#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SVOPL	136306	genome.wustl.edu	37	7	138305823	138305823	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:138305823T>G	ENST00000419765.3	-	13	1354	c.1321A>C	c.(1321-1323)Att>Ctt	p.I441L	SVOPL_ENST00000421622.1_Missense_Mutation_p.I321L|SVOPL_ENST00000463557.1_Intron|SVOPL_ENST00000288513.5_Missense_Mutation_p.I289L|SVOPL_ENST00000436657.1_Missense_Mutation_p.I289L	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	441						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						ATTGCACCAATGCGACACAGG	0.577													ENSG00000157703																																					0													71.0	58.0	62.0					7																	138305823		2203	4300	6503	SO:0001583	missense	0			-	BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.1321A>C	7.37:g.138305823T>G	ENSP00000405482:p.Ile441Leu			Missense_Mutation	SNP	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I289L	ENST00000419765.3	37	c.865	CCDS47721.1	7	.	.	.	.	.	.	.	.	.	.	T	14.50	2.552525	0.45487	.	.	ENSG00000157703	ENST00000288513;ENST00000421622;ENST00000436657;ENST00000419765	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	5.33	5.33	0.75918	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.050050	0.85682	D	0.000000	T	0.59046	0.2165	L	0.38692	1.165	0.43667	D	0.996095	B;B	0.29590	0.19;0.25	B;B	0.30572	0.085;0.117	T	0.56282	-0.8005	10	0.26408	T	0.33	-12.3084	10.0793	0.42379	0.0:0.0852:0.0:0.9148	.	441;289	Q8N434;Q8N434-2	SVOPL_HUMAN;.	L	289;321;289;441	ENSP00000288513:I289L;ENSP00000412830:I321L;ENSP00000417018:I289L;ENSP00000405482:I441L	ENSP00000288513:I289L	I	-	1	0	SVOPL	137956363	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.435000	0.44811	2.014000	0.59158	0.533000	0.62120	ATT	-	SVOPL	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.577	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SVOPL	HGNC	protein_coding	OTTHUMT00000342092.4	0	0	0	46	46	43	0.00	0.00	T	NM_174959		138305823	-1	6	10	32	34	tier1	no_errors	ENST00000288513	ensembl	human	known	74_37	missense	15.79	22.73	SNP	1.000	G	6	32
TMEM63B	55362	genome.wustl.edu	37	6	44118302	44118302	+	Splice_Site	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:44118302C>A	ENST00000259746.9	+	18	1792	c.1609C>A	c.(1609-1611)Ctg>Atg	p.L537M	TMEM63B_ENST00000323267.6_Splice_Site_p.L537M			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	537					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			TCCCTCCAGCCTGGACCTCTT	0.577													ENSG00000137216																																					0													87.0	77.0	80.0					6																	44118302		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1608-1C>A	6.37:g.44118302C>A			B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	pfam_DUF221	p.L537M	ENST00000259746.9	37	c.1609	CCDS34461.1	6	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704564	0.68615	.	.	ENSG00000137216	ENST00000259746;ENST00000323267	T;T	0.34472	1.36;1.36	5.0	3.07	0.35406	Domain of unknown function DUF221 (1);	0.000000	0.64402	D	0.000001	T	0.44685	0.1305	M	0.81341	2.54	0.37131	D	0.901241	D	0.89917	1.0	D	0.91635	0.999	T	0.50558	-0.8814	10	0.66056	D	0.02	.	4.692	0.12785	0.0:0.62:0.0:0.38	.	537	Q5T3F8	TM63B_HUMAN	M	537	ENSP00000259746:L537M;ENSP00000327154:L537M	ENSP00000259746:L537M	L	+	1	2	TMEM63B	44226280	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.588000	0.23924	1.342000	0.45619	0.655000	0.94253	CTG	-	TMEM63B	-	pfam_DUF221		0.577	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	0	0	0	34	34	104	0.00	0.00	C	XM_166410	Missense_Mutation	44118302	+1	10	23	19	24	tier1	no_errors	ENST00000259746	ensembl	human	known	74_37	missense	34.48	47.92	SNP	1.000	A	10	19
FGF3	2248	genome.wustl.edu	37	11	69625374	69625374	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:69625374G>A	ENST00000334134.2	-	3	509	c.419C>T	c.(418-420)aCg>aTg	p.T140M		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	140					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			GGCCCCAGGCGTACTAGACAC	0.667													ENSG00000186895																																					0													27.0	34.0	32.0					11																	69625374		2198	4291	6489	SO:0001583	missense	0			-		CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.419C>T	11.37:g.69625374G>A	ENSP00000334122:p.Thr140Met		Q0VG69	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.T140M	ENST00000334134.2	37	c.419	CCDS8195.1	11	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367857	0.24771	.	.	ENSG00000186895	ENST00000334134	T	0.67171	-0.25	3.92	0.762	0.18454	.	1.696980	0.03694	U	0.247536	T	0.60932	0.2307	N	0.08118	0	0.09310	N	1	D	0.67145	0.996	P	0.57911	0.829	T	0.56092	-0.8036	9	.	.	.	.	8.6882	0.34251	0.0:0.6197:0.296:0.0843	.	140	P11487	FGF3_HUMAN	M	140	ENSP00000334122:T140M	.	T	-	2	0	FGF3	69334555	0.001000	0.12720	0.007000	0.13788	0.003000	0.03518	0.851000	0.27751	0.129000	0.18514	-0.502000	0.04539	ACG	-	FGF3	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam		0.667	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF3	HGNC	protein_coding	OTTHUMT00000396835.1	0	0	0	84	84	55	0.00	0.00	G	NM_005247		69625374	-1	30	15	71	53	tier1	no_errors	ENST00000334134	ensembl	human	known	74_37	missense	29.70	22.06	SNP	0.020	A	30	71
TMEM39B	55116	genome.wustl.edu	37	1	32540672	32540672	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:32540672G>A	ENST00000336294.5	+	2	271	c.125G>A	c.(124-126)cGc>cAc	p.R42H	TMEM39B_ENST00000373634.4_5'UTR|TMEM39B_ENST00000487305.1_3'UTR|TMEM39B_ENST00000427288.1_5'UTR|RP11-277A4.4_ENST00000366152.3_RNA|TMEM39B_ENST00000456834.2_Missense_Mutation_p.R42H	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	42	Ser-rich.					integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GTTCGTTCCCGCACCAGGTAA	0.557													ENSG00000121775																																					0													54.0	55.0	55.0					1																	32540672		692	1591	2283	SO:0001583	missense	0			-	AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.125G>A	1.37:g.32540672G>A	ENSP00000338165:p.Arg42His		B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Missense_Mutation	SNP	pfam_Uncharacterised_TMEM39	p.R42H	ENST00000336294.5	37	c.125	CCDS351.2	1	.	.	.	.	.	.	.	.	.	.	G	31	5.091231	0.94149	.	.	ENSG00000121775	ENST00000336294;ENST00000373633;ENST00000438825;ENST00000456834	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.73583	0.3605	L	0.44542	1.39	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.76386	-0.2978	9	0.66056	D	0.02	-20.0839	18.2567	0.90022	0.0:0.0:1.0:0.0	.	42	Q9GZU3	TM39B_HUMAN	H	42	.	ENSP00000338165:R42H	R	+	2	0	TMEM39B	32313259	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	7.700000	0.84556	2.384000	0.81235	0.655000	0.94253	CGC	-	TMEM39B	-	NULL		0.557	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM39B	HGNC	protein_coding	OTTHUMT00000011489.2	0	0	0	63	63	88	0.00	0.00	G	NM_018056		32540672	+1	9	20	37	86	tier1	no_errors	ENST00000336294	ensembl	human	known	74_37	missense	19.57	18.69	SNP	1.000	A	9	37
TPRX1	284355	genome.wustl.edu	37	19	48305590	48305590	+	Silent	SNP	T	T	C	rs12461263		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:48305590T>C	ENST00000322175.3	-	2	833	c.678A>G	c.(676-678)ccA>ccG	p.P226P	TPRX1_ENST00000543508.1_Silent_p.P216P|TPRX1_ENST00000535759.1_Silent_p.P323P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	226	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		ggcctgggattgggcctggga	0.667													ENSG00000178928																									Esophageal Squamous(123;175 2281 3051 32395)												0													11.0	9.0	9.0					19																	48305590		1972	3929	5901	SO:0001819	synonymous_variant	0			-		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.678A>G	19.37:g.48305590T>C			A5D8Y3|B2RPL5	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.P323	ENST00000322175.3	37	c.969	CCDS33066.1	19																																																																																			rs12461263	TPRX1	-	NULL		0.667	TPRX1-001	KNOWN	basic|CCDS	protein_coding	TPRX1	HGNC	protein_coding	OTTHUMT00000409868.1	0	0	0	148	148	35	0.00	0.00	T	NM_198479		48305590	-1	18	7	80	43	tier1	no_errors	ENST00000535759	ensembl	human	known	74_37	silent	18.37	14.00	SNP	0.035	C	18	80
SLC5A11	115584	genome.wustl.edu	37	16	24895407	24895407	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:24895407C>T	ENST00000347898.3	+	8	1241	c.619C>T	c.(619-621)Cag>Tag	p.Q207*	SLC5A11_ENST00000545376.1_Nonsense_Mutation_p.Q137*|SLC5A11_ENST00000568579.1_Nonsense_Mutation_p.Q137*|SLC5A11_ENST00000539472.1_Nonsense_Mutation_p.Q143*|SLC5A11_ENST00000449109.2_Nonsense_Mutation_p.Q143*|SLC5A11_ENST00000567758.1_Nonsense_Mutation_p.Q172*|SLC5A11_ENST00000424767.2_Nonsense_Mutation_p.Q172*|SLC5A11_ENST00000569071.1_Nonsense_Mutation_p.Q143*|SLC5A11_ENST00000565769.1_Nonsense_Mutation_p.Q143*	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		GGATGCCCTGCAGACGCTGAT	0.607													ENSG00000158865																																					0													195.0	177.0	183.0					16																	24895407		2197	4300	6497	SO:0001587	stop_gained	0			-	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.619C>T	16.37:g.24895407C>T	ENSP00000289932:p.Gln207*			Nonsense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.Q207*	ENST00000347898.3	37	c.619	CCDS10625.1	16	.	.	.	.	.	.	.	.	.	.	C	39	7.608666	0.98387	.	.	ENSG00000158865	ENST00000347898;ENST00000449109;ENST00000424767;ENST00000545376;ENST00000539472	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.0468	0.80725	0.0:1.0:0.0:0.0	.	.	.	.	X	207;143;172;137;143	.	ENSP00000289932:Q207X	Q	+	1	0	SLC5A11	24802908	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	7.538000	0.82048	2.376000	0.81061	0.655000	0.94253	CAG	-	SLC5A11	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.607	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	HGNC	protein_coding	OTTHUMT00000214091.3	0	0	0	22	22	65	0.00	0.00	C	NM_052944		24895407	+1	7	12	9	36	tier1	no_errors	ENST00000347898	ensembl	human	known	74_37	nonsense	43.75	25.00	SNP	1.000	T	7	9
BCL6B	255877	genome.wustl.edu	37	17	6930824	6930824	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:6930824C>T	ENST00000293805.5	+	9	1418	c.1326C>T	c.(1324-1326)tgC>tgT	p.C442C		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	442					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						TCCCACAGTGCGACCCCTGTG	0.597													ENSG00000161940																																					0													38.0	45.0	42.0					17																	6930824		2073	4207	6280	SO:0001819	synonymous_variant	0			-	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.1326C>T	17.37:g.6930824C>T			Q6PCB4	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C442	ENST00000293805.5	37	c.1326	CCDS42248.1	17																																																																																			-	BCL6B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.597	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6B	HGNC	protein_coding	OTTHUMT00000439455.2	0	0	0	69	69	47	0.00	0.00	C	NM_181844		6930824	+1	9	17	30	18	tier1	no_errors	ENST00000293805	ensembl	human	known	74_37	silent	23.08	48.57	SNP	0.983	T	9	30
CTBP2	1488	genome.wustl.edu	37	10	126715774	126715774	+	Intron	SNP	A	A	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:126715774A>T	ENST00000337195.5	-	3	458				CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000309035.6_Silent_p.S185S|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000411419.2_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		ACCGCCCGGGAGATGCAGCCC	0.652													ENSG00000175029																																					0													32.0	35.0	34.0					10																	126715774		2203	4300	6503	SO:0001627	intron_variant	0			-	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+11791T>A	10.37:g.126715774A>T			A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	pfam_D-isomer_2_OHA_DH_D-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.S185	ENST00000337195.5	37	c.555	CCDS7643.1	10																																																																																			-	CTBP2	-	NULL		0.652	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	HGNC	protein_coding	OTTHUMT00000050900.3	0	0	0	71	71	49	0.00	0.00	A	NM_001083914		126715774	-1	11	13	58	42	tier1	no_errors	ENST00000309035	ensembl	human	known	74_37	silent	15.71	23.64	SNP	0.636	T	11	58
DGKE	8526	genome.wustl.edu	37	17	54939227	54939227	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:54939227G>A	ENST00000284061.3	+	10	1540	c.1360G>A	c.(1360-1362)Ggt>Agt	p.G454S		NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	454					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					ATACTGGGGCGGTGGCTGCAG	0.433													ENSG00000153933																																					0													164.0	166.0	165.0					17																	54939227		2203	4300	6503	SO:0001583	missense	0			-	U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.1360G>A	17.37:g.54939227G>A	ENSP00000284061:p.Gly454Ser		Q8TBM4|Q9UKQ3	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.G454S	ENST00000284061.3	37	c.1360	CCDS11590.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.627722	0.96671	.	.	ENSG00000153933	ENST00000284061	T	0.34859	1.34	5.66	5.66	0.87406	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.55625	0.1932	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.972	T	0.45308	-0.9270	10	0.34782	T	0.22	.	19.8076	0.96536	0.0:0.0:1.0:0.0	.	454;454	A1L4Q0;P52429	.;DGKE_HUMAN	S	454	ENSP00000284061:G454S	ENSP00000284061:G454S	G	+	1	0	DGKE	52294226	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.325000	0.96381	2.661000	0.90470	0.650000	0.86243	GGT	-	DGKE	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory		0.433	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKE	HGNC	protein_coding	OTTHUMT00000440601.1	0	0	0	83	83	118	0.00	0.00	G	NM_003647		54939227	+1	16	28	55	99	tier1	no_errors	ENST00000284061	ensembl	human	known	74_37	missense	22.54	21.88	SNP	1.000	A	16	55
ITPR2	3709	genome.wustl.edu	37	12	26775294	26775294	+	Missense_Mutation	SNP	G	G	A	rs369024488		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:26775294G>A	ENST00000381340.3	-	25	3583	c.3167C>T	c.(3166-3168)aCg>aTg	p.T1056M	RP11-666F17.1_ENST00000414098.2_RNA|ITPR2_ENST00000545902.1_5'UTR	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1056					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CCGTAAAAACGTCCTGCCTCC	0.428													ENSG00000123104																																					0								G	MET/THR	0,3830		0,0,1915	115.0	115.0	115.0		3167	5.1	1.0	12		115	1,8259		0,1,4129	no	missense	ITPR2	NM_002223.2	81	0,1,6044	AA,AG,GG		0.0121,0.0,0.0083	possibly-damaging	1056/2702	26775294	1,12089	1915	4130	6045	SO:0001583	missense	0			-	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3167C>T	12.37:g.26775294G>A	ENSP00000370744:p.Thr1056Met		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.T1056M	ENST00000381340.3	37	c.3167	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272191	0.40194	0.0	1.21E-4	ENSG00000123104	ENST00000381340	D	0.91740	-2.9	5.11	5.11	0.69529	.	0.105139	0.64402	D	0.000003	D	0.88526	0.6460	L	0.46157	1.445	0.80722	D	1	B	0.30824	0.296	B	0.21151	0.033	D	0.85787	0.1365	10	0.25751	T	0.34	.	18.7307	0.91734	0.0:0.0:1.0:0.0	.	1056	Q14571	ITPR2_HUMAN	M	1056	ENSP00000370744:T1056M	ENSP00000370744:T1056M	T	-	2	0	ITPR2	26666561	1.000000	0.71417	0.958000	0.39756	0.977000	0.68977	7.722000	0.84778	2.659000	0.90383	0.650000	0.86243	ACG	-	ITPR2	-	superfamily_ARM-type_fold		0.428	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	0	0	0	37	37	85	0.00	0.00	G	NM_002223		26775294	-1	7	23	24	58	tier1	no_errors	ENST00000381340	ensembl	human	known	74_37	missense	22.58	28.40	SNP	0.999	A	7	24
KIF3B	9371	genome.wustl.edu	37	20	30898718	30898718	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:30898718C>T	ENST00000375712.3	+	2	1305	c.1138C>T	c.(1138-1140)Cga>Tga	p.R380*	KIF3B_ENST00000418717.2_Intron	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	380					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GAGGAAGAGGCGAGAGAAGCG	0.572													ENSG00000101350																																					0													53.0	51.0	52.0					20																	30898718		2203	4300	6503	SO:0001587	stop_gained	0			-	AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1138C>T	20.37:g.30898718C>T	ENSP00000364864:p.Arg380*		B2RMP4|B4DSR5|E1P5M5	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R380*	ENST00000375712.3	37	c.1138	CCDS13200.1	20	.	.	.	.	.	.	.	.	.	.	C	37	6.280443	0.97440	.	.	ENSG00000101350	ENST00000375712	.	.	.	4.94	3.96	0.45880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	13.8182	0.63306	0.2378:0.7622:0.0:0.0	.	.	.	.	X	380	.	ENSP00000364864:R380X	R	+	1	2	KIF3B	30362379	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.697000	0.54764	2.583000	0.87209	0.462000	0.41574	CGA	-	KIF3B	-	superfamily_P-loop_NTPase		0.572	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	0	0	0	23	23	66	0.00	0.00	C	NM_004798		30898718	+1	11	16	19	43	tier1	no_errors	ENST00000375712	ensembl	human	known	74_37	nonsense	36.67	25.81	SNP	1.000	T	11	19
FIGLA	344018	genome.wustl.edu	37	2	71012570	71012570	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:71012570T>A	ENST00000332372.6	-	3	590	c.586A>T	c.(586-588)Att>Ttt	p.I196F		NM_001004311.3	NP_001004311.2	Q6QHK4	FIGLA_HUMAN	folliculogenesis specific basic helix-loop-helix	196					multicellular organismal development (GO:0007275)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			endometrium(2)|lung(3)	5						GGGGAGATAATTTCAGTCGTA	0.433													ENSG00000183733																																					0													182.0	180.0	180.0					2																	71012570		1998	4162	6160	SO:0001583	missense	0			-	BC039536	CCDS46320.1	2p13.3	2013-05-21			ENSG00000183733	ENSG00000183733		"""Basic helix-loop-helix proteins"""	24669	protein-coding gene	gene with protein product	"""factor in the germline alpha"""	608697				12468641	Standard	NM_001004311		Approved	bHLHc8	uc002she.1	Q6QHK4	OTTHUMG00000153440	ENST00000332372.6:c.586A>T	2.37:g.71012570T>A	ENSP00000333097:p.Ile196Phe			Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.I196F	ENST00000332372.6	37	c.586	CCDS46320.1	2	.	.	.	.	.	.	.	.	.	.	T	9.794	1.178585	0.21787	.	.	ENSG00000183733	ENST00000332372	D	0.96200	-3.94	4.12	1.38	0.22167	.	1.589190	0.04151	N	0.321366	D	0.88403	0.6427	N	0.08118	0	0.09310	N	1	B	0.19583	0.037	B	0.15870	0.014	T	0.79502	-0.1777	10	0.29301	T	0.29	.	6.1325	0.20213	0.0:0.6817:0.0:0.3183	.	196	Q6QHK4	FIGLA_HUMAN	F	196	ENSP00000333097:I196F	ENSP00000333097:I196F	I	-	1	0	FIGLA	70866078	0.000000	0.05858	0.013000	0.15412	0.009000	0.06853	-0.177000	0.09796	0.308000	0.22923	-0.137000	0.14449	ATT	-	FIGLA	-	NULL		0.433	FIGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGLA	HGNC	protein_coding	OTTHUMT00000331214.1	0	0	0	63	63	69	0.00	0.00	T	NM_001004311		71012570	-1	23	23	68	46	tier1	no_errors	ENST00000332372	ensembl	human	known	74_37	missense	25.27	33.33	SNP	0.015	A	23	68
LOC150776	150776	genome.wustl.edu	37	2	132277119	132277119	+	RNA	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:132277119G>A	ENST00000438378.2	+	0	2188					NR_026922.1																						TCAGCGAAGCGCAGCTTAGGC	0.562													ENSG00000152117																																					0																																												0			-																													2.37:g.132277119G>A				R	SNP	-	NULL	ENST00000438378.2	37	NULL		2																																																																																			-	AC093838.4	-	-		0.562	AC093838.4-001	KNOWN	basic	processed_transcript	LOC150776	Clone_based_vega_gene	pseudogene	OTTHUMT00000331819.7	0	0	0	30	30	49	0.00	0.00	G			132277119	+1	6	6	21	35	tier1	no_errors	ENST00000438378	ensembl	human	known	74_37	rna	22.22	14.63	SNP	0.995	A	6	21
DTYMK	1841	genome.wustl.edu	37	2	242615580	242615580	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:242615580T>C	ENST00000305784.2	-	5	808	c.601A>G	c.(601-603)Act>Gct	p.T201A		NM_001165031.1|NM_012145.3	NP_001158503.1|NP_036277.2	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)	201					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|cellular response to growth factor stimulus (GO:0071363)|dTDP biosynthetic process (GO:0006233)|dTTP biosynthetic process (GO:0006235)|myoblast differentiation (GO:0045445)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside monophosphate phosphorylation (GO:0046940)|nucleotide phosphorylation (GO:0046939)|response to cadmium ion (GO:0046686)|response to estrogen (GO:0043627)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|nucleoside phosphate kinase activity (GO:0050145)|thymidylate kinase activity (GO:0004798)			NS(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		TCTGTGGCAGTGCGGATGGCG	0.612													ENSG00000168393																																					0													60.0	54.0	56.0					2																	242615580		2203	4296	6499	SO:0001583	missense	0			-	X54729	CCDS2552.1	2q37	2008-02-05			ENSG00000168393	ENSG00000168393	2.7.4.9		3061	protein-coding gene	gene with protein product	"""dTMP kinase"", ""thymidylate (dTMP) kinase"""	188345				2017365, 8024690	Standard	NM_001165031		Approved	CDC8, TYMK, TMPK	uc002wbz.2	P23919	OTTHUMG00000133409	ENST00000305784.2:c.601A>G	2.37:g.242615580T>C	ENSP00000304802:p.Thr201Ala		B7ZW70|Q6FGX1|Q9BUX4	Missense_Mutation	SNP	superfamily_P-loop_NTPase,tigrfam_Thymidylate_kinase	p.T201A	ENST00000305784.2	37	c.601	CCDS2552.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.792|2.792	-0.251124|-0.251124	0.05867|0.05867	.|.	.|.	ENSG00000168393|ENSG00000168393	ENST00000445261|ENST00000305784	.|.	.|.	.|.	5.37|5.37	-0.494|-0.494	0.12034|0.12034	.|.	.|1.970280	.|0.02083	.|N	.|0.052533	T|T	0.17066|0.17066	0.0410|0.0410	N|N	0.04880|0.04880	-0.145|-0.145	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.04013	.|0.001;0.0	T|T	0.15954|0.15954	-1.0419|-1.0419	5|9	.|0.09590	.|T	.|0.72	0.1549|0.1549	5.902|5.902	0.18972|0.18972	0.1338:0.5541:0.0:0.3121|0.1338:0.5541:0.0:0.3121	.|.	.|177;201	.|B7ZW70;P23919	.|.;KTHY_HUMAN	R|A	158|201	.|.	.|ENSP00000304802:T201A	H|T	-|-	2|1	0|0	DTYMK|DTYMK	242264253|242264253	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.040000|-0.040000	0.12104|0.12104	-0.043000|-0.043000	0.13513|0.13513	-0.297000|-0.297000	0.09499|0.09499	CAC|ACT	-	DTYMK	-	superfamily_P-loop_NTPase		0.612	DTYMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTYMK	HGNC	protein_coding	OTTHUMT00000257266.2	0	0	0	42	42	39	0.00	0.00	T	NM_012145		242615580	-1	16	10	13	26	tier1	no_errors	ENST00000305784	ensembl	human	known	74_37	missense	55.17	27.78	SNP	0.000	C	16	13
ZNF518B	85460	genome.wustl.edu	37	4	10447632	10447632	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:10447632C>T	ENST00000326756.3	-	3	759	c.321G>A	c.(319-321)gcG>gcA	p.A107A		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	107					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						CAACATGAGTCGCACTGGAAT	0.413													ENSG00000178163																																					0													98.0	105.0	103.0					4																	10447632		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.321G>A	4.37:g.10447632C>T			Q96LN8	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A107	ENST00000326756.3	37	c.321	CCDS33960.1	4																																																																																			-	ZNF518B	-	NULL		0.413	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1	0	0	0	27	27	91	0.00	0.00	C	NM_053042		10447632	-1	12	12	18	40	tier1	no_errors	ENST00000326756	ensembl	human	known	74_37	silent	40.00	23.08	SNP	0.000	T	12	18
SP3	6670	genome.wustl.edu	37	2	174774931	174774931	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:174774931T>C	ENST00000310015.6	-	7	2614	c.2084A>G	c.(2083-2085)cAc>cGc	p.H695R	SP3_ENST00000418194.2_Missense_Mutation_p.H627R|SP3_ENST00000455789.2_Missense_Mutation_p.H642R	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	695					B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)		EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			TTTGGCAAGGTGGTCACTTCT	0.348													ENSG00000172845																																					0													105.0	102.0	103.0					2																	174774931		2203	4300	6503	SO:0001583	missense	0			-	M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.2084A>G	2.37:g.174774931T>C	ENSP00000310301:p.His695Arg		A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Galactose-bd-like,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H695R	ENST00000310015.6	37	c.2084	CCDS2254.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.52|11.52	1.663393|1.663393	0.29515|0.29515	.|.	.|.	ENSG00000172845|ENSG00000172845	ENST00000310015;ENST00000455789;ENST00000418194|ENST00000416195	T;T;T|.	0.70164|.	-0.46;-0.46;-0.46|.	5.14|5.14	5.14|5.14	0.70334|0.70334	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72374|0.72374	0.3452|0.3452	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	P;D;D|.	0.89917|.	0.955;0.998;1.0|.	P;D;D|.	0.97110|.	0.77;0.939;1.0|.	T|T	0.72297|0.72297	-0.4335|-0.4335	10|5	0.87932|.	D|.	0|.	.|.	15.2595|15.2595	0.73610|0.73610	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	692;695;642|.	B7ZLN9;Q02447;Q02447-6|.	.;SP3_HUMAN;.|.	R|A	695;642;627|652	ENSP00000310301:H695R;ENSP00000388903:H642R;ENSP00000406140:H627R|.	ENSP00000310301:H695R|.	H|T	-|-	2|1	0|0	SP3|SP3	174483177|174483177	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.997000|7.997000	0.88414|0.88414	2.069000|2.069000	0.61940|0.61940	0.455000|0.455000	0.32223|0.32223	CAC|ACC	-	SP3	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.348	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP3	HGNC	protein_coding	OTTHUMT00000255452.1	0	0	0	37	37	72	0.00	0.00	T	NM_003111		174774931	-1	14	28	36	65	tier1	no_errors	ENST00000310015	ensembl	human	known	74_37	missense	28.00	30.11	SNP	1.000	C	14	36
CCDC87	55231	genome.wustl.edu	37	11	66360012	66360012	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:66360012C>T	ENST00000333861.3	-	1	542	c.475G>A	c.(475-477)Gcc>Acc	p.A159T	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	159					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CAGTCCCTGGCGAGGCTGGCG	0.632													ENSG00000182791																																					0													48.0	48.0	48.0					11																	66360012		2200	4295	6495	SO:0001583	missense	0			-	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.475G>A	11.37:g.66360012C>T	ENSP00000328487:p.Ala159Thr		Q8NE76	Missense_Mutation	SNP	pfam_MAP65_Ase1_PRC1	p.A159T	ENST00000333861.3	37	c.475	CCDS8145.1	11	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283456	0.80803	.	.	ENSG00000182791	ENST00000333861	T	0.46451	0.87	5.2	5.2	0.72013	.	0.000000	0.49916	D	0.000124	T	0.64125	0.2570	M	0.75447	2.3	0.44719	D	0.997718	D	0.89917	1.0	D	0.91635	0.999	T	0.66709	-0.5855	10	0.72032	D	0.01	.	14.1172	0.65161	0.0:1.0:0.0:0.0	.	159	Q9NVE4	CCD87_HUMAN	T	159	ENSP00000328487:A159T	ENSP00000328487:A159T	A	-	1	0	CCDC87	66116588	0.998000	0.40836	1.000000	0.80357	0.469000	0.32828	0.625000	0.24477	2.706000	0.92434	0.655000	0.94253	GCC	-	CCDC87	-	NULL		0.632	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC87	HGNC	protein_coding	OTTHUMT00000393825.1	0	0	1	42	42	72	0.00	1.37	C	NM_018219		66360012	-1	10	20	18	49	tier1	no_errors	ENST00000333861	ensembl	human	known	74_37	missense	35.71	28.99	SNP	1.000	T	10	18
TSIX	9383	genome.wustl.edu	37	X	73046604	73046604	+	lincRNA	SNP	T	T	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chrX:73046604T>G	ENST00000604411.1	+	0	34565				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		TCCATCTAGGTAGGCTTTGTG	0.512													ENSG00000229807																																					0													161.0	147.0	151.0					X																	73046604		876	1991	2867			0			-			Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73046604T>G				R	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			-	XIST	-	-		0.512	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	0	0	0	49	49	90	0.00	0.00	T	NR_003255		73046604	-1	15	52	11	34	tier1	no_errors	ENST00000421322	ensembl	human	known	74_37	rna	57.69	60.47	SNP	0.000	G	15	11
