996	P	0.57009	0.811	D	0.99521	1.0958	10	0.87932	D	0	.	16.175	0.81844	1.0:0.0:0.0:0.0	.	867	E7EUN6	.	L	867;879;879;878	ENSP00000386306:F867L;ENSP00000364536:F879L;ENSP00000304748:F879L;ENSP00000386330:F878L	ENSP00000304748:F879L	F	-	1	0	SCN9A	166841981	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.142000	0.94618	2.274000	0.75844	0.528000	0.53228	TTC	-	SCN9A	-	pfam_Ion_trans_dom		0.463	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	0	0	0	184	184	99	0.00	0.00	A	NM_002977		167133735	-1	38	12	127	34	tier1	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	23.03	26.09	SNP	1.000	G	38	127
OR13C3	138803	genome.wustl.edu	37	9	107298240	107298240	+	Silent	SNP	G	G	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr9:107298240G>T	ENST00000374781.2	-	1	897	c.855C>A	c.(853-855)atC>atA	p.I285I		NM_001001961.1	NP_001001961.1	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C, member 3	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(1)|skin(1)	19						ACATAAAGAAGATGGTACCGT	0.433													ENSG00000204246																									GBM(86;1248 1274 14222 15028 46219)												0													142.0	134.0	137.0					9																	107298240		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS35089.1	9q31.1	2013-09-24			ENSG00000204246	ENSG00000204246		"""GPCR / Class A : Olfactory receptors"""	14704	protein-coding gene	gene with protein product							Standard	NM_001001961		Approved		uc004bcb.1	Q8NGS6	OTTHUMG00000020406	ENST00000374781.2:c.855C>A	9.37:g.107298240G>T			Q5VVG1|Q6IF52	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I285	ENST00000374781.2	37	c.855	CCDS35089.1	9																																																																																			-	OR13C3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.433	OR13C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C3	HGNC	protein_coding	OTTHUMT00000053477.2	0	0	0	88	88	57	0.00	0.00	G			107298240	-1	15	6	83	26	tier1	no_errors	ENST00000374781	ensembl	human	known	74_37	silent	15.31	18.75	SNP	0.929	T	15	83
EFR3A	23167	genome.wustl.edu	37	8	132957010	132957010	+	Missense_Mutation	SNP	G	G	A	rs375503062		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr8:132957010G>A	ENST00000254624.5	+	3	331	c.106G>A	c.(106-108)Gat>Aat	p.D36N	EFR3A_ENST00000519656.1_5'UTR|EFR3A_ENST00000334503.4_Missense_Mutation_p.D36N	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	36						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TGTGAAAACTGATATGGAGAA	0.348													ENSG00000132294																																					0								G	ASN/ASP	2,4402	4.2+/-10.8	0,2,2200	77.0	73.0	74.0		106	5.8	1.0	8		74	1,8597	1.2+/-3.3	0,1,4298	no	missense	EFR3A	NM_015137.4	23	0,3,6498	AA,AG,GG		0.0116,0.0454,0.0231	benign	36/822	132957010	3,12999	2202	4299	6501	SO:0001583	missense	0			-	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.106G>A	8.37:g.132957010G>A	ENSP00000254624:p.Asp36Asn		A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D36N	ENST00000254624.5	37	c.106	CCDS34942.2	8	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628444	0.28978	4.54E-4	1.16E-4	ENSG00000132294	ENST00000254624;ENST00000377917;ENST00000334503	T;T	0.16597	2.33;2.33	5.75	5.75	0.90469	.	.	.	.	.	T	0.09512	0.0234	N	0.10760	0.04	0.44694	D	0.997685	B	0.10296	0.003	B	0.15870	0.014	T	0.11155	-1.0599	9	0.02654	T	1	-10.087	18.9404	0.92602	0.0:0.0:1.0:0.0	.	36	Q14156	EFR3A_HUMAN	N	36	ENSP00000254624:D36N;ENSP00000334769:D36N	ENSP00000254624:D36N	D	+	1	0	EFR3A	133026192	1.000000	0.71417	0.966000	0.40874	0.800000	0.45204	5.727000	0.68523	2.725000	0.93324	0.655000	0.94253	GAT	-	EFR3A	-	NULL		0.348	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	0	0	0	247	247	86	0.00	0.00	G	NM_015137		132957010	+1	65	15	239	81	tier1	no_errors	ENST00000254624	ensembl	human	known	74_37	missense	21.31	15.62	SNP	0.986	A	65	239
SALL3	27164	genome.wustl.edu	37	18	76753935	76753935	+	Silent	SNP	G	G	A	rs373055868		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr18:76753935G>A	ENST00000537592.2	+	2	1944	c.1944G>A	c.(1942-1944)ccG>ccA	p.P648P	SALL3_ENST00000536229.3_Silent_p.P515P|SALL3_ENST00000575389.2_Silent_p.P648P	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	648					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P648P(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCCAGTTTCCGTTCGGGGGGC	0.652													ENSG00000256463																																					1	Substitution - coding silent(1)	lung(1)											21.0	21.0	21.0					18																	76753935		2200	4296	6496	SO:0001819	synonymous_variant	0			-	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1944G>A	18.37:g.76753935G>A			Q9UGH1	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P648	ENST00000537592.2	37	c.1944	CCDS12013.1	18																																																																																			-	SALL3	-	NULL		0.652	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	HGNC	protein_coding	OTTHUMT00000256397.1	0	0	0	38	38	31	0.00	0.00	G	NM_171999		76753935	+1	5	9	17	37	tier1	no_errors	ENST00000537592	ensembl	human	known	74_37	silent	22.73	19.57	SNP	0.280	A	5	17
GZMK	3003	genome.wustl.edu	37	5	54329635	54329635	+	Missense_Mutation	SNP	G	G	A	rs200562138		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr5:54329635G>A	ENST00000231009.2	+	5	746	c.676G>A	c.(676-678)Gct>Act	p.A226T	CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000609792.1_RNA|CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000609699.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	226	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A226S(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				TGTCTTCCACGCTATAGTCTC	0.453													ENSG00000113088																																					1	Substitution - Missense(1)	lung(1)						G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	102.0	93.0	96.0		676	5.3	0.7	5		96	1,8599	1.2+/-3.3	0,1,4299	no	missense	GZMK	NM_002104.2	58	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	226/265	54329635	2,13004	2203	4300	6503	SO:0001583	missense	0			-	BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.676G>A	5.37:g.54329635G>A	ENSP00000231009:p.Ala226Thr		B2R563	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A226T	ENST00000231009.2	37	c.676	CCDS3964.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.733630	0.96865	2.27E-4	1.16E-4	ENSG00000113088	ENST00000231009	D	0.88975	-2.45	5.28	5.28	0.74379	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.065450	0.64402	D	0.000018	D	0.90494	0.7022	L	0.49778	1.585	0.42889	D	0.994198	D	0.61080	0.989	P	0.53518	0.728	D	0.91543	0.5251	10	0.87932	D	0	.	16.4636	0.84071	0.0:0.0:1.0:0.0	.	226	P49863	GRAK_HUMAN	T	226	ENSP00000231009:A226T	ENSP00000231009:A226T	A	+	1	0	GZMK	54365392	0.998000	0.40836	0.687000	0.30102	0.559000	0.35586	7.069000	0.76755	2.738000	0.93877	0.655000	0.94253	GCT	rs200562138	GZMK	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.453	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMK	HGNC	protein_coding	OTTHUMT00000214098.1	0	0	1	157	157	88	0.00	1.12	G	NM_002104		54329635	+1	78	38	177	74	tier1	no_errors	ENST00000231009	ensembl	human	known	74_37	missense	30.47	33.93	SNP	0.988	A	78	177
A1CF	29974	genome.wustl.edu	37	10	52573658	52573658	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr10:52573658G>T	ENST00000373993.1	-	8	1350	c.1306C>A	c.(1306-1308)Cct>Act	p.P436T	A1CF_ENST00000395495.1_Missense_Mutation_p.P381T|A1CF_ENST00000374001.2_Missense_Mutation_p.P428T|A1CF_ENST00000282641.2_Missense_Mutation_p.P436T|ASAH2B_ENST00000483649.1_Intron|A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000373995.3_Missense_Mutation_p.P436T|A1CF_ENST00000395489.2_Missense_Mutation_p.P429T|A1CF_ENST00000373997.3_Missense_Mutation_p.P428T			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	436					cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.P428S(1)|p.P436S(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						AATGTGACAGGATTCATTGGG	0.438													ENSG00000148584																																					2	Substitution - Missense(2)	lung(2)											151.0	153.0	152.0					10																	52573658		2203	4300	6503	SO:0001583	missense	0			-	AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.1306C>A	10.37:g.52573658G>T	ENSP00000363105:p.Pro436Thr		A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.P436T	ENST00000373993.1	37	c.1306	CCDS7242.1	10	.	.	.	.	.	.	.	.	.	.	G	6.943	0.543785	0.13312	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489	T;T;T;T;T;T;T	0.13901	2.8;2.78;2.8;2.76;2.78;2.55;2.77	5.87	4.95	0.65309	.	0.266360	0.43260	N	0.000600	T	0.09992	0.0245	L	0.27053	0.805	0.32760	N	0.505275	B;B;B;B	0.12013	0.003;0.0;0.001;0.005	B;B;B;B	0.12837	0.008;0.001;0.001;0.007	T	0.13045	-1.0524	10	0.20519	T	0.43	-7.5986	11.6903	0.51512	0.0:0.0:0.6671:0.3329	.	429;436;428;436	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	T	428;436;428;436;436;381;411;429	ENSP00000363113:P428T;ENSP00000363105:P436T;ENSP00000363109:P428T;ENSP00000363107:P436T;ENSP00000282641:P436T;ENSP00000378873:P381T;ENSP00000378868:P429T	ENSP00000282641:P436T	P	-	1	0	A1CF	52243664	1.000000	0.71417	1.000000	0.80357	0.360000	0.29518	4.058000	0.57463	1.426000	0.47256	0.655000	0.94253	CCT	-	A1CF	-	tigrfam_HnRNP_R/Q_splicing_fac		0.438	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2	0	0	0	211	211	105	0.00	0.00	G	NM_014576		52573658	-1	48	9	137	51	tier1	no_errors	ENST00000282641	ensembl	human	known	74_37	missense	25.95	15.00	SNP	1.000	T	48	137
MUC16	94025	genome.wustl.edu	37	19	9066657	9066657	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:9066657G>T	ENST00000397910.4	-	3	20992	c.20789C>A	c.(20788-20790)aCa>aAa	p.T6930K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6932	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGACATTGATGTGGAAACAGT	0.468													ENSG00000181143																																					0													282.0	263.0	269.0					19																	9066657		2004	4177	6181	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20789C>A	19.37:g.9066657G>T	ENSP00000381008:p.Thr6930Lys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T6930K	ENST00000397910.4	37	c.20789	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	4.973	0.180705	0.09443	.	.	ENSG00000181143	ENST00000397910	T	0.30182	1.54	2.53	0.334	0.15948	.	.	.	.	.	T	0.40171	0.1106	L	0.59436	1.845	.	.	.	D	0.58268	0.982	P	0.59825	0.864	T	0.48479	-0.9032	8	0.87932	D	0	.	4.362	0.11206	0.3468:0.0:0.6532:0.0	.	6930	B5ME49	.	K	6930	ENSP00000381008:T6930K	ENSP00000381008:T6930K	T	-	2	0	MUC16	8927657	0.006000	0.16342	0.000000	0.03702	0.007000	0.05969	0.513000	0.22770	0.149000	0.19098	0.400000	0.26472	ACA	-	MUC16	-	NULL		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	101	101	155	0.00	0.00	G	NM_024690		9066657	-1	22	18	144	120	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	13.25	13.04	SNP	0.000	T	22	144
