#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
UPF2	26019	genome.wustl.edu	37	10	11990442	11990442	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr10:11990442C>G	ENST00000356352.2	-	15	3573	c.3100G>C	c.(3100-3102)Gaa>Caa	p.E1034Q	UPF2_ENST00000357604.5_Missense_Mutation_p.E1034Q|UPF2_ENST00000397053.2_Missense_Mutation_p.E1034Q			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	1034	Glu-rich.|Sufficient for interaction with EIF4A1 and EIF1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				tcttcttcttcttcatcctct	0.363													ENSG00000151461																																					0													140.0	122.0	128.0					10																	11990442		2203	4300	6503	SO:0001583	missense	0			-	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.3100G>C	10.37:g.11990442C>G	ENSP00000348708:p.Glu1034Gln		A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.E1034Q	ENST00000356352.2	37	c.3100	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630455	0.46944	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.05258	3.47;3.47;3.47	5.47	5.47	0.80525	.	0.114545	0.64402	D	0.000020	T	0.16599	0.0399	L	0.40543	1.245	0.48341	D	0.999631	D	0.62365	0.991	D	0.74023	0.982	T	0.10706	-1.0618	10	0.14252	T	0.57	.	18.2595	0.90030	0.0:1.0:0.0:0.0	.	1034	Q9HAU5	RENT2_HUMAN	Q	1034	ENSP00000348708:E1034Q;ENSP00000350221:E1034Q;ENSP00000380244:E1034Q	ENSP00000348708:E1034Q	E	-	1	0	UPF2	12030448	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.735000	0.62051	2.728000	0.93425	0.585000	0.79938	GAA	-	UPF2	-	NULL		0.363	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	0	0	0	40	40	64	0.00	0.00	C			11990442	-1	9	11	49	62	tier1	no_errors	ENST00000356352	ensembl	human	known	74_37	missense	15.52	14.86	SNP	1.000	G	9	49
DNAH11	8701	genome.wustl.edu	37	7	21628211	21628211	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:21628211C>T	ENST00000409508.3	+	11	1961	c.1930C>T	c.(1930-1932)Cga>Tga	p.R644*	DNAH11_ENST00000328843.6_Nonsense_Mutation_p.R644*	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	644	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R644*(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GGTTCTCCAACGACTTCAAAT	0.393									Kartagener syndrome				ENSG00000105877																																					1	Substitution - Nonsense(1)	endometrium(1)											112.0	110.0	111.0					7																	21628211		1867	4113	5980	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.1930C>T	7.37:g.21628211C>T	ENSP00000475939:p.Arg644*		Q9UJ82	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R644*	ENST00000409508.3	37	c.1930		7	.	.	.	.	.	.	.	.	.	.	C	36	5.724446	0.96847	.	.	ENSG00000105877	ENST00000328843	.	.	.	5.75	4.86	0.63082	.	0.072523	0.51477	D	0.000082	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3532	0.74405	0.1411:0.8589:0.0:0.0	.	.	.	.	X	644	.	ENSP00000330671:R644X	R	+	1	2	DNAH11	21594736	1.000000	0.71417	0.915000	0.36163	0.001000	0.01503	3.070000	0.50033	1.552000	0.49463	-0.188000	0.12872	CGA	-	DH11	-	pfam_Dynein_heavy_dom-1		0.393	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DH11	HGNC	protein_coding	OTTHUMT00000326582.6	0	0	0	38	38	94	0.00	0.00	C	NM_003777		21628211	+1	11	38	26	64	tier1	no_errors	ENST00000328843	ensembl	human	known	74_37	nonsense	29.73	36.89	SNP	0.978	T	11	26
SHROOM3	57619	genome.wustl.edu	37	4	77700031	77700031	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr4:77700031C>A	ENST00000296043.6	+	11	6645	c.5692C>A	c.(5692-5694)Ctg>Atg	p.L1898M	RP11-359D14.3_ENST00000449007.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1898	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			GAAGGAGAACCTGGATCGCAG	0.527													ENSG00000138771																																					0													78.0	73.0	75.0					4																	77700031		2203	4300	6503	SO:0001583	missense	0			-	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.5692C>A	4.37:g.77700031C>A	ENSP00000296043:p.Leu1898Met		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L1898M	ENST00000296043.6	37	c.5692	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917886	0.73098	.	.	ENSG00000138771	ENST00000296043	T	0.35421	1.31	5.18	4.33	0.51752	Apx/shroom, ASD2 (2);	0.110919	0.39544	N	0.001332	T	0.61173	0.2326	M	0.79123	2.44	0.52501	D	0.999957	D	0.89917	1.0	D	0.73380	0.98	T	0.68010	-0.5522	10	0.72032	D	0.01	-10.2418	15.8956	0.79333	0.0:0.8563:0.1437:0.0	.	1898	Q8TF72	SHRM3_HUMAN	M	1898	ENSP00000296043:L1898M	ENSP00000296043:L1898M	L	+	1	2	SHROOM3	77919055	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	4.497000	0.60367	1.403000	0.46800	0.491000	0.48974	CTG	-	SHROOM3	-	pfam_ASD2		0.527	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	0	0	0	58	58	76	0.00	0.00	C	NM_020859		77700031	+1	15	13	33	28	tier1	no_errors	ENST00000296043	ensembl	human	known	74_37	missense	31.25	31.71	SNP	1.000	A	15	33
IRS4	8471	genome.wustl.edu	37	X	107976496	107976496	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chrX:107976496G>T	ENST00000372129.2	-	1	3155	c.3079C>A	c.(3079-3081)Cca>Aca	p.P1027T	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1027					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GCCATGGCTGGTGTCATTGCT	0.473													ENSG00000133124																																					0													85.0	79.0	81.0					X																	107976496		2203	4300	6503	SO:0001583	missense	0			-	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3079C>A	X.37:g.107976496G>T	ENSP00000361202:p.Pro1027Thr			Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.P1027T	ENST00000372129.2	37	c.3079	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081731	0.36758	.	.	ENSG00000133124	ENST00000372129	T	0.48522	0.81	5.38	2.19	0.27852	.	0.292856	0.32608	N	0.005876	T	0.33206	0.0855	L	0.27053	0.805	0.32588	N	0.527551	P	0.42692	0.787	B	0.43251	0.413	T	0.46205	-0.9208	10	0.72032	D	0.01	-8.8698	5.6011	0.17355	0.1015:0.1263:0.6406:0.1316	.	1027	O14654	IRS4_HUMAN	T	1027	ENSP00000361202:P1027T	ENSP00000361202:P1027T	P	-	1	0	IRS4	107863152	1.000000	0.71417	0.944000	0.38274	0.496000	0.33645	2.798000	0.47884	0.992000	0.38840	0.600000	0.82982	CCA	-	IRS4	-	NULL		0.473	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	0	0	0	61	61	97	0.00	0.00	G	NM_003604		107976496	-1	12	24	19	31	tier1	no_errors	ENST00000372129	ensembl	human	known	74_37	missense	38.71	43.64	SNP	0.976	T	12	19
COIL	8161	genome.wustl.edu	37	17	55016500	55016500	+	Missense_Mutation	SNP	T	T	C	rs533878148		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:55016500T>C	ENST00000240316.4	-	7	1697	c.1663A>G	c.(1663-1665)Aaa>Gaa	p.K555E	RP5-1107A17.3_ENST00000572187.1_RNA	NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	555	Tudor; atypical.					Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					ATCAACTCTTTCCAAAATACA	0.388													ENSG00000121058	T|||	1	0.000199681	0.0	0.0	5008	,	,		17301	0.0		0.001	False		,,,				2504	0.0																0													119.0	114.0	116.0					17																	55016500		2203	4300	6503	SO:0001583	missense	0			-	U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.1663A>G	17.37:g.55016500T>C	ENSP00000240316:p.Lys555Glu		B2R931	Missense_Mutation	SNP	NULL	p.K555E	ENST00000240316.4	37	c.1663	CCDS11592.1	17	.	.	.	.	.	.	.	.	.	.	T	11.31	1.600898	0.28534	.	.	ENSG00000121058	ENST00000240316	T	0.35048	1.33	4.84	4.84	0.62591	.	0.333481	0.31872	N	0.006935	T	0.21468	0.0517	N	0.14661	0.345	0.21950	N	0.999451	B	0.02656	0.0	B	0.08055	0.003	T	0.11012	-1.0605	10	0.32370	T	0.25	-14.4845	10.9787	0.47482	0.0:0.0:0.0:1.0	.	555	P38432	COIL_HUMAN	E	555	ENSP00000240316:K555E	ENSP00000240316:K555E	K	-	1	0	COIL	52371499	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	1.545000	0.36169	2.173000	0.68751	0.533000	0.62120	AAA	-	COIL	-	NULL		0.388	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COIL	HGNC	protein_coding	OTTHUMT00000440618.1	0	0	0	35	35	91	0.00	0.00	T			55016500	-1	17	23	31	54	tier1	no_errors	ENST00000240316	ensembl	human	known	74_37	missense	35.42	29.49	SNP	1.000	C	17	31
BACE1	23621	genome.wustl.edu	37	11	117161674	117161674	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:117161674G>A	ENST00000313005.6	-	7	1494	c.1034C>T	c.(1033-1035)tCa>tTa	p.S345L	BACE1_ENST00000513780.1_Missense_Mutation_p.S320L|BACE1_ENST00000392937.6_Missense_Mutation_p.S245L|BACE1_ENST00000510630.1_Missense_Mutation_p.S220L|BACE1_ENST00000445823.2_Missense_Mutation_p.S301L|BACE1_ENST00000428381.2_Missense_Mutation_p.S276L|BACE1_ENST00000514464.1_5'Flank|BACE1_ENST00000528053.1_Missense_Mutation_p.S311L	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	345					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		TAGGTAGAGTGAGATGACTGG	0.537													ENSG00000186318																																					0													176.0	154.0	162.0					11																	117161674		2201	4296	6497	SO:0001583	missense	0			-	AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.1034C>T	11.37:g.117161674G>A	ENSP00000318585:p.Ser345Leu		A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Missense_Mutation	SNP	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom,prints_Pept_A1_BACE,prints_Pept_A1_BACE1,prints_Aspartic_peptidase	p.S345L	ENST00000313005.6	37	c.1034	CCDS8383.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.165795	0.94768	.	.	ENSG00000186318	ENST00000313005;ENST00000392937;ENST00000528053;ENST00000510630;ENST00000428381;ENST00000513780;ENST00000445823;ENST00000292095	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.93	5.02	0.67125	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	M	0.71871	2.18	0.80722	D	1	D;D;D;P;D;D	0.89917	0.999;0.996;1.0;0.928;1.0;0.981	D;D;D;P;D;P	0.83275	0.995;0.969;0.996;0.713;0.993;0.872	T	0.67138	-0.5746	10	0.62326	D	0.03	.	14.3799	0.66905	0.0707:0.0:0.9293:0.0	.	245;220;345;301;276;320	F8W807;E9PE65;P56817;P56817-3;P56817-4;P56817-2	.;.;BACE1_HUMAN;.;.;.	L	345;245;311;220;276;320;301;111	ENSP00000318585:S345L;ENSP00000431848:S311L;ENSP00000422461:S220L;ENSP00000402228:S276L;ENSP00000424536:S320L;ENSP00000403685:S301L	ENSP00000292095:S111L	S	-	2	0	BACE1	116666884	1.000000	0.71417	0.939000	0.37840	0.818000	0.46254	9.165000	0.94761	1.511000	0.48818	-0.150000	0.13652	TCA	-	BACE1	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom		0.537	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BACE1	HGNC	protein_coding	OTTHUMT00000361505.1	0	0	0	37	37	105	0.00	0.00	G			117161674	-1	20	22	25	67	tier1	no_errors	ENST00000313005	ensembl	human	known	74_37	missense	44.44	24.72	SNP	1.000	A	20	25
PLCXD1	55344	genome.wustl.edu	37	X	215829	215829	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chrX:215829G>A	ENST00000381657.2	+	7	1313	c.799G>A	c.(799-801)Gag>Aag	p.E267K	PLCXD1_ENST00000399012.1_Missense_Mutation_p.E267K|PLCXD1_ENST00000381663.3_Missense_Mutation_p.E267K	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1	267					lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)			endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCACCCGTCCGAGTCCCTGGA	0.652													ENSG00000182378																																					0													121.0	108.0	112.0					X																	215829		2203	4296	6499	SO:0001583	missense	0			-	AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.799G>A	X.37:g.215829G>A	ENSP00000371073:p.Glu267Lys		A2BH51|A2BH52	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.E267K	ENST00000381657.2	37	c.799	CCDS14103.1	X	.	.	.	.	.	.	.	.	.	.	.	4.180	0.031928	0.08101	.	.	ENSG00000182378	ENST00000399012;ENST00000381657;ENST00000381663	T;T;T	0.29655	1.56;1.56;1.56	1.77	-0.753	0.11068	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.717660	0.13746	N	0.365595	T	0.08492	0.0211	.	.	.	0.09310	N	1	P	0.36412	0.552	B	0.22152	0.038	T	0.32268	-0.9913	9	0.07175	T	0.84	-6.1112	4.6553	0.12615	0.156:0.2206:0.6234:0.0	.	267	Q9NUJ7	PLCX1_HUMAN	K	267	ENSP00000381976:E267K;ENSP00000371073:E267K;ENSP00000371079:E267K	ENSP00000371073:E267K	E	+	1	0	PLCXD1	155829	0.596000	0.26866	0.275000	0.24674	0.664000	0.39144	0.881000	0.28173	-0.482000	0.06782	0.181000	0.17075	GAG	-	PLCXD1	-	superfamily_PLC-like_Pdiesterase_TIM-brl		0.652	PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLCXD1	HGNC	protein_coding	OTTHUMT00000058879.2	0	0	0	125	125	62	0.00	0.00	G	NM_018390		215829	+1	33	20	102	17	tier1	no_errors	ENST00000381657	ensembl	human	known	74_37	missense	24.44	54.05	SNP	0.880	A	33	102
TNK2	10188	genome.wustl.edu	37	3	195609097	195609097	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:195609097C>A	ENST00000333602.6	-	6	1329	c.712G>T	c.(712-714)Gag>Tag	p.E238*	TNK2_ENST00000468819.1_Intron|TNK2_ENST00000392400.1_Nonsense_Mutation_p.E238*|TNK2_ENST00000381916.2_Nonsense_Mutation_p.E301*|TNK2_ENST00000428187.1_Nonsense_Mutation_p.E270*|TNK2_ENST00000316664.3_Nonsense_Mutation_p.E238*	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	238	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CCCATGCCCTCAGCCACCTGC	0.617													ENSG00000061938																																					0													103.0	86.0	92.0					3																	195609097		2203	4300	6503	SO:0001587	stop_gained	0			-	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.712G>T	3.37:g.195609097C>A	ENSP00000329425:p.Glu238*		Q6ZMQ0|Q8N6U7|Q96H59	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cdc42_binding_dom_like,pfam_Inhibitor_Mig-6,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.E301*	ENST00000333602.6	37	c.901	CCDS33928.1	3	.	.	.	.	.	.	.	.	.	.	C	39	7.757602	0.98474	.	.	ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000428187;ENST00000392400;ENST00000316664	.	.	.	4.74	4.74	0.60224	.	0.217045	0.49305	D	0.000150	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	7.3106	0.26473	0.0:0.8213:0.0:0.1787	.	.	.	.	X	238;301;270;238;238	.	ENSP00000323216:E238X	E	-	1	0	TNK2	197093494	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.332000	0.43903	2.614000	0.88457	0.655000	0.94253	GAG	-	TNK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.617	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TNK2	HGNC	protein_coding	OTTHUMT00000341437.3	0	0	0	52	52	49	0.00	0.00	C	NM_005781		195609097	-1	7	8	37	23	tier1	no_errors	ENST00000381916	ensembl	human	known	74_37	nonsense	15.91	25.81	SNP	0.998	A	7	37
VPS13C	54832	genome.wustl.edu	37	15	62273609	62273609	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr15:62273609C>G	ENST00000261517.5	-	22	2171	c.2098G>C	c.(2098-2100)Gta>Cta	p.V700L	VPS13C_ENST00000395896.4_Missense_Mutation_p.V700L|VPS13C_ENST00000395898.3_Missense_Mutation_p.V657L|VPS13C_ENST00000249837.3_Missense_Mutation_p.V657L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TGTGGAACTACTAGATAAGAA	0.343													ENSG00000129003																																					0													79.0	75.0	76.0					15																	62273609		2203	4300	6503	SO:0001583	missense	0			-	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.2098G>C	15.37:g.62273609C>G	ENSP00000261517:p.Val700Leu			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.V700L	ENST00000261517.5	37	c.2098	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141915	0.37825	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.34275	1.37;1.37;1.37	5.92	2.47	0.30058	.	0.184175	0.48286	D	0.000181	T	0.19846	0.0477	N	0.25332	0.735	0.33217	D	0.55424	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.002;0.003;0.003;0.001	T	0.14924	-1.0455	10	0.21540	T	0.41	.	4.6931	0.12790	0.0:0.3364:0.1586:0.505	.	657;700;657;700	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	L	657;700;700;700	ENSP00000249837:V657L;ENSP00000261517:V700L;ENSP00000379233:V700L	ENSP00000249837:V657L	V	-	1	0	VPS13C	60060901	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.745000	0.26259	0.497000	0.27926	-0.137000	0.14449	GTA	-	VPS13C	-	NULL		0.343	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	1	1	0	135	135	123	0.73	0.00	C	NM_017684		62273609	-1	21	18	197	135	tier1	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	9.63	11.76	SNP	0.982	G	21	197
IL17RE	132014	genome.wustl.edu	37	3	9944676	9944676	+	Silent	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:9944676C>G	ENST00000383814.3	+	1	165	c.60C>G	c.(58-60)ctC>ctG	p.L20L	IL17RE_ENST00000295980.3_Silent_p.L20L|IL17RE_ENST00000421412.1_Silent_p.L53L|IL17RE_ENST00000454190.2_Silent_p.L20L	NM_153480.1	NP_705613.1	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E	20					inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(11)|skin(1)	21				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		TCATCGACCTCTCTGACTCTG	0.617													ENSG00000163701																																					0													85.0	76.0	79.0					3																	9944676		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF458069	CCDS2589.1, CCDS54552.1	3p25.3	2008-02-05			ENSG00000163701	ENSG00000163701		"""Interleukins and interleukin receptors"""	18439	protein-coding gene	gene with protein product		614995					Standard	NM_153480		Approved	FLJ23658	uc003btu.3	Q8NFR9	OTTHUMG00000128649	ENST00000383814.3:c.60C>G	3.37:g.9944676C>G			B2RB34|B2RNR1|B9EH65|Q6P532|Q8N8H7|Q8N8H8|Q8TEC2	Silent	SNP	pfam_SEFIR	p.L53	ENST00000383814.3	37	c.159	CCDS2589.1	3																																																																																			-	IL17RE	-	NULL		0.617	IL17RE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RE	HGNC	protein_coding	OTTHUMT00000250529.1	0	0	0	61	61	30	0.00	0.00	C	NM_153480		9944676	+1	45	27	43	18	tier1	no_errors	ENST00000421412	ensembl	human	known	74_37	silent	51.14	60.00	SNP	0.028	G	45	43
THSD7A	221981	genome.wustl.edu	37	7	11485924	11485924	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:11485924T>A	ENST00000423059.4	-	13	3079	c.2828A>T	c.(2827-2829)aAa>aTa	p.K943I	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	943	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ATGGGAATTTTTACATTTTTC	0.353										HNSCC(18;0.044)			ENSG00000005108																																					0													149.0	143.0	145.0					7																	11485924		1811	4080	5891	SO:0001583	missense	0			-		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2828A>T	7.37:g.11485924T>A	ENSP00000406482:p.Lys943Ile			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.K943I	ENST00000423059.4	37	c.2828	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	T	21.9	4.211749	0.79240	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.60424	0.19	5.74	4.4	0.53042	.	0.127023	0.64402	D	0.000001	T	0.53400	0.1794	L	0.53249	1.67	0.46542	D	0.999091	B	0.26318	0.146	B	0.32090	0.14	T	0.53704	-0.8401	10	0.38643	T	0.18	.	11.6327	0.51185	0.0:0.1236:0.0:0.8764	.	943	Q9UPZ6	THS7A_HUMAN	I	943	ENSP00000406482:K943I	ENSP00000262042:K943I	K	-	2	0	THSD7A	11452449	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.859000	0.48364	2.193000	0.70182	0.482000	0.46254	AAA	-	THSD7A	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.353	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	0	0	0	49	49	91	0.00	0.00	T	XM_928187.2		11485924	-1	12	16	52	69	tier1	no_errors	ENST00000423059	ensembl	human	known	74_37	missense	18.75	18.82	SNP	1.000	A	12	52
VPS13C	54832	genome.wustl.edu	37	15	62273582	62273582	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr15:62273582C>T	ENST00000261517.5	-	22	2198	c.2125G>A	c.(2125-2127)Gaa>Aaa	p.E709K	VPS13C_ENST00000395896.4_Missense_Mutation_p.E709K|VPS13C_ENST00000395898.3_Missense_Mutation_p.E666K|VPS13C_ENST00000249837.3_Missense_Mutation_p.E666K	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TCTGACTTTTCATGGTGGAAA	0.368													ENSG00000129003																																					0													86.0	80.0	82.0					15																	62273582		2203	4300	6503	SO:0001583	missense	0			-	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.2125G>A	15.37:g.62273582C>T	ENSP00000261517:p.Glu709Lys			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.E709K	ENST00000261517.5	37	c.2125	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797447	0.31777	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.92	2.92	0.33932	.	0.989920	0.08245	N	0.975453	T	0.42539	0.1207	L	0.56769	1.78	0.35419	D	0.793047	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.10450	0.005;0.005;0.005;0.002	T	0.37731	-0.9693	10	0.52906	T	0.07	.	10.9482	0.47312	0.0:0.8007:0.0:0.1993	.	666;709;666;709	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	K	666;709;709;709	ENSP00000249837:E666K;ENSP00000261517:E709K;ENSP00000379233:E709K;ENSP00000379235:E709K	ENSP00000249837:E666K	E	-	1	0	VPS13C	60060874	0.080000	0.21391	0.959000	0.39883	0.984000	0.73092	0.486000	0.22340	0.352000	0.24053	0.655000	0.94253	GAA	-	VPS13C	-	NULL		0.368	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	0	0	0	135	135	121	0.00	0.00	C	NM_017684		62273582	-1	17	18	186	131	tier1	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	8.37	12.08	SNP	0.995	T	17	186
BAZ2B	29994	genome.wustl.edu	37	2	160261574	160261574	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr2:160261574T>G	ENST00000392783.2	-	15	3224	c.2729A>C	c.(2728-2730)cAg>cCg	p.Q910P	BAZ2B_ENST00000355831.2_Missense_Mutation_p.Q876P|BAZ2B_ENST00000343439.5_Missense_Mutation_p.Q810P|BAZ2B_ENST00000392782.1_Missense_Mutation_p.Q874P|AC008277.1_ENST00000420020.1_RNA|AC008277.1_ENST00000594921.1_RNA	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	910	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						AGCCTGTTCCTGCTTTTGAAG	0.353													ENSG00000123636																																					0													166.0	143.0	150.0					2																	160261574		1808	4089	5897	SO:0001583	missense	0			-	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2729A>C	2.37:g.160261574T>G	ENSP00000376534:p.Gln910Pro		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_D-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_D-bd_dom,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_D-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_D-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.Q910P	ENST00000392783.2	37	c.2729	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.880195	0.91740	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.32753	1.44;1.95;1.44;2.23	5.81	5.81	0.92471	.	0.000000	0.35320	U	0.003288	T	0.50582	0.1624	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.85130	0.995;0.997;0.994;0.993	T	0.44034	-0.9354	10	0.44086	T	0.13	-7.8279	16.1581	0.81680	0.0:0.0:0.0:1.0	.	714;810;874;910	Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;BAZ2B_HUMAN	P	874;910;876;810	ENSP00000376533:Q874P;ENSP00000376534:Q910P;ENSP00000348087:Q876P;ENSP00000339670:Q810P	ENSP00000339670:Q810P	Q	-	2	0	BAZ2B	159969820	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.959000	0.87885	2.220000	0.72140	0.477000	0.44152	CAG	-	BAZ2B	-	NULL		0.353	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	0	0	0	83	83	92	0.00	0.00	T			160261574	-1	30	23	89	71	tier1	no_errors	ENST00000392783	ensembl	human	known	74_37	missense	25.21	24.47	SNP	1.000	G	30	89
RHOBTB1	9886	genome.wustl.edu	37	10	62648444	62648444	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr10:62648444C>T	ENST00000337910.5	-	6	1319	c.982G>A	c.(982-984)Gac>Aac	p.D328N	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.D328N	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	328	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					TCCTCTGGGTCGACACTCAAT	0.537													ENSG00000072422																																					0													51.0	56.0	55.0					10																	62648444		2203	4300	6503	SO:0001583	missense	0			-	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.982G>A	10.37:g.62648444C>T	ENSP00000338671:p.Asp328Asn			Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_BTB/POZ_fold,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_BTB/POZ-like,pfscan_BTB/POZ-like,prints_Small_GTPase	p.D328N	ENST00000337910.5	37	c.982	CCDS7261.1	10	.	.	.	.	.	.	.	.	.	.	C	10.49	1.364174	0.24684	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.18502	2.21;2.21	5.91	5.01	0.66863	BTB/POZ-like (2);BTB/POZ fold (1);	0.318789	0.30260	N	0.010027	T	0.23451	0.0567	M	0.65975	2.015	0.53688	D	0.999976	B	0.18968	0.032	B	0.26770	0.073	T	0.02269	-1.1185	10	0.34782	T	0.22	.	15.2269	0.73359	0.0:0.9326:0.0:0.0674	.	328	O94844	RHBT1_HUMAN	N	328	ENSP00000350595:D328N;ENSP00000338671:D328N	ENSP00000338671:D328N	D	-	1	0	RHOBTB1	62318450	0.435000	0.25577	0.022000	0.16811	0.048000	0.14542	2.490000	0.45294	1.510000	0.48803	0.460000	0.39030	GAC	-	RHOBTB1	-	superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.537	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB1	HGNC	protein_coding	OTTHUMT00000048220.1	0	0	0	48	48	94	0.00	0.00	C			62648444	-1	10	30	22	52	tier1	no_errors	ENST00000337910	ensembl	human	known	74_37	missense	31.25	36.59	SNP	0.993	T	10	22
SYT6	148281	genome.wustl.edu	37	1	114682308	114682308	+	Missense_Mutation	SNP	C	C	T	rs543454369		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:114682308C>T	ENST00000610222.1	-	2	587	c.441G>A	c.(439-441)atG>atA	p.M147I	SYT6_ENST00000607941.1_Missense_Mutation_p.M62I|SYT6_ENST00000393296.1_Missense_Mutation_p.M147I|SYT6_ENST00000609117.1_Missense_Mutation_p.M62I|SYT6_ENST00000369547.1_Missense_Mutation_p.M62I			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	147					acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTTGACCGACATCTGCACCT	0.617													ENSG00000134207																																					0													107.0	86.0	93.0					1																	114682308		2203	4300	6503	SO:0001583	missense	0			-		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.441G>A	1.37:g.114682308C>T	ENSP00000476396:p.Met147Ile		B1AMB8|B3KPK1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.M147I	ENST00000610222.1	37	c.441		1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372178	0.61624	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545;ENST00000425037;ENST00000447981	T;T;T;T;T;T	0.56941	0.43;0.44;0.43;0.44;1.57;0.97	5.76	5.76	0.90799	.	0.047229	0.85682	D	0.000000	T	0.37156	0.0993	L	0.44542	1.39	0.53688	D	0.999972	B	0.13145	0.007	B	0.10450	0.005	T	0.12760	-1.0535	10	0.44086	T	0.13	.	19.9738	0.97296	0.0:1.0:0.0:0.0	.	147	Q5T7P8	SYT6_HUMAN	I	62;147;62;147;62;62	ENSP00000358560:M62I;ENSP00000376974:M147I;ENSP00000358559:M62I;ENSP00000358558:M147I;ENSP00000412443:M62I;ENSP00000389266:M62I	ENSP00000358558:M147I	M	-	3	0	SYT6	114483831	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.238000	0.32707	2.732000	0.93576	0.655000	0.94253	ATG	-	SYT6	-	NULL		0.617	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	HGNC	protein_coding	OTTHUMT00000314819.2	0	0	0	23	23	47	0.00	0.00	C	NM_205848		114682308	-1	18	19	26	13	tier1	no_errors	ENST00000393296	ensembl	human	known	74_37	missense	40.91	59.38	SNP	1.000	T	18	26
MORN3	283385	genome.wustl.edu	37	12	122091053	122091053	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr12:122091053C>T	ENST00000355329.3	-	4	746	c.576G>A	c.(574-576)atG>atA	p.M192I		NM_173855.4	NP_776254.3	Q6PF18	MORN3_HUMAN	MORN repeat containing 3	192						nucleus (GO:0005634)				breast(2)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)		CGCATTTGGCCATATTGTCCA	0.622													ENSG00000139714																																					0													66.0	54.0	58.0					12																	122091053		2203	4300	6503	SO:0001583	missense	0			-	BC057760	CCDS31917.1	12q24.31	2006-01-17			ENSG00000139714	ENSG00000139714			29807	protein-coding gene	gene with protein product							Standard	NM_173855		Approved		uc001uax.3	Q6PF18	OTTHUMG00000169075	ENST00000355329.3:c.576G>A	12.37:g.122091053C>T	ENSP00000347486:p.Met192Ile		Q86YQ9	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.M192I	ENST00000355329.3	37	c.576	CCDS31917.1	12	.	.	.	.	.	.	.	.	.	.	C	7.937	0.741870	0.15642	.	.	ENSG00000139714	ENST00000355329	T	0.39229	1.09	4.86	3.03	0.35002	.	0.350015	0.26453	N	0.024297	T	0.16727	0.0402	N	0.11000	0.08	0.22050	N	0.999391	B	0.02656	0.0	B	0.01281	0.0	T	0.14699	-1.0463	10	0.12430	T	0.62	.	1.6535	0.02776	0.1446:0.4708:0.1404:0.2442	.	192	Q6PF18	MORN3_HUMAN	I	192	ENSP00000347486:M192I	ENSP00000347486:M192I	M	-	3	0	MORN3	120575436	0.197000	0.23362	0.964000	0.40570	0.776000	0.43924	-0.155000	0.10115	0.583000	0.29574	0.561000	0.74099	ATG	-	MORN3	-	NULL		0.622	MORN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MORN3	HGNC	protein_coding	OTTHUMT00000402154.1	0	0	0	94	94	114	0.00	0.00	C	NM_173855		122091053	-1	28	25	63	70	tier1	no_errors	ENST00000355329	ensembl	human	known	74_37	missense	30.43	26.32	SNP	0.943	T	28	63
PRTG	283659	genome.wustl.edu	37	15	55912283	55912283	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr15:55912283C>A	ENST00000389286.4	-	20	3427	c.3380G>T	c.(3379-3381)gGg>gTg	p.G1127V		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGAAAACCGCCCAGAATCCCC	0.493													ENSG00000166450																																					0													99.0	98.0	98.0					15																	55912283		1889	4120	6009	SO:0001583	missense	0			-	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.3380G>T	15.37:g.55912283C>A	ENSP00000373937:p.Gly1127Val			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G1127V	ENST00000389286.4	37	c.3380	CCDS42040.1	15	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350089	0.82132	.	.	ENSG00000166450	ENST00000389286	T	0.64085	-0.08	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.70395	0.3219	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73563	-0.3943	10	0.87932	D	0	-17.5224	19.132	0.93412	0.0:1.0:0.0:0.0	.	1127	Q2VWP7	PRTG_HUMAN	V	1127	ENSP00000373937:G1127V	ENSP00000373937:G1127V	G	-	2	0	PRTG	53699575	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.782000	0.75073	2.768000	0.95171	0.650000	0.86243	GGG	-	PRTG	-	NULL		0.493	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTG	HGNC	protein_coding	OTTHUMT00000419357.1	0	0	0	65	65	107	0.00	0.00	C	NM_173814		55912283	-1	16	16	94	123	tier1	no_errors	ENST00000389286	ensembl	human	known	74_37	missense	14.55	11.51	SNP	1.000	A	16	94
ARHGAP21	57584	genome.wustl.edu	37	10	24909075	24909075	+	Silent	SNP	A	A	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr10:24909075A>G	ENST00000396432.2	-	9	2235	c.1749T>C	c.(1747-1749)ttT>ttC	p.F583F	ARHGAP21_ENST00000320481.6_Silent_p.F370F	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	582					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GAATTTTTTTAAACTGCGACA	0.408													ENSG00000107863																																					0													69.0	70.0	69.0					10																	24909075		2202	4300	6502	SO:0001819	synonymous_variant	0			-	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1749T>C	10.37:g.24909075A>G			Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.F583	ENST00000396432.2	37	c.1749	CCDS7144.2	10																																																																																			-	ARHGAP21	-	NULL		0.408	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	0	0	0	81	81	88	0.00	0.00	A	NM_020824		24909075	-1	10	10	83	90	tier1	no_errors	ENST00000396432	ensembl	human	known	74_37	silent	10.75	10.00	SNP	0.995	G	10	83
SLC7A14	57709	genome.wustl.edu	37	3	170201202	170201202	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:170201202G>T	ENST00000231706.5	-	6	1331	c.1016C>A	c.(1015-1017)gCc>gAc	p.A339D	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	339					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CGACCCAATGGCCACTACGAA	0.522											OREG0015917	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000013293																																					0													110.0	98.0	102.0					3																	170201202		2203	4300	6503	SO:0001583	missense	0			-	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1016C>A	3.37:g.170201202G>T	ENSP00000231706:p.Ala339Asp	1883	B3KV33|Q9HCF9	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom	p.A339D	ENST00000231706.5	37	c.1016	CCDS33892.1	3	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438197	0.83885	.	.	ENSG00000013293	ENST00000231706	D	0.90676	-2.71	5.9	5.9	0.94986	Amino acid permease domain (1);	0.047134	0.85682	D	0.000000	D	0.95143	0.8426	M	0.73217	2.22	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	D	0.94934	0.8085	10	0.87932	D	0	.	20.263	0.98456	0.0:0.0:1.0:0.0	.	339	Q8TBB6	S7A14_HUMAN	D	339	ENSP00000231706:A339D	ENSP00000231706:A339D	A	-	2	0	SLC7A14	171683896	1.000000	0.71417	1.000000	0.80357	0.368000	0.29767	9.421000	0.97455	2.788000	0.95919	0.655000	0.94253	GCC	-	SLC7A14	-	pfam_AA-permease/SLC12A_dom		0.522	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A14	HGNC	protein_coding	OTTHUMT00000352598.2	0	0	0	52	52	72	0.00	0.00	G	NM_020949		170201202	-1	19	8	69	63	tier1	no_errors	ENST00000231706	ensembl	human	known	74_37	missense	21.59	11.27	SNP	1.000	T	19	69
