#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ZFHX4	79776	genome.wustl.edu	37	8	77767256	77767256	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr8:77767256A>G	ENST00000521891.2	+	10	8547	c.8099A>G	c.(8098-8100)aAt>aGt	p.N2700S	ZFHX4_ENST00000518282.1_Missense_Mutation_p.N2674S|ZFHX4_ENST00000050961.6_Missense_Mutation_p.N2655S|ZFHX4_ENST00000455469.2_Missense_Mutation_p.N2655S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2655					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CGGCACTGGAATGAAGGAAAG	0.502										HNSCC(33;0.089)			ENSG00000091656																																					0													60.0	59.0	59.0					8																	77767256		1948	4145	6093	SO:0001583	missense	0			-		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8099A>G	8.37:g.77767256A>G	ENSP00000430497:p.Asn2700Ser		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.N2700S	ENST00000521891.2	37	c.8099	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	A	9.341	1.063002	0.19987	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.49720	0.77;0.82;0.79;0.78	5.18	4.04	0.47022	Zinc finger, C2H2 (1);	0.000000	0.47455	U	0.000235	T	0.46249	0.1383	L	0.40543	1.245	0.41414	D	0.987758	B;B;P	0.50528	0.124;0.196;0.936	B;B;P	0.50896	0.127;0.25;0.653	T	0.32455	-0.9906	10	0.33141	T	0.24	.	10.7116	0.45986	0.9256:0.0:0.0744:0.0	.	2655;2655;2700	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	S	2700;2684;2655;2655;2674	ENSP00000430497:N2700S;ENSP00000399605:N2655S;ENSP00000050961:N2655S;ENSP00000430848:N2674S	ENSP00000050961:N2655S	N	+	2	0	ZFHX4	77929811	1.000000	0.71417	0.986000	0.45419	0.084000	0.17831	6.144000	0.71762	1.004000	0.39156	0.454000	0.30748	AAT	-	ZFHX4	-	pfscan_Znf_C2H2		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	0	0	1	52	52	105	0.00	0.94	A	NM_024721		77767256	+1	34	48	76	135	tier1	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	30.91	26.09	SNP	1.000	G	34	76
CPAMD8	27151	genome.wustl.edu	37	19	17036138	17036138	+	Missense_Mutation	SNP	G	G	A	rs370777148		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr19:17036138G>A	ENST00000443236.1	-	26	3587	c.3556C>T	c.(3556-3558)Cgg>Tgg	p.R1186W		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1139						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						AACGGCAGCCGCAGGAGGTTG	0.547													ENSG00000160111	G|||	1	0.000199681	0.0008	0.0	5008	,	,		22264	0.0		0.0	False		,,,				2504	0.0																0													79.0	84.0	83.0					19																	17036138		1974	4150	6124	SO:0001583	missense	0			-	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3556C>T	19.37:g.17036138G>A	ENSP00000402505:p.Arg1186Trp		Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.R1186W	ENST00000443236.1	37	c.3556	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700522	0.48307	.	.	ENSG00000160111	ENST00000291440	.	.	.	2.84	2.84	0.33178	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);Alpha-2-macroglobulin, thiol-ester bond-forming (1);	0.085770	0.46758	U	0.000278	T	0.78572	0.4304	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80966	-0.1146	9	0.87932	D	0	.	10.6397	0.45586	0.0:0.0:0.8079:0.192	.	1139	Q8IZJ3	CPMD8_HUMAN	W	1186	.	ENSP00000291440:R1186W	R	-	1	2	CPAMD8	16897138	0.998000	0.40836	0.989000	0.46669	0.814000	0.46013	0.713000	0.25794	1.121000	0.41925	0.561000	0.74099	CGG	-	CPAMD8	-	pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase		0.547	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	0	0	0	78	78	126	0.00	0.00	G	NM_015692		17036138	-1	25	99	17	22	tier1	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	59.52	81.82	SNP	0.983	A	25	17
TTF1	7270	genome.wustl.edu	37	9	135267466	135267466	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr9:135267466T>G	ENST00000334270.2	-	6	2023	c.1984A>C	c.(1984-1986)Agt>Cgt	p.S662R		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	662	Myb-like 2. {ECO:0000255|PROSITE- ProRule:PRU00133}.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CACTTACGACTGCTGATCTGT	0.542													ENSG00000125482																																					0													71.0	65.0	67.0					9																	135267466		2203	4300	6503	SO:0001583	missense	0			-	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1984A>C	9.37:g.135267466T>G	ENSP00000333920:p.Ser662Arg		A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S662R	ENST00000334270.2	37	c.1984	CCDS6948.1	9	.	.	.	.	.	.	.	.	.	.	T	11.25	1.583621	0.28268	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.41065	1.01	5.77	-0.952	0.10366	SANT domain, DNA binding (1);Homeodomain-like (1);MYB-like (1);	0.880477	0.09861	N	0.746193	T	0.42585	0.1209	L	0.43152	1.355	0.09310	N	1	D	0.64830	0.994	P	0.60789	0.879	T	0.31779	-0.9931	10	0.19590	T	0.45	.	3.0135	0.06052	0.2902:0.2517:0.0:0.458	.	662	Q15361	TTF1_HUMAN	R	662	ENSP00000333920:S662R	ENSP00000245588:S662R	S	-	1	0	TTF1	134257287	0.045000	0.20229	0.000000	0.03702	0.143000	0.21401	0.589000	0.23939	-0.419000	0.07439	-0.290000	0.09829	AGT	-	TTF1	-	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom		0.542	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	HGNC	protein_coding	OTTHUMT00000054784.2	0	0	0	52	52	60	0.00	0.00	T	NM_007344		135267466	-1	16	23	30	45	tier1	no_errors	ENST00000334270	ensembl	human	known	74_37	missense	34.78	33.82	SNP	0.000	G	16	30
SMURF1	57154	genome.wustl.edu	37	7	98633223	98633223	+	Silent	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr7:98633223C>A	ENST00000361125.1	-	17	2323	c.2004G>T	c.(2002-2004)acG>acT	p.T668T	AC004893.11_ENST00000468960.2_RNA|AC004893.11_ENST00000360902.1_RNA|SMURF1_ENST00000361368.2_Silent_p.T642T	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	668	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CTTCATCGAACGTCTCCACCG	0.567													ENSG00000198742																																					0													126.0	111.0	116.0					7																	98633223		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.2004G>T	7.37:g.98633223C>A			A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Silent	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.T668	ENST00000361125.1	37	c.2004	CCDS34690.1	7																																																																																			-	SMURF1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.567	SMURF1-001	KNOWN	basic|CCDS	protein_coding	SMURF1	HGNC	protein_coding	OTTHUMT00000335001.2	0	0	0	56	56	63	0.00	0.00	C	NM_020429		98633223	-1	28	64	10	27	tier1	no_errors	ENST00000361125	ensembl	human	known	74_37	silent	73.68	68.82	SNP	0.954	A	28	10
MGEA5	10724	genome.wustl.edu	37	10	103558659	103558659	+	Silent	SNP	T	T	C	rs369547430		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr10:103558659T>C	ENST00000361464.3	-	9	2144	c.1749A>G	c.(1747-1749)caA>caG	p.Q583Q	MGEA5_ENST00000357797.5_Silent_p.Q530Q|MGEA5_ENST00000439817.1_Silent_p.Q530Q|MGEA5_ENST00000370094.3_Silent_p.Q583Q|MGEA5_ENST00000482611.1_5'UTR	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	583					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		CTCGAAGCCATTGAAATTCCC	0.453													ENSG00000198408																																					0								T	,	0,4406		0,0,2203	144.0	139.0	140.0		1590,1749	4.0	1.0	10		140	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	MGEA5	NM_001142434.1,NM_012215.3	,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,	530/864,583/917	103558659	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.1749A>G	10.37:g.103558659T>C			B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Silent	SNP	pfam_Beta-N-acetylglucosaminidase,superfamily_Glycoside_hydrolase_SF,superfamily_Acyl_CoA_acyltransferase	p.Q583	ENST00000361464.3	37	c.1749	CCDS7520.1	10																																																																																			-	MGEA5	-	NULL		0.453	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MGEA5	HGNC	protein_coding	OTTHUMT00000049987.1	0	0	0	49	49	111	0.00	0.00	T	NM_012215		103558659	-1	42	69	35	61	tier1	no_errors	ENST00000361464	ensembl	human	known	74_37	silent	54.55	53.08	SNP	1.000	C	42	35
SHOX	6473	genome.wustl.edu	37	X	601772	601772	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:601772C>T	ENST00000554971.1	+	4	674	c.583C>T	c.(583-585)Cga>Tga	p.R195*	SHOX_ENST00000381578.1_Nonsense_Mutation_p.R195*|SHOX_ENST00000381575.1_Nonsense_Mutation_p.R195*|SHOX_ENST00000334060.3_Nonsense_Mutation_p.R195*			O15266	SHOX_HUMAN	short stature homeobox	195					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGACGCCTGCCGAGTGGCACC	0.582													ENSG00000185960																									Ovarian(95;18 1419 12424 14056 28266)												0			GRCh37	CM971378	SHOX	M	rs137852552						243.0	209.0	221.0					X																	601772		2203	4296	6499	SO:0001587	stop_gained	0			-	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.583C>T	X.37:g.601772C>T	ENSP00000452016:p.Arg195*		O00412|O00413|O15267	Nonsense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.R195*	ENST00000554971.1	37	c.583	CCDS14107.1	X	.	.	.	.	.	.	.	.	.	.	C	9.544	1.114132	0.20795	.	.	ENSG00000185960	ENST00000334060;ENST00000381578;ENST00000554971;ENST00000381575	.	.	.	1.53	0.12	0.14691	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	7.4216	0.27075	0.5683:0.4316:0.0:0.0	.	.	.	.	X	195	.	ENSP00000335505:R195X	R	+	1	2	SHOX	521772	0.998000	0.40836	0.904000	0.35570	0.204000	0.24138	0.501000	0.22578	-0.146000	0.11274	0.115000	0.15696	CGA	-	SHOX	-	NULL		0.582	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SHOX	HGNC	protein_coding	OTTHUMT00000411999.3	0	0	0	146	146	88	0.00	0.00	C	NM_000451		601772	+1	34	15	60	61	tier1	no_errors	ENST00000381578	ensembl	human	known	74_37	nonsense	36.17	19.74	SNP	1.000	T	34	60