KLHL4	56062	genome.wustl.edu	37	X	86890736	86890736	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chrX:86890736C>A	ENST00000373119.4	+	9	2031	c.1886C>A	c.(1885-1887)gCt>gAt	p.A629D	KLHL4_ENST00000373114.4_Missense_Mutation_p.A629D	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	629						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GATGCCCCTGCTTCCAACCAT	0.408													ENSG00000102271																																					0													94.0	82.0	86.0					X																	86890736		2203	4300	6503	SO:0001583	missense	0			-	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1886C>A	X.37:g.86890736C>A	ENSP00000362211:p.Ala629Asp		B2RTW2|Q9Y3J5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.A629D	ENST00000373119.4	37	c.1886	CCDS14457.1	X	.	.	.	.	.	.	.	.	.	.	C	13.37	2.215792	0.39102	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.74737	-0.87;-0.84	4.21	3.34	0.38264	Galactose oxidase, beta-propeller (1);	0.256043	0.38326	N	0.001736	T	0.73194	0.3556	N	0.19112	0.55	0.58432	D	0.999999	P;D	0.59357	0.83;0.985	D;P	0.63793	0.918;0.877	T	0.74945	-0.3491	10	0.72032	D	0.01	.	10.5444	0.45052	0.0:0.9022:0.0:0.0978	.	629;629	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	D	629	ENSP00000362211:A629D;ENSP00000362206:A629D	ENSP00000362206:A629D	A	+	2	0	KLHL4	86777392	1.000000	0.71417	0.677000	0.29947	0.015000	0.08874	4.323000	0.59221	0.912000	0.36772	0.500000	0.49745	GCT	-	KLHL4	-	pfam_Kelch_1,smart_Kelch_1		0.408	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL4	HGNC	protein_coding	OTTHUMT00000057413.1	0	0	0	68	68	41	0.00	0.00	C			86890736	+1	101	26	23	12	tier1	no_errors	ENST00000373114	ensembl	human	known	74_37	missense	81.45	68.42	SNP	1.000	A	101	23
GIMAP8	155038	genome.wustl.edu	37	7	150174480	150174480	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr7:150174480T>A	ENST00000307271.3	+	5	2184	c.1610T>A	c.(1609-1611)tTc>tAc	p.F537Y		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	537	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CTGGGACGATTCACTGAAGAG	0.498													ENSG00000171115																																					0													78.0	75.0	76.0					7																	150174480		2203	4300	6503	SO:0001583	missense	0			-	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1610T>A	7.37:g.150174480T>A	ENSP00000305107:p.Phe537Tyr			Missense_Mutation	SNP	pfam_AIG1,superfamily_P-loop_NTPase	p.F537Y	ENST00000307271.3	37	c.1610	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	T	17.00	3.277921	0.59758	.	.	ENSG00000171115	ENST00000307271	T	0.05649	3.41	4.44	3.21	0.36854	AIG1 (1);	0.157695	0.29892	N	0.010928	T	0.07052	0.0179	L	0.49126	1.545	0.26942	N	0.966226	P	0.43024	0.798	B	0.42030	0.373	T	0.18713	-1.0328	10	0.34782	T	0.22	.	7.2046	0.25899	0.197:0.0:0.0:0.8029	.	537	Q8ND71	GIMA8_HUMAN	Y	537	ENSP00000305107:F537Y	ENSP00000305107:F537Y	F	+	2	0	GIMAP8	149805413	0.663000	0.27448	0.671000	0.29857	0.051000	0.14879	0.068000	0.14531	1.881000	0.54492	0.533000	0.62120	TTC	-	GIMAP8	-	pfam_AIG1,superfamily_P-loop_NTPase		0.498	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	0	0	0	93	93	167	0.00	0.00	T	NM_175571		150174480	+1	23	35	170	150	tier1	no_errors	ENST00000307271	ensembl	human	known	74_37	missense	11.92	18.82	SNP	0.770	A	23	170
CLASP2	23122	genome.wustl.edu	37	3	33686773	33686773	+	Splice_Site	SNP	C	C	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr3:33686773C>G	ENST00000487200.1	-	1	222		c.e1+1		CLASP2_ENST00000539981.1_Splice_Site|CLASP2_ENST00000307312.7_Intron|CLASP2_ENST00000313350.6_Splice_Site|CLASP2_ENST00000333778.6_5'Flank|CLASP2_ENST00000468888.2_Intron|CLASP2_ENST00000480013.1_Intron|CLASP2_ENST00000399362.4_Intron|CLASP2_ENST00000461133.3_Intron|CLASP2_ENST00000359576.5_Intron|CLASP2_ENST00000482896.1_Intron			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2						axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						CTGCAACTTACAATCACAGAT	0.448													ENSG00000163539																																					0													185.0	175.0	178.0					3																	33686773		876	1991	2867	SO:0001630	splice_region_variant	0			-	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000487200.1:c.34+1G>C	3.37:g.33686773C>G			Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Splice_Site	SNP	-	e1+1	ENST00000487200.1	37	c.34+1		3	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433535	0.62955	.	.	ENSG00000163539	ENST00000539981;ENST00000313350;ENST00000487200;ENST00000485378	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2904	0.90127	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLASP2	33661777	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.007000	0.70731	2.753000	0.94483	0.585000	0.79938	.	-	CLASP2	-	-		0.448	CLASP2-006	NOVEL	basic	protein_coding	CLASP2	HGNC	protein_coding	OTTHUMT00000356448.2	0	0	0	117	117	59	0.00	0.00	C	NM_001207044	Intron	33686773	-1	15	4	67	32	tier1	no_errors	ENST00000313350	ensembl	human	known	74_37	splice_site	18.29	11.11	SNP	1.000	G	15	67
KYNU	8942	genome.wustl.edu	37	2	143790838	143790838	+	Missense_Mutation	SNP	G	G	A	rs142934146		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr2:143790838G>A	ENST00000264170.4	+	12	1247	c.989G>A	c.(988-990)cGa>cAa	p.R330Q	KYNU_ENST00000409512.1_Missense_Mutation_p.R330Q	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		TGTGGATTCCGAATTTCAAAT	0.378													ENSG00000115919																																					0								G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	310.0	302.0	305.0		989,989	6.0	1.0	2	dbSNP_134	305	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KYNU	NM_001199241.1,NM_003937.2	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	330/466,330/466	143790838	1,13005	2203	4300	6503	SO:0001583	missense	0			-	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.989G>A	2.37:g.143790838G>A	ENSP00000264170:p.Arg330Gln			Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,tigrfam_Kynureninase	p.R330Q	ENST00000264170.4	37	c.989	CCDS2183.1	2	.	.	.	.	.	.	.	.	.	.	G	16.44	3.123813	0.56613	0.0	1.16E-4	ENSG00000115919	ENST00000264170;ENST00000409512	D;D	0.87256	-2.23;-2.23	6.03	6.03	0.97812	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.83381	0.5242	N	0.17922	0.545	0.80722	D	1	P	0.49862	0.929	P	0.51999	0.687	T	0.78450	-0.2199	10	0.02654	T	1	.	18.7374	0.91761	0.0:0.0:1.0:0.0	.	330	Q16719	KYNU_HUMAN	Q	330	ENSP00000264170:R330Q;ENSP00000386731:R330Q	ENSP00000264170:R330Q	R	+	2	0	KYNU	143507308	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	8.104000	0.89551	2.861000	0.98227	0.655000	0.94253	CGA	rs142934146	KYNU	-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,tigrfam_Kynureninase		0.378	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KYNU	HGNC	protein_coding	OTTHUMT00000254772.1	0	0	0	208	208	111	0.00	0.00	G	NM_001032998		143790838	+1	76	25	80	34	tier1	no_errors	ENST00000264170	ensembl	human	known	74_37	missense	48.72	41.67	SNP	1.000	A	76	80
CSE1L	1434	genome.wustl.edu	37	20	47707377	47707377	+	Splice_Site	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr20:47707377G>A	ENST00000262982.2	+	20	2402		c.e20+1		CSE1L_ENST00000396192.3_Splice_Site|CSE1L_ENST00000469700.1_Splice_Site|CSE1L_ENST00000542325.1_Splice_Site	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			ACATGCCTCCGTGAGTATGAC	0.338													ENSG00000124207																																					0													89.0	91.0	91.0					20																	47707377		2203	4300	6503	SO:0001630	splice_region_variant	0			-	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.2279+1G>A	20.37:g.47707377G>A			A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Splice_Site	SNP	-	e19+1	ENST00000262982.2	37	c.2279+1	CCDS13412.1	20	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264274	0.80358	.	.	ENSG00000124207	ENST00000417408;ENST00000262982;ENST00000542325;ENST00000396192	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1856	0.93642	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CSE1L	47140784	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.420000	0.97426	2.611000	0.88343	0.650000	0.86243	.	-	CSE1L	-	-		0.338	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	0	0	0	102	102	84	0.00	0.00	G	NM_001316	Intron	47707377	+1	20	16	87	62	tier1	no_errors	ENST00000262982	ensembl	human	known	74_37	splice_site	18.69	20.51	SNP	1.000	A	20	87
ZNF25	219749	genome.wustl.edu	37	10	38241130	38241130	+	Silent	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr10:38241130C>T	ENST00000302609.7	-	6	1508	c.1296G>A	c.(1294-1296)ggG>ggA	p.G432G	ZNF25_ENST00000374633.1_5'UTR|AL117337.1_ENST00000582458.1_RNA	NM_145011.2	NP_659448.1	P17030	ZNF25_HUMAN	zinc finger protein 25	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				TAAAGGTTTCCCCACACTCCT	0.428													ENSG00000175395																																					0													156.0	146.0	149.0					10																	38241130		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK056452	CCDS7195.1	10p11.2	2013-01-08	2006-05-10		ENSG00000175395	ENSG00000175395		"""Zinc fingers, C2H2-type"", ""-"""	13043	protein-coding gene	gene with protein product		194528	"""zinc finger protein 25 (KOX 19)"""			1639412, 8464732	Standard	NM_145011		Approved	KOX19, FLJ31890, Zfp9	uc001ize.1	P17030	OTTHUMG00000019344	ENST00000302609.7:c.1296G>A	10.37:g.38241130C>T			A9Z1X5|Q8IYE3|Q8NDD6|Q96MU2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G432	ENST00000302609.7	37	c.1296	CCDS7195.1	10																																																																																			-	ZNF25	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.428	ZNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF25	HGNC	protein_coding	OTTHUMT00000051214.1	0	0	0	38	38	60	0.00	0.00	C	NM_145011, NM_006966		38241130	-1	9	11	14	57	tier1	no_errors	ENST00000302609	ensembl	human	known	74_37	silent	39.13	16.18	SNP	0.768	T	9	14
CTBP2	1488	genome.wustl.edu	37	10	126686543	126686543	+	Silent	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr10:126686543G>A	ENST00000337195.5	-	6	954	c.555C>T	c.(553-555)ctC>ctT	p.L185L	CTBP2_ENST00000494626.2_Silent_p.L185L|CTBP2_ENST00000531469.1_Silent_p.L185L|CTBP2_ENST00000334808.6_Silent_p.L253L|CTBP2_ENST00000411419.2_Silent_p.L185L|CTBP2_ENST00000309035.6_Silent_p.L725L	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2	185					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CAAAGCCAATGAGGCCCAGCG	0.687													ENSG00000175029																																					0													77.0	59.0	65.0					10																	126686543		2202	4299	6501	SO:0001819	synonymous_variant	0			-	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.555C>T	10.37:g.126686543G>A			A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	pfam_D-isomer_2_OHA_DH_D-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.L725	ENST00000337195.5	37	c.2175	CCDS7643.1	10																																																																																			-	CTBP2	-	pfam_D-isomer_2_OHA_DH_D-bd,pfam_D-isomer_2_OHA_DH_cat_dom		0.687	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	HGNC	protein_coding	OTTHUMT00000050900.3	0	0	0	118	118	12	0.00	0.00	G	NM_001083914		126686543	-1	20	4	53	11	tier1	no_errors	ENST00000309035	ensembl	human	known	74_37	silent	27.40	26.67	SNP	1.000	A	20	53