KIF23	9493	genome.wustl.edu	37	15	69732777	69732777	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:69732777G>A	ENST00000260363.4	+	17	2135	c.2018G>A	c.(2017-2019)cGa>cAa	p.R673Q	KIF23_ENST00000558585.1_Missense_Mutation_p.R490Q|KIF23_ENST00000537891.1_Missense_Mutation_p.R490Q|KIF23_ENST00000559279.1_Missense_Mutation_p.R673Q|KIF23_ENST00000352331.4_Missense_Mutation_p.R673Q|KIF23_ENST00000395392.2_Missense_Mutation_p.R673Q	NM_138555.2	NP_612565.1	Q02241	KIF23_HUMAN	kinesin family member 23	673					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle elongation (GO:0000022)|positive regulation of cytokinesis (GO:0032467)|spindle midzone assembly involved in mitosis (GO:0051256)	centralspindlin complex (GO:0097149)|centrosome (GO:0005813)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercellular bridge (GO:0045171)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(6)|prostate(2)|skin(1)	21						TCTCGGGAGCGAGATCGAGAA	0.388													ENSG00000137807																																					0													79.0	83.0	82.0					15																	69732777		2199	4298	6497	SO:0001583	missense	0			-	X67155	CCDS32278.1, CCDS32279.1	15q23	2008-03-03	2003-01-13	2003-01-17		ENSG00000137807		"""Kinesins"""	6392	protein-coding gene	gene with protein product		605064	"""kinesin-like 5 (mitotic kinesin-like protein 1)"""	KNSL5		1406973	Standard	NM_138555		Approved	MKLP1, MKLP-1	uc002asb.3	Q02241		ENST00000260363.4:c.2018G>A	15.37:g.69732777G>A	ENSP00000260363:p.Arg673Gln		Q8WVP0	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R673Q	ENST00000260363.4	37	c.2018	CCDS32278.1	15	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751567	0.69533	.	.	ENSG00000137807	ENST00000260363;ENST00000352331;ENST00000395392;ENST00000537891	T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0	5.32	5.32	0.75619	.	0.234670	0.42294	D	0.000725	T	0.49695	0.1572	N	0.19112	0.55	0.44098	D	0.99686	B;D;D	0.63880	0.265;0.993;0.99	B;P;P	0.48400	0.047;0.576;0.505	T	0.38972	-0.9636	10	0.13108	T	0.6	.	11.7768	0.51991	0.0807:0.0:0.9193:0.0	.	490;673;673	B4E1K0;Q02241-2;Q02241	.;.;KIF23_HUMAN	Q	673;673;673;490	ENSP00000260363:R673Q;ENSP00000304978:R673Q;ENSP00000378790:R673Q;ENSP00000442969:R490Q	ENSP00000260363:R673Q	R	+	2	0	KIF23	67519831	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	3.052000	0.49893	2.641000	0.89580	0.591000	0.81541	CGA	-	KIF23	-	NULL		0.388	KIF23-201	KNOWN	basic|CCDS	protein_coding	KIF23	HGNC	protein_coding		0	0	0	44	44	95	0.00	0.00	G			69732777	+1	11	26	27	67	tier1	no_errors	ENST00000260363	ensembl	human	known	74_37	missense	28.95	27.96	SNP	1.000	A	11	27
SRP68	6730	genome.wustl.edu	37	17	74053539	74053539	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:74053539T>A	ENST00000307877.2	-	8	1084	c.923A>T	c.(922-924)gAc>gTc	p.D308V	SRP68_ENST00000539137.1_Missense_Mutation_p.D270V|SRP68_ENST00000355113.5_Missense_Mutation_p.D207V	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	308					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						GCGCACTTTGTCAATCTTCAC	0.453													ENSG00000167881																																					0													220.0	178.0	192.0					17																	74053539		2203	4300	6503	SO:0001583	missense	0			-	AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.923A>T	17.37:g.74053539T>A	ENSP00000312066:p.Asp308Val		B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Missense_Mutation	SNP	NULL	p.D308V	ENST00000307877.2	37	c.923	CCDS11738.1	17	.	.	.	.	.	.	.	.	.	.	T	26.6	4.750295	0.89753	.	.	ENSG00000167881	ENST00000411758;ENST00000539137;ENST00000540937;ENST00000307877;ENST00000304220;ENST00000355113	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	L	0.45581	1.43	0.80722	D	1	D;D	0.63880	0.993;0.993	P;P	0.57776	0.827;0.827	T	0.63247	-0.6680	9	0.33940	T	0.23	-30.8537	15.8426	0.78861	0.0:0.0:0.0:1.0	.	270;308	G3V1U4;Q9UHB9	.;SRP68_HUMAN	V	48;270;308;308;277;207	.	ENSP00000307756:D277V	D	-	2	0	SRP68	71565134	1.000000	0.71417	0.994000	0.49952	0.794000	0.44872	7.641000	0.83368	2.203000	0.70933	0.533000	0.62120	GAC	-	SRP68	-	NULL		0.453	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP68	HGNC	protein_coding	OTTHUMT00000449487.1	0	0	0	103	103	127	0.00	0.00	T	NM_014230		74053539	-1	40	41	98	92	tier1	no_errors	ENST00000307877	ensembl	human	known	74_37	missense	28.78	30.83	SNP	1.000	A	40	98
SRRM4	84530	genome.wustl.edu	37	12	119592120	119592120	+	Silent	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:119592120G>T	ENST00000267260.4	+	12	1852	c.1464G>T	c.(1462-1464)cgG>cgT	p.R488R		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	488	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						GGAGACGTCGGTCCTACTCGC	0.672													ENSG00000139767																																					0													16.0	21.0	20.0					12																	119592120		1856	4091	5947	SO:0001819	synonymous_variant	0			-	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1464G>T	12.37:g.119592120G>T			A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Silent	SNP	NULL	p.R488	ENST00000267260.4	37	c.1464	CCDS44994.1	12																																																																																			-	SRRM4	-	NULL		0.672	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM4	HGNC	protein_coding	OTTHUMT00000401640.2	0	0	0	158	158	23	0.00	0.00	G	NM_194286		119592120	+1	48	6	105	10	tier1	no_errors	ENST00000267260	ensembl	human	known	74_37	silent	31.17	37.50	SNP	0.998	T	48	105
F5	2153	genome.wustl.edu	37	1	169524539	169524539	+	Silent	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:169524539G>T	ENST00000367797.3	-	7	1200	c.999C>A	c.(997-999)acC>acA	p.T333T	F5_ENST00000546081.1_Silent_p.T196T|F5_ENST00000367796.3_Silent_p.T333T	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	333					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TAAGATTCCTGGTTTTCTTTG	0.413													ENSG00000198734																																					0													108.0	101.0	103.0					1																	169524539		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.999C>A	1.37:g.169524539G>T			A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.T333	ENST00000367797.3	37	c.999	CCDS1281.1	1																																																																																			-	F5	-	NULL		0.413	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	0	0	0	43	43	80	0.00	0.00	G	NM_000130		169524539	-1	17	22	47	67	tier1	no_errors	ENST00000367797	ensembl	human	known	74_37	silent	26.56	24.72	SNP	0.065	T	17	47
GBA2	57704	genome.wustl.edu	37	9	35744370	35744370	+	Missense_Mutation	SNP	C	C	T	rs192753525		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:35744370C>T	ENST00000378103.3	-	3	1014	c.491G>A	c.(490-492)cGt>cAt	p.R164H	GBA2_ENST00000378094.4_Missense_Mutation_p.R164H|GBA2_ENST00000467252.1_5'Flank|GBA2_ENST00000545786.1_Missense_Mutation_p.R164H	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	164					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCTCCAGCCACGGGTAATAGT	0.537													ENSG00000070610	C|||	1	0.000199681	0.0	0.0014	5008	,	,		20660	0.0		0.0	False		,,,				2504	0.0																0													62.0	56.0	58.0					9																	35744370		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.491G>A	9.37:g.35744370C>T	ENSP00000367343:p.Arg164His		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	pfam_Glucosylceramidase,pfam_GBA2_N,superfamily_6-hairpin_glycosidase-like,pirsf_Beta_glucosidase_GBA2-type	p.R164H	ENST00000378103.3	37	c.491	CCDS6589.1	9	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	32	5.131528	0.94473	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.42	3.6	0.41247	Beta-glucosidase, GBA2 type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84674	0.5524	M	0.93328	3.405	0.58432	D	0.999999	P;D;P	0.89917	0.766;1.0;0.804	B;D;B	0.91635	0.158;0.999;0.244	D	0.86860	0.2029	9	0.72032	D	0.01	-9.7225	11.515	0.50515	0.0:0.8549:0.0:0.1451	.	164;164;164	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	H	164	.	ENSP00000367334:R164H	R	-	2	0	GBA2	35734370	1.000000	0.71417	0.987000	0.45799	0.984000	0.73092	7.520000	0.81821	0.871000	0.35750	0.563000	0.77884	CGT	rs192753525	GBA2	-	pfam_GBA2_N,pirsf_Beta_glucosidase_GBA2-type		0.537	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GBA2	HGNC	protein_coding	OTTHUMT00000055456.1	0	0	0	36	36	151	0.00	0.00	C	NM_020944		35744370	-1	7	35	27	185	tier1	no_errors	ENST00000545786	ensembl	human	known	74_37	missense	20.59	15.91	SNP	0.984	T	7	27
ZNF512B	57473	genome.wustl.edu	37	20	62632529	62632529	+	Intron	SNP	A	A	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:62632529A>T	ENST00000450537.1	-	2	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.I375F			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GTCTGTCAGGATTTACATCAG	0.577													ENSG00000101161																																					0													94.0	79.0	84.0					20																	62632529		2203	4300	6503	SO:0001627	intron_variant	0			-	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-33221T>A	20.37:g.62632529A>T			Q08AK9|Q9ULM4	Missense_Mutation	SNP	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.I375F	ENST00000450537.1	37	c.1123	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	A	17.20	3.328547	0.60743	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.33438	1.41;1.41	5.52	4.43	0.53597	Tetratricopeptide-like helical (1);	0.095552	0.64402	D	0.000001	T	0.42063	0.1186	M	0.89287	3.02	0.80722	D	1	B;B	0.21147	0.052;0.003	B;B	0.28709	0.093;0.015	T	0.31971	-0.9924	10	0.37606	T	0.19	.	11.1883	0.48671	0.9282:0.0:0.0718:0.0	.	375;375	O94906-2;O94906	.;PRP6_HUMAN	F	375	ENSP00000266079:I375F;ENSP00000446216:I375F	ENSP00000266079:I375F	I	+	1	0	PRPF6	62102973	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.820000	0.69250	0.943000	0.37553	0.533000	0.62120	ATT	-	PRPF6	-	NULL		0.577	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	HGNC	protein_coding	OTTHUMT00000080246.1	0	0	0	26	26	99	0.00	0.00	A	NM_020713		62632529	+1	5	38	17	74	tier1	no_errors	ENST00000266079	ensembl	human	known	74_37	missense	22.73	33.93	SNP	1.000	T	5	17
NBEAL1	65065	genome.wustl.edu	37	2	203991416	203991416	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:203991416G>A	ENST00000449802.1	+	21	3368	c.3035G>A	c.(3034-3036)cGt>cAt	p.R1012H		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1012										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ATTTGGAACCGTGGAGATTTT	0.328													ENSG00000144426																																					0													96.0	73.0	80.0					2																	203991416		692	1591	2283	SO:0001583	missense	0			-	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3035G>A	2.37:g.203991416G>A	ENSP00000399903:p.Arg1012His		A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1012H	ENST00000449802.1	37	c.3035	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	G	12.52	1.964117	0.34659	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.53640	0.61	5.09	3.28	0.37604	.	.	.	.	.	T	0.36138	0.0956	L	0.43152	1.355	0.38571	D	0.949953	B	0.06786	0.001	B	0.06405	0.002	T	0.16158	-1.0412	9	0.12430	T	0.62	.	11.3572	0.49623	0.1515:0.0:0.8485:0.0	.	1012	Q6ZS30	NBEL1_HUMAN	H	1012	ENSP00000399903:R1012H	ENSP00000344985:R1012H	R	+	2	0	NBEAL1	203699661	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.578000	0.46051	0.648000	0.30732	0.467000	0.42956	CGT	-	NBEAL1	-	NULL		0.328	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	0	0	0	78	78	120	0.00	0.00	G			203991416	+1	23	28	37	56	tier1	no_errors	ENST00000449802	ensembl	human	known	74_37	missense	38.33	33.33	SNP	1.000	A	23	37
ANKFN1	162282	genome.wustl.edu	37	17	54588480	54588480	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:54588480G>A	ENST00000566473.2	+	20	3300	c.3300G>A	c.(3298-3300)gcG>gcA	p.A1100A				Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	0										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						CCTACGCAGCGGCCGTGGTGG	0.677													ENSG00000153930																																					0																																										SO:0001819	synonymous_variant	0			-	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000566473.2:c.3300G>A	17.37:g.54588480G>A				Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Fibronectin_type3,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3	p.A1100	ENST00000566473.2	37	c.3300		17																																																																																			-	ANKFN1	-	NULL		0.677	ANKFN1-002	NOVEL	basic|exp_conf	protein_coding	ANKFN1	HGNC	protein_coding	OTTHUMT00000435456.2	0	0	0	75	75	19	0.00	0.00	G	NM_153228		54588480	+1	28	5	59	14	tier1	no_errors	ENST00000566473	ensembl	human	novel	74_37	silent	32.18	26.32	SNP	0.000	A	28	59
CABP1	9478	genome.wustl.edu	37	12	121098562	121098562	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:121098562C>T	ENST00000316803.3	+	4	992	c.858C>T	c.(856-858)ttC>ttT	p.F286F	CABP1_ENST00000288616.3_Silent_p.F143F|CABP1_ENST00000453000.1_Silent_p.F222F|CABP1_ENST00000351200.2_Silent_p.F83F	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1	286	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTGATGACTTCGTGGAGCTAA	0.512													ENSG00000157782																																					0													232.0	224.0	227.0					12																	121098562		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.858C>T	12.37:g.121098562C>T			O95663|Q8N6H5|Q9NZU8	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.F286	ENST00000316803.3	37	c.858	CCDS31913.1	12																																																																																			-	CABP1	-	NULL		0.512	CABP1-001	KNOWN	basic|CCDS	protein_coding	CABP1	HGNC	protein_coding	OTTHUMT00000345822.1	0	0	0	71	71	145	0.00	0.00	C	NM_001033677		121098562	+1	15	24	58	107	tier1	no_errors	ENST00000316803	ensembl	human	known	74_37	silent	20.55	18.32	SNP	1.000	T	15	58
OR5V1	81696	genome.wustl.edu	37	6	29323056	29323056	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:29323056C>T	ENST00000377154.1	-	4	1216	c.917G>A	c.(916-918)aGc>aAc	p.S306N	OR5V1_ENST00000543825.1_Missense_Mutation_p.S306N			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CTGCCACTTGCTCCCTATAGT	0.373													ENSG00000243729																									Ovarian(32;43 883 21137 32120 42650)												0													91.0	90.0	90.0					6																	29323056		2203	4300	6503	SO:0001583	missense	0			-		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.917G>A	6.37:g.29323056C>T	ENSP00000366359:p.Ser306Asn		A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S306N	ENST00000377154.1	37	c.917	CCDS4657.1	6	.	.	.	.	.	.	.	.	.	.	C	9.588	1.125350	0.20959	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.38240	1.15;1.15	4.28	0.375	0.16188	.	.	.	.	.	T	0.03827	0.0108	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44421	-0.9329	9	0.13853	T	0.58	18.1758	4.0937	0.09982	0.1623:0.5601:0.0:0.2776	.	306	Q9UGF6	OR5V1_HUMAN	N	306	ENSP00000366359:S306N;ENSP00000443309:S306N	ENSP00000366356:S306N	S	-	2	0	OR5V1	29431035	0.002000	0.14202	0.002000	0.10522	0.430000	0.31655	0.097000	0.15168	-0.058000	0.13177	-0.324000	0.08512	AGC	-	OR5V1	-	NULL		0.373	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5V1	HGNC	protein_coding	OTTHUMT00000076398.3	0	0	0	66	66	103	0.00	0.00	C			29323056	-1	20	26	44	45	tier1	no_errors	ENST00000377154	ensembl	human	known	74_37	missense	31.25	36.62	SNP	0.000	T	20	44
TTC24	164118	genome.wustl.edu	37	1	156555138	156555138	+	Intron	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:156555138T>C	ENST00000368237.3	+	7	1456				AL365181.1_ENST00000581084.1_RNA|TTC24_ENST00000478081.1_3'UTR|TTC24_ENST00000368236.3_Intron			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CGCCTTCCTGTTGTCATTTCT	0.592													ENSG00000187862																																					0																																										SO:0001627	intron_variant	0			-		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.1456+115T>C	1.37:g.156555138T>C			Q5T3H7	R	SNP	-	NULL	ENST00000368237.3	37	NULL	CCDS53379.1	1																																																																																			-	TTC24	-	-		0.592	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1	0	0	0	36	36	70	0.00	0.00	T	XM_089384		156555138	+1	6	10	22	57	tier1	no_errors	ENST00000478081	ensembl	human	known	74_37	rna	21.43	14.93	SNP	0.000	C	6	22
FRMPD3	84443	genome.wustl.edu	37	X	106843776	106843776	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chrX:106843776C>T	ENST00000276185.4	+	16	2606	c.2606C>T	c.(2605-2607)cCg>cTg	p.P869L				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	869						cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						CTTGGGCGCCCGGATCCCAAC	0.652													ENSG00000147234																																					0													30.0	29.0	29.0					X																	106843776		876	1990	2866	SO:0001583	missense	0			-	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.2606C>T	X.37:g.106843776C>T	ENSP00000276185:p.Pro869Leu		Q96JK8	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.P869L	ENST00000276185.4	37	c.2606		X	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323383	0.41096	.	.	ENSG00000147234	ENST00000276185;ENST00000439554	T;T	0.13901	2.55;2.55	4.54	3.6	0.41247	.	0.403752	0.24445	N	0.038466	T	0.11239	0.0274	N	0.19112	0.55	0.33228	D	0.555581	.	.	.	.	.	.	T	0.12218	-1.0556	8	0.39692	T	0.17	.	8.7992	0.34898	0.43:0.57:0.0:0.0	.	.	.	.	L	869;817	ENSP00000276185:P869L;ENSP00000398668:P817L	ENSP00000276185:P869L	P	+	2	0	FRMPD3	106730432	0.986000	0.35501	0.994000	0.49952	0.812000	0.45895	2.754000	0.47532	2.090000	0.63153	0.377000	0.23210	CCG	-	FRMPD3	-	NULL		0.652	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	HGNC	protein_coding		0	0	0	9	9	53	0.00	0.00	C	XM_042978		106843776	+1	7	35	5	22	tier1	no_errors	ENST00000276185	ensembl	human	known	74_37	missense	58.33	61.40	SNP	0.990	T	7	5
VWA5B1	127731	genome.wustl.edu	37	1	20669069	20669069	+	Missense_Mutation	SNP	C	C	T	rs535112388		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:20669069C>T	ENST00000375079.2	+	15	2474	c.2278C>T	c.(2278-2280)Cgg>Tgg	p.R760W	VWA5B1_ENST00000525343.1_3'UTR|VWA5B1_ENST00000289815.8_Missense_Mutation_p.R760W|VWA5B1_ENST00000375083.4_Missense_Mutation_p.R760W	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	760						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TGTGAGAGAGCGGACTTCTGA	0.652													ENSG00000158816																																					0													32.0	35.0	34.0					1																	20669069		692	1591	2283	SO:0001583	missense	0			-	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2278C>T	1.37:g.20669069C>T	ENSP00000364220:p.Arg760Trp		A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R760W	ENST00000375079.2	37	c.2278		1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.357374	0.41801	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000375079	T;T;T	0.14144	2.53;2.53;2.53	4.2	0.839	0.18907	.	2.536670	0.01560	N	0.020071	T	0.11324	0.0276	N	0.08118	0	0.09310	N	1	P;B;D	0.56968	0.914;0.003;0.978	B;B;B	0.43916	0.076;0.001;0.436	T	0.48525	-0.9028	10	0.62326	D	0.03	-0.0802	12.6788	0.56910	0.0:0.4134:0.5866:0.0	.	760;760;760	Q5TIE3;Q5TIE3-5;Q5TIE3-2	VW5B1_HUMAN;.;.	W	760	ENSP00000289815:R760W;ENSP00000364224:R760W;ENSP00000364220:R760W	ENSP00000289815:R760W	R	+	1	2	VWA5B1	20541656	0.370000	0.25047	0.000000	0.03702	0.003000	0.03518	1.221000	0.32503	0.040000	0.15660	-0.745000	0.03516	CGG	-	VWA5B1	-	NULL		0.652	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4	0	0	0	98	98	75	0.00	0.00	C	XM_001722222		20669069	+1	21	18	71	57	tier1	no_errors	ENST00000289815	ensembl	human	known	74_37	missense	22.83	23.68	SNP	0.001	T	21	71
BCAM	4059	genome.wustl.edu	37	19	45316842	45316842	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:45316842G>A	ENST00000270233.6	+	6	771	c.749G>A	c.(748-750)cGc>cAc	p.R250H	BCAM_ENST00000589651.1_Missense_Mutation_p.R250H	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	250	Ig-like V-type 2.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)	p.R250H(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CGCCACGGCCGCCTGGACAGC	0.667													ENSG00000187244																																					1	Substitution - Missense(1)	large_intestine(1)											39.0	45.0	43.0					19																	45316842		2194	4295	6489	SO:0001583	missense	0			-	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.749G>A	19.37:g.45316842G>A	ENSP00000270233:p.Arg250His		A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R250H	ENST00000270233.6	37	c.749	CCDS12644.1	19	.	.	.	.	.	.	.	.	.	.	.	8.941	0.965821	0.18583	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.60548	0.18;0.22	4.15	1.57	0.23409	Immunoglobulin-like (1);	.	.	.	.	T	0.37919	0.1021	L	0.31294	0.92	0.31424	N	0.673963	B	0.13594	0.008	B	0.04013	0.001	T	0.34825	-0.9813	9	0.35671	T	0.21	-22.8633	2.4365	0.04484	0.2985:0.0:0.4704:0.2311	.	250	P50895	BCAM_HUMAN	H	250	ENSP00000270233:R250H;ENSP00000375817:R250H	ENSP00000270233:R250H	R	+	2	0	BCAM	50008682	0.002000	0.14202	1.000000	0.80357	0.474000	0.32979	-0.892000	0.04131	0.870000	0.35726	0.462000	0.41574	CGC	-	BCAM	-	smart_Ig_sub,pfscan_Ig-like_dom		0.667	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAM	HGNC	protein_coding	OTTHUMT00000453220.1	0	0	0	25	25	25	0.00	0.00	G	NM_005581		45316842	+1	7	14	9	17	tier1	no_errors	ENST00000270233	ensembl	human	known	74_37	missense	43.75	45.16	SNP	0.991	A	7	9
ARHGEF17	9828	genome.wustl.edu	37	11	73071453	73071453	+	Missense_Mutation	SNP	C	C	T	rs140312706		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:73071453C>T	ENST00000263674.3	+	11	4645	c.4295C>T	c.(4294-4296)cCg>cTg	p.P1432L		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1432					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CTTTCCTTCCCGCCAACCAAG	0.632													ENSG00000110237	C|||	1	0.000199681	0.0	0.0	5008	,	,		20154	0.0		0.001	False		,,,				2504	0.0																0								C	LEU/PRO	3,4397	6.2+/-15.9	0,3,2197	115.0	126.0	122.0		4295	4.9	0.9	11	dbSNP_134	122	4,8582	3.7+/-12.6	0,4,4289	yes	missense	ARHGEF17	NM_014786.3	98	0,7,6486	TT,TC,CC		0.0466,0.0682,0.0539	benign	1432/2064	73071453	7,12979	2200	4293	6493	SO:0001583	missense	0			-	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.4295C>T	11.37:g.73071453C>T	ENSP00000263674:p.Pro1432Leu		B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,superfamily_Vinculin/catenin,smart_DH-domain,pfscan_DH-domain	p.P1432L	ENST00000263674.3	37	c.4295	CCDS8221.1	11	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130664	0.56828	6.82E-4	4.66E-4	ENSG00000110237	ENST00000263674	T	0.32272	1.46	5.81	4.9	0.64082	.	0.128266	0.56097	N	0.000038	T	0.12050	0.0293	N	0.03608	-0.345	0.49483	D	0.999799	P	0.38535	0.635	B	0.22753	0.041	T	0.12116	-1.0560	10	0.38643	T	0.18	-15.8036	13.8958	0.63770	0.0:0.9275:0.0:0.0725	.	1432	Q96PE2	ARHGH_HUMAN	L	1432	ENSP00000263674:P1432L	ENSP00000263674:P1432L	P	+	2	0	ARHGEF17	72749101	1.000000	0.71417	0.910000	0.35882	0.986000	0.74619	5.467000	0.66737	1.466000	0.48025	0.655000	0.94253	CCG	rs140312706	ARHGEF17	-	NULL		0.632	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	HGNC	protein_coding	OTTHUMT00000397365.1	0	0	0	38	38	20	0.00	0.00	C	NM_014786		73071453	+1	7	3	23	26	tier1	no_errors	ENST00000263674	ensembl	human	known	74_37	missense	23.33	10.34	SNP	0.995	T	7	23
CCDC7	79741	genome.wustl.edu	37	10	32983811	32983811	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:32983811T>C	ENST00000375030.2	+	9	912	c.294T>C	c.(292-294)caT>caC	p.H98H	C10orf68_ENST00000375028.3_Intron|C10orf68_ENST00000375025.4_Silent_p.H90H			Q9H943	CJ068_HUMAN		90										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						ATGTAGCTCATGATGAAGAAC	0.333													ENSG00000150076																																					0													44.0	42.0	43.0					10																	32983811		2201	4299	6500	SO:0001819	synonymous_variant	0			-																												ENST00000375030.2:c.294T>C	10.37:g.32983811T>C			B0QZ71|Q08AN7|Q8N7T7	Silent	SNP	NULL	p.H90	ENST00000375030.2	37	c.270		10																																																																																			-	C10orf68	-	NULL		0.333	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	0	0	0	144	144	82	0.00	0.00	T			32983811	+1	45	15	76	39	tier1	no_errors	ENST00000375025	ensembl	human	known	74_37	silent	36.89	27.78	SNP	0.000	C	45	76
FN1	2335	genome.wustl.edu	37	2	216288076	216288076	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:216288076C>T	ENST00000359671.1	-	9	1655	c.1390G>A	c.(1390-1392)Gct>Act	p.A464T	FN1_ENST00000446046.1_Missense_Mutation_p.A464T|FN1_ENST00000356005.4_Missense_Mutation_p.A464T|FN1_ENST00000443816.1_Missense_Mutation_p.A464T|FN1_ENST00000354785.4_Missense_Mutation_p.A464T|FN1_ENST00000323926.6_Missense_Mutation_p.A464T|FN1_ENST00000421182.1_Missense_Mutation_p.A464T|FN1_ENST00000432072.2_Missense_Mutation_p.A464T|FN1_ENST00000346544.3_Missense_Mutation_p.A464T|FN1_ENST00000426059.1_Missense_Mutation_p.A464T|FN1_ENST00000357009.2_Missense_Mutation_p.A464T|FN1_ENST00000357867.4_Missense_Mutation_p.A464T|FN1_ENST00000336916.4_Missense_Mutation_p.A464T|FN1_ENST00000345488.5_Missense_Mutation_p.A464T			P02751	FINC_HUMAN	fibronectin 1	464	Collagen-binding.|Critical for collagen binding.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ATCTTACCAGCCATGGGGCAG	0.453													ENSG00000115414																																					0													96.0	88.0	91.0					2																	216288076		2203	4300	6503	SO:0001583	missense	0			-		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.1390G>A	2.37:g.216288076C>T	ENSP00000352696:p.Ala464Thr		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.A464T	ENST00000359671.1	37	c.1390		2	.	.	.	.	.	.	.	.	.	.	C	36	5.781665	0.96929	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50813	0.73;2.11;2.27;0.81;2.33;1.98;2.33;1.97;2.28;2.02;1.5;0.82;1.41;1.42	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000005	T	0.65626	0.2709	L	0.45698	1.435	0.80722	D	1	D;D;P;B;D;D;D;D;D;D;B	0.76494	0.998;0.99;0.664;0.183;0.999;0.998;0.999;0.99;0.999;0.999;0.075	D;D;P;B;D;D;D;D;D;D;B	0.91635	0.996;0.99;0.597;0.251;0.996;0.99;0.999;0.976;0.996;0.996;0.171	T	0.64343	-0.6430	10	0.62326	D	0.03	.	20.2983	0.98569	0.0:1.0:0.0:0.0	.	464;464;464;464;464;464;464;464;464;464;464	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	T	464	ENSP00000394423:A464T;ENSP00000323534:A464T;ENSP00000338200:A464T;ENSP00000350534:A464T;ENSP00000346839:A464T;ENSP00000352696:A464T;ENSP00000265312:A464T;ENSP00000273049:A464T;ENSP00000349509:A464T;ENSP00000410422:A464T;ENSP00000415018:A464T;ENSP00000399538:A464T;ENSP00000348285:A464T;ENSP00000398907:A464T	ENSP00000265313:A464T	A	-	1	0	FN1	215996321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.747000	0.85070	2.802000	0.96397	0.655000	0.94253	GCT	-	FN1	-	superfamily_Kringle-like		0.453	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		0	0	0	46	46	117	0.00	0.00	C	NM_212476		216288076	-1	10	27	34	58	tier1	no_errors	ENST00000354785	ensembl	human	known	74_37	missense	22.73	31.76	SNP	1.000	T	10	34