RXRA	6256	genome.wustl.edu	37	9	137330534	137330534	+	IGR	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr9:137330534G>C	ENST00000481739.1	+	0	1846				RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha						camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GAGTGCAAAAGACCCAACGCC	0.672													ENSG00000186350																																					0																																										SO:0001628	intergenic_variant	0			-	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887		9.37:g.137330534G>C			B3KY83|Q2NL52|Q2V504	R	SNP	-	NULL	ENST00000481739.1	37	NULL	CCDS35172.1	9																																																																																			-	RXRA	-	-		0.672	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRA	HGNC	protein_coding	OTTHUMT00000054949.1	0	0	0	208	208	95	0.00	0.00	G	NM_002957		137330534	+1	85	32	68	39	tier1	no_errors	ENST00000356384	ensembl	human	known	74_37	rna	55.19	45.07	SNP	0.000	C	85	68
ATRX	546	genome.wustl.edu	37	X	76849184	76849184	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:76849184T>A	ENST00000373344.5	-	26	6306	c.6092A>T	c.(6091-6093)gAg>gTg	p.E2031V	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.E1993V	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2031	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CCCAATTTCCTCTGCCATTCG	0.323			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											64.0	62.0	63.0					X																	76849184		2203	4296	6499	SO:0001583	missense	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6092A>T	X.37:g.76849184T>A	ENSP00000362441:p.Glu2031Val		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E2031V	ENST00000373344.5	37	c.6092	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024852	0.54683	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.91945	-2.94;-2.94	5.27	5.27	0.74061	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92993	0.7770	L	0.31420	0.93	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	D	0.93007	0.6428	10	0.44086	T	0.13	-12.1774	14.321	0.66487	0.0:0.0:0.0:1.0	.	1993;2031	P46100-4;P46100	.;ATRX_HUMAN	V	2031;1993	ENSP00000362441:E2031V;ENSP00000378967:E1993V	ENSP00000362441:E2031V	E	-	2	0	ATRX	76735840	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.646000	0.83445	1.761000	0.52028	0.430000	0.28490	GAG	-	ATRX	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.323	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	91	91	86	0.00	0.00	T	NM_000489		76849184	-1	51	27	79	29	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	39.23	48.21	SNP	1.000	A	51	79
LY6G6F	259215	genome.wustl.edu	37	6	31675750	31675750	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr6:31675750G>C	ENST00000375832.4	+	3	507	c.485G>C	c.(484-486)gGg>gCg	p.G162A	MEGT1_ENST00000503322.1_Missense_Mutation_p.G162A|LY6G6F_ENST00000556581.1_Missense_Mutation_p.G162A|XXbac-BPG32J3.20_ENST00000461287.1_Intron	NM_001003693.1	NP_001003693.1	Q5SQ64	LY66F_HUMAN	lymphocyte antigen 6 complex, locus G6F	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	12						TGGCAGGAAGGGAAGGGTCCC	0.627													ENSG00000204424																																					0													93.0	91.0	92.0					6																	31675750		1511	2709	4220	SO:0001583	missense	0			-		CCDS34403.1	6p21	2013-01-11	2008-05-21	2008-05-21		ENSG00000204424		"""Immunoglobulin superfamily / V-set domain containing"""	13933	protein-coding gene	gene with protein product		611404	"""chromosome 6 open reading frame 21"""	LY6G6D, C6orf21		12852788	Standard	NM_001003693		Approved	G6f, NG32	uc003nwa.1	Q5SQ64	OTTHUMG00000031252	ENST00000375832.4:c.485G>C	6.37:g.31675750G>C	ENSP00000364992:p.Gly162Ala		B0UXB7|O95869|Q7Z5H2|Q96QC7|Q9NZJ1	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.G162A	ENST00000375832.4	37	c.485	CCDS34403.1	6	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533105	0.45073	.	.	ENSG00000204424;ENSG00000204424;ENSG00000250641	ENST00000556581;ENST00000375832;ENST00000503322	T;T;T	0.38077	1.51;1.16;1.51	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000006	T	0.49558	0.1564	M	0.66939	2.045	0.31948	N	0.610082	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.53627	-0.8412	10	0.87932	D	0	-19.8165	14.8659	0.70416	0.0:0.0:1.0:0.0	.	162;162	Q9NZJ1;Q5SQ64	.;LY66F_HUMAN	A	162	ENSP00000452432:G162A;ENSP00000364992:G162A;ENSP00000421232:G162A	ENSP00000364992:G162A	G	+	2	0	XXbac-BPG32J3.19;LY6G6F	31783729	0.997000	0.39634	0.979000	0.43373	0.446000	0.32137	1.941000	0.40233	2.596000	0.87737	0.591000	0.81541	GGG	-	LY6G6F	-	NULL		0.627	LY6G6F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY6G6F	HGNC	protein_coding	OTTHUMT00000076532.2	0	0	0	55	55	52	0.00	0.00	G	NM_001003693		31675750	+1	18	14	26	18	tier1	no_errors	ENST00000556581	ensembl	human	known	74_37	missense	40.91	43.75	SNP	0.991	C	18	26
OR51Q1	390061	genome.wustl.edu	37	11	5444355	5444355	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr11:5444355C>T	ENST00000300778.4	+	1	1015	c.925C>T	c.(925-927)Ctt>Ttt	p.L309F	HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTTAAATTTCCTTTCCCTCAA	0.398													ENSG00000167360																																					0													42.0	42.0	42.0					11																	5444355		2201	4297	6498	SO:0001583	missense	0			-	AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.925C>T	11.37:g.5444355C>T	ENSP00000300778:p.Leu309Phe		B2RNN1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L309F	ENST00000300778.4	37	c.925	CCDS31381.1	11	.	.	.	.	.	.	.	.	.	.	C	4.565	0.105037	0.08731	.	.	ENSG00000167360	ENST00000300778	T	0.42131	0.98	5.0	-3.19	0.05171	.	0.460979	0.18208	N	0.148299	T	0.14917	0.0360	N	0.13043	0.29	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.30592	-0.9973	10	0.02654	T	1	.	4.3765	0.11272	0.2446:0.3496:0.0:0.4058	.	309	Q8NH59	O51Q1_HUMAN	F	309	ENSP00000300778:L309F	ENSP00000300778:L309F	L	+	1	0	OR51Q1	5400931	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-2.147000	0.01293	-0.424000	0.07382	0.380000	0.24917	CTT	-	OR51Q1	-	NULL		0.398	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51Q1	HGNC	protein_coding	OTTHUMT00000143373.1	0	0	0	23	23	72	0.00	0.00	C	NM_001004757		5444355	+1	5	14	10	27	tier1	no_errors	ENST00000300778	ensembl	human	known	74_37	missense	33.33	34.15	SNP	0.000	T	5	10
TRO	7216	genome.wustl.edu	37	X	54950979	54950979	+	Silent	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:54950979A>G	ENST00000173898.7	+	4	1444	c.1332A>G	c.(1330-1332)ttA>ttG	p.L444L	TRO_ENST00000375022.4_Silent_p.L444L|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000375041.2_Silent_p.L47L|TRO_ENST00000399736.1_Silent_p.L47L|TRO_ENST00000484031.1_3'UTR|TRO_ENST00000420798.2_5'UTR|TRO_ENST00000319167.8_Silent_p.L444L	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	444	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						TGGCCATTTTACAAGAAAGGG	0.502													ENSG00000067445																																					0													51.0	49.0	49.0					X																	54950979		2018	4171	6189	SO:0001819	synonymous_variant	0			-	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1332A>G	X.37:g.54950979A>G			B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L444	ENST00000173898.7	37	c.1332	CCDS43959.1	X																																																																																			-	TRO	-	pfscan_MAGE		0.502	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	HGNC	protein_coding	OTTHUMT00000056837.3	0	0	0	62	62	94	0.00	0.00	A	NM_016157		54950979	+1	23	81	24	42	tier1	no_errors	ENST00000173898	ensembl	human	known	74_37	silent	48.94	65.85	SNP	0.993	G	23	24
ZMYM3	9203	genome.wustl.edu	37	X	70469941	70469941	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:70469941G>A	ENST00000353904.2	-	6	1373	c.1186C>T	c.(1186-1188)Ccg>Tcg	p.P396S	ZMYM3_ENST00000373978.1_Silent_p.A299A|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373984.3_Missense_Mutation_p.P398S|ZMYM3_ENST00000373982.1_Missense_Mutation_p.P398S|ZMYM3_ENST00000373988.1_Missense_Mutation_p.P398S|ZMYM3_ENST00000373981.1_Missense_Mutation_p.P396S|ZMYM3_ENST00000373998.1_Missense_Mutation_p.P396S|ZMYM3_ENST00000314425.5_Missense_Mutation_p.P396S	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	396					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TGGGGGATCGGGCGCTGCTGC	0.607													ENSG00000147130																																					0													50.0	44.0	46.0					X																	70469941		2203	4300	6503	SO:0001583	missense	0			-	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.1186C>T	X.37:g.70469941G>A	ENSP00000343909:p.Pro396Ser		D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.P398S	ENST00000353904.2	37	c.1192	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	g	10.40	1.339509	0.24339	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981	T;T;T;T;T;T;T	0.49139	1.5;0.93;1.5;1.5;1.5;0.79;0.79	3.4	3.4	0.38934	.	0.486738	0.18768	N	0.131690	T	0.32436	0.0829	L	0.35341	1.055	0.33649	D	0.608262	B;B;B;B	0.33212	0.402;0.402;0.004;0.002	B;B;B;B	0.33196	0.159;0.159;0.006;0.002	T	0.41645	-0.9497	10	0.30078	T	0.28	-6.4602	6.8954	0.24253	0.218:0.0:0.782:0.0	.	398;396;396;396	A6NL54;Q96E26;Q14202-2;Q14202	.;.;.;ZMYM3_HUMAN	S	396;396;396;398;398;398;396	ENSP00000322845:P396S;ENSP00000363110:P396S;ENSP00000343909:P396S;ENSP00000363096:P398S;ENSP00000363100:P398S;ENSP00000363094:P398S;ENSP00000363093:P396S	ENSP00000322845:P396S	P	-	1	0	ZMYM3	70386666	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	4.016000	0.57159	1.957000	0.56846	0.468000	0.43344	CCG	-	ZMYM3	-	NULL		0.607	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	0	0	0	73	73	32	0.00	0.00	G	NM_201599		70469941	-1	8	8	10	18	tier1	no_errors	ENST00000373988	ensembl	human	known	74_37	missense	44.44	30.77	SNP	0.996	A	8	10