POGZ	23126	genome.wustl.edu	37	1	151384868	151384868	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr1:151384868C>A	ENST00000271715.2	-	11	1997	c.1683G>T	c.(1681-1683)aaG>aaT	p.K561N	POGZ_ENST00000491586.1_Missense_Mutation_p.K508N|POGZ_ENST00000368863.2_Missense_Mutation_p.K466N|POGZ_ENST00000361398.3_Missense_Mutation_p.K508N|POGZ_ENST00000540984.1_5'UTR|POGZ_ENST00000531094.1_Missense_Mutation_p.K499N|POGZ_ENST00000392723.1_Missense_Mutation_p.K508N|POGZ_ENST00000409503.1_Missense_Mutation_p.K552N	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	561					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGATCTTGCACTTGGCTGTAA	0.383													ENSG00000143442																																					0													80.0	75.0	77.0					1																	151384868		2203	4300	6503	SO:0001583	missense	0			-	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.1683G>T	1.37:g.151384868C>A	ENSP00000271715:p.Lys561Asn		B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_D-bd_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_HTH_CenpB_D-bd_dom,pfscan_Znf_C2H2	p.K561N	ENST00000271715.2	37	c.1683	CCDS997.1	1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320390	0.60634	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000529669	T;T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;5.13;2.29	4.95	4.02	0.46733	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000003	T	0.40719	0.1128	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.981;1.0;0.996;0.996;0.999	D;D;D;D;D;D	0.83275	0.991;0.966;0.996;0.99;0.99;0.991	T	0.26258	-1.0108	10	0.27082	T	0.32	-20.0585	13.3574	0.60635	0.1589:0.8411:0.0:0.0	.	499;552;466;508;508;561	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	N	508;561;508;466;552;499;508;10	ENSP00000376484:K508N;ENSP00000271715:K561N;ENSP00000354467:K508N;ENSP00000357856:K466N;ENSP00000386836:K552N;ENSP00000431259:K499N;ENSP00000418408:K508N;ENSP00000432295:K10N	ENSP00000271715:K561N	K	-	3	2	POGZ	149651492	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.470000	0.45119	1.274000	0.44362	0.557000	0.71058	AAG	-	POGZ	-	smart_Znf_C2H2-like		0.383	POGZ-001	KNOWN	basic|CCDS	protein_coding	POGZ	HGNC	protein_coding	OTTHUMT00000034915.2	0	0	0	119	119	140	0.00	0.00	C	NM_207171		151384868	-1	34	28	32	27	tier1	no_errors	ENST00000271715	ensembl	human	known	74_37	missense	51.52	50.91	SNP	1.000	A	34	32
NIT1	4817	genome.wustl.edu	37	1	161089713	161089713	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr1:161089713G>A	ENST00000368009.2	+	5	638	c.562G>A	c.(562-564)Gag>Aag	p.E188K	NIT1_ENST00000368007.4_Missense_Mutation_p.E173K|DEDD_ENST00000489249.1_5'Flank|NIT1_ENST00000368008.1_Missense_Mutation_p.E188K|NIT1_ENST00000392190.5_Missense_Mutation_p.E152K|NIT1_ENST00000496861.1_3'UTR|PFDN2_ENST00000368010.3_5'Flank|PFDN2_ENST00000468311.1_5'Flank	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	188	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)			NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCCCAGTCTTGAGTCACCTGT	0.522											OREG0013937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000158793																																					0													68.0	66.0	67.0					1																	161089713		2203	4300	6503	SO:0001583	missense	0			-	AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.562G>A	1.37:g.161089713G>A	ENSP00000356988:p.Glu188Lys	1814	B1AQP3|D3DVF4|O76091	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.E188K	ENST00000368009.2	37	c.562	CCDS1218.1	1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.167816	0.38315	.	.	ENSG00000158793	ENST00000368009;ENST00000368007;ENST00000368008;ENST00000392190	D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32	4.85	3.94	0.45596	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.369201	0.27227	N	0.020323	T	0.57475	0.2056	N	0.20483	0.58	0.21967	N	0.999443	B;B;P	0.34864	0.05;0.27;0.473	B;B;B	0.38755	0.026;0.281;0.281	T	0.56625	-0.7948	10	0.06625	T	0.88	-5.1189	7.2971	0.26399	0.1934:0.0:0.8066:0.0	.	173;188;188	Q86X76-4;B1AQP4;Q86X76	.;.;NIT1_HUMAN	K	188;173;188;152	ENSP00000356988:E188K;ENSP00000356986:E173K;ENSP00000356987:E188K;ENSP00000376028:E152K	ENSP00000356986:E173K	E	+	1	0	NIT1	159356337	0.947000	0.32204	0.934000	0.37439	0.985000	0.73830	3.048000	0.49862	1.256000	0.44068	0.563000	0.77884	GAG	-	NIT1	-	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase		0.522	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIT1	HGNC	protein_coding	OTTHUMT00000077060.1	0	0	0	130	130	87	0.00	0.00	G			161089713	+1	12	10	124	54	tier1	no_errors	ENST00000368009	ensembl	human	known	74_37	missense	8.82	15.62	SNP	0.253	A	12	124
EFR3A	23167	genome.wustl.edu	37	8	132957051	132957051	+	Silent	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr8:132957051G>A	ENST00000254624.5	+	3	372	c.147G>A	c.(145-147)gaG>gaA	p.E49E	EFR3A_ENST00000519656.1_Silent_p.E13E|EFR3A_ENST00000334503.4_Silent_p.E49E	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	49						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			CTGCTCCAGAGAAACTGGATC	0.368													ENSG00000132294																																					0													93.0	87.0	89.0					8																	132957051		2203	4299	6502	SO:0001819	synonymous_variant	0			-	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.147G>A	8.37:g.132957051G>A			A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	superfamily_ARM-type_fold	p.E49	ENST00000254624.5	37	c.147	CCDS34942.2	8																																																																																			-	EFR3A	-	NULL		0.368	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	0	0	0	216	216	106	0.00	0.00	G	NM_015137		132957051	+1	59	23	221	99	tier1	no_errors	ENST00000254624	ensembl	human	known	74_37	silent	21.07	18.85	SNP	1.000	A	59	221
METTL25	84190	genome.wustl.edu	37	12	82752386	82752386	+	Silent	SNP	C	C	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr12:82752386C>G	ENST00000248306.3	+	1	111	c.42C>G	c.(40-42)ccC>ccG	p.P14P	CCDC59_ENST00000256151.7_5'UTR|CCDC59_ENST00000548126.1_Intron|METTL25_ENST00000547357.1_3'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	14							methyltransferase activity (GO:0008168)										CGGACCTGCCCACGCTGCGTG	0.627											OREG0022008	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000127720																																					0													60.0	51.0	54.0					12																	82752386		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.42C>G	12.37:g.82752386C>G		1216	Q9H5Y3	Silent	SNP	NULL	p.P14	ENST00000248306.3	37	c.42	CCDS9024.1	12																																																																																			-	METTL25	-	NULL		0.627	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL25	HGNC	protein_coding	OTTHUMT00000408192.1	0	0	0	68	68	22	0.00	0.00	C	NM_032230		82752386	+1	12	7	68	29	tier1	no_errors	ENST00000248306	ensembl	human	known	74_37	silent	15.00	19.44	SNP	0.058	G	12	68
ARHGAP30	257106	genome.wustl.edu	37	1	161018648	161018648	+	Silent	SNP	T	T	C			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr1:161018648T>C	ENST00000368013.3	-	12	2483	c.2163A>G	c.(2161-2163)aaA>aaG	p.K721K	ARHGAP30_ENST00000368015.1_Silent_p.K544K|USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Intron|USF1_ENST00000368021.3_5'Flank	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	721	Glu-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TCTTCTGACCTTTGGACTTCT	0.493													ENSG00000186517																																					0													249.0	262.0	258.0					1																	161018648		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.2163A>G	1.37:g.161018648T>C			Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K721	ENST00000368013.3	37	c.2163	CCDS30918.1	1																																																																																			-	ARHGAP30	-	NULL		0.493	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP30	HGNC	protein_coding	OTTHUMT00000077090.2	0	0	0	115	115	78	0.00	0.00	T	NM_181720		161018648	-1	39	37	79	40	tier1	no_errors	ENST00000368013	ensembl	human	known	74_37	silent	33.05	48.05	SNP	0.010	C	39	79
PIM2	11040	genome.wustl.edu	37	X	48771549	48771549	+	Silent	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chrX:48771549C>A	ENST00000376509.4	-	6	984	c.795G>T	c.(793-795)cgG>cgT	p.R265R	SLC35A2_ENST00000247138.5_5'Flank|SLC35A2_ENST00000413561.2_5'Flank|SLC35A2_ENST00000376512.1_5'Flank|SLC35A2_ENST00000376521.1_5'Flank|SLC35A2_ENST00000376529.3_5'Flank|SLC35A2_ENST00000452555.2_5'Flank|SLC35A2_ENST00000376515.3_5'Flank|SLC35A2_ENST00000445167.2_5'Flank|PIM2_ENST00000485431.1_5'UTR	NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			lung(3)|stomach(1)	4						GGGCCAGGCACCGGCGGATTA	0.587													ENSG00000102096																																					0													30.0	31.0	30.0					X																	48771549		2201	4298	6499	SO:0001819	synonymous_variant	0			-	U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.795G>T	X.37:g.48771549C>A			A8K4G6|Q99739	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R265	ENST00000376509.4	37	c.795	CCDS14312.1	X																																																																																			-	PIM2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.587	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM2	HGNC	protein_coding	OTTHUMT00000060805.1	0	0	0	103	103	43	0.00	0.00	C			48771549	-1	52	18	146	62	tier1	no_errors	ENST00000376509	ensembl	human	known	74_37	silent	26.26	22.50	SNP	1.000	A	52	146
RASGRF1	5923	genome.wustl.edu	37	15	79310205	79310205	+	Silent	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr15:79310205G>A	ENST00000419573.3	-	12	1924	c.1650C>T	c.(1648-1650)atC>atT	p.I550I	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Silent_p.I550I	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	550	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GCTCCACCCCGATTTTAAAAT	0.502													ENSG00000058335																																					0													121.0	111.0	114.0					15																	79310205		2196	4293	6489	SO:0001819	synonymous_variant	0			-	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1650C>T	15.37:g.79310205G>A			F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.I550	ENST00000419573.3	37	c.1650	CCDS10309.1	15																																																																																			-	RASGRF1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.502	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	0	0	0	194	194	130	0.00	0.00	G	NM_002891		79310205	-1	35	14	186	85	tier1	no_errors	ENST00000419573	ensembl	human	known	74_37	silent	15.84	14.14	SNP	0.430	A	35	186
PEG3	5178	genome.wustl.edu	37	19	57326959	57326959	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:57326959C>A	ENST00000326441.9	-	10	3214	c.2851G>T	c.(2851-2853)Gta>Tta	p.V951L	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.V951L|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.V827L|PEG3_ENST00000593695.1_Missense_Mutation_p.V825L	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	951					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GAGTGAATTACAGAGGTCTCA	0.468													ENSG00000198300																																					0													145.0	139.0	141.0					19																	57326959		2203	4300	6503	SO:0001583	missense	0			-	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2851G>T	19.37:g.57326959C>A	ENSP00000326581:p.Val951Leu		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.V951L	ENST00000326441.9	37	c.2851	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	15.46	2.838955	0.51057	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02890	4.12;4.12	3.99	2.96	0.34315	.	0.000000	0.42548	D	0.000692	T	0.04318	0.0119	M	0.66939	2.045	.	.	.	B;P;P	0.48764	0.141;0.858;0.915	B;B;B	0.44108	0.028;0.365;0.441	T	0.16897	-1.0387	9	0.34782	T	0.22	-13.7777	5.1178	0.14845	0.2041:0.69:0.0:0.106	.	827;951;886	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	L	951	ENSP00000326581:V951L;ENSP00000403051:V951L	ENSP00000326581:V951L	V	-	1	0	ZIM2	62018771	0.000000	0.05858	0.957000	0.39632	0.863000	0.49368	-0.102000	0.10956	1.287000	0.44583	0.655000	0.94253	GTA	-	PEG3	-	NULL		0.468	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	0	0	0	97	97	107	0.00	0.00	C			57326959	-1	61	32	99	79	tier1	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	38.12	28.83	SNP	0.566	A	61	99