INPP5A	3632	genome.wustl.edu	37	10	134563094	134563094	+	Missense_Mutation	SNP	G	G	T	rs201167385		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr10:134563094G>T	ENST00000368594.3	+	10	1083	c.806G>T	c.(805-807)cGt>cTt	p.R269L	INPP5A_ENST00000368593.3_Missense_Mutation_p.R269L	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	269					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)			cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		CTCATATTTCGTGAGTCGGAC	0.612													ENSG00000068383																									Pancreas(63;823 1267 11107 20380 51626)												0													77.0	67.0	70.0					10																	134563094		2203	4300	6503	SO:0001583	missense	0			-	X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.806G>T	10.37:g.134563094G>T	ENSP00000357583:p.Arg269Leu		D3DXI3|Q14640|Q5JSF1	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.R269L	ENST00000368594.3	37	c.806	CCDS7669.2	10	.	.	.	.	.	.	.	.	.	.	G	30	5.053357	0.93793	.	.	ENSG00000068383	ENST00000368594;ENST00000368593;ENST00000432898	T;T	0.50548	0.75;0.74	4.92	4.92	0.64577	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.183120	0.49305	D	0.000148	T	0.64338	0.2589	M	0.68317	2.08	0.80722	D	1	D;D	0.63046	0.984;0.992	P;P	0.60068	0.779;0.868	T	0.63681	-0.6582	10	0.38643	T	0.18	-0.8831	18.5242	0.90965	0.0:0.0:1.0:0.0	.	269;269	Q14642;Q5T1B5	I5P1_HUMAN;.	L	269;269;186	ENSP00000357583:R269L;ENSP00000357582:R269L	ENSP00000357582:R269L	R	+	2	0	INPP5A	134413084	1.000000	0.71417	0.395000	0.26283	0.930000	0.56654	6.878000	0.75567	2.445000	0.82738	0.655000	0.94253	CGT	-	INPP5A	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.612	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5A	HGNC	protein_coding	OTTHUMT00000051085.1	0	0	0	34	34	33	0.00	0.00	G	NM_005539		134563094	+1	11	23	20	28	tier1	no_errors	ENST00000368594	ensembl	human	known	74_37	missense	35.48	45.10	SNP	1.000	T	11	20
SPHKAP	80309	genome.wustl.edu	37	2	228882458	228882458	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr2:228882458A>C	ENST00000392056.3	-	7	3158	c.3112T>G	c.(3112-3114)Ttt>Gtt	p.F1038V	SPHKAP_ENST00000344657.5_Missense_Mutation_p.F1038V	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1038						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCATTGGCAAAAAGATTGACA	0.507													ENSG00000153820																																					0													93.0	86.0	88.0					2																	228882458		2203	4300	6503	SO:0001583	missense	0			-		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3112T>G	2.37:g.228882458A>C	ENSP00000375909:p.Phe1038Val		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.F1038V	ENST00000392056.3	37	c.3112	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	A	19.01	3.744705	0.69418	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.19806	2.15;2.12	6.08	6.08	0.98989	.	0.047582	0.85682	D	0.000000	T	0.36026	0.0952	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.972;0.941;0.994	T	0.11446	-1.0587	10	0.87932	D	0	.	15.825	0.78698	1.0:0.0:0.0:0.0	.	69;1038;1038	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	V	1038	ENSP00000375909:F1038V;ENSP00000339886:F1038V	ENSP00000339886:F1038V	F	-	1	0	SPHKAP	228590702	1.000000	0.71417	0.928000	0.36995	0.653000	0.38743	8.534000	0.90620	2.333000	0.79357	0.533000	0.62120	TTT	-	SPHKAP	-	NULL		0.507	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	0	0	0	50	50	61	0.00	0.00	A	NM_030623		228882458	-1	3	11	18	39	tier1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	14.29	22.00	SNP	0.997	C	3	18
SLCO1B1	10599	genome.wustl.edu	37	12	21349882	21349882	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr12:21349882A>T	ENST00000256958.2	+	8	826	c.730A>T	c.(730-732)Act>Tct	p.T244S		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	244					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	TATTCTAGGCACTATCAGGAT	0.348													ENSG00000134538																																					0													157.0	151.0	153.0					12																	21349882		2203	4300	6503	SO:0001583	missense	0			-		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.730A>T	12.37:g.21349882A>T	ENSP00000256958:p.Thr244Ser		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.T244S	ENST00000256958.2	37	c.730	CCDS8685.1	12	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.576723	0.00887	.	.	ENSG00000134538	ENST00000256958	T	0.38240	1.15	3.24	2.08	0.27032	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.699152	0.14757	N	0.300250	T	0.19087	0.0458	N	0.17674	0.51	0.09310	N	1	B	0.10296	0.003	B	0.20184	0.028	T	0.31392	-0.9945	10	0.08837	T	0.75	.	6.7986	0.23738	0.8865:0.0:0.1135:0.0	.	244	Q9Y6L6	SO1B1_HUMAN	S	244	ENSP00000256958:T244S	ENSP00000256958:T244S	T	+	1	0	SLCO1B1	21241149	0.040000	0.19996	0.008000	0.14137	0.052000	0.14988	3.243000	0.51392	0.445000	0.26639	0.402000	0.26972	ACT	-	SLCO1B1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.348	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	HGNC	protein_coding	OTTHUMT00000402070.1	0	0	0	54	54	40	0.00	0.00	A	NM_006446		21349882	+1	90	44	131	45	tier1	no_errors	ENST00000256958	ensembl	human	known	74_37	missense	40.72	49.44	SNP	0.007	T	90	131
NAALAD2	10003	genome.wustl.edu	37	11	89924822	89924822	+	Silent	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:89924822C>T	ENST00000534061.1	+	19	2360	c.2130C>T	c.(2128-2130)aaC>aaT	p.N710N	NAALAD2_ENST00000321955.4_Silent_p.N677N|NAALAD2_ENST00000375944.3_Missense_Mutation_p.T298I	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	710					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				ATAAAGCCAACTCTCGTTTGG	0.363													ENSG00000077616																																					0													94.0	95.0	95.0					11																	89924822		2201	4298	6499	SO:0001819	synonymous_variant	0			-	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.2130C>T	11.37:g.89924822C>T			B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	pfam_Protease-assoc_domain	p.T298I	ENST00000534061.1	37	c.893	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765455	0.31228	.	.	ENSG00000077616	ENST00000375944	T	0.12465	2.68	5.26	3.36	0.38483	.	.	.	.	.	T	0.08492	0.0211	.	.	.	0.23304	N	0.99794	B	0.09022	0.002	B	0.06405	0.002	T	0.38243	-0.9670	7	.	.	.	-12.8557	8.2695	0.31836	0.0:0.6615:0.0:0.3385	.	298	Q4KKV4	.	I	298	ENSP00000365111:T298I	.	T	+	2	0	NAALAD2	89564470	0.004000	0.15560	0.969000	0.41365	0.735000	0.41995	-0.307000	0.08167	0.700000	0.31782	0.454000	0.30748	ACT	-	ALAD2	-	NULL		0.363	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	0	0	0	74	74	75	0.00	0.00	C	NM_005467		89924822	+1	19	8	77	64	tier1	no_errors	ENST00000375944	ensembl	human	novel	74_37	missense	19.79	11.11	SNP	0.991	T	19	77
CYFIP2	26999	genome.wustl.edu	37	5	156757766	156757766	+	Missense_Mutation	SNP	C	C	T	rs535692197		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr5:156757766C>T	ENST00000521420.1	+	19	2186	c.2095C>T	c.(2095-2097)Cgt>Tgt	p.R699C	CYFIP2_ENST00000347377.6_Missense_Mutation_p.R725C|CYFIP2_ENST00000318218.6_Missense_Mutation_p.R750C|CYFIP2_ENST00000377576.3_Missense_Mutation_p.R725C|CYFIP2_ENST00000522463.1_Missense_Mutation_p.R529C|CYFIP2_ENST00000541131.1_Missense_Mutation_p.R650C|CYFIP2_ENST00000442283.2_Missense_Mutation_p.R10C|CYFIP2_ENST00000435847.2_Missense_Mutation_p.R424C					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTTGGATAAACGTTTTCGAGC	0.438													ENSG00000055163																																					0													170.0	154.0	159.0					5																	156757766		1962	4169	6131	SO:0001583	missense	0			-	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.2095C>T	5.37:g.156757766C>T	ENSP00000430904:p.Arg699Cys			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.R750C	ENST00000521420.1	37	c.2248		5	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983561	0.93044	.	.	ENSG00000055163	ENST00000318218;ENST00000442283;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.56615	0.1997	M	0.84219	2.685	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;0.998;0.999;1.0;1.0;0.989	P;P;D;D;D;D	0.72625	0.841;0.893;0.959;0.926;0.921;0.978	T	0.61992	-0.6948	10	0.66056	D	0.02	-12.1655	19.1128	0.93323	0.0:1.0:0.0:0.0	.	589;529;699;725;725;750	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	C	750;10;529;699;725;725;650;424	ENSP00000325817:R750C;ENSP00000390948:R10C;ENSP00000428009:R529C;ENSP00000430904:R699C;ENSP00000313567:R725C;ENSP00000366799:R725C;ENSP00000444645:R650C;ENSP00000403793:R424C	ENSP00000325817:R750C	R	+	1	0	CYFIP2	156690344	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.606000	0.67641	2.516000	0.84829	0.655000	0.94253	CGT	-	CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub		0.438	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	0	0	0	86	86	109	0.00	0.00	C	NM_001037332		156757766	+1	25	39	70	62	tier1	no_errors	ENST00000318218	ensembl	human	known	74_37	missense	26.32	38.61	SNP	1.000	T	25	70
OR5F1	338674	genome.wustl.edu	37	11	55761685	55761685	+	Silent	SNP	G	G	T	rs201523946		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:55761685G>T	ENST00000278409.1	-	1	416	c.417C>A	c.(415-417)acC>acA	p.T139T		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	139					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					TTAGGTAGACGGTCCTGGACA	0.522													ENSG00000149133																																					0													46.0	48.0	47.0					11																	55761685		2201	4296	6497	SO:0001819	synonymous_variant	0			-	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.417C>A	11.37:g.55761685G>T			Q495D1|Q6IFB9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T139	ENST00000278409.1	37	c.417	CCDS31515.1	11																																																																																			rs201523946	OR5F1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.522	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5F1	HGNC	protein_coding	OTTHUMT00000391532.1	0	0	0	59	59	51	0.00	0.00	G	NM_003697		55761685	-1	13	11	51	70	tier1	no_errors	ENST00000278409	ensembl	human	known	74_37	silent	20.31	13.58	SNP	0.000	T	13	51
ZNF850	342892	genome.wustl.edu	37	19	37239096	37239096	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr19:37239096C>G	ENST00000591344.1	-	5	3004	c.2846G>C	c.(2845-2847)gGc>gCc	p.G949A	ZNF850_ENST00000589390.1_Intron	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850	949					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GGGTTTCTCGCCAGTGTGAAT	0.438													ENSG00000267041																																					0																																										SO:0001583	missense	0			-	BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14		ENST00000591344.1:c.2846G>C	19.37:g.37239096C>G	ENSP00000464976:p.Gly949Ala			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G949A	ENST00000591344.1	37	c.2846	CCDS59379.1	19																																																																																			-	ZNF850	-	pfscan_Znf_C2H2		0.438	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF850	HGNC	protein_coding	OTTHUMT00000453557.1	0	0	0	47	47	89	0.00	0.00	C	XM_001720258		37239096	-1	12	19	33	48	tier1	no_errors	ENST00000591344	ensembl	human	known	74_37	missense	26.67	27.94	SNP	0.161	G	12	33
TANGO6	79613	genome.wustl.edu	37	16	68961693	68961693	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr16:68961693C>T	ENST00000261778.1	+	13	2362	c.2350C>T	c.(2350-2352)Cat>Tat	p.H784Y	RP11-521L9.1_ENST00000562790.1_lincRNA	NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	784						integral component of membrane (GO:0016021)											ACAAACCAGTCATGAAAGACC	0.512													ENSG00000103047																																					0													91.0	93.0	92.0					16																	68961693		1987	4179	6166	SO:0001583	missense	0			-		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.2350C>T	16.37:g.68961693C>T	ENSP00000261778:p.His784Tyr		Q569F9|Q9H9K1	Missense_Mutation	SNP	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.H784Y	ENST00000261778.1	37	c.2350	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.092837	0.00364	.	.	ENSG00000103047	ENST00000261778	.	.	.	5.37	-6.22	0.02058	Armadillo-type fold (1);	2.800450	0.00760	N	0.001125	T	0.17704	0.0425	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12578	-1.0542	9	0.11485	T	0.65	7.4903	3.1035	0.06334	0.1068:0.3663:0.1054:0.4215	.	784	Q9C0B7	TMCO7_HUMAN	Y	784	.	ENSP00000261778:H784Y	H	+	1	0	TMCO7	67519194	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.980000	0.03770	-1.103000	0.03019	0.655000	0.94253	CAT	-	TANGO6	-	pfam_DUF2435,superfamily_ARM-type_fold		0.512	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	HGNC	protein_coding	OTTHUMT00000433471.2	0	0	0	30	30	102	0.00	0.00	C	XM_928235.2		68961693	+1	31	61	13	39	tier1	no_errors	ENST00000261778	ensembl	human	known	74_37	missense	70.45	61.00	SNP	0.000	T	31	13
C6orf165	154313	genome.wustl.edu	37	6	88173930	88173930	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr6:88173930G>T	ENST00000507897.1	+	13	1914	c.1831G>T	c.(1831-1833)Gtc>Ttc	p.V611F	C6ORF165_ENST00000369562.4_Missense_Mutation_p.V611F|C6orf165_ENST00000506888.1_3'UTR			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	611										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		CACCGATGAGGTCAAGGTGAA	0.443													ENSG00000272514																																					0													91.0	77.0	82.0					6																	88173930		2203	4300	6503	SO:0001583	missense	0			-	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.1831G>T	6.37:g.88173930G>T	ENSP00000426769:p.Val611Phe		A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	pfam_DUF3508	p.V611F	ENST00000507897.1	37	c.1831	CCDS34498.1	6	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633898	0.47049	.	.	ENSG00000213204	ENST00000369562	T	0.35789	1.29	5.68	2.95	0.34219	.	0.369486	0.30940	N	0.008580	T	0.30603	0.0770	M	0.77103	2.36	0.31164	N	0.704	P	0.51653	0.947	P	0.49799	0.622	T	0.17715	-1.0360	10	0.66056	D	0.02	.	8.162	0.31204	0.3626:0.0:0.6374:0.0	.	611	Q8IYR0	CF165_HUMAN	F	611	ENSP00000358575:V611F	ENSP00000358575:V611F	V	+	1	0	C6orf165	88230649	0.985000	0.35326	0.598000	0.28837	0.494000	0.33585	1.647000	0.37260	0.763000	0.33175	0.563000	0.77884	GTC	-	C6ORF165	-	NULL		0.443	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	Uniprot_gn	protein_coding	OTTHUMT00000470406.1	0	0	0	41	41	132	0.00	0.00	G	NM_178823		88173930	+1	10	20	23	58	tier1	no_errors	ENST00000369562	ensembl	human	known	74_37	missense	30.30	25.64	SNP	0.311	T	10	23
UVRAG	7405	genome.wustl.edu	37	11	75590941	75590941	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:75590941C>T	ENST00000356136.3	+	4	530	c.289C>T	c.(289-291)Ctc>Ttc	p.L97F	UVRAG_ENST00000528420.1_5'UTR	NM_003369.3	NP_003360.2	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	97	C2.				DNA repair (GO:0006281)|positive regulation of autophagy (GO:0010508)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(15)|skin(5)|urinary_tract(2)	32						GTGGCGAAGTCTCGATTTTGG	0.393													ENSG00000198382																																					0													244.0	235.0	238.0					11																	75590941		2200	4293	6493	SO:0001583	missense	0			-	X99050, AB012958	CCDS8241.1	11q13	2012-11-15	2012-11-15		ENSG00000198382	ENSG00000198382			12640	protein-coding gene	gene with protein product	"""beclin 1 binding protein"""	602493	"""UV radiation resistance associated gene"""			9169138, 16799551, 18843052	Standard	NM_003369		Approved	VPS38	uc001oxc.3	Q9P2Y5	OTTHUMG00000165319	ENST00000356136.3:c.289C>T	11.37:g.75590941C>T	ENSP00000348455:p.Leu97Phe		B3KTC1|O00392	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.L97F	ENST00000356136.3	37	c.289	CCDS8241.1	11	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024585	0.75390	.	.	ENSG00000198382	ENST00000356136	T	0.34667	1.35	5.65	5.65	0.86999	C2 calcium-dependent membrane targeting (1);	0.000000	0.85682	D	0.000000	T	0.32823	0.0842	N	0.13043	0.29	0.80722	D	1	P	0.38827	0.649	P	0.45343	0.477	T	0.08027	-1.0742	10	0.35671	T	0.21	-9.7066	18.3143	0.90213	0.0:1.0:0.0:0.0	.	97	Q9P2Y5	UVRAG_HUMAN	F	97	ENSP00000348455:L97F	ENSP00000348455:L97F	L	+	1	0	UVRAG	75268589	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	2.257000	0.43240	2.678000	0.91216	0.655000	0.94253	CTC	-	UVRAG	-	smart_C2_dom		0.393	UVRAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVRAG	HGNC	protein_coding	OTTHUMT00000383430.1	0	0	1	126	126	128	0.00	0.77	C	NM_003369		75590941	+1	45	40	116	128	tier1	no_errors	ENST00000356136	ensembl	human	known	74_37	missense	27.95	23.81	SNP	1.000	T	45	116
UGT2B17	7367	genome.wustl.edu	37	4	69431379	69431379	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr4:69431379A>T	ENST00000317746.2	-	2	826	c.784T>A	c.(784-786)Tat>Aat	p.Y262N		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	262					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	AAATCCCAATAGGTTCGAATG	0.393													ENSG00000197888																									Melanoma(18;649 833 28984 37818 38500)												0													73.0	73.0	73.0					4																	69431379		2084	3884	5968	SO:0001583	missense	0			-	U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.784T>A	4.37:g.69431379A>T	ENSP00000320401:p.Tyr262Asn			Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.Y262N	ENST00000317746.2	37	c.784	CCDS3523.1	4	.	.	.	.	.	.	.	.	.	.	a	0.940	-0.709758	0.03230	.	.	ENSG00000197888	ENST00000317746	T	0.61040	0.14	2.49	2.49	0.30216	.	0.000000	0.64402	U	0.000002	T	0.52565	0.1742	M	0.73430	2.235	0.26350	N	0.977224	.	.	.	.	.	.	T	0.47114	-0.9142	8	0.02654	T	1	.	8.5215	0.33279	1.0:0.0:0.0:0.0	.	.	.	.	N	262	ENSP00000320401:Y262N	ENSP00000320401:Y262N	Y	-	1	0	UGT2B17	69113974	1.000000	0.71417	0.668000	0.29813	0.943000	0.58893	3.978000	0.56881	1.169000	0.42739	0.329000	0.21502	TAT	-	UGT2B17	-	pfam_UDP_glucos_trans		0.393	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B17	HGNC	protein_coding	OTTHUMT00000251436.1	0	0	0	75	75	60	0.00	0.00	A	NM_001077		69431379	-1	45	16	29	26	tier1	no_errors	ENST00000317746	ensembl	human	known	74_37	missense	60.81	38.10	SNP	1.000	T	45	29
FAM205B	389715	genome.wustl.edu	37	9	34835569	34835569	+	RNA	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:34835569G>T	ENST00000455647.2	-	0	824							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		CCCTGGACAAGGCTGGGGTTG	0.567													ENSG00000257198																																					0																																												0			-			9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34835569G>T			Q6ZRJ7	R	SNP	-	NULL	ENST00000455647.2	37	NULL		9																																																																																			-	FAM205B	-	-		0.567	FAM205B-001	KNOWN	basic	processed_transcript	FAM205B	HGNC	pseudogene	OTTHUMT00000052246.5	0	0	0	74	74	144	0.00	0.00	G	NR_024481		34835569	-1	21	28	91	124	tier1	no_errors	ENST00000455647	ensembl	human	known	74_37	rna	18.75	18.42	SNP	0.000	T	21	91
TENM2	57451	genome.wustl.edu	37	5	167642246	167642246	+	Silent	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr5:167642246G>A	ENST00000518659.1	+	21	4086	c.4047G>A	c.(4045-4047)aaG>aaA	p.K1349K	TENM2_ENST00000519204.1_Silent_p.K1228K|TENM2_ENST00000545108.1_Silent_p.K1348K|TENM2_ENST00000520394.1_Silent_p.K1110K|TENM2_ENST00000403607.2_Silent_p.K1173K	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1349					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										ATGGAGGGAAGGCCATAGATG	0.552													ENSG00000145934																																					0													94.0	100.0	98.0					5																	167642246		1969	4156	6125	SO:0001819	synonymous_variant	0			-	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4047G>A	5.37:g.167642246G>A			Q9ULU2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.K1349	ENST00000518659.1	37	c.4047		5																																																																																			-	TENM2	-	superfamily_ConA-like_lec_gl_sf		0.552	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	0	0	0	48	48	112	0.00	0.00	G	NM_001122679		167642246	+1	17	19	27	42	tier1	no_errors	ENST00000518659	ensembl	human	known	74_37	silent	38.64	31.15	SNP	1.000	A	17	27
SEMG1	6406	genome.wustl.edu	37	20	43836660	43836660	+	Missense_Mutation	SNP	C	C	T	rs377393231		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr20:43836660C>T	ENST00000372781.3	+	2	779	c.722C>T	c.(721-723)gCg>gTg	p.A241V	SEMG1_ENST00000244069.6_Missense_Mutation_p.A241V	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	241	Interaction with EPPIN.|Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CTCTGTCCTGCGCACCAAGAC	0.378													ENSG00000124233																																					0								C	VAL/ALA	0,4406		0,0,2203	113.0	99.0	104.0		722	-4.2	0.0	20		104	1,8599	1.2+/-3.3	0,1,4299	no	missense	SEMG1	NM_003007.3	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		241/463	43836660	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.722C>T	20.37:g.43836660C>T	ENSP00000361867:p.Ala241Val		Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	pfam_Semenogelin	p.A241V	ENST00000372781.3	37	c.722	CCDS13345.1	20	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801935	0.31869	0.0	1.16E-4	ENSG00000124233	ENST00000244069;ENST00000372781	T;T	0.10668	2.85;2.85	2.09	-4.19	0.03835	.	.	.	.	.	T	0.21145	0.0509	M	0.77616	2.38	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.999	P;P;D	0.66196	0.871;0.825;0.942	T	0.08827	-1.0703	9	0.52906	T	0.07	.	0.0928	0.00041	0.3412:0.2169:0.1707:0.2713	.	241;241;241	P04279-2;P04279;E7EPD3	.;SEMG1_HUMAN;.	V	241	ENSP00000244069:A241V;ENSP00000361867:A241V	ENSP00000244069:A241V	A	+	2	0	SEMG1	43270074	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.286000	0.08399	-1.450000	0.01936	0.557000	0.71058	GCG	-	SEMG1	-	pfam_Semenogelin		0.378	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEMG1	HGNC	protein_coding	OTTHUMT00000079416.3	0	0	0	73	73	103	0.00	0.00	C	NM_003007		43836660	+1	34	32	72	84	tier1	no_errors	ENST00000372781	ensembl	human	known	74_37	missense	32.08	27.59	SNP	0.000	T	34	72
VWF	7450	genome.wustl.edu	37	12	6085362	6085362	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr12:6085362C>A	ENST00000261405.5	-	43	7606	c.7352G>T	c.(7351-7353)tGc>tTc	p.C2451F		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2451	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GGTGCAGGTGCACACATCGCA	0.602													ENSG00000110799																																					0													92.0	76.0	81.0					12																	6085362		2203	4300	6503	SO:0001583	missense	0			-		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7352G>T	12.37:g.6085362C>A	ENSP00000261405:p.Cys2451Phe		Q8TCE8|Q99806	Missense_Mutation	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.C2451F	ENST00000261405.5	37	c.7352	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354747	0.82243	.	.	ENSG00000110799	ENST00000261405	D	0.92149	-2.98	5.19	5.19	0.71726	von Willebrand factor, type C (4);	0.000000	0.42964	D	0.000635	D	0.96519	0.8864	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96847	0.9622	10	0.56958	D	0.05	.	15.8551	0.78972	0.0:1.0:0.0:0.0	.	2451	P04275	VWF_HUMAN	F	2451	ENSP00000261405:C2451F	ENSP00000261405:C2451F	C	-	2	0	VWF	5955623	1.000000	0.71417	0.993000	0.49108	0.947000	0.59692	6.643000	0.74334	2.412000	0.81896	0.591000	0.81541	TGC	-	VWF	-	pirsf_VWF,pfam_VWF_C,smart_VWF_C,pfscan_VWF_C		0.602	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	0	0	0	31	31	48	0.00	0.00	C	NM_000552		6085362	-1	14	7	30	26	tier1	no_errors	ENST00000261405	ensembl	human	known	74_37	missense	31.82	21.21	SNP	1.000	A	14	30
LCT	3938	genome.wustl.edu	37	2	136567385	136567385	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr2:136567385C>A	ENST00000264162.2	-	8	2542	c.2532G>T	c.(2530-2532)aaG>aaT	p.K844N	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	844	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GGAAACCGTTCTTTTCTATGA	0.502													ENSG00000115850																																					0													231.0	226.0	228.0					2																	136567385		2203	4300	6503	SO:0001583	missense	0			-	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2532G>T	2.37:g.136567385C>A	ENSP00000264162:p.Lys844Asn		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.K844N	ENST00000264162.2	37	c.2532	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	C	0.567	-0.842745	0.02671	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.49432	0.78	5.78	3.02	0.34903	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.411149	0.28635	N	0.014647	T	0.21718	0.0523	N	0.13327	0.33	0.35379	D	0.789744	B	0.21225	0.053	B	0.22386	0.039	T	0.10847	-1.0612	10	0.10111	T	0.7	-22.9195	1.3125	0.02100	0.3393:0.3457:0.1125:0.2026	.	844	P09848	LPH_HUMAN	N	844;276	ENSP00000264162:K844N	ENSP00000264162:K844N	K	-	3	2	LCT	136283855	0.005000	0.15991	0.998000	0.56505	0.722000	0.41435	-1.142000	0.03203	0.365000	0.24400	0.563000	0.77884	AAG	-	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF		0.502	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	0	0	0	37	37	100	0.00	0.00	C	NM_002299		136567385	-1	9	21	79	118	tier1	no_errors	ENST00000264162	ensembl	human	known	74_37	missense	10.23	15.11	SNP	0.977	A	9	79
ABCB5	340273	genome.wustl.edu	37	7	20795117	20795117	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:20795117C>G	ENST00000404938.2	+	28	4296	c.3644C>G	c.(3643-3645)tCt>tGt	p.S1215C	ABCB5_ENST00000258738.6_Missense_Mutation_p.S770C	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	1215	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CACAGGCTCTCTGCAATTCAG	0.453													ENSG00000004846																																					0													110.0	99.0	103.0					7																	20795117		2203	4300	6503	SO:0001583	missense	0			-	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.3644C>G	7.37:g.20795117C>G	ENSP00000384881:p.Ser1215Cys		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.S770C	ENST00000404938.2	37	c.2309	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017991	0.54576	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	T;T	0.68624	-0.34;-0.34	5.01	5.01	0.66863	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.56097	D	0.000025	D	0.86091	0.5850	M	0.92412	3.305	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.987	D	0.89320	0.3639	10	0.87932	D	0	.	17.9745	0.89123	0.0:1.0:0.0:0.0	.	1215;770	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	C	1215;770	ENSP00000384881:S1215C;ENSP00000258738:S770C	ENSP00000258738:S770C	S	+	2	0	ABCB5	20761642	1.000000	0.71417	0.990000	0.47175	0.023000	0.10783	7.168000	0.77570	2.692000	0.91855	0.650000	0.86243	TCT	-	ABCB5	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.453	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	0	0	0	44	44	85	0.00	0.00	C	NM_178559		20795117	+1	13	10	58	68	tier1	no_errors	ENST00000258738	ensembl	human	known	74_37	missense	18.31	12.82	SNP	1.000	G	13	58
EPO	2056	genome.wustl.edu	37	7	100320681	100320681	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:100320681C>A	ENST00000252723.2	+	5	688	c.507C>A	c.(505-507)ttC>ttA	p.F169L		NM_000799.2	NP_000790.2	P01588	EPO_HUMAN	erythropoietin	169					aging (GO:0007568)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular hyperosmotic response (GO:0071474)|cellular response to hypoxia (GO:0071456)|embryo implantation (GO:0007566)|erythrocyte maturation (GO:0043249)|hemoglobin biosynthetic process (GO:0042541)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cation channel activity (GO:2001258)|negative regulation of erythrocyte apoptotic process (GO:1902251)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to axon injury (GO:0048678)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to hyperoxia (GO:0055093)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to salt stress (GO:0009651)|response to testosterone (GO:0033574)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein kinase activator activity (GO:0030295)			central_nervous_system(2)|endometrium(2)|lung(7)|prostate(1)	12	Lung NSC(181;0.041)|all_lung(186;0.0581)					GCAAACTCTTCCGAGTCTACT	0.562													ENSG00000130427																																					0													121.0	124.0	123.0					7																	100320681		2203	4300	6503	SO:0001583	missense	0			-	X02157	CCDS5705.1	7q21	2014-01-30			ENSG00000130427	ENSG00000130427		"""Endogenous ligands"""	3415	protein-coding gene	gene with protein product		133170				9799793, 3838366	Standard	NM_000799		Approved	EP	uc003uwi.3	P01588	OTTHUMG00000152121	ENST00000252723.2:c.507C>A	7.37:g.100320681C>A	ENSP00000252723:p.Phe169Leu		Q2M2L6|Q549U2|Q9UDZ0|Q9UEZ5|Q9UHA0	Missense_Mutation	SNP	pfam_EPO_TPO,superfamily_4_helix_cytokine-like_core,pirsf_Erythroptn,prints_Erythroptn	p.F169L	ENST00000252723.2	37	c.507	CCDS5705.1	7	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791999	0.50102	.	.	ENSG00000130427	ENST00000252723	T	0.37915	1.17	5.27	4.37	0.52481	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.065037	0.64402	D	0.000008	T	0.32912	0.0845	L	0.49640	1.575	0.41564	D	0.988645	P;P	0.43973	0.823;0.823	B;B	0.43301	0.415;0.415	T	0.02766	-1.1113	10	0.24483	T	0.36	-20.0309	10.3495	0.43927	0.0:0.9043:0.0:0.0957	.	168;169	B7ZKK5;P01588	.;EPO_HUMAN	L	169	ENSP00000252723:F169L	ENSP00000252723:F169L	F	+	3	2	EPO	100158617	0.996000	0.38824	0.998000	0.56505	0.679000	0.39708	1.333000	0.33816	2.616000	0.88540	0.643000	0.83706	TTC	-	EPO	-	pfam_EPO_TPO,superfamily_4_helix_cytokine-like_core,pirsf_Erythroptn,prints_Erythroptn		0.562	EPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPO	HGNC	protein_coding	OTTHUMT00000325323.1	0	0	0	19	19	54	0.00	0.00	C	NM_000799		100320681	+1	6	12	29	45	tier1	no_errors	ENST00000252723	ensembl	human	known	74_37	missense	17.14	21.05	SNP	1.000	A	6	29
RPF2	84154	genome.wustl.edu	37	6	111310221	111310221	+	Intron	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr6:111310221T>C	ENST00000441448.2	+	3	248					NM_032194.1	NP_115570.1	Q9H7B2	RPF2_HUMAN	ribosome production factor 2 homolog (S. cerevisiae)							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)	7						CTATAAATTTTGTTTTACAGT	0.284													ENSG00000197498																																					0													44.0	46.0	46.0					6																	111310221		2183	4297	6480	SO:0001627	intron_variant	0			-	AK024740	CCDS5088.1	6q21	2009-09-25	2009-09-25	2009-09-25	ENSG00000197498	ENSG00000197498			20870	protein-coding gene	gene with protein product	"""ribosomal processing factor 2 homolog (S. cerevisiae)"""		"""brix domain containing 1"""	BXDC1		12048200	Standard	NM_032194		Approved	FLJ21087, bA397G5.4	uc003pun.3	Q9H7B2	OTTHUMG00000015368	ENST00000441448.2:c.157-10T>C	6.37:g.111310221T>C			Q5VXN1|Q8N4A1	Missense_Mutation	SNP	NULL	p.C63R	ENST00000441448.2	37	c.187	CCDS5088.1	6																																																																																			-	RPF2	-	NULL		0.284	RPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPF2	HGNC	protein_coding	OTTHUMT00000041813.2	0	0	0	84	84	22	0.00	0.00	T	NM_032194		111310221	+1	22	4	61	17	tier1	no_errors	ENST00000368864	ensembl	human	known	74_37	missense	26.51	19.05	SNP	0.999	C	22	61
KLHL6	89857	genome.wustl.edu	37	3	183211909	183211909	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:183211909G>T	ENST00000341319.3	-	5	1343	c.1308C>A	c.(1306-1308)aaC>aaA	p.N436K		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	436					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TCTCCACATTGTTGATTCTCT	0.448													ENSG00000172578																																					0													254.0	238.0	243.0					3																	183211909		2203	4300	6503	SO:0001583	missense	0			-	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1308C>A	3.37:g.183211909G>T	ENSP00000341342:p.Asn436Lys		B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.N436K	ENST00000341319.3	37	c.1308	CCDS3245.2	3	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526525	0.44969	.	.	ENSG00000172578	ENST00000341319	T	0.80123	-1.34	5.96	3.84	0.44239	Kelch-type beta propeller (1);	0.225320	0.51477	D	0.000086	T	0.68118	0.2966	N	0.12887	0.27	0.43678	D	0.996112	B	0.33345	0.409	B	0.36030	0.216	T	0.72334	-0.4325	10	0.66056	D	0.02	.	14.1535	0.65403	0.1427:0.0:0.8573:0.0	.	436	Q8WZ60	KLHL6_HUMAN	K	436	ENSP00000341342:N436K	ENSP00000341342:N436K	N	-	3	2	KLHL6	184694603	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	2.153000	0.42282	1.489000	0.48450	0.655000	0.94253	AAC	-	KLHL6	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.448	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL6	HGNC	protein_coding	OTTHUMT00000309024.1	0	0	0	45	45	141	0.00	0.00	G	NM_130446		183211909	-1	11	23	62	102	tier1	no_errors	ENST00000341319	ensembl	human	known	74_37	missense	15.07	18.40	SNP	1.000	T	11	62
CACNA1B	774	genome.wustl.edu	37	9	141000214	141000214	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:141000214C>A	ENST00000371372.1	+	39	5528	c.5383C>A	c.(5383-5385)Ctg>Atg	p.L1795M	CACNA1B_ENST00000371357.1_Missense_Mutation_p.L1794M|CACNA1B_ENST00000277549.5_Missense_Mutation_p.L989M|CACNA1B_ENST00000277551.2_Missense_Mutation_p.L1795M|CACNA1B_ENST00000371363.1_Missense_Mutation_p.L1793M|CACNA1B_ENST00000371365.2_Missense_Mutation_p.L159M|CACNA1B_ENST00000371355.4_Missense_Mutation_p.L1796M	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1795					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CACGTCCACGCTGATGGCCCT	0.642													ENSG00000148408																																					0													34.0	35.0	34.0					9																	141000214		2129	4221	6350	SO:0001583	missense	0			-	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5383C>A	9.37:g.141000214C>A	ENSP00000360423:p.Leu1795Met		B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.L1796M	ENST00000371372.1	37	c.5386	CCDS59522.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.18|14.18	2.459276|2.459276	0.43634|0.43634	.|.	.|.	ENSG00000148408|ENSG00000148408	ENST00000413253|ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355;ENST00000371365	.|T;T;T;T;T;T;T	.|0.71579	.|-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58	5.0|5.0	3.89|3.89	0.44902|0.44902	.|.	.|0.083257	.|0.50627	.|D	.|0.000114	D|D	0.84110|0.84110	0.5400|0.5400	H|H	0.94385|0.94385	3.53|3.53	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D	.|0.64830	.|0.994;0.994;0.994	.|P;P;P	.|0.57911	.|0.829;0.829;0.829	D|D	0.87064|0.87064	0.2155|0.2155	5|10	.|0.87932	.|D	.|0	.|.	9.3774|9.3774	0.38292|0.38292	0.0:0.7698:0.0:0.2302|0.0:0.7698:0.0:0.2302	.|.	.|1795;1794;1793	.|Q00975;B1AQK7;B1AQK6	.|CAC1B_HUMAN;.;.	D|M	159|1795;1795;989;1793;1794;1796;159	.|ENSP00000360423:L1795M;ENSP00000277551:L1795M;ENSP00000277549:L989M;ENSP00000360414:L1793M;ENSP00000360408:L1794M;ENSP00000360406:L1796M;ENSP00000360416:L159M	.|ENSP00000277549:L989M	A|L	+|+	2|1	0|2	CACNA1B|CACNA1B	140120035|140120035	0.945000|0.945000	0.32115|0.32115	0.996000|0.996000	0.52242|0.52242	0.297000|0.297000	0.27493|0.27493	2.070000|2.070000	0.41491|0.41491	2.317000|2.317000	0.78254|0.78254	0.561000|0.561000	0.74099|0.74099	GCT|CTG	-	CAC1B	-	NULL		0.642	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CAC1B	HGNC	protein_coding	OTTHUMT00000055380.1	0	0	0	30	30	48	0.00	0.00	C	NM_000718		141000214	+1	12	21	17	24	tier1	no_errors	ENST00000371355	ensembl	human	known	74_37	missense	41.38	46.67	SNP	0.974	A	12	17