PRAMEF20	645425	genome.wustl.edu	37	1	13743010	13743010	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:13743010G>C	ENST00000602960.1	+	1	203	c.199G>C	c.(199-201)Ggg>Cgg	p.G67R	PRAMEF20_ENST00000316412.5_Missense_Mutation_p.G67R			Q5VT98	PRA20_HUMAN	PRAME family member 20	67					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)	4	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.5e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000156)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCTTCCTCTGGGGTCTCTGAT	0.582													ENSG00000204478																																					0													25.0	27.0	27.0					1																	13743010		2185	4253	6438	SO:0001583	missense	0			-		CCDS41265.1	1p36.21	2014-07-15			ENSG00000204478	ENSG00000204478		"""-"""	25224	protein-coding gene	gene with protein product			"""PRAME family member 21"""	PRAMEF21			Standard	NM_001099852		Approved	OTTHUMG00000007911, OTTHUMT00000008157	uc009vnv.1	Q5VT98	OTTHUMG00000007911	ENST00000602960.1:c.199G>C	1.37:g.13743010G>C	ENSP00000473584:p.Gly67Arg			Missense_Mutation	SNP	NULL	p.G67R	ENST00000602960.1	37	c.199	CCDS41265.1	1	.	.	.	.	.	.	.	.	.	.	.	6.431	0.447635	0.12223	.	.	ENSG00000204478	ENST00000316412	T	0.04970	3.52	1.51	0.573	0.17363	.	0.000000	0.85682	D	0.000000	T	0.09818	0.0241	M	0.67625	2.065	0.09310	N	1	.	.	.	.	.	.	T	0.10590	-1.0623	8	0.52906	T	0.07	.	4.0884	0.09958	0.226:0.0:0.774:0.0	.	.	.	.	R	67	ENSP00000346275:G67R	ENSP00000346275:G67R	G	+	1	0	PRAMEF20	13615597	0.128000	0.22383	0.015000	0.15790	0.008000	0.06430	1.147000	0.31602	0.232000	0.21100	-0.667000	0.03836	GGG	-	PRAMEF20	-	NULL		0.582	PRAMEF20-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	PRAMEF20	HGNC	protein_coding	OTTHUMT00000021782.1	0	0	0	157	157	26	0.00	0.00	G	NM_001099852		13743010	+1	28	8	86	36	tier1	no_errors	ENST00000316412	ensembl	human	known	74_37	missense	24.56	18.18	SNP	0.015	C	28	86
ZNF833P	401898	genome.wustl.edu	37	19	11797000	11797000	+	lincRNA	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr19:11797000G>C	ENST00000344893.3	+	0	2999					NR_028594.1		Q6ZTB9	ZN833_HUMAN	zinc finger protein 833, pseudogene								metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5						TGTAAAGAATGTGGTAAAACC	0.333													ENSG00000197332																																					0																																												0			-	BC137336		19p13.2	2010-08-03	2010-08-03	2010-08-03	ENSG00000197332	ENSG00000197332			33819	pseudogene	pseudogene			"""zinc finger protein 833"""	ZNF833			Standard	NR_028594		Approved		uc021upi.1	Q6ZTB9	OTTHUMG00000156530		19.37:g.11797000G>C			B2RPA0	R	SNP	-	NULL	ENST00000344893.3	37	NULL		19																																																																																			-	ZNF833P	-	-		0.333	ZNF833P-001	KNOWN	basic|readthrough_transcript	lincRNA	ZNF833P	HGNC	lincRNA	OTTHUMT00000458891.1	0	0	0	64	64	110	0.00	0.00	G	NM_001013691		11797000	+1	67	71	19	14	tier1	no_errors	ENST00000344893	ensembl	human	known	74_37	rna	77.91	82.56	SNP	0.095	C	67	19
PASK	23178	genome.wustl.edu	37	2	242054559	242054559	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr2:242054559G>A	ENST00000405260.1	-	14	3930	c.3232C>T	c.(3232-3234)Cag>Tag	p.Q1078*	PASK_ENST00000358649.4_Nonsense_Mutation_p.Q1078*|PASK_ENST00000403638.3_Nonsense_Mutation_p.Q1078*|PASK_ENST00000475666.1_5'Flank|PASK_ENST00000544142.1_Nonsense_Mutation_p.Q892*|PASK_ENST00000234040.4_Nonsense_Mutation_p.Q1078*|PASK_ENST00000539818.1_Nonsense_Mutation_p.Q862*	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1078	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		ATCACAAGCTGGAAGAACCCT	0.488													ENSG00000115687																																					0													64.0	70.0	68.0					2																	242054559		2203	4300	6503	SO:0001587	stop_gained	0			-	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3232C>T	2.37:g.242054559G>A	ENSP00000384016:p.Gln1078*		G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,superfamily_PAS,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_dom,tigrfam_PAS	p.Q1078*	ENST00000405260.1	37	c.3232	CCDS2545.1	2	.	.	.	.	.	.	.	.	.	.	G	48	14.148800	0.99782	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	.	.	.	5.63	5.63	0.86233	.	0.000000	0.51477	D	0.000085	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.6668	0.95895	0.0:0.0:1.0:0.0	.	.	.	.	X	1078;892;1078;1078;862;1078	.	ENSP00000234040:Q1078X	Q	-	1	0	PASK	241703232	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.285000	0.95894	2.650000	0.89964	0.655000	0.94253	CAG	-	PASK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.488	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	0	0	0	24	24	91	0.00	0.00	G	NM_015148		242054559	-1	5	21	9	62	tier1	no_errors	ENST00000358649	ensembl	human	known	74_37	nonsense	35.71	25.30	SNP	1.000	A	5	9
GAB3	139716	genome.wustl.edu	37	X	153906237	153906237	+	3'UTR	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:153906237C>T	ENST00000369575.3	-	0	2010				GAB3_ENST00000496390.1_5'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3						macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GAGCCCCCTCCGGAAGGCAAC	0.453													ENSG00000160219																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.*218G>A	X.37:g.153906237C>T			A6NHF8|E9PB44	R	SNP	-	NULL	ENST00000369575.3	37	NULL	CCDS14760.1	X																																																																																			-	GAB3	-	-		0.453	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	0	0	0	14	14	73	0.00	0.00	C	NM_001081573		153906237	-1	4	25	10	71	tier1	no_errors	ENST00000496390	ensembl	human	known	74_37	rna	28.57	26.04	SNP	0.000	T	4	10
ZNF804A	91752	genome.wustl.edu	37	2	185803515	185803515	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr2:185803515T>A	ENST00000302277.6	+	4	3986	c.3392T>A	c.(3391-3393)tTt>tAt	p.F1131Y		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1131							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CACCAACAGTTTCTTTCCCAA	0.532													ENSG00000170396																																					0													144.0	139.0	141.0					2																	185803515		2203	4300	6503	SO:0001583	missense	0			-	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3392T>A	2.37:g.185803515T>A	ENSP00000303252:p.Phe1131Tyr		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.F1131Y	ENST00000302277.6	37	c.3392	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	T	16.14	3.038207	0.54896	.	.	ENSG00000170396	ENST00000302277	T	0.06687	3.27	5.03	5.03	0.67393	.	0.000000	0.49916	D	0.000130	T	0.24005	0.0581	L	0.57536	1.79	0.33030	D	0.530029	D	0.76494	0.999	D	0.78314	0.991	T	0.24657	-1.0154	10	0.72032	D	0.01	-16.832	12.5019	0.55960	0.0:0.0:0.0:1.0	.	1131	Q7Z570	Z804A_HUMAN	Y	1131	ENSP00000303252:F1131Y	ENSP00000303252:F1131Y	F	+	2	0	ZNF804A	185511760	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.333000	0.52090	1.882000	0.54519	0.260000	0.18958	TTT	-	ZNF804A	-	NULL		0.532	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	0	0	0	38	38	86	0.00	0.00	T	NM_194250		185803515	+1	4	28	14	82	tier1	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	22.22	25.45	SNP	1.000	A	4	14
MAP1A	4130	genome.wustl.edu	37	15	43820411	43820411	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr15:43820411T>A	ENST00000300231.5	+	4	7190	c.6740T>A	c.(6739-6741)cTg>cAg	p.L2247Q	MAP1A_ENST00000382031.1_Missense_Mutation_p.L2485Q|MAP1A_ENST00000399453.1_Missense_Mutation_p.L2247Q			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2247					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CTCTCCAATCTGCCACGACCT	0.607													ENSG00000166963																																					0													63.0	69.0	67.0					15																	43820411		1931	4115	6046	SO:0001583	missense	0			-	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.6740T>A	15.37:g.43820411T>A	ENSP00000300231:p.Leu2247Gln		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.L2247Q	ENST00000300231.5	37	c.6740	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	T	12.46	1.944658	0.34283	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01725	4.67;4.67;4.67	4.56	4.56	0.56223	.	0.000000	0.27802	N	0.017781	T	0.05318	0.0141	L	0.36672	1.1	0.37034	D	0.896842	D	0.76494	0.999	D	0.76575	0.988	T	0.58047	-0.7705	10	0.28530	T	0.3	-4.6459	12.6407	0.56709	0.0:0.0:0.0:1.0	.	2247	P78559	MAP1A_HUMAN	Q	2485;2247;2247	ENSP00000371462:L2485Q;ENSP00000382380:L2247Q;ENSP00000300231:L2247Q	ENSP00000300231:L2247Q	L	+	2	0	MAP1A	41607703	1.000000	0.71417	0.679000	0.29978	0.970000	0.65996	1.921000	0.40035	1.911000	0.55334	0.459000	0.35465	CTG	-	MAP1A	-	NULL		0.607	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	0	0	0	143	143	52	0.00	0.00	T	NM_002373		43820411	+1	22	16	41	25	tier1	no_errors	ENST00000399453	ensembl	human	known	74_37	missense	34.38	39.02	SNP	0.972	A	22	41
OR6C76	390326	genome.wustl.edu	37	12	55820114	55820114	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:55820114T>C	ENST00000328314.3	+	1	77	c.77T>C	c.(76-78)tTc>tCc	p.F26S		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GTTGTGATTTTCTCGTTCCTA	0.418													ENSG00000185821																																					0													168.0	162.0	164.0					12																	55820114		2203	4300	6503	SO:0001583	missense	0			-		CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.77T>C	12.37:g.55820114T>C	ENSP00000328402:p.Phe26Ser			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F26S	ENST00000328314.3	37	c.77	CCDS31823.1	12	.	.	.	.	.	.	.	.	.	.	t	16.81	3.225932	0.58668	.	.	ENSG00000185821	ENST00000328314	T	0.04551	3.6	4.35	4.35	0.52113	.	0.000000	0.44688	U	0.000423	T	0.15046	0.0363	M	0.83692	2.655	0.30245	N	0.794666	P	0.50528	0.936	P	0.50270	0.636	T	0.03761	-1.1006	10	0.72032	D	0.01	.	13.6441	0.62270	0.0:0.0:0.0:1.0	.	26	A6NM76	O6C76_HUMAN	S	26	ENSP00000328402:F26S	ENSP00000328402:F26S	F	+	2	0	OR6C76	54106381	0.751000	0.28327	0.077000	0.20336	0.028000	0.11728	1.506000	0.35747	1.945000	0.56424	0.487000	0.48397	TTC	-	OR6C76	-	prints_GPCR_Rhodpsn		0.418	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C76	HGNC	protein_coding	OTTHUMT00000406675.1	0	0	0	50	50	84	0.00	0.00	T	NM_001005183		55820114	+1	37	65	6	15	tier1	no_errors	ENST00000328314	ensembl	human	known	74_37	missense	86.05	81.25	SNP	0.865	C	37	6