TP53	7157	genome.wustl.edu	37	17	7578176	7578176	+	Splice_Site	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr17:7578176C>A	ENST00000269305.4	-	6	862		c.e6+1		TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(56)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAACCAGACCTCAGGCGGC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Unknown(56)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	ovary(12)|upper_aerodigestive_tract(10)|lung(8)|biliary_tract(5)|endometrium(5)|large_intestine(4)|oesophagus(4)|bone(4)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|cervix(1)|soft_tissue(1)|skin(1)|pancreas(1)	GRCh37	CS071266	TP53	S							80.0	75.0	77.0					17																	7578176		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.672+1G>T	17.37:g.7578176C>A			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e5+1	ENST00000269305.4	37	c.672+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964220	0.74131	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.205	0.59790	0.1605:0.8394:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518901	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.775000	0.85489	1.321000	0.45227	0.563000	0.77884	.	-	TP53	-	-		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	148	148	114	0.00	0.00	C	NM_000546	Intron	7578176	-1	168	100	41	18	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	80.38	84.75	SNP	1.000	A	168	41
ROCK1P1	727758	genome.wustl.edu	37	18	117148	117148	+	RNA	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr18:117148C>A	ENST00000608049.1	+	0	574					NR_033770.1				Rho-associated, coiled-coil containing protein kinase 1 pseudogene 1																		TGAGTTTATTCCTACACTCTA	0.423													ENSG00000263006																																					0																																												0			-			18p11.32	2012-10-04			ENSG00000263006	ENSG00000263006			37832	pseudogene	pseudogene							Standard	NR_033770		Approved		uc002kke.3		OTTHUMG00000177913		18.37:g.117148C>A				R	SNP	-	NULL	ENST00000608049.1	37	NULL		18																																																																																			-	ROCK1P1	-	-		0.423	ROCK1P1-003	KNOWN	basic	processed_transcript	ROCK1P1	HGNC	pseudogene	OTTHUMT00000472417.1	0	0	0	203	203	141	0.00	0.00	C			117148	+1	34	23	183	119	tier1	no_errors	ENST00000576266	ensembl	human	known	74_37	rna	15.67	16.08	SNP	1.000	A	34	183
PPP1R2P1	100507444	genome.wustl.edu	37	6	32847349	32847349	+	RNA	SNP	C	C	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr6:32847349C>G	ENST00000420261.1	-	0	276							Q96PQ5	IPP2L_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 1						glycogen metabolic process (GO:0005977)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of signal transduction (GO:0009966)		protein phosphatase inhibitor activity (GO:0004864)										GTTTCTGTATCACTACATGCA	0.428													ENSG00000234515																																					0																																												0			-	AF275684		6p21.32	2013-06-10		2001-08-31	ENSG00000234515	ENSG00000234515			9289	pseudogene	pseudogene				PPP1R2P		11696978, 7949733	Standard	NG_027882		Approved	IPP-2P		Q96PQ5	OTTHUMG00000031273		6.37:g.32847349C>G				R	SNP	-	NULL	ENST00000420261.1	37	NULL		6																																																																																			-	PPP1R2P1	-	-		0.428	PPP1R2P1-002	KNOWN	basic	processed_transcript	PPP1R2P1	HGNC	pseudogene	OTTHUMT00000276488.1	0	0	0	144	144	14	0.00	0.00	C	NG_027882		32847349	-1	16	4	94	10	tier1	no_errors	ENST00000420261	ensembl	human	known	74_37	rna	14.55	28.57	SNP	0.002	G	16	94
TBC1D32	221322	genome.wustl.edu	37	6	121544380	121544385	+	Splice_Site	DEL	ACAATA	ACAATA	-			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	ACAATA	ACAATA	ACAATA	-	ACAATA	ACAATA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr6:121544380_121544385delACAATA	ENST00000398212.2	-	21	2527_2531	c.2478_2482delTATTGT	c.(2476-2484)gttattgta>gtta	p.826_828VIV>V	TBC1D32_ENST00000398197.2_5'UTR|TBC1D32_ENST00000275159.6_Splice_Site_p.826_828VIV>V	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	826					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										AAAATGACTTACAATAACACATGTTG	0.301													ENSG00000146350																																					0																																										SO:0001630	splice_region_variant	0				AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2481+1TATTGT>-	6.37:g.121544380_121544385delACAATA			Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Splice_Site	DEL	-	e4-1	ENST00000398212.2	37	c.327+5_0	CCDS43501.1	6																																																																																				TBC1D32	-	-		0.301	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TBC1D32	HGNC	protein_coding	OTTHUMT00000380937.2	0	0	0	86	86	86	0.00	0.00	ACAATA	NM_152730	In_Frame_Del	121544385	-1	14	14	40	40	tier1	no_errors	ENST00000464622	ensembl	human	known	74_37	splice_site_del	25.93	25.93	DEL	1.000:0.999:0.878:0.870:0.829:0.780	-	14	40
PCF11	51585	genome.wustl.edu	37	11	82896849	82896852	+	3'UTR	DEL	TTCT	TTCT	-	rs139014507		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	TTCT	TTCT	TTCT	-	TTCT	TTCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr11:82896849_82896852delTTCT	ENST00000298281.4	+	0	6033_6036				RP11-727A23.11_ENST00000602322.1_lincRNA|RP11-727A23.4_ENST00000528133.1_RNA	NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						TTGTTTGTACTTCTTTATTTCTTG	0.314													ENSG00000269939																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.*916TTCT>-	11.37:g.82896849_82896852delTTCT			A6H8W7|O43671|Q6P0X8	R	DEL	-	NULL	ENST00000298281.4	37	NULL	CCDS44689.1	11																																																																																				RP11-727A23.11	-	-		0.314	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269939	Clone_based_vega_gene	protein_coding	OTTHUMT00000392548.2	0	0	0	114	114	80	0.00	0.00	TTCT	NM_015885		82896852	-1	57	27	50	20	tier1	no_errors	ENST00000602322	ensembl	human	known	74_37	rna	53.27	57.45	DEL	0.986:0.999:1.000:1.000	-	57	50
MASP1	5648	genome.wustl.edu	37	3	186974575	186974575	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr3:186974575delG	ENST00000337774.5	-	5	1010	c.621delC	c.(619-621)cccfs	p.P207fs	MASP1_ENST00000169293.6_Frame_Shift_Del_p.P207fs|MASP1_ENST00000296280.6_Frame_Shift_Del_p.P207fs|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000392472.2_Frame_Shift_Del_p.P94fs|MASP1_ENST00000392470.2_Frame_Shift_Del_p.P181fs	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	207	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.|Interaction with FCN2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.P207P(3)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CAGAGCTCTTGGGGTAAGGGT	0.493													ENSG00000127241																																					3	Substitution - coding silent(3)	lung(3)											164.0	139.0	147.0					3																	186974575		2203	4300	6503	SO:0001589	frameshift_variant	0				D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.621delC	3.37:g.186974575delG	ENSP00000336792:p.Pro207fs		A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Frame_Shift_Del	DEL	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.K208fs	ENST00000337774.5	37	c.621	CCDS33907.1	3																																																																																				MASP1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.493	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	0	0	0	67	67	125	0.00	0.00	G	NM_001879		186974575	-1	12	26	77	88	tier1	no_errors	ENST00000296280	ensembl	human	known	74_37	frame_shift_del	13.48	22.81	DEL	1.000	-	12	77
NAPEPLD	222236	genome.wustl.edu	37	7	102760459	102760459	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr7:102760459delG	ENST00000417955.1	-	3	660	c.506delC	c.(505-507)ccgfs	p.P169fs	NAPEPLD_ENST00000455523.2_Frame_Shift_Del_p.P242fs|NAPEPLD_ENST00000465647.1_Frame_Shift_Del_p.P169fs|NAPEPLD_ENST00000427257.1_Frame_Shift_Del_p.P169fs|NAPEPLD_ENST00000341533.4_Frame_Shift_Del_p.P169fs			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	169					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)	p.P169Q(1)		endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TATTGTGCACGGGGAACGACG	0.468													ENSG00000161048																																					1	Substitution - Missense(1)	lung(1)											211.0	185.0	194.0					7																	102760459		2203	4300	6503	SO:0001589	frameshift_variant	0				BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.506delC	7.37:g.102760459delG	ENSP00000407112:p.Pro169fs		Q5CZ87|Q769K1	Frame_Shift_Del	DEL	NULL	p.P242fs	ENST00000417955.1	37	c.725	CCDS5729.1	7																																																																																				PEPLD	-	NULL		0.468	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEPLD	HGNC	protein_coding	OTTHUMT00000347904.1	0	0	0	86	86	124	0.00	0.00	G	NM_198990		102760459	-1	17	20	113	132	tier1	no_errors	ENST00000455523	ensembl	human	known	74_37	frame_shift_del	13.08	13.16	DEL	1.000	-	17	113
KIFC3	3801	genome.wustl.edu	37	16	57832148	57832148	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr16:57832148G>A	ENST00000379655.4	-	2	265	c.8C>T	c.(7-9)cCc>cTc	p.P3L	KIFC3_ENST00000421376.2_5'Flank|KIFC3_ENST00000566975.1_5'Flank|KIFC3_ENST00000445690.2_Missense_Mutation_p.P3L|KIFC3_ENST00000539578.1_5'Flank|KIFC3_ENST00000541240.1_Missense_Mutation_p.P25L|KIFC3_ENST00000465878.2_5'Flank	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	3					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CCTGCGAGAGGGGACCATGGC	0.711													ENSG00000140859																																					0													3.0	3.0	3.0					16																	57832148		1813	3510	5323	SO:0001583	missense	0			-	BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.8C>T	16.37:g.57832148G>A	ENSP00000368976:p.Pro3Leu		A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P3L	ENST00000379655.4	37	c.8	CCDS10789.2	16	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023244	0.54683	.	.	ENSG00000140859	ENST00000379655;ENST00000445690;ENST00000541240	T;T;T	0.78246	-1.16;-1.16;-1.16	5.32	3.22	0.36961	.	0.925411	0.08973	U	0.866997	T	0.61590	0.2359	N	0.08118	0	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.002	T	0.54497	-0.8285	10	0.87932	D	0	.	10.8289	0.46649	0.0:0.0:0.6234:0.3766	.	25;3	B7Z484;Q9BVG8	.;KIFC3_HUMAN	L	3;3;25	ENSP00000368976:P3L;ENSP00000401696:P3L;ENSP00000442008:P25L	ENSP00000368976:P3L	P	-	2	0	KIFC3	56389649	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	2.421000	0.44688	1.172000	0.42781	0.591000	0.81541	CCC	-	KIFC3	-	NULL		0.711	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIFC3	HGNC	protein_coding	OTTHUMT00000257329.2	0	0	0	14	14	8	0.00	0.00	G	NM_005550		57832148	-1	8	3	18	2	tier1	no_errors	ENST00000379655	ensembl	human	known	74_37	missense	30.77	60.00	SNP	0.995	A	8	18