CPSF6	11052	genome.wustl.edu	37	12	69652407	69652407	+	Silent	SNP	A	A	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:69652407A>C	ENST00000435070.2	+	6	842	c.732A>C	c.(730-732)ccA>ccC	p.P244P	CPSF6_ENST00000266679.8_Silent_p.P281P|CPSF6_ENST00000456847.3_Intron|CPSF6_ENST00000551516.1_Intron	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	244	Pro-rich.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			TAGGTCCTCCAGGCCCACCTG	0.502													ENSG00000111605																																					0													82.0	75.0	78.0					12																	69652407		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.732A>C	12.37:g.69652407A>C			A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P281	ENST00000435070.2	37	c.843	CCDS8988.1	12																																																																																			-	CPSF6	-	NULL		0.502	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF6	HGNC	protein_coding	OTTHUMT00000403609.1	0	0	1	80	80	75	0.00	1.32	A	NM_007007		69652407	+1	12	19	35	63	tier1	no_errors	ENST00000266679	ensembl	human	known	74_37	silent	25.53	23.17	SNP	0.997	C	12	35
SYNE1	23345	genome.wustl.edu	37	6	152826384	152826384	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:152826384T>C	ENST00000367255.5	-	9	1331	c.730A>G	c.(730-732)Act>Gct	p.T244A	SYNE1_ENST00000265368.4_Missense_Mutation_p.T244A|SYNE1_ENST00000423061.1_Missense_Mutation_p.T251A|SYNE1_ENST00000367253.4_Missense_Mutation_p.T244A|SYNE1_ENST00000466159.2_Missense_Mutation_p.T244A|SYNE1_ENST00000448038.1_Missense_Mutation_p.T251A|SYNE1_ENST00000413186.2_Missense_Mutation_p.T244A|SYNE1_ENST00000367248.3_Missense_Mutation_p.T251A|SYNE1_ENST00000341594.5_Missense_Mutation_p.T244A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	244	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCGGCGATAGTGAAAGCATCC	0.443										HNSCC(10;0.0054)			ENSG00000131018																																					0													148.0	133.0	138.0					6																	152826384		2203	4300	6503	SO:0001583	missense	0			-	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.730A>G	6.37:g.152826384T>C	ENSP00000356224:p.Thr244Ala		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.T244A	ENST00000367255.5	37	c.730	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	3.654	-0.070880	0.07228	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	D;D;D;D;D;D;D;D;D;D	0.94793	-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52	5.74	1.85	0.25348	Calponin homology domain (5);	0.288263	0.29822	N	0.011102	T	0.75309	0.3832	N	0.12920	0.275	0.22827	N	0.998689	B;B;B;B;B	0.15141	0.003;0.001;0.0;0.001;0.012	B;B;B;B;B	0.16289	0.005;0.003;0.003;0.003;0.015	T	0.67925	-0.5544	10	0.33141	T	0.24	.	5.8688	0.18793	0.3692:0.0667:0.0:0.5641	.	244;244;244;244;251	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	A	244;251;244;251;244;244;251;244;244;244	ENSP00000356224:T244A;ENSP00000396024:T251A;ENSP00000265368:T244A;ENSP00000390975:T251A;ENSP00000341887:T244A;ENSP00000356222:T244A;ENSP00000356217:T251A;ENSP00000414510:T244A;ENSP00000446021:T244A;ENSP00000441264:T244A	ENSP00000265368:T244A	T	-	1	0	SYNE1	152868077	0.070000	0.21116	0.727000	0.30756	0.140000	0.21249	-0.040000	0.12104	0.450000	0.26774	-0.361000	0.07541	ACT	-	SYNE1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	0	0	0	50	50	131	0.00	0.00	T	NM_182961		152826384	-1	17	29	39	90	tier1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	30.36	24.37	SNP	0.356	C	17	39
BLVRB	645	genome.wustl.edu	37	19	40964425	40964425	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:40964425T>C	ENST00000263368.4	-	2	258	c.107A>G	c.(106-108)gAc>gGc	p.D36G	BLVRB_ENST00000595483.1_Missense_Mutation_p.D36G	NM_000713.2	NP_000704.1	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase (NADPH))	36					heme catabolic process (GO:0042167)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	biliverdin reductase activity (GO:0004074)|riboflavin reductase (NADPH) activity (GO:0042602)			large_intestine(3)|lung(3)	6			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		Riboflavin(DB00140)	CCTGGAGGAGTCCCGCACCAG	0.642													ENSG00000090013																																					0													31.0	31.0	31.0					19																	40964425		2203	4299	6502	SO:0001583	missense	0			-	D26308	CCDS33029.1	19q13.1-q13.2	2011-09-14				ENSG00000090013	1.3.1.24, 1.5.1.30	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	1063	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 43U, member 1"""	600941	"""Flavin reductase"""	FLR		7656592, 19027726	Standard	NM_000713		Approved	SDR43U1	uc002onw.2	P30043		ENST00000263368.4:c.107A>G	19.37:g.40964425T>C	ENSP00000263368:p.Asp36Gly		A6NKD8|B2R5C6|P32078|P53005|Q32LZ2	Missense_Mutation	SNP	pfam_NmrA,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase	p.D36G	ENST00000263368.4	37	c.107	CCDS33029.1	19	.	.	.	.	.	.	.	.	.	.	T	24.4	4.526762	0.85706	.	.	ENSG00000090013	ENST00000263368	T	0.48201	0.82	5.38	5.38	0.77491	NAD(P)-binding domain (1);NmrA-like (1);	0.000000	0.85682	D	0.000000	T	0.69450	0.3112	M	0.85945	2.785	0.80722	D	1	D	0.63046	0.992	D	0.63033	0.91	T	0.75246	-0.3385	10	0.66056	D	0.02	-23.7774	14.3841	0.66931	0.0:0.0:0.0:1.0	.	36	P30043	BLVRB_HUMAN	G	36	ENSP00000263368:D36G	ENSP00000263368:D36G	D	-	2	0	BLVRB	45656265	1.000000	0.71417	0.668000	0.29813	0.980000	0.70556	7.089000	0.76909	2.057000	0.61298	0.455000	0.32223	GAC	-	BLVRB	-	pfam_NmrA,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase		0.642	BLVRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLVRB	HGNC	protein_coding	OTTHUMT00000462563.1	0	0	0	10	10	29	0.00	0.00	T			40964425	-1	6	16	11	32	tier1	no_errors	ENST00000263368	ensembl	human	known	74_37	missense	35.29	33.33	SNP	0.993	C	6	11
NRD1	4898	genome.wustl.edu	37	1	52280213	52280213	+	Intron	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:52280213T>C	ENST00000354831.7	-	15	2013				NRD1_ENST00000485608.1_Intron|NRD1_ENST00000544028.1_Intron|NRD1_ENST00000539524.1_Intron|NRD1_ENST00000352171.7_Intron	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)						cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TTCCAGGAAGTGTTTATTACC	0.418													ENSG00000078618																																					0													88.0	82.0	84.0					1																	52280213		2203	4300	6503	SO:0001627	intron_variant	0			-	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.1823+9A>G	1.37:g.52280213T>C			A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	R	SNP	-	NULL	ENST00000354831.7	37	NULL	CCDS559.1	1																																																																																			-	NRD1	-	-		0.418	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRD1	HGNC	protein_coding	OTTHUMT00000023045.1	0	0	0	73	73	96	0.00	0.00	T	NM_002525		52280213	-1	10	24	47	57	tier1	no_errors	ENST00000483007	ensembl	human	known	74_37	rna	17.24	29.63	SNP	0.002	C	10	47
ITGA10	8515	genome.wustl.edu	37	1	145535815	145535815	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:145535815G>A	ENST00000369304.3	+	16	2178	c.2003G>A	c.(2002-2004)cGg>cAg	p.R668Q	ITGA10_ENST00000538811.1_Missense_Mutation_p.R537Q|ITGA10_ENST00000539363.1_Missense_Mutation_p.R525Q	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	668			R -> W (in dbSNP:rs36073645).		axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GACTGTAGGCGGCGAGGCCAA	0.572													ENSG00000143127																																					0													98.0	90.0	93.0					1																	145535815		2203	4300	6503	SO:0001583	missense	0			-	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.2003G>A	1.37:g.145535815G>A	ENSP00000358310:p.Arg668Gln		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.R668Q	ENST00000369304.3	37	c.2003	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992951	0.93167	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.46451	0.87;0.87;0.87	5.44	5.44	0.79542	Integrin alpha-2 (1);	0.074488	0.49916	D	0.000134	T	0.46756	0.1409	L	0.41492	1.28	0.49582	D	0.999806	D;D;D;D	0.89917	1.0;0.986;1.0;1.0	D;P;D;D	0.87578	0.994;0.746;0.998;0.998	T	0.14035	-1.0487	10	0.29301	T	0.29	.	16.807	0.85708	0.0:0.0:1.0:0.0	.	634;537;525;668	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	Q	668;634;525;537	ENSP00000358310:R668Q;ENSP00000439894:R525Q;ENSP00000440011:R537Q	ENSP00000358310:R668Q	R	+	2	0	ITGA10	144247172	0.991000	0.36638	0.653000	0.29593	0.727000	0.41649	7.702000	0.84576	2.828000	0.97474	0.655000	0.94253	CGG	-	ITGA10	-	pfam_Integrin_alpha-2		0.572	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	0	0	0	26	26	68	0.00	0.00	G	NM_003637		145535815	+1	13	24	14	58	tier1	no_errors	ENST00000369304	ensembl	human	known	74_37	missense	48.15	29.27	SNP	0.696	A	13	14
BLMH	642	genome.wustl.edu	37	17	28601155	28601155	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:28601155G>A	ENST00000261714.6	-	7	880	c.706C>T	c.(706-708)Cga>Tga	p.R236*	BLMH_ENST00000582669.1_5'UTR|BLMH_ENST00000394819.3_Nonsense_Mutation_p.R149*	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	236					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	TCTTTGTCTCGATATTCCCAG	0.448													ENSG00000108578																									Pancreas(127;628 1772 12912 33293 36203)												0													85.0	82.0	83.0					17																	28601155		2203	4300	6503	SO:0001587	stop_gained	0			-	X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.706C>T	17.37:g.28601155G>A	ENSP00000261714:p.Arg236*		B2R796|Q53F86|Q9UER9	Nonsense_Mutation	SNP	pfam_Peptidase_C1B,pirsf_Peptidase_C1B	p.R236*	ENST00000261714.6	37	c.706	CCDS32604.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.553903	0.96501	.	.	ENSG00000108578	ENST00000261714;ENST00000394819	.	.	.	5.91	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.7216	15.0025	0.71486	0.0:0.0:0.8572:0.1428	.	.	.	.	X	236;149	.	ENSP00000261714:R236X	R	-	1	2	BLMH	25625281	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.963000	0.29293	2.802000	0.96397	0.655000	0.94253	CGA	-	BLMH	-	pfam_Peptidase_C1B,pirsf_Peptidase_C1B		0.448	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLMH	HGNC	protein_coding	OTTHUMT00000447940.1	0	0	0	156	156	96	0.00	0.00	G	NM_000386		28601155	-1	38	31	70	63	tier1	no_errors	ENST00000261714	ensembl	human	known	74_37	nonsense	35.19	32.98	SNP	1.000	A	38	70
NDRG1	10397	genome.wustl.edu	37	8	134266812	134266812	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:134266812C>T	ENST00000414097.2	-	9	1431	c.564G>A	c.(562-564)ccG>ccA	p.P188P	NDRG1_ENST00000522476.1_Silent_p.P122P|NDRG1_ENST00000537882.1_Silent_p.P107P|NDRG1_ENST00000323851.7_Silent_p.P188P|NDRG1_ENST00000518176.1_Intron|NDRG1_ENST00000354944.5_Silent_p.P118P|NDRG1_ENST00000518066.1_Intron	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	188					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)		NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CCACCATGTCCGGCAGAGCTT	0.522			T	ERG	prostate								ENSG00000104419																												Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	0													87.0	69.0	75.0					8																	134266812		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.564G>A	8.37:g.134266812C>T			B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Silent	SNP	pfam_Ndr	p.P188	ENST00000414097.2	37	c.564	CCDS34945.1	8																																																																																			-	NDRG1	-	pfam_Ndr		0.522	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDRG1	HGNC	protein_coding	OTTHUMT00000378805.1	0	0	0	66	66	92	0.00	0.00	C			134266812	-1	26	36	58	74	tier1	no_errors	ENST00000323851	ensembl	human	known	74_37	silent	30.95	32.73	SNP	0.000	T	26	58
TUBE1	51175	genome.wustl.edu	37	6	112393216	112393216	+	Silent	SNP	G	G	A	rs267600764		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:112393216G>A	ENST00000368662.5	-	11	1236	c.1158C>T	c.(1156-1158)tcC>tcT	p.S386S	TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	386					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	CAGGAGGTACGGAACACAGGC	0.413													ENSG00000074935																																					0													84.0	88.0	87.0					6																	112393216		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.1158C>T	6.37:g.112393216G>A			Q5H8W8|Q8NEG3	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Epsilon_tubulin,prints_Tubulin	p.S386	ENST00000368662.5	37	c.1158	CCDS5100.1	6																																																																																			-	TUBE1	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom		0.413	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBE1	HGNC	protein_coding	OTTHUMT00000041867.1	0	0	1	57	57	63	0.00	1.56	G	NM_016262		112393216	-1	18	11	71	74	tier1	no_errors	ENST00000368662	ensembl	human	known	74_37	silent	20.22	12.94	SNP	0.969	A	18	71
LOC728554	728554	genome.wustl.edu	37	5	177310858	177310858	+	RNA	SNP	C	C	T	rs570231127	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:177310858C>T	ENST00000506672.1	+	0	1155					NR_003615.2																						GAGGAGGCCCCGGCAGAGGTC	0.488													ENSG00000170089	C|||	4	0.000798722	0.0015	0.0029	5008	,	,		20942	0.0		0.0	False		,,,				2504	0.0																0																																												0			-																													5.37:g.177310858C>T				R	SNP	-	NULL	ENST00000506672.1	37	NULL		5																																																																																			-	RP11-423H2.1	-	-		0.488	RP11-423H2.1-002	KNOWN	basic	processed_transcript	LOC728554	Clone_based_vega_gene	pseudogene	OTTHUMT00000373226.1	0	0	0	56	56	62	0.00	0.00	C			177310858	+1	7	14	46	51	tier1	no_errors	ENST00000506672	ensembl	human	known	74_37	rna	13.21	21.54	SNP	0.010	T	7	46
RP11-464F9.1	0	genome.wustl.edu	37	10	75480331	75480331	+	RNA	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:75480331G>A	ENST00000399449.3	-	0	925				BMS1P4_ENST00000584747.1_RNA|RP11-574K11.28_ENST00000580790.1_RNA																							TTTCAAGTGCGCTCCTCTTAA	0.378													ENSG00000242288																																					0																																												0			-																													10.37:g.75480331G>A				R	SNP	-	NULL	ENST00000399449.3	37	NULL		10																																																																																			-	RP11-464F9.1	-	-		0.378	RP11-464F9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000242288	Clone_based_vega_gene	processed_transcript	OTTHUMT00000048674.2	0	0	0	382	382	54	0.00	0.00	G			75480331	-1	89	7	310	37	tier1	no_errors	ENST00000399449	ensembl	human	known	74_37	rna	22.25	15.91	SNP	1.000	A	89	310
TTC13	79573	genome.wustl.edu	37	1	231067164	231067164	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:231067164T>C	ENST00000366661.4	-	11	1187	c.1180A>G	c.(1180-1182)Agc>Ggc	p.S394G	TTC13_ENST00000366662.4_Missense_Mutation_p.S341G|TTC13_ENST00000414259.1_Missense_Mutation_p.S341G	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	394										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		GCAACATGGCTGAGCCCTTTC	0.443													ENSG00000143643																																					0													142.0	134.0	137.0					1																	231067164		2203	4300	6503	SO:0001583	missense	0			-		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.1180A>G	1.37:g.231067164T>C	ENSP00000355621:p.Ser394Gly		B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S394G	ENST00000366661.4	37	c.1180	CCDS1588.1	1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.097922	0.76870	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259	T;T;T	0.60548	1.16;0.18;0.18	5.77	5.77	0.91146	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.64148	0.2572	N	0.24115	0.695	0.80722	D	1	P;D;P;P	0.58268	0.835;0.982;0.763;0.704	B;D;B;B	0.67548	0.261;0.952;0.21;0.363	T	0.68895	-0.5288	10	0.87932	D	0	0.0119	16.0941	0.81109	0.0:0.0:0.0:1.0	.	319;341;341;394	Q69YR0;E9PGV4;Q8NBP0-2;Q8NBP0	.;.;.;TTC13_HUMAN	G	394;341;341	ENSP00000355621:S394G;ENSP00000355622:S341G;ENSP00000416631:S341G	ENSP00000355621:S394G	S	-	1	0	TTC13	229133787	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	7.963000	0.87922	2.203000	0.70933	0.477000	0.44152	AGC	-	TTC13	-	pfscan_TPR-contain_dom		0.443	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC13	HGNC	protein_coding	OTTHUMT00000092229.2	0	0	0	43	43	108	0.00	0.00	T	NM_024525		231067164	-1	13	20	49	77	tier1	no_errors	ENST00000366661	ensembl	human	known	74_37	missense	20.97	20.62	SNP	1.000	C	13	49
NMD3	51068	genome.wustl.edu	37	3	160960405	160960405	+	Silent	SNP	A	A	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:160960405A>T	ENST00000460469.1	+	10	1436	c.981A>T	c.(979-981)atA>atT	p.I327I	NMD3_ENST00000472947.1_Silent_p.I327I|NMD3_ENST00000351193.2_Silent_p.I327I			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	327					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			TCCAAGATATAAAACGTGCTG	0.408													ENSG00000169251																																					0													91.0	87.0	88.0					3																	160960405		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.981A>T	3.37:g.160960405A>T			D3DNM7|Q9Y2Z6	Silent	SNP	pfam_NMD3	p.I327	ENST00000460469.1	37	c.981	CCDS3194.1	3																																																																																			-	NMD3	-	NULL		0.408	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NMD3	HGNC	protein_coding	OTTHUMT00000353114.1	0	0	0	65	65	71	0.00	0.00	A	NM_015938		160960405	+1	22	16	50	53	tier1	no_errors	ENST00000351193	ensembl	human	known	74_37	silent	30.56	23.19	SNP	0.520	T	22	50
PRR12	57479	genome.wustl.edu	37	19	50097789	50097789	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:50097789C>T	ENST00000418929.2	+	3	290	c.278C>T	c.(277-279)tCg>tTg	p.S93L		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0	Pro-rich.						DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		AACCTTATCTCGGCCCTGGAA	0.677													ENSG00000126464																																					0													39.0	47.0	44.0					19																	50097789		1892	4092	5984	SO:0001583	missense	0			-	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.278C>T	19.37:g.50097789C>T	ENSP00000394510:p.Ser93Leu		E9PB06|Q8N4J6	Missense_Mutation	SNP	NULL	p.S93L	ENST00000418929.2	37	c.278	CCDS46143.1	19	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908434	0.52333	.	.	ENSG00000126464	ENST00000418929	T	0.29917	1.55	4.65	4.65	0.58169	.	.	.	.	.	T	0.49558	0.1564	.	.	.	0.38401	D	0.945655	D	0.71674	0.998	P	0.56398	0.797	T	0.59526	-0.7438	8	0.87932	D	0	.	16.4582	0.84029	0.0:1.0:0.0:0.0	.	93	Q9ULL5-3	.	L	93	ENSP00000394510:S93L	ENSP00000394510:S93L	S	+	2	0	PRR12	54789601	1.000000	0.71417	0.956000	0.39512	0.976000	0.68499	6.984000	0.76186	2.419000	0.82065	0.563000	0.77884	TCG	-	PRR12	-	NULL		0.677	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR12	HGNC	protein_coding	OTTHUMT00000465915.1	0	0	0	47	47	26	0.00	0.00	C	NM_020719		50097789	+1	8	14	24	25	tier1	no_errors	ENST00000418929	ensembl	human	novel	74_37	missense	25.00	35.90	SNP	0.999	T	8	24
TMEM132C	92293	genome.wustl.edu	37	12	128900080	128900080	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:128900080C>A	ENST00000435159.2	+	2	889	c.889C>A	c.(889-891)Cct>Act	p.P297T		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	297						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CATCTGGCTGCCTTCCAGGCC	0.607													ENSG00000181234																																					0													33.0	39.0	37.0					12																	128900080		692	1591	2283	SO:0001583	missense	0			-	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.889C>A	12.37:g.128900080C>A	ENSP00000410852:p.Pro297Thr		Q69YX8	Missense_Mutation	SNP	NULL	p.P297T	ENST00000435159.2	37	c.889		12	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669057	0.88348	.	.	ENSG00000181234	ENST00000435159	T	0.21932	1.98	5.09	5.09	0.68999	.	.	.	.	.	T	0.31949	0.0813	M	0.83774	2.66	0.80722	D	1	B	0.31077	0.307	B	0.26416	0.069	T	0.27938	-1.0059	9	0.59425	D	0.04	.	18.8683	0.92301	0.0:1.0:0.0:0.0	.	297	Q8N3T6	T132C_HUMAN	T	297	ENSP00000410852:P297T	ENSP00000410852:P297T	P	+	1	0	TMEM132C	127466033	1.000000	0.71417	0.972000	0.41901	0.975000	0.68041	5.808000	0.69165	2.519000	0.84933	0.655000	0.94253	CCT	-	TMEM132C	-	NULL		0.607	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		0	0	0	38	38	97	0.00	0.00	C	XM_044062		128900080	+1	13	19	25	76	tier1	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	34.21	20.00	SNP	1.000	A	13	25
GPRIN1	114787	genome.wustl.edu	37	5	176025084	176025084	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:176025084C>T	ENST00000303991.4	-	2	1929	c.1752G>A	c.(1750-1752)ccG>ccA	p.P584P		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	584					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGAGGGCACCGGGACTGTTT	0.562													ENSG00000169258																																					0													82.0	85.0	84.0					5																	176025084		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.1752G>A	5.37:g.176025084C>T			C9JM70|Q8ND74|Q96PZ4	Silent	SNP	NULL	p.P584	ENST00000303991.4	37	c.1752	CCDS4405.1	5																																																																																			-	GPRIN1	-	NULL		0.562	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN1	HGNC	protein_coding	OTTHUMT00000253149.1	0	0	0	57	57	106	0.00	0.00	C	NM_052899		176025084	-1	13	16	54	66	tier1	no_errors	ENST00000303991	ensembl	human	known	74_37	silent	19.40	19.51	SNP	0.000	T	13	54
GLIS2	84662	genome.wustl.edu	37	16	4387501	4387501	+	Silent	SNP	G	G	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:4387501G>C	ENST00000262366.3	+	8	2372	c.1551G>C	c.(1549-1551)ctG>ctC	p.L517L	GLIS2_ENST00000433375.1_Silent_p.L517L|RP11-295D4.1_ENST00000574705.1_RNA|PAM16_ENST00000577031.1_Intron			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	517					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						GCTCGGTGCTGCTCAAACCGG	0.682													ENSG00000126603																																					0													11.0	10.0	10.0					16																	4387501		2154	4245	6399	SO:0001819	synonymous_variant	0			-	AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.1551G>C	16.37:g.4387501G>C			B3KX84	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L517	ENST00000262366.3	37	c.1551	CCDS10511.1	16																																																																																			-	GLIS2	-	NULL		0.682	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS2	HGNC	protein_coding	OTTHUMT00000251630.1	0	0	0	70	70	20	0.00	0.00	G	NM_032575		4387501	+1	7	2	41	14	tier1	no_errors	ENST00000262366	ensembl	human	known	74_37	silent	14.58	12.50	SNP	1.000	C	7	41
KNTC1	9735	genome.wustl.edu	37	12	123014670	123014670	+	Silent	SNP	C	C	T	rs374816944|rs370631854		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:123014670C>T	ENST00000333479.7	+	2	237	c.60C>T	c.(58-60)gtC>gtT	p.V20V	KNTC1_ENST00000450485.2_Silent_p.V20V	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	20					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ACCTGAGTGTCGGTTCAAGAA	0.393													ENSG00000184445																																					0													115.0	119.0	118.0					12																	123014670		1873	4110	5983	SO:0001819	synonymous_variant	0			-		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.60C>T	12.37:g.123014670C>T			A7E2C4|B3KSG2	Silent	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.V20	ENST00000333479.7	37	c.60	CCDS45002.1	12																																																																																			-	KNTC1	-	NULL		0.393	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	0	0	0	89	89	139	0.00	0.00	C			123014670	+1	34	37	80	103	tier1	no_errors	ENST00000333479	ensembl	human	known	74_37	silent	29.82	26.43	SNP	0.903	T	34	80
ACVR2B	93	genome.wustl.edu	37	3	38524696	38524696	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:38524696C>T	ENST00000352511.4	+	11	1884	c.1412C>T	c.(1411-1413)gCg>gTg	p.A471V		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	471	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		CGCTTGTCCGCGGGCTGTGTG	0.602													ENSG00000114739																																					0													186.0	163.0	171.0					3																	38524696		2203	4300	6503	SO:0001583	missense	0			-	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.1412C>T	3.37:g.38524696C>T	ENSP00000340361:p.Ala471Val		Q4VAV0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_TGFB_receptor	p.A471V	ENST00000352511.4	37	c.1412	CCDS2679.1	3	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329678	0.60743	.	.	ENSG00000114739	ENST00000352511	D	0.94330	-3.4	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96846	0.8970	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	D	0.97246	0.9894	10	0.87932	D	0	.	18.8582	0.92262	0.0:1.0:0.0:0.0	.	471	Q13705	AVR2B_HUMAN	V	471	ENSP00000340361:A471V	ENSP00000340361:A471V	A	+	2	0	ACVR2B	38499700	1.000000	0.71417	0.197000	0.23402	0.219000	0.24729	7.651000	0.83577	2.674000	0.91012	0.650000	0.86243	GCG	-	ACVR2B	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.602	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR2B	HGNC	protein_coding	OTTHUMT00000254059.3	0	0	0	58	58	64	0.00	0.00	C	NM_001106		38524696	+1	14	21	32	26	tier1	no_errors	ENST00000352511	ensembl	human	known	74_37	missense	30.43	44.68	SNP	1.000	T	14	32
C1orf21	81563	genome.wustl.edu	37	1	184588668	184588668	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:184588668C>T	ENST00000235307.6	+	6	779	c.344C>T	c.(343-345)tCg>tTg	p.S115L	C1orf21_ENST00000367514.3_3'UTR	NM_030806.3	NP_110433.1	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21	115										breast(1)|lung(1)	2		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		GATTACTGTTCGGAAGAAGAG	0.398													ENSG00000116667																																					0													134.0	130.0	132.0					1																	184588668		2203	4300	6503	SO:0001583	missense	0			-	AF312864	CCDS1362.1	1q25	2008-07-18			ENSG00000116667	ENSG00000116667			15494	protein-coding gene	gene with protein product	"""proliferation-inducing protein 13"""					11318611	Standard	NM_030806		Approved	PIG13	uc001gqv.1	Q9H246	OTTHUMG00000035386	ENST00000235307.6:c.344C>T	1.37:g.184588668C>T	ENSP00000235307:p.Ser115Leu		B2R551	Missense_Mutation	SNP	NULL	p.S115L	ENST00000235307.6	37	c.344	CCDS1362.1	1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831246	0.71258	.	.	ENSG00000116667	ENST00000235307;ENST00000367514	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.61974	0.2390	L	0.58810	1.83	0.58432	D	0.999998	P	0.47302	0.893	P	0.46510	0.519	T	0.68085	-0.5502	9	0.87932	D	0	.	16.5787	0.84708	0.0:1.0:0.0:0.0	.	115	Q9H246	CA021_HUMAN	L	115;81	.	ENSP00000235307:S115L	S	+	2	0	C1orf21	182855291	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.771000	0.62318	2.338000	0.79540	0.655000	0.94253	TCG	-	C1orf21	-	NULL		0.398	C1orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf21	HGNC	protein_coding	OTTHUMT00000085784.2	0	0	0	62	62	166	0.00	0.00	C	NM_030806		184588668	+1	18	47	45	127	tier1	no_errors	ENST00000235307	ensembl	human	known	74_37	missense	27.69	27.01	SNP	1.000	T	18	45
OR2T11	127077	genome.wustl.edu	37	1	248789924	248789924	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:248789924C>T	ENST00000330803.2	-	1	567	c.506G>A	c.(505-507)cGa>cAa	p.R169Q		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R169Q(1)		breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTTGATACTTCGGGAGCCACA	0.507													ENSG00000183130																																					1	Substitution - Missense(1)	large_intestine(1)											54.0	60.0	58.0					1																	248789924		2047	4233	6280	SO:0001583	missense	0			-	BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.506G>A	1.37:g.248789924C>T	ENSP00000328934:p.Arg169Gln		Q6IEY6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R169Q	ENST00000330803.2	37	c.506	CCDS31122.1	1	.	.	.	.	.	.	.	.	.	.	.	8.429	0.848082	0.17034	.	.	ENSG00000183130	ENST00000330803	T	0.00044	8.83	4.38	0.12	0.14691	GPCR, rhodopsin-like superfamily (1);	0.777423	0.10998	N	0.610864	T	0.00144	0.0004	L	0.45137	1.4	0.09310	N	1	B	0.25105	0.118	B	0.29077	0.098	T	0.10989	-1.0606	10	0.54805	T	0.06	.	8.1251	0.30995	0.0:0.5212:0.0:0.4788	.	169	Q8NH01	O2T11_HUMAN	Q	169	ENSP00000328934:R169Q	ENSP00000328934:R169Q	R	-	2	0	OR2T11	246856547	0.000000	0.05858	0.002000	0.10522	0.253000	0.25986	-0.663000	0.05299	0.086000	0.17137	0.655000	0.94253	CGA	-	OR2T11	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.507	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T11	HGNC	protein_coding	OTTHUMT00000097134.1	0	0	0	28	28	44	0.00	0.00	C	NM_001001964		248789924	-1	10	27	11	21	tier1	no_errors	ENST00000330803	ensembl	human	known	74_37	missense	47.62	56.25	SNP	0.000	T	10	11