EFNB3	1949	genome.wustl.edu	37	17	7611316	7611316	+	Missense_Mutation	SNP	G	G	C	rs201123805		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:7611316G>C	ENST00000226091.2	+	2	560	c.163G>C	c.(163-165)Ggg>Cgg	p.G55R		NM_001406.3	NP_001397.1	Q15768	EFNB3_HUMAN	ephrin-B3	55	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				adult walking behavior (GO:0007628)|axon choice point recognition (GO:0016198)|axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	8		all_cancers(10;1.14e-06)|Prostate(122;0.081)				CCCTCAGATCGGGGACCGGCT	0.602													ENSG00000108947																																					0													42.0	47.0	45.0					17																	7611316		2203	4299	6502	SO:0001583	missense	0			-	U57001	CCDS11120.1	17p13.1	2011-03-09			ENSG00000108947	ENSG00000108947		"""Ephrins"""	3228	protein-coding gene	gene with protein product		602297		EPLG8		9126477	Standard	NM_001406		Approved	LERK-8	uc002gis.3	Q15768	OTTHUMG00000108161	ENST00000226091.2:c.163G>C	17.37:g.7611316G>C	ENSP00000226091:p.Gly55Arg		B2RBW2|D3DTQ6|O00680|Q8TBH7|Q92875	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.G55R	ENST00000226091.2	37	c.163	CCDS11120.1	17	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724385	0.68959	.	.	ENSG00000108947	ENST00000226091	D	0.94613	-3.47	4.68	4.68	0.58851	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.97148	0.9068	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97822	1.0257	10	0.87932	D	0	-16.9217	16.5165	0.84302	0.0:0.0:1.0:0.0	.	55	Q15768	EFNB3_HUMAN	R	55	ENSP00000226091:G55R	ENSP00000226091:G55R	G	+	1	0	EFNB3	7552041	1.000000	0.71417	0.996000	0.52242	0.453000	0.32348	9.148000	0.94652	2.423000	0.82170	0.453000	0.30009	GGG	-	EFNB3	-	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin		0.602	EFNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNB3	HGNC	protein_coding	OTTHUMT00000226965.1	0	0	0	88	88	57	0.00	0.00	G	NM_001406		7611316	+1	9	6	90	46	tier1	no_errors	ENST00000226091	ensembl	human	known	74_37	missense	9.09	11.54	SNP	1.000	C	9	90
EMILIN3	90187	genome.wustl.edu	37	20	39991664	39991664	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr20:39991664C>T	ENST00000332312.3	-	4	737	c.545G>A	c.(544-546)cGg>cAg	p.R182Q		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	182						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				GCGTTCCAGCCGCTCACCAAA	0.602													ENSG00000183798																																					0																																										SO:0001583	missense	0			-	AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.545G>A	20.37:g.39991664C>T	ENSP00000332806:p.Arg182Gln		Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	pfam_EMI_domain,pfscan_EMI_domain	p.R182Q	ENST00000332312.3	37	c.545	CCDS13316.1	20	.	.	.	.	.	.	.	.	.	.	C	17.02	3.283163	0.59867	.	.	ENSG00000183798	ENST00000332312	T	0.19669	2.13	5.46	4.5	0.54988	.	0.126128	0.53938	N	0.000050	T	0.16342	0.0393	L	0.45137	1.4	0.43667	D	0.996092	P	0.40144	0.704	B	0.29862	0.108	T	0.03166	-1.1065	9	.	.	.	-20.5091	14.5855	0.68320	0.0:0.9287:0.0:0.0713	.	182	Q9NT22	EMIL3_HUMAN	Q	182	ENSP00000332806:R182Q	.	R	-	2	0	EMILIN3	39425078	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.382000	0.59594	1.290000	0.44636	0.455000	0.32223	CGG	-	EMILIN3	-	NULL		0.602	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN3	HGNC	protein_coding	OTTHUMT00000106876.2	0	0	0	38	38	39	0.00	0.00	C	XM_029741		39991664	-1	7	14	43	42	tier1	no_errors	ENST00000332312	ensembl	human	known	74_37	missense	14.00	25.00	SNP	1.000	T	7	43
ASPH	444	genome.wustl.edu	37	8	62538820	62538820	+	Intron	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:62538820C>G	ENST00000379454.4	-	14	1122				ASPH_ENST00000522919.1_Intron|ASPH_ENST00000356457.5_3'UTR|ASPH_ENST00000517903.1_3'UTR|ASPH_ENST00000518068.1_3'UTR|ASPH_ENST00000523897.1_Intron|ASPH_ENST00000445642.3_3'UTR|ASPH_ENST00000522835.1_3'UTR|ASPH_ENST00000517847.2_3'UTR|ASPH_ENST00000541428.1_Intron	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase						activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TAGGGGCAGTCTTTTTGAAGC	0.403													ENSG00000198363																																					0													85.0	79.0	81.0					8																	62538820		1852	4082	5934	SO:0001627	intron_variant	0			-	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.935-7242G>C	8.37:g.62538820C>G			A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	R	SNP	-	NULL	ENST00000379454.4	37	NULL	CCDS34898.1	8																																																																																			-	ASPH	-	-		0.403	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	HGNC	protein_coding	OTTHUMT00000378510.3	0	0	0	96	96	123	0.00	0.00	C	NM_004318		62538820	-1	25	38	117	105	tier1	no_errors	ENST00000519678	ensembl	human	known	74_37	rna	17.61	26.57	SNP	1.000	G	25	117
HTR2C	3358	genome.wustl.edu	37	X	113965856	113965856	+	Silent	SNP	A	A	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chrX:113965856A>T	ENST00000276198.1	+	4	917	c.189A>T	c.(187-189)atA>atT	p.I63I	HTR2C_ENST00000371950.3_Silent_p.I63I|HTR2C_ENST00000371951.1_Silent_p.I63I	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	63					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCGTCATCATAATAATCATGA	0.428													ENSG00000147246																																					0													183.0	150.0	161.0					X																	113965856		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.189A>T	X.37:g.113965856A>T			B1AMW4|Q5VUF8|Q9NP28	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT2C_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.I63	ENST00000276198.1	37	c.189	CCDS14564.1	X																																																																																			-	HTR2C	-	prints_GPCR_Rhodpsn		0.428	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2C	HGNC	protein_coding	OTTHUMT00000057962.1	0	0	0	94	94	101	0.00	0.00	A	NM_000868		113965856	+1	17	22	25	27	tier1	no_errors	ENST00000276198	ensembl	human	known	74_37	silent	40.48	44.90	SNP	0.937	T	17	25
OR51H1P	401663	genome.wustl.edu	37	11	4881147	4881147	+	Silent	SNP	A	A	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:4881147A>G	ENST00000322059.1	-	1	647	c.648T>C	c.(646-648)acT>acC	p.T216T	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			Q8NH63	O51H1_HUMAN	olfactory receptor, family 51, subfamily H, member 1 pseudogene	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)	1						AAGACAGTAGAGTGAGGAGAA	0.532													ENSG00000176904																																					0																																										SO:0001819	synonymous_variant	0			-			11p15.4	2013-09-24		2004-03-10	ENSG00000176904	ENSG00000176904		"""GPCR / Class A : Olfactory receptors"""	14833	pseudogene	pseudogene				OR51H1			Standard	NG_004388		Approved			Q8NH63	OTTHUMG00000066512	ENST00000322059.1:c.648T>C	11.37:g.4881147A>G			Q6IFI3	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T216	ENST00000322059.1	37	c.648		11																																																																																			-	OR51H1P	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.532	OR51H1P-001	PUTATIVE	basic|appris_principal	protein_coding	OR51H1P	HGNC	protein_coding	OTTHUMT00000142185.1	0	0	0	29	29	79	0.00	0.00	A			4881147	-1	5	15	31	75	tier1	no_errors	ENST00000322059	ensembl	human	putative	74_37	silent	13.89	16.67	SNP	0.000	G	5	31
PPP2R2A	5520	genome.wustl.edu	37	8	26227825	26227825	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:26227825G>C	ENST00000380737.3	+	10	1569	c.1240G>C	c.(1240-1242)Gac>Cac	p.D414H	PPP2R2A_ENST00000315985.7_Missense_Mutation_p.D424H	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	414					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		TGACAGCCTAGACTTCAATAA	0.423													ENSG00000221914																																					0													88.0	87.0	87.0					8																	26227825		2203	4300	6503	SO:0001583	missense	0			-	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.1240G>C	8.37:g.26227825G>C	ENSP00000370113:p.Asp414His		B2RBU8|B4E1T7|P50409|Q00007	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.D414H	ENST00000380737.3	37	c.1240	CCDS34867.1	8	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365911	0.61513	.	.	ENSG00000221914	ENST00000380737;ENST00000524169;ENST00000315985	T;T;T	0.57273	1.59;0.41;1.59	5.25	5.25	0.73442	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	U	0.000000	T	0.81153	0.4763	H	0.94582	3.555	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.81914	0.989;0.984;0.995	D	0.85853	0.1405	10	0.87932	D	0	-18.6548	19.3941	0.94598	0.0:0.0:1.0:0.0	.	424;414;415	B4E1T7;P63151;Q6ZP32	.;2ABA_HUMAN;.	H	414;193;424	ENSP00000370113:D414H;ENSP00000430320:D193H;ENSP00000325074:D424H	ENSP00000325074:D424H	D	+	1	0	PPP2R2A	26283742	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.165000	0.94761	2.885000	0.99019	0.655000	0.94253	GAC	-	PPP2R2A	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55		0.423	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2A	HGNC	protein_coding	OTTHUMT00000375954.2	0	0	0	111	111	118	0.00	0.00	G	NM_002717		26227825	+1	24	14	87	60	tier1	no_errors	ENST00000380737	ensembl	human	known	74_37	missense	21.62	18.92	SNP	1.000	C	24	87
SCRN2	90507	genome.wustl.edu	37	17	45918224	45918224	+	Intron	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:45918224G>T	ENST00000290216.9	-	2	126				SCRN2_ENST00000584123.1_Missense_Mutation_p.P4T|SCRN2_ENST00000407215.3_Intron	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2							extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						GGAGAGGCGGGCCTCTCCATA	0.657											OREG0024502	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000141295																																					0													15.0	20.0	18.0					17																	45918224		2196	4300	6496	SO:0001627	intron_variant	0			-	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.1-15C>A	17.37:g.45918224G>T		935	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	pfam_Peptidase_C69,pfam_Pept_C45_AAT	p.P4T	ENST00000290216.9	37	c.10	CCDS11519.1	17																																																																																			-	SCRN2	-	NULL		0.657	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN2	HGNC	protein_coding	OTTHUMT00000441383.1	0	0	0	61	61	26	0.00	0.00	G	NM_138355		45918224	-1	12	4	60	25	tier1	no_errors	ENST00000584123	ensembl	human	putative	74_37	missense	16.67	13.79	SNP	0.000	T	12	60
BIN3	55909	genome.wustl.edu	37	8	22487957	22487957	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:22487957T>G	ENST00000276416.6	-	5	363	c.295A>C	c.(295-297)Aag>Cag	p.K99Q	BIN3_ENST00000519335.1_5'UTR|BIN3_ENST00000399977.4_Missense_Mutation_p.K51Q|BIN3_ENST00000520292.1_Missense_Mutation_p.K99Q|BIN3_ENST00000519513.1_Missense_Mutation_p.K45Q	NM_018688.4	NP_061158.1	Q9NQY0	BIN3_HUMAN	bridging integrator 3	99	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				actin filament organization (GO:0007015)|barrier septum assembly (GO:0000917)|cytokinesis (GO:0000910)|myoblast migration involved in skeletal muscle regeneration (GO:0014839)|protein localization (GO:0008104)|regulation of lamellipodium assembly (GO:0010591)|skeletal muscle fiber development (GO:0048741)|unidimensional cell growth (GO:0009826)	actin filament (GO:0005884)|cytoplasm (GO:0005737)	cytoskeletal adaptor activity (GO:0008093)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	9		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		CTAGTCACCTTTTCCTGATTG	0.602													ENSG00000147439																																					0													201.0	201.0	201.0					8																	22487957		2013	4168	6181	SO:0001583	missense	0			-		CCDS47825.1	8p21.2	2008-07-04			ENSG00000147439	ENSG00000147439			1054	protein-coding gene	gene with protein product		606396				16524918	Standard	NM_018688		Approved		uc003xcl.3	Q9NQY0	OTTHUMG00000163844	ENST00000276416.6:c.295A>C	8.37:g.22487957T>G	ENSP00000276416:p.Lys99Gln		Q9BVG2|Q9NVY9	Missense_Mutation	SNP	pfam_BAR_dom,pfam_Vps5_C,smart_BAR_dom,pfscan_BAR_dom	p.K99Q	ENST00000276416.6	37	c.295	CCDS47825.1	8	.	.	.	.	.	.	.	.	.	.	T	24.9	4.581045	0.86748	.	.	ENSG00000147439	ENST00000276416;ENST00000519513;ENST00000399977;ENST00000520292	T;T;T;T	0.62941	-0.01;-0.01;-0.01;0.31	5.57	5.57	0.84162	BAR (3);	0.053539	0.64402	D	0.000001	T	0.58235	0.2108	L	0.54323	1.7	0.80722	D	1	P;P	0.39535	0.636;0.677	B;B	0.39419	0.286;0.299	T	0.57481	-0.7804	10	0.29301	T	0.29	-39.1121	13.6917	0.62550	0.0:0.0:0.0:1.0	.	99;99	Q9NQY0;Q53HW0	BIN3_HUMAN;.	Q	99;45;51;99	ENSP00000276416:K99Q;ENSP00000430423:K45Q;ENSP00000382859:K51Q;ENSP00000429660:K99Q	ENSP00000276416:K99Q	K	-	1	0	BIN3	22543902	1.000000	0.71417	0.995000	0.50966	0.950000	0.60333	7.440000	0.80464	2.121000	0.65114	0.533000	0.62120	AAG	-	BIN3	-	pfam_BAR_dom,pfam_Vps5_C,smart_BAR_dom,pfscan_BAR_dom		0.602	BIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIN3	HGNC	protein_coding	OTTHUMT00000375895.1	0	0	0	54	54	89	0.00	0.00	T			22487957	-1	19	23	36	57	tier1	no_errors	ENST00000276416	ensembl	human	known	74_37	missense	34.55	28.75	SNP	1.000	G	19	36
FAM69B	138311	genome.wustl.edu	37	9	139616579	139616579	+	Silent	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:139616579G>A	ENST00000371692.4	+	4	405	c.309G>A	c.(307-309)gtG>gtA	p.V103V	SNHG7_ENST00000436596.1_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000416970.1_RNA|FAM69B_ENST00000371691.1_Silent_p.V16V	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	103						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		CTGTCCAGGTGTACAGCGGGC	0.667													ENSG00000165716																																					0													74.0	76.0	75.0					9																	139616579		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.309G>A	9.37:g.139616579G>A			Q5VUD7|Q8N5N0|Q8WYU5	Silent	SNP	pfam_FAM69_kinase_dom	p.V103	ENST00000371692.4	37	c.309	CCDS7004.1	9																																																																																			-	FAM69B	-	NULL		0.667	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM69B	HGNC	protein_coding	OTTHUMT00000055102.1	0	0	0	30	30	62	0.00	0.00	G	NM_152421		139616579	+1	11	21	25	46	tier1	no_errors	ENST00000371692	ensembl	human	known	74_37	silent	30.56	31.34	SNP	1.000	A	11	25
ZAN	7455	genome.wustl.edu	37	7	100350523	100350523	+	RNA	SNP	A	A	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:100350523A>G	ENST00000348028.3	+	0	2960				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ATCCCCACTGAAGAGACTACC	0.517													ENSG00000146839																																					0													310.0	356.0	342.0					7																	100350523		1847	4091	5938			0			-	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100350523A>G			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.E932G	ENST00000348028.3	37	c.2795		7	.	.	.	.	.	.	.	.	.	.	A	12.83	2.054369	0.36277	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.70164	-0.46;-0.46;-0.46	3.11	0.641	0.17759	.	.	.	.	.	T	0.72819	0.3508	L	0.59436	1.845	0.09310	N	0.999999	D;D	0.76494	0.995;0.999	D;D	0.81914	0.987;0.995	T	0.58607	-0.7607	9	0.56958	D	0.05	.	3.7894	0.08713	0.6966:0.0:0.1141:0.1893	.	932;932	F5H0T8;Q9Y493	.;ZAN_HUMAN	G	932	ENSP00000445943:E932G;ENSP00000445091:E932G;ENSP00000444427:E932G	ENSP00000423579:E932G	E	+	2	0	ZAN	100188459	0.013000	0.17824	0.000000	0.03702	0.000000	0.00434	-0.170000	0.09897	0.120000	0.18254	-0.353000	0.07706	GAA	-	ZAN	-	NULL		0.517	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	0	0	0	158	158	76	0.00	0.00	A	NM_003386		100350523	+1	81	21	127	44	tier1	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	38.94	31.82	SNP	0.000	G	81	127
CACNA1F	778	genome.wustl.edu	37	X	49065762	49065762	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chrX:49065762C>G	ENST00000376265.2	-	42	5007	c.4946G>C	c.(4945-4947)gGa>gCa	p.G1649A	CACNA1F_ENST00000376251.1_Missense_Mutation_p.G1584A|CACNA1F_ENST00000323022.5_Missense_Mutation_p.G1638A	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1649					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ctcctccactccctcctgccc	0.547													ENSG00000102001																																					0													174.0	116.0	135.0					X																	49065762		2203	4299	6502	SO:0001583	missense	0			-	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4946G>C	X.37:g.49065762C>G	ENSP00000365441:p.Gly1649Ala		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.G1649A	ENST00000376265.2	37	c.4946	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	C	0.131	-1.113938	0.01799	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265;ENST00000486943	D;D;D	0.96104	-3.91;-3.84;-3.84	4.43	0.969	0.19686	.	1.258290	0.05586	N	0.573880	D	0.84781	0.5548	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.76727	-0.2853	10	0.02654	T	1	.	0.8477	0.01165	0.1654:0.2098:0.3395:0.2854	.	1638;1649	F5CIQ9;O60840	.;CAC1F_HUMAN	A	1584;1638;1649;59	ENSP00000365427:G1584A;ENSP00000321618:G1638A;ENSP00000365441:G1649A	ENSP00000321618:G1638A	G	-	2	0	CACNA1F	48952706	0.000000	0.05858	0.004000	0.12327	0.903000	0.53119	-0.289000	0.08365	0.275000	0.22094	0.600000	0.82982	GGA	-	CAC1F	-	NULL		0.547	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CAC1F	HGNC	protein_coding	OTTHUMT00000358157.1	0	0	0	106	106	103	0.00	0.00	C	NM_005183		49065762	-1	39	30	53	48	tier1	no_errors	ENST00000376265	ensembl	human	known	74_37	missense	41.49	38.46	SNP	0.000	G	39	53
CPNE4	131034	genome.wustl.edu	37	3	131300488	131300488	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:131300488G>T	ENST00000512055.1	-	13	2928	c.802C>A	c.(802-804)Ccc>Acc	p.P268T	CPNE4_ENST00000511604.1_Missense_Mutation_p.P268T|CPNE4_ENST00000512332.1_Missense_Mutation_p.P286T|CPNE4_ENST00000429747.1_Missense_Mutation_p.P268T|CPNE4_ENST00000502818.1_Missense_Mutation_p.P286T			Q96A23	CPNE4_HUMAN	copine IV	268						extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						TTGTACTTGGGATTGATGCAC	0.453													ENSG00000196353																																					0													260.0	212.0	229.0					3																	131300488		2203	4300	6503	SO:0001583	missense	0			-	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.802C>A	3.37:g.131300488G>T	ENSP00000421705:p.Pro268Thr		D3DNC5|Q8TEX1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom	p.P286T	ENST00000512055.1	37	c.856	CCDS3072.1	3	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661951	0.88251	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.56275	0.48;0.48;0.47;0.48;0.47	5.52	5.52	0.82312	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.71888	0.3393	M	0.84433	2.695	0.80722	D	1	P;D	0.58268	0.843;0.982	P;P	0.55615	0.544;0.78	T	0.77354	-0.2619	10	0.87932	D	0	-17.408	18.2061	0.89854	0.0:0.0:1.0:0.0	.	286;268	Q96A23-2;Q96A23	.;CPNE4_HUMAN	T	268;268;286;268;286	ENSP00000421705:P268T;ENSP00000411904:P268T;ENSP00000424853:P286T;ENSP00000423811:P268T;ENSP00000421646:P286T	ENSP00000411904:P268T	P	-	1	0	CPNE4	132783178	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.673000	0.91186	2.605000	0.88082	0.655000	0.94253	CCC	-	CPNE4	-	superfamily_C2_dom		0.453	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	0	0	0	48	48	94	0.00	0.00	G	NM_130808		131300488	-1	15	11	39	63	tier1	no_errors	ENST00000502818	ensembl	human	known	74_37	missense	27.78	14.86	SNP	1.000	T	15	39
CRB2	286204	genome.wustl.edu	37	9	126133185	126133185	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:126133185G>T	ENST00000373631.3	+	7	1854	c.1853G>T	c.(1852-1854)gGg>gTg	p.G618V	CRB2_ENST00000373629.2_Missense_Mutation_p.G286V|CRB2_ENST00000359999.3_Missense_Mutation_p.G618V	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	618	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						GTCCACGGAGGGTCCTGTGTG	0.632													ENSG00000148204																																					0													62.0	62.0	62.0					9																	126133185		2203	4300	6503	SO:0001583	missense	0			-	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.1853G>T	9.37:g.126133185G>T	ENSP00000362734:p.Gly618Val		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G618V	ENST00000373631.3	37	c.1853	CCDS6852.2	9	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681658	0.47991	.	.	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	D;D;D	0.87491	-2.26;-2.26;-2.26	5.03	4.1	0.47936	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.150554	0.30989	N	0.008461	D	0.95433	0.8517	H	0.97758	4.07	0.80722	D	1	D;D	0.76494	0.994;0.999	P;D	0.67231	0.826;0.95	D	0.96424	0.9314	10	0.87932	D	0	.	13.7032	0.62622	0.0:0.2954:0.7046:0.0	.	618;618	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	V	618;618;286	ENSP00000353092:G618V;ENSP00000362734:G618V;ENSP00000362732:G286V	ENSP00000353092:G618V	G	+	2	0	CRB2	125173006	1.000000	0.71417	0.989000	0.46669	0.332000	0.28634	5.527000	0.67123	1.060000	0.40578	0.448000	0.29417	GGG	-	CRB2	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.632	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB2	HGNC	protein_coding	OTTHUMT00000053990.3	0	0	0	13	13	50	0.00	0.00	G	NM_173689		126133185	+1	8	19	11	11	tier1	no_errors	ENST00000373631	ensembl	human	known	74_37	missense	42.11	63.33	SNP	0.979	T	8	11
MYH9	4627	genome.wustl.edu	37	22	36681262	36681262	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr22:36681262C>G	ENST00000216181.5	-	38	5618	c.5388G>C	c.(5386-5388)gaG>gaC	p.E1796D	MYH9_ENST00000475726.1_5'UTR	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1796					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TGCCCTCCATCTCCTGCAGCT	0.587			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated				ENSG00000100345																												Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													144.0	112.0	123.0					22																	36681262		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	-		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.5388G>C	22.37:g.36681262C>G	ENSP00000216181:p.Glu1796Asp		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tR-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1796D	ENST00000216181.5	37	c.5388	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566379	0.65651	.	.	ENSG00000100345	ENST00000337818;ENST00000397231;ENST00000216181	D	0.84730	-1.89	5.03	3.98	0.46160	Myosin tail (1);Regulator of G protein signalling superfamily (1);	0.058396	0.64402	D	0.000003	D	0.87529	0.6200	M	0.76328	2.33	0.80722	D	1	P	0.41366	0.747	P	0.48270	0.572	D	0.87790	0.2618	10	0.87932	D	0	.	11.0668	0.47980	0.0:0.8466:0.0:0.1534	.	1796	P35579	MYH9_HUMAN	D	1218;398;1796	ENSP00000216181:E1796D	ENSP00000216181:E1796D	E	-	3	2	MYH9	35011208	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.895000	0.39778	1.069000	0.40788	0.557000	0.71058	GAG	-	MYH9	-	pfam_Myosin_tail,superfamily_Regulat_G_prot_signal_superfam		0.587	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	0	0	0	26	26	79	0.00	0.00	C	NM_002473		36681262	-1	10	13	29	51	tier1	no_errors	ENST00000216181	ensembl	human	known	74_37	missense	25.64	20.31	SNP	1.000	G	10	29
DNAH9	1770	genome.wustl.edu	37	17	11631267	11631267	+	Intron	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:11631267T>C	ENST00000262442.4	+	28	5882				DNAH9_ENST00000454412.2_Intron	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9						cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GTGGGAGCCTTGTGGTCTTCA	0.498													ENSG00000007174																																					0													82.0	74.0	77.0					17																	11631267		2203	4300	6503	SO:0001627	intron_variant	0			-	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.5814+28T>C	17.37:g.11631267T>C			A2VCQ8|O15064|O95494|Q9NQ28	R	SNP	-	NULL	ENST00000262442.4	37	NULL	CCDS11160.1	17																																																																																			-	DH9	-	-		0.498	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH9	HGNC	protein_coding	OTTHUMT00000252756.2	0	0	0	26	26	146	0.00	0.00	T	NM_001372		11631267	+1	13	68	14	64	tier1	no_errors	ENST00000584663	ensembl	human	putative	74_37	rna	48.15	51.13	SNP	0.000	C	13	14
RP9	6100	genome.wustl.edu	37	7	33136123	33136123	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:33136123C>T	ENST00000297157.3	-	5	466	c.449G>A	c.(448-450)cGa>cAa	p.R150Q		NM_203288.1	NP_976033.1	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9 (autosomal dominant)	150	PIM1-binding. {ECO:0000250}.				cognition (GO:0050890)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|signal recognition particle receptor complex (GO:0005785)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|urinary_tract(1)	7			GBM - Glioblastoma multiforme(11;0.0403)			CTTTTCATGTCGTTTATTGTC	0.373													ENSG00000164610																																					0													264.0	220.0	235.0					7																	33136123		2203	4300	6503	SO:0001583	missense	0			-	AX016710	CCDS5440.1	7p14.3	2014-01-28			ENSG00000164610	ENSG00000164610			10288	protein-coding gene	gene with protein product	"""Pim-1 kinase associated protein"""	607331				8513323	Standard	NM_203288		Approved	PAP-1	uc003tdm.3	Q8TA86	OTTHUMG00000152988	ENST00000297157.3:c.449G>A	7.37:g.33136123C>T	ENSP00000297157:p.Arg150Gln			Missense_Mutation	SNP	NULL	p.R150Q	ENST00000297157.3	37	c.449	CCDS5440.1	7	.	.	.	.	.	.	.	.	.	.	C	15.98	2.991875	0.54041	.	.	ENSG00000164610	ENST00000297157;ENST00000448915	D;D	0.83163	-1.58;-1.69	3.66	3.66	0.41972	.	0.120359	0.53938	D	0.000060	T	0.79251	0.4414	M	0.65498	2.005	0.38333	D	0.943846	B	0.24132	0.098	B	0.15870	0.014	T	0.77148	-0.2694	10	0.19590	T	0.45	-21.8648	14.3959	0.67010	0.0:1.0:0.0:0.0	.	150	Q8TA86	RP9_HUMAN	Q	150;116	ENSP00000297157:R150Q;ENSP00000411577:R116Q	ENSP00000297157:R150Q	R	-	2	0	RP9	33102648	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.183000	0.72002	1.980000	0.57719	0.508000	0.49915	CGA	-	RP9	-	NULL		0.373	RP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP9	HGNC	protein_coding	OTTHUMT00000328914.1	0	0	0	47	47	86	0.00	0.00	C	NM_203288		33136123	-1	32	28	46	70	tier1	no_errors	ENST00000297157	ensembl	human	known	74_37	missense	41.03	28.00	SNP	1.000	T	32	46
PLA2G4C	8605	genome.wustl.edu	37	19	48565415	48565415	+	Intron	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr19:48565415G>A	ENST00000599921.1	-	14	1460				PLA2G4C_ENST00000596510.1_Intron|PLA2G4C_ENST00000599111.1_Intron|CTD-2265M8.2_ENST00000596552.1_RNA|CTD-2265M8.2_ENST00000601950.1_RNA|CTD-2265M8.2_ENST00000601548.1_RNA|PLA2G4C_ENST00000413144.2_Intron|PLA2G4C_ENST00000354276.3_Intron			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)						arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		GCCACCTGTGGTGCCCAGGAA	0.547													ENSG00000105499																																					0													49.0	37.0	41.0					19																	48565415		2203	4300	6503	SO:0001627	intron_variant	0			-	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1103-6C>T	19.37:g.48565415G>A			B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	R	SNP	-	NULL	ENST00000599921.1	37	NULL	CCDS12710.1	19																																																																																			-	PLA2G4C	-	-		0.547	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLA2G4C	HGNC	protein_coding	OTTHUMT00000465551.1	0	0	0	32	32	93	0.00	0.00	G			48565415	-1	7	13	23	53	tier1	no_errors	ENST00000599239	ensembl	human	known	74_37	rna	23.33	19.70	SNP	0.001	A	7	23
UNC80	285175	genome.wustl.edu	37	2	210791624	210791624	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr2:210791624C>G	ENST00000439458.1	+	35	5602	c.5522C>G	c.(5521-5523)gCa>gGa	p.A1841G	UNC80_ENST00000272845.6_Missense_Mutation_p.A1836G	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1841					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CCCCCACAAGCAGTGTTCCCA	0.498													ENSG00000144406																																					0													192.0	161.0	170.0					2																	210791624		692	1591	2283	SO:0001583	missense	0			-	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.5522C>G	2.37:g.210791624C>G	ENSP00000391088:p.Ala1841Gly		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.A1841G	ENST00000439458.1	37	c.5522	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839544	0.71488	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.32753	1.44;1.44	5.67	5.67	0.87782	.	0.114671	0.64402	D	0.000018	T	0.24392	0.0591	N	0.14661	0.345	0.80722	D	1	B	0.22683	0.073	B	0.26969	0.075	T	0.04294	-1.0962	10	0.39692	T	0.17	-14.2436	19.7657	0.96340	0.0:1.0:0.0:0.0	.	1841	Q8N2C7	UNC80_HUMAN	G	1841;1836	ENSP00000391088:A1841G;ENSP00000272845:A1836G	ENSP00000272845:A1836G	A	+	2	0	UNC80	210499869	1.000000	0.71417	0.401000	0.26359	0.984000	0.73092	7.487000	0.81328	2.649000	0.89929	0.655000	0.94253	GCA	-	UNC80	-	NULL		0.498	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		0	0	0	57	57	96	0.00	0.00	C	NM_182587		210791624	+1	11	25	38	58	tier1	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	22.45	30.12	SNP	0.994	G	11	38
GLCE	26035	genome.wustl.edu	37	15	69548731	69548731	+	Splice_Site	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr15:69548731G>A	ENST00000261858.2	+	3	814	c.586G>A	c.(586-588)Ggt>Agt	p.G196S	GLCE_ENST00000559420.2_Splice_Site_p.G132S	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	196					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						TGGGGTTGAAGGTTGGTATCT	0.413													ENSG00000138604																																					0													69.0	70.0	70.0					15																	69548731		2200	4296	6496	SO:0001630	splice_region_variant	0			-	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.586+1G>A	15.37:g.69548731G>A			Q6GUQ2	Missense_Mutation	SNP	pfam_C5-epim	p.G196S	ENST00000261858.2	37	c.586	CCDS32277.1	15	.	.	.	.	.	.	.	.	.	.	G	31	5.069197	0.93950	.	.	ENSG00000138604	ENST00000261858	T	0.42900	0.96	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.67382	0.2887	M	0.84326	2.69	0.80722	D	1	D	0.76494	0.999	D	0.67103	0.949	T	0.72786	-0.4188	10	0.87932	D	0	-15.0894	17.6591	0.88187	0.0:0.0:1.0:0.0	.	196	O94923	GLCE_HUMAN	S	196	ENSP00000261858:G196S	ENSP00000261858:G196S	G	+	1	0	GLCE	67335785	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.603000	0.98315	2.578000	0.87016	0.655000	0.94253	GGT	-	GLCE	-	NULL		0.413	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCE	HGNC	protein_coding		0	0	0	53	53	166	0.00	0.00	G	NM_015554	Missense_Mutation	69548731	+1	15	48	59	216	tier1	no_errors	ENST00000261858	ensembl	human	known	74_37	missense	20.27	18.18	SNP	1.000	A	15	59
AL445384.1	0	genome.wustl.edu	37	14	28459224	28459224	+	RNA	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr14:28459224T>C	ENST00000411232.1	+	0	14																											GTCATATGTTTGTAAACATAT	0.294													ENSG00000223164																																					0																																												0			-																													14.37:g.28459224T>C				R	SNP	-	NULL	ENST00000411232.1	37	NULL		14																																																																																			-	AL445384.1	-	-		0.294	AL445384.1-201	NOVEL	basic	miRNA	ENSG00000223164	Clone_based_ensembl_gene	miRNA		0	0	0	110	110	25	0.00	0.00	T			28459224	+1	42	9	42	14	tier1	no_errors	ENST00000411232	ensembl	human	novel	74_37	rna	50.00	39.13	SNP	0.025	C	42	42
PDE1C	5137	genome.wustl.edu	37	7	31815286	31815286	+	Missense_Mutation	SNP	G	G	A	rs202172020		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:31815286G>A	ENST00000396191.1	-	17	2407	c.1952C>T	c.(1951-1953)aCg>aTg	p.T651M	PDE1C_ENST00000396193.1_Missense_Mutation_p.T711M|PDE1C_ENST00000321453.7_Missense_Mutation_p.T651M	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	651					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	ACCTGGCAACGTAAGGCGACA	0.488													ENSG00000154678																																					0													66.0	58.0	60.0					7																	31815286		876	1991	2867	SO:0001583	missense	0			-	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1952C>T	7.37:g.31815286G>A	ENSP00000379494:p.Thr651Met		B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.T651M	ENST00000396191.1	37	c.1952	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452213	0.43531	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453	T;T;T	0.74842	-0.88;-0.88;-0.88	5.62	5.62	0.85841	.	1.104160	0.06775	N	0.784258	T	0.81922	0.4925	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.985	T	0.74244	-0.3728	10	0.87932	D	0	.	16.371	0.83361	0.0:0.0:1.0:0.0	.	711;651	E9PE92;Q14123	.;PDE1C_HUMAN	M	711;651;651	ENSP00000379496:T711M;ENSP00000379494:T651M;ENSP00000318105:T651M	ENSP00000318105:T651M	T	-	2	0	PDE1C	31781811	0.998000	0.40836	0.995000	0.50966	0.216000	0.24613	4.896000	0.63222	2.662000	0.90505	0.655000	0.94253	ACG	rs202172020	PDE1C	-	NULL		0.488	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	0	0	0	74	74	104	0.00	0.00	G			31815286	-1	16	30	53	70	tier1	no_errors	ENST00000321453	ensembl	human	known	74_37	missense	23.19	30.00	SNP	0.999	A	16	53