PCDHA8	56140	genome.wustl.edu	37	5	140223088	140223088	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr5:140223088A>C	ENST00000531613.1	+	1	2182	c.2182A>C	c.(2182-2184)Act>Cct	p.T728P	PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.T728P|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	728					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCACTGCCCACTGAGGGCGG	0.647													ENSG00000204962																																					0													53.0	52.0	52.0					5																	140223088		2196	4267	6463	SO:0001583	missense	0			-	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.2182A>C	5.37:g.140223088A>C	ENSP00000434655:p.Thr728Pro		B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T728P	ENST00000531613.1	37	c.2182	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	A	2.081	-0.410748	0.04799	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.13538	2.58;2.58	2.5	-3.1	0.05315	.	2.220660	0.03166	U	0.169962	T	0.21718	0.0523	M	0.66939	2.045	0.09310	N	1	P;P	0.39022	0.524;0.655	B;P	0.46629	0.163;0.522	T	0.32981	-0.9886	10	0.48119	T	0.1	.	5.2758	0.15649	0.4398:0.1614:0.3988:0.0	.	728;728	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	P	728	ENSP00000434655:T728P;ENSP00000367363:T728P	ENSP00000367363:T728P	T	+	1	0	PCDHA8	140203272	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.412000	0.02476	-0.748000	0.04753	-1.983000	0.00453	ACT	-	PCDHA8	-	NULL		0.647	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	0	0	0	94	94	21	0.00	0.00	A	NM_018911		140223088	+1	22	2	99	9	tier1	no_errors	ENST00000531613	ensembl	human	known	74_37	missense	18.18	18.18	SNP	0.000	C	22	99
ZFHX3	463	genome.wustl.edu	37	16	72827758	72827758	+	Silent	SNP	T	T	A	rs699444	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr16:72827758T>A	ENST00000268489.5	-	9	9495	c.8823A>T	c.(8821-8823)ggA>ggT	p.G2941G	ZFHX3_ENST00000397992.5_Silent_p.G2027G|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2941					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CAGGCCGATCTCCGCTGTCAC	0.522													ENSG00000140836																																					0													62.0	60.0	60.0					16																	72827758		2198	4300	6498	SO:0001819	synonymous_variant	0			-	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.8823A>T	16.37:g.72827758T>A			D3DWS8|O15101|Q13719	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.G2941	ENST00000268489.5	37	c.8823	CCDS10908.1	16																																																																																			-	ZFHX3	-	superfamily_Homeodomain-like		0.522	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	0	0	0	35	35	32	0.00	0.00	T	NM_006885		72827758	-1	25	17	14	9	tier1	no_errors	ENST00000268489	ensembl	human	known	74_37	silent	21.19	22.37	SNP	1.000	A	25	14
ZNF716	441234	genome.wustl.edu	37	7	57529220	57529220	+	Silent	SNP	C	C	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr7:57529220C>G	ENST00000420713.1	+	4	1165	c.1053C>G	c.(1051-1053)ctC>ctG	p.L351L		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	351					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						GGGAGAAACTCTACACATGTG	0.398													ENSG00000182111																																					0													60.0	62.0	61.0					7																	57529220		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1053C>G	7.37:g.57529220C>G				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L351	ENST00000420713.1	37	c.1053	CCDS55112.1	7																																																																																			-	ZNF716	-	pfscan_Znf_C2H2		0.398	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	HGNC	protein_coding	OTTHUMT00000345309.1	0	0	0	94	94	16	0.00	0.00	C	NM_001159279		57529220	+1	54	4	102	8	tier1	no_errors	ENST00000420713	ensembl	human	known	74_37	silent	34.62	33.33	SNP	0.772	G	54	102
TXNRD1	7296	genome.wustl.edu	37	12	104725408	104725408	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr12:104725408G>A	ENST00000529546.1	+	11	1300	c.1075G>A	c.(1075-1077)Gaa>Aaa	p.E359K	TXNRD1_ENST00000525566.1_Missense_Mutation_p.E547K|TXNRD1_ENST00000524698.1_Missense_Mutation_p.E397K|TXNRD1_ENST00000378070.4_Missense_Mutation_p.E496K|TXNRD1_ENST00000388854.3_Missense_Mutation_p.E449K|TXNRD1_ENST00000542918.1_Missense_Mutation_p.E447K|TXNRD1_ENST00000540716.1_Missense_Mutation_p.E359K|TXNRD1_ENST00000503506.2_Missense_Mutation_p.E397K|TXNRD1_ENST00000429002.2_Missense_Mutation_p.E547K|TXNRD1_ENST00000526691.1_Missense_Mutation_p.E449K|TXNRD1_ENST00000397736.2_Missense_Mutation_p.E441K|TXNRD1_ENST00000526390.1_Missense_Mutation_p.E441K|TXNRD1_ENST00000427956.1_Missense_Mutation_p.E512K|TXNRD1_ENST00000526950.1_Missense_Mutation_p.E466K|TXNRD1_ENST00000354940.6_Missense_Mutation_p.E397K			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	547					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	GTTTGGGGAAGAAAATATTGA	0.333													ENSG00000198431																									Ovarian(139;555 1836 9186 9946 10884)												0													71.0	64.0	66.0					12																	104725408		1817	4080	5897	SO:0001583	missense	0			-		CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.1075G>A	12.37:g.104725408G>A	ENSP00000434919:p.Glu359Lys		B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/D,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_D-bd_dom,pfam_FAD_bind_dom,pfam_Glutaredoxin,superfamily_FAD/D-linked_Rdtase_dimer,superfamily_Thioredoxin-like_fold,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Thioredoxin/glutathione_Rdtase	p.E547K	ENST00000529546.1	37	c.1639	CCDS58274.1	12	.	.	.	.	.	.	.	.	.	.	G	19.34	3.808922	0.70797	.	.	ENSG00000198431	ENST00000525566;ENST00000429002;ENST00000503506;ENST00000526691;ENST00000388854;ENST00000354940;ENST00000526390;ENST00000529546;ENST00000540716;ENST00000524698;ENST00000542918;ENST00000378070;ENST00000397736;ENST00000427956;ENST00000526950	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.70282	-0.34;-0.33;-0.43;-0.45;-0.45;-0.43;-0.44;-0.25;-0.25;-0.43;-0.45;-0.37;-0.44;-0.47;-0.46	5.67	5.67	0.87782	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.185926	0.56097	D	0.000024	T	0.68201	0.2975	L	0.56199	1.76	0.58432	D	0.999999	B;B;B;B;B;B;B	0.21606	0.004;0.002;0.053;0.002;0.002;0.058;0.032	B;B;B;B;B;B;B	0.27380	0.03;0.02;0.074;0.019;0.012;0.079;0.055	T	0.66002	-0.6031	10	0.56958	D	0.05	-26.477	14.0461	0.64706	0.072:0.0:0.928:0.0	.	447;441;547;449;397;547;512	B7Z2S5;E2QRB9;B7Z904;Q16881-4;B2R5P6;Q16881;E7EW10	.;.;.;.;.;TRXR1_HUMAN;.	K	547;547;397;449;449;397;441;359;359;397;447;496;441;512;466	ENSP00000434516:E547K;ENSP00000412045:E547K;ENSP00000421934:E397K;ENSP00000435929:E449K;ENSP00000373506:E449K;ENSP00000347020:E397K;ENSP00000435123:E441K;ENSP00000434919:E359K;ENSP00000442709:E359K;ENSP00000433425:E397K;ENSP00000440978:E447K;ENSP00000367310:E496K;ENSP00000380844:E441K;ENSP00000393328:E512K;ENSP00000432812:E466K	ENSP00000347020:E397K	E	+	1	0	TXNRD1	103249538	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.476000	0.66793	2.693000	0.91896	0.650000	0.86243	GAA	-	TXNRD1	-	pfam_Pyr_nucl-diS_OxRdtase_dimer,superfamily_FAD/D-linked_Rdtase_dimer,tigrfam_Thioredoxin/glutathione_Rdtase		0.333	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	TXNRD1	HGNC	protein_coding	OTTHUMT00000389969.1	0	0	0	257	257	116	0.00	0.00	G	NM_003330		104725408	+1	31	4	336	102	tier1	no_errors	ENST00000429002	ensembl	human	known	74_37	missense	8.45	3.77	SNP	1.000	A	31	336
FDXR	2232	genome.wustl.edu	37	17	72860089	72860090	+	Missense_Mutation	DNP	TC	TC	CT			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T|C	T|C	T|C	C|T	T|C	T|C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr17:72860089_72860090TC>CT	ENST00000293195.5	-	10	1180_1181	c.1102_1103GA>AG	c.(1102-1104)GAc>AGc	p.D368S	FDXR_ENST00000442102.2_Missense_Mutation_p.D411S|FDXR_ENST00000582944.1_Missense_Mutation_p.D360S|FDXR_ENST00000583917.1_Missense_Mutation_p.D340S|FDXR_ENST00000455107.2_Missense_Mutation_p.T351A|FDXR_ENST00000420580.2_Missense_Mutation_p.D328S|GRIN2C_ENST00000578159.1_5'Flank|FDXR_ENST00000413947.2_Missense_Mutation_p.D399S|FDXR_ENST00000581530.1_Missense_Mutation_p.D374S|FDXR_ENST00000581969.1_5'Flank|FDXR_ENST00000544854.1_Missense_Mutation_p.D316S	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	368					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	CACGCTTGGGTCGACAGGGCGG	0.624													ENSG00000161513																																					0																																										SO:0001583	missense	0			-	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.1102_1103delinsCT	17.37:g.72860089_72860090delinsCT	ENSP00000293195:p.Asp368Ser		B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/D	p.D374G|p.D374N	ENST00000293195.5	37	c.1121|c.1120	CCDS58593.1	17																																																																																			-	FDXR	-	NULL		0.624	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FDXR	HGNC	protein_coding	OTTHUMT00000444449.1	0	0	0	77	79|77	84	0.00	0.00	T|C	NM_004110		72860089|72860090	-1	17|16	8|9	83|82	93	tier1	no_errors	ENST00000581530	ensembl	human	known	74_37	missense	16.83|16.33	7.92|8.82	SNP	0.996|0.976	C|T	16	82
MX1	4599	genome.wustl.edu	37	21	42808961	42808961	+	Silent	SNP	G	G	T	rs139708669		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr21:42808961G>T	ENST00000398600.2	+	9	1343	c.318G>T	c.(316-318)ccG>ccT	p.P106P	MX1_ENST00000288383.6_Silent_p.P83P|MX1_ENST00000455164.2_Silent_p.P106P|MX1_ENST00000398598.3_Silent_p.P106P	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	106	Dynamin-type G.|GTPase domain (Globular).				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				CCAGATGCCCGCTGGTGCTGA	0.502													ENSG00000157601																																					0													95.0	84.0	88.0					21																	42808961		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.318G>T	21.37:g.42808961G>T			B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_GED,prints_Dynamin_SF	p.P106	ENST00000398600.2	37	c.318	CCDS13673.1	21																																																																																			-	MX1	-	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF		0.502	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX1	HGNC	protein_coding	OTTHUMT00000195161.2	0	0	1	157	157	120	0.00	0.83	G			42808961	+1	14	12	108	112	tier1	no_errors	ENST00000398598	ensembl	human	known	74_37	silent	11.48	9.68	SNP	0.911	T	14	108