MMP19	4327	genome.wustl.edu	37	12	56231653	56231653	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:56231653C>T	ENST00000322569.4	-	7	1125	c.1034G>A	c.(1033-1035)cGa>cAa	p.R345Q	MMP19_ENST00000394182.1_Missense_Mutation_p.R59Q|MMP19_ENST00000548629.1_Missense_Mutation_p.R322Q|TMEM198B_ENST00000478241.1_RNA|MMP19_ENST00000409200.3_Silent_p.S298S	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	345					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R345Q(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	CCATTGTGTTCGAGGCGAGTA	0.507													ENSG00000123342																																					1	Substitution - Missense(1)	large_intestine(1)											105.0	107.0	107.0					12																	56231653		2203	4300	6503	SO:0001583	missense	0			-	X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.1034G>A	12.37:g.56231653C>T	ENSP00000313437:p.Arg345Gln		B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.R345Q	ENST00000322569.4	37	c.1034	CCDS8895.1	12	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136693	0.77662	.	.	ENSG00000123342	ENST00000394182;ENST00000322569;ENST00000548629	T;T;T	0.02395	4.31;4.31;4.31	5.94	5.94	0.96194	Hemopexin/matrixin (2);	0.357272	0.26460	N	0.024255	T	0.09468	0.0233	L	0.41079	1.255	0.53688	D	0.99997	D;D	0.89917	0.994;1.0	P;D	0.68039	0.854;0.955	T	0.43925	-0.9361	10	0.22706	T	0.39	.	17.8571	0.88767	0.0:1.0:0.0:0.0	.	345;59	Q99542;Q99542-3	MMP19_HUMAN;.	Q	59;345;322	ENSP00000377736:R59Q;ENSP00000313437:R345Q;ENSP00000446979:R322Q	ENSP00000313437:R345Q	R	-	2	0	MMP19	54517920	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.143000	0.64826	2.826000	0.97356	0.561000	0.74099	CGA	-	MMP19	-	pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans		0.507	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP19	HGNC	protein_coding	OTTHUMT00000408023.1	0	0	1	77	77	114	0.00	0.87	C	NM_002429		56231653	-1	18	31	41	113	tier1	no_errors	ENST00000322569	ensembl	human	known	74_37	missense	30.51	21.53	SNP	1.000	T	18	41
OMP	4975	genome.wustl.edu	37	11	76814248	76814248	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:76814248C>T	ENST00000529803.1	+	1	363	c.363C>T	c.(361-363)gaC>gaT	p.D121D	CAPN5_ENST00000278559.3_Intron|CAPN5_ENST00000529629.1_Intron|CAPN5_ENST00000456580.2_Intron|CAPN5_ENST00000531028.1_Intron	NM_006189.1	NP_006180.1	P47874	OMP_HUMAN	olfactory marker protein	121					neurogenesis (GO:0022008)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						ATGAGGCCGACGCCCTGGAGT	0.617													ENSG00000254550																																					0													54.0	62.0	59.0					11																	76814248		2079	4177	6256	SO:0001819	synonymous_variant	0			-	U01212	CCDS53682.1	11q14-q21	2008-07-21				ENSG00000254550			8136	protein-coding gene	gene with protein product		164340				8499899	Standard	NM_006189		Approved		uc010rsk.2	P47874		ENST00000529803.1:c.363C>T	11.37:g.76814248C>T			Q562G2	Silent	SNP	pfam_Olfactory_marker,superfamily_Olfactory_marker	p.D121	ENST00000529803.1	37	c.363	CCDS53682.1	11																																																																																			-	OMP	-	pfam_Olfactory_marker,superfamily_Olfactory_marker		0.617	OMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMP	HGNC	protein_coding	OTTHUMT00000382570.1	0	0	0	42	42	67	0.00	0.00	C	NM_006189		76814248	+1	13	24	27	44	tier1	no_errors	ENST00000529803	ensembl	human	known	74_37	silent	32.50	34.78	SNP	0.848	T	13	27
DTWD1	56986	genome.wustl.edu	37	15	49917553	49917553	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:49917553T>C	ENST00000251250.6	+	3	396	c.189T>C	c.(187-189)ggT>ggC	p.G63G	DTWD1_ENST00000329873.5_Silent_p.G63G|DTWD1_ENST00000558653.1_Silent_p.G63G|DTWD1_ENST00000403028.3_Silent_p.G63G|DTWD1_ENST00000559223.1_3'UTR	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	63										endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		AATGTGGTGGTTCCAGAATGT	0.353													ENSG00000104047																																					0													89.0	83.0	85.0					15																	49917553		2196	4295	6491	SO:0001819	synonymous_variant	0			-	BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.189T>C	15.37:g.49917553T>C			Q567Q3|Q8WVG9|Q9NRU6	Silent	SNP	pfam_DTW	p.G63	ENST00000251250.6	37	c.189	CCDS10132.1	15																																																																																			-	DTWD1	-	NULL		0.353	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTWD1	HGNC	protein_coding	OTTHUMT00000254431.2	0	0	0	139	139	66	0.00	0.00	T	NM_020234		49917553	+1	42	12	92	43	tier1	no_errors	ENST00000251250	ensembl	human	known	74_37	silent	31.34	21.82	SNP	0.941	C	42	92
TCEA2	6919	genome.wustl.edu	37	20	62694686	62694686	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:62694686G>C	ENST00000343484.5	+	1	190	c.21G>C	c.(19-21)gaG>gaC	p.E7D	TCEA2_ENST00000395053.3_Missense_Mutation_p.E7D|TCEA2_ENST00000361317.2_Intron	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	7	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					AGGAAGAGGAGATTGCGCGGA	0.756													ENSG00000171703																																					0													29.0	26.0	27.0					20																	62694686		2023	4011	6034	SO:0001583	missense	0			-	U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.21G>C	20.37:g.62694686G>C	ENSP00000343515:p.Glu7Asp		B3KNM1|Q8TD37|Q8TD38	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_TFIIS_N,pfam_Znf_TFIIS,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.E7D	ENST00000343484.5	37	c.21	CCDS13553.1	20	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842364	0.71488	.	.	ENSG00000171703	ENST00000343484;ENST00000395053	.	.	.	3.21	3.21	0.36854	Transcription factor IIS, N-terminal (3);	0.215268	0.37669	U	0.001987	T	0.49966	0.1588	L	0.58101	1.795	0.44976	D	0.997994	B	0.33022	0.394	B	0.33521	0.165	T	0.53486	-0.8432	9	0.51188	T	0.08	-19.9239	7.5814	0.27967	0.1254:0.0:0.8746:0.0	.	7	Q15560	TCEA2_HUMAN	D	7	.	ENSP00000343515:E7D	E	+	3	2	TCEA2	62165130	0.987000	0.35691	1.000000	0.80357	0.460000	0.32559	1.364000	0.34171	1.601000	0.50113	0.313000	0.20887	GAG	-	TCEA2	-	superfamily_TFIIS_N,pirsf_TF_IIS-rel,tigrfam_TFSII		0.756	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA2	HGNC	protein_coding	OTTHUMT00000080277.2	0	0	0	30	30	25	0.00	0.00	G	NM_198723		62694686	+1	6	3	2	24	tier1	no_errors	ENST00000343484	ensembl	human	known	74_37	missense	75.00	11.11	SNP	1.000	C	6	2
MNAT1	4331	genome.wustl.edu	37	14	61285544	61285544	+	Silent	SNP	G	G	A	rs143441995		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr14:61285544G>A	ENST00000261245.4	+	6	767	c.666G>A	c.(664-666)acG>acA	p.T222T	MNAT1_ENST00000539616.2_Intron	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	222					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		AACCAGTGACGTTTTCCACAG	0.348								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)					ENSG00000020426																																					0								G	,	0,4406		0,0,2203	79.0	80.0	80.0		,666	-11.7	0.4	14	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	no	intron,coding-synonymous	MNAT1	NM_001177963.1,NM_002431.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	,222/310	61285544	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.666G>A	14.37:g.61285544G>A			G3V1U8|Q15817|Q6ICQ7	Silent	SNP	pirsf_MAT1/Tfb3,pfam_Cdk-activating_kinase_MAT1_cen,smart_Znf_RING,pfscan_Ubiquitin-int_motif,pfscan_Znf_RING,tigrfam_MAT1/Tfb3	p.T222	ENST00000261245.4	37	c.666	CCDS9750.1	14																																																																																			rs143441995	MT1	-	pirsf_MAT1/Tfb3,pfam_Cdk-activating_kinase_MAT1_cen,tigrfam_MAT1/Tfb3		0.348	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1	HGNC	protein_coding	OTTHUMT00000276956.1	0	0	0	80	80	170	0.00	0.00	G	NM_002431		61285544	+1	21	45	42	50	tier1	no_errors	ENST00000261245	ensembl	human	known	74_37	silent	33.33	47.37	SNP	0.127	A	21	42
KIF4B	285643	genome.wustl.edu	37	5	154396339	154396339	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:154396339C>T	ENST00000435029.4	+	1	3080	c.2920C>T	c.(2920-2922)Cga>Tga	p.R974*		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	974	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGAGAAGATGCGAGAAGTGTG	0.463													ENSG00000226650																																					0													140.0	137.0	138.0					5																	154396339		2203	4300	6503	SO:0001587	stop_gained	0			-	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2920C>T	5.37:g.154396339C>T	ENSP00000387875:p.Arg974*			Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R974*	ENST00000435029.4	37	c.2920	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	c	33	5.239423	0.95240	.	.	ENSG00000226650	ENST00000435029	.	.	.	1.76	0.852	0.18995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.2406	0.04018	0.303:0.5025:0.0:0.1945	.	.	.	.	X	974	.	ENSP00000387875:R974X	R	+	1	2	KIF4B	154376532	1.000000	0.71417	0.318000	0.25279	0.374000	0.29953	1.050000	0.30404	0.290000	0.22444	0.557000	0.71058	CGA	-	KIF4B	-	NULL		0.463	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	0	0	0	48	48	22	0.00	0.00	C			154396339	+1	22	10	50	19	tier1	no_errors	ENST00000435029	ensembl	human	known	74_37	nonsense	30.56	34.48	SNP	0.502	T	22	50
MAMDC2	256691	genome.wustl.edu	37	9	72758568	72758568	+	Missense_Mutation	SNP	C	C	T	rs368156190		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:72758568C>T	ENST00000377182.4	+	9	1854	c.1237C>T	c.(1237-1239)Cgt>Tgt	p.R413C	MAMDC2-AS1_ENST00000591368.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	413	MAM 3. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						GTATTGTCTGCGTTTTCATTA	0.438													ENSG00000165072																																					0								C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	116.0	106.0	110.0		1237	5.9	1.0	9	dbSNP_134	110	0,8600		0,0,4300	no	missense	MAMDC2	NM_153267.4	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	413/687	72758568	1,13005	2203	4300	6503	SO:0001583	missense	0			-	BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.1237C>T	9.37:g.72758568C>T	ENSP00000366387:p.Arg413Cys		Q5VW47|Q8WX43|Q96BM4	Missense_Mutation	SNP	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom	p.R413C	ENST00000377182.4	37	c.1237	CCDS6631.1	9	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081853	0.76528	2.27E-4	0.0	ENSG00000165072	ENST00000377182	T	0.02552	4.25	5.91	5.91	0.95273	Concanavalin A-like lectin/glucanase (1);MAM domain (4);	0.043631	0.85682	D	0.000000	T	0.14743	0.0356	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.00011	-1.2439	10	0.54805	T	0.06	-10.1709	14.4388	0.67301	0.0:0.93:0.0:0.07	.	413	Q7Z304	MAMC2_HUMAN	C	413	ENSP00000366387:R413C	ENSP00000366387:R413C	R	+	1	0	MAMDC2	71948388	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.035000	0.41155	2.803000	0.96430	0.650000	0.86243	CGT	-	MAMDC2	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom		0.438	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAMDC2	HGNC	protein_coding	OTTHUMT00000052600.1	0	0	0	53	53	79	0.00	0.00	C	NM_153267		72758568	+1	11	25	57	60	tier1	no_errors	ENST00000377182	ensembl	human	known	74_37	missense	16.18	29.41	SNP	1.000	T	11	57
PTPRN2	5799	genome.wustl.edu	37	7	157408190	157408190	+	Intron	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:157408190G>A	ENST00000389418.4	-	15	2354				PTPRN2_ENST00000409483.1_Intron|PTPRN2_ENST00000389416.4_Intron|PTPRN2_ENST00000389413.3_Intron|PTPRN2_ENST00000404321.2_Intron|AC005481.5_ENST00000409610.1_Silent_p.S61S	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2						negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CAATATGCTCGGGACCTGGGG	0.607													ENSG00000222012																																					0																																										SO:0001627	intron_variant	0			-	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2344+5863C>T	7.37:g.157408190G>A			E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	NULL	p.S61	ENST00000389418.4	37	c.183	CCDS5947.1	7																																																																																			-	AC005481.5	-	NULL		0.607	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000222012	Clone_based_vega_gene	protein_coding	OTTHUMT00000353214.1	0	0	0	70	70	77	0.00	0.00	G			157408190	+1	20	35	62	83	tier1	no_errors	ENST00000409610	ensembl	human	putative	74_37	silent	24.39	29.66	SNP	0.000	A	20	62
SPACA6P-AS	102238594	genome.wustl.edu	37	19	52196888	52196888	+	lincRNA	SNP	C	C	T	rs554911608		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:52196888C>T	ENST00000602324.1	-	0	0				MIR125A_ENST00000385273.1_RNA|MIR99B_ENST00000384819.1_RNA|LINC00085_ENST00000573266.1_RNA|MIRLET7E_ENST00000362102.1_RNA	NR_029482.1|NR_029693.1																						CTACTCTGAGCGCCTCCGCAT	0.647													ENSG00000182310																																					0																																												0			-																													19.37:g.52196888C>T				R	SNP	-	NULL	ENST00000602324.1	37	NULL		19																																																																																			-	LINC00085	-	-		0.647	hsa-mir-125a.1-001	KNOWN	basic	lincRNA	LINC00085	HGNC	lincRNA	OTTHUMT00000467329.1	0	0	0	29	29	7	0.00	0.00	C			52196888	+1	9	4	16	12	tier1	no_errors	ENST00000573266	ensembl	human	known	74_37	rna	36.00	25.00	SNP	0.332	T	9	16
ZIM3	114026	genome.wustl.edu	37	19	57646928	57646928	+	Silent	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:57646928G>T	ENST00000269834.1	-	5	1162	c.777C>A	c.(775-777)gcC>gcA	p.A259A	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A259A(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCCAGGAAAAGGCTTTTCCAC	0.368													ENSG00000141946																																					1	Substitution - coding silent(1)	lung(1)											126.0	123.0	124.0					19																	57646928		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.777C>A	19.37:g.57646928G>T			Q14CA6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A259	ENST00000269834.1	37	c.777	CCDS33125.1	19																																																																																			-	ZIM3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.368	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM3	HGNC	protein_coding	OTTHUMT00000465078.1	0	0	0	48	48	96	0.00	0.00	G			57646928	-1	4	16	36	57	tier1	no_errors	ENST00000269834	ensembl	human	known	74_37	silent	10.00	21.92	SNP	0.983	T	4	36
TOP3B	8940	genome.wustl.edu	37	22	22313572	22313572	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr22:22313572G>A	ENST00000398793.2	-	16	2271	c.1837C>T	c.(1837-1839)Ccc>Tcc	p.P613S	TOP3B_ENST00000357179.5_Missense_Mutation_p.P613S	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	613					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		GCCGCCAGGGGCGAGAAAGAC	0.602													ENSG00000100038																																					0													122.0	104.0	110.0					22																	22313572		2203	4300	6503	SO:0001583	missense	0			-	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.1837C>T	22.37:g.22313572G>A	ENSP00000381773:p.Pro613Ser		A0M8Q3|Q9BUP5	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_D-bd,prints_Topo_IA	p.P613S	ENST00000398793.2	37	c.1837	CCDS13797.1	22	.	.	.	.	.	.	.	.	.	.	G	17.66	3.443976	0.63067	.	.	ENSG00000100038	ENST00000357179;ENST00000398793	T;T	0.22945	1.93;1.93	5.1	5.1	0.69264	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 1 (1);	0.000000	0.85682	D	0.000000	T	0.25938	0.0632	L	0.41824	1.3	0.80722	D	1	B;B;B	0.15473	0.004;0.012;0.013	B;B;B	0.21917	0.011;0.016;0.037	T	0.02925	-1.1093	10	0.32370	T	0.25	.	18.692	0.91586	0.0:0.0:1.0:0.0	.	158;613;613	B3KU89;O95985;O95985-2	.;TOP3B_HUMAN;.	S	613	ENSP00000349705:P613S;ENSP00000381773:P613S	ENSP00000349705:P613S	P	-	1	0	TOP3B	20643572	1.000000	0.71417	0.966000	0.40874	0.903000	0.53119	9.152000	0.94680	2.643000	0.89663	0.655000	0.94253	CCC	-	TOP3B	-	superfamily_Topo_IA_core_domain		0.602	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1	0	0	0	32	32	50	0.00	0.00	G	NM_003935		22313572	-1	11	14	20	48	tier1	no_errors	ENST00000357179	ensembl	human	known	74_37	missense	35.48	22.58	SNP	1.000	A	11	20
LYRM4-AS1	100129461	genome.wustl.edu	37	6	5030298	5030298	+	lincRNA	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:5030298C>A	ENST00000606227.1	-	0	6546				RP11-428J1.5_ENST00000606761.1_lincRNA																							TGGAGCATAGCGTCACTGAGC	0.537													ENSG00000272142																																					0																																												0			-																													6.37:g.5030298C>A				R	SNP	-	NULL	ENST00000606227.1	37	NULL		6																																																																																			-	RP11-428J1.5	-	-		0.537	RP11-428J1.4-001	KNOWN	basic	lincRNA	LOC100129461	Clone_based_vega_gene	lincRNA	OTTHUMT00000470950.1	0	0	0	23	23	69	0.00	0.00	C			5030298	+1	9	14	5	35	tier1	no_errors	ENST00000606761	ensembl	human	known	74_37	rna	64.29	28.57	SNP	0.000	A	9	5
OR6N1	128372	genome.wustl.edu	37	1	158736114	158736114	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:158736114T>C	ENST00000335094.2	-	1	378	c.359A>G	c.(358-360)tAc>tGc	p.Y120C		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					ATACCTATCGTAGGCCATAGC	0.507													ENSG00000197403																																					0													54.0	56.0	55.0					1																	158736114		2203	4300	6503	SO:0001583	missense	0			-	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.359A>G	1.37:g.158736114T>C	ENSP00000335535:p.Tyr120Cys		Q5VUU8|Q96R35	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y120C	ENST00000335094.2	37	c.359	CCDS30905.1	1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.857964	0.51376	.	.	ENSG00000197403	ENST00000335094	T	0.01347	4.99	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42053	D	0.000780	T	0.05914	0.0154	M	0.86651	2.83	0.34976	D	0.753648	D	0.89917	1.0	D	0.91635	0.999	T	0.01608	-1.1313	10	0.87932	D	0	-11.416	13.9937	0.64382	0.0:0.0:0.0:1.0	.	120	Q8NGY5	OR6N1_HUMAN	C	120	ENSP00000335535:Y120C	ENSP00000335535:Y120C	Y	-	2	0	OR6N1	157002738	0.003000	0.15002	1.000000	0.80357	0.917000	0.54804	0.464000	0.21988	2.119000	0.64992	0.533000	0.62120	TAC	-	OR6N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.507	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	HGNC	protein_coding	OTTHUMT00000059067.1	0	0	0	48	48	83	0.00	0.00	T	NM_001005185		158736114	-1	10	30	37	70	tier1	no_errors	ENST00000335094	ensembl	human	known	74_37	missense	21.28	29.70	SNP	1.000	C	10	37
PTPN5	84867	genome.wustl.edu	37	11	18762166	18762166	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:18762166A>G	ENST00000358540.2	-	8	1329	c.899T>C	c.(898-900)cTg>cCg	p.L300P	PTPN5_ENST00000496201.2_5'Flank|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396167.2_Missense_Mutation_p.L268P|PTPN5_ENST00000477854.1_Missense_Mutation_p.L104P|PTPN5_ENST00000396170.1_Missense_Mutation_p.L268P|PTPN5_ENST00000396171.4_Missense_Mutation_p.L300P|PTPN5_ENST00000396168.1_Missense_Mutation_p.L276P	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	300	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						TTCCGCCTGCAGCAGGAAAGG	0.612													ENSG00000110786																																					0													67.0	71.0	70.0					11																	18762166		2199	4293	6492	SO:0001583	missense	0			-	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.899T>C	11.37:g.18762166A>G	ENSP00000351342:p.Leu300Pro		B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L300P	ENST00000358540.2	37	c.899	CCDS7845.1	11	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358321	0.82243	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3	5.13	5.13	0.70059	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.64402	D	0.000013	T	0.70281	0.3206	H	0.94886	3.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80165	-0.1496	10	0.87932	D	0	.	14.9684	0.71213	1.0:0.0:0.0:0.0	.	300;268	P54829;B3KXG7	PTN5_HUMAN;.	P	104;300;268;300;268;276	ENSP00000435056:L104P;ENSP00000351342:L300P;ENSP00000379473:L268P;ENSP00000379474:L300P;ENSP00000379470:L268P;ENSP00000379471:L276P	ENSP00000351342:L300P	L	-	2	0	PTPN5	18718742	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.946000	0.92992	1.940000	0.56252	0.528000	0.53228	CTG	-	PTPN5	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt		0.612	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	HGNC	protein_coding	OTTHUMT00000259196.2	0	0	0	40	40	117	0.00	0.00	A	NM_001039970		18762166	-1	9	29	35	85	tier1	no_errors	ENST00000358540	ensembl	human	known	74_37	missense	20.45	25.44	SNP	1.000	G	9	35
NEDD4	4734	genome.wustl.edu	37	15	56164658	56164658	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:56164658A>G	ENST00000508342.1	-	3	1915	c.1616T>C	c.(1615-1617)tTg>tCg	p.L539S	NEDD4_ENST00000435532.3_Missense_Mutation_p.L120S|NEDD4_ENST00000338963.2_Intron|NEDD4_ENST00000506154.1_Missense_Mutation_p.L539S	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	539					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TGGTCTCTCCAATCTTGGATT	0.274													ENSG00000069869																																					0													24.0	23.0	24.0					15																	56164658		1669	3844	5513	SO:0001583	missense	0			-	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1616T>C	15.37:g.56164658A>G	ENSP00000424827:p.Leu539Ser		A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_WW_dom	p.L539S	ENST00000508342.1	37	c.1616		15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.51|13.51	2.259118|2.259118	0.39896|0.39896	.|.	.|.	ENSG00000069869|ENSG00000069869	ENST00000508342;ENST00000435532;ENST00000506154|ENST00000508871	D;D;T|.	0.91631|.	-2.88;-2.88;-0.57|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|.	.|.	.|.	.|.	T|T	0.46814|0.46814	0.1412|0.1412	L|L	0.36672|0.36672	1.1|1.1	0.28220|0.28220	N|N	0.926557|0.926557	B;B;B|.	0.21821|.	0.007;0.003;0.061|.	B;B;B|.	0.20184|.	0.005;0.005;0.028|.	T|T	0.42085|0.42085	-0.9472|-0.9472	9|5	0.40728|.	T|.	0.16|.	.|.	14.5043|14.5043	0.67743|0.67743	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	539;120;539|.	P46934-2;P46934-4;P46934|.	.;.;NEDD4_HUMAN|.	S|R	539;120;539|130	ENSP00000424827:L539S;ENSP00000410613:L120S;ENSP00000422705:L539S|.	ENSP00000410613:L120S|.	L|W	-|-	2|1	0|0	NEDD4|NEDD4	53951950|53951950	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	1.841000|1.841000	0.39240|0.39240	2.031000|2.031000	0.59945|0.59945	0.383000|0.383000	0.25322|0.25322	TTG|TGG	-	NEDD4	-	superfamily_C2_dom		0.274	NEDD4-002	KNOWN	basic	protein_coding	NEDD4	HGNC	protein_coding	OTTHUMT00000359817.1	0	0	0	133	133	55	0.00	0.00	A	NM_198400		56164658	-1	46	24	158	75	tier1	no_errors	ENST00000508342	ensembl	human	known	74_37	missense	22.55	24.24	SNP	1.000	G	46	158
IGSF9B	22997	genome.wustl.edu	37	11	133781869	133781869	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:133781869C>T	ENST00000533871.2	-	19	4247	c.4017G>A	c.(4015-4017)gcG>gcA	p.A1339A	IGSF9B_ENST00000564347.1_5'UTR	NM_001277285.1	NP_001264214.1	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1341	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GCCTCTCAGGCGCAGCAGCGT	0.537													ENSG00000080854																																					0																																										SO:0001819	synonymous_variant	0			-	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000533871.2:c.4017G>A	11.37:g.133781869C>T			G5EA26	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A1339	ENST00000533871.2	37	c.4017		11																																																																																			-	IGSF9B	-	NULL		0.537	IGSF9B-002	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	IGSF9B	HGNC	protein_coding	OTTHUMT00000471431.1	0	0	0	51	51	74	0.00	0.00	C	XM_290502		133781869	-1	11	36	12	44	tier1	no_errors	ENST00000533871	ensembl	human	putative	74_37	silent	47.83	45.00	SNP	1.000	T	11	12
RELL2	285613	genome.wustl.edu	37	5	141019123	141019123	+	Missense_Mutation	SNP	G	G	A	rs139014914		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:141019123G>A	ENST00000297164.3	+	4	1610	c.410G>A	c.(409-411)cGc>cAc	p.R137H	RELL2_ENST00000444782.1_Missense_Mutation_p.R137H|RELL2_ENST00000518856.1_Missense_Mutation_p.R71H|FCHSD1_ENST00000523856.1_5'UTR|RELL2_ENST00000518025.1_3'UTR|FCHSD1_ENST00000435817.2_3'UTR|RELL2_ENST00000521367.1_Missense_Mutation_p.R71H|HDAC3_ENST00000305264.3_5'Flank	NM_173828.4	NP_776189.3	Q8NC24	RELL2_HUMAN	RELT-like 2	137					positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATTGCAGCCGCAGCAAGAGG	0.647													ENSG00000164620																																					0								G	HIS/ARG,,HIS/ARG	0,4406		0,0,2203	41.0	44.0	43.0		410,,410	4.8	1.0	5	dbSNP_134	43	1,8599	1.2+/-3.3	0,1,4299	no	missense,utr-3,missense	FCHSD1,RELL2	NM_001130029.1,NM_033449.2,NM_173828.4	29,,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,,probably-damaging	137/304,,137/304	141019123	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AK054889	CCDS4265.1	5q31.3	2011-10-11	2007-06-15	2007-06-15	ENSG00000164620	ENSG00000164620			26902	protein-coding gene	gene with protein product		611213	"""chromosome 5 open reading frame 16"""	C5orf16		12975309, 16389068	Standard	NM_173828		Approved	FLJ90583	uc003lli.3	Q8NC24	OTTHUMG00000129612	ENST00000297164.3:c.410G>A	5.37:g.141019123G>A	ENSP00000297164:p.Arg137His		D3DQE2|Q6P4E7|Q6UXY2	Missense_Mutation	SNP	pfam_TNF_rcpt_RELT	p.R137H	ENST00000297164.3	37	c.410	CCDS4265.1	5	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806330	0.70682	0.0	1.16E-4	ENSG00000164620	ENST00000444782;ENST00000521367;ENST00000297164;ENST00000518856	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.7	4.77	0.60923	.	0.502118	0.19074	N	0.123434	T	0.37598	0.1009	N	0.14661	0.345	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.63703	0.917;0.869	T	0.15752	-1.0426	10	0.54805	T	0.06	-12.8261	9.8534	0.41070	0.074:0.0:0.7844:0.1416	.	71;137	E5RHA7;Q8NC24	.;RELL2_HUMAN	H	137;71;137;71	ENSP00000409443:R137H;ENSP00000430948:R71H;ENSP00000297164:R137H;ENSP00000427992:R71H	ENSP00000297164:R137H	R	+	2	0	RELL2	140999307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.079000	0.41577	2.683000	0.91414	0.655000	0.94253	CGC	rs139014914	RELL2	-	NULL		0.647	RELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RELL2	HGNC	protein_coding	OTTHUMT00000251807.2	0	0	0	82	82	22	0.00	0.00	G	NM_173828		141019123	+1	20	6	44	26	tier1	no_errors	ENST00000297164	ensembl	human	known	74_37	missense	31.25	18.18	SNP	0.998	A	20	44
TPD52L2	7165	genome.wustl.edu	37	20	62500659	62500659	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:62500659G>A	ENST00000346249.4	+	2	106	c.30G>A	c.(28-30)ctG>ctA	p.L10L	TPD52L2_ENST00000369927.4_Intron|TPD52L2_ENST00000352482.4_Silent_p.L10L|TPD52L2_ENST00000358548.4_Silent_p.L10L|TPD52L2_ENST00000351424.4_Silent_p.L10L|TPD52L2_ENST00000217121.5_Silent_p.L10L|TPD52L2_ENST00000348257.5_Silent_p.L10L	NM_001243891.1|NM_003288.3	NP_001230820.1|NP_003279.2	O43399	TPD54_HUMAN	tumor protein D52-like 2	10					regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(38;1.3e-12)|all_epithelial(29;2.23e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)					ATATCAACCTGAATTCTCCTA	0.488													ENSG00000101150																																					0													113.0	108.0	110.0					20																	62500659		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF004430	CCDS13540.1, CCDS13541.1, CCDS13542.1, CCDS13543.1, CCDS13544.1, CCDS13545.1, CCDS58785.1, CCDS74752.1, CCDS74753.1	20q13.2-q13.3	2007-12-19			ENSG00000101150	ENSG00000101150			12007	protein-coding gene	gene with protein product		603747				9484778	Standard	NM_199360		Approved	D54, hD54	uc002ygy.3	O43399	OTTHUMG00000033009	ENST00000346249.4:c.30G>A	20.37:g.62500659G>A			B4DPJ6|E1P5G7|O43398|Q5JWU5|Q5JWU6|Q5JWU8|Q5U0E0|Q9H3Z6	Silent	SNP	pfam_TPD52	p.L10	ENST00000346249.4	37	c.30	CCDS13540.1	20																																																																																			-	TPD52L2	-	NULL		0.488	TPD52L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPD52L2	HGNC	protein_coding	OTTHUMT00000080248.1	0	0	0	69	69	94	0.00	0.00	G			62500659	+1	16	25	54	75	tier1	no_errors	ENST00000217121	ensembl	human	known	74_37	silent	22.86	25.00	SNP	1.000	A	16	54