ANXA13	312	genome.wustl.edu	37	8	124696849	124696849	+	Splice_Site	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:124696849C>T	ENST00000419625.1	-	10	904		c.e10+1		ANXA13_ENST00000262219.6_Splice_Site	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13						cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			GTGTGTCTTACCTCGGCCCTG	0.478													ENSG00000104537																																					0													150.0	116.0	127.0					8																	124696849		2203	4300	6503	SO:0001630	splice_region_variant	0			-	Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.831+1G>A	8.37:g.124696849C>T			Q9BQR5	Splice_Site	SNP	-	e11+1	ENST00000419625.1	37	c.954+1	CCDS47917.1	8	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704267	0.68615	.	.	ENSG00000104537	ENST00000262219;ENST00000419625	.	.	.	5.62	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0844	0.72138	0.1433:0.8567:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANXA13	124766030	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	6.455000	0.73497	1.489000	0.48450	0.555000	0.69702	.	-	ANXA13	-	-		0.478	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA13	HGNC	protein_coding	OTTHUMT00000381308.1	0	0	1	42	42	103	0.00	0.96	C	NM_004306	Intron	124696849	-1	16	22	31	65	tier1	no_errors	ENST00000262219	ensembl	human	known	74_37	splice_site	34.04	25.29	SNP	1.000	T	16	31
SCN4A	6329	genome.wustl.edu	37	17	62026027	62026027	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:62026027G>T	ENST00000435607.1	-	16	3164	c.3088C>A	c.(3088-3090)Cac>Aac	p.H1030N	SCN4A_ENST00000578147.1_Missense_Mutation_p.H1030N	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1030					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACCAGTTGTGCTCGACAATC	0.632													ENSG00000007314																																					0													51.0	54.0	53.0					17																	62026027		2201	4300	6501	SO:0001583	missense	0			-	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3088C>A	17.37:g.62026027G>T	ENSP00000396320:p.His1030Asn		Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.H1030N	ENST00000435607.1	37	c.3088	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764834	0.69878	.	.	ENSG00000007314	ENST00000435607	D	0.85861	-2.04	4.16	4.16	0.48862	Sodium ion transport-associated (1);	0.052924	0.85682	D	0.000000	D	0.89743	0.6803	M	0.80028	2.48	0.58432	D	0.999999	D	0.54964	0.969	P	0.54544	0.755	D	0.88969	0.3399	10	0.30854	T	0.27	.	15.9618	0.79936	0.0:0.0:1.0:0.0	.	1030	P35499	SCN4A_HUMAN	N	1030	ENSP00000396320:H1030N	ENSP00000396320:H1030N	H	-	1	0	SCN4A	59379759	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	9.601000	0.98297	2.324000	0.78689	0.313000	0.20887	CAC	-	SCN4A	-	pfam_Na_trans_assoc		0.632	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		0	0	0	48	48	46	0.00	0.00	G	NM_000334		62026027	-1	13	17	23	61	tier1	no_errors	ENST00000435607	ensembl	human	known	74_37	missense	36.11	21.79	SNP	1.000	T	13	23
NCR1	9437	genome.wustl.edu	37	19	55420623	55420623	+	Silent	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr19:55420623C>A	ENST00000291890.4	+	4	413	c.375C>A	c.(373-375)acC>acA	p.T125T	NCR1_ENST00000447255.1_Silent_p.T125T|NCR1_ENST00000338835.5_Silent_p.T125T|NCR1_ENST00000598576.1_Silent_p.T113T|NCR1_ENST00000350790.5_Silent_p.T30T|NCR1_ENST00000594765.1_Silent_p.T125T|NCR1_ENST00000357397.5_Silent_p.T18T	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	125					cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		ACACACCCACCCTCTCGGTTC	0.483													ENSG00000189430																																					0													83.0	71.0	75.0					19																	55420623		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.375C>A	19.37:g.55420623C>A			B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Silent	SNP	smart_Ig_sub	p.T125	ENST00000291890.4	37	c.375	CCDS12911.1	19																																																																																			-	NCR1	-	NULL		0.483	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCR1	HGNC	protein_coding	OTTHUMT00000465680.1	0	0	0	40	40	95	0.00	0.00	C			55420623	+1	11	15	41	46	tier1	no_errors	ENST00000291890	ensembl	human	known	74_37	silent	21.15	24.59	SNP	0.645	A	11	41
ATP6AP1	537	genome.wustl.edu	37	X	153663637	153663637	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chrX:153663637G>C	ENST00000369762.2	+	9	1050	c.989G>C	c.(988-990)cGc>cCc	p.R330P	GDI1_ENST00000447750.2_5'Flank	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	330					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGGCCAACCGCCTCTACCCA	0.627													ENSG00000071553																																					0													42.0	40.0	41.0					X																	153663637		2203	4300	6503	SO:0001583	missense	0			-	D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.989G>C	X.37:g.153663637G>C	ENSP00000358777:p.Arg330Pro		A6ZKI4|Q8NBT4|Q9H0C7	Missense_Mutation	SNP	pfam_BIG/ATPase_V1_suS1	p.R330P	ENST00000369762.2	37	c.989	CCDS35451.1	X	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971227	0.53614	.	.	ENSG00000071553	ENST00000369762;ENST00000422890;ENST00000445849	.	.	.	5.69	2.92	0.33932	.	0.201208	0.53938	D	0.000045	T	0.60741	0.2292	L	0.59436	1.845	0.35256	D	0.779187	D;D	0.60160	0.987;0.987	D;D	0.65233	0.933;0.933	T	0.65096	-0.6251	9	0.35671	T	0.21	-1.9201	7.1502	0.25606	0.1653:0.1378:0.697:0.0	.	290;330	B3KR70;Q15904	.;VAS1_HUMAN	P	330;244;154	.	ENSP00000358777:R330P	R	+	2	0	ATP6AP1	153316831	0.079000	0.21365	0.446000	0.26920	0.319000	0.28217	1.521000	0.35910	0.569000	0.29329	-0.223000	0.12442	CGC	-	ATP6AP1	-	pfam_BIG/ATPase_V1_suS1		0.627	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6AP1	HGNC	protein_coding	OTTHUMT00000081639.4	0	0	0	45	45	50	0.00	0.00	G	NM_001183		153663637	+1	7	16	22	35	tier1	no_errors	ENST00000369762	ensembl	human	known	74_37	missense	24.14	31.37	SNP	0.999	C	7	22
OR2Y1	134083	genome.wustl.edu	37	5	180166694	180166694	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr5:180166694C>A	ENST00000307832.2	-	1	405	c.365G>T	c.(364-366)cGc>cTc	p.R122L		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCAGCATAGCGGTCAAAGGC	0.607													ENSG00000174339																																					0													77.0	64.0	68.0					5																	180166694		2203	4300	6503	SO:0001583	missense	0			-	AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.365G>T	5.37:g.180166694C>A	ENSP00000312403:p.Arg122Leu		B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R122L	ENST00000307832.2	37	c.365	CCDS34323.1	5	.	.	.	.	.	.	.	.	.	.	c	15.88	2.963119	0.53507	.	.	ENSG00000174339	ENST00000307832	T	0.77358	-1.09	4.41	3.54	0.40534	GPCR, rhodopsin-like superfamily (1);	0.128292	0.36134	N	0.002767	D	0.88217	0.6377	H	0.97390	3.995	0.33977	D	0.647486	P	0.50369	0.934	P	0.51415	0.669	D	0.93119	0.6523	10	0.87932	D	0	.	10.5089	0.44849	0.0:0.903:0.0:0.097	.	122	Q8NGV0	OR2Y1_HUMAN	L	122	ENSP00000312403:R122L	ENSP00000312403:R122L	R	-	2	0	OR2Y1	180099300	1.000000	0.71417	0.997000	0.53966	0.025000	0.11179	3.930000	0.56522	1.197000	0.43143	0.511000	0.50034	CGC	-	OR2Y1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.607	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Y1	HGNC	protein_coding	OTTHUMT00000368059.2	0	0	0	38	38	51	0.00	0.00	C	XM_068682		180166694	-1	9	19	11	19	tier1	no_errors	ENST00000307832	ensembl	human	known	74_37	missense	45.00	50.00	SNP	1.000	A	9	11
UPF3AP2	147150	genome.wustl.edu	37	17	20279504	20279504	+	RNA	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:20279504G>C	ENST00000578315.1	-	0	202									UPF3A pseudogene 2																		TGCACCGGGGGCACAGGATTC	0.547													ENSG00000214832																																					0																																												0			-			17p11.2	2013-09-13	2013-09-13			ENSG00000214832			30567	pseudogene	pseudogene			"""UPF3 regulator of nonsense transcripts homolog A (yeast) pseudogene 2"""			11997339	Standard	NG_001546		Approved						17.37:g.20279504G>C				R	SNP	-	NULL	ENST00000578315.1	37	NULL		17																																																																																			-	UPF3AP2	-	-		0.547	UPF3AP2-002	KNOWN	basic	processed_transcript	UPF3AP2	HGNC	pseudogene	OTTHUMT00000443627.1	0	0	0	39	39	44	0.00	0.00	G	NG_001546		20279504	-1	24	26	26	22	tier1	no_errors	ENST00000578315	ensembl	human	known	74_37	rna	48.00	54.17	SNP	0.996	C	24	26
CEACAM8	1088	genome.wustl.edu	37	19	43092964	43092964	+	Silent	SNP	C	C	T	rs144424224		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr19:43092964C>T	ENST00000244336.5	-	4	1031	c.930G>A	c.(928-930)agG>agA	p.R310R	LIPE-AS1_ENST00000594688.1_RNA|LIPE-AS1_ENST00000594624.2_RNA|CEACAM8_ENST00000599005.1_Intron	NM_001816.3	NP_001807.2	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 8	310	Ig-like C2-type 2.				immune response (GO:0006955)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	16		Prostate(69;0.00899)				TGACTGTGGTCCTGTTGCGGC	0.498													ENSG00000124469																																					0								C		1,4405	2.1+/-5.4	0,1,2202	178.0	168.0	171.0		930	-4.1	0.0	19	dbSNP_134	171	0,8600		0,0,4300	no	coding-synonymous	CEACAM8	NM_001816.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		310/350	43092964	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	D90064	CCDS12610.1	19q13.2	2013-01-29			ENSG00000124469	ENSG00000124469		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1820	protein-coding gene	gene with protein product		615747		CGM6		2208113, 2306228	Standard	NM_001816		Approved	CD66b	uc002oud.2	P31997	OTTHUMG00000151124	ENST00000244336.5:c.930G>A	19.37:g.43092964C>T			O60399|Q16574	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R310	ENST00000244336.5	37	c.930	CCDS12610.1	19																																																																																			rs144424224	CEACAM8	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.498	CEACAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM8	HGNC	protein_coding	OTTHUMT00000321430.1	0	0	0	69	69	81	0.00	0.00	C			43092964	-1	23	16	72	54	tier1	no_errors	ENST00000244336	ensembl	human	known	74_37	silent	24.21	22.86	SNP	0.006	T	23	72
SPATA19	219938	genome.wustl.edu	37	11	133714498	133714498	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:133714498A>G	ENST00000299140.3	-	3	227	c.173T>C	c.(172-174)cTg>cCg	p.L58P	SPATA19_ENST00000532889.1_Missense_Mutation_p.L58P	NM_174927.1	NP_777587.1	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19	58					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	mitochondrial outer membrane (GO:0005741)				cervix(1)|endometrium(2)|large_intestine(2)|lung(5)|prostate(1)	11	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		GTTGATGGACAGCTTTTCCTT	0.517													ENSG00000166118																																					0													124.0	122.0	123.0					11																	133714498		2201	4297	6498	SO:0001583	missense	0			-	AK098717	CCDS8493.1	11q25	2010-04-23				ENSG00000166118			30614	protein-coding gene	gene with protein product	"""spergen 1"", ""cancer/testis antigen 132"""	609805				12477932	Standard	XM_005271448		Approved	FLJ25851, spergen1, SPAS1, CT132	uc001qgv.1	Q7Z5L4		ENST00000299140.3:c.173T>C	11.37:g.133714498A>G	ENSP00000299140:p.Leu58Pro		Q8N7A9	Missense_Mutation	SNP	NULL	p.L58P	ENST00000299140.3	37	c.173	CCDS8493.1	11	.	.	.	.	.	.	.	.	.	.	A	12.09	1.834871	0.32421	.	.	ENSG00000166118	ENST00000299140;ENST00000532889	T;T	0.50001	0.76;0.76	5.24	4.12	0.48240	.	0.442496	0.21816	N	0.068683	T	0.32971	0.0847	N	0.08118	0	0.42632	D	0.993388	P	0.47677	0.899	P	0.48227	0.571	T	0.22765	-1.0207	10	0.72032	D	0.01	.	7.7307	0.28786	0.9034:0.0:0.0966:0.0	.	58	Q7Z5L4	SPT19_HUMAN	P	58	ENSP00000299140:L58P;ENSP00000435248:L58P	ENSP00000299140:L58P	L	-	2	0	SPATA19	133219708	0.872000	0.30054	0.785000	0.31869	0.154000	0.21943	2.703000	0.47110	0.835000	0.34877	0.533000	0.62120	CTG	-	SPATA19	-	NULL		0.517	SPATA19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA19	HGNC	protein_coding	OTTHUMT00000393281.1	0	0	0	36	36	56	0.00	0.00	A	NM_174927		133714498	-1	5	9	14	27	tier1	no_errors	ENST00000299140	ensembl	human	known	74_37	missense	26.32	25.00	SNP	0.861	G	5	14
HEG1	57493	genome.wustl.edu	37	3	124732673	124732673	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:124732673A>C	ENST00000311127.4	-	6	1817	c.1750T>G	c.(1750-1752)Tca>Gca	p.S584A	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	584	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TAAGAAGTTGAGCTCTCCACA	0.423													ENSG00000173706																																					0													116.0	110.0	112.0					3																	124732673		1940	4137	6077	SO:0001583	missense	0			-	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1750T>G	3.37:g.124732673A>C	ENSP00000311502:p.Ser584Ala		Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.S584A	ENST00000311127.4	37	c.1750	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	A	15.03	2.712619	0.48517	.	.	ENSG00000173706	ENST00000311127	D	0.92752	-3.1	5.12	2.6	0.31112	.	0.000000	0.30392	U	0.009723	D	0.90448	0.7009	M	0.62723	1.935	0.28549	N	0.911702	P;B	0.40619	0.724;0.429	B;B	0.43155	0.41;0.14	D	0.84916	0.0851	10	0.59425	D	0.04	.	10.0338	0.42116	0.6715:0.3285:0.0:0.0	.	584;584	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	A	584	ENSP00000311502:S584A	ENSP00000311502:S584A	S	-	1	0	HEG1	126215363	0.955000	0.32602	0.965000	0.40720	0.304000	0.27724	0.408000	0.21065	0.363000	0.24346	0.528000	0.53228	TCA	-	HEG1	-	NULL		0.423	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	0	0	0	51	51	61	0.00	0.00	A	XM_087386		124732673	-1	10	11	50	40	tier1	no_errors	ENST00000311127	ensembl	human	known	74_37	missense	16.67	21.57	SNP	0.975	C	10	50
FABP4	2167	genome.wustl.edu	37	8	82391090	82391090	+	3'UTR	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:82391090G>A	ENST00000256104.4	-	0	504				FABP4_ENST00000518669.1_5'UTR|RP11-157I4.4_ENST00000524085.2_RNA	NM_001442.2	NP_001433.1	P15090	FABP4_HUMAN	fatty acid binding protein 4, adipocyte						brown fat cell differentiation (GO:0050873)|cellular response to lithium ion (GO:0071285)|cholesterol homeostasis (GO:0042632)|cytokine production (GO:0001816)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of inflammatory response (GO:0050729)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|nucleus (GO:0005634)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|large_intestine(1)|ovary(1)|skin(1)	6			Epithelial(68;0.213)			CCAGGTCAACGTCCCTTGGCT	0.388													ENSG00000170323																									NSCLC(35;550 1252 19644 48360)												0													183.0	153.0	163.0					8																	82391090		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	J02874	CCDS6230.1	8q21.13	2013-03-01			ENSG00000170323	ENSG00000170323		"""Fatty acid binding protein family"""	3559	protein-coding gene	gene with protein product		600434				2481498	Standard	NM_001442		Approved	A-FABP, aP2	uc003ycd.2	P15090	OTTHUMG00000164602	ENST00000256104.4:c.*10C>T	8.37:g.82391090G>A			Q6IBA1	R	SNP	-	NULL	ENST00000256104.4	37	NULL	CCDS6230.1	8																																																																																			-	FABP4	-	-		0.388	FABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP4	HGNC	protein_coding	OTTHUMT00000379368.1	0	0	1	63	63	90	0.00	1.10	G	NM_001442		82391090	-1	40	47	30	56	tier1	no_errors	ENST00000518669	ensembl	human	known	74_37	rna	57.14	45.63	SNP	0.000	A	40	30
RIMS2	9699	genome.wustl.edu	37	8	104709430	104709430	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:104709430C>G	ENST00000406091.3	+	2	293	c.293C>G	c.(292-294)aCa>aGa	p.T98R		NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	129	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TGCCACAAAACAAAGTTTGCT	0.438										HNSCC(12;0.0054)			ENSG00000176406																																					0													166.0	168.0	167.0					8																	104709430		1993	4168	6161	SO:0001583	missense	0			-	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.293C>G	8.37:g.104709430C>G	ENSP00000384892:p.Thr98Arg		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.T98R	ENST00000406091.3	37	c.293	CCDS55269.1	8	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022403	0.93462	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998	T;T	0.76448	-1.02;-1.02	5.72	5.72	0.89469	.	.	.	.	.	D	0.90872	0.7132	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92000	0.5610	9	0.87932	D	0	.	19.9379	0.97147	0.0:1.0:0.0:0.0	.	98	F8WD47	.	R	98;129;98;129	ENSP00000427018:T98R;ENSP00000384892:T98R	ENSP00000332184:T129R	T	+	2	0	RIMS2	104778606	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.815000	0.86186	2.710000	0.92621	0.556000	0.70494	ACA	-	RIMS2	-	superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel		0.438	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS2	HGNC	protein_coding		0	0	0	87	87	109	0.00	0.00	C	NM_001100117		104709430	+1	13	14	81	85	tier1	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	13.83	14.14	SNP	1.000	G	13	81
IMPDH2	3615	genome.wustl.edu	37	3	49064019	49064019	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:49064019G>C	ENST00000326739.4	-	8	882	c.843C>G	c.(841-843)atC>atG	p.I281M	RP13-131K19.6_ENST00000607245.1_RNA	NM_000884.2	NP_000875.2			IMP (inosine 5'-monophosphate) dehydrogenase 2											breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGATCTGGAAGATGGAATTTC	0.478													ENSG00000178035																																					0													127.0	111.0	117.0					3																	49064019		2203	4300	6503	SO:0001583	missense	0			-		CCDS2786.1	3p21.2	2014-05-15	2010-04-29		ENSG00000178035	ENSG00000178035	1.1.1.205		6053	protein-coding gene	gene with protein product		146691				9858805, 1969416	Standard	XM_006713128		Approved		uc003cvt.3	P12268	OTTHUMG00000156771	ENST00000326739.4:c.843C>G	3.37:g.49064019G>C	ENSP00000321584:p.Ile281Met			Missense_Mutation	SNP	pfam_IMP_DH_GMPRt,pfam_CBS_dom,pfam_2Npropane_dOase,pfam_FMN-dep_DH,pfam_NanE,smart_CBS_dom,pirsf_IMP_DH,tigrfam_IMP_DH	p.I281M	ENST00000326739.4	37	c.843	CCDS2786.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.848|8.848	0.943854|0.943854	0.18281|0.18281	.|.	.|.	ENSG00000178035|ENSG00000178035	ENST00000537036;ENST00000326739;ENST00000442157|ENST00000429182	T;T|.	0.78595|.	-1.18;-1.19|.	5.53|5.53	1.1|1.1	0.20463|0.20463	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.45736|0.45736	0.1357|0.1357	N|N	0.25286|0.25286	0.73|0.73	0.58432|0.58432	D|D	0.999998|0.999998	B|.	0.19445|.	0.036|.	B|.	0.29176|.	0.099|.	T|T	0.17471|0.17471	-1.0368|-1.0368	10|5	0.24483|.	T|.	0.36|.	-17.7336|-17.7336	10.3799|10.3799	0.44106|0.44106	0.4321:0.0:0.5679:0.0|0.4321:0.0:0.5679:0.0	.|.	281|.	P12268|.	IMDH2_HUMAN|.	M|V	281;281;256|213	ENSP00000321584:I281M;ENSP00000403502:I256M|.	ENSP00000321584:I281M|.	I|L	-|-	3|1	3|0	IMPDH2|IMPDH2	49039023|49039023	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	0.393000|0.393000	0.20817|0.20817	0.279000|0.279000	0.22186|0.22186	0.591000|0.591000	0.81541|0.81541	ATC|CTT	-	IMPDH2	-	pfam_IMP_DH_GMPRt,pfam_2Npropane_dOase,pfam_FMN-dep_DH,pfam_NanE,pirsf_IMP_DH,tigrfam_IMP_DH		0.478	IMPDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPDH2	HGNC	protein_coding	OTTHUMT00000345657.1	0	0	0	45	45	73	0.00	0.00	G			49064019	-1	25	25	21	39	tier1	no_errors	ENST00000326739	ensembl	human	known	74_37	missense	53.19	39.06	SNP	0.998	C	25	21
RSPH14	27156	genome.wustl.edu	37	22	23404056	23404056	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr22:23404056T>C	ENST00000216036.4	-	6	917	c.721A>G	c.(721-723)Aaa>Gaa	p.K241E		NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		241										breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		ACTGGGTCTTTCAGCAGATGG	0.587													ENSG00000100218																																					0													106.0	77.0	87.0					22																	23404056		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000216036.4:c.721A>G	22.37:g.23404056T>C	ENSP00000216036:p.Lys241Glu			Missense_Mutation	SNP	pfam_HEAT,pfam_Armadillo,superfamily_ARM-type_fold	p.K241E	ENST00000216036.4	37	c.721	CCDS13803.1	22	.	.	.	.	.	.	.	.	.	.	T	4.236	0.042644	0.08196	.	.	ENSG00000100218	ENST00000216036	T	0.16743	2.32	4.77	1.14	0.20703	Armadillo-like helical (1);Armadillo-type fold (1);	1.752930	0.02702	N	0.111853	T	0.13970	0.0338	L	0.45581	1.43	0.09310	N	1	B	0.22080	0.064	B	0.24848	0.056	T	0.21827	-1.0234	10	0.08381	T	0.77	-2.7304	1.6016	0.02675	0.1765:0.1015:0.1688:0.5532	.	241	Q9UHP6	RTDR1_HUMAN	E	241	ENSP00000216036:K241E	ENSP00000216036:K241E	K	-	1	0	RTDR1	21734056	0.008000	0.16893	0.009000	0.14445	0.032000	0.12392	-0.032000	0.12266	0.223000	0.20920	0.379000	0.24179	AAA	-	RTDR1	-	pfam_HEAT,pfam_Armadillo,superfamily_ARM-type_fold		0.587	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTDR1	HGNC	protein_coding	OTTHUMT00000319049.1	0	0	0	32	32	70	0.00	0.00	T			23404056	-1	23	11	35	78	tier1	no_errors	ENST00000216036	ensembl	human	known	74_37	missense	39.66	12.36	SNP	0.003	C	23	35
LYVE1	10894	genome.wustl.edu	37	11	10580737	10580737	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:10580737G>C	ENST00000256178.3	-	6	1048	c.890C>G	c.(889-891)tCa>tGa	p.S297*	MRVI1-AS1_ENST00000529979.1_RNA|LYVE1_ENST00000531706.1_5'Flank|MRVI1-AS1_ENST00000529829.1_RNA|LYVE1_ENST00000529598.1_Nonsense_Mutation_p.S193*	NM_006691.3	NP_006682.2	Q9Y5Y7	LYVE1_HUMAN	lymphatic vessel endothelial hyaluronan receptor 1	297					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8				all cancers(16;7.22e-08)|Epithelial(150;1.03e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0609)		AGTTTTCTTTGATTCCTCATT	0.423													ENSG00000133800																																					0													282.0	259.0	267.0					11																	10580737		2201	4294	6495	SO:0001587	stop_gained	0			-	AF118108	CCDS7804.1	11p15	2008-02-05	2007-06-26	2007-06-26		ENSG00000133800			14687	protein-coding gene	gene with protein product		605702	"""extracellular link domain containing 1"""	XLKD1		10037799, 12554094	Standard	NM_006691		Approved	LYVE-1	uc001miv.2	Q9Y5Y7		ENST00000256178.3:c.890C>G	11.37:g.10580737G>C	ENSP00000256178:p.Ser297*		Q8TC18|Q9UNF4	Nonsense_Mutation	SNP	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link,prints_Link	p.S297*	ENST00000256178.3	37	c.890	CCDS7804.1	11	.	.	.	.	.	.	.	.	.	.	g	16.94	3.261665	0.59431	.	.	ENSG00000133800	ENST00000256178;ENST00000529598	.	.	.	6.02	4.07	0.47477	.	0.847765	0.10524	N	0.664610	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-0.0066	8.6869	0.34243	0.0771:0.0:0.7731:0.1498	.	.	.	.	X	297;193	.	ENSP00000256178:S297X	S	-	2	0	LYVE1	10537313	1.000000	0.71417	0.953000	0.39169	0.176000	0.22953	2.693000	0.47027	1.579000	0.49836	-0.119000	0.15052	TCA	-	LYVE1	-	NULL		0.423	LYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYVE1	HGNC	protein_coding	OTTHUMT00000385893.1	0	0	0	105	105	93	0.00	0.00	G	NM_016164		10580737	-1	14	19	72	75	tier1	no_errors	ENST00000256178	ensembl	human	known	74_37	nonsense	16.28	19.79	SNP	0.990	C	14	72
IL1RL2	8808	genome.wustl.edu	37	2	102818149	102818149	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr2:102818149T>A	ENST00000264257.2	+	5	749	c.623T>A	c.(622-624)gTt>gAt	p.V208D	IL1RL2_ENST00000441515.2_Missense_Mutation_p.V91D|IL1RL2_ENST00000539491.1_Missense_Mutation_p.V208D|IL1RL2_ENST00000481806.1_3'UTR	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	208	Ig-like C2-type 2.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						CAGTACGAGGTTTTAAATGGC	0.478													ENSG00000115598																																					0													130.0	106.0	114.0					2																	102818149		2203	4300	6503	SO:0001583	missense	0			-	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.623T>A	2.37:g.102818149T>A	ENSP00000264257:p.Val208Asp		A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom,prints_IL-1_rcpt_I/II-typ,prints_IL-1_rcpt_I-typ	p.V208D	ENST00000264257.2	37	c.623	CCDS2056.1	2	.	.	.	.	.	.	.	.	.	.	T	17.67	3.446569	0.63178	.	.	ENSG00000115598	ENST00000264257;ENST00000441515;ENST00000539491	T;T;T	0.04917	3.83;3.53;3.83	4.56	4.56	0.56223	Immunoglobulin subtype (1);	0.514997	0.20040	N	0.100526	T	0.22437	0.0541	M	0.77313	2.365	0.24556	N	0.993998	D;D	0.65815	0.995;0.993	P;D	0.68192	0.905;0.956	T	0.02625	-1.1132	10	0.59425	D	0.04	.	10.4726	0.44646	0.0:0.0:0.0:1.0	.	91;208	A4FU63;Q9HB29	.;ILRL2_HUMAN	D	208;91;208	ENSP00000264257:V208D;ENSP00000413348:V91D;ENSP00000442184:V208D	ENSP00000264257:V208D	V	+	2	0	IL1RL2	102184581	0.042000	0.20092	0.003000	0.11579	0.196000	0.23810	3.284000	0.51708	2.046000	0.60703	0.379000	0.24179	GTT	-	IL1RL2	-	smart_Ig_sub,prints_IL-1_rcpt_I/II-typ		0.478	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL2	HGNC	protein_coding	OTTHUMT00000253290.1	0	0	0	54	54	74	0.00	0.00	T	NM_003854		102818149	+1	22	8	47	58	tier1	no_errors	ENST00000264257	ensembl	human	known	74_37	missense	31.88	12.12	SNP	0.005	A	22	47
MAP2K6	5608	genome.wustl.edu	37	17	67522761	67522761	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:67522761T>G	ENST00000590474.1	+	10	1079	c.792T>G	c.(790-792)ttT>ttG	p.F264L	MAP2K6_ENST00000589647.1_Missense_Mutation_p.F208L	NM_002758.3	NP_002749.2	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	264	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cell cycle arrest (GO:0007050)|cellular response to sorbitol (GO:0072709)|DNA damage induced protein phosphorylation (GO:0006975)|innate immune response (GO:0045087)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to ischemia (GO:0002931)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	20	Breast(10;6.05e-10)					GAACTCCATTTCAGCAGCTCA	0.468													ENSG00000108984																																					0													104.0	100.0	101.0					17																	67522761		2203	4300	6503	SO:0001583	missense	0			-	U39064	CCDS11686.1	17q	2011-06-09						"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6846	protein-coding gene	gene with protein product	"""protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6)"""	601254		PRKMK6		8621675	Standard	XM_005257515		Approved	MEK6, MKK6, SAPKK3, MAPKK6	uc002jij.3	P52564		ENST00000590474.1:c.792T>G	17.37:g.67522761T>G	ENSP00000468348:p.Phe264Leu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F264L	ENST00000590474.1	37	c.792	CCDS11686.1	17	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843648	0.91197	.	.	ENSG00000108984	ENST00000359094	.	.	.	6.16	-4.3	0.03710	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.58075	0.2097	N	0.20328	0.56	0.58432	D	0.999999	D	0.63880	0.993	D	0.81914	0.995	T	0.56890	-0.7904	8	.	.	.	-19.3305	19.3989	0.94620	0.0:0.7847:0.0:0.2153	.	264	P52564	MP2K6_HUMAN	L	264	.	.	F	+	3	2	MAP2K6	65034356	0.371000	0.25056	0.730000	0.30809	0.989000	0.77384	-0.285000	0.08410	-0.891000	0.03940	0.528000	0.53228	TTT	-	MAP2K6	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.468	MAP2K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K6	HGNC	protein_coding	OTTHUMT00000450689.1	0	0	1	49	49	66	0.00	1.49	T	NM_002758		67522761	+1	15	19	37	64	tier1	no_errors	ENST00000590474	ensembl	human	known	74_37	missense	28.85	22.89	SNP	0.967	G	15	37
PADI2	11240	genome.wustl.edu	37	1	17413052	17413052	+	Silent	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:17413052G>T	ENST00000375486.4	-	7	861	c.798C>A	c.(796-798)gtC>gtA	p.V266V	PADI2_ENST00000444885.2_Missense_Mutation_p.S185Y|PADI2_ENST00000375481.1_Silent_p.V266V	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	266					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	CATGGATGGAGACCAGGCCTG	0.632													ENSG00000117115																																					0													38.0	39.0	38.0					1																	17413052		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.798C>A	1.37:g.17413052G>T			Q96DA7|Q9UPN2	Missense_Mutation	SNP	pfam_PAD_C,pfam_PAD_N,superfamily_Cupredoxin,superfamily_Prot_Arg_deaminase_cen_dom	p.S185Y	ENST00000375486.4	37	c.554	CCDS177.1	1	.	.	.	.	.	.	.	.	.	.	G	9.045	0.990684	0.18966	.	.	ENSG00000117115	ENST00000444885	T	0.05925	3.37	5.08	-0.382	0.12481	.	.	.	.	.	T	0.06781	0.0173	.	.	.	0.24240	N	0.99536	B	0.19935	0.04	B	0.31016	0.123	T	0.40440	-0.9563	8	0.59425	D	0.04	-41.9573	8.3059	0.32042	0.1579:0.5167:0.3254:0.0	.	185	B4DIU3	.	Y	185	ENSP00000405894:S185Y	ENSP00000405894:S185Y	S	-	2	0	PADI2	17285639	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	0.741000	0.26202	-0.101000	0.12219	0.460000	0.39030	TCT	-	PADI2	-	NULL		0.632	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI2	HGNC	protein_coding	OTTHUMT00000006624.1	0	0	0	73	73	65	0.00	0.00	G			17413052	-1	21	15	77	69	tier1	no_errors	ENST00000444885	ensembl	human	known	74_37	missense	21.43	17.86	SNP	0.993	T	21	77
C8orf12	83656	genome.wustl.edu	37	8	11223281	11223281	+	5'Flank	SNP	A	A	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:11223281A>T	ENST00000284481.3	+	0	0				TDH_ENST00000534302.1_RNA					chromosome 8 open reading frame 12																		TCAAGGGAGAACTGTCACAAC	0.453													ENSG00000154316																																					0																																										SO:0001631	upstream_gene_variant	0			-	AJ301563		8p23.1	2013-01-15			ENSG00000184608	ENSG00000184608			15548	other	unknown							Standard	NR_026814		Approved			Q96KT0	OTTHUMG00000165366		8.37:g.11223281A>T	Exception_encountered			R	SNP	-	NULL	ENST00000284481.3	37	NULL		8																																																																																			-	TDH	-	-		0.453	C8orf12-201	KNOWN	basic|appris_principal	protein_coding	TDH	HGNC	protein_coding		0	0	0	19	19	100	0.00	0.00	A	NR_026814		11223281	+1	5	31	11	57	tier1	no_errors	ENST00000525246	ensembl	human	known	74_37	rna	31.25	34.83	SNP	0.000	T	5	11
FRMD3	257019	genome.wustl.edu	37	9	85905553	85905553	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:85905553G>A	ENST00000304195.3	-	13	1366	c.1160C>T	c.(1159-1161)cCc>cTc	p.P387L	FRMD3_ENST00000376434.1_Missense_Mutation_p.P193L|FRMD3_ENST00000376438.1_Missense_Mutation_p.P387L	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	387						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						TTGCTCGCTGGGGGAAGGAAG	0.517													ENSG00000172159																																					0													105.0	106.0	106.0					9																	85905553		1914	4135	6049	SO:0001583	missense	0			-	AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1160C>T	9.37:g.85905553G>A	ENSP00000303508:p.Pro387Leu		A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.P387L	ENST00000304195.3	37	c.1160	CCDS43840.1	9	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509684	0.64522	.	.	ENSG00000172159	ENST00000376438;ENST00000376434;ENST00000304195	D;D;D	0.86562	-1.69;-2.14;-1.67	5.9	5.9	0.94986	.	0.159994	0.56097	D	0.000029	T	0.81522	0.4840	N	0.19112	0.55	0.80722	D	1	B;B	0.25563	0.084;0.129	B;B	0.27076	0.045;0.076	T	0.76798	-0.2826	10	0.46703	T	0.11	.	19.0536	0.93054	0.0:0.0:1.0:0.0	.	387;387	A2A2Y4;A2A2Y4-2	FRMD3_HUMAN;.	L	387;193;387	ENSP00000365621:P387L;ENSP00000365617:P193L;ENSP00000303508:P387L	ENSP00000303508:P387L	P	-	2	0	FRMD3	85095373	1.000000	0.71417	0.857000	0.33713	0.930000	0.56654	5.767000	0.68850	2.806000	0.96561	0.655000	0.94253	CCC	-	FRMD3	-	NULL		0.517	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD3	HGNC	protein_coding	OTTHUMT00000157355.1	0	0	0	60	60	62	0.00	0.00	G	NM_174938		85905553	-1	17	18	46	38	tier1	no_errors	ENST00000304195	ensembl	human	known	74_37	missense	26.98	32.14	SNP	0.941	A	17	46
PEBP1	5037	genome.wustl.edu	37	12	118582631	118582631	+	3'UTR	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr12:118582631C>G	ENST00000261313.2	+	0	939				PEBP1_ENST00000542939.1_3'UTR	NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGACCTGAACTGTCCTGGAG	0.567													ENSG00000089220																									NSCLC(44;94 1357 12187 49467)												0													45.0	40.0	41.0					12																	118582631		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.*23C>G	12.37:g.118582631C>G			B2R4S1	R	SNP	-	NULL	ENST00000261313.2	37	NULL	CCDS9187.1	12																																																																																			-	PEBP1	-	-		0.567	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEBP1	HGNC	protein_coding	OTTHUMT00000401405.1	0	0	0	23	23	29	0.00	0.00	C	NM_002567		118582631	+1	9	12	26	11	tier1	no_errors	ENST00000542939	ensembl	human	known	74_37	rna	25.71	52.17	SNP	0.000	G	9	26