AKAP6	9472	genome.wustl.edu	37	14	33291068	33291068	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr14:33291068C>A	ENST00000280979.4	+	13	4219	c.4049C>A	c.(4048-4050)gCa>gAa	p.A1350E	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1350					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AAGCCCTGCGCATGTCATGGA	0.433													ENSG00000151320																									Melanoma(49;821 1200 7288 13647 42351)												0													68.0	64.0	66.0					14																	33291068		2203	4299	6502	SO:0001583	missense	0			-	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4049C>A	14.37:g.33291068C>A	ENSP00000280979:p.Ala1350Glu		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.A1350E	ENST00000280979.4	37	c.4049	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.457805	0.01071	.	.	ENSG00000151320	ENST00000280979	T	0.04654	3.58	5.71	2.89	0.33648	.	1.095730	0.06825	N	0.792961	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.01281	0.0	T	0.43065	-0.9414	10	0.52906	T	0.07	0.0083	2.9334	0.05807	0.3605:0.3945:0.0:0.245	.	1350	Q13023	AKAP6_HUMAN	E	1350	ENSP00000280979:A1350E	ENSP00000280979:A1350E	A	+	2	0	AKAP6	32360819	0.000000	0.05858	0.176000	0.23000	0.504000	0.33889	0.225000	0.17757	0.753000	0.32945	0.563000	0.77884	GCA	-	AKAP6	-	NULL		0.433	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	0	0	0	51	51	62	0.00	0.00	C	NM_004274		33291068	+1	14	10	92	152	tier1	no_errors	ENST00000280979	ensembl	human	known	74_37	missense	13.21	6.17	SNP	0.000	A	14	92
VWF	7450	genome.wustl.edu	37	12	6131103	6131103	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr12:6131103T>C	ENST00000261405.5	-	27	3891	c.3637A>G	c.(3637-3639)Acc>Gcc	p.T1213A		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1213					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GGATTCAAGGTGACTTTCTTT	0.502													ENSG00000110799																																					0													135.0	142.0	139.0					12																	6131103		2203	4300	6503	SO:0001583	missense	0			-		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3637A>G	12.37:g.6131103T>C	ENSP00000261405:p.Thr1213Ala		Q8TCE8|Q99806	Missense_Mutation	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T1213A	ENST00000261405.5	37	c.3637	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	.	14.55	2.570276	0.45798	.	.	ENSG00000110799	ENST00000261405	T	0.35048	1.33	4.74	3.51	0.40186	.	0.584112	0.14329	N	0.326469	T	0.30386	0.0763	M	0.75447	2.3	0.80722	D	1	B	0.27791	0.189	B	0.19148	0.024	T	0.09443	-1.0674	10	0.13470	T	0.59	.	4.8434	0.13501	0.1686:0.0975:0.0:0.7339	.	1213	P04275	VWF_HUMAN	A	1213	ENSP00000261405:T1213A	ENSP00000261405:T1213A	T	-	1	0	VWF	6001364	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	2.094000	0.41719	2.120000	0.65058	0.397000	0.26171	ACC	-	VWF	-	pirsf_VWF		0.502	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	0	0	0	330	330	86	0.00	0.00	T	NM_000552		6131103	-1	71	8	405	83	tier1	no_errors	ENST00000261405	ensembl	human	known	74_37	missense	14.79	8.70	SNP	1.000	C	71	405
DOCK5	80005	genome.wustl.edu	37	8	25209283	25209283	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr8:25209283C>T	ENST00000276440.7	+	27	2835	c.2791C>T	c.(2791-2793)Cgg>Tgg	p.R931W		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	931					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TATAATGGAACGGCTGCTGAG	0.512													ENSG00000147459																									Pancreas(145;34 1887 3271 10937 30165)												0													126.0	93.0	104.0					8																	25209283		2203	4300	6503	SO:0001583	missense	0			-		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2791C>T	8.37:g.25209283C>T	ENSP00000276440:p.Arg931Trp		B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.R931W	ENST00000276440.7	37	c.2791	CCDS6047.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.514611|4.514611	0.85389|0.85389	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000276440|ENST00000444569	T|.	0.04234|.	3.67|.	5.84|5.84	4.94|4.94	0.65067|0.65067	.|.	0.059863|.	0.64402|.	D|.	0.000002|.	T|T	0.71434|0.71434	0.3339|0.3339	M|M	0.63428|0.63428	1.95|1.95	0.58432|0.58432	D|D	0.999991|0.999991	D;D;D|.	0.71674|.	0.998;0.996;0.998|.	P;P;P|.	0.61477|.	0.889;0.889;0.889|.	T|T	0.70579|0.70579	-0.4833|-0.4833	10|5	0.66056|.	D|.	0.02|.	.|.	15.8855|15.8855	0.79244|0.79244	0.1404:0.8596:0.0:0.0|0.1404:0.8596:0.0:0.0	.|.	921;706;931|.	D3DSS6;Q68DL4;Q9H7D0|.	.;.;DOCK5_HUMAN|.	W|M	931|702	ENSP00000276440:R931W|.	ENSP00000276440:R931W|.	R|T	+|+	1|2	2|0	DOCK5|DOCK5	25265200|25265200	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.928000|0.928000	0.56348|0.56348	2.622000|2.622000	0.46427|0.46427	1.400000|1.400000	0.46741|0.46741	0.655000|0.655000	0.94253|0.94253	CGG|ACG	-	DOCK5	-	superfamily_ARM-type_fold		0.512	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2	0	0	0	116	116	113	0.00	0.00	C	NM_024940		25209283	+1	11	6	90	88	tier1	no_errors	ENST00000276440	ensembl	human	known	74_37	missense	10.78	6.38	SNP	1.000	T	11	90
RNLS	55328	genome.wustl.edu	37	10	90034752	90034752	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr10:90034752C>T	ENST00000371947.3	-	7	2253	c.914G>A	c.(913-915)aGc>aAc	p.S305N	RNLS_ENST00000437752.1_Missense_Mutation_p.S222N	NM_018363.3	NP_060833.1	Q5VYX0	RNLS_HUMAN	renalase, FAD-dependent amine oxidase	0					cardiac left ventricle morphogenesis (GO:0003214)|dopamine metabolic process (GO:0042417)|epinephrine metabolic process (GO:0042414)|heart contraction (GO:0060047)|norepinephrine metabolic process (GO:0042415)|phosphate ion homeostasis (GO:0055062)|regulation of systemic arterial blood pressure (GO:0003073)|response to epinephrine (GO:0071871)|response to ischemia (GO:0002931)|response to norepinephrine (GO:0071873)|response to salt (GO:1902074)	extracellular space (GO:0005615)	oxidoreductase activity (GO:0016491)			breast(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7						CATCCAGGGGCTCTTCGCACA	0.448													ENSG00000184719																																					0													124.0	103.0	110.0					10																	90034752		2203	4300	6503	SO:0001583	missense	0			-	BC005364	CCDS7388.1, CCDS31239.1	10q23.31	2009-04-22	2009-04-22	2009-04-22	ENSG00000184719	ENSG00000184719			25641	protein-coding gene	gene with protein product		609360	"""chromosome 10 open reading frame 59"""	C10orf59		15841207, 17565281	Standard	NM_001031709		Approved	FLJ11218, renalase	uc001kfe.3	Q5VYX0	OTTHUMG00000018692	ENST00000371947.3:c.914G>A	10.37:g.90034752C>T	ENSP00000361015:p.Ser305Asn		Q9BS33|Q9NUP8	Missense_Mutation	SNP	pfam_Amino_oxidase	p.S305N	ENST00000371947.3	37	c.914	CCDS7388.1	10	.	.	.	.	.	.	.	.	.	.	C	6.047	0.377104	0.11466	.	.	ENSG00000184719	ENST00000371947;ENST00000437752	T;T	0.48522	0.83;0.81	1.39	-1.98	0.07480	.	.	.	.	.	T	0.17109	0.0411	N	0.08118	0	0.09310	N	1	P;B	0.37663	0.604;0.386	B;B	0.32090	0.14;0.047	T	0.16453	-1.0402	9	0.12103	T	0.63	.	2.7019	0.05150	0.0:0.3661:0.2566:0.3773	.	222;305	B4DJW3;Q5VYX0-2	.;.	N	305;222	ENSP00000361015:S305N;ENSP00000387577:S222N	ENSP00000361015:S305N	S	-	2	0	RNLS	90024732	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-1.345000	0.02637	-0.707000	0.05022	-0.759000	0.03464	AGC	-	RNLS	-	NULL		0.448	RNLS-001	KNOWN	basic|CCDS	protein_coding	RNLS	HGNC	protein_coding	OTTHUMT00000049249.1	0	0	0	81	81	77	0.00	0.00	C	NM_018363		90034752	-1	8	7	55	81	tier1	no_errors	ENST00000371947	ensembl	human	known	74_37	missense	12.50	7.95	SNP	0.001	T	8	55
SEL1L2	80343	genome.wustl.edu	37	20	13830169	13830169	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr20:13830169G>A	ENST00000284951.5	-	20	2103	c.2029C>T	c.(2029-2031)Cct>Tct	p.P677S	SEL1L2_ENST00000486903.1_5'UTR|SEL1L2_ENST00000378072.5_Missense_Mutation_p.P564S			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	677						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						ATCAGCCCAGGAACAATGAGG	0.478													ENSG00000101251																																					0													155.0	150.0	152.0					20																	13830169		1931	4145	6076	SO:0001583	missense	0			-	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.2029C>T	20.37:g.13830169G>A	ENSP00000284951:p.Pro677Ser		B4DXX5	Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.P677S	ENST00000284951.5	37	c.2029		20	.	.	.	.	.	.	.	.	.	.	G	5.506	0.278424	0.10403	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.22336	1.96;2.34	5.39	3.44	0.39384	.	1.021050	0.07801	N	0.956531	T	0.11067	0.0270	N	0.08118	0	0.09310	N	0.999993	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.002	T	0.29761	-1.0001	10	0.21014	T	0.42	0.2041	7.9411	0.29959	0.0:0.7508:0.1612:0.088	.	564;677	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	S	564;677	ENSP00000367312:P564S;ENSP00000284951:P677S	ENSP00000284951:P677S	P	-	1	0	SEL1L2	13778169	0.222000	0.23652	0.727000	0.30756	0.067000	0.16453	0.352000	0.20113	1.290000	0.44636	-0.155000	0.13514	CCT	-	SEL1L2	-	NULL		0.478	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	1	1	0	180	180	167	0.55	0.00	G	NM_025229		13830169	-1	32	24	223	221	tier1	no_errors	ENST00000284951	ensembl	human	known	74_37	missense	12.50	9.68	SNP	0.450	A	32	223
PAPPA2	60676	genome.wustl.edu	37	1	176679192	176679192	+	Silent	SNP	A	A	G			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr1:176679192A>G	ENST00000367662.3	+	11	4695	c.3531A>G	c.(3529-3531)gtA>gtG	p.V1177V		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1177					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCAGCATTGTAGACTGTGGCA	0.453													ENSG00000116183																																					0													137.0	129.0	131.0					1																	176679192		1894	4135	6029	SO:0001819	synonymous_variant	0			-	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3531A>G	1.37:g.176679192A>G			A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.V1177	ENST00000367662.3	37	c.3531	CCDS41438.1	1																																																																																			-	PAPPA2	-	NULL		0.453	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	0	0	0	100	100	118	0.00	0.00	A			176679192	+1	19	12	141	112	tier1	no_errors	ENST00000367662	ensembl	human	known	74_37	silent	11.88	9.68	SNP	0.002	G	19	141
CDH10	1008	genome.wustl.edu	37	5	24509886	24509886	+	Missense_Mutation	SNP	C	C	T	rs138533676		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr5:24509886C>T	ENST00000264463.4	-	7	1552	c.1045G>A	c.(1045-1047)Gaa>Aaa	p.E349K		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	349	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E349K(3)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TTTTCTGCTTCGACTTTCAGA	0.378										HNSCC(23;0.051)			ENSG00000040731																																					3	Substitution - Missense(3)	large_intestine(2)|central_nervous_system(1)						C	LYS/GLU	2,4404	2.1+/-5.4	0,2,2201	71.0	72.0	72.0		1045	5.0	1.0	5	dbSNP_134	72	0,8600		0,0,4300	no	missense	CDH10	NM_006727.3	56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	349/789	24509886	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1045G>A	5.37:g.24509886C>T	ENSP00000264463:p.Glu349Lys		Q9ULB3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E349K	ENST00000264463.4	37	c.1045	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973677	0.74246	4.54E-4	0.0	ENSG00000040731	ENST00000264463	T	0.01705	4.68	5.03	5.03	0.67393	Cadherin (5);Cadherin-like (1);	0.048877	0.85682	D	0.000000	T	0.07234	0.0183	L	0.56396	1.775	0.43164	D	0.994951	D	0.62365	0.991	P	0.59424	0.857	T	0.27297	-1.0078	10	0.42905	T	0.14	.	17.6996	0.88291	0.0:1.0:0.0:0.0	.	349	Q9Y6N8	CAD10_HUMAN	K	349	ENSP00000264463:E349K	ENSP00000264463:E349K	E	-	1	0	CDH10	24545643	0.990000	0.36364	0.997000	0.53966	0.879000	0.50718	2.869000	0.48444	2.502000	0.84385	0.561000	0.74099	GAA	rs138533676	CDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.378	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2	0	0	0	114	114	72	0.00	0.00	C	NM_006727		24509886	-1	23	8	170	97	tier1	no_errors	ENST00000264463	ensembl	human	known	74_37	missense	11.92	7.62	SNP	0.996	T	23	170