SP4	6671	genome.wustl.edu	37	7	21516784	21516784	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:21516784C>T	ENST00000222584.3	+	4	1984	c.1766C>T	c.(1765-1767)aCg>aTg	p.T589M		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	589					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GCTAATGCCACGATAGGTGCT	0.473													ENSG00000105866																																					0													109.0	93.0	98.0					7																	21516784		2203	4300	6503	SO:0001583	missense	0			-		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1766C>T	7.37:g.21516784C>T	ENSP00000222584:p.Thr589Met		O60402|Q32M52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T589M	ENST00000222584.3	37	c.1766	CCDS5373.1	7	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752685	0.69533	.	.	ENSG00000105866	ENST00000222584;ENST00000432066	T	0.11604	2.76	6.17	6.17	0.99709	.	0.192155	0.46145	D	0.000312	T	0.10337	0.0253	L	0.31926	0.97	0.46564	D	0.999103	P	0.48640	0.913	B	0.37550	0.253	T	0.02257	-1.1187	10	0.52906	T	0.07	.	17.766	0.88477	0.0:0.8782:0.1218:0.0	.	589	Q02446	SP4_HUMAN	M	589;32	ENSP00000222584:T589M	ENSP00000222584:T589M	T	+	2	0	SP4	21483309	1.000000	0.71417	0.991000	0.47740	0.972000	0.66771	5.468000	0.66743	2.941000	0.99782	0.655000	0.94253	ACG	-	SP4	-	NULL		0.473	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2	0	0	1	57	57	136	0.00	0.73	C	NM_003112		21516784	+1	15	17	51	75	tier1	no_errors	ENST00000222584	ensembl	human	known	74_37	missense	22.73	18.48	SNP	0.988	T	15	51
ACOXL	55289	genome.wustl.edu	37	2	111857883	111857883	+	Intron	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:111857883C>T	ENST00000439055.1	+	17	1766				AC096670.3_ENST00000376593.2_RNA	NM_001142807.1	NP_001136279.1	Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like						fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						ATCATGTGAGCATGCAGGTGA	0.473													ENSG00000204581																																					0																																										SO:0001627	intron_variant	0			-		CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000439055.1:c.1542+7340C>T	2.37:g.111857883C>T			A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	R	SNP	-	NULL	ENST00000439055.1	37	NULL	CCDS46389.1	2																																																																																			-	AC096670.3	-	-		0.473	ACOXL-013	KNOWN	basic|CCDS	protein_coding	FLJ44006	Clone_based_vega_gene	protein_coding	OTTHUMT00000376017.1	0	0	0	54	54	64	0.00	0.00	C	NM_018308		111857883	-1	15	7	33	46	tier1	no_errors	ENST00000376593	ensembl	human	known	74_37	rna	31.25	13.21	SNP	0.000	T	15	33
CNTNAP3	79937	genome.wustl.edu	37	9	39099915	39099915	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:39099915G>A	ENST00000297668.6	-	18	3061	c.2988C>T	c.(2986-2988)tgC>tgT	p.C996C	CNTNAP3_ENST00000377656.2_Intron|CNTNAP3_ENST00000358144.2_Silent_p.C908C	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	996	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TACCATTGGAGCAGAACGGCC	0.468													ENSG00000106714																																					0													43.0	36.0	38.0					9																	39099915		2202	4297	6499	SO:0001819	synonymous_variant	0			-	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2988C>T	9.37:g.39099915G>A			B1AMA0|Q9C0E9	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.C996	ENST00000297668.6	37	c.2988	CCDS6616.1	9																																																																																			-	CNTP3	-	superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,pfscan_EG-like_dom		0.468	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTP3	HGNC	protein_coding	OTTHUMT00000052511.1	0	0	0	119	119	73	0.00	0.00	G	NM_033655		39099915	-1	48	43	120	94	tier1	no_errors	ENST00000297668	ensembl	human	known	74_37	silent	28.40	31.39	SNP	0.759	A	48	120
MTHFD2L	441024	genome.wustl.edu	37	4	75040309	75040309	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:75040309T>C	ENST00000395759.2	+	2	257	c.230T>C	c.(229-231)cTt>cCt	p.L77P	MTHFD2L_ENST00000433372.1_5'UTR|MTHFD2L_ENST00000331145.6_Missense_Mutation_p.L19P|MTHFD2L_ENST00000325278.6_Missense_Mutation_p.L19P	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	77					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			TGGGTTTCCCTTGGAAACAGA	0.428													ENSG00000163738																																					0													92.0	92.0	92.0					4																	75040309		2203	4300	6503	SO:0001583	missense	0			-	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.230T>C	4.37:g.75040309T>C	ENSP00000379108:p.Leu77Pro		Q6P079|Q8N560	Missense_Mutation	SNP	pfam_THF_DH/CycHdrlase_D-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.L77P	ENST00000395759.2	37	c.230	CCDS47075.1	4	.	.	.	.	.	.	.	.	.	.	T	14.98	2.698398	0.48307	.	.	ENSG00000163738	ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T	0.30981	1.94;1.51;1.51;1.93	5.36	5.36	0.76844	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (1);	0.275863	0.37393	N	0.002120	T	0.35566	0.0936	L	0.48642	1.525	0.80722	D	1	P;P	0.41624	0.757;0.731	P;B	0.46885	0.53;0.3	T	0.05305	-1.0893	10	0.37606	T	0.19	-25.162	13.3557	0.60627	0.0:0.0:0.0:1.0	.	77;19	Q9H903;Q9H903-3	MTD2L_HUMAN;.	P	77;19;19;19	ENSP00000379108:L77P;ENSP00000330982:L19P;ENSP00000352012:L19P;ENSP00000321984:L19P	ENSP00000321984:L19P	L	+	2	0	MTHFD2L	75259173	0.167000	0.22975	0.997000	0.53966	0.933000	0.57130	1.157000	0.31724	2.248000	0.74166	0.523000	0.50628	CTT	-	MTHFD2L	-	pfam_THF_DH/CycHdrlase_cat_dom		0.428	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2L	HGNC	protein_coding		0	0	0	113	113	107	0.00	0.00	T	NM_001004346		75040309	+1	29	31	91	105	tier1	no_errors	ENST00000395759	ensembl	human	known	74_37	missense	24.17	22.63	SNP	0.996	C	29	91
AXIN1	8312	genome.wustl.edu	37	16	396193	396193	+	Missense_Mutation	SNP	G	G	A	rs147515329	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:396193G>A	ENST00000262320.3	-	2	1204	c.833C>T	c.(832-834)cCg>cTg	p.P278L	AXIN1_ENST00000354866.3_Missense_Mutation_p.P278L|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	278	Interaction with TP53. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.P278Q(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GGAGACCCTCGGGGCAGCTGT	0.602													ENSG00000103126																																					1	Substitution - Missense(1)	lung(1)						G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	47.0	49.0	48.0		833,833	4.1	0.9	16	dbSNP_134	48	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	AXIN1	NM_003502.3,NM_181050.2	98,98	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign,benign	278/863,278/827	396193	4,13002	2203	4300	6503	SO:0001583	missense	0			-	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.833C>T	16.37:g.396193G>A	ENSP00000262320:p.Pro278Leu		Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	pfam_DIX,pfam_RGS_dom,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.P278L	ENST00000262320.3	37	c.833	CCDS10405.1	16	.	.	.	.	.	.	.	.	.	.	G	7.638	0.680240	0.14907	0.0	4.65E-4	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.59224	0.28;0.28	5.1	4.09	0.47781	.	0.346259	0.32473	N	0.006045	T	0.29588	0.0738	N	0.03154	-0.405	0.46222	D	0.998935	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.08106	-1.0738	10	0.10636	T	0.68	-1.7229	10.652	0.45653	0.0:0.0:0.3643:0.6357	.	278;278	O15169-2;O15169	.;AXIN1_HUMAN	L	278	ENSP00000262320:P278L;ENSP00000346935:P278L	ENSP00000262320:P278L	P	-	2	0	AXIN1	336194	1.000000	0.71417	0.949000	0.38748	0.996000	0.88848	4.446000	0.60014	1.063000	0.40649	0.655000	0.94253	CCG	rs147515329	AXIN1	-	NULL		0.602	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXIN1	HGNC	protein_coding	OTTHUMT00000139441.3	0	0	0	48	48	22	0.00	0.00	G			396193	-1	11	13	20	33	tier1	no_errors	ENST00000262320	ensembl	human	known	74_37	missense	35.48	28.26	SNP	1.000	A	11	20
AP1M2	10053	genome.wustl.edu	37	19	10692454	10692454	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:10692454G>T	ENST00000250244.6	-	4	450	c.368C>A	c.(367-369)cCg>cAg	p.P123Q	AP1M2_ENST00000590923.1_Missense_Mutation_p.P123Q	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	123					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GGTGGTCTGCGGGAAGCCAAA	0.577													ENSG00000129354																																					0													75.0	77.0	76.0					19																	10692454		2203	4300	6503	SO:0001583	missense	0			-	AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.368C>A	19.37:g.10692454G>T	ENSP00000250244:p.Pro123Gln		B2RDV5|Q9BSI8	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.P123Q	ENST00000250244.6	37	c.368	CCDS45964.1	19	.	.	.	.	.	.	.	.	.	.	g	24.1	4.493043	0.84962	.	.	ENSG00000129354	ENST00000250244	T	0.70631	-0.5	5.05	5.05	0.67936	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	D	0.90573	0.7045	H	0.98612	4.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94047	0.7314	10	0.87932	D	0	-33.4156	17.403	0.87465	0.0:0.0:1.0:0.0	.	123;123	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	Q	123	ENSP00000250244:P123Q	ENSP00000250244:P123Q	P	-	2	0	AP1M2	10553454	1.000000	0.71417	0.943000	0.38184	0.810000	0.45777	9.597000	0.98273	2.639000	0.89480	0.485000	0.47835	CCG	-	AP1M2	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_Clathrin_mu,prints_Clathrin_mu		0.577	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP1M2	HGNC	protein_coding	OTTHUMT00000452034.1	0	0	0	46	46	30	0.00	0.00	G			10692454	-1	15	9	38	34	tier1	no_errors	ENST00000590923	ensembl	human	known	74_37	missense	28.30	20.93	SNP	1.000	T	15	38
MIR517A	574479	genome.wustl.edu	37	19	54215555	54215555	+	RNA	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:54215555T>C	ENST00000385001.1	+	0	34				MIR524_ENST00000385242.1_RNA|MIR519D_ENST00000385246.1_RNA	NR_030201.1				microRNA 517a																		GGAAGCACTGTCTGTTGTATA	0.473													ENSG00000207734																																					0													141.0	130.0	134.0					19																	54215555		1568	3582	5150			0			-			19q13.42	2011-09-12		2008-12-18	ENSG00000207734	ENSG00000207734		"""ncRNAs / Micro RNAs"""	32111	non-coding RNA	RNA, micro				MIRN517A			Standard	NR_030201		Approved	hsa-mir-517a	uc021vae.1				19.37:g.54215555T>C				R	SNP	-	NULL	ENST00000385001.1	37	NULL		19																																																																																			-	MIR517A	-	-		0.473	MIR517A-201	KNOWN	basic	miRNA	MIR517A	HGNC	miRNA		0	0	0	112	112	10	0.00	0.00	T	NR_030201		54215555	+1	22	3	79	13	tier1	no_errors	ENST00000385001	ensembl	human	known	74_37	rna	21.78	18.75	SNP	0.134	C	22	79
NSG1	27065	genome.wustl.edu	37	4	4411344	4411344	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:4411344C>T	ENST00000421177.2	+	8	2282	c.291C>T	c.(289-291)gtC>gtT	p.V97V	NSG1_ENST00000397958.1_Silent_p.V97V|NSG1_ENST00000513555.1_Silent_p.V97V|NSG1_ENST00000505246.1_Silent_p.V97V|NSG1_ENST00000506380.1_Silent_p.V97V|NSG1_ENST00000504171.1_Silent_p.V58V|NSG1_ENST00000433139.2_Silent_p.V97V			P42857	NSG1_HUMAN		97					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											TCACCTGCGTCGTCTTCCTGG	0.612													ENSG00000168824																																					0													195.0	150.0	166.0					4																	4411344		2203	4300	6503	SO:0001819	synonymous_variant	0			-																												ENST00000421177.2:c.291C>T	4.37:g.4411344C>T			B4DXC5|Q49AQ1	Silent	SNP	pfam_Calcyon_neuron-sp,pirsf_Calcyon_neuron-sp	p.V97	ENST00000421177.2	37	c.291	CCDS3376.1	4																																																																																			-	NSG1	-	pfam_Calcyon_neuron-sp,pirsf_Calcyon_neuron-sp		0.612	NSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSG1	Uniprot_gn	protein_coding	OTTHUMT00000246799.1	0	0	0	51	51	77	0.00	0.00	C			4411344	+1	15	22	32	70	tier1	no_errors	ENST00000397958	ensembl	human	known	74_37	silent	31.91	23.91	SNP	0.996	T	15	32
USP36	57602	genome.wustl.edu	37	17	76818061	76818061	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:76818061T>C	ENST00000542802.3	-	7	1158	c.715A>G	c.(715-717)Acc>Gcc	p.T239A	USP36_ENST00000588467.1_5'Flank|USP36_ENST00000449938.2_5'UTR|USP36_ENST00000312010.6_Missense_Mutation_p.T239A			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	239	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			TGGACCAAGGTAGTAGCCTGC	0.517													ENSG00000055483																																					0													153.0	127.0	136.0					17																	76818061		2203	4300	6503	SO:0001583	missense	0			-	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.715A>G	17.37:g.76818061T>C	ENSP00000441214:p.Thr239Ala		Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.T239A	ENST00000542802.3	37	c.715	CCDS32755.1	17	.	.	.	.	.	.	.	.	.	.	T	21.2	4.107291	0.77096	.	.	ENSG00000055483	ENST00000312010;ENST00000542802;ENST00000432878	T;T	0.30182	1.54;1.54	5.24	5.24	0.73138	.	0.048347	0.85682	D	0.000000	T	0.58352	0.2116	M	0.88979	2.995	0.80722	D	1	D	0.69078	0.997	D	0.71414	0.973	T	0.65541	-0.6143	10	0.72032	D	0.01	-29.6182	10.1194	0.42612	0.1493:0.0:0.0:0.8506	.	239	Q9P275-2	.	A	239	ENSP00000310590:T239A;ENSP00000441214:T239A	ENSP00000310590:T239A	T	-	1	0	USP36	74329656	1.000000	0.71417	0.044000	0.18714	0.950000	0.60333	5.455000	0.66658	1.983000	0.57843	0.459000	0.35465	ACC	-	USP36	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.517	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP36	HGNC	protein_coding	OTTHUMT00000437472.3	0	0	0	80	80	172	0.00	0.00	T	NM_025090		76818061	-1	22	40	56	149	tier1	no_errors	ENST00000312010	ensembl	human	known	74_37	missense	28.21	21.16	SNP	0.984	C	22	56
TSNAX	7257	genome.wustl.edu	37	1	231696971	231696971	+	Silent	SNP	G	G	A	rs372994168		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:231696971G>A	ENST00000366639.4	+	5	623	c.465G>A	c.(463-465)acG>acA	p.T155T	TSNAX-DISC1_ENST00000602962.1_Silent_p.T155T	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X	155	Interaction with C1D.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				TGATATTTACGACTGAAGACA	0.279													ENSG00000116918																																					0								G		0,4392		0,0,2196	46.0	52.0	50.0		465	-0.0	1.0	1		50	1,8573	1.2+/-3.3	0,1,4286	no	coding-synonymous	TSNAX	NM_005999.2		0,1,6482	AA,AG,GG		0.0117,0.0,0.0077		155/291	231696971	1,12965	2196	4287	6483	SO:0001819	synonymous_variant	0			-	X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.465G>A	1.37:g.231696971G>A			B1APC6	Silent	SNP	pfam_Translin,superfamily_Translin	p.T155	ENST00000366639.4	37	c.465	CCDS1596.1	1																																																																																			-	TSX	-	pfam_Translin,superfamily_Translin		0.279	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSX	HGNC	protein_coding	OTTHUMT00000095267.2	0	0	0	86	86	50	0.00	0.00	G	NM_005999		231696971	+1	29	18	93	56	tier1	no_errors	ENST00000366639	ensembl	human	known	74_37	silent	23.77	24.32	SNP	0.158	A	29	93
SPATA22	84690	genome.wustl.edu	37	17	3366054	3366054	+	Silent	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:3366054G>T	ENST00000573128.1	-	4	663	c.180C>A	c.(178-180)gcC>gcA	p.A60A	SPATA22_ENST00000268981.5_Silent_p.A60A|SPATA22_ENST00000575375.1_Silent_p.A60A|SPATA22_ENST00000541913.1_Silent_p.A44A|SPATA22_ENST00000572969.1_Silent_p.A60A|SPATA22_ENST00000397168.3_Silent_p.A60A|SPATA22_ENST00000355380.4_Silent_p.A17A			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	60					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						CAGCTTCCCAGGCCCAATCTC	0.343													ENSG00000141255																																					0													94.0	99.0	97.0					17																	3366054		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.180C>A	17.37:g.3366054G>T			B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Silent	SNP	NULL	p.A60	ENST00000573128.1	37	c.180	CCDS11027.1	17																																																																																			-	SPATA22	-	NULL		0.343	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATA22	HGNC	protein_coding	OTTHUMT00000438067.2	0	0	0	66	66	108	0.00	0.00	G	NM_032598		3366054	-1	26	20	47	52	tier1	no_errors	ENST00000397168	ensembl	human	known	74_37	silent	35.62	27.78	SNP	1.000	T	26	47
NECAB1	64168	genome.wustl.edu	37	8	91973050	91973050	+	IGR	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:91973050G>A	ENST00000417640.2	+	0	5289				RP11-122A3.2_ENST00000517562.2_Silent_p.L84L	NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			AGCTTCAACAGGAAATCTCTG	0.343													ENSG00000253250																																					0																																										SO:0001628	intergenic_variant	0			-	AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009		8.37:g.91973050G>A			Q6NUS7|Q96AZ7|Q9HBW8	Silent	SNP	NULL	p.L84	ENST00000417640.2	37	c.250	CCDS47889.1	8																																																																																			-	RP11-122A3.2	-	NULL		0.343	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100127983	Clone_based_vega_gene	protein_coding	OTTHUMT00000376728.1	0	0	0	139	139	69	0.00	0.00	G	NM_022351		91973050	-1	39	15	114	54	tier1	no_errors	ENST00000517562	ensembl	human	putative	74_37	silent	25.49	21.74	SNP	1.000	A	39	114
STARD9	57519	genome.wustl.edu	37	15	42977276	42977276	+	Missense_Mutation	SNP	G	G	A	rs369876432		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:42977276G>A	ENST00000290607.7	+	23	3557	c.3500G>A	c.(3499-3501)cGt>cAt	p.R1167H		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1167					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GGGGGCAATCGTCCCACCAAC	0.537													ENSG00000159433																																					0								A	HIS/ARG	1,1383		0,1,691	46.0	46.0	46.0		3500	-0.9	0.0	15		46	0,3180		0,0,1590	no	missense	STARD9	NM_020759.2	29	0,1,2281	AA,AG,GG		0.0,0.0723,0.0219		1167/4701	42977276	1,4563	692	1590	2282	SO:0001583	missense	0			-	AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.3500G>A	15.37:g.42977276G>A	ENSP00000290607:p.Arg1167His		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1167H	ENST00000290607.7	37	c.3500	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	g	8.991	0.977795	0.18812	7.23E-4	0.0	ENSG00000159433	ENST00000290607	T	0.63096	-0.02	5.61	-0.882	0.10604	.	1.848160	0.04020	N	0.299682	T	0.30885	0.0779	N	0.02011	-0.69	0.09310	N	1	.	.	.	.	.	.	T	0.12344	-1.0551	8	0.15066	T	0.55	2.7261	4.5374	0.12040	0.3804:0.0:0.3697:0.2498	.	.	.	.	H	1167	ENSP00000290607:R1167H	ENSP00000290607:R1167H	R	+	2	0	STARD9	40764568	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.734000	0.04893	-0.349000	0.08274	-0.269000	0.10298	CGT	-	STARD9	-	NULL		0.537	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	0	0	0	34	34	153	0.00	0.00	G			42977276	+1	8	38	35	116	tier1	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	18.60	24.68	SNP	0.000	A	8	35
CASZ1	54897	genome.wustl.edu	37	1	10703232	10703232	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:10703232G>A	ENST00000377022.3	-	19	4322	c.4005C>T	c.(4003-4005)cgC>cgT	p.R1335R	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1335					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		AGGGGGGCACGCGGTCGAAGT	0.662													ENSG00000130940																																					0													43.0	50.0	48.0					1																	10703232		2078	4200	6278	SO:0001819	synonymous_variant	0			-	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4005C>T	1.37:g.10703232G>A			Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1335	ENST00000377022.3	37	c.4005	CCDS41246.1	1																																																																																			-	CASZ1	-	NULL		0.662	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	0	0	0	106	106	20	0.00	0.00	G	NM_017766		10703232	-1	14	3	50	12	tier1	no_errors	ENST00000377022	ensembl	human	known	74_37	silent	21.88	20.00	SNP	0.107	A	14	50
BCHE	590	genome.wustl.edu	37	3	165547451	165547451	+	Silent	SNP	C	C	T	rs369712135		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:165547451C>T	ENST00000264381.3	-	2	1537	c.1371G>A	c.(1369-1371)ccG>ccA	p.P457P	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	457					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	ATTCTGGCCACGGAAGTTTGG	0.398													ENSG00000114200																																					0								C		1,4405	2.1+/-5.4	0,1,2202	97.0	101.0	100.0		1371	3.1	1.0	3		100	0,8600		0,0,4300	no	coding-synonymous	BCHE	NM_000055.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		457/603	165547451	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1371G>A	3.37:g.165547451C>T			A8K7P8	Silent	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.P457	ENST00000264381.3	37	c.1371	CCDS3198.1	3																																																																																			-	BCHE	-	pfam_CarbesteraseB		0.398	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	0	0	0	68	68	101	0.00	0.00	C			165547451	-1	17	22	47	70	tier1	no_errors	ENST00000264381	ensembl	human	known	74_37	silent	26.56	23.91	SNP	0.995	T	17	47
SEPT12	124404	genome.wustl.edu	37	16	4833438	4833438	+	Intron	SNP	C	C	T	rs376514473		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:4833438C>T	ENST00000268231.8	-	7	990				SEPT12_ENST00000396693.5_Intron|SEPT12_ENST00000591861.1_5'Flank	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12						cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						TCACCTCGCCCGCCTCCCGCC	0.502													ENSG00000140623																																					0								C	,	0,4394		0,0,2197	118.0	106.0	110.0		,	-6.5	0.0	16		110	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron	SEPT12	NM_001154458.2,NM_144605.4	,	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	,	,	4833438	1,12993	2197	4300	6497	SO:0001627	intron_variant	0			-	AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.726+24G>A	16.37:g.4833438C>T			Q0P6B0|Q1PBH0|Q96LL0	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_AIG1,pfam_Cell_div_FtsK/SpoIIIE,superfamily_P-loop_NTPase,pirsf_Septin	p.G251R	ENST00000268231.8	37	c.751	CCDS10522.1	16																																																																																			-	SEPT12	-	pirsf_Septin		0.502	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT12	HGNC	protein_coding	OTTHUMT00000251645.2	0	0	0	69	69	85	0.00	0.00	C	NM_144605		4833438	-1	19	45	31	40	tier1	no_errors	ENST00000587603	ensembl	human	known	74_37	missense	38.00	52.94	SNP	0.000	T	19	31
EPHA7	2045	genome.wustl.edu	37	6	93967917	93967917	+	Silent	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:93967917A>G	ENST00000369303.4	-	11	2194	c.2010T>C	c.(2008-2010)ggT>ggC	p.G670G		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	670	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTTCTGTGTAACCAACTTTCA	0.443													ENSG00000135333																																					0													138.0	140.0	139.0					6																	93967917		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2010T>C	6.37:g.93967917A>G			A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.G670	ENST00000369303.4	37	c.2010	CCDS5031.1	6																																																																																			-	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.443	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	0	0	0	96	96	110	0.00	0.00	A			93967917	-1	28	35	51	89	tier1	no_errors	ENST00000369303	ensembl	human	known	74_37	silent	35.44	28.23	SNP	1.000	G	28	51
SNHG14	104472715	genome.wustl.edu	37	15	25334989	25334989	+	RNA	SNP	G	G	A	rs534123185		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:25334989G>A	ENST00000546682.1	+	0	815				SNHG14_ENST00000549804.2_RNA|SNHG14_ENST00000384430.1_RNA|SNORD116-23_ENST00000384645.1_RNA|SNORD116-20_ENST00000384529.1_lincRNA|SNHG14_ENST00000553108.1_RNA|SNORD116-20_ENST00000384507.1_lincRNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		GGGCTCTTTCGGAGGCTGTTG	0.493													ENSG00000224078	G|||	1	0.000199681	0.0	0.0	5008	,	,		21083	0.0		0.001	False		,,,				2504	0.0																0																																												0			-			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25334989G>A				R	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			-	SNHG14	-	-		0.493	SNHG14-022	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000408281.1	0	0	0	38	38	122	0.00	0.00	G			25334989	+1	7	40	42	102	tier1	no_errors	ENST00000546682	ensembl	human	known	74_37	rna	14.29	28.17	SNP	0.002	A	7	42
PPP1R16A	84988	genome.wustl.edu	37	8	145722812	145722812	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:145722812G>A	ENST00000292539.4	+	2	1152	c.235G>A	c.(235-237)Gct>Act	p.A79T	CTD-2517M22.14_ENST00000532766.1_RNA|CTD-2517M14.5_ENST00000569326.1_RNA|PPP1R16A_ENST00000435887.1_Missense_Mutation_p.A79T			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	79						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TCTGGAGGCCGCTGCCCGAAA	0.647													ENSG00000160972																																					0													52.0	48.0	50.0					8																	145722812		2202	4300	6502	SO:0001583	missense	0			-		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.235G>A	8.37:g.145722812G>A	ENSP00000292539:p.Ala79Thr		D3DWM5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A79T	ENST00000292539.4	37	c.235	CCDS6429.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.54|16.54	3.150744|3.150744	0.57151|0.57151	.|.	.|.	ENSG00000160972|ENSG00000255182	ENST00000292539;ENST00000435887|ENST00000532766	T;T|.	0.72725|.	-0.68;-0.68|.	4.81|4.81	4.81|4.81	0.61882|0.61882	Ankyrin repeat-containing domain (4);|.	0.122037|.	0.56097|.	D|.	0.000035|.	T|T	0.77350|0.77350	0.4117|0.4117	M|M	0.80508|0.80508	2.5|2.5	0.54753|0.54753	D|D	0.999989|0.999989	P|.	0.44690|.	0.841|.	P|.	0.47430|.	0.547|.	T|T	0.81473|0.81473	-0.0917|-0.0917	10|6	0.48119|0.87932	T|D	0.1|0	.|.	15.3805|15.3805	0.74651|0.74651	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	79|.	Q96I34|.	PP16A_HUMAN|.	T|W	79|154	ENSP00000292539:A79T;ENSP00000391126:A79T|.	ENSP00000292539:A79T|ENSP00000435686:R154W	A|R	+|-	1|1	0|2	PPP1R16A|CTD-2517M22.14	145693620|145693620	0.997000|0.997000	0.39634|0.39634	0.999000|0.999000	0.59377|0.59377	0.079000|0.079000	0.17450|0.17450	2.503000|2.503000	0.45407|0.45407	2.236000|2.236000	0.73375|0.73375	0.462000|0.462000	0.41574|0.41574	GCT|CGG	-	PPP1R16A	-	superfamily_Ankyrin_rpt-contain_dom,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt-contain_dom		0.647	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16A	HGNC	protein_coding	OTTHUMT00000382459.1	0	0	0	52	52	61	0.00	0.00	G	NM_032902		145722812	+1	12	15	36	48	tier1	no_errors	ENST00000292539	ensembl	human	known	74_37	missense	25.00	23.81	SNP	0.998	A	12	36