TRIM58	25893	genome.wustl.edu	37	1	248039664	248039664	+	Missense_Mutation	SNP	G	G	T	rs200018732		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:248039664G>T	ENST00000366481.3	+	6	1382	c.1334G>T	c.(1333-1335)cGg>cTg	p.R445L	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	445	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGTCTTCTTCGGCCTTACTTT	0.428													ENSG00000162722																																					0													160.0	156.0	158.0					1																	248039664		2203	4300	6503	SO:0001583	missense	0			-	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1334G>T	1.37:g.248039664G>T	ENSP00000355437:p.Arg445Leu		Q6B0H9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R445L	ENST00000366481.3	37	c.1334	CCDS1636.1	1	.	.	.	.	.	.	.	.	.	.	G	9.271	1.045657	0.19748	.	.	ENSG00000162722	ENST00000366481	T	0.68181	-0.31	4.05	3.14	0.36123	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.51477	D	0.000090	T	0.68220	0.2977	M	0.64260	1.97	0.20703	N	0.999867	D	0.56035	0.974	P	0.57204	0.815	T	0.57539	-0.7794	10	0.10636	T	0.68	.	7.8462	0.29426	0.1103:0.0:0.8897:0.0	.	445	Q8NG06	TRI58_HUMAN	L	445	ENSP00000355437:R445L	ENSP00000355437:R445L	R	+	2	0	TRIM58	246106287	0.006000	0.16342	0.900000	0.35374	0.322000	0.28314	1.526000	0.35964	1.313000	0.45069	0.650000	0.86243	CGG	-	TRIM58	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.428	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	0	0	0	114	114	94	0.00	0.00	G	NM_015431		248039664	+1	18	29	4	12	tier1	no_errors	ENST00000366481	ensembl	human	known	74_37	missense	81.82	69.05	SNP	0.350	T	18	4
TF	7018	genome.wustl.edu	37	3	133467272	133467272	+	Silent	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:133467272C>T	ENST00000402696.3	+	2	545	c.60C>T	c.(58-60)gtC>gtT	p.V20V	TF_ENST00000475382.1_3'UTR|TF_ENST00000264998.3_Intron|TFP1_ENST00000460564.1_RNA	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	20					blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	GTCTGGCTGTCCCTGATAAAA	0.572													ENSG00000091513																																					0													130.0	114.0	120.0					3																	133467272		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.60C>T	3.37:g.133467272C>T			O43890|Q1HBA5|Q9NQB8|Q9UHV0	Silent	SNP	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.V20	ENST00000402696.3	37	c.60	CCDS3080.1	3																																																																																			-	TF	-	pirsf_Transferrin		0.572	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TF	HGNC	protein_coding	OTTHUMT00000317775.1	0	0	0	71	71	50	0.00	0.00	C	NM_001063		133467272	+1	25	25	11	13	tier1	no_errors	ENST00000402696	ensembl	human	known	74_37	silent	69.44	64.10	SNP	0.003	T	25	11
TNRC6C	57690	genome.wustl.edu	37	17	76047369	76047369	+	Silent	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:76047369A>G	ENST00000588061.1	+	5	2953	c.2226A>G	c.(2224-2226)gtA>gtG	p.V742V	TNRC6C_ENST00000541771.1_Silent_p.V742V|TNRC6C_ENST00000335749.4_Silent_p.V742V|TNRC6C_ENST00000588847.1_Silent_p.V742V|TNRC6C_ENST00000301624.4_Silent_p.V742V|TNRC6C_ENST00000544502.1_Silent_p.V742V			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	742	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			ATAAAACTGTAAACATGTGGG	0.517													ENSG00000078687																																					0													33.0	33.0	33.0					17																	76047369		1939	4060	5999	SO:0001819	synonymous_variant	0			-	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2226A>G	17.37:g.76047369A>G			G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.V742	ENST00000588061.1	37	c.2226	CCDS45798.1	17																																																																																			-	TNRC6C	-	NULL		0.517	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	0	0	0	59	59	89	0.00	0.00	A	NM_018996		76047369	+1	47	57	55	73	tier1	no_errors	ENST00000335749	ensembl	human	known	74_37	silent	46.08	43.85	SNP	0.996	G	47	55
MED14	9282	genome.wustl.edu	37	X	40511075	40511075	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:40511075G>A	ENST00000324817.1	-	31	4466	c.4348C>T	c.(4348-4350)Cct>Tct	p.P1450S		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1450					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGCCCACCAGGGGGCAGTGTA	0.393													ENSG00000180182																																					0													45.0	39.0	41.0					X																	40511075		2203	4299	6502	SO:0001583	missense	0			-	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.4348C>T	X.37:g.40511075G>A	ENSP00000323720:p.Pro1450Ser		Q4KMR7|Q9UNB3	Missense_Mutation	SNP	pfam_Mediator_Med14	p.P1450S	ENST00000324817.1	37	c.4348	CCDS14254.1	X	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051597	0.36181	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.88	5.88	0.94601	.	0.159176	0.64402	D	0.000019	T	0.23014	0.0556	N	0.00841	-1.15	0.58432	D	0.999996	B	0.17038	0.02	B	0.12837	0.008	T	0.41215	-0.9521	9	0.02654	T	1	.	19.1532	0.93499	0.0:0.0:1.0:0.0	.	1450	O60244	MED14_HUMAN	S	1450	.	ENSP00000323720:P1450S	P	-	1	0	MED14	40396019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.038000	0.76537	2.474000	0.83562	0.600000	0.82982	CCT	-	MED14	-	NULL		0.393	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	HGNC	protein_coding	OTTHUMT00000060692.1	0	0	0	90	90	83	0.00	0.00	G	NM_004229		40511075	-1	38	21	105	63	tier1	no_errors	ENST00000324817	ensembl	human	known	74_37	missense	26.57	25.00	SNP	1.000	A	38	105
WBSCR22	114049	genome.wustl.edu	37	7	73112209	73112209	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr7:73112209G>A	ENST00000265758.2	+	12	897	c.839G>A	c.(838-840)cGc>cAc	p.R280H	WBSCR22_ENST00000423497.1_Missense_Mutation_p.R297H|STX1A_ENST00000484736.1_5'Flank|WBSCR22_ENST00000423166.2_Intron	NM_017528.4	NP_059998.2	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	280					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|large_intestine(2)|lung(9)|prostate(1)	13		Lung NSC(55;0.0908)|all_lung(88;0.198)				CGCAAGCCCCGCTTCTAAGTC	0.458													ENSG00000071462																																					0													53.0	56.0	55.0					7																	73112209		2203	4300	6503	SO:0001583	missense	0			-	AF420248	CCDS5557.1, CCDS56490.1	7q11.23	2012-06-12			ENSG00000071462	ENSG00000071462			16405	protein-coding gene	gene with protein product	"""metastasis-related methyltransferase 1"""	615733				12073013, 11978965, 21148752	Standard	NM_001202560		Approved	MGC19709, MGC2022, MGC5140, PP3381, WBMT, MERM1	uc003tyt.3	O43709	OTTHUMG00000023306	ENST00000265758.2:c.839G>A	7.37:g.73112209G>A	ENSP00000265758:p.Arg280His		A8K501|C9K060|Q96P12|Q9BQ58|Q9HBP9	Missense_Mutation	SNP	pfam_Unchr_MeTrfase_Williams-Beuren,pfam_Methyltransf_11	p.R280H	ENST00000265758.2	37	c.839	CCDS5557.1	7	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478176	0.44044	.	.	ENSG00000071462	ENST00000265758;ENST00000423497	T;T	0.48522	0.83;0.81	6.08	0.183	0.15082	.	0.582707	0.18861	N	0.129124	T	0.40570	0.1122	L	0.60455	1.87	0.80722	D	1	B;B	0.25312	0.123;0.018	B;B	0.24394	0.053;0.036	T	0.28138	-1.0053	10	0.48119	T	0.1	-20.5154	9.7358	0.40386	0.5069:0.0:0.4931:0.0	.	297;280	C9K060;O43709	.;WBS22_HUMAN	H	280;297	ENSP00000265758:R280H;ENSP00000401191:R297H	ENSP00000265758:R280H	R	+	2	0	WBSCR22	72750145	0.011000	0.17503	0.994000	0.49952	0.617000	0.37484	-0.049000	0.11924	0.093000	0.17368	0.655000	0.94253	CGC	-	WBSCR22	-	pfam_Unchr_MeTrfase_Williams-Beuren		0.458	WBSCR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR22	HGNC	protein_coding	OTTHUMT00000252303.1	0	0	0	132	132	64	0.00	0.00	G			73112209	+1	28	17	77	53	tier1	no_errors	ENST00000265758	ensembl	human	known	74_37	missense	26.67	24.29	SNP	0.997	A	28	77
MS4A14	84689	genome.wustl.edu	37	11	60183891	60183891	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr11:60183891A>G	ENST00000300187.6	+	5	1727	c.1450A>G	c.(1450-1452)Aga>Gga	p.R484G	MS4A14_ENST00000531787.1_Missense_Mutation_p.R372G|MS4A14_ENST00000531783.1_Missense_Mutation_p.R517G|MS4A14_ENST00000395005.2_Missense_Mutation_p.R467G	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	484	Gln-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						AAAATCCTCAAGACGGCATTC	0.393													ENSG00000166928																																					0													80.0	82.0	81.0					11																	60183891		2203	4300	6503	SO:0001583	missense	0			-	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.1450A>G	11.37:g.60183891A>G	ENSP00000300187:p.Arg484Gly		E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	pfam_CD20-like	p.R484G	ENST00000300187.6	37	c.1450	CCDS31569.1	11	.	.	.	.	.	.	.	.	.	.	A	12.73	2.024721	0.35701	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	T;T;T;T	0.38560	1.13;2.31;1.13;2.69	4.13	1.77	0.24775	.	2.940030	0.01067	N	0.004746	T	0.39145	0.1067	L	0.52573	1.65	0.09310	N	1	P;P	0.50819	0.939;0.9	B;B	0.42916	0.402;0.227	T	0.26155	-1.0111	10	0.51188	T	0.08	-1.0233	2.7685	0.05328	0.6562:0.0:0.1193:0.2245	.	467;484	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	G	372;484;467;517	ENSP00000437222:R372G;ENSP00000300187:R484G;ENSP00000378453:R467G;ENSP00000433761:R517G	ENSP00000300187:R484G	R	+	1	2	MS4A14	59940467	0.003000	0.15002	0.002000	0.10522	0.004000	0.04260	1.517000	0.35867	0.667000	0.31107	0.528000	0.53228	AGA	-	MS4A14	-	NULL		0.393	MS4A14-002	KNOWN	basic|CCDS	protein_coding	MS4A14	HGNC	protein_coding	OTTHUMT00000395383.2	0	0	0	20	20	98	0.00	0.00	A			60183891	+1	18	64	9	28	tier1	no_errors	ENST00000300187	ensembl	human	known	74_37	missense	66.67	69.57	SNP	0.000	G	18	9