ABCA13	154664	genome.wustl.edu	37	7	48312581	48312581	+	Silent	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr7:48312581C>T	ENST00000435803.1	+	17	3342	c.3318C>T	c.(3316-3318)caC>caT	p.H1106H		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1106					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ACAATAAACACATTTCTTCCG	0.318													ENSG00000179869																																					0													51.0	50.0	50.0					7																	48312581		1818	4075	5893	SO:0001819	synonymous_variant	0			-	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.3318C>T	7.37:g.48312581C>T			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.H1106	ENST00000435803.1	37	c.3318	CCDS47584.1	7																																																																																			-	ABCA13	-	NULL		0.318	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	0	0	0	101	101	101	0.00	0.00	C	NM_152701		48312581	+1	19	8	119	73	tier1	no_errors	ENST00000435803	ensembl	human	known	74_37	silent	13.77	9.88	SNP	0.000	T	19	119
AC010504.2	0	genome.wustl.edu	37	19	34849728	34849729	+	RNA	INS	-	-	TTGGGAGGCCAAG	rs371848520|rs372921836|rs139773857|rs200887983	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:34849728_34849729insTTGGGAGGCCAAG	ENST00000591311.1	-	0	180_181																											atcccagcactgtgggaggatc	0.52													ENSG00000267219		604	0.120607	0.2421	0.0764	5008	,	,		18268	0.0069		0.0497	False		,,,				2504	0.1779																0																																												0																																19.37:g.34849728_34849729insTTGGGAGGCCAAG				R	INS	-	NULL	ENST00000591311.1	37	NULL		19																																																																																				AC010504.2	-	-		0.520	AC010504.2-001	KNOWN	basic	antisense	ENSG00000267219	Clone_based_vega_gene	antisense	OTTHUMT00000451683.1	0	0	0	0	0	0	0.00	0.00	-			34849729	-1	0	0	0	0	tier1	no_errors	ENST00000591311	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.005:0.003	TTGGGAGGCCAAG	0	0
ZSCAN1	284312	genome.wustl.edu	37	19	58549273	58549273	+	Silent	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:58549273C>T	ENST00000282326.1	+	3	316	c.69C>T	c.(67-69)gaC>gaT	p.D23D	ZSCAN1_ENST00000601162.1_Silent_p.D23D|ZSCAN1_ENST00000391700.1_Silent_p.D23D	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	23					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GTGAGCAGGACGCAGACCCTG	0.697													ENSG00000152467																																					0													10.0	12.0	11.0					19																	58549273		2031	4183	6214	SO:0001819	synonymous_variant	0			-	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.69C>T	19.37:g.58549273C>T			Q3B798|Q6WLH8|Q86WS8	Silent	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.D23	ENST00000282326.1	37	c.69	CCDS12969.1	19																																																																																			-	ZSCAN1	-	NULL		0.697	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	HGNC	protein_coding	OTTHUMT00000466427.1	0	0	0	60	60	13	0.00	0.00	C	NM_182572		58549273	+1	5	0	47	8	tier1	no_errors	ENST00000282326	ensembl	human	known	74_37	silent	9.62	0.00	SNP	0.000	T	5	47
EOMES	8320	genome.wustl.edu	37	3	27763427	27763428	+	In_Frame_Ins	INS	-	-	CGGCGC	rs368178421|rs1874198|rs3062761	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr3:27763427_27763428insCGGCGC	ENST00000295743.4	-	1	561_562	c.358_359insGCGCCG	c.(358-360)gcc>gGCGCCGcc	p.119_120insGA	EOMES_ENST00000537516.1_Intron|EOMES_ENST00000461503.1_Intron|EOMES_ENST00000449599.1_In_Frame_Ins_p.119_120insGA			O95936	EOMES_HUMAN	eomesodermin	119	Ala-rich.		A -> G (in dbSNP:rs12715125).		brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						ggcggcggcggctgcagcggcg	0.767													ENSG00000163508		2685	0.536142	0.3147	0.5274	5008	,	,		7250	0.8363		0.3837	False		,,,				2504	0.6892																0										101,91,844		44,2,11,38,13,410						-0.4	0.1		dbSNP_102	1	316,357,1963		136,0,44,143,71,924	no	codingComplex	EOMES	NM_005442.2		180,2,55,181,84,1334	A1A1,A1A2,A1R,A2A2,A2R,RR		25.5311,18.5328,23.5566				417,448,2807				SO:0001652	inframe_insertion	0				BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.358_359insGCGCCG	3.37:g.27763427_27763428insCGGCGC	ENSP00000295743:p.Ala119_Ala120insGlyAla		B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	In_Frame_Ins	INS	pfam_TF_T-box,superfamily_p53-like_TF_D-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.120in_frame_insGA	ENST00000295743.4	37	c.359_358	CCDS2646.1	3																																																																																				EOMES	-	NULL		0.767	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	HGNC	protein_coding	OTTHUMT00000252995.1	0	0	0	0	0	0	0.00	0.00	-	NM_005442		27763428	-1	0	0	0	0	tier1	no_errors	ENST00000449599	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.116:0.075	CGGCGC	0	0
KRTAP9-2	83899	genome.wustl.edu	37	17	39383043	39383043	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr17:39383043G>T	ENST00000377721.3	+	1	144	c.137G>T	c.(136-138)aGc>aTc	p.S46I	KRTAP9-2_ENST00000455970.2_Missense_Mutation_p.S46I	NM_031961.2	NP_114167.2	Q9BYQ4	KRA92_HUMAN	keratin associated protein 9-2	46	17 X 5 AA repeats of C-C-[RQVSGE]-[SPTQ]- [TASP].					keratin filament (GO:0045095)				large_intestine(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TGTGTGTCCAGCTGCTGCCAG	0.647													ENSG00000239886																																					0													63.0	56.0	58.0					17																	39383043		2203	4299	6502	SO:0001583	missense	0			-	AJ406946	CCDS32651.1	17q21.2	2013-06-25			ENSG00000239886	ENSG00000239886		"""Keratin associated proteins"""	16926	protein-coding gene	gene with protein product						11279113	Standard	NM_031961		Approved	KAP9.2	uc002hwf.3	Q9BYQ4	OTTHUMG00000133609	ENST00000377721.3:c.137G>T	17.37:g.39383043G>T	ENSP00000366950:p.Ser46Ile		Q17RK8|Q2TB15|Q6ISF6	Missense_Mutation	SNP	NULL	p.S46I	ENST00000377721.3	37	c.137	CCDS32651.1	17	.	.	.	.	.	.	.	.	.	.	.	12.17	1.858830	0.32884	.	.	ENSG00000239886	ENST00000377721;ENST00000455970	T;T	0.01933	4.55;4.61	2.85	1.84	0.25277	.	.	.	.	.	T	0.04452	0.0122	M	0.82716	2.605	0.31899	N	0.616243	B	0.17268	0.021	B	0.15484	0.013	T	0.01228	-1.1412	9	0.52906	T	0.07	.	7.015	0.24883	0.0:0.0:0.7286:0.2714	.	46	Q9BYQ4	KRA92_HUMAN	I	46	ENSP00000366950:S46I;ENSP00000398325:S46I	ENSP00000366950:S46I	S	+	2	0	KRTAP9-2	36636569	0.618000	0.27051	1.000000	0.80357	0.963000	0.63663	-0.229000	0.09098	0.746000	0.32786	0.552000	0.68991	AGC	-	KRTAP9-2	-	NULL		0.647	KRTAP9-2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP9-2	HGNC	protein_coding	OTTHUMT00000257717.1	0	0	0	231	231	3	0.00	0.00	G			39383043	+1	40	0	136	3	tier1	no_errors	ENST00000377721	ensembl	human	known	74_37	missense	22.60	0.00	SNP	1.000	T	40	136
ATP13A3	79572	genome.wustl.edu	37	3	194219220	194219221	+	5'Flank	INS	-	-	TTTTG	rs3077317|rs377149399|rs10662330	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr3:194219220_194219221insTTTTG	ENST00000439040.1	-	0	0				AC108676.1_ENST00000455557.2_RNA|LINC00884_ENST00000437597.1_RNA|LINC00884_ENST00000448892.1_RNA			Q9H7F0	AT133_HUMAN	ATPase type 13A3							integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TAGCTCTTCTTttttgttttgt	0.426													ENSG00000244675		748	0.149361	0.0749	0.2089	5008	,	,		23361	0.1081		0.2256	False		,,,				2504	0.1718																0																																										SO:0001631	upstream_gene_variant	0				AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034		3.37:g.194219226_194219230dupTTTTG	Exception_encountered		Q8NC11|Q96KS1	R	INS	-	NULL	ENST00000439040.1	37	NULL	CCDS43187.1	3																																																																																				AC108676.1	-	-		0.426	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LOC100507033	Clone_based_vega_gene	protein_coding	OTTHUMT00000342799.2	0	0	0	0	0	0	0.00	0.00	-	NM_024524		194219221	-1	0	0	0	0	tier1	no_errors	ENST00000455557	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.000:0.000	TTTTG	0	0
MT-ATP8	4509	genome.wustl.edu	37	M	8418	8418	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chrM:8418T>C	ENST00000361851.1	+	1	53	c.53T>C	c.(52-54)cTt>cCt	p.L18P	MT-TG_ENST00000387429.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TW_ENST00000387382.1_RNA			P03928	ATP8_HUMAN	mitochondrially encoded ATP synthase 8	18					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)										CCCCATACTCCTTACACTATT	0.368													ENSG00000228253																																					0																																										SO:0001583	missense	0			-			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000228253	ENSG00000228253		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7415	protein-coding gene	gene with protein product		516070	"""ATP synthase 8"""	MTATP8			Standard			Approved	ATP8, A6L		P03928		ENST00000361851.1:c.53T>C	M.37:g.8418T>C	ENSP00000355265:p.Leu18Pro		Q34771	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_su8_mt_metazoan	p.L18P	ENST00000361851.1	37	c.53		MT																																																																																			-	MT-ATP8	-	pfam_ATPase_F0-cplx_su8_mt_metazoan		0.368	MT-ATP8-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP8	HGNC	protein_coding		0	0	0	25	25	2	0.00	0.00	T	YP_003024030		8418	+1	4	0	16	2	tier1	no_errors	ENST00000361851	ensembl	human	known	74_37	missense	20.00	0.00	SNP	NULL	C	4	16
NCOR2	9612	genome.wustl.edu	37	12	124856967	124856967	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr12:124856967G>A	ENST00000405201.1	-	20	2408	c.2408C>T	c.(2407-2409)aCc>aTc	p.T803I	NCOR2_ENST00000356219.3_Missense_Mutation_p.T803I|NCOR2_ENST00000404621.1_Missense_Mutation_p.T785I|NCOR2_ENST00000429285.2_Missense_Mutation_p.T785I|NCOR2_ENST00000397355.1_Missense_Mutation_p.T786I|NCOR2_ENST00000404121.2_Missense_Mutation_p.T356I			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	803	Pro-rich.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		AGGGGCTCCGGTGGCTTCAGA	0.741													ENSG00000196498																																					0													5.0	7.0	6.0					12																	124856967		1717	3764	5481	SO:0001583	missense	0			-	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.2408C>T	12.37:g.124856967G>A	ENSP00000384018:p.Thr803Ile		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.T803I	ENST00000405201.1	37	c.2408	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	G	7.472	0.646879	0.14516	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;2.5;2.22;2.5;-0.12	4.63	2.79	0.32731	.	2.446060	0.01959	N	0.043211	T	0.44414	0.1292	N	0.08118	0	0.09310	N	1	B;B;B	0.23735	0.054;0.054;0.09	B;B;B	0.16289	0.006;0.006;0.015	T	0.36720	-0.9736	10	0.49607	T	0.09	-0.4545	6.9777	0.24686	0.0:0.2493:0.5827:0.168	.	785;786;803	C9J0Q5;C9J239;C9JFD3	.;.;.	I	803;785;803;786;802;356;785;803	ENSP00000384018:T803I;ENSP00000384202:T785I;ENSP00000348551:T803I;ENSP00000380513:T786I;ENSP00000385618:T356I;ENSP00000400281:T785I;ENSP00000402808:T803I	ENSP00000348551:T803I	T	-	2	0	NCOR2	123422920	0.995000	0.38212	0.000000	0.03702	0.000000	0.00434	0.000000	0.12993	0.380000	0.24823	-0.226000	0.12346	ACC	-	NCOR2	-	NULL		0.741	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	0	0	0	31	31	0	0.00	0.00	G	NM_006312		124856967	-1	4	0	18	0	tier1	no_errors	ENST00000356219	ensembl	human	known	74_37	missense	18.18	0.00	SNP	0.000	A	4	18