SMARCAL1	50485	genome.wustl.edu	37	2	217315650	217315650	+	Missense_Mutation	SNP	C	C	T	rs119473037		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:217315650C>T	ENST00000357276.4	+	12	2263	c.1933C>T	c.(1933-1935)Cgc>Tgc	p.R645C	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.R645C	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	645			R -> C (in SIOD). {ECO:0000269|PubMed:11799392}.		cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CATGCTGCGGCGCCTCAAGTC	0.602									Schimke Immuno-Osseous Dysplasia				ENSG00000138375																																					0			GRCh37	CM020313	SMARCAL1	M	rs119473037						63.0	61.0	62.0					2																	217315650		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SIOD	-	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.1933C>T	2.37:g.217315650C>T	ENSP00000349823:p.Arg645Cys		A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	pfam_HARP_dom,pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R645C	ENST00000357276.4	37	c.1933	CCDS2403.1	2	.	.	.	.	.	.	.	.	.	.	C	28.3	4.905865	0.92107	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;D	0.99961	-9.38;-9.38;-9.38	5.32	5.32	0.75619	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.99975	0.9992	H	0.99273	4.495	0.80722	A	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97764	1.0222	9	0.87932	D	0	-14.1219	18.0562	0.89365	0.0:1.0:0.0:0.0	.	645	Q9NZC9	SMAL1_HUMAN	C	645;645;487	ENSP00000349823:R645C;ENSP00000350940:R645C;ENSP00000375974:R487C	ENSP00000349823:R645C	R	+	1	0	SMARCAL1	217023895	1.000000	0.71417	0.971000	0.41717	0.848000	0.48234	6.004000	0.70709	2.483000	0.83821	0.644000	0.83932	CGC	rs119473037	SMARCAL1	-	pfam_SNF2_N,superfamily_P-loop_NTPase		0.602	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	HGNC	protein_coding	OTTHUMT00000256671.2	0	0	0	30	30	31	0.00	0.00	C			217315650	+1	6	11	9	25	tier1	no_errors	ENST00000357276	ensembl	human	known	74_37	missense	40.00	30.56	SNP	1.000	T	6	9
BDKRB1	623	genome.wustl.edu	37	14	96730713	96730713	+	Missense_Mutation	SNP	C	C	T	rs371690606		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr14:96730713C>T	ENST00000216629.6	+	3	1300	c.694C>T	c.(694-696)Cgg>Tgg	p.R232W	BDKRB1_ENST00000553356.1_Missense_Mutation_p.R232W|RP11-404P21.3_ENST00000553638.1_RNA	NM_000710.3	NP_000701.2	P46663	BKRB1_HUMAN	bradykinin receptor B1	232					cell migration (GO:0016477)|inflammatory response (GO:0006954)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell growth (GO:0030308)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|peptide binding (GO:0042277)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(4)|skin(1)|urinary_tract(1)	16		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		CCTGCGAACGCGGGAGGAGGT	0.587													ENSG00000100739																																					0								C	TRP/ARG	0,4406		0,0,2203	70.0	65.0	67.0		694	4.0	0.0	14		67	1,8599	1.2+/-3.3	0,1,4299	no	missense	BDKRB1	NM_000710.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	232/354	96730713	1,13005	2203	4300	6503	SO:0001583	missense	0			-	L42383	CCDS9943.1	14q32.1-q32.2	2012-08-08				ENSG00000100739		"""GPCR / Class A : Bradykinin receptors"""	1029	protein-coding gene	gene with protein product		600337				8808279	Standard	NM_000710		Approved	BKR1, B1BKR, bradyb1	uc001yfh.3	P46663		ENST00000216629.6:c.694C>T	14.37:g.96730713C>T	ENSP00000216629:p.Arg232Trp		A8K7F5|Q546S7|Q8N0Y8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Brdyknn_1_rcpt,prints_GPCR_Rhodpsn,prints_Brdyknn_rcpt	p.R232W	ENST00000216629.6	37	c.694	CCDS9943.1	14	.	.	.	.	.	.	.	.	.	.	C	10.80	1.453944	0.26161	0.0	1.16E-4	ENSG00000100739	ENST00000216629;ENST00000553356	T;T	0.39787	1.06;1.06	4.92	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.396531	0.24291	U	0.039816	T	0.60483	0.2272	M	0.77616	2.38	0.09310	N	1	D;D	0.89917	0.999;1.0	P;D	0.76071	0.888;0.987	T	0.52697	-0.8541	10	0.62326	D	0.03	-3.4876	7.3442	0.26654	0.1656:0.7462:0.0:0.0882	.	232;232	G3V4Y2;P46663	.;BKRB1_HUMAN	W	232	ENSP00000216629:R232W;ENSP00000452064:R232W	ENSP00000216629:R232W	R	+	1	2	BDKRB1	95800466	0.000000	0.05858	0.014000	0.15608	0.099000	0.18886	0.389000	0.20751	1.072000	0.40860	0.456000	0.33151	CGG	-	BDKRB1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Brdyknn_1_rcpt		0.587	BDKRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDKRB1	HGNC	protein_coding	OTTHUMT00000413300.1	0	0	0	38	38	48	0.00	0.00	C			96730713	+1	13	22	19	30	tier1	no_errors	ENST00000216629	ensembl	human	known	74_37	missense	40.62	42.31	SNP	0.000	T	13	19
URI1	8725	genome.wustl.edu	37	19	30505904	30505904	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:30505904G>A	ENST00000542441.2	+	11	1833	c.1536G>A	c.(1534-1536)ctG>ctA	p.L512L	URI1_ENST00000312051.6_Silent_p.L472L|URI1_ENST00000360605.4_Intron|URI1_ENST00000392271.1_Silent_p.L436L			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	512					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										AGGAAGTTCTGTTGGAAGCAT	0.428													ENSG00000105176																																					0													116.0	116.0	116.0					19																	30505904		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.1536G>A	19.37:g.30505904G>A			A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin	p.L512	ENST00000542441.2	37	c.1536	CCDS12420.1	19																																																																																			-	URI1	-	NULL		0.428	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URI1	HGNC	protein_coding	OTTHUMT00000439756.1	0	0	1	59	59	139	0.00	0.71	G	NM_134447		30505904	+1	10	42	46	86	tier1	no_errors	ENST00000542441	ensembl	human	known	74_37	silent	17.86	32.31	SNP	0.723	A	10	46
RGSL1	353299	genome.wustl.edu	37	1	182496778	182496778	+	Missense_Mutation	SNP	C	C	T	rs367955469		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:182496778C>T	ENST00000294854.8	+	11	2016	c.1996C>T	c.(1996-1998)Cgg>Tgg	p.R666W	RGSL1_ENST00000456971.2_3'UTR|RGSL1_ENST00000542961.1_Missense_Mutation_p.R701W	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	666	RGS.				termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						CCTCAAGGAACGGAAGGCTAA	0.388													ENSG00000121446																									Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)												0													99.0	85.0	89.0					1																	182496778		692	1591	2283	SO:0001583	missense	0			-	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.1996C>T	1.37:g.182496778C>T	ENSP00000457748:p.Arg666Trp		A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam	p.R666W	ENST00000294854.8	37	c.1996	CCDS58049.1	1																																																																																			-	RGSL1	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam		0.388	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	RGSL1	HGNC	protein_coding	OTTHUMT00000320710.3	0	0	0	74	74	110	0.00	0.00	C	NM_181572		182496778	+1	19	25	75	56	tier1	no_errors	ENST00000294854	ensembl	human	known	74_37	missense	20.21	30.86	SNP	1.000	T	19	75
PVR	5817	genome.wustl.edu	37	19	45150757	45150757	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:45150757C>T	ENST00000425690.3	+	2	641	c.342C>T	c.(340-342)cgC>cgT	p.R114R	PVR_ENST00000344956.4_Silent_p.R114R|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000406449.4_Silent_p.R114R|PVR_ENST00000403059.4_Silent_p.R114R	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	114	Ig-like V-type.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		TCGGGTTGCGCGTAGAGGATG	0.622													ENSG00000073008																																					0													60.0	52.0	55.0					19																	45150757		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.342C>T	19.37:g.45150757C>T			B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Silent	SNP	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R114	ENST00000425690.3	37	c.342	CCDS12640.1	19																																																																																			-	PVR	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.622	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVR	HGNC	protein_coding	OTTHUMT00000323017.2	0	0	0	41	41	67	0.00	0.00	C	NM_006505		45150757	+1	12	24	32	77	tier1	no_errors	ENST00000425690	ensembl	human	known	74_37	silent	27.27	23.76	SNP	0.000	T	12	32
TFAP4	7023	genome.wustl.edu	37	16	4312668	4312668	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:4312668G>A	ENST00000204517.6	-	2	452	c.124C>T	c.(124-126)Cgg>Tgg	p.R42W		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	42					cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						TCCTGGTCCCGCTGAGTCTCG	0.622													ENSG00000090447																																					0													82.0	87.0	86.0					16																	4312668		2197	4300	6497	SO:0001583	missense	0			-	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.124C>T	16.37:g.4312668G>A	ENSP00000204517:p.Arg42Trp		O60409	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R42W	ENST00000204517.6	37	c.124	CCDS10510.1	16	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864473	0.51482	.	.	ENSG00000090447	ENST00000204517	D	0.98926	-5.24	5.57	-1.16	0.09678	Helix-loop-helix DNA-binding (1);	0.069327	0.56097	D	0.000031	D	0.97105	0.9054	N	0.08118	0	0.47698	D	0.99949	D	0.89917	1.0	D	0.75020	0.985	D	0.94273	0.7512	10	0.41790	T	0.15	.	16.3691	0.83347	0.0:0.0:0.4388:0.5612	.	42	Q01664	TFAP4_HUMAN	W	42	ENSP00000204517:R42W	ENSP00000204517:R42W	R	-	1	2	TFAP4	4252669	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	2.109000	0.41863	-0.011000	0.14247	0.591000	0.81541	CGG	-	TFAP4	-	superfamily_bHLH_dom		0.622	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP4	HGNC	protein_coding	OTTHUMT00000251595.2	0	0	0	26	26	35	0.00	0.00	G	NM_003223		4312668	-1	5	5	12	23	tier1	no_errors	ENST00000204517	ensembl	human	known	74_37	missense	29.41	17.86	SNP	1.000	A	5	12
MYT1L	23040	genome.wustl.edu	37	2	1796148	1796148	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:1796148G>A	ENST00000399161.2	-	24	4112	c.3365C>T	c.(3364-3366)gCg>gTg	p.A1122V	MYT1L_ENST00000407844.1_Missense_Mutation_p.A120V|MYT1L_ENST00000428368.2_Missense_Mutation_p.A1120V	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1122					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCTCAGGTTCGCCAGCTCGTG	0.542													ENSG00000186487																																					0													85.0	91.0	89.0					2																	1796148		2075	4223	6298	SO:0001583	missense	0			-	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3365C>T	2.37:g.1796148G>A	ENSP00000382114:p.Ala1122Val		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.A1122V	ENST00000399161.2	37	c.3365		2	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783788	0.90282	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000399157;ENST00000428368	T;T;T	0.49139	0.79;2.28;0.79	5.5	5.5	0.81552	.	0.047167	0.85682	D	0.000000	T	0.66366	0.2782	L	0.58101	1.795	0.58432	D	0.999999	D;D;D	0.89917	0.974;0.999;1.0	P;P;D	0.66716	0.542;0.883;0.946	T	0.68356	-0.5430	10	0.87932	D	0	-38.2564	19.3812	0.94536	0.0:0.0:1.0:0.0	.	120;1122;1120	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	V	1122;1068;120;176;1120	ENSP00000382114:A1122V;ENSP00000382111:A176V;ENSP00000396103:A1120V	ENSP00000295067:A1068V	A	-	2	0	MYT1L	1775155	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	7.789000	0.85783	2.572000	0.86782	0.655000	0.94253	GCG	-	MYT1L	-	NULL		0.542	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	0	0	0	24	24	89	0.00	0.00	G	NM_015025		1796148	-1	11	35	25	62	tier1	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	30.56	36.08	SNP	1.000	A	11	25
CCDC116	164592	genome.wustl.edu	37	22	21988606	21988606	+	Missense_Mutation	SNP	G	G	A	rs566751888		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr22:21988606G>A	ENST00000292779.3	+	3	529	c.368G>A	c.(367-369)cGg>cAg	p.R123Q	CCDC116_ENST00000607942.1_Missense_Mutation_p.R123Q	NM_152612.2	NP_689825.2	Q8IYX3	CC116_HUMAN	coiled-coil domain containing 116	123										endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(5)	22	Colorectal(54;0.105)					GGTGGACGGCGGGCACATGCC	0.667													ENSG00000161180	G|||	1	0.000199681	0.0	0.0014	5008	,	,		15415	0.0		0.0	False		,,,				2504	0.0																0													89.0	85.0	86.0					22																	21988606		2203	4300	6503	SO:0001583	missense	0			-	BC033499	CCDS13791.1	22q11.21	2006-06-27			ENSG00000161180	ENSG00000161180			26688	protein-coding gene	gene with protein product						12477932	Standard	NM_152612		Approved	FLJ36046	uc002zve.3	Q8IYX3	OTTHUMG00000150821	ENST00000292779.3:c.368G>A	22.37:g.21988606G>A	ENSP00000292779:p.Arg123Gln		Q8N9Y9	Missense_Mutation	SNP	NULL	p.R123Q	ENST00000292779.3	37	c.368	CCDS13791.1	22	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996109	0.35226	.	.	ENSG00000161180	ENST00000292779	T	0.21361	2.01	4.42	-0.429	0.12303	.	0.170908	0.28021	N	0.016905	T	0.14830	0.0358	L	0.46157	1.445	0.09310	N	1	P;D	0.55172	0.887;0.97	B;B	0.43754	0.142;0.43	T	0.14035	-1.0487	9	.	.	.	-60.2949	3.1411	0.06456	0.3154:0.0:0.4969:0.1877	.	123;123	B7Z7H5;Q8IYX3-2	.;.	Q	123	ENSP00000292779:R123Q	.	R	+	2	0	CCDC116	20318606	0.001000	0.12720	0.002000	0.10522	0.023000	0.10783	0.844000	0.27654	0.221000	0.20879	0.491000	0.48974	CGG	-	CCDC116	-	NULL		0.667	CCDC116-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC116	HGNC	protein_coding	OTTHUMT00000320199.1	0	0	0	52	52	15	0.00	0.00	G	NM_152612		21988606	+1	12	7	29	10	tier1	no_errors	ENST00000292779	ensembl	human	known	74_37	missense	29.27	41.18	SNP	0.000	A	12	29
ARID3B	10620	genome.wustl.edu	37	15	74883522	74883522	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:74883522T>C	ENST00000346246.5	+	6	1143	c.912T>C	c.(910-912)tgT>tgC	p.C304C		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	304	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.|Interaction with RB1.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						CCTATGAGTGTGAGAAGAAAG	0.552													ENSG00000179361																																					0													120.0	131.0	128.0					15																	74883522		2197	4295	6492	SO:0001819	synonymous_variant	0			-		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.912T>C	15.37:g.74883522T>C			O95443|Q59HC9|Q6P9C9	Silent	SNP	pfam_ARID/BRIGHT_D-bd,superfamily_ARID/BRIGHT_D-bd,smart_ARID/BRIGHT_D-bd,pfscan_ARID/BRIGHT_D-bd	p.C304	ENST00000346246.5	37	c.912	CCDS10264.1	15																																																																																			-	ARID3B	-	superfamily_ARID/BRIGHT_D-bd,smart_ARID/BRIGHT_D-bd,pfscan_ARID/BRIGHT_D-bd		0.552	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3B	HGNC	protein_coding	OTTHUMT00000280688.2	0	0	0	63	63	60	0.00	0.00	T	NM_006465		74883522	+1	16	21	57	39	tier1	no_errors	ENST00000346246	ensembl	human	known	74_37	silent	21.62	35.00	SNP	1.000	C	16	57
HMGCS2	3158	genome.wustl.edu	37	1	120301801	120301801	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:120301801G>A	ENST00000369406.3	-	4	839	c.790C>T	c.(790-792)Cgg>Tgg	p.R264W	HMGCS2_ENST00000544913.2_Missense_Mutation_p.R222W|HMGCS2_ENST00000476640.1_Intron	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	264					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		TCCAAGGCCCGCAAGTAGCAC	0.463													ENSG00000134240																																					0													122.0	120.0	121.0					1																	120301801		2203	4300	6503	SO:0001583	missense	0			-	BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.790C>T	1.37:g.120301801G>A	ENSP00000358414:p.Arg264Trp		B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Missense_Mutation	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.R264W	ENST00000369406.3	37	c.790	CCDS905.1	1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336829	0.60963	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	T;T	0.78003	-1.14;-1.14	5.26	4.33	0.51752	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.112215	0.39909	N	0.001229	D	0.83142	0.5190	M	0.82517	2.595	0.40561	D	0.98121	D;D	0.76494	0.994;0.999	P;P	0.62885	0.846;0.908	D	0.85949	0.1463	10	0.72032	D	0.01	-0.5823	11.8542	0.52427	0.0:0.0:0.6821:0.3178	.	222;264	B7Z8R3;P54868	.;HMCS2_HUMAN	W	264;222	ENSP00000358414:R264W;ENSP00000439495:R222W	ENSP00000358414:R264W	R	-	1	2	HMGCS2	120103324	0.997000	0.39634	0.531000	0.27976	0.469000	0.32828	2.596000	0.46205	1.173000	0.42796	0.655000	0.94253	CGG	-	HMGCS2	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk		0.463	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS2	HGNC	protein_coding	OTTHUMT00000033469.2	0	0	0	66	66	97	0.00	0.00	G	NM_005518		120301801	-1	19	24	57	59	tier1	no_errors	ENST00000369406	ensembl	human	known	74_37	missense	25.00	28.92	SNP	0.932	A	19	57
DEDD	9191	genome.wustl.edu	37	1	161093976	161093976	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:161093976T>C	ENST00000368006.3	-	3	491	c.277A>G	c.(277-279)Act>Gct	p.T93A	DEDD_ENST00000545495.1_Missense_Mutation_p.T93A|DEDD_ENST00000368005.1_Missense_Mutation_p.T93A|DEDD_ENST00000489249.1_5'UTR|DEDD_ENST00000458050.2_Missense_Mutation_p.T93A|NIT1_ENST00000368008.1_3'UTR|DEDD_ENST00000392188.1_Missense_Mutation_p.T93A|DEDD_ENST00000490843.2_Missense_Mutation_p.T93A	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing	93	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)			cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TCGTGGCGAGTGATGATGCGC	0.572													ENSG00000158796																																					0													80.0	74.0	76.0					1																	161093976		2203	4300	6503	SO:0001583	missense	0			-	AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.277A>G	1.37:g.161093976T>C	ENSP00000356985:p.Thr93Ala		D3DVF5|O60737	Missense_Mutation	SNP	pfam_DED,superfamily_DEATH-like_dom,smart_DED,pfscan_DED	p.T93A	ENST00000368006.3	37	c.277	CCDS1219.1	1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.076686	0.55753	.	.	ENSG00000158796	ENST00000368006;ENST00000392188;ENST00000545495;ENST00000458050;ENST00000541906;ENST00000368005;ENST00000535389	.	.	.	5.66	4.51	0.55191	DEATH-like (2);Death effector (3);	0.000000	0.85682	D	0.000000	T	0.51856	0.1699	L	0.45137	1.4	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.997	D;D;D	0.79108	0.992;0.98;0.992	T	0.50972	-0.8764	9	0.19147	T	0.46	.	10.3148	0.43729	0.1476:0.0:0.0:0.8524	.	50;93;93	B4DKM1;B1AQP5;O75618	.;.;DEDD_HUMAN	A	93;93;93;93;93;93;50	.	ENSP00000356984:T93A	T	-	1	0	DEDD	159360600	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.344000	0.79328	0.953000	0.37825	-0.336000	0.08194	ACT	-	DEDD	-	pfam_DED,superfamily_DEATH-like_dom,smart_DED,pfscan_DED		0.572	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEDD	HGNC	protein_coding	OTTHUMT00000080582.1	0	0	0	28	28	64	0.00	0.00	T	NM_004216		161093976	-1	10	22	27	55	tier1	no_errors	ENST00000368005	ensembl	human	known	74_37	missense	27.03	28.57	SNP	1.000	C	10	27
PCYOX1	51449	genome.wustl.edu	37	2	70486511	70486511	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:70486511T>C	ENST00000433351.2	+	2	160	c.132T>C	c.(130-132)atT>atC	p.I44I	PCYOX1_ENST00000545138.1_5'UTR|PCYOX1_ENST00000264441.5_Silent_p.I44I|PCYOX1_ENST00000505044.2_5'UTR	NM_016297.3	NP_057381.3	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1	44					prenylated protein catabolic process (GO:0030327)|prenylcysteine catabolic process (GO:0030328)|prenylcysteine metabolic process (GO:0030329)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	chloride-transporting ATPase activity (GO:0008555)|prenylcysteine oxidase activity (GO:0001735)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)	15						GAGCCGGAATTGGTGGCACTT	0.443													ENSG00000116005																																					0													142.0	159.0	153.0					2																	70486511		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB020715	CCDS1902.1	2p13.3	2008-02-05			ENSG00000116005	ENSG00000116005	1.8.3.5		20588	protein-coding gene	gene with protein product		610995				10585463, 12186880	Standard	NM_016297		Approved	KIAA0908, PCL1	uc002sgn.4	Q9UHG3	OTTHUMG00000129671	ENST00000433351.2:c.132T>C	2.37:g.70486511T>C			B2RB14|B7Z9P8|O94982|Q8N4N5|Q96QM8	Silent	SNP	pfam_Prenylcys_lyase,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/D,pfam_Amino_oxidase,pirsf_Prenylcysteine_Oxase	p.I44	ENST00000433351.2	37	c.132	CCDS1902.1	2																																																																																			-	PCYOX1	-	pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/D,pirsf_Prenylcysteine_Oxase		0.443	PCYOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1	HGNC	protein_coding	OTTHUMT00000251872.3	0	0	0	88	88	97	0.00	0.00	T	NM_016297		70486511	+1	21	25	81	95	tier1	no_errors	ENST00000433351	ensembl	human	known	74_37	silent	20.59	20.66	SNP	0.997	C	21	81
C1orf27	54953	genome.wustl.edu	37	1	186360840	186360840	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:186360840C>T	ENST00000287859.6	+	8	753	c.628C>T	c.(628-630)Cgc>Tgc	p.R210C	C1orf27_ENST00000419367.3_Missense_Mutation_p.R178C|C1orf27_ENST00000432021.3_Missense_Mutation_p.R210C|C1orf27_ENST00000367470.3_Missense_Mutation_p.R210C	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	210						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						TGGACTTACACGCTGGGCCAA	0.328													ENSG00000157181																																					0													78.0	79.0	79.0					1																	186360840		1839	4083	5922	SO:0001583	missense	0			-	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.628C>T	1.37:g.186360840C>T	ENSP00000287859:p.Arg210Cys		B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Missense_Mutation	SNP	NULL	p.R210C	ENST00000287859.6	37	c.628	CCDS53448.1	1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551046	0.65311	.	.	ENSG00000157181	ENST00000367470;ENST00000419367;ENST00000432021;ENST00000287859	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.93	4.93	0.64822	.	0.242240	0.40222	N	0.001144	T	0.60753	0.2293	M	0.65975	2.015	0.53688	D	0.99997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.985;0.95;0.95	T	0.62558	-0.6829	10	0.56958	D	0.05	-26.4955	13.1345	0.59402	0.1602:0.8398:0.0:0.0	.	178;210;210	E9PFR7;Q5SWX8-2;Q5SWX8	.;.;ODR4_HUMAN	C	210;178;210;210	ENSP00000356440:R210C;ENSP00000395084:R178C;ENSP00000402029:R210C;ENSP00000287859:R210C	ENSP00000287859:R210C	R	+	1	0	C1orf27	184627463	0.596000	0.26866	0.972000	0.41901	0.971000	0.66376	1.101000	0.31037	2.438000	0.82558	0.650000	0.86243	CGC	-	C1orf27	-	NULL		0.328	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C1orf27	HGNC	protein_coding	OTTHUMT00000086352.2	0	0	0	94	94	96	0.00	0.00	C	NM_017847		186360840	+1	37	25	90	80	tier1	no_errors	ENST00000287859	ensembl	human	known	74_37	missense	29.13	23.81	SNP	0.944	T	37	90
BAI1	575	genome.wustl.edu	37	8	143562626	143562626	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:143562626C>T	ENST00000517894.1	+	10	2734	c.1840C>T	c.(1840-1842)Cga>Tga	p.R614*	BAI1_ENST00000323289.5_Nonsense_Mutation_p.R614*			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	614					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ACTCATCCTGCGACGGTGTGA	0.607													ENSG00000181790																																					0													71.0	79.0	77.0					8																	143562626		2013	4188	6201	SO:0001587	stop_gained	0			-	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1840C>T	8.37:g.143562626C>T	ENSP00000430945:p.Arg614*			Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.R614*	ENST00000517894.1	37	c.1840		8	.	.	.	.	.	.	.	.	.	.	C	40	8.002495	0.98605	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	.	.	.	4.16	-0.734	0.11140	.	0.000000	0.64402	U	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2383	0.20776	0.2975:0.5284:0.0:0.1741	.	.	.	.	X	614	.	ENSP00000313046:R614X	R	+	1	2	BAI1	143559628	1.000000	0.71417	0.973000	0.42090	0.521000	0.34408	2.301000	0.43628	-0.044000	0.13491	0.313000	0.20887	CGA	-	BAI1	-	smart_GPCR_2_extracellular_dom,prints_GPCR_2_brain-spec_angio_inhib,pfscan_GPCR_2_extracellular_dom		0.607	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	0	0	0	80	80	73	0.00	0.00	C	NM_001702		143562626	+1	23	21	53	38	tier1	no_errors	ENST00000323289	ensembl	human	known	74_37	nonsense	30.26	35.59	SNP	0.995	T	23	53
CELSR3	1951	genome.wustl.edu	37	3	48688438	48688438	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:48688438G>A	ENST00000164024.4	-	15	6537	c.6257C>T	c.(6256-6258)tCg>tTg	p.S2086L	CELSR3_ENST00000544264.1_Missense_Mutation_p.S2086L	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2086	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.|Laminin EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ACATGAGCGCGAGGTGGAGCC	0.652													ENSG00000008300																																					0													48.0	50.0	49.0					3																	48688438		2202	4296	6498	SO:0001583	missense	0			-	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.6257C>T	3.37:g.48688438G>A	ENSP00000164024:p.Ser2086Leu		O75092	Missense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S2086L	ENST00000164024.4	37	c.6257	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	G	29.5	5.007397	0.93287	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.63255	-0.03;-0.03	5.44	5.44	0.79542	EGF-like, laminin (3);	.	.	.	.	D	0.85673	0.5751	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.977;0.998	D	0.89487	0.3754	9	0.87932	D	0	.	19.2788	0.94042	0.0:0.0:1.0:0.0	.	2086;2156	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	L	2086	ENSP00000164024:S2086L;ENSP00000445694:S2086L	ENSP00000164024:S2086L	S	-	2	0	CELSR3	48663442	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.476000	0.97823	2.567000	0.86603	0.655000	0.94253	TCG	-	CELSR3	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin		0.652	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	0	0	0	44	44	26	0.00	0.00	G	NM_001407		48688438	-1	10	5	17	16	tier1	no_errors	ENST00000544264	ensembl	human	known	74_37	missense	37.04	23.81	SNP	1.000	A	10	17
MKNK2	2872	genome.wustl.edu	37	19	2041986	2041986	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:2041986G>A	ENST00000591601.1	-	10	833	c.798C>T	c.(796-798)agC>agT	p.S266S	MKNK2_ENST00000541165.1_Silent_p.S135S|MKNK2_ENST00000309340.7_Silent_p.S266S|MKNK2_ENST00000591588.1_Silent_p.S10S|MKNK2_ENST00000591142.1_Silent_p.S10S|MKNK2_ENST00000588014.1_Silent_p.S10S|MKNK2_ENST00000250896.3_Silent_p.S266S			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGCCTCCTCGCTGAAGGCCT	0.662													ENSG00000099875																																					0													29.0	23.0	25.0					19																	2041986		2170	4255	6425	SO:0001819	synonymous_variant	0			-	AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.798C>T	19.37:g.2041986G>A			Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S266	ENST00000591601.1	37	c.798	CCDS12080.1	19																																																																																			-	MKNK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.662	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKNK2	HGNC	protein_coding	OTTHUMT00000449312.1	0	0	0	58	58	52	0.00	0.00	G	NM_199054		2041986	-1	10	3	27	22	tier1	no_errors	ENST00000250896	ensembl	human	known	74_37	silent	26.32	12.00	SNP	1.000	A	10	27
PRDM1	639	genome.wustl.edu	37	6	106552838	106552838	+	Missense_Mutation	SNP	G	G	A	rs367766895		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:106552838G>A	ENST00000369096.4	+	5	1037	c.803G>A	c.(802-804)cGt>cAt	p.R268H	PRDM1_ENST00000369089.3_Missense_Mutation_p.R134H|PRDM1_ENST00000369091.2_Missense_Mutation_p.R232H	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	268					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		GACCTCTACCGTTCTAACATT	0.478			"""D, N, Mis, F, S"""		DLBCL								ENSG00000057657																												Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	0								G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	219.0	236.0	230.0		401,803	1.2	0.0	6		230	0,8600		0,0,4300	no	missense,missense	PRDM1	NM_182907.1,NM_001198.3	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	134/692,268/826	106552838	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.803G>A	6.37:g.106552838G>A	ENSP00000358092:p.Arg268His		B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.R268H	ENST00000369096.4	37	c.803	CCDS5054.2	6	.	.	.	.	.	.	.	.	.	.	G	5.958	0.360654	0.11296	2.27E-4	0.0	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000450060;ENST00000369089	T;T;T;T	0.55760	3.14;3.13;0.5;3.12	5.73	1.17	0.20885	.	0.423809	0.28161	N	0.016367	T	0.15782	0.0380	L	0.31294	0.92	0.09310	N	1	B;B	0.12013	0.002;0.005	B;B	0.10450	0.001;0.005	T	0.22871	-1.0204	10	0.32370	T	0.25	-1.0114	6.4985	0.22155	0.223:0.2981:0.4789:0.0	.	134;268	Q86WM7;O75626	.;PRDM1_HUMAN	H	232;268;232;147;134	ENSP00000358087:R232H;ENSP00000358092:R268H;ENSP00000399772:R147H;ENSP00000358085:R134H	ENSP00000358085:R134H	R	+	2	0	PRDM1	106659531	0.745000	0.28261	0.003000	0.11579	0.254000	0.26022	1.744000	0.38268	0.295000	0.22570	-0.211000	0.12701	CGT	-	PRDM1	-	pirsf_Znf_PRDM1		0.478	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	0	0	0	110	110	115	0.00	0.00	G			106552838	+1	25	23	101	175	tier1	no_errors	ENST00000369096	ensembl	human	known	74_37	missense	19.84	11.50	SNP	0.002	A	25	101