ARV1	64801	genome.wustl.edu	37	1	231115061	231115061	+	Intron	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:231115061A>G	ENST00000310256.2	+	1	231				TTC13_ENST00000366661.4_5'Flank|TTC13_ENST00000414259.1_5'Flank|TTC13_ENST00000366662.4_5'Flank|ARV1_ENST00000497753.1_3'UTR|ARV1_ENST00000366658.2_Intron	NM_022786.1	NP_073623.1	Q9H2C2	ARV1_HUMAN	ARV1 homolog (S. cerevisiae)						bile acid metabolic process (GO:0008206)|cholesterol transport (GO:0030301)|regulation of cholesterol metabolic process (GO:0090181)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|large_intestine(2)|lung(2)	7	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)		TTGAGAAGAAAATGGCGCGGC	0.532													ENSG00000173409																																					0													57.0	67.0	63.0					1																	231115061		2203	4300	6503	SO:0001627	intron_variant	0			-	AF271780	CCDS1589.1	1q42.2	2014-02-03	2006-04-04		ENSG00000173409	ENSG00000173409			29561	protein-coding gene	gene with protein product		611647	"""ARV1 homolog (yeast)"""			11063737, 12145310, 20663892	Standard	NM_022786		Approved		uc001huh.3	Q9H2C2	OTTHUMG00000037837	ENST00000310256.2:c.174+36A>G	1.37:g.231115061A>G			A8KAI4|Q5VSN7|Q5VSN8|Q5VSN9|Q5VSP0|Q5VSP2|Q9H2H2|Q9H5V6|Q9UFF5	R	SNP	-	NULL	ENST00000310256.2	37	NULL	CCDS1589.1	1																																																																																			-	ARV1	-	-		0.532	ARV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARV1	HGNC	protein_coding	OTTHUMT00000092362.2	0	0	0	39	39	111	0.00	0.00	A	NM_022786		231115061	+1	14	60	7	17	tier1	no_errors	ENST00000497753	ensembl	human	known	74_37	rna	66.67	77.92	SNP	0.002	G	14	7
SLC26A4	5172	genome.wustl.edu	37	7	107330649	107330649	+	Silent	SNP	G	G	A	rs371756312		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr7:107330649G>A	ENST00000265715.3	+	10	1454	c.1230G>A	c.(1228-1230)acG>acA	p.T410T	SLC26A4_ENST00000541474.1_5'Flank|SLC26A4_ENST00000544569.1_5'Flank	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	410			T -> M (in DFNB4 and PDS; fails to localize to cell membrane; abolishes iodide transport). {ECO:0000269|PubMed:10700480, ECO:0000269|PubMed:11748854, ECO:0000269|PubMed:11919333, ECO:0000269|PubMed:12676893, ECO:0000269|PubMed:14679580, ECO:0000269|PubMed:15355436, ECO:0000269|PubMed:9618167}.		chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTTCCCGCACGGCCGTCCAGG	0.493									Pendred syndrome				ENSG00000091137																																					0													131.0	121.0	124.0					7																	107330649		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Goiter-Deafness syndrome	-	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1230G>A	7.37:g.107330649G>A			B7Z266|O43170	Silent	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.T410	ENST00000265715.3	37	c.1230	CCDS5746.1	7																																																																																			-	SLC26A4	-	pfam_Sulph_transpt,tigrfam_SulP_transpt		0.493	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	HGNC	protein_coding	OTTHUMT00000337148.1	0	0	0	34	34	83	0.00	0.00	G	NM_000441		107330649	+1	11	63	12	28	tier1	no_errors	ENST00000265715	ensembl	human	known	74_37	silent	47.83	69.23	SNP	0.001	A	11	12
ACAN	176	genome.wustl.edu	37	15	89381937	89381937	+	Silent	SNP	G	G	A	rs367956651		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr15:89381937G>A	ENST00000561243.1	+	2	114	c.114G>A	c.(112-114)ccG>ccA	p.P38P	ACAN_ENST00000439576.2_Silent_p.P38P|ACAN_ENST00000558207.1_Silent_p.P38P|ACAN_ENST00000352105.7_Silent_p.P38P|ACAN_ENST00000559004.1_Silent_p.P38P			P16112	PGCA_HUMAN	aggrecan	38	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AACCGTCCCCGCTGAGGGTCC	0.622													ENSG00000157766																																					0								A	,	3,4007		0,3,2002	107.0	117.0	114.0		114,114	-9.9	0.0	15		114	0,8328		0,0,4164	no	coding-synonymous,coding-synonymous	ACAN	NM_001135.3,NM_013227.3	,	0,3,6166	AA,AG,GG		0.0,0.0748,0.0243	,	38/2432,38/2531	89381937	3,12335	2005	4164	6169	SO:0001819	synonymous_variant	0			-	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.114G>A	15.37:g.89381937G>A			Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.P38	ENST00000561243.1	37	c.114	CCDS53970.1	15																																																																																			-	ACAN	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom		0.622	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	0	0	1	88	88	76	0.00	1.28	G	NM_001135		89381937	+1	8	19	30	39	tier1	no_errors	ENST00000439576	ensembl	human	known	74_37	silent	21.05	32.76	SNP	0.000	A	8	30
NF1	4763	genome.wustl.edu	37	17	29664854	29664854	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:29664854T>G	ENST00000358273.4	+	44	7043	c.6660T>G	c.(6658-6660)atT>atG	p.I2220M	NF1_ENST00000444181.2_Missense_Mutation_p.S6A|NF1_ENST00000417592.2_Missense_Mutation_p.S6A|NF1_ENST00000356175.3_Missense_Mutation_p.I2199M	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2220					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGAGAGATATTCCAACGTGCA	0.313			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			ENSG00000196712																											yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											71.0	71.0	71.0					17																	29664854		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	-		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6660T>G	17.37:g.29664854T>G	ENSP00000351015:p.Ile2220Met		O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.I2220M	ENST00000358273.4	37	c.6660	CCDS42292.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.26|13.26	2.184987|2.184987	0.38609|0.38609	.|.	.|.	ENSG00000196712|ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735|ENST00000444181;ENST00000417592	T;T;T|T	0.34275|0.44083	1.37;1.37;1.37|0.93	5.65|5.65	3.42|3.42	0.39159|0.39159	Armadillo-type fold (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.44477|0.44477	0.1295|0.1295	L|L	0.52573|0.52573	1.65|1.65	0.22142|0.22142	N|N	0.999338|0.999338	D;P|.	0.60575|.	0.988;0.459|.	D;B|.	0.72338|.	0.977;0.358|.	T|T	0.36212|0.36212	-0.9757|-0.9757	10|7	0.46703|0.72032	T|D	0.11|0.01	.|.	8.5992|8.5992	0.33734|0.33734	0.0:0.2732:0.0:0.7268|0.0:0.2732:0.0:0.7268	.|.	2199;2220|.	P21359-2;P21359|.	.;NF1_HUMAN|.	M|A	2220;2199;1865|6	ENSP00000351015:I2220M;ENSP00000348498:I2199M;ENSP00000389907:I1865M|ENSP00000396481:S6A	ENSP00000348498:I2199M|ENSP00000398991:S6A	I|S	+|+	3|1	3|0	NF1|NF1	26688980|26688980	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	1.401000|1.401000	0.34589|0.34589	1.081000|1.081000	0.41110|0.41110	0.460000|0.460000	0.39030|0.39030	ATT|TCC	-	NF1	-	superfamily_ARM-type_fold		0.313	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	0	0	0	67	67	69	0.00	0.00	T	NM_000267		29664854	+1	24	2	14	12	tier1	no_errors	ENST00000358273	ensembl	human	known	74_37	missense	63.16	13.33	SNP	1.000	G	24	14
FAM47B	170062	genome.wustl.edu	37	X	34962204	34962204	+	Missense_Mutation	SNP	G	G	A	rs146264202	byFrequency	TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:34962204G>A	ENST00000329357.5	+	1	1292	c.1256G>A	c.(1255-1257)cGg>cAg	p.R419Q		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	419										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AAGACTCGTCGGGTGTCCAGT	0.562													ENSG00000189132																																					0													69.0	62.0	65.0					X																	34962204		2202	4300	6502	SO:0001583	missense	0			-	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1256G>A	X.37:g.34962204G>A	ENSP00000328307:p.Arg419Gln		Q5JQN5|Q6PIG3	Missense_Mutation	SNP	NULL	p.R419Q	ENST00000329357.5	37	c.1256	CCDS14236.1	X	.	.	.	.	.	.	.	.	.	.	G	4.508	0.094292	0.08632	.	.	ENSG00000189132	ENST00000329357	T	0.15487	2.42	0.158	0.158	0.14942	.	.	.	.	.	T	0.11665	0.0284	L	0.47716	1.5	0.09310	N	1	B	0.26258	0.145	B	0.13407	0.009	T	0.37220	-0.9715	8	0.14252	T	0.57	.	.	.	.	.	419	Q8NA70	FA47B_HUMAN	Q	419	ENSP00000328307:R419Q	ENSP00000328307:R419Q	R	+	2	0	FAM47B	34872125	0.021000	0.18746	0.001000	0.08648	0.002000	0.02628	0.287000	0.18920	0.187000	0.20147	0.190000	0.17370	CGG	-	FAM47B	-	NULL		0.562	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	HGNC	protein_coding	OTTHUMT00000056211.1	0	0	0	94	94	23	0.00	0.00	G	NM_152631		34962204	+1	39	14	49	12	tier1	no_errors	ENST00000329357	ensembl	human	known	74_37	missense	44.32	53.85	SNP	0.001	A	39	49
CXorf22	170063	genome.wustl.edu	37	X	35937998	35937998	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:35937998C>A	ENST00000297866.5	+	1	148	c.82C>A	c.(82-84)Ccc>Acc	p.P28T		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	28										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TTCCCTCGTCCCCCGGGATAT	0.612													ENSG00000165164																																					0													52.0	41.0	45.0					X																	35937998		2202	4300	6502	SO:0001583	missense	0			-	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.82C>A	X.37:g.35937998C>A	ENSP00000297866:p.Pro28Thr		Q5JRM8|Q8N6X8	Missense_Mutation	SNP	superfamily_PapD-like	p.P28T	ENST00000297866.5	37	c.82	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	C	9.710	1.156820	0.21454	.	.	ENSG00000165164	ENST00000297866	T	0.14640	2.49	4.81	0.774	0.18521	.	1.194060	0.06213	N	0.685432	T	0.15522	0.0374	L	0.57536	1.79	0.09310	N	1	B	0.22414	0.069	B	0.30029	0.11	T	0.40194	-0.9576	10	0.39692	T	0.17	-37.141	3.3823	0.07259	0.1312:0.5508:0.1408:0.1772	.	28	Q6ZTR5	CX022_HUMAN	T	28	ENSP00000297866:P28T	ENSP00000297866:P28T	P	+	1	0	CXorf22	35847919	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.388000	0.07352	-0.518000	0.06452	-1.231000	0.01572	CCC	-	CXorf22	-	NULL		0.612	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	0	0	0	127	127	77	0.00	0.00	C	NM_152632		35937998	+1	58	56	48	54	tier1	no_errors	ENST00000297866	ensembl	human	known	74_37	missense	54.72	50.91	SNP	0.000	A	58	48