KIF17	57576	genome.wustl.edu	37	1	21014006	21014006	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:21014006G>T	ENST00000247986.2	-	8	2123	c.1813C>A	c.(1813-1815)Ccc>Acc	p.P605T	KIF17_ENST00000375044.1_Missense_Mutation_p.P505T|KIF17_ENST00000400463.3_Missense_Mutation_p.P605T|KIF17_ENST00000490034.1_Intron			Q9P2E2	KIF17_HUMAN	kinesin family member 17	605					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CCCTGCAGGGGCACCTCCTGC	0.657													ENSG00000117245																																					0													38.0	40.0	40.0					1																	21014006		2203	4300	6503	SO:0001583	missense	0			-	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1813C>A	1.37:g.21014006G>T	ENSP00000247986:p.Pro605Thr		A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P605T	ENST00000247986.2	37	c.1813	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	G	8.876	0.950473	0.18431	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.71698	-0.59;-0.45;-0.45	4.43	-2.75	0.05914	.	0.579344	0.13005	U	0.421312	T	0.55178	0.1904	L	0.36672	1.1	0.09310	N	1	B;B	0.24721	0.11;0.007	B;B	0.22601	0.04;0.007	T	0.45101	-0.9284	10	0.56958	D	0.05	.	8.5046	0.33179	0.1732:0.5736:0.2533:0.0	.	605;605	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	T	505;605;605	ENSP00000364184:P505T;ENSP00000383311:P605T;ENSP00000247986:P605T	ENSP00000247986:P605T	P	-	1	0	KIF17	20886593	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.551000	0.06027	-0.640000	0.05495	0.563000	0.77884	CCC	-	KIF17	-	NULL		0.657	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	0	0	0	31	31	33	0.00	0.00	G	NM_020816		21014006	-1	8	7	48	38	tier1	no_errors	ENST00000247986	ensembl	human	known	74_37	missense	14.29	15.56	SNP	0.000	T	8	48
KCNQ5	56479	genome.wustl.edu	37	6	73904739	73904739	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr6:73904739G>C	ENST00000370398.1	+	14	2510	c.2401G>C	c.(2401-2403)Gac>Cac	p.D801H	KCNQ5_ENST00000403813.2_Missense_Mutation_p.D792H|KCNQ5_ENST00000402622.2_Missense_Mutation_p.D811H|KCNQ5_ENST00000355194.4_Missense_Mutation_p.D801H|KCNQ5_ENST00000414165.2_Missense_Mutation_p.D691H|KCNQ5_ENST00000355635.3_Missense_Mutation_p.D802H|KCNQ5_ENST00000342056.2_Missense_Mutation_p.D820H	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	801					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	TCTCACCAAGGACCGTTCTAT	0.488													ENSG00000185760																									GBM(142;1375 1859 14391 23261 44706)												0													147.0	118.0	128.0					6																	73904739		2203	4300	6503	SO:0001583	missense	0			-	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2401G>C	6.37:g.73904739G>C	ENSP00000359425:p.Asp801His		A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.D811H	ENST00000370398.1	37	c.2431	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	G	18.20	3.572328	0.65765	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99519	-5.87;-5.88;-5.88;-5.88;-5.89;-5.91;-6.07	5.71	5.71	0.89125	.	0.136607	0.49916	D	0.000125	D	0.99143	0.9704	L	0.45581	1.43	0.39007	D	0.959464	D;B;D;B;B	0.76494	0.999;0.028;0.981;0.004;0.002	D;B;P;B;B	0.76071	0.987;0.018;0.687;0.01;0.003	D	0.99889	1.1130	10	0.30078	T	0.28	.	18.043	0.89324	0.0:0.0:1.0:0.0	.	691;811;820;792;801	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	H	820;820;801;801;811;802;792;691	ENSP00000345055:D820H;ENSP00000347326:D801H;ENSP00000359425:D801H;ENSP00000385501:D811H;ENSP00000347853:D802H;ENSP00000384453:D792H;ENSP00000409861:D691H	ENSP00000345055:D820H	D	+	1	0	KCNQ5	73961460	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.889000	0.63171	2.689000	0.91719	0.655000	0.94253	GAC	-	KCNQ5	-	NULL		0.488	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	HGNC	protein_coding	OTTHUMT00000041198.3	0	0	0	55	55	108	0.00	0.00	G	NM_019842		73904739	+1	16	13	51	76	tier1	no_errors	ENST00000402622	ensembl	human	known	74_37	missense	23.88	14.44	SNP	1.000	C	16	51
LRRC38	126755	genome.wustl.edu	37	1	13839848	13839848	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:13839848C>A	ENST00000376085.3	-	1	695	c.241G>T	c.(241-243)Gac>Tac	p.D81Y	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	81					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TAGACCAGGTCGCCGTAGAAG	0.637													ENSG00000162494																																					0																																										SO:0001583	missense	0			-	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.241G>T	1.37:g.13839848C>A	ENSP00000365253:p.Asp81Tyr		Q96B32	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.D81Y	ENST00000376085.3	37	c.241	CCDS53269.1	1	.	.	.	.	.	.	.	.	.	.	C	19.60	3.858504	0.71834	.	.	ENSG00000162494	ENST00000376085	T	0.57595	0.39	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.62938	0.2469	L	0.38733	1.17	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.67776	-0.5583	10	0.87932	D	0	.	14.9716	0.71238	0.0:1.0:0.0:0.0	.	81	Q5VT99	LRC38_HUMAN	Y	81	ENSP00000365253:D81Y	ENSP00000365253:D81Y	D	-	1	0	LRRC38	13712435	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	7.616000	0.83018	1.837000	0.53436	0.297000	0.19635	GAC	-	LRRC38	-	smart_Leu-rich_rpt_typical-subtyp		0.637	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC38	HGNC	protein_coding	OTTHUMT00000021793.1	0	0	0	53	53	36	0.00	0.00	C			13839848	-1	19	5	60	31	tier1	no_errors	ENST00000376085	ensembl	human	known	74_37	missense	23.75	13.89	SNP	0.998	A	19	60
CSMD1	64478	genome.wustl.edu	37	8	2800029	2800029	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:2800029A>C	ENST00000520002.1	-	70	11058	c.10503T>G	c.(10501-10503)atT>atG	p.I3501M	CSMD1_ENST00000602723.1_Missense_Mutation_p.I3324M|CSMD1_ENST00000400186.3_Missense_Mutation_p.I3324M|CSMD1_ENST00000537824.1_Missense_Mutation_p.I3500M|CSMD1_ENST00000542608.1_Missense_Mutation_p.I3323M|CSMD1_ENST00000602557.1_Missense_Mutation_p.I3501M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3501						integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACCCTGATAAAATTAGAGCAA	0.438													ENSG00000183117																																					0													48.0	48.0	48.0					8																	2800029		1863	4098	5961	SO:0001583	missense	0			-			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.10503T>G	8.37:g.2800029A>C	ENSP00000430733:p.Ile3501Met		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.I3501M	ENST00000520002.1	37	c.10503		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.61|18.61	3.661420|3.661420	0.67700|0.67700	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|T;T;T;T	.|0.38240	.|1.15;1.43;1.46;1.15	5.67|5.67	0.149|0.149	0.14863|0.14863	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49184|0.49184	0.1542|0.1542	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	.|P;D;D	.|0.76494	.|0.883;0.999;0.998	.|P;D;D	.|0.87578	.|0.499;0.998;0.979	T|T	0.44620|0.44620	-0.9316|-0.9316	5|10	.|0.87932	.|D	.|0	.|.	4.6454|4.6454	0.12570|0.12570	0.5497:0.0:0.2583:0.192|0.5497:0.0:0.2583:0.192	.|.	.|3501;3501;3323	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	V|M	2903|3324;3501;3362;3500;3323	.|ENSP00000383047:I3324M;ENSP00000430733:I3501M;ENSP00000441462:I3500M;ENSP00000446243:I3323M	.|ENSP00000320445:I3362M	F|I	-|-	1|3	0|3	CSMD1|CSMD1	2787436|2787436	0.992000|0.992000	0.36948|0.36948	0.134000|0.134000	0.22075|0.22075	0.950000|0.950000	0.60333|0.60333	0.774000|0.774000	0.26675|0.26675	0.073000|0.073000	0.16731|0.16731	0.523000|0.523000	0.50628|0.50628	TTT|ATT	-	CSMD1	-	NULL		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	0	0	0	74	74	106	0.00	0.00	A	NM_033225		2800029	-1	18	19	42	19	tier1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	30.00	50.00	SNP	0.711	C	18	42
NDFIP2	54602	genome.wustl.edu	37	13	80125212	80125212	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr13:80125212G>T	ENST00000218652.7	+	7	1020	c.968G>T	c.(967-969)aGt>aTt	p.S323I		NM_001161407.1|NM_019080.2	NP_001154879.1|NP_061953.2	Q9NV92	NFIP2_HUMAN	Nedd4 family interacting protein 2	323					negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of transporter activity (GO:0032410)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			NS(1)|breast(1)|endometrium(2)|kidney(3)|lung(3)|ovary(2)|prostate(1)|skin(1)	14		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)		ATGTCTGAAAGTATGGCAGCT	0.328													ENSG00000102471																																					0													110.0	121.0	117.0					13																	80125212		2203	4296	6499	SO:0001583	missense	0			-	AB032991	CCDS31998.1	13q22.1	2011-05-18			ENSG00000102471	ENSG00000102471			18537	protein-coding gene	gene with protein product		610041				10574461, 12050153	Standard	NM_019080		Approved	KIAA1165, N4wbp5a	uc001vlf.3	Q9NV92	OTTHUMG00000017136	ENST00000218652.7:c.968G>T	13.37:g.80125212G>T	ENSP00000218652:p.Ser323Ile		Q7Z2H3|Q7Z428|Q8TAR3|Q9ULQ5	Missense_Mutation	SNP	pfam_NEDD4/BSD2	p.S323I	ENST00000218652.7	37	c.968	CCDS31998.1	13	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671696	0.67928	.	.	ENSG00000102471	ENST00000218652;ENST00000487865	T;T	0.32988	1.43;1.5	5.67	4.82	0.62117	.	0.170323	0.64402	D	0.000004	T	0.40398	0.1115	N	0.24115	0.695	0.48135	D	0.999596	D;D	0.89917	0.998;1.0	D;D	0.77004	0.953;0.989	T	0.20207	-1.0282	10	0.33940	T	0.23	-23.1091	14.6199	0.68576	0.0699:0.0:0.9301:0.0	.	209;323	B4DGY6;Q9NV92	.;NFIP2_HUMAN	I	323;220	ENSP00000218652:S323I;ENSP00000419200:S220I	ENSP00000218652:S323I	S	+	2	0	NDFIP2	79023213	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.980000	0.70516	1.413000	0.46997	0.460000	0.39030	AGT	-	NDFIP2	-	pfam_NEDD4/BSD2		0.328	NDFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDFIP2	HGNC	protein_coding	OTTHUMT00000045380.2	0	0	0	54	54	80	0.00	0.00	G			80125212	+1	11	4	33	35	tier1	no_errors	ENST00000218652	ensembl	human	known	74_37	missense	25.00	10.26	SNP	1.000	T	11	33
UNCX	340260	genome.wustl.edu	37	7	1273220	1273220	+	Silent	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:1273220C>G	ENST00000316333.8	+	2	450	c.339C>G	c.(337-339)acC>acG	p.T113T		NM_001080461.1	NP_001073930.1	A6NJT0	UNC4_HUMAN	UNC homeobox	113					cartilage condensation (GO:0001502)|common myeloid progenitor cell proliferation (GO:0035726)|dorsal spinal cord development (GO:0021516)|olfactory bulb interneuron differentiation (GO:0021889)|pattern specification process (GO:0007389)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T113T(1)		lung(2)|skin(1)|upper_aerodigestive_tract(1)	4		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CCAACTTCACCGGCTGGCAGC	0.687													ENSG00000164853																																					1	Substitution - coding silent(1)	lung(1)											29.0	31.0	30.0					7																	1273220		2189	4289	6478	SO:0001819	synonymous_variant	0			-		CCDS34583.1	7p22.3	2011-06-20			ENSG00000164853	ENSG00000164853		"""Homeoboxes / PRD class"""	33194	protein-coding gene	gene with protein product							Standard	NM_001080461		Approved	Uncx4.1	uc011jvw.2	A6NJT0	OTTHUMG00000152022	ENST00000316333.8:c.339C>G	7.37:g.1273220C>G			A4D221	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.T113	ENST00000316333.8	37	c.339	CCDS34583.1	7																																																																																			-	UNCX	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.687	UNCX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	UNCX	HGNC	protein_coding	OTTHUMT00000324910.2	0	0	0	92	92	18	0.00	0.00	C	NM_001080461		1273220	+1	18	2	130	14	tier1	no_errors	ENST00000316333	ensembl	human	known	74_37	silent	12.16	12.50	SNP	0.995	G	18	130
CCDC13	152206	genome.wustl.edu	37	3	42774443	42774443	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:42774443G>T	ENST00000310232.6	-	12	1614	c.1531C>A	c.(1531-1533)Cac>Aac	p.H511N	CCDC13-AS1_ENST00000446950.1_RNA|CCDC13-AS1_ENST00000418161.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	511										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						ACCAGTGTGTGGCCCAGGCTG	0.622													ENSG00000244607																																					0													38.0	30.0	33.0					3																	42774443		2170	4236	6406	SO:0001583	missense	0			-	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1531C>A	3.37:g.42774443G>T	ENSP00000309836:p.His511Asn			Missense_Mutation	SNP	superfamily_Prefoldin	p.H511N	ENST00000310232.6	37	c.1531	CCDS2705.1	3	.	.	.	.	.	.	.	.	.	.	G	17.89	3.498593	0.64298	.	.	ENSG00000244607	ENST00000310232	T	0.12039	2.72	6.08	6.08	0.98989	.	0.170119	0.50627	D	0.000105	T	0.35128	0.0921	M	0.76574	2.34	0.36167	D	0.848534	D	0.67145	0.996	P	0.60609	0.877	T	0.21655	-1.0239	9	.	.	.	.	16.1648	0.81747	0.0:0.0:1.0:0.0	.	511	Q8IYE1	CCD13_HUMAN	N	511	ENSP00000309836:H511N	.	H	-	1	0	CCDC13	42749447	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.412000	0.66392	2.890000	0.99128	0.655000	0.94253	CAC	-	CCDC13	-	NULL		0.622	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	HGNC	protein_coding	OTTHUMT00000256652.1	0	0	0	35	35	32	0.00	0.00	G	NM_144719		42774443	-1	8	12	38	47	tier1	no_errors	ENST00000310232	ensembl	human	known	74_37	missense	17.39	20.34	SNP	1.000	T	8	38
TMEM132C	92293	genome.wustl.edu	37	12	129189821	129189821	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr12:129189821C>T	ENST00000435159.2	+	9	2308	c.2308C>T	c.(2308-2310)Cga>Tga	p.R770*	TMEM132C_ENST00000537538.1_Nonsense_Mutation_p.R155*|TMEM132C_ENST00000315208.8_Nonsense_Mutation_p.R386*	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	770						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCCACTGATCCGAGTGGACAT	0.642													ENSG00000181234																																					0													24.0	29.0	27.0					12																	129189821		692	1591	2283	SO:0001587	stop_gained	0			-	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2308C>T	12.37:g.129189821C>T	ENSP00000410852:p.Arg770*		Q69YX8	Nonsense_Mutation	SNP	NULL	p.R770*	ENST00000435159.2	37	c.2308		12	.	.	.	.	.	.	.	.	.	.	C	37	6.414742	0.97546	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	.	.	.	4.84	3.86	0.44501	.	0.121402	0.33875	N	0.004469	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0737	0.42347	0.4706:0.5294:0.0:0.0	.	.	.	.	X	770;386;155	.	ENSP00000324458:R386X	R	+	1	2	TMEM132C	127755774	0.818000	0.29161	0.940000	0.37924	0.559000	0.35586	2.102000	0.41796	2.230000	0.72887	0.655000	0.94253	CGA	-	TMEM132C	-	NULL		0.642	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		0	0	0	34	34	19	0.00	0.00	C	XM_044062		129189821	+1	8	6	41	17	tier1	no_errors	ENST00000435159	ensembl	human	known	74_37	nonsense	16.33	26.09	SNP	0.991	T	8	41
RPLP0P2	113157	genome.wustl.edu	37	11	61404548	61404548	+	RNA	SNP	G	G	T	rs572940221	byFrequency	TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:61404548G>T	ENST00000496593.1	+	0	1152					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		TCTGGACCCCGAGAAGACCTC	0.547													ENSG00000243742																																					0																																												0			-	BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404548G>T				R	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			-	RPLP0P2	-	-		0.547	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1	0	0	0	60	60	35	0.00	0.00	G	NR_002775		61404548	+1	12	6	45	28	tier1	no_errors	ENST00000496593	ensembl	human	known	74_37	rna	21.05	17.65	SNP	1.000	T	12	45
DNAH6	1768	genome.wustl.edu	37	2	85046471	85046471	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr2:85046471A>T	ENST00000237449.6	+	76	12424	c.12416A>T	c.(12415-12417)aAg>aTg	p.K4139M	DNAH6_ENST00000389394.3_Missense_Mutation_p.K4139M|TRABD2A_ENST00000479944.1_5'Flank			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	4139					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TTACCCTCCAAGCGGTCCAAA	0.443													ENSG00000115423																																					0													110.0	100.0	103.0					2																	85046471		692	1591	2283	SO:0001583	missense	0			-	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.12416A>T	2.37:g.85046471A>T	ENSP00000237449:p.Lys4139Met		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K4139M	ENST00000237449.6	37	c.12416	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	A	23.9	4.467160	0.84533	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.64260	-0.09;-0.09	5.58	5.58	0.84498	Dynein heavy chain (1);	0.529435	0.15201	N	0.275011	T	0.78679	0.4321	M	0.84585	2.705	0.80722	D	1	P	0.42556	0.783	P	0.55667	0.781	T	0.79067	-0.1955	10	0.52906	T	0.07	.	13.7073	0.62648	1.0:0.0:0.0:0.0	.	4139	Q9C0G6	DYH6_HUMAN	M	4139	ENSP00000374045:K4139M;ENSP00000237449:K4139M	ENSP00000237449:K4139M	K	+	2	0	DNAH6	84899982	0.994000	0.37717	0.998000	0.56505	0.905000	0.53344	2.897000	0.48664	2.127000	0.65507	0.533000	0.62120	AAG	-	DH6	-	pfam_Dynein_heavy_dom		0.443	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH6	HGNC	protein_coding	OTTHUMT00000328537.2	0	0	0	57	57	107	0.00	0.00	A	NM_001370		85046471	+1	15	26	59	107	tier1	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	20.27	19.55	SNP	0.996	T	15	59
DKKL1	27120	genome.wustl.edu	37	19	49869110	49869110	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr19:49869110C>G	ENST00000221498.2	+	4	790	c.385C>G	c.(385-387)Cca>Gca	p.P129A	AC010524.2_ENST00000599433.1_RNA|DKKL1_ENST00000594268.1_Intron	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	129					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		ATCCATTCAACCAGCGGAGGG	0.493													ENSG00000104901																																					0													110.0	100.0	103.0					19																	49869110		2203	4300	6503	SO:0001583	missense	0			-	AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.385C>G	19.37:g.49869110C>G	ENSP00000221498:p.Pro129Ala			Missense_Mutation	SNP	NULL	p.P129A	ENST00000221498.2	37	c.385	CCDS12762.1	19	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761151	0.31137	.	.	ENSG00000104901	ENST00000221498	T	0.11821	2.74	4.5	3.44	0.39384	.	0.512935	0.16796	N	0.199174	T	0.14184	0.0343	L	0.57536	1.79	0.09310	N	1	P	0.40107	0.703	B	0.35470	0.203	T	0.10989	-1.0606	10	0.62326	D	0.03	-6.2523	10.6047	0.45388	0.0:0.805:0.195:0.0	.	129	Q9UK85	DKKL1_HUMAN	A	129	ENSP00000221498:P129A	ENSP00000221498:P129A	P	+	1	0	DKKL1	54560922	0.018000	0.18449	0.016000	0.15963	0.218000	0.24690	1.440000	0.35024	1.244000	0.43870	0.561000	0.74099	CCA	-	DKKL1	-	NULL		0.493	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKKL1	HGNC	protein_coding	OTTHUMT00000465454.2	0	0	0	41	41	107	0.00	0.00	C	NM_014419		49869110	+1	5	16	56	66	tier1	no_errors	ENST00000221498	ensembl	human	known	74_37	missense	8.20	19.51	SNP	0.040	G	5	56
TRIM69	140691	genome.wustl.edu	37	15	45047473	45047473	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr15:45047473C>A	ENST00000559390.1	+	3	1310	c.382C>A	c.(382-384)Cca>Aca	p.P128T	TRIM69_ENST00000329464.4_Missense_Mutation_p.P128T|TRIM69_ENST00000338264.4_Intron|TRIM69_ENST00000558329.1_Intron|TRIM69_ENST00000561043.1_Intron|TRIM69_ENST00000558173.1_5'UTR|TRIM69_ENST00000560442.1_Intron			Q86WT6	TRI69_HUMAN	tripartite motif containing 69	128	Necessary for nuclear localization. {ECO:0000250}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(9)|skin(1)	20		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		GTTCAGTAAACCAGATGGGAA	0.468													ENSG00000185880																									Pancreas(84;519 1450 1802 20427 34706)												0													83.0	73.0	76.0					15																	45047473		2198	4298	6496	SO:0001583	missense	0			-	AF302088	CCDS10114.1, CCDS32220.1, CCDS73719.1	15q15-q21	2013-01-09	2011-01-25	2006-09-26	ENSG00000185880	ENSG00000185880		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	17857	protein-coding gene	gene with protein product			"""ring finger protein 36"", ""tripartite motif-containing 69"""	RNF36			Standard	XM_005254162		Approved	Trif, TRIMLESS	uc001zug.1	Q86WT6	OTTHUMG00000131246	ENST00000559390.1:c.382C>A	15.37:g.45047473C>A	ENSP00000453177:p.Pro128Thr		A8MX03|Q309B0|Q4G1A5|Q6W897|Q8IYY3|Q8WY16|Q8WY17	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.P128T	ENST00000559390.1	37	c.382	CCDS32220.1	15	.	.	.	.	.	.	.	.	.	.	C	16.22	3.060920	0.55432	.	.	ENSG00000185880	ENST00000329464	T	0.52526	0.66	5.17	5.17	0.71159	.	0.103697	0.41396	D	0.000894	T	0.40886	0.1135	L	0.41236	1.265	0.27916	N	0.938423	P	0.37914	0.611	B	0.38106	0.265	T	0.47182	-0.9137	10	0.59425	D	0.04	.	12.2941	0.54836	0.0:0.8292:0.1708:0.0	.	128	Q86WT6	TRI69_HUMAN	T	128	ENSP00000332284:P128T	ENSP00000332284:P128T	P	+	1	0	TRIM69	42834765	0.948000	0.32251	1.000000	0.80357	0.984000	0.73092	0.481000	0.22260	2.584000	0.87258	0.557000	0.71058	CCA	-	TRIM69	-	NULL		0.468	TRIM69-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM69	HGNC	protein_coding	OTTHUMT00000416171.1	0	0	0	48	48	80	0.00	0.00	C			45047473	+1	40	47	24	43	tier1	no_errors	ENST00000329464	ensembl	human	known	74_37	missense	62.50	52.22	SNP	1.000	A	40	24
GCNT3	9245	genome.wustl.edu	37	15	59911070	59911070	+	Silent	SNP	A	A	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr15:59911070A>G	ENST00000396065.1	+	3	1081	c.633A>G	c.(631-633)gaA>gaG	p.E211E	GCNT3_ENST00000560585.1_Silent_p.E211E	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	211					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACTGCATGGAAGACTTGCTCC	0.488													ENSG00000140297																																					0													132.0	124.0	127.0					15																	59911070		2190	4290	6480	SO:0001819	synonymous_variant	0			-	AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.633A>G	15.37:g.59911070A>G				Silent	SNP	pfam_Glyco_trans_14	p.E211	ENST00000396065.1	37	c.633	CCDS10172.1	15																																																																																			-	GCNT3	-	pfam_Glyco_trans_14		0.488	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT3	HGNC	protein_coding	OTTHUMT00000256068.1	0	0	0	50	50	77	0.00	0.00	A	NM_004751		59911070	+1	13	15	76	132	tier1	no_errors	ENST00000396065	ensembl	human	known	74_37	silent	14.61	10.20	SNP	1.000	G	13	76
DMXL1	1657	genome.wustl.edu	37	5	118583861	118583861	+	3'UTR	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr5:118583861C>G	ENST00000311085.8	+	0	10111				DMXL1_ENST00000505312.1_3'UTR	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1											breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		tttattttatcttatttttaG	0.274													ENSG00000172869																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.*947C>G	5.37:g.118583861C>G				R	SNP	-	NULL	ENST00000311085.8	37	NULL	CCDS4125.1	5																																																																																			-	DMXL1	-	-		0.274	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	0	0	0	102	102	34	0.00	0.00	C	NM_005509		118583861	+1	25	11	37	31	tier1	no_errors	ENST00000505312	ensembl	human	known	74_37	rna	40.32	26.19	SNP	0.001	G	25	37
DDX24	57062	genome.wustl.edu	37	14	94521472	94521472	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr14:94521472T>C	ENST00000330836.5	-	7	2179	c.2048A>G	c.(2047-2049)aAt>aGt	p.N683S	DDX24_ENST00000555054.1_Missense_Mutation_p.N640S|DDX24_ENST00000544005.1_Missense_Mutation_p.N433S	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	683	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		GAGGCCTTCATTGGTAGCTCG	0.498													ENSG00000089737																																					0													173.0	158.0	163.0					14																	94521472		2203	4300	6503	SO:0001583	missense	0			-	AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.2048A>G	14.37:g.94521472T>C	ENSP00000328690:p.Asn683Ser		E7EMJ4|Q4V9L5	Missense_Mutation	SNP	pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_R_helicase_DEAD_Q_motif	p.N683S	ENST00000330836.5	37	c.2048	CCDS9918.1	14	.	.	.	.	.	.	.	.	.	.	T	4.608	0.112996	0.08831	.	.	ENSG00000089737	ENST00000330836;ENST00000544005;ENST00000440370;ENST00000543787;ENST00000555054;ENST00000542247	T;T;T	0.04809	3.55;3.55;3.55	5.43	0.493	0.16878	Helicase, C-terminal (1);	0.387052	0.33309	N	0.005051	T	0.02848	0.0085	N	0.14661	0.345	0.24662	N	0.993465	B	0.06786	0.001	B	0.06405	0.002	T	0.44406	-0.9330	10	0.26408	T	0.33	-0.3315	9.6826	0.40078	0.0:0.5442:0.0:0.4558	.	683	Q9GZR7	DDX24_HUMAN	S	683;433;628;309;640;640	ENSP00000328690:N683S;ENSP00000440623:N433S;ENSP00000452145:N640S	ENSP00000328690:N683S	N	-	2	0	DDX24	93591225	0.473000	0.25878	0.686000	0.30086	0.155000	0.21991	0.848000	0.27710	-0.086000	0.12550	0.533000	0.62120	AAT	-	DDX24	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.498	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX24	HGNC	protein_coding	OTTHUMT00000412861.1	0	0	0	38	38	85	0.00	0.00	T	NM_020414		94521472	-1	20	26	35	23	tier1	no_errors	ENST00000330836	ensembl	human	known	74_37	missense	36.36	53.06	SNP	0.854	C	20	35
KIAA1462	57608	genome.wustl.edu	37	10	30316575	30316575	+	Silent	SNP	C	C	T	rs373784122		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr10:30316575C>T	ENST00000375377.1	-	3	2603	c.2502G>A	c.(2500-2502)caG>caA	p.Q834Q		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	834					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						AACTTTCTAACTGACTGATCA	0.557													ENSG00000165757																																					0								C		2,3996		0,2,1997	72.0	76.0	75.0		2502	2.6	0.6	10		75	0,8348		0,0,4174	no	coding-synonymous	KIAA1462	NM_020848.2		0,2,6171	TT,TC,CC		0.0,0.05,0.0162		834/1360	30316575	2,12344	1999	4174	6173	SO:0001819	synonymous_variant	0			-	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.2502G>A	10.37:g.30316575C>T			Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Silent	SNP	NULL	p.Q834	ENST00000375377.1	37	c.2502	CCDS41500.1	10																																																																																			-	KIAA1462	-	NULL		0.557	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	HGNC	protein_coding	OTTHUMT00000047409.1	0	0	0	39	39	77	0.00	0.00	C	NM_020848		30316575	-1	4	26	40	72	tier1	no_errors	ENST00000375377	ensembl	human	known	74_37	silent	9.09	26.26	SNP	0.997	T	4	40
TAF1L	138474	genome.wustl.edu	37	9	32632751	32632751	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:32632751C>A	ENST00000242310.4	-	1	2916	c.2827G>T	c.(2827-2829)Gat>Tat	p.D943Y	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	943					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ACTTCATCATCAATCTTCATC	0.488													ENSG00000122728																																					0													171.0	157.0	162.0					9																	32632751		2203	4300	6503	SO:0001583	missense	0			-	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2827G>T	9.37:g.32632751C>A	ENSP00000418379:p.Asp943Tyr		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D943Y	ENST00000242310.4	37	c.2827	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	13.81	2.347894	0.41599	.	.	ENSG00000122728	ENST00000242310	T	0.15718	2.4	1.04	1.04	0.20106	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.36496	0.0969	M	0.78049	2.395	0.58432	D	0.999995	D	0.89917	1.0	D	0.83275	0.996	T	0.11966	-1.0566	10	0.87932	D	0	.	7.4859	0.27432	0.0:1.0:0.0:0.0	.	943	Q8IZX4	TAF1L_HUMAN	Y	943	ENSP00000418379:D943Y	ENSP00000418379:D943Y	D	-	1	0	TAF1L	32622751	1.000000	0.71417	0.995000	0.50966	0.856000	0.48823	3.371000	0.52379	0.507000	0.28148	0.195000	0.17529	GAT	-	TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591		0.488	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	0	0	0	69	69	49	0.00	0.00	C			32632751	-1	22	11	26	17	tier1	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	45.83	39.29	SNP	1.000	A	22	26
PLA2G2D	26279	genome.wustl.edu	37	1	20442883	20442883	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:20442883G>C	ENST00000375105.3	-	2	186	c.128C>G	c.(127-129)cCc>cGc	p.P43R		NM_012400.2	NP_036532.1	Q9UNK4	PA2GD_HUMAN	phospholipase A2, group IID	43					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(1)|lung(2)	3		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000798)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ACAGCCGTAGGGCCAGTAGGA	0.567										Multiple Myeloma(11;0.12)			ENSG00000117215																									Melanoma(60;742 1548 31762 39240)												0													140.0	119.0	126.0					1																	20442883		2203	4300	6503	SO:0001583	missense	0			-	AF112982	CCDS203.1, CCDS72721.1	1p36.12	2008-09-19			ENSG00000117215	ENSG00000117215	3.1.1.4		9033	protein-coding gene	gene with protein product		605630				10455175	Standard	NM_012400		Approved	sPLA2S	uc001bcz.4	Q9UNK4	OTTHUMG00000002701	ENST00000375105.3:c.128C>G	1.37:g.20442883G>C	ENSP00000364246:p.Pro43Arg		A8K2Z1|B1AEL9|Q9UK01	Missense_Mutation	SNP	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.P43R	ENST00000375105.3	37	c.128	CCDS203.1	1	.	.	.	.	.	.	.	.	.	.	G	3.820	-0.037882	0.07497	.	.	ENSG00000117215	ENST00000375105	T	0.25579	1.79	5.35	-3.52	0.04682	Phospholipase A2 (3);	1.839730	0.02303	N	0.071425	T	0.12008	0.0292	N	0.10782	0.045	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.16928	-1.0386	10	0.25106	T	0.35	-1.6273	3.8483	0.08943	0.4136:0.0:0.303:0.2833	.	43	Q9UNK4	PA2GD_HUMAN	R	43	ENSP00000364246:P43R	ENSP00000364246:P43R	P	-	2	0	PLA2G2D	20315470	0.001000	0.12720	0.095000	0.20976	0.110000	0.19582	-0.374000	0.07484	-0.226000	0.09899	0.561000	0.74099	CCC	-	PLA2G2D	-	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2		0.567	PLA2G2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2D	HGNC	protein_coding	OTTHUMT00000007683.1	0	0	0	79	79	93	0.00	0.00	G			20442883	-1	20	21	93	96	tier1	no_errors	ENST00000375105	ensembl	human	known	74_37	missense	17.70	17.95	SNP	0.003	C	20	93
ST8SIA3	51046	genome.wustl.edu	37	18	55024254	55024254	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr18:55024254T>A	ENST00000324000.3	+	3	2447	c.413T>A	c.(412-414)tTc>tAc	p.F138Y		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	138					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		AAATATGTTTTCTCTATTAGC	0.363													ENSG00000177511																																					0													97.0	99.0	99.0					18																	55024254		2203	4300	6503	SO:0001583	missense	0			-	AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.413T>A	18.37:g.55024254T>A	ENSP00000320431:p.Phe138Tyr		A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.F138Y	ENST00000324000.3	37	c.413	CCDS32834.1	18	.	.	.	.	.	.	.	.	.	.	T	14.86	2.660342	0.47572	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.29655	1.56	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.26521	0.0648	L	0.41492	1.28	0.58432	D	0.999999	B	0.24258	0.1	B	0.26094	0.066	T	0.06752	-1.0809	10	0.10902	T	0.67	-6.1765	15.7114	0.77631	0.0:0.0:0.0:1.0	.	138	O43173	SIA8C_HUMAN	Y	245;138	ENSP00000320431:F138Y	ENSP00000320431:F138Y	F	+	2	0	ST8SIA3	53175252	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.756000	0.68757	2.193000	0.70182	0.533000	0.62120	TTC	-	ST8SIA3	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans		0.363	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ST8SIA3	HGNC	protein_coding	OTTHUMT00000449765.1	0	0	0	40	40	83	0.00	0.00	T	NM_015879		55024254	+1	21	23	18	33	tier1	no_errors	ENST00000324000	ensembl	human	known	74_37	missense	53.85	41.07	SNP	1.000	A	21	18
AKAP9	10142	genome.wustl.edu	37	7	91694631	91694631	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:91694631C>T	ENST00000359028.2	+	26	6325	c.6100C>T	c.(6100-6102)Caa>Taa	p.Q2034*	AKAP9_ENST00000356239.3_Nonsense_Mutation_p.Q2022*|AKAP9_ENST00000491695.1_3'UTR|AKAP9_ENST00000358100.2_Nonsense_Mutation_p.Q2034*			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2034	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCTTCAAAAACAAGTGAAAGC	0.318			T	BRAF	papillary thyroid								ENSG00000127914																												Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													79.0	77.0	78.0					7																	91694631		2203	4300	6503	SO:0001587	stop_gained	0			-	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.6100C>T	7.37:g.91694631C>T	ENSP00000351922:p.Gln2034*		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Nonsense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.Q2034*	ENST00000359028.2	37	c.6100		7	.	.	.	.	.	.	.	.	.	.	C	47	13.600250	0.99752	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000265737	.	.	.	5.72	5.72	0.89469	.	0.000000	0.40385	N	0.001120	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.2406	0.98372	0.0:1.0:0.0:0.0	.	.	.	.	X	2022;2034;2034;2034;237	.	ENSP00000265737:Q237X	Q	+	1	0	AKAP9	91532567	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.916000	0.75776	2.857000	0.98124	0.650000	0.86243	CAA	-	AKAP9	-	NULL		0.318	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		0	0	1	99	99	120	0.00	0.83	C	NM_005751		91694631	+1	36	28	40	71	tier1	no_errors	ENST00000359028	ensembl	human	known	74_37	nonsense	46.75	28.28	SNP	1.000	T	36	40
CSF3R	1441	genome.wustl.edu	37	1	36945109	36945109	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:36945109G>C	ENST00000373106.1	-	0	536				CSF3R_ENST00000361632.4_De_novo_Start_OutOfFrame|CSF3R_ENST00000373104.1_De_novo_Start_OutOfFrame|CSF3R_ENST00000338937.5_5'Flank|CSF3R_ENST00000440588.2_5'Flank|CSF3R_ENST00000373103.1_De_novo_Start_OutOfFrame|CSF3R_ENST00000331941.5_5'Flank|CSF3R_ENST00000418048.2_5'Flank	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)						cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GCACCAACTTGATGTTCACCT	0.527													ENSG00000119535																																					0													93.0	71.0	78.0					1																	36945109		2203	4300	6503			0			-	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.-12C>G	1.37:g.36945109G>C				R	SNP	-	NULL	ENST00000373106.1	37	NULL	CCDS413.1	1																																																																																			-	CSF3R	-	-		0.527	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2	0	0	0	36	36	102	0.00	0.00	G	NM_156039		36945109	-1	5	16	33	121	tier1	no_errors	ENST00000526980	ensembl	human	known	74_37	rna	13.16	11.68	SNP	0.035	C	5	33