DAB1	1600	genome.wustl.edu	37	1	57480999	57480999	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:57480999G>A	ENST00000371231.1	-	13	1134	c.1100C>T	c.(1099-1101)cCg>cTg	p.P367L	DAB1_ENST00000420954.2_Missense_Mutation_p.P332L|DAB1_ENST00000371236.2_Missense_Mutation_p.P334L|DAB1_ENST00000371234.4_Missense_Mutation_p.P334L|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000414851.2_Missense_Mutation_p.P316L|DAB1_ENST00000439789.2_Missense_Mutation_p.P248L			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	367					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CTGAGCCCCCGGCATCACCTG	0.667													ENSG00000173406																																					0													35.0	39.0	38.0					1																	57480999		2203	4298	6501	SO:0001583	missense	0			-	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1100C>T	1.37:g.57480999G>A	ENSP00000360275:p.Pro367Leu		A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.P367L	ENST00000371231.1	37	c.1100		1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092809	0.76756	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.54866	0.76;0.76;0.55;0.74;1.59;0.61	5.54	5.54	0.83059	.	0.098967	0.64402	D	0.000001	T	0.52370	0.1730	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D	0.69078	0.997;0.99;0.992;0.966;0.997	P;P;P;P;P	0.54174	0.744;0.734;0.744;0.482;0.744	T	0.45469	-0.9259	10	0.38643	T	0.18	-10.2179	12.275	0.54730	0.0:0.0:0.7212:0.2788	.	316;367;334;248;332	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	L	334;334;334;332;316;248;367	ENSP00000360280:P334L;ENSP00000360278:P334L;ENSP00000395296:P332L;ENSP00000387581:P316L;ENSP00000409328:P248L;ENSP00000360275:P367L	ENSP00000360275:P367L	P	-	2	0	DAB1	57253587	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	5.568000	0.67385	2.890000	0.99128	0.650000	0.86243	CCG	-	DAB1	-	NULL		0.667	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1	0	0	0	46	46	71	0.00	0.00	G	NM_021080		57480999	-1	4	11	29	74	tier1	no_errors	ENST00000371231	ensembl	human	known	74_37	missense	12.12	12.94	SNP	0.991	A	4	29
FAM83A	84985	genome.wustl.edu	37	8	124214732	124214732	+	Intron	SNP	T	T	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:124214732T>G	ENST00000518448.1	+	5	2787				FAM83A_ENST00000546351.1_Intron|FAM83A-AS1_ENST00000520576.1_RNA|FAM83A_ENST00000522648.1_Intron|FAM83A-AS1_ENST00000523330.1_RNA|FAM83A_ENST00000536633.1_Intron|FAM83A_ENST00000318462.6_Intron|FAM83A_ENST00000276699.6_Intron|FAM83A-AS1_ENST00000517519.1_RNA			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			atttgtgaacttgattagccg	0.443													ENSG00000204949																																					0																																										SO:0001627	intron_variant	0			-	BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.774-4665T>G	8.37:g.124214732T>G			Q71HL2|Q8N7I1|Q96I47	R	SNP	-	NULL	ENST00000518448.1	37	NULL	CCDS6340.1	8																																																																																			-	FAM83A-AS1	-	-		0.443	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83A-AS1	HGNC	protein_coding	OTTHUMT00000381737.1	0	0	1	89	89	109	0.00	0.91	T	NM_032899		124214732	-1	22	20	76	80	tier1	no_errors	ENST00000517519	ensembl	human	known	74_37	rna	22.45	20.00	SNP	0.002	G	22	76
PLA2G4F	255189	genome.wustl.edu	37	15	42444923	42444923	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:42444923C>T	ENST00000382396.4	-	7	650	c.564G>A	c.(562-564)acG>acA	p.T188T	PLA2G4F_ENST00000397272.3_Silent_p.T188T			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	188					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CTCCCCGGAGCGTGCCCTGGA	0.627													ENSG00000168907																																					0													45.0	37.0	40.0					15																	42444923		2185	4270	6455	SO:0001819	synonymous_variant	0			-		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.564G>A	15.37:g.42444923C>T			Q6ZMC8	Silent	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.T188	ENST00000382396.4	37	c.564	CCDS32204.1	15																																																																																			-	PLA2G4F	-	NULL		0.627	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLA2G4F	HGNC	protein_coding	OTTHUMT00000420463.1	0	0	0	17	17	62	0.00	0.00	C	NM_213600		42444923	-1	5	14	17	36	tier1	no_errors	ENST00000397272	ensembl	human	known	74_37	silent	22.73	27.45	SNP	0.006	T	5	17
MRPS30	10884	genome.wustl.edu	37	5	44811183	44811183	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:44811183G>A	ENST00000507110.1	+	2	712	c.674G>A	c.(673-675)cGa>cAa	p.R225Q	RP11-53O19.1_ENST00000505637.1_RNA|RP11-53O19.1_ENST00000514597.1_RNA|RP11-53O19.1_ENST00000505302.1_RNA|RP11-53O19.1_ENST00000508945.1_RNA|RP11-53O19.1_ENST00000503179.1_RNA|RP11-53O19.1_ENST00000505401.1_RNA|RP11-53O19.1_ENST00000508123.1_RNA|RP11-53O19.1_ENST00000503452.1_RNA	NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	225					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					CGAAGAGGTCGAATTGATGAC	0.363													ENSG00000112996																																					0													136.0	132.0	134.0					5																	44811183		2203	4300	6503	SO:0001583	missense	0			-	AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.674G>A	5.37:g.44811183G>A	ENSP00000424328:p.Arg225Gln		Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Missense_Mutation	SNP	pfam_Ribosomal_L37/S30	p.R225Q	ENST00000507110.1	37	c.674	CCDS3951.1	5	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558487	0.65538	.	.	ENSG00000112996	ENST00000507110	T	0.19105	2.17	5.31	3.51	0.40186	.	0.273815	0.35805	N	0.002975	T	0.33527	0.0866	M	0.75264	2.295	0.39346	D	0.965676	D	0.64830	0.994	P	0.55222	0.771	T	0.28004	-1.0057	10	0.13108	T	0.6	-2.697	11.0554	0.47915	0.1522:0.0:0.8478:0.0	.	225	Q9NP92	RT30_HUMAN	Q	225	ENSP00000424328:R225Q	ENSP00000424328:R225Q	R	+	2	0	MRPS30	44846940	0.998000	0.40836	0.936000	0.37596	0.703000	0.40648	3.159000	0.50731	0.707000	0.31934	0.655000	0.94253	CGA	-	MRPS30	-	pfam_Ribosomal_L37/S30		0.363	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS30	HGNC	protein_coding	OTTHUMT00000214033.2	0	0	0	137	137	119	0.00	0.00	G	NM_016640		44811183	+1	49	26	119	78	tier1	no_errors	ENST00000507110	ensembl	human	known	74_37	missense	29.17	25.00	SNP	0.995	A	49	119
OR4D10	390197	genome.wustl.edu	37	11	59245410	59245410	+	Missense_Mutation	SNP	G	G	A	rs201321935		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:59245410G>A	ENST00000530162.1	+	1	565	c.508G>A	c.(508-510)Gga>Aga	p.G170R		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G168R(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCTTTCTGCGGACCCAATGT	0.498													ENSG00000254466	G|||	1	0.000199681	0.0	0.0	5008	,	,		19684	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	prostate(1)											112.0	111.0	111.0					11																	59245410		2201	4295	6496	SO:0001583	missense	0			-	AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.508G>A	11.37:g.59245410G>A	ENSP00000436424:p.Gly170Arg		B2RNH6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G170R	ENST00000530162.1	37	c.508	CCDS53636.1	11	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007513	0.35415	.	.	ENSG00000254466	ENST00000530162	T	0.38560	1.13	4.71	2.84	0.33178	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.61223	0.2330	M	0.76727	2.345	0.29486	N	0.856014	D	0.89917	1.0	D	0.87578	0.998	T	0.56757	-0.7926	9	0.87932	D	0	.	9.0361	0.36289	0.1839:0.0:0.8161:0.0	.	170	Q8NGI6	OR4DA_HUMAN	R	170	ENSP00000436424:G170R	ENSP00000436424:G170R	G	+	1	0	OR4D10	59001986	0.998000	0.40836	0.993000	0.49108	0.081000	0.17604	2.324000	0.43831	0.522000	0.28464	-0.136000	0.14681	GGA	rs201321935	OR4D10	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.498	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D10	HGNC	protein_coding	OTTHUMT00000394235.1	0	0	0	53	53	71	0.00	0.00	G	NM_001004705		59245410	+1	6	26	30	66	tier1	no_errors	ENST00000530162	ensembl	human	known	74_37	missense	16.67	28.26	SNP	0.923	A	6	30
KIF14	9928	genome.wustl.edu	37	1	200572974	200572974	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:200572974C>T	ENST00000367350.4	-	9	2294	c.1856G>A	c.(1855-1857)cGa>cAa	p.R619Q		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	619	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TACCTTTAGTCGATCTCCATT	0.403													ENSG00000118193																																					0													118.0	107.0	111.0					1																	200572974		2203	4300	6503	SO:0001583	missense	0			-	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.1856G>A	1.37:g.200572974C>T	ENSP00000356319:p.Arg619Gln		Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R619Q	ENST00000367350.4	37	c.1856	CCDS30963.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.440016	0.96168	.	.	ENSG00000118193	ENST00000367350	T	0.75260	-0.92	5.31	3.46	0.39613	Kinesin, motor domain (4);	0.068450	0.64402	N	0.000019	D	0.84047	0.5386	M	0.75884	2.315	0.53688	D	0.999975	D	0.89917	1.0	D	0.77557	0.99	D	0.84421	0.0571	10	0.87932	D	0	.	11.5303	0.50604	0.0:0.8548:0.0:0.1452	.	619	Q15058	KIF14_HUMAN	Q	619	ENSP00000356319:R619Q	ENSP00000356319:R619Q	R	-	2	0	KIF14	198839597	0.997000	0.39634	0.082000	0.20525	0.664000	0.39144	3.794000	0.55492	0.633000	0.30452	0.585000	0.79938	CGA	-	KIF14	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.403	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF14	HGNC	protein_coding	OTTHUMT00000086878.1	0	0	0	67	67	65	0.00	0.00	C	NM_014875		200572974	-1	29	33	39	55	tier1	no_errors	ENST00000367350	ensembl	human	known	74_37	missense	42.65	37.50	SNP	0.978	T	29	39
MCM9	254394	genome.wustl.edu	37	6	119136219	119136219	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:119136219G>A	ENST00000316316.6	-	13	3486	c.3200C>T	c.(3199-3201)tCg>tTg	p.S1067L		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	1067					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		TTTGGATTCCGATGGGGGAGT	0.498													ENSG00000111877																																					0																																										SO:0001583	missense	0			-	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.3200C>T	6.37:g.119136219G>A	ENSP00000314505:p.Ser1067Leu		B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	pfam_MCM_D-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_D-dep_ATPase,smart_AAA+_ATPase,prints_MCM_D-dep_ATPase,pfscan_MCM_D-dep_ATPase	p.S1067L	ENST00000316316.6	37	c.3200	CCDS56447.1	6	.	.	.	.	.	.	.	.	.	.	G	10.38	1.333031	0.24167	.	.	ENSG00000111877	ENST00000316316;ENST00000243218	T	0.04234	3.67	5.7	1.99	0.26369	.	1024.330000	0.00447	U	0.000081	T	0.03053	0.0090	M	0.65975	2.015	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.48980	-0.8986	10	0.39692	T	0.17	.	12.0524	0.53513	0.197:0.0:0.803:0.0	.	1067	Q9NXL9	MCM9_HUMAN	L	1067;686	ENSP00000314505:S1067L	ENSP00000243218:S686L	S	-	2	0	MCM9	119242922	0.359000	0.24955	0.001000	0.08648	0.003000	0.03518	1.166000	0.31834	0.077000	0.16863	-0.940000	0.02684	TCG	-	MCM9	-	NULL		0.498	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	HGNC	protein_coding	OTTHUMT00000042005.4	0	0	0	21	21	95	0.00	0.00	G	NM_153255		119136219	-1	7	26	9	76	tier1	no_errors	ENST00000316316	ensembl	human	known	74_37	missense	43.75	25.49	SNP	0.013	A	7	9
FBXL6	26233	genome.wustl.edu	37	8	145581176	145581176	+	Intron	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:145581176G>A	ENST00000331890.5	-	3	640				FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank|FBXL6_ENST00000455319.2_Intron|SLC52A2_ENST00000540505.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6						protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GGCCGACAGCGGAGGCAGAGC	0.602													ENSG00000185803																																					0													79.0	76.0	77.0					8																	145581176		2203	4300	6503	SO:0001627	intron_variant	0			-	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.576-14C>T	8.37:g.145581176G>A			Q53G43|Q9H5W9|Q9UKC7	R	SNP	-	NULL	ENST00000331890.5	37	NULL	CCDS6422.1	8																																																																																			-	SLC52A2	-	-		0.602	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC52A2	HGNC	protein_coding	OTTHUMT00000382413.1	0	0	0	22	22	129	0.00	0.00	G	NM_024555		145581176	+1	8	48	14	98	tier1	no_errors	ENST00000532815	ensembl	human	known	74_37	rna	36.36	32.88	SNP	0.939	A	8	14
FTCD	10841	genome.wustl.edu	37	21	47556290	47556290	+	3'UTR	SNP	C	C	T	rs547177806		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr21:47556290C>T	ENST00000291670.5	-	0	1790				FTCD_ENST00000359679.2_3'UTR|FTCD_ENST00000355384.2_3'UTR|FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397748.1_3'UTR	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase						cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	GAAGGGTGGACGGGAACTGAG	0.592													ENSG00000160282	C|||	1	0.000199681	0.0	0.0	5008	,	,		16019	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			-	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.*121G>A	21.37:g.47556290C>T			B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	R	SNP	-	NULL	ENST00000291670.5	37	NULL	CCDS13731.1	21																																																																																			-	FTCD	-	-		0.592	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	HGNC	protein_coding	OTTHUMT00000206962.1	0	0	0	31	31	106	0.00	0.00	C	NM_006657		47556290	-1	5	39	14	52	tier1	no_errors	ENST00000460011	ensembl	human	known	74_37	rna	26.32	42.86	SNP	0.000	T	5	14
CPB1	1360	genome.wustl.edu	37	3	148558511	148558511	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:148558511A>G	ENST00000491148.1	+	5	645	c.311A>G	c.(310-312)cAg>cGg	p.Q104R	CPB1_ENST00000282957.4_Missense_Mutation_p.Q104R			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	104						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			GTGGAGGCTCAGTTTGATAGC	0.438													ENSG00000153002																																					0													158.0	160.0	159.0					3																	148558511		2203	4300	6503	SO:0001583	missense	0			-	AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.311A>G	3.37:g.148558511A>G	ENSP00000417222:p.Gln104Arg		O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.Q104R	ENST00000491148.1	37	c.311	CCDS33874.1	3	.	.	.	.	.	.	.	.	.	.	A	15.41	2.826070	0.50739	.	.	ENSG00000153002	ENST00000491148;ENST00000282957;ENST00000468341	T;T;T	0.15834	2.39;2.39;2.39	5.15	5.15	0.70609	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.135492	0.53938	D	0.000049	T	0.44726	0.1307	M	0.79926	2.475	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.50013	-0.8877	10	0.87932	D	0	.	15.0077	0.71524	1.0:0.0:0.0:0.0	.	104	P15086	CBPB1_HUMAN	R	104	ENSP00000417222:Q104R;ENSP00000282957:Q104R;ENSP00000419427:Q104R	ENSP00000282957:Q104R	Q	+	2	0	CPB1	150041201	1.000000	0.71417	0.997000	0.53966	0.205000	0.24178	8.817000	0.91985	1.934000	0.56057	0.533000	0.62120	CAG	-	CPB1	-	pfam_Prot_inh_M14A,superfamily_Prot_inh_propept		0.438	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPB1	HGNC	protein_coding	OTTHUMT00000355928.1	0	0	0	106	106	157	0.00	0.00	A	NM_001871		148558511	+1	29	56	83	135	tier1	no_errors	ENST00000282957	ensembl	human	known	74_37	missense	25.89	29.32	SNP	1.000	G	29	83
SLITRK6	84189	genome.wustl.edu	37	13	86368334	86368334	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr13:86368334T>C	ENST00000400286.2	-	2	2908	c.2310A>G	c.(2308-2310)ggA>ggG	p.G770G		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	770					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		ATTCTGTGATTCCCAGTTGCT	0.403													ENSG00000184564																																					0													198.0	183.0	188.0					13																	86368334		1844	4095	5939	SO:0001819	synonymous_variant	0			-	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.2310A>G	13.37:g.86368334T>C			A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G770	ENST00000400286.2	37	c.2310	CCDS41903.1	13																																																																																			-	SLITRK6	-	NULL		0.403	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	0	0	0	44	44	129	0.00	0.00	T	NM_032229		86368334	-1	7	25	23	87	tier1	no_errors	ENST00000400286	ensembl	human	known	74_37	silent	23.33	22.32	SNP	1.000	C	7	23
FGD5	152273	genome.wustl.edu	37	3	14949206	14949206	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:14949206C>T	ENST00000285046.5	+	10	3434	c.3324C>T	c.(3322-3324)ctC>ctT	p.L1108L	FGD5_ENST00000543601.1_Silent_p.L867L|FGD5_ENST00000476851.1_3'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1108					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GGGATCTCCTCCAGCCAGGAA	0.647													ENSG00000154783																																					0													42.0	49.0	46.0					3																	14949206		2012	4153	6165	SO:0001819	synonymous_variant	0			-	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3324C>T	3.37:g.14949206C>T			B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.L1108	ENST00000285046.5	37	c.3324	CCDS46767.1	3																																																																																			-	FGD5	-	NULL		0.647	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	0	0	0	77	77	63	0.00	0.00	C	NM_152536		14949206	+1	39	34	315	276	tier1	no_errors	ENST00000285046	ensembl	human	known	74_37	silent	11.02	10.90	SNP	1.000	T	39	315
KCNC4	3749	genome.wustl.edu	37	1	110765809	110765809	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:110765809T>C	ENST00000369787.3	+	2	929	c.902T>C	c.(901-903)gTg>gCg	p.V301A	KCNC4_ENST00000438661.2_Missense_Mutation_p.V301A|KCNC4_ENST00000413138.3_Missense_Mutation_p.V301A|KCNC4_ENST00000412512.2_Intron	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	301					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		GTGCGCATCGTGTGCTGCCCC	0.602													ENSG00000116396																																					0													304.0	222.0	250.0					1																	110765809		2203	4300	6503	SO:0001583	missense	0			-	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.902T>C	1.37:g.110765809T>C	ENSP00000358802:p.Val301Ala		Q3MIM4|Q5TBI6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_K_chnl_volt-dep_Kv3_ID,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.4,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.V301A	ENST00000369787.3	37	c.902	CCDS821.1	1	.	.	.	.	.	.	.	.	.	.	T	13.89	2.371778	0.42003	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.98633	-5.04;-5.04;-5.04	4.62	3.49	0.39957	Ion transport (1);	0.240742	0.42053	D	0.000771	D	0.93900	0.8048	N	0.17723	0.515	0.46260	D	0.998955	B;B;B	0.31752	0.056;0.026;0.338	B;B;B	0.38755	0.069;0.026;0.281	D	0.91614	0.5305	10	0.42905	T	0.14	.	10.1597	0.42844	0.0:0.0803:0.0:0.9197	.	301;301;301	Q03721;Q03721-3;Q03721-2	KCNC4_HUMAN;.;.	A	301	ENSP00000358802:V301A;ENSP00000388029:V301A;ENSP00000393655:V301A	ENSP00000358802:V301A	V	+	2	0	KCNC4	110567332	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.516000	0.53436	0.736000	0.32559	0.260000	0.18958	GTG	-	KCNC4	-	pfam_Ion_trans_dom,prints_K_chnl		0.602	KCNC4-004	KNOWN	basic|CCDS	protein_coding	KCNC4	HGNC	protein_coding	OTTHUMT00000052146.2	0	0	0	13	13	82	0.00	0.00	T	NM_001039574		110765809	+1	5	17	19	38	tier1	no_errors	ENST00000369787	ensembl	human	known	74_37	missense	20.83	30.91	SNP	1.000	C	5	19
COPB2	9276	genome.wustl.edu	37	3	139108396	139108396	+	5'UTR	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:139108396T>C	ENST00000333188.5	-	0	178				RP11-319G6.1_ENST00000504670.1_RNA|RP11-319G6.1_ENST00000507362.1_RNA|RP11-319G6.1_ENST00000512622.1_RNA|COPB2_ENST00000510491.1_5'UTR|RNU6-736P_ENST00000516436.1_RNA|RP11-319G6.1_ENST00000510068.1_RNA|RP11-319G6.1_ENST00000514729.1_RNA|COPB2_ENST00000507777.1_Intron|RP11-319G6.1_ENST00000515247.1_RNA	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)						COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						CTACCATGGCTGCGTCGGTCC	0.592													ENSG00000184432																																					0													51.0	50.0	50.0					3																	139108396		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			-	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.-4A>G	3.37:g.139108396T>C			B4DZI8	R	SNP	-	NULL	ENST00000333188.5	37	NULL	CCDS3108.1	3																																																																																			-	COPB2	-	-		0.592	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB2	HGNC	protein_coding	OTTHUMT00000358495.2	0	0	1	252	252	108	0.00	0.92	T	NM_004766		139108396	-1	67	22	154	81	tier1	no_errors	ENST00000510491	ensembl	human	known	74_37	rna	30.32	21.15	SNP	0.960	C	67	154
NUP54	53371	genome.wustl.edu	37	4	77065350	77065350	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:77065350T>C	ENST00000264883.3	-	3	387	c.247A>G	c.(247-249)Act>Gct	p.T83A	NUP54_ENST00000342467.6_5'UTR|NUP54_ENST00000515460.1_5'UTR|NUP54_ENST00000514987.1_Intron|NUP54_ENST00000458189.2_5'UTR	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	83	9 X 2 AA repeats of F-G.|Gly-rich.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						CCCAGTCCAGTTCCCAAACCA	0.423													ENSG00000138750																																					0													253.0	255.0	255.0					4																	77065350		2203	4300	6503	SO:0001583	missense	0			-	AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.247A>G	4.37:g.77065350T>C	ENSP00000264883:p.Thr83Ala		B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Missense_Mutation	SNP	NULL	p.T83A	ENST00000264883.3	37	c.247	CCDS3576.1	4	.	.	.	.	.	.	.	.	.	.	T	14.45	2.537716	0.45176	.	.	ENSG00000138750	ENST00000264883;ENST00000514901	.	.	.	5.76	4.58	0.56647	.	0.147588	0.64402	D	0.000010	T	0.40546	0.1121	L	0.34521	1.04	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.22521	-1.0214	9	0.05959	T	0.93	-19.5175	11.4886	0.50369	0.0:0.07:0.0:0.93	.	83	Q7Z3B4	NUP54_HUMAN	A	83;137	.	ENSP00000264883:T83A	T	-	1	0	NUP54	77284374	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.019000	0.49635	2.315000	0.78130	0.533000	0.62120	ACT	-	NUP54	-	NULL		0.423	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP54	HGNC	protein_coding	OTTHUMT00000252402.3	0	0	0	88	88	208	0.00	0.00	T			77065350	-1	21	50	61	139	tier1	no_errors	ENST00000264883	ensembl	human	known	74_37	missense	25.61	26.46	SNP	1.000	C	21	61
AHNAK2	113146	genome.wustl.edu	37	14	105420418	105420418	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr14:105420418C>T	ENST00000333244.5	-	7	1489	c.1370G>A	c.(1369-1371)aGc>aAc	p.S457N	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	457						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GATTTCCAGGCTCTGCAGTCC	0.597													ENSG00000185567																																					0													49.0	54.0	52.0					14																	105420418		2027	4176	6203	SO:0001583	missense	0			-	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1370G>A	14.37:g.105420418C>T	ENSP00000353114:p.Ser457Asn		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S457N	ENST00000333244.5	37	c.1370	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	c	17.51	3.406805	0.62399	.	.	ENSG00000185567	ENST00000333244	T	0.03745	3.82	5.1	2.24	0.28232	.	.	.	.	.	T	0.02455	0.0075	N	0.14661	0.345	0.09310	N	1	B	0.28713	0.22	B	0.30105	0.111	T	0.50381	-0.8835	9	0.16896	T	0.51	.	8.0663	0.30663	0.0:0.6123:0.3047:0.083	.	457	Q8IVF2	AHNK2_HUMAN	N	457	ENSP00000353114:S457N	ENSP00000353114:S457N	S	-	2	0	AHNAK2	104491463	0.000000	0.05858	0.001000	0.08648	0.324000	0.28378	-0.266000	0.08631	0.250000	0.21479	0.555000	0.69702	AGC	-	AHK2	-	NULL		0.597	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK2	HGNC	protein_coding	OTTHUMT00000410300.1	0	0	0	40	40	71	0.00	0.00	C	NM_138420		105420418	-1	7	23	18	18	tier1	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	28.00	56.10	SNP	0.011	T	7	18
TNC	3371	genome.wustl.edu	37	9	117825395	117825395	+	Silent	SNP	C	C	T	rs150370072	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:117825395C>T	ENST00000350763.4	-	13	4245	c.3834G>A	c.(3832-3834)acG>acA	p.T1278T	TNC_ENST00000542877.1_Intron|TNC_ENST00000537320.1_Intron|TNC_ENST00000345230.3_Intron|TNC_ENST00000341037.4_Intron|TNC_ENST00000423613.2_Silent_p.T1278T|TNC_ENST00000340094.3_Intron|TNC_ENST00000346706.3_Intron|TNC_ENST00000535648.1_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1278	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TTCCATCTGGCGTGGTCCAGT	0.537													ENSG00000041982																																					0								C		0,4406		0,0,2203	123.0	91.0	102.0		3834	0.6	1.0	9	dbSNP_134	102	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous	TNC	NM_002160.3		0,7,6496	TT,TC,CC		0.0814,0.0,0.0538		1278/2202	117825395	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.3834G>A	9.37:g.117825395C>T			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.T1278	ENST00000350763.4	37	c.3834	CCDS6811.1	9																																																																																			rs150370072	TNC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.537	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	0	0	1	33	33	169	0.00	0.59	C	NM_002160		117825395	-1	11	42	30	126	tier1	no_errors	ENST00000350763	ensembl	human	known	74_37	silent	26.83	24.85	SNP	0.520	T	11	30
SYNE2	23224	genome.wustl.edu	37	14	64430701	64430701	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr14:64430701T>C	ENST00000344113.4	+	10	1185	c.973T>C	c.(973-975)Tac>Cac	p.Y325H	SYNE2_ENST00000554584.1_Missense_Mutation_p.Y325H|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Missense_Mutation_p.Y325H	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	325					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GAATGATACCTACTTTAAAAA	0.328													ENSG00000054654																																					0													69.0	66.0	67.0					14																	64430701		1805	4064	5869	SO:0001583	missense	0			-	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.973T>C	14.37:g.64430701T>C	ENSP00000341781:p.Tyr325His		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Y325H	ENST00000344113.4	37	c.973	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	T	7.065	0.567190	0.13560	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.59772	0.59;0.59;0.24	5.04	3.87	0.44632	.	0.140063	0.32473	N	0.006055	T	0.65893	0.2735	L	0.59436	1.845	0.80722	D	1	D;D	0.58268	0.97;0.982	P;P	0.58454	0.694;0.839	T	0.66956	-0.5792	10	0.87932	D	0	.	10.0364	0.42131	0.0:0.0:0.1696:0.8304	.	325;325	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	H	325	ENSP00000350719:Y325H;ENSP00000341781:Y325H;ENSP00000452570:Y325H	ENSP00000261678:Y325H	Y	+	1	0	SYNE2	63500454	0.022000	0.18835	0.825000	0.32803	0.012000	0.07955	0.828000	0.27435	0.755000	0.32990	-0.477000	0.04895	TAC	-	SYNE2	-	NULL		0.328	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	0	0	0	134	134	111	0.00	0.00	T	NM_182914		64430701	+1	32	37	80	50	tier1	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	28.57	42.53	SNP	0.992	C	32	80