RPLP2	6181	genome.wustl.edu	37	11	810010	810018	+	5'UTR	DEL	CTCCGCCGC	CTCCGCCGC	-	rs11540443|rs17155725|rs542687757	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	CTCCGCCGC	CTCCGCCGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr11:810010_810018delCTCCGCCGC	ENST00000321153.4	+	0	364_372				PIDD_ENST00000534649.1_5'Flank|RPLP2_ENST00000532004.1_3'UTR|RPLP2_ENST00000530797.1_5'UTR|SNORA52_ENST00000362915.1_RNA	NM_001004.3	NP_000995.1	P05387	RLA2_HUMAN	ribosomal protein, large, P2						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGTGAGACTTCTCCGCCGCCTCCGCCGCA	0.713													ENSG00000177600		1438	0.287141	0.0877	0.2017	5008	,	,		15128	0.4018		0.3161	False		,,,				2504	0.4693																0																																										SO:0001623	5_prime_UTR_variant	0				M17887	CCDS7717.1	11p15.5	2011-07-29			ENSG00000177600	ENSG00000177600		"""L ribosomal proteins"""	10377	protein-coding gene	gene with protein product	"""60S acidic ribosomal protein P2"", ""acidic ribosomal phosphoprotein P2"""	180530		D11S2243E		3323886	Standard	NM_001004		Approved	P2, RPP2, MGC71408, LP2	uc001lrq.1	P05387	OTTHUMG00000133317	ENST00000321153.4:c.-23CTCCGCCGC>-	11.37:g.810019_810027delCTCCGCCGC			Q6FG96	R	DEL	-	NULL	ENST00000321153.4	37	NULL	CCDS7717.1	11																																																																																				RPLP2	-	-		0.713	RPLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPLP2	HGNC	protein_coding	OTTHUMT00000257115.2	0	0	0	4	4	4	0.00	0.00	CTCCGCCGC	NM_001004		810018	+1	0	0	1	1	tier1	no_errors	ENST00000532004	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.006:0.006:0.009:0.013:0.013:0.025:0.024	-	0	1
UFL1	23376	genome.wustl.edu	37	6	96969559	96969578	+	5'Flank	DEL	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC	-	rs3841018|rs112373805|rs67707404	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr6:96969559_96969578delAACCCCCAGCGCCGCGGTAC	ENST00000369278.4	+	0	0				UFL1_ENST00000461673.1_3'UTR|UFL1-AS1_ENST00000430796.1_RNA	NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1						negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										CGCCGGGAGGAACCCCCAGCGCCGCGGTACAACCACGGCA	0.7													ENSG00000014123		677	0.135184	0.1036	0.1772	5008	,	,		14561	0.0387		0.2157	False		,,,				2504	0.1646																0																																										SO:0001631	upstream_gene_variant	0				BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238		6.37:g.96969559_96969578delAACCCCCAGCGCCGCGGTAC	Exception_encountered		A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	R	DEL	-	NULL	ENST00000369278.4	37	NULL	CCDS5034.1	6																																																																																				UFL1	-	-		0.700	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	HGNC	protein_coding	OTTHUMT00000041557.1	0	0	0	2	2	2	0.00	0.00	AACCCCCAGCGCCGCGGTAC	NM_015323		96969578	+1	0	0	1	1	tier1	no_errors	ENST00000461673	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.000:0.001:0.001:0.003:0.006:0.006:0.002:0.000:0.000:0.000:0.000:0.000:0.000	-	0	1
HOXA7	3204	genome.wustl.edu	37	7	27192088	27192089	+	IGR	INS	-	-	GGCCT	rs117819065|rs71823962|rs145281130|rs3216926	byFrequency	TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr7:27192088_27192089insGGCCT	ENST00000242159.3	-	0	2020				HOXA7_ENST00000523796.2_5'Flank|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000524304.1_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|HOXA6_ENST00000521478.1_5'Flank|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000521197.1_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7						angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						GGGAGCCGCCAGGCCTGGCCTG	0.693													ENSG00000273433		940	0.1877	0.0416	0.2334	5008	,	,		12775	0.1379		0.2843	False		,,,				2504	0.3047																0																																										SO:0001628	intergenic_variant	0					CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217		7.37:g.27192094_27192098dupGGCCT			A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	R	INS	-	NULL	ENST00000242159.3	37	NULL	CCDS5408.1	7																																																																																				RP1-170O19.22	-	-		0.693	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000273433	Clone_based_vega_gene	protein_coding	OTTHUMT00000358695.1	0	0	0	2	2	2	0.00	0.00	-			27192089	-1	7	7	4	4	tier1	no_errors	ENST00000467897	ensembl	human	known	74_37	rna	63.64	63.64	INS	0.007:0.074	GGCCT	7	4
SMTN	6525	genome.wustl.edu	37	22	31503500	31503500	+	IGR	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr22:31503500G>A	ENST00000347557.2	+	0	3130				SELM_ENST00000465536.1_5'UTR|SELM_ENST00000400299.2_5'UTR|SELM_ENST00000402395.1_5'UTR	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin						muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						ATCGGGACCCGGCCGCAGATG	0.746													ENSG00000198832																																					0													4.0	6.0	5.0					22																	31503500		1859	3912	5771	SO:0001628	intergenic_variant	0			-	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203		22.37:g.31503500G>A			O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	R	SNP	-	NULL	ENST00000347557.2	37	NULL	CCDS13886.1	22																																																																																			-	SELM	-	-		0.746	SMTN-001	KNOWN	basic|CCDS	protein_coding	SELM	Uniprot_gn	protein_coding	OTTHUMT00000321766.1	0	0	0	47	47	2	0.00	0.00	G	NM_134270		31503500	-1	9	2	59	5	tier1	no_errors	ENST00000460642	ensembl	human	known	74_37	rna	13.24	28.57	SNP	0.013	A	9	59
DPY19L3	147991	genome.wustl.edu	37	19	32927362	32927362	+	Silent	SNP	C	C	T			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr19:32927362C>T	ENST00000342179.5	+	5	554	c.339C>T	c.(337-339)ggC>ggT	p.G113G	DPY19L3_ENST00000586987.1_Silent_p.G113G|DPY19L3_ENST00000392250.2_Silent_p.G113G	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	113						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					GTTTTCATGGCCTAATATATG	0.289													ENSG00000178904																																					0													43.0	48.0	46.0					19																	32927362		2198	4281	6479	SO:0001819	synonymous_variant	0			-		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.339C>T	19.37:g.32927362C>T			Q68DC7|Q6ZTB7|Q6ZTS2	Silent	SNP	pfam_Dpy-19	p.G113	ENST00000342179.5	37	c.339	CCDS12422.1	19	.	.	.	.	.	.	.	.	.	.	C	6.412	0.444160	0.12164	.	.	ENSG00000178904	ENST00000392248	.	.	.	5.87	3.71	0.42584	.	.	.	.	.	T	0.60894	0.2304	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63664	-0.6586	5	0.87932	D	0	-12.2576	5.3438	0.15998	0.1835:0.5792:0.0:0.2373	.	.	.	.	V	113	.	ENSP00000376079:A113V	A	+	2	0	DPY19L3	37619202	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	1.021000	0.30040	1.495000	0.48549	-0.137000	0.14449	GCC	-	DPY19L3	-	pfam_Dpy-19		0.289	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	HGNC	protein_coding	OTTHUMT00000450311.1	0	0	0	236	236	105	0.00	0.00	C	NM_207325		32927362	+1	65	2	310	67	tier1	no_errors	ENST00000342179	ensembl	human	known	74_37	silent	17.33	2.90	SNP	1.000	T	65	310
TMTC2	160335	genome.wustl.edu	37	12	83455574	83455574	+	Silent	SNP	G	G	A			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr12:83455574G>A	ENST00000321196.3	+	11	3002	c.2295G>A	c.(2293-2295)gaG>gaA	p.E765E	TMTC2_ENST00000549919.1_Silent_p.E759E	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	765					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						AAGCAGCTGAGAAGTATTATG	0.353													ENSG00000179104																																					0													117.0	114.0	115.0					12																	83455574		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.2295G>A	12.37:g.83455574G>A			B2RCU7|Q8N2K8	Silent	SNP	pfam_TPR_1,pfam_TPR_2,pfam_DUF1736,pfam_TPR-4,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E765	ENST00000321196.3	37	c.2295	CCDS9025.1	12																																																																																			-	TMTC2	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.353	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC2	HGNC	protein_coding	OTTHUMT00000405663.1	0	0	0	99	99	46	0.00	0.00	G	NM_152588		83455574	+1	21	3	131	37	tier1	no_errors	ENST00000321196	ensembl	human	known	74_37	silent	13.82	7.50	SNP	1.000	A	21	131
COBLL1	22837	genome.wustl.edu	37	2	165551295	165551296	+	Frame_Shift_Ins	INS	-	-	A	rs374805044		TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr2:165551295_165551296insA	ENST00000392717.2	-	13	2838_2839	c.2834_2835insT	c.(2833-2835)ttgfs	p.L945fs	COBLL1_ENST00000342193.4_Frame_Shift_Ins_p.L907fs|COBLL1_ENST00000375458.2_Frame_Shift_Ins_p.L869fs|COBLL1_ENST00000409184.3_Frame_Shift_Ins_p.L907fs|COBLL1_ENST00000194871.6_Frame_Shift_Ins_p.L974fs			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	945						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TCTGCATCTGCAAAAAAAAAGA	0.421													ENSG00000082438																																					0																																										SO:0001589	frameshift_variant	0				AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.2835dupT	2.37:g.165551304_165551304dupA	ENSP00000376478:p.Leu945fs		A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Frame_Shift_Ins	INS	pfam_Cordon-bleu_ubiquitin_domain,pfscan_WH2_dom	p.L974fs	ENST00000392717.2	37	c.2922_2921		2																																																																																				COBLL1	-	NULL		0.421	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		0	0	0	95	95	53	0.00	0.00	-	NM_014900		165551296	-1	5	2	48	35	tier1	no_errors	ENST00000194871	ensembl	human	known	74_37	frame_shift_ins	9.43	5.41	INS	0.958:0.972	A	5	48
ASIC2	40	genome.wustl.edu	37	17	31348283	31348285	+	In_Frame_Del	DEL	ATA	ATA	-			TCGA-DX-AB2V-01A-11D-A417-09	TCGA-DX-AB2V-10A-01D-A41A-09	ATA	ATA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6a7b2aef-6971-4bfc-a6d8-0cdce906213e	0cd670fd-cc01-4335-9b59-a21f57dd6b99	g.chr17:31348283_31348285delATA	ENST00000359872.6	-	7	2001_2003	c.1240_1242delTAT	c.(1240-1242)tatdel	p.Y414del	ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_In_Frame_Del_p.Y465del	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	414					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	CAATTGTCTCATAATTGAGAGCT	0.419													ENSG00000108684																																					0																																										SO:0001651	inframe_deletion	0				AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.1240_1242delTAT	17.37:g.31348283_31348285delATA	ENSP00000352934:p.Tyr414del		E9PBX2|Q13553|Q6DJU1|Q8N3E2	In_Frame_Del	DEL	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.Y465in_frame_del	ENST00000359872.6	37	c.1395_1393	CCDS42296.1	17																																																																																				ASIC2	-	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC		0.419	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	HGNC	protein_coding	OTTHUMT00000447552.1	0	0	0	79	79	75	0.00	0.00	ATA	NM_183377, NM_001094		31348285	-1	16	2	67	41	tier1	no_errors	ENST00000225823	ensembl	human	known	74_37	in_frame_del	19.28	4.65	DEL	1.000:1.000:1.000	-	16	67