STAB1	23166	genome.wustl.edu	37	3	52535687	52535687	+	Silent	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:52535687C>A	ENST00000321725.6	+	3	325	c.249C>A	c.(247-249)tcC>tcA	p.S83S		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	83					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CTATGGTGTCCATGAGCGGCT	0.642													ENSG00000010327																																					0													17.0	19.0	18.0					3																	52535687		2193	4289	6482	SO:0001819	synonymous_variant	0			-	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.249C>A	3.37:g.52535687C>A			A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.S83	ENST00000321725.6	37	c.249	CCDS33768.1	3																																																																																			-	STAB1	-	NULL		0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	0	0	0	55	55	28	0.00	0.00	C	NM_015136		52535687	+1	46	11	38	22	tier1	no_errors	ENST00000321725	ensembl	human	known	74_37	silent	54.76	32.35	SNP	0.014	A	46	38
PLCH1	23007	genome.wustl.edu	37	3	155198794	155198794	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:155198794T>C	ENST00000340059.7	-	23	5044	c.5045A>G	c.(5044-5046)gAt>gGt	p.D1682G	PLCH1_ENST00000414191.1_Missense_Mutation_p.D1644G|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.D1644G|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Missense_Mutation_p.D1644G	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1682					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TGGTTTATCATCACTGCTTGG	0.413													ENSG00000114805																																					0													41.0	48.0	46.0					3																	155198794		2203	4300	6503	SO:0001583	missense	0			-	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.5045A>G	3.37:g.155198794T>C	ENSP00000345988:p.Asp1682Gly		Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.D1682G	ENST00000340059.7	37	c.5045	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	T	15.46	2.840871	0.51057	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.38	5.38	0.77491	.	1.322130	0.04676	N	0.411592	T	0.24586	0.0596	L	0.38175	1.15	0.32584	N	0.528098	P;P	0.39665	0.592;0.682	B;B	0.40329	0.326;0.223	T	0.11446	-1.0587	10	0.52906	T	0.07	.	11.1175	0.48268	0.0:0.0:0.1546:0.8454	.	1644;1682	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	G	1644;1682;1644;1644	ENSP00000417502:D1644G;ENSP00000345988:D1682G;ENSP00000335469:D1644G;ENSP00000412977:D1644G	ENSP00000335469:D1644G	D	-	2	0	PLCH1	156681488	0.899000	0.30636	0.780000	0.31762	0.995000	0.86356	3.291000	0.51764	2.027000	0.59764	0.533000	0.62120	GAT	-	PLCH1	-	NULL		0.413	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	0	0	0	76	76	92	0.00	0.00	T	NM_014996		155198794	-1	44	64	33	34	tier1	no_errors	ENST00000340059	ensembl	human	known	74_37	missense	57.14	64.65	SNP	0.842	C	44	33
RAPSN	5913	genome.wustl.edu	37	11	47460330	47460330	+	Silent	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:47460330C>T	ENST00000298854.2	-	7	1332	c.1119G>A	c.(1117-1119)aaG>aaA	p.K373K	RAPSN_ENST00000352508.3_Silent_p.K314K|RNU6-1302P_ENST00000516518.1_RNA|RAPSN_ENST00000524487.1_Missense_Mutation_p.E323K|RAPSN_ENST00000528356.1_Intron|RAPSN_ENST00000529341.1_Silent_p.K314K	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse	373					positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						GCCGGCTGTTCTTCTCGCCTA	0.667													ENSG00000165917																																					0													41.0	35.0	37.0					11																	47460330		2195	4284	6479	SO:0001819	synonymous_variant	0			-		CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.1119G>A	11.37:g.47460330C>T			Q8TDF3|Q9BTD9	Missense_Mutation	SNP	pfam_Rapsyn_myristoylation/link_N,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Postsynaptic	p.E323K	ENST00000298854.2	37	c.967	CCDS7936.1	11	.	.	.	.	.	.	.	.	.	.	C	15.19	2.759457	0.49468	.	.	ENSG00000165917	ENST00000524487	D	0.96554	-4.05	5.77	2.79	0.32731	.	.	.	.	.	D	0.95645	0.8584	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.92170	0.5743	5	.	.	.	-18.8881	8.7354	0.34525	0.0:0.7131:0.1506:0.1363	.	.	.	.	K	323	ENSP00000435551:E323K	.	E	-	1	0	RAPSN	47416906	0.998000	0.40836	0.341000	0.25589	0.993000	0.82548	1.145000	0.31577	0.298000	0.22638	0.603000	0.83216	GAA	-	RAPSN	-	NULL		0.667	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPSN	HGNC	protein_coding	OTTHUMT00000391726.1	0	0	0	93	93	19	0.00	0.00	C			47460330	-1	31	3	131	22	tier1	no_errors	ENST00000524487	ensembl	human	novel	74_37	missense	19.14	12.00	SNP	0.994	T	31	131
STAT1	6772	genome.wustl.edu	37	2	191848465	191848465	+	Splice_Site	SNP	G	G	A	rs527393923		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr2:191848465G>A	ENST00000361099.3	-	17	1736	c.1349C>T	c.(1348-1350)aCg>aTg	p.T450M	STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000392322.3_Splice_Site_p.T450M|STAT1_ENST00000409465.1_Splice_Site_p.T450M|STAT1_ENST00000392323.2_Splice_Site_p.T452M	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	450					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			CAGAGAGGTCGTCTAAAGGAT	0.488													ENSG00000115415	G|||	1	0.000199681	0.0008	0.0	5008	,	,		18041	0.0		0.0	False		,,,				2504	0.0																0													72.0	67.0	69.0					2																	191848465		2203	4300	6503	SO:0001630	splice_region_variant	0			-		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.1348-1C>T	2.37:g.191848465G>A			A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	pfam_STAT_TF_D-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT1_TAZ2-bd_C,pfam_SH2,superfamily_p53-like_TF_D-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.T450M	ENST00000361099.3	37	c.1349	CCDS2309.1	2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471247	0.84533	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323	D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81	5.19	5.19	0.71726	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.186112	0.64402	D	0.000020	D	0.95701	0.8602	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.942;0.994	D	0.95603	0.8665	10	0.66056	D	0.02	-23.1049	19.2755	0.94030	0.0:0.0:1.0:0.0	.	450;450	P42224-2;P42224	.;STAT1_HUMAN	M	450;450;450;452	ENSP00000354394:T450M;ENSP00000386244:T450M;ENSP00000376136:T450M;ENSP00000376137:T452M	ENSP00000354394:T450M	T	-	2	0	STAT1	191556710	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.728000	0.84847	2.865000	0.98341	0.655000	0.94253	ACG	-	STAT1	-	pfam_STAT_TF_D-bd,superfamily_p53-like_TF_D-bd		0.488	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT1	HGNC	protein_coding	OTTHUMT00000255997.3	0	0	0	33	33	87	0.00	0.00	G	NM_007315	Missense_Mutation	191848465	-1	14	23	24	47	tier1	no_errors	ENST00000361099	ensembl	human	known	74_37	missense	36.84	32.86	SNP	1.000	A	14	24
EMP2	2013	genome.wustl.edu	37	16	10626829	10626829	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr16:10626829G>T	ENST00000359543.3	-	5	646	c.437C>A	c.(436-438)gCg>gAg	p.A146E	EMP2_ENST00000536829.1_Missense_Mutation_p.A146E|EMP2_ENST00000566033.1_5'Flank|RP11-27M24.1_ENST00000535363.1_RNA	NM_001424.4	NP_001415.1	P54851	EMP2_HUMAN	epithelial membrane protein 2	146					cell proliferation (GO:0008283)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|regulation of glomerular filtration (GO:0003093)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	integrin binding (GO:0005178)			NS(1)|endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6						GGCCACCCACGCCAGGATGTA	0.532													ENSG00000213853																									GBM(158;2021 2691 14714 39478)												0													143.0	114.0	124.0					16																	10626829		2197	4300	6497	SO:0001583	missense	0			-	U52100	CCDS10541.1	16p13.2	2008-08-01			ENSG00000213853	ENSG00000213853			3334	protein-coding gene	gene with protein product		602334				8996089, 10331954, 16216233	Standard	NM_001424		Approved	XMP	uc002czx.3	P54851	OTTHUMG00000129752	ENST00000359543.3:c.437C>A	16.37:g.10626829G>T	ENSP00000352540:p.Ala146Glu		B2R7V6|D3DUF8	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_EMP_2,prints_PMP22_EMP_MP20	p.A146E	ENST00000359543.3	37	c.437	CCDS10541.1	16	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000406	0.93227	.	.	ENSG00000213853	ENST00000359543;ENST00000536829	D;D	0.91464	-2.85;-2.85	5.37	4.42	0.53409	.	0.000000	0.85682	U	0.000000	D	0.95417	0.8512	M	0.87827	2.91	0.58432	D	0.999999	D	0.89917	1.0	D	0.74674	0.984	D	0.95955	0.8957	10	0.87932	D	0	-7.5492	13.6342	0.62213	0.0749:0.0:0.9251:0.0	.	146	P54851	EMP2_HUMAN	E	146	ENSP00000352540:A146E;ENSP00000445712:A146E	ENSP00000352540:A146E	A	-	2	0	EMP2	10534330	1.000000	0.71417	0.996000	0.52242	0.957000	0.61999	9.281000	0.95811	1.413000	0.46997	0.655000	0.94253	GCG	-	EMP2	-	pfam_PMP22/EMP/MP20/Claudin,prints_PMP22_EMP_MP20		0.532	EMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP2	HGNC	protein_coding	OTTHUMT00000251965.1	0	0	0	35	35	41	0.00	0.00	G	NM_001424		10626829	-1	9	20	21	24	tier1	no_errors	ENST00000359543	ensembl	human	known	74_37	missense	30.00	45.45	SNP	1.000	T	9	21
EEF1DP3	196549	genome.wustl.edu	37	13	32526746	32526746	+	RNA	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr13:32526746G>T	ENST00000428783.1	+	0	446							Q658K8	EF1DL_HUMAN	eukaryotic translation elongation factor 1 delta pseudogene 3								translation elongation factor activity (GO:0003746)										TAGGTGAGAAGATCTGGTTCC	0.552													ENSG00000229715																																					0													50.0	45.0	47.0					13																	32526746		692	1591	2283			0			-			13q13.1	2012-10-23			ENSG00000229715	ENSG00000229715			30486	pseudogene	pseudogene						12477932	Standard	NR_027062		Approved		uc001utu.3	Q658K8	OTTHUMG00000016691		13.37:g.32526746G>T			Q08AR3	R	SNP	-	NULL	ENST00000428783.1	37	NULL		13																																																																																			-	EEF1DP3	-	-		0.552	EEF1DP3-001	KNOWN	basic	processed_transcript	EEF1DP3	HGNC	pseudogene	OTTHUMT00000044400.2	0	0	0	33	33	39	0.00	0.00	G	NR_027062		32526746	+1	8	3	17	10	tier1	no_errors	ENST00000428783	ensembl	human	known	74_37	rna	32.00	23.08	SNP	1.000	T	8	17
MED13L	23389	genome.wustl.edu	37	12	116408418	116408418	+	Silent	SNP	A	A	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr12:116408418A>G	ENST00000281928.3	-	27	6254	c.6048T>C	c.(6046-6048)gaT>gaC	p.D2016D		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	2016						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GGCTAAACCCATCTTCATTGG	0.522													ENSG00000123066																																					0													178.0	152.0	161.0					12																	116408418		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.6048T>C	12.37:g.116408418A>G			A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Silent	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.D2016	ENST00000281928.3	37	c.6048	CCDS9177.1	12																																																																																			-	MED13L	-	pfam_Mediator_Med13		0.522	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3	0	0	0	50	50	124	0.00	0.00	A			116408418	-1	12	11	42	75	tier1	no_errors	ENST00000281928	ensembl	human	known	74_37	silent	22.22	12.79	SNP	1.000	G	12	42
MUC5B	727897	genome.wustl.edu	37	11	1280258	1280258	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:1280258G>C	ENST00000529681.1	+	44	16738	c.16680G>C	c.(16678-16680)caG>caC	p.Q5560H	MUC5B_ENST00000447027.1_Missense_Mutation_p.Q5563H	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5560	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGCAATGTCAGGAGGATGCCT	0.652													ENSG00000117983																																					0													47.0	53.0	51.0					11																	1280258		1947	4092	6039	SO:0001583	missense	0			-	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16680G>C	11.37:g.1280258G>C	ENSP00000436812:p.Gln5560His		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.Q5563H	ENST00000529681.1	37	c.16689	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	8.752	0.921479	0.17982	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844;ENST00000526859	T;T;T	0.71934	-0.61;-0.61;-0.61	4.7	2.66	0.31614	.	.	.	.	.	T	0.52058	0.1711	N	0.08118	0	0.09310	N	1	B;P	0.36171	0.279;0.541	B;B	0.41412	0.272;0.356	T	0.47699	-0.9097	9	0.87932	D	0	.	5.4515	0.16568	0.105:0.0:0.6988:0.1963	.	5897;5563	A7Y9J9;E9PBJ0	.;.	H	5560;5563;5504;459;5272;105	ENSP00000436812:Q5560H;ENSP00000415793:Q5563H;ENSP00000434539:Q105H	ENSP00000343037:Q5504H	Q	+	3	2	MUC5B	1236834	0.000000	0.05858	0.014000	0.15608	0.030000	0.12068	-0.502000	0.06390	1.107000	0.41642	0.561000	0.74099	CAG	-	MUC5B	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	0	0	0	82	82	74	0.00	0.00	G	XM_001126093		1280258	+1	29	8	83	63	tier1	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	25.89	11.27	SNP	0.005	C	29	83
DLEC1	9940	genome.wustl.edu	37	3	38104286	38104286	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:38104286A>T	ENST00000308059.6	+	5	1109	c.1088A>T	c.(1087-1089)gAa>gTa	p.E363V	DLEC1_ENST00000452631.2_Missense_Mutation_p.E363V|DLEC1_ENST00000346219.3_Missense_Mutation_p.E363V|DLEC1_ENST00000469151.1_3'UTR					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		ACAGAGCCAGAACAGAGGTAT	0.488													ENSG00000008226																																					0													58.0	56.0	57.0					3																	38104286		1862	4102	5964	SO:0001583	missense	0			-	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1088A>T	3.37:g.38104286A>T	ENSP00000308597:p.Glu363Val			Missense_Mutation	SNP	superfamily_PapD-like	p.E363V	ENST00000308059.6	37	c.1088	CCDS2672.2	3	.	.	.	.	.	.	.	.	.	.	A	11.58	1.680645	0.29872	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.06218	3.35;3.33;3.57	4.64	-0.609	0.11608	.	0.698452	0.14330	N	0.326415	T	0.06142	0.0159	M	0.64997	1.995	0.09310	N	1	B;B;B;B	0.26602	0.083;0.134;0.154;0.134	B;B;B;B	0.23574	0.047;0.047;0.029;0.047	T	0.34700	-0.9818	10	0.30854	T	0.27	-4.2736	3.3996	0.07319	0.5585:0.0:0.2765:0.165	.	363;363;363;363	A1L305;F8W6T4;Q9Y238-3;Q9Y238	.;.;.;DLEC1_HUMAN	V	363	ENSP00000308597:E363V;ENSP00000315914:E363V;ENSP00000410427:E363V	ENSP00000308597:E363V	E	+	2	0	DLEC1	38079290	0.000000	0.05858	0.001000	0.08648	0.130000	0.20726	0.081000	0.14823	-0.171000	0.10797	0.533000	0.62120	GAA	-	DLEC1	-	NULL		0.488	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DLEC1	HGNC	protein_coding	OTTHUMT00000253745.3	0	0	0	32	32	74	0.00	0.00	A	NM_007337		38104286	+1	32	56	47	83	tier1	no_errors	ENST00000346219	ensembl	human	known	74_37	missense	40.51	40.29	SNP	0.000	T	32	47
MSLN	10232	genome.wustl.edu	37	16	816491	816491	+	Splice_Site	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr16:816491G>C	ENST00000382862.3	+	12	1325		c.e12+1		MSLN_ENST00000566549.1_Splice_Site|MSLN_ENST00000563941.1_Splice_Site|MSLN_ENST00000545450.2_Splice_Site	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin						cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				GAGTCCTCAGGTGACCGTCCG	0.602													ENSG00000102854																																					0													70.0	68.0	69.0					16																	816491		2189	4289	6478	SO:0001630	splice_region_variant	0			-	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.1230+1G>C	16.37:g.816491G>C			D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Splice_Site	SNP	-	e11+1	ENST00000382862.3	37	c.1230+1	CCDS32356.1	16	.	.	.	.	.	.	.	.	.	.	G	9.745	1.166002	0.21538	.	.	ENSG00000102854	ENST00000446427;ENST00000445361;ENST00000545450;ENST00000382862	.	.	.	4.67	2.59	0.31030	.	.	.	.	.	.	.	.	.	.	.	0.52099	D	0.999946	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.051	0.14508	0.1089:0.0:0.6818:0.2092	.	.	.	.	.	-1	.	.	.	+	.	.	MSLN	756492	0.983000	0.35010	0.829000	0.32907	0.023000	0.10783	2.104000	0.41815	1.040000	0.40099	0.297000	0.19635	.	-	MSLN	-	-		0.602	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MSLN	HGNC	protein_coding	OTTHUMT00000109253.2	0	0	0	41	41	88	0.00	0.00	G		Intron	816491	+1	23	15	35	36	tier1	no_errors	ENST00000382862	ensembl	human	known	74_37	splice_site	39.66	29.41	SNP	0.448	C	23	35
SCGB2A2	4250	genome.wustl.edu	37	11	62038380	62038380	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:62038380T>G	ENST00000227918.2	+	2	145	c.83T>G	c.(82-84)gTg>gGg	p.V28G	SCGB2A2_ENST00000525380.1_Missense_Mutation_p.V28G	NM_002411.2	NP_002402.1	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2	28										large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7						TTGGAGAATGTGATTTCCAAG	0.438													ENSG00000110484																																					0													80.0	73.0	76.0					11																	62038380		2202	4299	6501	SO:0001583	missense	0			-	AF015224	CCDS8018.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000110484	ENSG00000110484		"""Secretoglobins"""	7050	protein-coding gene	gene with protein product	"""mammaglobin A"""	605562	"""mammaglobin 1"""	MGB1		9488047, 8631025, 22155607	Standard	XM_005274005		Approved	UGB2, MGC71974	uc001ntc.3	Q13296	OTTHUMG00000167509	ENST00000227918.2:c.83T>G	11.37:g.62038380T>G	ENSP00000227918:p.Val28Gly		A1A522|Q86WH8	Missense_Mutation	SNP	pfam_Secretoglobin,superfamily_Secretoglobin	p.V28G	ENST00000227918.2	37	c.83	CCDS8018.1	11	.	.	.	.	.	.	.	.	.	.	T	10.02	1.235867	0.22626	.	.	ENSG00000110484	ENST00000227918;ENST00000525380	T;T	0.16897	2.31;2.31	3.06	-0.688	0.11317	.	.	.	.	.	T	0.20414	0.0491	.	.	.	0.09310	N	1	D;D	0.55172	0.962;0.97	P;P	0.50825	0.519;0.651	T	0.13926	-1.0491	8	0.72032	D	0.01	.	5.8439	0.18652	0.0:0.3934:0.0:0.6066	.	28;28	Q13296-2;Q13296	.;SG2A2_HUMAN	G	28	ENSP00000227918:V28G;ENSP00000431997:V28G	ENSP00000227918:V28G	V	+	2	0	SCGB2A2	61794956	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.130000	0.10498	-0.127000	0.11661	0.378000	0.23410	GTG	-	SCGB2A2	-	pfam_Secretoglobin,superfamily_Secretoglobin		0.438	SCGB2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB2A2	HGNC	protein_coding	OTTHUMT00000394860.1	0	0	0	35	35	88	0.00	0.00	T	NM_002411		62038380	+1	14	14	45	101	tier1	no_errors	ENST00000227918	ensembl	human	known	74_37	missense	23.33	12.17	SNP	0.000	G	14	45
MTHFR	4524	genome.wustl.edu	37	1	11854057	11854057	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:11854057G>C	ENST00000376592.1	-	8	1565	c.1437C>G	c.(1435-1437)atC>atG	p.I479M	MTHFR_ENST00000376585.1_Missense_Mutation_p.I520M|MTHFR_ENST00000376583.3_Missense_Mutation_p.I520M|MTHFR_ENST00000376590.3_Missense_Mutation_p.I479M			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	479					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)			NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	TGATGGTGAGGATGCCCTGGC	0.647													ENSG00000177000																																					0													98.0	102.0	101.0					1																	11854057		2203	4300	6503	SO:0001583	missense	0			-	BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.1437C>G	1.37:g.11854057G>C	ENSP00000365777:p.Ile479Met		B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	pfam_Mehydrof_redctse,tigrfam_Fadh2_euk	p.I520M	ENST00000376592.1	37	c.1560	CCDS137.1	1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626983	0.66901	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	4.71	4.71	0.59529	.	0.162118	0.56097	D	0.000037	T	0.71187	0.3310	M	0.64997	1.995	0.49915	D	0.999834	B;P	0.43938	0.031;0.822	B;P	0.51101	0.044;0.659	T	0.74153	-0.3757	10	0.66056	D	0.02	.	10.3388	0.43864	0.09:0.0:0.91:0.0	.	479;520	P42898;Q5SNW6	MTHR_HUMAN;.	M	479;520;479;520	ENSP00000365777:I479M;ENSP00000365767:I520M;ENSP00000365775:I479M;ENSP00000365770:I520M	ENSP00000365767:I520M	I	-	3	3	MTHFR	11776644	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.535000	0.53575	2.180000	0.69256	0.462000	0.41574	ATC	-	MTHFR	-	NULL		0.647	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MTHFR	HGNC	protein_coding	OTTHUMT00000006538.1	0	0	0	34	34	37	0.00	0.00	G	NM_005957		11854057	-1	21	19	43	28	tier1	no_errors	ENST00000376583	ensembl	human	known	74_37	missense	32.81	40.43	SNP	1.000	C	21	43
MAP3K5	4217	genome.wustl.edu	37	6	137018523	137018523	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr6:137018523T>A	ENST00000359015.4	-	5	1169	c.809A>T	c.(808-810)cAg>cTg	p.Q270L		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	270					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		CCGGAAGTACTGGCTGGTAAA	0.353													ENSG00000197442																																					0													107.0	108.0	107.0					6																	137018523		2203	4300	6503	SO:0001583	missense	0			-	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.809A>T	6.37:g.137018523T>A	ENSP00000351908:p.Gln270Leu		A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q270L	ENST00000359015.4	37	c.809	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	T	18.14	3.558344	0.65538	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.09817	2.94	5.09	5.09	0.68999	.	0.107148	0.64402	D	0.000004	T	0.19644	0.0472	L	0.54323	1.7	0.80722	D	1	B;D;B	0.69078	0.024;0.997;0.193	B;D;B	0.80764	0.05;0.994;0.081	T	0.00797	-1.1562	10	0.66056	D	0.02	.	15.1546	0.72730	0.0:0.0:0.0:1.0	.	350;115;270	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	L	270;350	ENSP00000351908:Q270L	ENSP00000351908:Q270L	Q	-	2	0	MAP3K5	137060216	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.881000	0.69706	2.029000	0.59856	0.482000	0.46254	CAG	-	MAP3K5	-	NULL		0.353	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	0	0	0	81	81	139	0.00	0.00	T			137018523	-1	13	28	42	89	tier1	no_errors	ENST00000359015	ensembl	human	known	74_37	missense	23.64	23.93	SNP	1.000	A	13	42
FCRL6	343413	genome.wustl.edu	37	1	159785345	159785345	+	Missense_Mutation	SNP	C	C	T	rs149132393	byFrequency	TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:159785345C>T	ENST00000368106.3	+	10	1200	c.1199C>T	c.(1198-1200)gCg>gTg	p.A400V	FCRL6_ENST00000321935.6_Silent_p.C405C|FCRL6_ENST00000339348.5_Silent_p.C389C|FCRL6_ENST00000392235.3_Silent_p.C303C	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	400						external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					ATCATCTGTGCGGAGGTGAGA	0.527													ENSG00000181036	.|||	4	0.000798722	0.0	0.0	5008	,	,		22009	0.004		0.0	False		,,,				2504	0.0																0								C	VAL/ALA	0,4406		0,0,2203	141.0	134.0	136.0		1199	2.9	0.0	1	dbSNP_134	136	2,8598	2.2+/-6.3	0,2,4298	yes	missense	FCRL6	NM_001004310.2	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	400/435	159785345	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.1199C>T	1.37:g.159785345C>T	ENSP00000357086:p.Ala400Val		A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A400V	ENST00000368106.3	37	c.1199	CCDS30912.1	1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.636222	0.29068	0.0	2.33E-4	ENSG00000181036	ENST00000368106	T	0.01203	5.18	3.87	2.94	0.34122	.	.	.	.	.	T	0.00328	0.0010	N	0.14661	0.345	0.09310	N	1	P	0.37141	0.584	B	0.28849	0.095	T	0.48269	-0.9050	9	0.54805	T	0.06	.	7.9397	0.29950	0.0:0.8868:0.0:0.1132	.	400	Q6DN72	FCRL6_HUMAN	V	400	ENSP00000357086:A400V	ENSP00000357086:A400V	A	+	2	0	FCRL6	158051969	0.001000	0.12720	0.001000	0.08648	0.101000	0.19017	1.330000	0.33781	1.184000	0.42957	0.491000	0.48974	GCG	rs149132393	FCRL6	-	NULL		0.527	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL6	HGNC	protein_coding	OTTHUMT00000276853.1	0	0	0	18	18	71	0.00	0.00	C	NM_001004310		159785345	+1	10	17	28	37	tier1	no_errors	ENST00000368106	ensembl	human	known	74_37	missense	26.32	31.48	SNP	0.001	T	10	28
F5	2153	genome.wustl.edu	37	1	169529886	169529886	+	Silent	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:169529886G>A	ENST00000367797.3	-	4	693	c.492C>T	c.(490-492)gaC>gaT	p.D164D	F5_ENST00000367796.3_Silent_p.D164D|F5_ENST00000546081.1_Silent_p.D27D	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	164	F5/8 type A 1.|Plastocyanin-like 1.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GGCATGGAGGGTCATCATGGG	0.502													ENSG00000198734																																					0													204.0	178.0	187.0					1																	169529886		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.492C>T	1.37:g.169529886G>A			A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.D164	ENST00000367797.3	37	c.492	CCDS1281.1	1																																																																																			-	F5	-	pfam_Cu-oxidase_3,superfamily_Cupredoxin		0.502	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	0	0	0	64	64	82	0.00	0.00	G	NM_000130		169529886	-1	37	43	28	28	tier1	no_errors	ENST00000367797	ensembl	human	known	74_37	silent	56.92	60.56	SNP	1.000	A	37	28
CCNF	899	genome.wustl.edu	37	16	2505464	2505464	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr16:2505464G>T	ENST00000397066.4	+	16	1872	c.1784G>T	c.(1783-1785)aGc>aTc	p.S595I	RP11-715J22.3_ENST00000561653.1_RNA|RP11-715J22.4_ENST00000566085.1_lincRNA	NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	595	PEST.				mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GAGCTGTCCAGCCAGGAGGAG	0.637													ENSG00000162063																																					0													43.0	37.0	39.0					16																	2505464		2197	4299	6496	SO:0001583	missense	0			-	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1784G>T	16.37:g.2505464G>T	ENSP00000380256:p.Ser595Ile		B2R8H3|Q96EG9	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,pfam_F-box_dom,superfamily_Cyclin-like,superfamily_F-box_dom,smart_F-box_dom,smart_Cyclin-like,pfscan_F-box_dom	p.S595I	ENST00000397066.4	37	c.1784	CCDS10467.1	16	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883322	0.51908	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.24908	1.83	5.52	4.56	0.56223	.	0.170880	0.64402	D	0.000005	T	0.20373	0.0490	L	0.43152	1.355	0.30827	N	0.737176	B	0.29341	0.242	B	0.30029	0.11	T	0.18808	-1.0325	10	0.59425	D	0.04	-25.286	5.5426	0.17045	0.1767:0.1652:0.6581:0.0	.	595	P41002	CCNF_HUMAN	I	595;510	ENSP00000380256:S595I	ENSP00000293968:S510I	S	+	2	0	CCNF	2445465	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.103000	0.41806	1.315000	0.45114	0.561000	0.74099	AGC	-	CCNF	-	NULL		0.637	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNF	HGNC	protein_coding	OTTHUMT00000250801.1	0	0	0	58	58	51	0.00	0.00	G	NM_001761		2505464	+1	16	11	54	19	tier1	no_errors	ENST00000397066	ensembl	human	known	74_37	missense	22.86	36.67	SNP	1.000	T	16	54
TAF2	6873	genome.wustl.edu	37	8	120756584	120756584	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:120756584T>C	ENST00000378164.2	-	24	3456	c.3158A>G	c.(3157-3159)gAt>gGt	p.D1053G	TAF2_ENST00000519355.1_5'Flank	NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	1053					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GGCCTGGCTATCATGAACAGT	0.388													ENSG00000064313																																					0													165.0	158.0	161.0					8																	120756584		2203	4300	6503	SO:0001583	missense	0			-	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.3158A>G	8.37:g.120756584T>C	ENSP00000367406:p.Asp1053Gly		B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,superfamily_ARM-type_fold	p.D1053G	ENST00000378164.2	37	c.3158	CCDS34937.1	8	.	.	.	.	.	.	.	.	.	.	T	21.9	4.211107	0.79240	.	.	ENSG00000064313	ENST00000378164;ENST00000529653	T;T	0.45668	1.63;0.89	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.51822	0.1697	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.53830	-0.8383	10	0.52906	T	0.07	-17.2903	15.8953	0.79329	0.0:0.0:0.0:1.0	.	1053	Q6P1X5	TAF2_HUMAN	G	1053;229	ENSP00000367406:D1053G;ENSP00000436750:D229G	ENSP00000367406:D1053G	D	-	2	0	TAF2	120825765	1.000000	0.71417	0.997000	0.53966	0.882000	0.50991	7.929000	0.87595	2.163000	0.67991	0.482000	0.46254	GAT	-	TAF2	-	NULL		0.388	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF2	HGNC	protein_coding	OTTHUMT00000381436.1	0	0	0	53	53	105	0.00	0.00	T	NM_003184		120756584	-1	5	28	36	74	tier1	no_errors	ENST00000378164	ensembl	human	known	74_37	missense	12.20	27.18	SNP	1.000	C	5	36
SPNS1	83985	genome.wustl.edu	37	16	28986111	28986111	+	5'UTR	SNP	T	T	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr16:28986111T>G	ENST00000311008.11	+	0	16				SPNS1_ENST00000334536.8_5'Flank|SPNS1_ENST00000352260.7_5'Flank|SPNS1_ENST00000565975.1_Missense_Mutation_p.F4C|RP11-264B17.3_ENST00000569969.1_RNA|RP11-264B17.4_ENST00000567209.1_RNA|SPNS1_ENST00000323081.8_5'Flank	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)						lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						ATGACCGGCTTTAAGCAACAT	0.692													ENSG00000169682																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.-362T>G	16.37:g.28986111T>G			B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.F4C	ENST00000311008.11	37	c.11	CCDS10646.1	16																																																																																			-	SPNS1	-	NULL		0.692	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS1	HGNC	protein_coding	OTTHUMT00000254690.2	0	0	0	20	20	18	0.00	0.00	T	NM_032038		28986111	+1	8	4	8	11	tier1	no_errors	ENST00000565975	ensembl	human	putative	74_37	missense	50.00	26.67	SNP	0.010	G	8	8
CPNE4	131034	genome.wustl.edu	37	3	131300489	131300489	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:131300489A>T	ENST00000512055.1	-	13	2927	c.801T>A	c.(799-801)aaT>aaA	p.N267K	CPNE4_ENST00000511604.1_Missense_Mutation_p.N267K|CPNE4_ENST00000512332.1_Missense_Mutation_p.N285K|CPNE4_ENST00000429747.1_Missense_Mutation_p.N267K|CPNE4_ENST00000502818.1_Missense_Mutation_p.N285K			Q96A23	CPNE4_HUMAN	copine IV	267						extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						TGTACTTGGGATTGATGCACT	0.448													ENSG00000196353																																					0													260.0	213.0	229.0					3																	131300489		2203	4300	6503	SO:0001583	missense	0			-	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.801T>A	3.37:g.131300489A>T	ENSP00000421705:p.Asn267Lys		D3DNC5|Q8TEX1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom	p.N285K	ENST00000512055.1	37	c.855	CCDS3072.1	3	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905354	0.72868	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.58210	0.37;0.37;0.35;0.37;0.35	5.52	-2.95	0.05564	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.70228	0.3200	M	0.85859	2.78	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.983	T	0.73871	-0.3846	10	0.87932	D	0	-36.3766	13.1457	0.59461	0.581:0.0:0.419:0.0	.	285;267	Q96A23-2;Q96A23	.;CPNE4_HUMAN	K	267;267;285;267;285	ENSP00000421705:N267K;ENSP00000411904:N267K;ENSP00000424853:N285K;ENSP00000423811:N267K;ENSP00000421646:N285K	ENSP00000411904:N267K	N	-	3	2	CPNE4	132783179	0.994000	0.37717	0.980000	0.43619	0.960000	0.62799	0.225000	0.17757	-0.487000	0.06735	-0.250000	0.11733	AAT	-	CPNE4	-	superfamily_C2_dom		0.448	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	0	0	0	47	47	95	0.00	0.00	A	NM_130808		131300489	-1	15	12	41	63	tier1	no_errors	ENST00000502818	ensembl	human	known	74_37	missense	26.79	16.00	SNP	0.884	T	15	41
CDH4	1002	genome.wustl.edu	37	20	60508134	60508134	+	Silent	SNP	C	C	A	rs377265888		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr20:60508134C>A	ENST00000360469.5	+	14	2419	c.2331C>A	c.(2329-2331)cgC>cgA	p.R777R	CDH4_ENST00000543233.1_Silent_p.R703R	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	777					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ACGACGTCCGCGACAACATCC	0.652													ENSG00000179242																																					0													101.0	75.0	84.0					20																	60508134		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.2331C>A	20.37:g.60508134C>A			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.R777	ENST00000360469.5	37	c.2331	CCDS13488.1	20																																																																																			-	CDH4	-	pfam_Cadherin_cytoplasmic-dom,prints_Cadherin/Desmocollin		0.652	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	0	0	0	23	23	44	0.00	0.00	C	NM_001794		60508134	+1	11	7	60	48	tier1	no_errors	ENST00000360469	ensembl	human	known	74_37	silent	15.49	12.73	SNP	0.053	A	11	60