TRPA1	8989	genome.wustl.edu	37	8	72975032	72975032	+	Splice_Site	SNP	A	A	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr8:72975032A>T	ENST00000262209.4	-	6	1015		c.e6+1			NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1						calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ATGAAGAGTTACCTCCACTGG	0.363													ENSG00000104321																																					0													115.0	107.0	110.0					8																	72975032		2203	4300	6503	SO:0001630	splice_region_variant	0			-	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.807+1T>A	8.37:g.72975032A>T			A6NIN6	Splice_Site	SNP	-	e6+2	ENST00000262209.4	37	c.807+2	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	A	10.02	1.235463	0.22626	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	.	.	.	5.62	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8246	0.52259	0.9304:0.0:0.0696:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRPA1	73137586	1.000000	0.71417	0.803000	0.32268	0.071000	0.16799	5.143000	0.64826	0.909000	0.36697	0.528000	0.53228	.	-	TRPA1	-	-		0.363	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	0	0	0	52	52	43	0.00	0.00	A	NM_007332	Intron	72975032	-1	20	30	54	83	tier1	no_errors	ENST00000262209	ensembl	human	known	74_37	splice_site	27.03	26.55	SNP	0.998	T	20	54
EBF1	1879	genome.wustl.edu	37	5	158500455	158500465	+	Frame_Shift_Del	DEL	TTCTTGTCACA	TTCTTGTCACA	-			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	TTCTTGTCACA	TTCTTGTCACA	TTCTTGTCACA	-	TTCTTGTCACA	TTCTTGTCACA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr5:158500455_158500465delTTCTTGTCACA	ENST00000313708.6	-	6	775_785	c.493_503delTGTGACAAGAA	c.(493-504)tgtgacaagaaafs	p.CDKK165fs	EBF1_ENST00000380654.4_Intron|EBF1_ENST00000517373.1_Frame_Shift_Del_p.CDKK165fs|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	165					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCACAGCTTTTCTTGTCACAACAGCGGCTA	0.408			T	HMGA2	lipoma								ENSG00000164330																												Dom	yes		5	5q34	1879	early B-cell factor 1		M	0																																										SO:0001589	frameshift_variant	0				AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.493_503delTGTGACAAGAA	5.37:g.158500455_158500465delTTCTTGTCACA	ENSP00000322898:p.Cys165fs		Q8IW11	Frame_Shift_Del	DEL	pfam_IPT,superfamily_Ig_E-set,superfamily_bHLH_dom,smart_IPT	p.C165fs	ENST00000313708.6	37	c.503_493	CCDS4343.1	5																																																																																				EBF1	-	NULL		0.408	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1	0	0	0	99	99	99	0.00	0.00	TTCTTGTCACA	NM_024007		158500465	-1	7	7	13	13	tier1	no_errors	ENST00000313708	ensembl	human	known	74_37	frame_shift_del	35.00	35.00	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	7	13
PIK3C2G	5288	genome.wustl.edu	37	12	18491389	18491390	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:18491389_18491390insA	ENST00000266497.5	+	8	1340_1341	c.1302_1303insA	c.(1303-1305)aaafs	p.K435fs	PIK3C2G_ENST00000535651.1_Frame_Shift_Ins_p.K435fs|PIK3C2G_ENST00000538779.1_Frame_Shift_Ins_p.K435fs|PIK3C2G_ENST00000433979.1_Frame_Shift_Ins_p.K435fs			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	435					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TTGAAGAAGTTAAAAAAATATG	0.312													ENSG00000139144																																					0																																										SO:0001589	frameshift_variant	0				AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1309dupA	12.37:g.18491396_18491396dupA	ENSP00000266497:p.Lys435fs		A1L3U0	Frame_Shift_Ins	INS	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.I436fs	ENST00000266497.5	37	c.1302_1303	CCDS44839.1	12																																																																																				PIK3C2G	-	NULL		0.312	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	0	0	0	50	50	80	0.00	0.00	-	NM_004570		18491390	+1	15	31	103	100	tier1	no_errors	ENST00000538779	ensembl	human	known	74_37	frame_shift_ins	12.71	23.66	INS	0.996:0.999	A	15	103
CCDC18	343099	genome.wustl.edu	37	1	93691986	93691986	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:93691986T>G	ENST00000343253.7	+	17	2771	c.2269T>G	c.(2269-2271)Tta>Gta	p.L757V	CCDC18_ENST00000338949.4_Missense_Mutation_p.L513V|CCDC18_ENST00000401026.3_Missense_Mutation_p.L758V|CCDC18_ENST00000557479.1_Missense_Mutation_p.L876V|CCDC18_ENST00000421014.2_3'UTR|CCDC18_ENST00000334652.5_Missense_Mutation_p.L53V			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	757										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TGAAAAACAGTTAAAGAAGAA	0.279													ENSG00000122483																																					0													45.0	45.0	45.0					1																	93691986		1794	4053	5847	SO:0001583	missense	0			-			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.2269T>G	1.37:g.93691986T>G	ENSP00000343377:p.Leu757Val		Q6ZU17	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tR-bd_arm	p.L876V	ENST00000343253.7	37	c.2626		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.49|15.49	2.848408|2.848408	0.51164|0.51164	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000334652;ENST00000455267|ENST00000370276	T;T;T;T;T;T|.	0.35973|.	1.28;1.28;1.28;1.28;1.28;1.28|.	5.23|5.23	2.13|2.13	0.27403|0.27403	.|.	0.165528|.	0.41001|.	D|.	0.000967|.	T|T	0.31482|0.31482	0.0798|0.0798	L|L	0.46157|0.46157	1.445|1.445	0.45464|0.45464	D|D	0.998432|0.998432	P;P|.	0.52316|.	0.732;0.952|.	B;P|.	0.47673|.	0.26;0.554|.	T|T	0.14783|0.14783	-1.0460|-1.0460	10|5	0.25106|.	T|.	0.35|.	.|.	4.5895|4.5895	0.12299|0.12299	0.2496:0.5203:0.0:0.23|0.2496:0.5203:0.0:0.23	.|.	757;876|.	Q5T9S5;G3V388|.	CCD18_HUMAN;.|.	V|R	757;758;876;513;53;433|810	ENSP00000343377:L757V;ENSP00000383808:L758V;ENSP00000451099:L876V;ENSP00000344380:L513V;ENSP00000334084:L53V;ENSP00000391151:L433V|.	ENSP00000334084:L53V|.	L|S	+|+	1|3	2|2	CCDC18|CCDC18	93464574|93464574	0.907000|0.907000	0.30839|0.30839	0.993000|0.993000	0.49108|0.49108	0.996000|0.996000	0.88848|0.88848	-0.072000|-0.072000	0.11486|0.11486	0.670000|0.670000	0.31165|0.31165	-0.248000|-0.248000	0.11899|0.11899	TTA|AGT	-	CCDC18	-	NULL		0.279	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	CCDC18	HGNC	protein_coding	OTTHUMT00000382327.1	0	0	0	95	95	60	0.00	0.00	T	NM_206886		93691986	+1	112	35	34	7	tier1	no_errors	ENST00000557479	ensembl	human	known	74_37	missense	76.71	83.33	SNP	0.946	G	112	34
CDYL2	124359	genome.wustl.edu	37	16	80719022	80719022	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr16:80719022T>C	ENST00000570137.2	-	2	184	c.29A>G	c.(28-30)gAa>gGa	p.E10G	CDYL2_ENST00000566173.1_Missense_Mutation_p.E10G|CDYL2_ENST00000563890.1_Missense_Mutation_p.E10G|CDYL2_ENST00000562812.1_Missense_Mutation_p.E10G|CDYL2_ENST00000562753.1_5'UTR	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	10	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.					nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						TACAATCCTTTCAACCTGCGA	0.483													ENSG00000166446																																					0													88.0	78.0	82.0					16																	80719022		2203	4297	6500	SO:0001583	missense	0			-	AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.29A>G	16.37:g.80719022T>C	ENSP00000476295:p.Glu10Gly		Q7Z5I8	Missense_Mutation	SNP	pfam_Crotonase_core_superfam,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.E10G	ENST00000570137.2	37	c.29	CCDS32493.1	16	.	.	.	.	.	.	.	.	.	.	T	23.6	4.439747	0.83885	.	.	ENSG00000166446	ENST00000299564	T	0.58210	0.35	5.08	5.08	0.68730	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.85682	D	0.000000	T	0.80188	0.4577	H	0.95151	3.63	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86231	0.1637	10	0.87932	D	0	.	14.1946	0.65662	0.0:0.0:0.0:1.0	.	10	Q8N8U2	CDYL2_HUMAN	G	10	ENSP00000299564:E10G	ENSP00000299564:E10G	E	-	2	0	CDYL2	79276523	1.000000	0.71417	0.999000	0.59377	0.895000	0.52256	7.757000	0.85209	2.131000	0.65755	0.533000	0.62120	GAA	-	CDYL2	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow		0.483	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDYL2	HGNC	protein_coding	OTTHUMT00000434727.2	0	0	0	24	24	102	0.00	0.00	T	NM_152342		80719022	-1	7	65	3	7	tier1	no_errors	ENST00000570137	ensembl	human	known	74_37	missense	70.00	89.04	SNP	1.000	C	7	3
CTAGE5	4253	genome.wustl.edu	37	14	39790147	39790147	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr14:39790147G>C	ENST00000280083.3	+	19	1873	c.1559G>C	c.(1558-1560)gGt>gCt	p.G520A	CTAGE5_ENST00000557038.1_Missense_Mutation_p.G440A|CTAGE5_ENST00000396158.2_Missense_Mutation_p.G525A|CTAGE5_ENST00000341749.3_Missense_Mutation_p.G508A|CTAGE5_ENST00000396165.4_Missense_Mutation_p.G491A|CTAGE5_ENST00000348007.3_Intron|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.G491A|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.G1055A|CTAGE5_ENST00000556148.1_Missense_Mutation_p.G445A|CTAGE5_ENST00000553352.1_Missense_Mutation_p.G491A|CTAGE5_ENST00000341502.5_Missense_Mutation_p.G520A			O15320	CTGE5_HUMAN	CTAGE family, member 5	520	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TCCCCATATGGTCCCTCACCA	0.423													ENSG00000150527																																					0													129.0	135.0	133.0					14																	39790147		2203	4300	6503	SO:0001583	missense	0			-	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.1559G>C	14.37:g.39790147G>C	ENSP00000280083:p.Gly520Ala		B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	NULL	p.G525A	ENST00000280083.3	37	c.1574	CCDS9674.1	14	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785910	0.70337	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000553352	T;T;T;T;T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19	5.95	5.05	0.67936	.	0.000000	0.35407	N	0.003229	T	0.57932	0.2087	L	0.59436	1.845	0.44142	D	0.996931	B;B;B;B	0.22541	0.071;0.039;0.039;0.022	B;B;B;B	0.32624	0.149;0.106;0.106;0.106	T	0.53899	-0.8373	9	.	.	.	.	15.4115	0.74929	0.0:0.1384:0.8616:0.0	.	482;525;520;508	F8W9E1;O15320-5;O15320;G3XAC5	.;.;CTGE5_HUMAN;.	A	1055;508;440;482;491;520;525;520;445;491	ENSP00000452252:G1055A;ENSP00000343897:G508A;ENSP00000450869:G440A;ENSP00000379468:G491A;ENSP00000339286:G520A;ENSP00000379462:G525A;ENSP00000280083:G520A;ENSP00000452562:G445A;ENSP00000450449:G491A	.	G	+	2	0	CTAGE5;RP11-407N17.3	38859898	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.590000	0.67530	1.486000	0.48398	0.655000	0.94253	GGT	-	CTAGE5	-	NULL		0.423	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CTAGE5	HGNC	protein_coding	OTTHUMT00000276771.2	0	0	0	77	77	30	0.00	0.00	G	NM_005930		39790147	+1	31	10	8	7	tier1	no_errors	ENST00000396158	ensembl	human	known	74_37	missense	79.49	58.82	SNP	1.000	C	31	8