FOXP3	50943	genome.wustl.edu	37	X	49107859	49107859	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chrX:49107859A>G	ENST00000376207.4	-	12	1419	c.1232T>C	c.(1231-1233)cTg>cCg	p.L411P	FOXP3_ENST00000557224.1_Missense_Mutation_p.L436P|FOXP3_ENST00000376197.1_Missense_Mutation_p.L421P|FOXP3_ENST00000376199.2_Missense_Mutation_p.L376P|FOXP3_ENST00000518685.1_Missense_Mutation_p.L376P|FOXP3_ENST00000455775.2_Missense_Mutation_p.L384P	NM_014009.3	NP_054728.2	Q9BZS1	FOXP3_HUMAN	forkhead box P3	411					B cell homeostasis (GO:0001782)|CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|chromatin remodeling (GO:0006338)|cytokine production (GO:0001816)|myeloid cell homeostasis (GO:0002262)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of immune response (GO:0050777)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of histone acetylation (GO:0035066)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peripheral T cell tolerance induction (GO:0002851)|positive regulation of T cell anergy (GO:0002669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell activation (GO:0042110)|T cell homeostasis (GO:0043029)|T cell mediated immunity (GO:0002456)|T cell receptor signaling pathway (GO:0050852)|tolerance induction to self antigen (GO:0002513)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|NFAT protein binding (GO:0051525)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)	10	Ovarian(276;0.236)					GCGGAACTCCAGCTCATCCAC	0.607													ENSG00000049768																									GBM(182;1432 2112 16160 23073 31774)												0													96.0	68.0	77.0					X																	49107859		2203	4300	6503	SO:0001583	missense	0			-		CCDS14323.1, CCDS48109.1	Xp11.23	2014-09-17		2002-09-20	ENSG00000049768	ENSG00000049768		"""Forkhead boxes"""	6106	protein-coding gene	gene with protein product		300292	"""immune dysregulation, polyendocrinopathy, enteropathy, X-linked"""	IPEX		10677306, 11138001	Standard	NM_014009		Approved	JM2, XPID, AIID, PIDX, DIETER, SCURFIN	uc004dnf.4	Q9BZS1	OTTHUMG00000024135	ENST00000376207.4:c.1232T>C	X.37:g.49107859A>G	ENSP00000365380:p.Leu411Pro		A5HJT1|B7ZLG0|B9UN80|O60827|Q14DD8|Q4ZH51	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L411P	ENST00000376207.4	37	c.1232	CCDS14323.1	X	.	.	.	.	.	.	.	.	.	.	A	13.73	2.323194	0.41096	.	.	ENSG00000049768	ENST00000376207;ENST00000376199;ENST00000557224;ENST00000518685;ENST00000376197;ENST00000455775	D;D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71;-3.71	4.58	4.58	0.56647	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.371350	0.19341	N	0.116659	D	0.92958	0.7759	L	0.28504	0.86	0.58432	D	0.999999	P;P;P;P;P	0.49253	0.822;0.921;0.904;0.822;0.786	P;P;P;P;B	0.48400	0.447;0.576;0.461;0.576;0.44	D	0.91452	0.5182	10	0.36615	T	0.2	.	12.1704	0.54155	1.0:0.0:0.0:0.0	.	384;434;436;411;376	B9UN80;B7ZLG1;Q9BZS1-3;Q9BZS1;Q9BZS1-2	.;.;.;FOXP3_HUMAN;.	P	411;376;436;376;421;384	ENSP00000365380:L411P;ENSP00000365372:L376P;ENSP00000451208:L436P;ENSP00000428952:L376P;ENSP00000365369:L421P;ENSP00000396415:L384P	ENSP00000365369:L421P	L	-	2	0	FOXP3	48994803	0.072000	0.21174	0.987000	0.45799	0.856000	0.48823	3.189000	0.50965	1.504000	0.48704	0.352000	0.21897	CTG	-	FOXP3	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head		0.607	FOXP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXP3	HGNC	protein_coding	OTTHUMT00000060814.1	0	0	0	24	24	80	0.00	0.00	A	NM_014009		49107859	-1	10	16	10	32	tier1	no_errors	ENST00000376207	ensembl	human	known	74_37	missense	50.00	33.33	SNP	0.979	G	10	10
KLHL11	55175	genome.wustl.edu	37	17	40011503	40011503	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:40011503C>T	ENST00000319121.3	-	2	676	c.616G>A	c.(616-618)Gtg>Atg	p.V206M		NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	206	BACK.									NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				TGAATTGCCACACAATTTGAG	0.358													ENSG00000178502																																					0													62.0	63.0	63.0					17																	40011503		2201	4299	6500	SO:0001583	missense	0			-		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.616G>A	17.37:g.40011503C>T	ENSP00000314608:p.Val206Met			Missense_Mutation	SNP	pfam_BACK,pfam_BTB_POZ,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.V206M	ENST00000319121.3	37	c.616	CCDS11411.1	17	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017479	0.35606	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.70399	-0.48	4.84	4.84	0.62591	BTB/Kelch-associated (2);	0.066462	0.64402	D	0.000014	T	0.60612	0.2282	N	0.25332	0.735	0.58432	D	0.999997	P	0.39376	0.67	B	0.36335	0.222	T	0.68198	-0.5472	10	0.87932	D	0	-7.1335	17.9438	0.89034	0.0:1.0:0.0:0.0	.	206	Q9NVR0	KLH11_HUMAN	M	206;69	ENSP00000314608:V206M	ENSP00000314608:V206M	V	-	1	0	KLHL11	37265029	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.644000	0.67902	2.225000	0.72522	0.591000	0.81541	GTG	-	KLHL11	-	pfam_BACK,smart_BACK		0.358	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL11	HGNC	protein_coding	OTTHUMT00000257464.2	0	0	0	84	84	106	0.00	0.00	C	NM_018143		40011503	-1	22	25	68	83	tier1	no_errors	ENST00000319121	ensembl	human	known	74_37	missense	24.44	23.15	SNP	1.000	T	22	68
CTPS2	56474	genome.wustl.edu	37	X	16609020	16609020	+	Intron	DEL	A	A	-			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chrX:16609020delA	ENST00000443824.1	-	18	2435				CTPS2_ENST00000483053.1_5'UTR|CTPS2_ENST00000359276.4_Intron|CTPS2_ENST00000380241.3_Intron	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2						'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					AGCAAGGTATAAAAAAAAAAC	0.323													ENSG00000047230																																					0													47.0	44.0	45.0					X																	16609020		2203	4300	6503	SO:0001627	intron_variant	0				AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.1692-35T>-	X.37:g.16609020delA			B3KWM2|Q9BRI0|Q9H809|Q9H8K9	R	DEL	-	NULL	ENST00000443824.1	37	NULL	CCDS14175.1	X																																																																																				CTPS2	-	-		0.323	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	HGNC	protein_coding	OTTHUMT00000055906.1	0	0	1	53	53	106	0.00	0.93	A	NM_019857		16609020	-1	9	17	26	64	tier1	no_errors	ENST00000483053	ensembl	human	known	74_37	rna	25.71	20.99	DEL	0.000	-	9	26
ATRX	546	genome.wustl.edu	37	X	76814269	76814272	+	Frame_Shift_Del	DEL	ATTA	ATTA	-			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	ATTA	ATTA	ATTA	-	ATTA	ATTA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chrX:76814269_76814272delATTA	ENST00000373344.5	-	29	6586_6589	c.6372_6375delTAAT	c.(6370-6375)attaatfs	p.IN2124fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.IN2086fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2124	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CAGCTACCAGATTAATTCCTAGAG	0.319			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								SO:0001589	frameshift_variant	0				U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6372_6375delTAAT	X.37:g.76814269_76814272delATTA	ENSP00000362441:p.Ile2124fs		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N2125fs	ENST00000373344.5	37	c.6375_6372	CCDS14434.1	X																																																																																				ATRX	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.319	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	329	329	114	0.00	0.00	ATTA	NM_000489		76814272	-1	89	20	155	44	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	36.48	31.25	DEL	1.000:1.000:1.000:1.000	-	89	155
C10orf90	118611	genome.wustl.edu	37	10	128193333	128193333	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr10:128193333G>A	ENST00000284694.7	-	3	556	c.436C>T	c.(436-438)Cgc>Tgc	p.R146C	C10orf90_ENST00000454341.1_Missense_Mutation_p.R146C|C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000356858.3_Missense_Mutation_p.R99C|C10orf90_ENST00000544758.1_Missense_Mutation_p.R243C|C10orf90_ENST00000392694.1_Missense_Mutation_p.R99C	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	146	Required for interaction with HDAC1. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		GGGCCCACGCGTCTGGCCGTG	0.692											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000154493																																					0													26.0	31.0	29.0					10																	128193333		2177	4276	6453	SO:0001583	missense	0			-	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.436C>T	10.37:g.128193333G>A	ENSP00000284694:p.Arg146Cys	1563	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	NULL	p.R243C	ENST00000284694.7	37	c.727	CCDS31310.1	10	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764873	0.69878	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.37752	1.47;1.45;1.54;1.48;1.18	5.1	4.19	0.49359	.	0.000000	0.56097	D	0.000034	T	0.56455	0.1986	M	0.65498	2.005	0.47441	D	0.999424	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.995;1.0;1.0	T	0.60444	-0.7262	10	0.87932	D	0	-23.141	12.1279	0.53926	0.0:0.0:0.6883:0.3116	.	243;243;99;146;146	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	C	99;146;146;243;146;99;99	ENSP00000284694:R146C;ENSP00000398786:R146C;ENSP00000444369:R243C;ENSP00000405995:R146C;ENSP00000376459:R99C	ENSP00000284694:R146C	R	-	1	0	C10orf90	128183323	0.992000	0.36948	0.913000	0.36048	0.722000	0.41435	3.237000	0.51344	1.368000	0.46115	0.655000	0.94253	CGC	-	C10orf90	-	NULL		0.692	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf90	HGNC	protein_coding		0	0	0	41	41	10	0.00	0.00	G	NM_001004298		128193333	-1	16	10	13	5	tier1	no_errors	ENST00000544758	ensembl	human	known	74_37	missense	55.17	66.67	SNP	0.983	A	16	13
CDKN2A	1029	genome.wustl.edu	37	9	21974782	21974782	+	Nonsense_Mutation	SNP	C	C	T	rs138677674		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:21974782C>T	ENST00000304494.5	-	1	315	c.45G>A	c.(43-45)tgG>tgA	p.W15*	CDKN2A_ENST00000361570.3_Intron|CDKN2A_ENST00000579755.1_Intron|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.W15*|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.W15*|CDKN2A_ENST00000494262.1_Intron|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.W15*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	15					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.W15*(3)|p.S12fs*6(1)|p.L16fs*9(1)|p.0(1)|p.S7_A19del(1)|p.S12fs*20(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCGTGGCCAGCCAGTCAGCCG	0.756		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			ENSG00000147889																																					1346	Whole gene deletion(1316)|Unknown(23)|Substitution - Nonsense(3)|Deletion - Frameshift(3)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(279)|skin(168)|central_nervous_system(164)|lung(146)|urinary_tract(90)|bone(73)|soft_tissue(58)|pleura(52)|oesophagus(51)|upper_aerodigestive_tract(47)|ovary(34)|kidney(31)|pancreas(31)|breast(30)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	GRCh37	CM994496	CDKN2A	M	rs138677674						13.0	16.0	15.0					9																	21974782		1680	3539	5219	SO:0001587	stop_gained	0			-	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.45G>A	9.37:g.21974782C>T	ENSP00000307101:p.Trp15*		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.W15*	ENST00000304494.5	37	c.45	CCDS6510.1	9	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307496	0.81247	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	.	.	.	4.89	3.01	0.34805	.	.	.	.	.	.	.	.	.	.	.	0.23802	N	0.996805	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	10.1873	0.43006	0.0:0.8197:0.0:0.1803	.	.	.	.	X	15	.	ENSP00000307101:W15X	W	-	3	0	CDKN2A	21964782	0.000000	0.05858	0.013000	0.15412	0.019000	0.09904	-0.767000	0.04720	1.375000	0.46248	0.655000	0.94253	TGG	rs138677674	CDKN2A	-	superfamily_Ankyrin_rpt-contain_dom		0.756	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1	0	0	0	23	23	6	0.00	0.00	C	NM_000077		21974782	-1	5	5	6	6	tier1	no_errors	ENST00000446177	ensembl	human	known	74_37	nonsense	45.45	45.45	SNP	0.045	T	5	6
GLIS1	148979	genome.wustl.edu	37	1	53986384	53986384	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:53986384T>C	ENST00000312233.2	-	6	1690	c.1124A>G	c.(1123-1125)cAg>cGg	p.Q375R		NM_147193.2	NP_671726.2			GLIS family zinc finger 1									p.Q375R(1)		endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						GTGGAGCTGCTGCAGGACCAG	0.672													ENSG00000174332																																					1	Substitution - Missense(1)	lung(1)											29.0	29.0	29.0					1																	53986384		2200	4298	6498	SO:0001583	missense	0			-	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.1124A>G	1.37:g.53986384T>C	ENSP00000309653:p.Gln375Arg			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q375R	ENST00000312233.2	37	c.1124	CCDS582.1	1	.	.	.	.	.	.	.	.	.	.	T	18.72	3.684928	0.68157	.	.	ENSG00000174332	ENST00000312233	T	0.12255	2.7	4.89	1.06	0.20224	.	0.139161	0.32301	N	0.006288	T	0.11367	0.0277	L	0.36672	1.1	0.44660	D	0.997648	B	0.25955	0.138	B	0.34452	0.183	T	0.10683	-1.0619	10	0.56958	D	0.05	.	6.5004	0.22166	0.0:0.0812:0.2969:0.6218	.	375	Q8NBF1	GLIS1_HUMAN	R	375	ENSP00000309653:Q375R	ENSP00000309653:Q375R	Q	-	2	0	GLIS1	53758972	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.016000	0.49607	0.790000	0.33803	0.459000	0.35465	CAG	-	GLIS1	-	NULL		0.672	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS1	HGNC	protein_coding	OTTHUMT00000022109.1	0	0	0	42	42	11	0.00	0.00	T	NM_147193		53986384	-1	23	4	38	5	tier1	no_errors	ENST00000312233	ensembl	human	known	74_37	missense	37.70	44.44	SNP	1.000	C	23	38
IFNA14	3448	genome.wustl.edu	37	9	21239675	21239675	+	Missense_Mutation	SNP	G	G	A	rs145144646	byFrequency	TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:21239675G>A	ENST00000380222.2	-	1	303	c.260C>T	c.(259-261)aCc>aTc	p.T87I		NM_002172.2	NP_002163.2	P01570	IFN14_HUMAN	interferon, alpha 14	87					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)	11				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GAGATTGAAGGTCTGCTGCAT	0.443													ENSG00000228083																																					0													112.0	110.0	111.0					9																	21239675		2203	4300	6503	SO:0001583	missense	0			-		CCDS6501.1	9p22	2010-08-24			ENSG00000228083	ENSG00000228083		"""Interferons"""	5420	protein-coding gene	gene with protein product		147579				1385305	Standard	NM_002172		Approved	LEIF2H, IFN-alphaH	uc010mis.3	P01570	OTTHUMG00000019665	ENST00000380222.2:c.260C>T	9.37:g.21239675G>A	ENSP00000369571:p.Thr87Ile		Q5VZ56|Q7M4S1	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.T87I	ENST00000380222.2	37	c.260	CCDS6501.1	9	.	.	.	.	.	.	.	.	.	.	-	0.786	-0.760644	0.02996	.	.	ENSG00000228083	ENST00000380222	T	0.02323	4.34	3.38	0.727	0.18254	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.873345	0.10112	N	0.714578	T	0.01592	0.0051	N	0.04746	-0.17	0.09310	N	1	B	0.15473	0.013	B	0.22880	0.042	T	0.49934	-0.8886	10	0.10111	T	0.7	.	7.7739	0.29026	0.8613:0.0:0.1387:0.0	.	87	P01570	IFN14_HUMAN	I	87	ENSP00000369571:T87I	ENSP00000369571:T87I	T	-	2	0	IFNA14	21229675	0.000000	0.05858	0.010000	0.14722	0.216000	0.24613	-0.717000	0.04986	0.027000	0.15297	-0.552000	0.04208	ACC	-	IF14	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta		0.443	IFNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IF14	HGNC	protein_coding	OTTHUMT00000051894.1	0	0	0	125	125	17	0.00	0.00	G	NM_002172		21239675	-1	35	4	48	3	tier1	no_errors	ENST00000380222	ensembl	human	known	74_37	missense	42.17	57.14	SNP	0.178	A	35	48
MRGPRE	116534	genome.wustl.edu	37	11	3249728	3249728	+	Missense_Mutation	SNP	G	G	C	rs372934659		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:3249728G>C	ENST00000389832.5	-	2	608	c.302C>G	c.(301-303)aCg>aGg	p.T101R	AC109309.4_ENST00000418995.2_RNA|MRGPRE_ENST00000436689.2_Missense_Mutation_p.T100R			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T100M(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAAGCGCAGCGTTGCCAGGCT	0.662													ENSG00000184350																																					1	Substitution - Missense(1)	prostate(1)											39.0	50.0	46.0					11																	3249728		2183	4276	6459	SO:0001583	missense	0			-	AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.302C>G	11.37:g.3249728G>C	ENSP00000374482:p.Thr101Arg		Q2M1V7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.T101R	ENST00000389832.5	37	c.302		11	.	.	.	.	.	.	.	.	.	.	g	11.01	1.514461	0.27123	.	.	ENSG00000184350	ENST00000436689;ENST00000389832	.	.	.	3.62	1.52	0.23074	GPCR, rhodopsin-like superfamily (1);	1.254590	0.05970	U	0.642291	T	0.16769	0.0403	N	0.02916	-0.46	0.09310	N	1	B	0.23249	0.082	B	0.30105	0.111	T	0.34229	-0.9837	9	0.19147	T	0.46	-3.6331	5.2432	0.15483	0.1218:0.0:0.6779:0.2003	.	100	Q86SM8	MRGRE_HUMAN	R	101;100	.	ENSP00000374482:T100R	T	-	2	0	MRGPRE	3206304	0.000000	0.05858	0.001000	0.08648	0.056000	0.15407	0.468000	0.22051	0.675000	0.31264	0.585000	0.79938	ACG	-	MRGPRE	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM		0.662	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	MRGPRE	HGNC	protein_coding	OTTHUMT00000032346.5	0	0	0	19	19	17	0.00	0.00	G	XM_171536		3249728	-1	7	4	25	1	tier1	no_errors	ENST00000389832	ensembl	human	known	74_37	missense	21.88	80.00	SNP	0.002	C	7	25
OR5H14	403273	genome.wustl.edu	37	3	97868995	97868995	+	Missense_Mutation	SNP	G	G	T	rs148799830	byFrequency	TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:97868995G>T	ENST00000437310.1	+	1	826	c.766G>T	c.(766-768)Gcc>Tcc	p.A256S	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TGGGCCCCTCGCCTTCATGTA	0.413													ENSG00000236032																																					0													55.0	50.0	52.0					3																	97868995		2203	4298	6501	SO:0001583	missense	0			-		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.766G>T	3.37:g.97868995G>T	ENSP00000401706:p.Ala256Ser		B9EH15	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A256S	ENST00000437310.1	37	c.766	CCDS33798.1	3	.	.	.	.	.	.	.	.	.	.	G	3.305	-0.142089	0.06669	.	.	ENSG00000236032	ENST00000437310	T	0.37235	1.21	2.49	-2.35	0.06684	GPCR, rhodopsin-like superfamily (1);	0.550026	0.15214	N	0.274324	T	0.14313	0.0346	N	0.04148	-0.265	0.09310	N	1	B	0.26547	0.152	B	0.34093	0.175	T	0.17471	-1.0368	10	0.56958	D	0.05	.	1.1048	0.01691	0.1767:0.4022:0.183:0.2381	.	256	A6NHG9	O5H14_HUMAN	S	256	ENSP00000401706:A256S	ENSP00000401706:A256S	A	+	1	0	OR5H14	99351685	0.000000	0.05858	0.010000	0.14722	0.042000	0.13812	-1.146000	0.03191	-0.488000	0.06726	0.195000	0.17529	GCC	-	OR5H14	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.413	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H14	HGNC	protein_coding	OTTHUMT00000359112.1	0	0	0	47	47	14	0.00	0.00	G			97868995	+1	11	2	14	2	tier1	no_errors	ENST00000437310	ensembl	human	known	74_37	missense	44.00	50.00	SNP	0.000	T	11	14
PLEKHG4	25894	genome.wustl.edu	37	16	67315959	67315959	+	Silent	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr16:67315959C>G	ENST00000360461.5	+	7	3588	c.1053C>G	c.(1051-1053)ctC>ctG	p.L351L	PLEKHG4_ENST00000427155.2_Silent_p.L351L|PLEKHG4_ENST00000379344.3_Silent_p.L351L|PLEKHG4_ENST00000450733.1_Silent_p.L270L	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	351							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		GTGCCCTGCTCCAGGGGGCCA	0.627													ENSG00000196155																																					0													57.0	57.0	57.0					16																	67315959		2198	4300	6498	SO:0001819	synonymous_variant	0			-	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.1053C>G	16.37:g.67315959C>G			Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L351	ENST00000360461.5	37	c.1053	CCDS32466.1	16																																																																																			-	PLEKHG4	-	NULL		0.627	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4	HGNC	protein_coding	OTTHUMT00000421395.2	0	0	0	55	55	26	0.00	0.00	C	NM_015432		67315959	+1	32	6	21	7	tier1	no_errors	ENST00000360461	ensembl	human	known	74_37	silent	60.38	46.15	SNP	0.972	G	32	21
REPIN1	29803	genome.wustl.edu	37	7	150068731	150068731	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:150068731A>G	ENST00000425389.2	+	1	479	c.401A>G	c.(400-402)cAt>cGt	p.H134R	REPIN1_ENST00000397281.2_Missense_Mutation_p.H134R|REPIN1_ENST00000540729.1_Missense_Mutation_p.H134R|REPIN1_ENST00000466559.1_3'UTR|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000489432.2_Missense_Mutation_p.H191R|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000482680.1_3'UTR|REPIN1_ENST00000444957.1_Missense_Mutation_p.H134R	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	134					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CTGGTTCTGCATCTGCGGGCC	0.647													ENSG00000214022																																					0													15.0	17.0	17.0					7																	150068731		2064	4190	6254	SO:0001583	missense	0			-	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.401A>G	7.37:g.150068731A>G	ENSP00000388287:p.His134Arg		C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H191R	ENST00000425389.2	37	c.572	CCDS43677.1	7	.	.	.	.	.	.	.	.	.	.	A	19.04	3.750242	0.69533	.	.	ENSG00000214022	ENST00000519397;ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000475514;ENST00000488943;ENST00000461637;ENST00000425389	D;D;D;D;D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2;-10.2;-10.2;-10.2;-10.2	5.26	5.26	0.73747	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.99975	0.9992	M	0.90425	3.115	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.80764	0.994;0.994	D	0.95335	0.8433	9	0.87932	D	0	-12.8302	13.1489	0.59478	1.0:0.0:0.0:0.0	.	191;134	C9J3L7;Q9BWE0	.;REPI1_HUMAN	R	134;134;134;134;191;193;194;191;134	ENSP00000428562:H134R;ENSP00000445016:H134R;ENSP00000380451:H134R;ENSP00000407714:H134R;ENSP00000417291:H191R;ENSP00000419789:H193R;ENSP00000419872:H194R;ENSP00000388287:H134R	ENSP00000380451:H134R	H	+	2	0	REPIN1	149699664	0.999000	0.42202	0.993000	0.49108	0.927000	0.56198	5.552000	0.67281	1.990000	0.58119	0.379000	0.24179	CAT	-	REPIN1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.647	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	REPIN1	HGNC	protein_coding	OTTHUMT00000376940.1	0	0	0	25	25	22	0.00	0.00	A	NM_014374		150068731	+1	4	2	18	6	tier1	no_errors	ENST00000489432	ensembl	human	known	74_37	missense	18.18	25.00	SNP	0.997	G	4	18
USH1G	124590	genome.wustl.edu	37	17	72916165	72916165	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:72916165C>A	ENST00000319642.1	-	2	948	c.766G>T	c.(766-768)Gtg>Ttg	p.V256L		NM_001282489.1|NM_173477.2	NP_001269418.1|NP_775748.2	Q495M9	USH1G_HUMAN	Usher syndrome 1G (autosomal recessive)	256					equilibrioception (GO:0050957)|inner ear morphogenesis (GO:0042472)|inner ear receptor cell differentiation (GO:0060113)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	spectrin binding (GO:0030507)		HN1/USH1G(2)	endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(3)	14	all_lung(278;0.172)|Lung NSC(278;0.207)					CCCTGGCGCACGAACATCACG	0.697													ENSG00000182040																																					0													35.0	41.0	39.0					17																	72916165		2203	4294	6497	SO:0001583	missense	0			-	AK091243	CCDS32725.1	17q25.1	2013-01-10			ENSG00000182040	ENSG00000182040		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	16356	protein-coding gene	gene with protein product		607696				12588794	Standard	NM_001282489		Approved	Sans, FLJ33924, ANKS4A	uc002jme.1	Q495M9	OTTHUMG00000178864	ENST00000319642.1:c.766G>T	17.37:g.72916165C>A	ENSP00000320076:p.Val256Leu		Q8N251	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V256L	ENST00000319642.1	37	c.766	CCDS32725.1	17	.	.	.	.	.	.	.	.	.	.	C	12.59	1.984291	0.35036	.	.	ENSG00000182040	ENST00000319642	T	0.74526	-0.85	4.25	3.23	0.37069	.	0.145968	0.46145	D	0.000301	T	0.57932	0.2087	N	0.16266	0.395	0.43902	D	0.996534	B	0.06786	0.001	B	0.06405	0.002	T	0.50693	-0.8798	10	0.27082	T	0.32	-29.5552	13.8484	0.63481	0.0:0.8457:0.1543:0.0	.	256	Q495M9	USH1G_HUMAN	L	256	ENSP00000320076:V256L	ENSP00000320076:V256L	V	-	1	0	USH1G	70427760	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.008000	0.63991	0.964000	0.38108	0.485000	0.47835	GTG	-	USH1G	-	NULL		0.697	USH1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USH1G	HGNC	protein_coding	OTTHUMT00000443676.1	0	0	0	48	48	9	0.00	0.00	C	NM_173477		72916165	-1	14	3	35	7	tier1	no_errors	ENST00000319642	ensembl	human	known	74_37	missense	28.57	30.00	SNP	1.000	A	14	35
WDTC1	23038	genome.wustl.edu	37	1	27632840	27632840	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:27632840G>C	ENST00000319394.3	+	16	2535	c.2000G>C	c.(1999-2001)aGc>aCc	p.S667T	WDTC1_ENST00000361771.3_Missense_Mutation_p.S666T	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	667					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		GATGAGGACAGCTCTGAGGGC	0.667													ENSG00000142784																																					0													38.0	41.0	40.0					1																	27632840		2203	4300	6503	SO:0001583	missense	0			-	AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.2000G>C	1.37:g.27632840G>C	ENSP00000317971:p.Ser667Thr		D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,smart_TPR_repeat,pfscan_TPR-contain_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S667T	ENST00000319394.3	37	c.2000		1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813419	0.32053	.	.	ENSG00000142784	ENST00000319394;ENST00000361771	T;T	0.61859	0.08;0.07	5.33	4.42	0.53409	.	0.075738	0.85682	D	0.000000	T	0.36552	0.0971	N	0.08118	0	0.58432	D	0.999999	B;B	0.31817	0.231;0.341	B;B	0.32980	0.074;0.156	T	0.18587	-1.0332	10	0.19147	T	0.46	.	13.4245	0.61018	0.0761:0.0:0.9239:0.0	.	667;666	Q8N5D0;Q8N5D0-4	WDTC1_HUMAN;.	T	667;666	ENSP00000317971:S667T;ENSP00000355317:S666T	ENSP00000317971:S667T	S	+	2	0	WDTC1	27505427	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.407000	0.66363	1.386000	0.46466	-0.140000	0.14226	AGC	-	WDTC1	-	NULL		0.667	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	WDTC1	HGNC	protein_coding		0	0	0	43	43	21	0.00	0.00	G	NM_015023		27632840	+1	10	6	22	7	tier1	no_errors	ENST00000319394	ensembl	human	known	74_37	missense	31.25	46.15	SNP	1.000	C	10	22
SCN11A	11280	genome.wustl.edu	37	3	38991680	38991680	+	Silent	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr3:38991680G>T	ENST00000302328.3	-	1	372	c.174C>A	c.(172-174)gcC>gcA	p.A58A	SCN11A_ENST00000450244.1_Silent_p.A58A|SCN11A_ENST00000456224.3_Silent_p.A58A|SCN11A_ENST00000444237.2_Silent_p.A58A	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	58					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTTCCTGGAGGCCTTTAGGT	0.498													ENSG00000168356																																					0													148.0	148.0	148.0					3																	38991680		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.174C>A	3.37:g.38991680G>T			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.A58	ENST00000302328.3	37	c.174	CCDS33737.1	3																																																																																			-	SCN11A	-	NULL		0.498	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	0	0	0	52	52	84	0.00	0.00	G	NM_014139		38991680	-1	8	10	68	94	tier1	no_errors	ENST00000302328	ensembl	human	known	74_37	silent	10.53	9.62	SNP	0.427	T	8	68
NAALAD2	10003	genome.wustl.edu	37	11	89924884	89924884	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:89924884C>T	ENST00000534061.1	+	19	2422	c.2192C>T	c.(2191-2193)gCa>gTa	p.A731V	NAALAD2_ENST00000321955.4_Missense_Mutation_p.A698V|NAALAD2_ENST00000375944.3_3'UTR	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	731					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				ACAATTCAAGCAGCAGCAGGA	0.353													ENSG00000077616																																					0													69.0	72.0	71.0					11																	89924884		2201	4298	6499	SO:0001583	missense	0			-	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.2192C>T	11.37:g.89924884C>T	ENSP00000432481:p.Ala731Val		B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.A731V	ENST00000534061.1	37	c.2192	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.192715	0.94960	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	T;T	0.58506	0.33;0.33	5.08	5.08	0.68730	Transferrin receptor-like, dimerisation domain (3);	0.000000	0.64402	D	0.000003	T	0.77046	0.4073	M	0.80508	2.5	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	T	0.78463	-0.2194	9	.	.	.	-19.5226	18.9015	0.92444	0.0:1.0:0.0:0.0	.	731	Q9Y3Q0	NALD2_HUMAN	V	731;698	ENSP00000432481:A731V;ENSP00000320083:A698V	.	A	+	2	0	NAALAD2	89564532	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.972000	0.76110	2.535000	0.85469	0.454000	0.30748	GCA	-	ALAD2	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom		0.353	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	0	0	0	100	100	76	0.00	0.00	C	NM_005467		89924884	+1	18	6	115	84	tier1	no_errors	ENST00000534061	ensembl	human	known	74_37	missense	13.53	6.67	SNP	1.000	T	18	115
ANKDD1A	348094	genome.wustl.edu	37	15	65219154	65219154	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr15:65219154G>A	ENST00000380230.3	+	6	555	c.526G>A	c.(526-528)Gac>Aac	p.D176N	ANKDD1A_ENST00000395723.1_Missense_Mutation_p.D85N|ANKDD1A_ENST00000496660.1_Missense_Mutation_p.D85N|ANKDD1A_ENST00000491145.1_3'UTR|ANKDD1A_ENST00000395720.1_Missense_Mutation_p.D176N|AC069368.3_ENST00000437723.1_Intron|ANKDD1A_ENST00000319580.8_3'UTR|ANKDD1A_ENST00000357698.3_Missense_Mutation_p.D176N	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	176					signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						GGATGCTCTGGACTTCCTCGT	0.607													ENSG00000166839																																					0													136.0	116.0	123.0					15																	65219154		2202	4299	6501	SO:0001583	missense	0			-		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.526G>A	15.37:g.65219154G>A	ENSP00000369579:p.Asp176Asn		Q495B2|Q495B3|Q8N7A0|Q8NBS5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,prints_Ankyrin_rpt	p.D176N	ENST00000380230.3	37	c.526	CCDS10197.2	15	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020978	0.75275	.	.	ENSG00000166839	ENST00000380230;ENST00000357698;ENST00000395720;ENST00000496660;ENST00000395723	T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1	4.23	4.23	0.50019	Ankyrin repeat-containing domain (4);	0.095315	0.42172	D	0.000752	T	0.52058	0.1711	N	0.03967	-0.31	0.80722	D	1	D;P;D;P	0.56746	0.96;0.863;0.977;0.95	P;P;P;P	0.57244	0.816;0.532;0.787;0.72	T	0.62618	-0.6816	10	0.62326	D	0.03	-29.6929	12.2937	0.54833	0.0:0.0:1.0:0.0	.	176;82;176;176	Q495B1;A4QMR4;Q495B1-2;Q495B1-1	AKD1A_HUMAN;.;.;.	N	176;176;176;85;85	ENSP00000369579:D176N;ENSP00000350329:D176N;ENSP00000379070:D176N;ENSP00000420999:D85N;ENSP00000379073:D85N	ENSP00000350329:D176N	D	+	1	0	ANKDD1A	63006207	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.746000	0.55127	2.363000	0.80096	0.561000	0.74099	GAC	-	ANKDD1A	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.607	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKDD1A	HGNC	protein_coding	OTTHUMT00000256705.2	0	0	1	23	23	87	0.00	1.12	G	NM_182703		65219154	+1	10	8	36	97	tier1	no_errors	ENST00000380230	ensembl	human	known	74_37	missense	21.74	7.62	SNP	1.000	A	10	36
FANCC	2176	genome.wustl.edu	37	9	97869348	97869348	+	Splice_Site	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:97869348C>A	ENST00000289081.3	-	14	1787	c.1533G>T	c.(1531-1533)ctG>ctT	p.L511L	FANCC_ENST00000375305.1_Splice_Site_p.L511L	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	511					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				GGAGACTTACCAGGGTGATGA	0.582			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				ENSG00000158169																											yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0													166.0	144.0	151.0					9																	97869348		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.1533+1G>T	9.37:g.97869348C>A			B1ALR8	Silent	SNP	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi	p.L511	ENST00000289081.3	37	c.1533	CCDS35071.1	9																																																																																			-	FANCC	-	pfam_Fanconi,pirsf_Fanconi		0.582	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	HGNC	protein_coding	OTTHUMT00000053219.1	0	0	0	43	43	79	0.00	0.00	C	NM_000136	Silent	97869348	-1	7	10	42	110	tier1	no_errors	ENST00000289081	ensembl	human	known	74_37	silent	14.29	8.33	SNP	0.012	A	7	42
RAB2A	5862	genome.wustl.edu	37	8	61504448	61504448	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr8:61504448G>C	ENST00000262646.7	+	6	745	c.394G>C	c.(394-396)Gaa>Caa	p.E132Q	RAB2A_ENST00000530071.1_3'UTR|RAB2A_ENST00000529579.1_Intron|RAB2A_ENST00000531289.1_Missense_Mutation_p.E108Q	NM_002865.2	NP_002856.1	P61019	RAB2A_HUMAN	RAB2A, member RAS oncogene family	132					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|lung(4)	6			BRCA - Breast invasive adenocarcinoma(89;0.0805)			AGTAAAAAAAGAAGAAGGTGA	0.378													ENSG00000104388																																					0													99.0	103.0	102.0					8																	61504448		2203	4300	6503	SO:0001583	missense	0			-		CCDS6175.1, CCDS56537.1	8q12.1	2007-01-15	2007-01-15	2007-01-15	ENSG00000104388	ENSG00000104388		"""RAB, member RAS oncogene"""	9763	protein-coding gene	gene with protein product		179509	"""RAB2, member RAS oncogene family"""	RAB2			Standard	NM_002865		Approved		uc003xud.2	P61019	OTTHUMG00000134298	ENST00000262646.7:c.394G>C	8.37:g.61504448G>C	ENSP00000262646:p.Glu132Gln		B2R5W8|B4DMQ5|P08886	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E132Q	ENST00000262646.7	37	c.394	CCDS6175.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.192601|5.192601	0.94960|0.94960	.|.	.|.	ENSG00000104388|ENSG00000104388	ENST00000262646;ENST00000531289;ENST00000543829|ENST00000452437	T;T|.	0.78246|.	-1.16;-1.16|.	5.37|5.37	5.37|5.37	0.77165|0.77165	Small GTP-binding protein domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71600|0.71600	0.3359|0.3359	L|L	0.52823|0.52823	1.66|1.66	0.80722|0.80722	D|D	1|1	B;B|.	0.27656|.	0.184;0.142|.	B;B|.	0.31751|.	0.135;0.087|.	T|T	0.67875|0.67875	-0.5557|-0.5557	10|5	0.72032|.	D|.	0.01|.	.|.	19.4619|19.4619	0.94921|0.94921	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	108;132|.	B4DMQ5;P61019|.	.;RAB2A_HUMAN|.	Q|T	132;108;86|42	ENSP00000262646:E132Q;ENSP00000431846:E108Q|.	ENSP00000262646:E132Q|.	E|R	+|+	1|2	0|0	RAB2A|RAB2A	61667002|61667002	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.791000|9.791000	0.99081|0.99081	2.663000|2.663000	0.90544|0.90544	0.585000|0.585000	0.79938|0.79938	GAA|AGA	-	RAB2A	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom		0.378	RAB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB2A	HGNC	protein_coding	OTTHUMT00000259145.2	0	0	0	97	97	101	0.00	0.00	G			61504448	+1	16	4	107	92	tier1	no_errors	ENST00000262646	ensembl	human	known	74_37	missense	13.01	4.17	SNP	1.000	C	16	107