H1FNT	341567	genome.wustl.edu	37	12	48723491	48723491	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:48723491G>C	ENST00000335017.1	+	1	729	c.417G>C	c.(415-417)gaG>gaC	p.E139D		NM_181788.1	NP_861453.1	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	139	Arg-rich.				chromosome condensation (GO:0030261)|multicellular organismal development (GO:0007275)|sperm chromatin condensation (GO:0035092)|spermatid nucleus elongation (GO:0007290)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	13						GGCAAGAGGAGGGCACGCGCG	0.726													ENSG00000187166																																					0													9.0	13.0	12.0					12																	48723491		2184	4254	6438	SO:0001583	missense	0			-	AY302593	CCDS8762.1	12q13.11	2011-01-27				ENSG00000187166		"""Histones / Replication-independent"""	24893	protein-coding gene	gene with protein product						15710904	Standard	NM_181788		Approved	HANP1, H1T2	uc001rrm.3	Q75WM6		ENST00000335017.1:c.417G>C	12.37:g.48723491G>C	ENSP00000334805:p.Glu139Asp		Q147U8|Q5GKZ5|Q7Z694	Missense_Mutation	SNP	NULL	p.E139D	ENST00000335017.1	37	c.417	CCDS8762.1	12	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598772	0.28445	.	.	ENSG00000187166	ENST00000335017	T	0.19806	2.12	4.83	1.93	0.25924	.	0.952142	0.08513	N	0.934607	T	0.15392	0.0371	L	0.39898	1.24	0.09310	N	1	B	0.18013	0.025	B	0.21917	0.037	T	0.38972	-0.9636	10	0.18710	T	0.47	-11.3038	3.8943	0.09133	0.2808:0.1848:0.5344:0.0	.	139	Q75WM6	H1FNT_HUMAN	D	139	ENSP00000334805:E139D	ENSP00000334805:E139D	E	+	3	2	H1FNT	47009758	0.716000	0.27956	0.001000	0.08648	0.002000	0.02628	1.854000	0.39368	0.556000	0.29098	-0.172000	0.13284	GAG	-	H1FNT	-	NULL		0.726	H1FNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H1FNT	HGNC	protein_coding	OTTHUMT00000406516.1	0	0	0	14	14	16	0.00	0.00	G	NM_181788		48723491	+1	8	6	1	2	tier1	no_errors	ENST00000335017	ensembl	human	known	74_37	missense	88.89	75.00	SNP	0.000	C	8	1
GLT8D2	83468	genome.wustl.edu	37	12	104396990	104396990	+	Silent	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:104396990G>T	ENST00000360814.4	-	5	612	c.207C>A	c.(205-207)atC>atA	p.I69I	GLT8D2_ENST00000546436.1_Silent_p.I69I|GLT8D2_ENST00000548660.1_Silent_p.I69I	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	69						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						AGATGCTATTGATGGCAGCCA	0.468													ENSG00000120820																																					0													221.0	176.0	191.0					12																	104396990		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.207C>A	12.37:g.104396990G>T			Q96KA2	Silent	SNP	pfam_Glyco_trans_8	p.I69	ENST00000360814.4	37	c.207	CCDS9096.1	12																																																																																			-	GLT8D2	-	pfam_Glyco_trans_8		0.468	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D2	HGNC	protein_coding	OTTHUMT00000407371.1	0	0	0	63	63	91	0.00	0.00	G	NM_031302		104396990	-1	34	63	8	8	tier1	no_errors	ENST00000360814	ensembl	human	known	74_37	silent	80.95	88.73	SNP	1.000	T	34	8
LOXHD1	125336	genome.wustl.edu	37	18	44139448	44139448	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr18:44139448T>C	ENST00000398722.4	-	13	2344	c.2345A>G	c.(2344-2346)aAg>aGg	p.K782R	LOXHD1_ENST00000441551.2_Intron|LOXHD1_ENST00000582408.1_5'Flank|LOXHD1_ENST00000300591.6_5'Flank|LOXHD1_ENST00000441893.2_5'Flank|LOXHD1_ENST00000536736.1_Missense_Mutation_p.K1060R|LOXHD1_ENST00000579038.1_5'Flank			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	782	PLAT 6. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GTCTGACTTCTTCAGGGGTCG	0.592													ENSG00000167210																																					0													123.0	118.0	119.0					18																	44139448		692	1591	2283	SO:0001583	missense	0			-	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2345A>G	18.37:g.44139448T>C	ENSP00000381707:p.Lys782Arg		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.K1060R	ENST00000398722.4	37	c.3179		18	.	.	.	.	.	.	.	.	.	.	T	8.056	0.767030	0.15983	.	.	ENSG00000167210	ENST00000398722;ENST00000536736;ENST00000335730	T;T	0.64991	-0.13;-0.13	5.27	1.62	0.23740	.	0.382239	0.31156	N	0.008151	T	0.35566	0.0936	N	0.04705	-0.18	0.80722	D	1	B;B	0.26512	0.094;0.151	B;B	0.29862	0.07;0.108	T	0.04509	-1.0946	10	0.14656	T	0.56	.	9.0389	0.36305	0.0:0.2871:0.0:0.7129	.	1060;782	F5GZB4;Q8IVV2-2	.;.	R	782;1060;782	ENSP00000381707:K782R;ENSP00000444586:K1060R	ENSP00000338222:K782R	K	-	2	0	LOXHD1	42393446	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	1.734000	0.38166	0.340000	0.23745	0.368000	0.22195	AAG	-	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.592	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		0	0	0	101	101	90	0.00	0.00	T	NM_144612		44139448	-1	11	33	6	8	tier1	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	64.71	80.49	SNP	1.000	C	11	6
MEGF6	1953	genome.wustl.edu	37	1	3425216	3425216	+	Silent	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:3425216C>T	ENST00000356575.4	-	13	1792	c.1566G>A	c.(1564-1566)ttG>ttA	p.L522L	MEGF6_ENST00000294599.4_Silent_p.L417L	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	522	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CATCACAGGTCAAGCTGCAGT	0.627													ENSG00000162591																									Ovarian(73;978 3658)												0													50.0	56.0	54.0					1																	3425216		2100	4207	6307	SO:0001819	synonymous_variant	0			-	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1566G>A	1.37:g.3425216C>T			Q4AC86|Q5VV39	Silent	SNP	pfam_EGF_laminin,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.L522	ENST00000356575.4	37	c.1566	CCDS41237.1	1																																																																																			-	MEGF6	-	smart_EG-like_dom,pfscan_EG-like_dom		0.627	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF6	HGNC	protein_coding	OTTHUMT00000354866.1	0	0	0	103	103	61	0.00	0.00	C	NM_001409		3425216	-1	22	25	5	4	tier1	no_errors	ENST00000356575	ensembl	human	known	74_37	silent	81.48	86.21	SNP	1.000	T	22	5
RET	5979	genome.wustl.edu	37	10	43615162	43615162	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr10:43615162C>A	ENST00000355710.3	+	14	2808	c.2576C>A	c.(2575-2577)tCa>tAa	p.S859*	RET_ENST00000340058.5_Nonsense_Mutation_p.S859*	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	859	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGGCAGATCTCACAGGGGATG	0.657		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma				ENSG00000165731																									Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0													60.0	51.0	54.0					10																	43615162		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	-	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2576C>A	10.37:g.43615162C>A	ENSP00000347942:p.Ser859*		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Nonsense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.S859*	ENST00000355710.3	37	c.2576	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	C	41	8.993139	0.99029	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.0766	0.93165	0.0:1.0:0.0:0.0	.	.	.	.	X	859	.	ENSP00000344798:S859X	S	+	2	0	RET	42935168	1.000000	0.71417	0.976000	0.42696	0.774000	0.43823	7.807000	0.86032	2.518000	0.84900	0.313000	0.20887	TCA	-	RET	-	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.657	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	0	0	0	71	71	22	0.00	0.00	C	NM_020975		43615162	+1	9	14	16	8	tier1	no_errors	ENST00000355710	ensembl	human	known	74_37	nonsense	36.00	60.87	SNP	1.000	A	9	16
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	rs28934578	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	30	30	49	0.00	0.00	C	NM_000546		7578406	-1	18	25	3	3	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	85.71	89.29	SNP	1.000	T	18	3
GLIS2	84662	genome.wustl.edu	37	16	4386613	4386613	+	Intron	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr16:4386613G>A	ENST00000262366.3	+	8	1596				PAM16_ENST00000577031.1_Intron|GLIS2_ENST00000433375.1_Intron|RP11-295D4.1_ENST00000574705.1_RNA			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2						cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						CCCAGAATTGGGGCATCTATG	0.622													ENSG00000262712																																					0																																										SO:0001627	intron_variant	0			-	AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.776-113G>A	16.37:g.4386613G>A			B3KX84	R	SNP	-	NULL	ENST00000262366.3	37	NULL	CCDS10511.1	16																																																																																			-	RP11-295D4.1	-	-		0.622	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262712	Clone_based_vega_gene	protein_coding	OTTHUMT00000251630.1	0	0	1	53	53	47	0.00	2.08	G	NM_032575		4386613	-1	14	25	19	26	tier1	no_errors	ENST00000574705	ensembl	human	known	74_37	rna	42.42	49.02	SNP	0.001	A	14	19
MUC4	4585	genome.wustl.edu	37	3	195510015	195510015	+	Silent	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:195510015A>G	ENST00000463781.3	-	2	8895	c.8436T>C	c.(8434-8436)ggT>ggC	p.G2812G	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.G2812G|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGTGGCGTGACCTGTGGACA	0.587													ENSG00000145113																																					0													70.0	44.0	52.0					3																	195510015		685	1511	2196	SO:0001819	synonymous_variant	0			-	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8436T>C	3.37:g.195510015A>G			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.G2812	ENST00000463781.3	37	c.8436	CCDS54700.1	3																																																																																			-	MUC4	-	NULL		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	187	187	5	0.00	0.00	A	NM_018406		195510015	-1	8	0	18	6	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	29.63	0.00	SNP	0.287	G	8	18
NKX2-5	1482	genome.wustl.edu	37	5	172661847	172661847	+	Silent	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr5:172661847G>T	ENST00000329198.4	-	1	513	c.240C>A	c.(238-240)gcC>gcA	p.A80A	NKX2-5_ENST00000521848.1_Silent_p.A80A|NKX2-5_ENST00000424406.2_Silent_p.A80A	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	80	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ACGCACACTTGGCCGGTGAAG	0.701													ENSG00000183072																									Esophageal Squamous(72;810 1219 2387 13420 44943)												0													17.0	19.0	18.0					5																	172661847		2198	4291	6489	SO:0001819	synonymous_variant	0			-	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.240C>A	5.37:g.172661847G>T			A8K3K0|B4DNB6|E9PBU6	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.A80	ENST00000329198.4	37	c.240	CCDS4387.1	5																																																																																			-	NKX2-5	-	NULL		0.701	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-5	HGNC	protein_coding	OTTHUMT00000252942.2	0	0	0	77	77	10	0.00	0.00	G			172661847	-1	4	0	34	4	tier1	no_errors	ENST00000329198	ensembl	human	known	74_37	silent	10.53	0.00	SNP	0.997	T	4	34
GOLGA6L7P	728310	genome.wustl.edu	37	15	29090545	29090545	+	RNA	SNP	C	C	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr15:29090545C>G	ENST00000569815.1	-	0	717					NR_047567.1				golgin A6 family-like 7, pseudogene																		CAACCACGCACAAAAGCAGCA	0.597													ENSG00000261649																																					0																																												0			-	AK302238		15q13.1	2012-10-05	2011-04-15	2010-04-20	ENSG00000261649	ENSG00000261649			37442	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 6-like 7 (pseudogene)"""	GOLGA6L7			Standard	NR_047567		Approved		uc010uar.2		OTTHUMG00000176345		15.37:g.29090545C>G				R	SNP	-	NULL	ENST00000569815.1	37	NULL		15																																																																																			-	GOLGA6L7P	-	-		0.597	GOLGA6L7P-002	PUTATIVE	basic	processed_transcript	GOLGA6L7P	HGNC	pseudogene	OTTHUMT00000431796.1	0	0	0	26	26	0	0.00	0.00	C	XR_078490		29090545	-1	7	0	2	0	tier1	no_errors	ENST00000569815	ensembl	human	putative	74_37	rna	77.78	0.00	SNP	0.028	G	7	2
DNM1P47	100216544	genome.wustl.edu	37	15	102299771	102299771	+	RNA	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr15:102299771C>A	ENST00000561463.1	+	0	7817									DNM1 pseudogene 47																		GTCGGCAGAGCAGGCACAGAG	0.577													ENSG00000259660																																					0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299771C>A				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.577	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0	0	16	16	0	0.00	0.00	C	NG_009149		102299771	+1	4	0	8	0	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	33.33	0.00	SNP	1.000	A	4	8
NACC2	138151	genome.wustl.edu	37	9	138903668	138903668	+	Silent	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr9:138903668G>A	ENST00000371753.1	-	5	1516	c.1458C>T	c.(1456-1458)gcC>gcT	p.A486A	NACC2_ENST00000277554.2_Silent_p.A486A			Q96BF6	NACC2_HUMAN	NACC family member 2, BEN and BTB (POZ) domain containing	486					cellular protein complex localization (GO:0034629)|histone deacetylation (GO:0016575)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle by negative regulation of transcription from RNA polymerase II promoter (GO:1900477)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|posttranscriptional regulation of gene expression (GO:0010608)|protein homooligomerization (GO:0051260)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5						CCTGTGCCGCGGCAGGCGGGA	0.677													ENSG00000148411																																					0													8.0	8.0	8.0					9																	138903668		2160	4188	6348	SO:0001819	synonymous_variant	0			-	BC015649	CCDS6993.1	9q34.3	2013-01-09	2008-10-03	2008-10-03	ENSG00000148411	ENSG00000148411		"""BEN domain containing"", ""BTB/POZ domain containing"""	23846	protein-coding gene	gene with protein product	"""BEN domain containing 9"""	615786	"""BTB (POZ) domain containing 14A"""	BTBD14A		12477932	Standard	NM_144653		Approved	MGC23427, BEND9, BTBD31	uc004cgv.4	Q96BF6	OTTHUMG00000020921	ENST00000371753.1:c.1458C>T	9.37:g.138903668G>A				Silent	SNP	pfam_BTB_POZ,pfam_BEN_domain,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.A486	ENST00000371753.1	37	c.1458	CCDS6993.1	9																																																																																			-	CC2	-	NULL		0.677	NACC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CC2	HGNC	protein_coding	OTTHUMT00000055040.1	0	0	0	44	44	4	0.00	0.00	G	NM_144653		138903668	-1	7	0	9	1	tier1	no_errors	ENST00000277554	ensembl	human	known	74_37	silent	43.75	0.00	SNP	0.021	A	7	9
NEU4	129807	genome.wustl.edu	37	2	242756292	242756292	+	Silent	SNP	G	G	A	rs367892217	byFrequency	TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr2:242756292G>A	ENST00000391969.2	+	4	1116	c.405G>A	c.(403-405)tcG>tcA	p.S135S	NEU4_ENST00000404257.1_Silent_p.S147S|NEU4_ENST00000325935.6_Silent_p.S148S|NEU4_ENST00000405370.1_Silent_p.S135S|NEU4_ENST00000407683.1_Silent_p.S135S	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	135					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		CCGGCCTCTCGTGGGGCAGCG	0.721													ENSG00000204099	G|||	5	0.000998403	0.003	0.0014	5008	,	,		12955	0.0		0.0	False		,,,				2504	0.0																0								G	,,,,	12,4106		0,12,2047	6.0	7.0	7.0		444,405,405,405,441	-3.2	0.0	2		7	0,8142		0,0,4071	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NEU4	NM_001167599.1,NM_001167600.1,NM_001167601.1,NM_001167602.1,NM_080741.2	,,,,	0,12,6118	AA,AG,GG		0.0,0.2914,0.0979	,,,,	148/498,135/485,135/485,135/485,147/497	242756292	12,12248	2059	4071	6130	SO:0001819	synonymous_variant	0			-	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.405G>A	2.37:g.242756292G>A			A8K056|J3KNJ5|Q96D64	Silent	SNP	superfamily_Sialidases	p.S148	ENST00000391969.2	37	c.444	CCDS54442.1	2																																																																																			-	NEU4	-	superfamily_Sialidases		0.721	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NEU4	HGNC	protein_coding	OTTHUMT00000257270.2	0	0	0	105	105	0	0.00	0.00	G	NM_080741		242756292	+1	9	0	28	0	tier1	no_errors	ENST00000325935	ensembl	human	known	74_37	silent	24.32	0.00	SNP	0.943	A	9	28
POTEM	641455	genome.wustl.edu	37	14	20012890	20012890	+	Intron	SNP	A	A	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr14:20012890A>T	ENST00000551509.1	-	4	862				RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						tcgaggttgcagtgagctgtg	0.348													ENSG00000187537																																					0																																										SO:0001627	intron_variant	0			-		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.811-1233T>A	14.37:g.20012890A>T				Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L289Q	ENST00000551509.1	37	c.866	CCDS45076.1	14	.	.	.	.	.	.	.	.	.	.	a	2.357	-0.347586	0.05208	.	.	ENSG00000187537	ENST00000439503	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	T	0.29423	0.0733	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26573	-1.0099	3	.	.	.	.	.	.	.	.	.	.	.	Q	289	.	.	L	-	2	0	POTEM	19082890	0.000000	0.05858	0.016000	0.15963	0.030000	0.12068	-1.894000	0.01607	0.156000	0.19299	0.155000	0.16302	CTG	-	POTEM	-	NULL		0.348	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	0	0	0	21	21	0	0.00	0.00	A	NM_001145442		20012890	-1	16	0	39	0	tier1	no_errors	ENST00000547722	ensembl	human	known	74_37	missense	29.09	0.00	SNP	0.017	T	16	39
KANK1	23189	genome.wustl.edu	37	9	734665	734666	+	Intron	INS	-	-	AA	rs377485461|rs77731420|rs142267604	byFrequency	TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr9:734665_734666insAA	ENST00000382303.1	+	11	3897				KANK1_ENST00000382293.3_Intron|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Intron	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1						negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		gaccctgtctcaaaaaaaaaaT	0.426													ENSG00000107104																																					0																																										SO:0001627	intron_variant	0				AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3246-82->AA	9.37:g.734674_734675dupAA			A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	R	INS	-	NULL	ENST00000382303.1	37	NULL	CCDS34976.1	9																																																																																				KANK1	-	-		0.426	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	0	0	0	46	46	30	0.00	0.00	-	NM_015158		734666	+1	3	2	34	22	tier1	no_errors	ENST00000489369	ensembl	human	known	74_37	rna	8.11	8.33	INS	0.002:0.002	AA	3	34