FANCC	2176	genome.wustl.edu	37	9	97869347	97869347	+	Splice_Site	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:97869347C>A	ENST00000289081.3	-	14	1788		c.e14+1		FANCC_ENST00000375305.1_Splice_Site	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C						DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				GGGAGACTTACCAGGGTGATG	0.582			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				ENSG00000158169																											yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0													165.0	143.0	151.0					9																	97869347		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.1533+1G>T	9.37:g.97869347C>A			B1ALR8	Splice_Site	SNP	-	e13+1	ENST00000289081.3	37	c.1533+1	CCDS35071.1	9	.	.	.	.	.	.	.	.	.	.	C	11.29	1.595899	0.28445	.	.	ENSG00000158169	ENST00000289081;ENST00000375305	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6518	0.77104	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FANCC	96909168	0.997000	0.39634	0.909000	0.35828	0.098000	0.18820	4.461000	0.60115	2.411000	0.81874	0.655000	0.94253	.	-	FANCC	-	-		0.582	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	HGNC	protein_coding	OTTHUMT00000053219.1	0	0	0	43	43	80	0.00	0.00	C	NM_000136	Intron	97869347	-1	7	10	40	111	tier1	no_errors	ENST00000289081	ensembl	human	known	74_37	splice_site	14.89	8.26	SNP	0.986	A	7	40
SEL1L2	80343	genome.wustl.edu	37	20	13866984	13866984	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr20:13866984T>A	ENST00000284951.5	-	9	924	c.850A>T	c.(850-852)Ata>Tta	p.I284L	SEL1L2_ENST00000378072.5_Missense_Mutation_p.I284L|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	284						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						TATTGGTATATGTCCCAATCC	0.343													ENSG00000101251																																					0													138.0	128.0	131.0					20																	13866984		1824	4087	5911	SO:0001583	missense	0			-	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.850A>T	20.37:g.13866984T>A	ENSP00000284951:p.Ile284Leu		B4DXX5	Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.I284L	ENST00000284951.5	37	c.850		20	.	.	.	.	.	.	.	.	.	.	T	4.030	0.003026	0.07866	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.21031	2.03;2.36	5.78	1.78	0.24846	.	0.162693	0.43110	N	0.000607	T	0.05914	0.0154	N	0.03948	-0.315	0.27816	N	0.941959	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.37337	-0.9710	10	0.05833	T	0.94	-7.7229	4.0545	0.09810	0.1577:0.1873:0.0:0.655	.	284;284	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	L	284	ENSP00000367312:I284L;ENSP00000284951:I284L	ENSP00000284951:I284L	I	-	1	0	SEL1L2	13814984	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.294000	0.19047	0.431000	0.26258	0.454000	0.30748	ATA	-	SEL1L2	-	NULL		0.343	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	0	0	0	87	87	110	0.00	0.00	T	NM_025229		13866984	-1	26	7	95	85	tier1	no_errors	ENST00000284951	ensembl	human	known	74_37	missense	21.49	7.53	SNP	0.999	A	26	95
OPTN	10133	genome.wustl.edu	37	10	13167497	13167509	+	Frame_Shift_Del	DEL	AAGTTAGAGCTAC	AAGTTAGAGCTAC	-			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	AAGTTAGAGCTAC	AAGTTAGAGCTAC	AAGTTAGAGCTAC	-	AAGTTAGAGCTAC	AAGTTAGAGCTAC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr10:13167497_13167509delAAGTTAGAGCTAC	ENST00000378748.3	+	11	1440_1452	c.1078_1090delAAGTTAGAGCTAC	c.(1078-1092)aagttagagctacaafs	p.KLELQ360fs	OPTN_ENST00000378747.3_Frame_Shift_Del_p.KLELQ360fs|OPTN_ENST00000263036.5_Frame_Shift_Del_p.KLELQ360fs|OPTN_ENST00000378764.2_Frame_Shift_Del_p.KLELQ354fs|OPTN_ENST00000378757.2_Frame_Shift_Del_p.KLELQ360fs|OPTN_ENST00000378752.3_Frame_Shift_Del_p.KLELQ354fs	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	360					cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						TACTAACAAAAAGTTAGAGCTACAAGTGGAAAG	0.408													ENSG00000123240																																					0																																										SO:0001589	frameshift_variant	0				AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.1078_1090delAAGTTAGAGCTAC	10.37:g.13167497_13167509delAAGTTAGAGCTAC	ENSP00000368022:p.Lys360fs		B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Frame_Shift_Del	DEL	pfam_NEMO_N	p.L361fs	ENST00000378748.3	37	c.1078_1090	CCDS7094.1	10																																																																																				OPTN	-	NULL		0.408	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPTN	HGNC	protein_coding	OTTHUMT00000046834.1	0	0	0	78	78	78	0.00	0.00	AAGTTAGAGCTAC	NM_021980		13167509	+1	4	4	102	102	tier1	no_errors	ENST00000263036	ensembl	human	known	74_37	frame_shift_del	3.77	3.77	DEL	1.000:1.000:0.992:0.988:0.993:0.972:0.993:0.990:0.757:0.989:0.963:0.467:0.997	-	4	102
BOD1L1	259282	genome.wustl.edu	37	4	13588085	13588096	+	In_Frame_Del	DEL	CATCTGGATTAT	CATCTGGATTAT	-	rs376355355|rs533887203|rs370124533		TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	CATCTGGATTAT	CATCTGGATTAT	CATCTGGATTAT	-	CATCTGGATTAT	CATCTGGATTAT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr4:13588085_13588096delCATCTGGATTAT	ENST00000040738.5	-	17	8492_8503	c.8357_8368delATAATCCAGATG	c.(8356-8370)gataatccagatgtc>gtc	p.DNPD2786del		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2786						nucleus (GO:0005634)	DNA binding (GO:0003677)										GAATCCAGGACATCTGGATTATCATCTGTAAA	0.349													ENSG00000038219																																					0																																										SO:0001651	inframe_deletion	0				AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8357_8368delATAATCCAGATG	4.37:g.13588085_13588096delCATCTGGATTAT	ENSP00000040738:p.Asp2786_Asp2789del		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	In_Frame_Del	DEL	NULL	p.DNPD2786in_frame_del	ENST00000040738.5	37	c.8368_8357	CCDS3411.2	4																																																																																				BOD1L1	-	NULL		0.349	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	0	0	0	68	68	68	0.00	0.00	CATCTGGATTAT	NM_148894		13588096	-1	4	4	44	44	tier1	no_errors	ENST00000040738	ensembl	human	known	74_37	in_frame_del	8.33	8.33	DEL	0.874:0.813:0.646:0.614:0.411:0.357:0.328:0.277:0.287:0.568:0.656:0.960	-	4	44
BTBD17	388419	genome.wustl.edu	37	17	72352937	72352937	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:72352937G>C	ENST00000375366.3	-	3	1422	c.1296C>G	c.(1294-1296)caC>caG	p.H432Q		NM_001080466.1	NP_001073935.1	A6NE02	BTBDH_HUMAN	BTB (POZ) domain containing 17	432					negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|lung(4)	6						CGCTGCTCTGGTGGAAGCTGT	0.716													ENSG00000204347																																					0													31.0	30.0	30.0					17																	72352937		2203	4298	6501	SO:0001583	missense	0			-		CCDS32719.1	17q25.1	2013-01-08			ENSG00000204347	ENSG00000204347		"""BTB/POZ domain containing"""	33758	protein-coding gene	gene with protein product	"""transport and golgi organization 10 homolog A (Drosophila)"""						Standard	NM_001080466		Approved	LGALS3BPL, BTBD17A, TANGO10A	uc002jkn.2	A6NE02	OTTHUMG00000178580	ENST00000375366.3:c.1296C>G	17.37:g.72352937G>C	ENSP00000364515:p.His432Gln			Missense_Mutation	SNP	pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.H432Q	ENST00000375366.3	37	c.1296	CCDS32719.1	17	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434007	0.62955	.	.	ENSG00000204347	ENST00000375366	D	0.83163	-1.69	5.06	2.57	0.30868	.	0.000000	0.85682	D	0.000000	D	0.84316	0.5445	L	0.36672	1.1	0.49213	D	0.999768	D	0.76494	0.999	D	0.83275	0.996	T	0.82810	-0.0273	10	0.59425	D	0.04	-33.2095	8.1141	0.30933	0.2977:0.0:0.7023:0.0	.	432	A6NE02	BTBDH_HUMAN	Q	432	ENSP00000364515:H432Q	ENSP00000364515:H432Q	H	-	3	2	BTBD17	69864532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.059000	0.57470	0.800000	0.34041	0.556000	0.70494	CAC	-	BTBD17	-	NULL		0.716	BTBD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD17	HGNC	protein_coding	OTTHUMT00000442542.1	0	0	0	41	41	7	0.00	0.00	G	NM_001080466		72352937	-1	9	0	17	1	tier1	no_errors	ENST00000375366	ensembl	human	known	74_37	missense	34.62	0.00	SNP	1.000	C	9	17
LINC01168	399829	genome.wustl.edu	37	10	134787952	134787952	+	lincRNA	SNP	C	C	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr10:134787952C>A	ENST00000461291.2	+	0	3724					NR_046231.1																						TCCTCGCCGCCCGCACCTGCC	0.672													ENSG00000240707																																					0																																												0			-																													10.37:g.134787952C>A				R	SNP	-	NULL	ENST00000461291.2	37	NULL		10																																																																																			-	RP13-137A17.6	-	-		0.672	RP13-137A17.6-001	KNOWN	basic	lincRNA	LOC399829	Clone_based_vega_gene	lincRNA	OTTHUMT00000349546.2	0	0	0	17	17	20	0.00	0.00	C			134787952	+1	13	1	7	3	tier1	no_errors	ENST00000461291	ensembl	human	known	74_37	rna	65.00	25.00	SNP	0.001	A	13	7
MYH7B	57644	genome.wustl.edu	37	20	33582077	33582077	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr20:33582077C>G	ENST00000262873.7	+	25	2791	c.2699C>G	c.(2698-2700)gCc>gGc	p.A900G		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	858						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GAGCTGGCGGCCCTGCGGGCA	0.647													ENSG00000078814																																					0													57.0	67.0	64.0					20																	33582077		1990	4158	6148	SO:0001583	missense	0			-	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.2699C>G	20.37:g.33582077C>G	ENSP00000262873:p.Ala900Gly		Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tR-bd_arm,superfamily_t-SRE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A900G	ENST00000262873.7	37	c.2699	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	9.794	1.178738	0.21787	.	.	ENSG00000078814	ENST00000262873	D	0.93366	-3.21	4.32	4.32	0.51571	.	0.000000	0.37669	N	0.001987	D	0.85461	0.5702	L	0.31578	0.945	0.09310	N	1	B	0.26318	0.146	B	0.22386	0.039	T	0.70103	-0.4964	10	0.16896	T	0.51	.	6.8041	0.23768	0.3001:0.6148:0.0:0.0851	.	858	A7E2Y1	MYH7B_HUMAN	G	900	ENSP00000262873:A900G	ENSP00000262873:A900G	A	+	2	0	MYH7B	33045738	0.017000	0.18338	0.805000	0.32314	0.779000	0.44077	0.705000	0.25675	2.409000	0.81822	0.655000	0.94253	GCC	-	MYH7B	-	NULL		0.647	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	0	0	0	28	28	8	0.00	0.00	C	NM_020884		33582077	+1	10	1	39	5	tier1	no_errors	ENST00000262873	ensembl	human	novel	74_37	missense	20.41	16.67	SNP	0.082	G	10	39
RASSF7	8045	genome.wustl.edu	37	11	562471	562471	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr11:562471G>A	ENST00000397583.3	+	3	950	c.517G>A	c.(517-519)Gcc>Acc	p.A173T	RASSF7_ENST00000344375.4_Missense_Mutation_p.A173T|RP11-496I9.1_ENST00000527113.1_RNA|C11orf35_ENST00000329451.3_5'Flank|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000454668.2_Missense_Mutation_p.A173T|RASSF7_ENST00000431809.1_Missense_Mutation_p.A173T|RASSF7_ENST00000397582.3_Missense_Mutation_p.A173T	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	173					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGCCATGAGGCCTTCTGGGA	0.697													ENSG00000099849																									Pancreas(184;1170 3913 7268)												0													16.0	15.0	15.0					11																	562471		2005	3939	5944	SO:0001583	missense	0			-	M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.517G>A	11.37:g.562471G>A	ENSP00000380713:p.Ala173Thr		G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.A173T	ENST00000397583.3	37	c.517	CCDS7702.1	11	.	.	.	.	.	.	.	.	.	.	G	11.22	1.575972	0.28092	.	.	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668	D;D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05;-3.05	3.52	3.52	0.40303	.	0.611812	0.16672	N	0.204331	D	0.88463	0.6443	L	0.51422	1.61	0.32412	N	0.550469	P;P;P	0.47409	0.879;0.895;0.879	B;B;B	0.42827	0.399;0.351;0.399	D	0.87638	0.2520	10	0.26408	T	0.33	-0.001	10.1253	0.42646	0.0991:0.0:0.9009:0.0	.	173;173;173	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	T	173	ENSP00000403068:A173T;ENSP00000380712:A173T;ENSP00000344226:A173T;ENSP00000380713:A173T;ENSP00000405606:A173T	ENSP00000344226:A173T	A	+	1	0	RASSF7	552471	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	3.166000	0.50785	1.824000	0.53156	0.462000	0.41574	GCC	-	RASSF7	-	NULL		0.697	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF7	HGNC	protein_coding	OTTHUMT00000254972.2	0	0	0	39	39	9	0.00	0.00	G	NM_003475		562471	+1	11	1	32	7	tier1	no_errors	ENST00000344375	ensembl	human	known	74_37	missense	25.58	12.50	SNP	0.991	A	11	32
VAT1L	57687	genome.wustl.edu	37	16	77822609	77822609	+	Silent	SNP	G	G	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr16:77822609G>A	ENST00000302536.2	+	1	183	c.30G>A	c.(28-30)gaG>gaA	p.E10E		NM_020927.1	NP_065978.1	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport 1-like	10							oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(10)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24						AGAAGGCGGAGGAGACGGAGC	0.751													ENSG00000171724																																					0													16.0	13.0	14.0					16																	77822609		2045	4037	6082	SO:0001819	synonymous_variant	0			-	AB046796	CCDS32492.1	16q23.1	2014-09-09	2013-08-23		ENSG00000171724	ENSG00000171724			29315	protein-coding gene	gene with protein product			"""vesicle amine transport protein 1 homolog (T. californica)-like"""			10997877	Standard	NM_020927		Approved	KIAA1576	uc002ffg.1	Q9HCJ6	OTTHUMG00000176845	ENST00000302536.2:c.30G>A	16.37:g.77822609G>A			Q8IYW8	Silent	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.E10	ENST00000302536.2	37	c.30	CCDS32492.1	16																																																																																			-	VAT1L	-	NULL		0.751	VAT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAT1L	HGNC	protein_coding	OTTHUMT00000434010.1	0	0	0	32	32	14	0.00	0.00	G	NM_020927		77822609	+1	21	1	18	8	tier1	no_errors	ENST00000302536	ensembl	human	known	74_37	silent	53.85	11.11	SNP	1.000	A	21	18
FAM182B	728882	genome.wustl.edu	37	20	25848664	25848664	+	5'UTR	SNP	T	T	A			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr20:25848664T>A	ENST00000478164.1	-	0	122				FAM182B_ENST00000376404.2_5'UTR			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						tggggtttcctcatcctggtc	0.672													ENSG00000175170																																					0																																										SO:0001623	5_prime_UTR_variant	0			-			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000478164.1:c.-870A>T	20.37:g.25848664T>A			Q4G0Q1	Splice_Site	SNP	-	NULL	ENST00000478164.1	37	c.NULL		20																																																																																			-	FAM182B	-	-		0.672	FAM182B-005	KNOWN	basic	processed_transcript	FAM182B	HGNC	protein_coding	OTTHUMT00000316665.1	0	0	0	62	62	0	0.00	0.00	T	NR_026714		25848664	-1	10	0	75	2	tier1	no_errors	ENST00000582267	ensembl	human	known	74_37	splice_site	11.76	0.00	SNP	0.024	A	10	75
FAM74A7	100996582	genome.wustl.edu	37	9	40716018	40716018	+	lincRNA	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:40716018G>T	ENST00000432614.1	-	0	0				FAM74A3_ENST00000604146.1_lincRNA																							AAGACGTGGAGAGAGTTCAGA	0.547													ENSG00000204844																																					0													28.0	30.0	30.0					9																	40716018		2201	4291	6492			0			-																													9.37:g.40716018G>T				R	SNP	-	NULL	ENST00000432614.1	37	NULL		9																																																																																			-	FAM74A3	-	-		0.547	RP11-395E19.5-001	KNOWN	basic	lincRNA	FAM74A3	HGNC	lincRNA	OTTHUMT00000143688.1	1	1	0	312	312	0	0.32	0.00	G			40716018	+1	48	0	344	0	tier1	no_errors	ENST00000355345	ensembl	human	known	74_37	rna	12.24	0.00	SNP	0.650	T	48	344
FGF9	2254	genome.wustl.edu	37	13	22275847	22275848	+	3'UTR	DEL	TA	TA	-	rs138451360|rs112896362|rs61706549|rs201279299|rs79021222|rs9796160|rs71093347|rs398037423	byFrequency	TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr13:22275847_22275848delTA	ENST00000382353.5	+	0	1430_1431				FGF9_ENST00000478546.1_3'UTR	NM_002010.2	NP_002001.1	P31371	FGF9_HUMAN	fibroblast growth factor 9						angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic digestive tract development (GO:0048566)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein import into nucleus (GO:0006606)|regulation of timing of cell differentiation (GO:0048505)|signal transduction (GO:0007165)|substantia nigra development (GO:0021762)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(2)	9		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		GGAgtgtgtgtatgtgtgtgtg	0.525													ENSG00000102678																									Melanoma(195;1939 2127 12623 13963 52730)												0																																										SO:0001624	3_prime_UTR_variant	0				D14838	CCDS9298.1	13q11-q12	2014-01-30	2013-06-18		ENSG00000102678	ENSG00000102678		"""Endogenous ligands"""	3687	protein-coding gene	gene with protein product	"""glia-activating factor"""	600921	"""fibroblast growth factor 9 (glia-activating factor)"""			8321227	Standard	NM_002010		Approved		uc001uog.2	P31371	OTTHUMG00000017412	ENST00000382353.5:c.*274TA>-	13.37:g.22275847_22275848delTA			A8K427|Q3SY32	R	DEL	-	NULL	ENST00000382353.5	37	NULL	CCDS9298.1	13																																																																																				FGF9	-	-		0.525	FGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF9	HGNC	protein_coding	OTTHUMT00000046002.2	0	0	0	13	13	0	0.00	0.00	TA			22275848	+1	5	0	12	0	tier1	no_errors	ENST00000478546	ensembl	human	known	74_37	rna	29.41	0.00	DEL	0.000:0.004	-	5	12
HSD17B7	51478	genome.wustl.edu	37	1	162782284	162782284	+	3'UTR	SNP	G	G	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr1:162782284G>C	ENST00000254521.3	+	0	1155				HSD17B7_ENST00000367917.3_3'UTR|HSD17B7_ENST00000485405.1_3'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7						cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					gagaaacatagtgagcccttg	0.498													ENSG00000132196																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.*74G>C	1.37:g.162782284G>C			Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	R	SNP	-	NULL	ENST00000254521.3	37	NULL	CCDS1242.1	1																																																																																			-	HSD17B7	-	-		0.498	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B7	HGNC	protein_coding	OTTHUMT00000083207.1	0	0	0	22	22	0	0.00	0.00	G	NM_016371		162782284	+1	6	0	18	0	tier1	no_errors	ENST00000485405	ensembl	human	known	74_37	rna	25.00	0.00	SNP	0.112	C	6	18
POTEG	404785	genome.wustl.edu	37	14	19563586	19563586	+	Intron	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr14:19563586T>C	ENST00000409832.3	+	5	1107				CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						AATTGAGGTTTAAAATAATTA	0.383													ENSG00000258252																																					0													25.0	40.0	36.0					14																	19563586		920	2229	3149	SO:0001627	intron_variant	0			-		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1055+45T>C	14.37:g.19563586T>C			A1L153|A6NMI9|Q6S5H6|Q6S8J2	R	SNP	-	NULL	ENST00000409832.3	37	NULL	CCDS32018.1	14																																																																																			-	CTD-2311B13.5	-	-		0.383	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929948	Clone_based_vega_gene	protein_coding	OTTHUMT00000408579.1	0	0	0	178	178	1	0.00	0.00	T	NM_001005356		19563586	-1	43	0	109	0	tier1	no_errors	ENST00000548748	ensembl	human	known	74_37	rna	28.29	0.00	SNP	0.018	C	43	109
PSG1	5669	genome.wustl.edu	37	19	43382272	43382272	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr19:43382272G>T	ENST00000436291.2	-	2	339	c.223C>A	c.(223-225)Ctc>Atc	p.L75I	PSG1_ENST00000595124.1_Missense_Mutation_p.L75I|PSG1_ENST00000403380.3_Missense_Mutation_p.L75I|PSG1_ENST00000595356.1_Missense_Mutation_p.L75I|PSG1_ENST00000312439.6_Missense_Mutation_p.L75I|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000244296.2_Missense_Mutation_p.L75I	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	75	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				TAATGGTAGAGGTCCCTCATT	0.438													ENSG00000231924																																					0													220.0	215.0	217.0					19																	43382272		2202	4299	6501	SO:0001583	missense	0			-		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.223C>A	19.37:g.43382272G>T	ENSP00000413041:p.Leu75Ile		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L75I	ENST00000436291.2	37	c.223	CCDS54275.1	19	.	.	.	.	.	.	.	.	.	.	N	0.032	-1.325286	0.01309	.	.	ENSG00000231924	ENST00000270059;ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	1.64	-3.28	0.05033	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65616	0.2708	M	0.67625	2.065	0.09310	N	1	B;B;P;B;B;B;B;D;B	0.71674	0.345;0.001;0.607;0.023;0.339;0.002;0.022;0.998;0.004	B;B;B;B;B;B;B;D;B	0.69654	0.122;0.005;0.146;0.075;0.134;0.008;0.021;0.965;0.012	T	0.54603	-0.8269	9	0.25106	T	0.35	.	0.3803	0.00394	0.3292:0.157:0.3002:0.2136	.	75;75;75;75;75;75;75;75;75	O75238;P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;Q9UPK8;O75237;P11464-2	.;.;.;PSG1_HUMAN;.;.;.;.;.	I	75	ENSP00000413041:L75I;ENSP00000385386:L75I;ENSP00000308970:L75I;ENSP00000244296:L75I	ENSP00000244296:L75I	L	-	1	0	PSG1	48074112	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-2.042000	0.01414	-2.602000	0.00450	0.184000	0.17185	CTC	-	PSG1	-	pfam_Ig_V-set,smart_Ig_sub		0.438	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	0	0	0	191	191	0	0.00	0.00	G			43382272	-1	38	0	125	0	tier1	no_errors	ENST00000312439	ensembl	human	known	74_37	missense	23.31	0.00	SNP	0.000	T	38	125
FAM57A	79850	genome.wustl.edu	37	17	636266	636267	+	Intron	INS	-	-	GGGCC	rs141977343|rs3830920	byFrequency	TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:636266_636267insGGGCC	ENST00000308278.8	+	2	358				FAM57A_ENST00000572018.1_Intron|FAM57A_ENST00000301324.8_Intron	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		GTCAGGCCGAAGGGCCGGGCCG	0.762													ENSG00000167695		2438	0.486821	0.3351	0.5173	5008	,	,		10677	0.6022		0.4692	False		,,,				2504	0.5695																0																																										SO:0001627	intron_variant	0				AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.123-71->GGGCC	17.37:g.636272_636276dupGGGCC			A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Frame_Shift_Ins	INS	NULL	p.P131fs	ENST00000308278.8	37	c.379_380	CCDS10996.1	17																																																																																				FAM57A	-	NULL		0.762	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57A	HGNC	protein_coding	OTTHUMT00000437155.2	0	0	0	0	0	0	0.00	0.00	-	NM_024792		636267	+1	2	2	1	1	tier1	no_errors	ENST00000574327	ensembl	human	known	74_37	frame_shift_ins	66.67	66.67	INS	0.000:0.000	GGGCC	2	1
NOTCH3	4854	genome.wustl.edu	37	19	15271749	15271749	+	Silent	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr19:15271749G>T	ENST00000263388.2	-	33	6765	c.6690C>A	c.(6688-6690)ccC>ccA	p.P2230P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	2230					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGGCCTTTGGGGGGCTGCTGT	0.706													ENSG00000074181																																					0													6.0	8.0	8.0					19																	15271749		2128	4188	6316	SO:0001819	synonymous_variant	0			-	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.6690C>A	19.37:g.15271749G>T			Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P2230	ENST00000263388.2	37	c.6690	CCDS12326.1	19																																																																																			-	NOTCH3	-	pirsf_Notch,pfam_DUF3454_notch		0.706	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	0	0	0	23	23	3	0.00	0.00	G	NM_000435		15271749	-1	5	2	16	1	tier1	no_errors	ENST00000263388	ensembl	human	known	74_37	silent	23.81	66.67	SNP	0.678	T	5	16
TRPV3	162514	genome.wustl.edu	37	17	3447913	3447913	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr17:3447913C>T	ENST00000576742.1	-	4	592	c.271G>A	c.(271-273)Gat>Aat	p.D91N	TRPV3_ENST00000301365.4_Missense_Mutation_p.D91N|TRPV3_ENST00000572519.1_Missense_Mutation_p.D91N	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	91					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GTCACATCATCCTGAGGAGAC	0.577													ENSG00000167723																																					0													40.0	39.0	40.0					17																	3447913		2203	4300	6503	SO:0001583	missense	0			-	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.271G>A	17.37:g.3447913C>T	ENSP00000461518:p.Asp91Asn		Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel	p.D91N	ENST00000576742.1	37	c.271	CCDS11029.1	17	.	.	.	.	.	.	.	.	.	.	c	18.40	3.615008	0.66672	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	T	0.41400	1.0	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000006	T	0.55752	0.1940	L	0.44542	1.39	0.30511	N	0.769384	D;D;D;D;P;B	0.67145	0.996;0.993;0.993;0.996;0.474;0.419	D;D;D;D;B;B	0.79784	0.993;0.984;0.984;0.993;0.357;0.244	T	0.53208	-0.8471	10	0.30854	T	0.27	-8.2605	16.2359	0.82375	0.0:1.0:0.0:0.0	.	75;75;75;91;91;91	E7EV24;B7ZKP9;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;TRPV3_HUMAN;.	N	91;91;75	ENSP00000301365:D91N	ENSP00000301365:D91N	D	-	1	0	TRPV3	3394663	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.265000	0.58865	2.591000	0.87537	0.550000	0.68814	GAT	-	TRPV3	-	NULL		0.577	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPV3	HGNC	protein_coding	OTTHUMT00000207379.2	0	0	0	60	60	28	0.00	0.00	C	NM_145068		3447913	-1	14	2	70	21	tier1	no_errors	ENST00000301365	ensembl	human	known	74_37	missense	16.47	8.70	SNP	1.000	T	14	70
SDR9C7	121214	genome.wustl.edu	37	12	57317653	57317653	+	Silent	SNP	T	T	C			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr12:57317653T>C	ENST00000293502.1	-	4	1049	c.906A>G	c.(904-906)ctA>ctG	p.L302L		NM_148897.2	NP_683695.1	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C, member 7	302					oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	retinol dehydrogenase activity (GO:0004745)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)	7						GGTACCGGCTTAGGATGAAAT	0.582													ENSG00000170426																																					0													118.0	100.0	106.0					12																	57317653		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY044434	CCDS8926.1	12q13.3	2014-09-04			ENSG00000170426	ENSG00000170426	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29958	protein-coding gene	gene with protein product		609769				12234675, 19027726	Standard	NM_148897		Approved	SDR-O, RDHS	uc010sqw.2	Q8NEX9	OTTHUMG00000171004	ENST00000293502.1:c.906A>G	12.37:g.57317653T>C			B3KVB4	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.L302	ENST00000293502.1	37	c.906	CCDS8926.1	12																																																																																			-	SDR9C7	-	NULL		0.582	SDR9C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDR9C7	HGNC	protein_coding	OTTHUMT00000411211.1	0	0	0	54	54	105	0.00	0.00	T	NM_148897		57317653	-1	5	3	50	79	tier1	no_errors	ENST00000293502	ensembl	human	known	74_37	silent	9.09	3.66	SNP	0.010	C	5	50
KIAA1549	57670	genome.wustl.edu	37	7	138566134	138566134	+	Splice_Site	SNP	C	C	G			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:138566134C>G	ENST00000422774.1	-	11	4277	c.4229G>C	c.(4228-4230)aGa>aCa	p.R1410T	KIAA1549_ENST00000440172.1_Splice_Site_p.R1410T|KIAA1549_ENST00000242365.4_Splice_Site_p.R1360T			Q9HCM3	K1549_HUMAN	KIAA1549	1410						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CAATAATAACCTTCCTCTGTG	0.507			O	BRAF	pilocytic astrocytoma								ENSG00000122778																									NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													113.0	116.0	115.0					7																	138566134		1977	4157	6134	SO:0001630	splice_region_variant	0			-		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.4229+1G>C	7.37:g.138566134C>G			B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NULL	p.R1410T	ENST00000422774.1	37	c.4229	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125151	0.77436	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.27557	1.66;1.67;1.68	5.23	5.23	0.72850	.	0.095039	0.64402	D	0.000001	T	0.49830	0.1580	M	0.64997	1.995	0.58432	D	0.999998	D;P;D;P	0.76494	0.999;0.573;0.999;0.573	P;B;P;B	0.60012	0.867;0.23;0.791;0.23	T	0.40059	-0.9583	9	.	.	.	.	17.5362	0.87832	0.0:1.0:0.0:0.0	.	1410;194;1410;194	Q9HCM3;Q9HCM3-4;Q9HCM3-2;Q9HCM3-3	K1549_HUMAN;.;.;.	T	1410;1360;1410	ENSP00000406661:R1410T;ENSP00000242365:R1360T;ENSP00000416040:R1410T	.	R	-	2	0	KIAA1549	138216674	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	4.840000	0.62817	2.716000	0.92895	0.655000	0.94253	AGA	-	KIAA1549	-	NULL		0.507	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	0	0	0	56	56	85	0.00	0.00	C		Missense_Mutation	138566134	-1	8	3	60	61	tier1	no_errors	ENST00000422774	ensembl	human	known	74_37	missense	11.76	4.69	SNP	1.000	G	8	60
ZNF491	126069	genome.wustl.edu	37	19	11916909	11916909	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr19:11916909G>T	ENST00000323169.5	+	3	472	c.141G>T	c.(139-141)atG>atT	p.M47I	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	47					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						AAATCTTCATGGGATATTCAT	0.388													ENSG00000177599																																					0													71.0	76.0	74.0					19																	11916909		2203	4300	6503	SO:0001583	missense	0			-	AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.141G>T	19.37:g.11916909G>T	ENSP00000313443:p.Met47Ile		Q3MJ35|Q8NAT8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M47I	ENST00000323169.5	37	c.141	CCDS12267.1	19	.	.	.	.	.	.	.	.	.	.	g	1.098	-0.661938	0.03454	.	.	ENSG00000177599	ENST00000323169;ENST00000455048;ENST00000450087	T;T	0.14266	2.52;2.52	1.01	-2.02	0.07388	Zinc finger, C2H2 (1);	.	.	.	.	T	0.03783	0.0107	N	0.02391	-0.57	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40813	-0.9543	9	0.21014	T	0.42	.	2.0579	0.03585	0.398:0.0:0.3183:0.2837	.	47	Q8N8L2	ZN491_HUMAN	I	47	ENSP00000313443:M47I;ENSP00000392176:M47I	ENSP00000313443:M47I	M	+	3	0	ZNF491	11777909	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.916000	0.01576	-0.729000	0.04875	-0.555000	0.04198	ATG	-	ZNF491	-	pfscan_Znf_C2H2		0.388	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF491	HGNC	protein_coding	OTTHUMT00000344518.1	0	0	0	27	27	79	0.00	0.00	G	NM_152356		11916909	+1	3	2	15	65	tier1	no_errors	ENST00000323169	ensembl	human	known	74_37	missense	16.67	2.99	SNP	0.001	T	3	15
PALM2	114299	genome.wustl.edu	37	9	112694185	112694206	+	Intron	DEL	ATTCCCTGTTCTCTGCTACCAG	ATTCCCTGTTCTCTGCTACCAG	-	rs547916509	byFrequency	TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	ATTCCCTGTTCTCTGCTACCAG	ATTCCCTGTTCTCTGCTACCAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr9:112694185_112694206delATTCCCTGTTCTCTGCTACCAG	ENST00000374531.2	+	6	474				PALM2-AKAP2_ENST00000374530.3_Splice_Site|PALM2_ENST00000314527.4_Splice_Site|AKAP2_ENST00000555236.1_Splice_Site|PALM2_ENST00000448454.2_Splice_Site|PALM2-AKAP2_ENST00000302798.7_Splice_Site|PALM2_ENST00000483909.1_Intron|AKAP2_ENST00000510514.5_Splice_Site	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2						regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						GACTAATTGTATTCCCTGTTCTCTGCTACCAGATGCAGTAAA	0.554													ENSG00000157654																																					0																																										SO:0001627	intron_variant	0				AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.400+6823ATTCCCTGTTCTCTGCTACCAG>-	9.37:g.112694185_112694206delATTCCCTGTTCTCTGCTACCAG			A9Z1X9|Q8N9D5|Q96DU1	Splice_Site	DEL	-	e6-1	ENST00000374531.2	37	c.395-22_395-1	CCDS35099.1	9																																																																																				PALM2-AKAP2	-	-		0.554	PALM2-002	KNOWN	basic|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000053604.1	0	0	0	89	89	89	0.00	0.00	ATTCCCTGTTCTCTGCTACCAG	NM_001037293		112694206	+1	3	3	69	69	tier1	no_errors	ENST00000374530	ensembl	human	known	74_37	splice_site_del	4.17	4.17	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	3	69
KIAA1549	57670	genome.wustl.edu	37	7	138566128	138566133	+	Splice_Site	DEL	AATAAC	AATAAC	-			TCGA-DX-AB2W-01A-11D-A38Z-09	TCGA-DX-AB2W-10A-01D-A38Z-09	AATAAC	AATAAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9e7a22ef-8718-40eb-a310-51aa9a7cac0f	c2643ccc-1642-43f0-932f-2ec47a0d943b	g.chr7:138566128_138566133delAATAAC	ENST00000422774.1	-	11	4278		c.e11+1		KIAA1549_ENST00000440172.1_Splice_Site|KIAA1549_ENST00000242365.4_Splice_Site			Q9HCM3	K1549_HUMAN	KIAA1549							integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						AAAGCCCAATAATAACCTTCCTCTGT	0.505			O	BRAF	pilocytic astrocytoma								ENSG00000122778																									NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0																																										SO:0001630	splice_region_variant	0					CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.4229+1GTTATT>-	7.37:g.138566128_138566133delAATAAC			B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Splice_Site	DEL	-	e11+1	ENST00000422774.1	37	c.4229+1_4229+1	CCDS56513.1	7																																																																																				KIAA1549	-	-		0.505	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	0	0	0	87	87	87	0.00	0.00	AATAAC		Intron	138566133	-1	3	3	62	62	tier1	no_errors	ENST00000422774	ensembl	human	known	74_37	splice_site_del	4.62	4.62	DEL	0.001:0.001:0.002:0.036:0.994:1.000	-	3	62