ARID3B	10620	genome.wustl.edu	37	15	74883953	74883953	+	Silent	SNP	C	C	A	rs569459248		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:74883953C>A	ENST00000346246.5	+	7	1449	c.1218C>A	c.(1216-1218)ccC>ccA	p.P406P		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	406						nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						TGGCTGTGCCCGTGACCTTGG	0.617													ENSG00000179361																																					0													22.0	25.0	24.0					15																	74883953		2197	4294	6491	SO:0001819	synonymous_variant	0			-		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.1218C>A	15.37:g.74883953C>A			O95443|Q59HC9|Q6P9C9	Silent	SNP	pfam_ARID/BRIGHT_D-bd,superfamily_ARID/BRIGHT_D-bd,smart_ARID/BRIGHT_D-bd,pfscan_ARID/BRIGHT_D-bd	p.P406	ENST00000346246.5	37	c.1218	CCDS10264.1	15																																																																																			-	ARID3B	-	NULL		0.617	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3B	HGNC	protein_coding	OTTHUMT00000280688.2	0	0	0	35	35	51	0.00	0.00	C	NM_006465		74883953	+1	6	8	24	31	tier1	no_errors	ENST00000346246	ensembl	human	known	74_37	silent	20.00	20.51	SNP	0.002	A	6	24
CDIPT	10423	genome.wustl.edu	37	16	29872575	29872575	+	Missense_Mutation	SNP	G	G	A	rs150782987		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:29872575G>A	ENST00000219789.6	-	3	1062	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	CDIPT_ENST00000569956.1_Missense_Mutation_p.R62W|CDIPT_ENST00000567459.1_5'Flank|CDIPT-AS1_ENST00000398859.3_RNA|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT_ENST00000563415.1_Missense_Mutation_p.R62W|CDIPT_ENST00000566113.1_Missense_Mutation_p.R17W|CDIPT_ENST00000561555.1_Missense_Mutation_p.R86W|CDIPT_ENST00000570016.1_Missense_Mutation_p.R62W	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	62					CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						GCCCCAAACCGGGTTCCTGGA	0.567													ENSG00000103502																																					0								G	TRP/ARG	0,4394		0,0,2197	67.0	58.0	61.0		184	4.8	1.0	16	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDIPT	NM_006319.3	101	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	62/214	29872575	1,12993	2197	4300	6497	SO:0001583	missense	0			-	AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144	ENST00000219789.6:c.184C>T	16.37:g.29872575G>A	ENSP00000219789:p.Arg62Trp		B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	Missense_Mutation	SNP	pfam_CDP-OH_P_trans,pirsf_CDP_diag_ino_3_P_euk	p.R62W	ENST00000219789.6	37	c.184	CCDS10657.1	16	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256954	0.80246	0.0	1.16E-4	ENSG00000103502	ENST00000219789;ENST00000403894	T	0.45276	0.9	5.78	4.79	0.61399	.	0.115651	0.64402	D	0.000017	T	0.67411	0.2890	M	0.88512	2.96	0.48571	D	0.999673	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.75020	0.975;0.985;0.967	T	0.72839	-0.4171	10	0.87932	D	0	-3.6843	12.0649	0.53581	0.0:0.0:0.705:0.295	.	17;62;86	B4DUV0;O14735;B3KY94	.;CDIPT_HUMAN;.	W	62;115	ENSP00000219789:R62W	ENSP00000219789:R62W	R	-	1	2	CDIPT	29780076	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.615000	0.61190	2.749000	0.94314	0.655000	0.94253	CGG	rs150782987	CDIPT	-	pfam_CDP-OH_P_trans,pirsf_CDP_diag_ino_3_P_euk		0.567	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDIPT	HGNC	protein_coding	OTTHUMT00000255147.3	0	0	0	79	79	101	0.00	0.00	G	NM_006319		29872575	-1	11	19	41	109	tier1	no_errors	ENST00000219789	ensembl	human	known	74_37	missense	21.15	14.84	SNP	1.000	A	11	41
OBSCN	84033	genome.wustl.edu	37	1	228506748	228506748	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:228506748C>T	ENST00000422127.1	+	54	14339	c.14295C>T	c.(14293-14295)gaC>gaT	p.D4765D	OBSCN_ENST00000366707.4_Silent_p.D2399D|OBSCN_ENST00000570156.2_Silent_p.D5722D|OBSCN_ENST00000284548.11_Silent_p.D4765D|OBSCN_ENST00000366709.4_Silent_p.D1884D	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4765					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGAGGAGGACGGCCGCTCGC	0.657													ENSG00000154358																																					0													18.0	23.0	21.0					1																	228506748		2197	4290	6487	SO:0001819	synonymous_variant	0			-	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14295C>T	1.37:g.228506748C>T			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.D4765	ENST00000422127.1	37	c.14295	CCDS58065.1	1																																																																																			-	OBSCN	-	NULL		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		0	0	0	37	37	10	0.00	0.00	C	NM_052843		228506748	+1	8	7	22	14	tier1	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	26.67	33.33	SNP	0.002	T	8	22
AGAP11	119385	genome.wustl.edu	37	10	88759697	88759697	+	RNA	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:88759697C>T	ENST00000444431.1	+	0	827				RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.5_ENST00000433214.2_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										cttctttgtgctgtggttttc	0.498													ENSG00000151303																																					0																																												0			-			10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88759697C>T			B9EIP7|D3DWE4	R	SNP	-	NULL	ENST00000444431.1	37	NULL		10																																																																																			-	AGAP11	-	-		0.498	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	AGAP11	HGNC	processed_transcript	OTTHUMT00000049193.1	0	0	0	23	23	37	0.00	0.00	C	NM_133447		88759697	+1	6	8	10	22	tier1	no_errors	ENST00000444431	ensembl	human	known	74_37	rna	37.50	26.67	SNP	0.475	T	6	10
MAN2B2	23324	genome.wustl.edu	37	4	6602448	6602448	+	Missense_Mutation	SNP	G	G	A	rs186250763		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:6602448G>A	ENST00000285599.3	+	10	1540	c.1504G>A	c.(1504-1506)Gtc>Atc	p.V502I	MAN2B2_ENST00000504248.1_Missense_Mutation_p.V451I	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	502					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						TGGAGTCCGCGTCACAGATGA	0.617													ENSG00000013288																																					0													88.0	74.0	79.0					4																	6602448		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1504G>A	4.37:g.6602448G>A	ENSP00000285599:p.Val502Ile		Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.V502I	ENST00000285599.3	37	c.1504	CCDS33951.1	4	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	9.246	1.039524	0.19669	.	.	ENSG00000013288	ENST00000285599;ENST00000504248	D;D	0.89617	-2.54;-2.54	4.67	1.81	0.25067	Glycosyl hydrolases 38, C-terminal (1);Glycosyl hydrolase, family 13, all-beta (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.392363	0.25720	N	0.028744	D	0.83562	0.5281	L	0.50333	1.59	0.41438	D	0.987904	P;P;B	0.39480	0.539;0.675;0.174	B;B;B	0.38056	0.264;0.135;0.03	T	0.77887	-0.2420	10	0.52906	T	0.07	-21.7388	8.408	0.32627	0.0843:0.2936:0.6221:0.0	.	451;502;502	E9PCD7;Q9Y2E5;Q9Y2E5-2	.;MA2B2_HUMAN;.	I	502;451	ENSP00000285599:V502I;ENSP00000423129:V451I	ENSP00000285599:V502I	V	+	1	0	MAN2B2	6653349	0.985000	0.35326	0.033000	0.17914	0.027000	0.11550	1.844000	0.39269	0.023000	0.15187	0.555000	0.69702	GTC	rs186250763	MAN2B2	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom		0.617	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	0	0	0	40	40	48	0.00	0.00	G	NM_015274		6602448	+1	13	18	18	46	tier1	no_errors	ENST00000285599	ensembl	human	known	74_37	missense	41.94	28.12	SNP	0.891	A	13	18
KNG1	3827	genome.wustl.edu	37	3	186450325	186450325	+	Silent	SNP	C	C	T	rs201943382		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:186450325C>T	ENST00000265023.4	+	7	1004	c.792C>T	c.(790-792)tgC>tgT	p.C264C	KNG1_ENST00000447445.1_Silent_p.C228C|KNG1_ENST00000287611.2_Silent_p.C264C|RP11-573D15.8_ENST00000599314.1_RNA|RP11-573D15.8_ENST00000354642.2_RNA	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	264					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		CCAAGATTTGCGTGGGCTGCC	0.488													ENSG00000113889	C|||	1	0.000199681	0.0	0.0	5008	,	,		21829	0.0		0.001	False		,,,				2504	0.0																0													100.0	99.0	99.0					3																	186450325		2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.792C>T	3.37:g.186450325C>T			A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Silent	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat,prints_Kininogen	p.C264	ENST00000265023.4	37	c.792	CCDS43183.1	3																																																																																			rs201943382	KNG1	-	smart_Prot_inh_cystat		0.488	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KNG1	HGNC	protein_coding	OTTHUMT00000317738.1	0	0	0	61	61	161	0.00	0.00	C	NM_001102416		186450325	+1	14	41	54	134	tier1	no_errors	ENST00000265023	ensembl	human	known	74_37	silent	20.59	23.30	SNP	0.018	T	14	54
CRHR2	1395	genome.wustl.edu	37	7	30728894	30728894	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:30728894C>T	ENST00000348438.4	-	2	166	c.97G>A	c.(97-99)Ggg>Agg	p.G33R	CRHR2_ENST00000341843.4_5'Flank|CRHR2_ENST00000462882.1_5'UTR	NM_001202475.1|NM_001202481.1	NP_001189404.1|NP_001189410.1	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	0					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TGGCTCTGCCCGGCTGCCTAG	0.582													ENSG00000106113																																					0																																										SO:0001583	missense	0			-		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000348438.4:c.97G>A	7.37:g.30728894C>T	ENSP00000340943:p.Gly33Arg		B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.G33R	ENST00000348438.4	37	c.97	CCDS56478.1	7	.	.	.	.	.	.	.	.	.	.	C	5.107	0.205358	0.09704	.	.	ENSG00000106113	ENST00000348438;ENST00000445981	T	0.53640	0.61	4.1	-2.52	0.06346	.	1.265650	0.05704	N	0.594609	T	0.29458	0.0734	.	.	.	0.09310	N	1	P;B;B	0.49961	0.93;0.194;0.001	B;B;B	0.38327	0.271;0.03;0.003	T	0.27905	-1.0060	9	0.33141	T	0.24	.	5.6559	0.17642	0.0:0.2575:0.4937:0.2488	.	33;33;33	F2Z2M6;C9JZM9;Q13324-2	.;.;.	R	33	ENSP00000340943:G33R	ENSP00000340943:G33R	G	-	1	0	CRHR2	30695419	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-0.788000	0.04614	-0.435000	0.07264	0.455000	0.32223	GGG	-	CRHR2	-	NULL		0.582	CRHR2-001	KNOWN	basic|CCDS	protein_coding	CRHR2	HGNC	protein_coding	OTTHUMT00000327785.1	0	0	0	23	23	54	0.00	0.00	C			30728894	-1	4	10	10	55	tier1	no_errors	ENST00000348438	ensembl	human	known	74_37	missense	28.57	15.38	SNP	0.001	T	4	10
ABCA1	19	genome.wustl.edu	37	9	107581064	107581064	+	Silent	SNP	G	G	T	rs547738950		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:107581064G>T	ENST00000374736.3	-	23	3736	c.3342C>A	c.(3340-3342)tcC>tcA	p.S1114S		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1114	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GAAACAGGGAGGAGCCCACAC	0.532													ENSG00000165029																																					0													103.0	91.0	95.0					9																	107581064		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.3342C>A	9.37:g.107581064G>T			Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S1114	ENST00000374736.3	37	c.3342	CCDS6762.1	9																																																																																			-	ABCA1	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.532	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1	0	0	0	47	47	141	0.00	0.00	G	NM_005502		107581064	-1	12	51	41	107	tier1	no_errors	ENST00000374736	ensembl	human	known	74_37	silent	22.64	32.28	SNP	1.000	T	12	41
LRP1B	53353	genome.wustl.edu	37	2	141201965	141201965	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:141201965T>C	ENST00000389484.3	-	65	11199	c.10228A>G	c.(10228-10230)Atc>Gtc	p.I3410V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3410	LDL-receptor class A 23. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTACTGGGATACATTTCTGG	0.388										TSP Lung(27;0.18)			ENSG00000168702																									Colon(99;50 2074 2507 20106)												0													208.0	193.0	198.0					2																	141201965		2203	4300	6503	SO:0001583	missense	0			-	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10228A>G	2.37:g.141201965T>C	ENSP00000374135:p.Ile3410Val		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.I3410V	ENST00000389484.3	37	c.10228	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	17.86	3.491456	0.64074	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.98012	-4.66	5.22	5.22	0.72569	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	U	0.000000	D	0.97848	0.9293	L	0.46819	1.47	0.51012	D	0.999909	D	0.63880	0.993	D	0.76071	0.987	D	0.97712	1.0191	10	0.35671	T	0.21	.	15.2632	0.73640	0.0:0.0:0.0:1.0	.	3410	Q9NZR2	LRP1B_HUMAN	V	3410;3348	ENSP00000374135:I3410V	ENSP00000374135:I3410V	I	-	1	0	LRP1B	140918435	1.000000	0.71417	0.978000	0.43139	0.901000	0.52897	7.825000	0.86693	2.189000	0.69895	0.460000	0.39030	ATC	-	LRP1B	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	0	0	0	79	79	171	0.00	0.00	T	NM_018557		141201965	-1	20	35	57	97	tier1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	25.97	26.52	SNP	1.000	C	20	57
MCM4	4173	genome.wustl.edu	37	8	48878876	48878876	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:48878876G>A	ENST00000262105.2	+	8	1171	c.962G>A	c.(961-963)cGc>cAc	p.R321H	MCM4_ENST00000523944.1_Missense_Mutation_p.R321H	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	321					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				GACCGCGGCCGCATTGCAGAG	0.622													ENSG00000104738																																					0													61.0	54.0	56.0					8																	48878876		2203	4300	6503	SO:0001583	missense	0			-		CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.962G>A	8.37:g.48878876G>A	ENSP00000262105:p.Arg321His		Q8NEH1|Q99658	Missense_Mutation	SNP	pfam_MCM_D-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_D-dep_ATPase,pfscan_MCM_D-dep_ATPase,prints_MCM_4,prints_MCM_D-dep_ATPase	p.R321H	ENST00000262105.2	37	c.962	CCDS6143.1	8	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257484	0.59321	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229	T;T	0.04502	3.61;3.61	5.5	4.63	0.57726	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.09335	0.0230	M	0.77103	2.36	0.80722	D	1	P;P	0.42993	0.797;0.688	B;B	0.37943	0.261;0.134	T	0.05699	-1.0869	10	0.54805	T	0.06	-18.7768	14.678	0.68996	0.0701:0.0:0.9299:0.0	.	321;321	B3KMX0;P33991	.;MCM4_HUMAN	H	321;321;308;281	ENSP00000430194:R321H;ENSP00000262105:R321H	ENSP00000262105:R321H	R	+	2	0	MCM4	49041429	1.000000	0.71417	0.986000	0.45419	0.483000	0.33249	9.237000	0.95368	1.458000	0.47871	0.462000	0.41574	CGC	-	MCM4	-	superfamily_-bd_OB-fold,smart_MCM_D-dep_ATPase		0.622	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM4	HGNC	protein_coding	OTTHUMT00000377791.1	0	0	0	13	13	25	0.00	0.00	G	NM_005914		48878876	+1	12	10	13	11	tier1	no_errors	ENST00000262105	ensembl	human	known	74_37	missense	48.00	47.62	SNP	1.000	A	12	13
TLE1	7088	genome.wustl.edu	37	9	84228347	84228347	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:84228347G>A	ENST00000376499.3	-	12	2072	c.1008C>T	c.(1006-1008)ggC>ggT	p.G336G	TLE1_ENST00000464999.1_5'UTR|TLE1_ENST00000376472.1_Silent_p.G11G|TLE1_ENST00000376484.1_Silent_p.G11G	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	336	Pro/Ser-rich.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						CTGGACGGAGGCCTGGAGTGG	0.582													ENSG00000196781																									NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)												0													99.0	98.0	98.0					9																	84228347		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1008C>T	9.37:g.84228347G>A			A8K495|Q5T3G4|Q969V9	Silent	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.G336	ENST00000376499.3	37	c.1008	CCDS6661.1	9																																																																																			-	TLE1	-	NULL		0.582	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE1	HGNC	protein_coding	OTTHUMT00000055407.1	0	0	0	62	62	70	0.00	0.00	G	NM_005077		84228347	-1	21	27	45	44	tier1	no_errors	ENST00000376499	ensembl	human	known	74_37	silent	31.82	38.03	SNP	0.927	A	21	45
KANK2	25959	genome.wustl.edu	37	19	11280774	11280774	+	Missense_Mutation	SNP	C	C	T	rs368328659		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:11280774C>T	ENST00000586659.1	-	11	2676	c.2362G>A	c.(2362-2364)Gcg>Acg	p.A788T	KANK2_ENST00000355150.5_Missense_Mutation_p.A788T|KANK2_ENST00000587317.1_5'UTR|KANK2_ENST00000432929.2_Missense_Mutation_p.A796T|KANK2_ENST00000589894.1_Missense_Mutation_p.A788T|KANK2_ENST00000589359.1_Missense_Mutation_p.A796T			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	788	Interaction with NCOA1.				apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AGCAGCCCCGCGATCTCCTTG	0.642													ENSG00000197256																																					0								C	THR/ALA,THR/ALA	0,4406		0,0,2203	75.0	73.0	74.0		2362,2386	-2.7	0.0	19		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KANK2	NM_001136191.2,NM_015493.6	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	788/852,796/860	11280774	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.2362G>A	19.37:g.11280774C>T	ENSP00000465650:p.Ala788Thr		B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A796T	ENST00000586659.1	37	c.2386	CCDS12255.1	19	.	.	.	.	.	.	.	.	.	.	C	9.871	1.198940	0.22121	0.0	1.16E-4	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.67523	-0.27;-0.27	5.29	-2.73	0.05950	Ankyrin repeat-containing domain (4);	0.510398	0.19638	N	0.109508	T	0.49898	0.1584	L	0.36672	1.1	0.21950	N	0.999451	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.0	T	0.37798	-0.9690	10	0.36615	T	0.2	-4.4205	10.6463	0.45621	0.0:0.5499:0.0:0.4501	.	788;796	Q63ZY3;Q63ZY3-2	KANK2_HUMAN;.	T	796;788	ENSP00000395650:A796T;ENSP00000347276:A788T	ENSP00000347276:A788T	A	-	1	0	KANK2	11141774	0.927000	0.31430	0.021000	0.16686	0.101000	0.19017	1.685000	0.37659	-0.382000	0.07870	-0.263000	0.10527	GCG	-	KANK2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.642	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	0	0	0	32	32	21	0.00	0.00	C	NM_015493		11280774	-1	5	6	26	10	tier1	no_errors	ENST00000432929	ensembl	human	known	74_37	missense	16.13	37.50	SNP	0.713	T	5	26
POLR3E	55718	genome.wustl.edu	37	16	22337274	22337274	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:22337274C>T	ENST00000299853.5	+	18	1708	c.1541C>T	c.(1540-1542)gCg>gTg	p.A514V	POLR3E_ENST00000418581.2_Missense_Mutation_p.A478V|POLR3E_ENST00000359210.4_Missense_Mutation_p.A514V|POLR3E_ENST00000564209.1_Missense_Mutation_p.A514V	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	514					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		gagcaggaggcggaggaggag	0.716													ENSG00000058600																																					0													34.0	28.0	30.0					16																	22337274		2182	4277	6459	SO:0001583	missense	0			-	AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.1541C>T	16.37:g.22337274C>T	ENSP00000299853:p.Ala514Val		B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Missense_Mutation	SNP	pfam_R_pol_III_Rpc5	p.A514V	ENST00000299853.5	37	c.1541	CCDS10605.1	16	.	.	.	.	.	.	.	.	.	.	c	3.050	-0.195562	0.06259	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	T;T;T	0.43294	0.95;0.96;0.95	4.07	-6.86	0.01676	.	0.586078	0.14238	N	0.332280	T	0.14787	0.0357	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.13145	0.002;0.0;0.0;0.002;0.0;0.007	B;B;B;B;B;B	0.08055	0.001;0.001;0.0;0.003;0.001;0.003	T	0.06215	-1.0839	10	0.49607	T	0.09	-1.5505	2.9338	0.05808	0.1307:0.2013:0.1289:0.539	.	458;478;514;514;514;514	B4DDR0;B4DL24;B4DUP6;Q9NVU0-2;Q9NVU0;Q9NVU0-3	.;.;.;.;RPC5_HUMAN;.	V	514;514;478	ENSP00000299853:A514V;ENSP00000352140:A514V;ENSP00000399254:A478V	ENSP00000299853:A514V	A	+	2	0	POLR3E	22244775	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.256000	0.02869	-1.127000	0.02925	-1.438000	0.01074	GCG	-	POLR3E	-	NULL		0.716	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3E	HGNC	protein_coding	OTTHUMT00000211590.1	0	0	0	147	147	34	0.00	0.00	C	NM_018119		22337274	+1	41	10	99	33	tier1	no_errors	ENST00000299853	ensembl	human	known	74_37	missense	28.67	23.26	SNP	0.000	T	41	99
PDCD11	22984	genome.wustl.edu	37	10	105172954	105172954	+	Missense_Mutation	SNP	C	C	T	rs566526072		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:105172954C>T	ENST00000369797.3	+	9	1154	c.1060C>T	c.(1060-1062)Cgc>Tgc	p.R354C		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	354					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ACAGCCTGGACGCCCACTCAC	0.562													ENSG00000148843	C|||	1	0.000199681	0.0	0.0	5008	,	,		18082	0.0		0.0	False		,,,				2504	0.001																0													109.0	95.0	100.0					10																	105172954		2203	4300	6503	SO:0001583	missense	0			-	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1060C>T	10.37:g.105172954C>T	ENSP00000358812:p.Arg354Cys		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_R-bd_dom,pfam_Suf,superfamily_-bd_OB-fold,smart_R-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_R-bd_dom,prints_Ribosomal_S1	p.R354C	ENST00000369797.3	37	c.1060	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	C	13.27	2.186146	0.38609	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.10860	2.83	5.36	5.36	0.76844	Nucleic acid-binding, OB-fold-like (1);	0.446559	0.26927	N	0.021792	T	0.16599	0.0399	L	0.50333	1.59	0.09310	N	0.999998	D	0.67145	0.996	P	0.51550	0.673	T	0.11470	-1.0586	10	0.54805	T	0.06	-12.0926	9.4671	0.38820	0.1494:0.6858:0.1648:0.0	.	354	Q14690	RRP5_HUMAN	C	354	ENSP00000358812:R354C	ENSP00000358812:R354C	R	+	1	0	PDCD11	105162944	0.258000	0.24033	0.985000	0.45067	0.142000	0.21351	1.135000	0.31454	2.522000	0.85027	0.467000	0.42956	CGC	-	PDCD11	-	superfamily_-bd_OB-fold		0.562	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	0	0	0	72	72	68	0.00	0.00	C			105172954	+1	11	21	27	49	tier1	no_errors	ENST00000369797	ensembl	human	known	74_37	missense	28.95	29.17	SNP	0.005	T	11	27
PDIA4	9601	genome.wustl.edu	37	7	148701072	148701072	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:148701072G>A	ENST00000286091.4	-	10	1984	c.1752C>T	c.(1750-1752)gaC>gaT	p.D584D		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	584	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			TGGCAGTGGCGTCCATCTTGG	0.587													ENSG00000155660																																					0													110.0	108.0	109.0					7																	148701072		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1752C>T	7.37:g.148701072G>A			A8K4K6|Q549T6	Silent	SNP	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,prints_Calsequestrin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.D584	ENST00000286091.4	37	c.1752	CCDS5893.1	7																																																																																			-	PDIA4	-	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase		0.587	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	HGNC	protein_coding	OTTHUMT00000317077.1	0	0	0	73	73	75	0.00	0.00	G	NM_004911		148701072	-1	17	13	52	62	tier1	no_errors	ENST00000286091	ensembl	human	known	74_37	silent	24.64	17.33	SNP	0.934	A	17	52
ITGA7	3679	genome.wustl.edu	37	12	56091249	56091249	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:56091249G>A	ENST00000555728.1	-	11	1651	c.1623C>T	c.(1621-1623)ggC>ggT	p.G541G	ITGA7_ENST00000257880.7_Silent_p.G541G|ITGA7_ENST00000394229.2_Silent_p.G497G|ITGA7_ENST00000257879.6_Silent_p.G497G|ITGA7_ENST00000452168.2_Silent_p.G404G|ITGA7_ENST00000553804.1_Silent_p.G501G|ITGA7_ENST00000394230.2_Silent_p.G501G|ITGA7_ENST00000347027.6_Silent_p.G497G			Q13683	ITA7_HUMAN	integrin, alpha 7	541					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCGAGTGGCCGCCAGCACAGT	0.622													ENSG00000135424																																					0													52.0	49.0	50.0					12																	56091249		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.1623C>T	12.37:g.56091249G>A			B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G541	ENST00000555728.1	37	c.1623		12																																																																																			-	ITGA7	-	pfam_Integrin_alpha-2		0.622	ITGA7-014	KNOWN	basic	protein_coding	ITGA7	HGNC	protein_coding	OTTHUMT00000410138.1	0	0	0	45	45	48	0.00	0.00	G	NM_002206		56091249	-1	8	13	34	41	tier1	no_errors	ENST00000555728	ensembl	human	known	74_37	silent	18.60	23.64	SNP	0.001	A	8	34
SAMHD1	25939	genome.wustl.edu	37	20	35555586	35555586	+	Splice_Site	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:35555586G>A	ENST00000262878.4	-	6	894	c.695C>T	c.(694-696)aCg>aTg	p.T232M	SAMHD1_ENST00000373694.5_Splice_Site_p.T17M	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	232	HD.				dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				AATACATACCGTCCATTTCAC	0.353													ENSG00000101347																																					0													105.0	102.0	103.0					20																	35555586		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.696+1C>T	20.37:g.35555586G>A			B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	pfam_HD_domain,pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,smart_HD/PDEase_dom,pfscan_SAM	p.T232M	ENST00000262878.4	37	c.695	CCDS13288.1	20	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345827	0.82022	.	.	ENSG00000101347	ENST00000262878;ENST00000373694	D;D	0.95171	-3.63;-3.63	5.76	-3.85	0.04243	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.484683	0.24776	N	0.035683	D	0.93943	0.8061	L	0.59912	1.85	0.27804	N	0.942376	D	0.65815	0.995	P	0.56788	0.806	D	0.90165	0.4231	10	0.59425	D	0.04	-3.1125	12.1145	0.53858	0.0:0.1608:0.1534:0.6859	.	232	Q9Y3Z3	SAMH1_HUMAN	M	232;17	ENSP00000262878:T232M;ENSP00000362798:T17M	ENSP00000262878:T232M	T	-	2	0	SAMHD1	34989000	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	0.659000	0.24994	-0.169000	0.10834	0.655000	0.94253	ACG	-	SAMHD1	-	pfam_HD_domain,smart_HD/PDEase_dom		0.353	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMHD1	HGNC	protein_coding	OTTHUMT00000079062.2	0	0	0	74	74	81	0.00	0.00	G	NM_015474	Missense_Mutation	35555586	-1	17	32	59	66	tier1	no_errors	ENST00000262878	ensembl	human	known	74_37	missense	22.37	32.65	SNP	0.999	A	17	59
GLRA1	2741	genome.wustl.edu	37	5	151202325	151202325	+	Missense_Mutation	SNP	C	C	T	rs281864919		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:151202325C>T	ENST00000455880.2	-	9	1569	c.1283G>A	c.(1282-1284)cGc>cAc	p.R428H	GLRA1_ENST00000545569.1_Missense_Mutation_p.R337H|GLRA1_ENST00000274576.4_Missense_Mutation_p.R420H			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	428			R -> H (in HKPX1). {ECO:0000269|PubMed:10514101}.		acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GAAGCCAATGCGGGATATTTT	0.498													ENSG00000145888																																					0			GRCh37	CM992338	GLRA1	M							144.0	152.0	149.0					5																	151202325		2203	4300	6503	SO:0001583	missense	0			-		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.1283G>A	5.37:g.151202325C>T	ENSP00000411593:p.Arg428His		B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A1,prints_Neur_channel,tigrfam_Neur_channel	p.R428H	ENST00000455880.2	37	c.1283	CCDS54942.1	5	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783859	0.90282	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	D;D;D	0.88277	-2.36;-2.36;-2.36	5.03	5.03	0.67393	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95617	0.8575	M	0.89968	3.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.96533	0.9394	10	0.87932	D	0	.	18.3582	0.90365	0.0:1.0:0.0:0.0	.	428;337;420	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	H	420;428;337	ENSP00000274576:R420H;ENSP00000411593:R428H;ENSP00000445913:R337H	ENSP00000274576:R420H	R	-	2	0	GLRA1	151182518	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.841000	0.69409	2.308000	0.77769	0.563000	0.77884	CGC	-	GLRA1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel		0.498	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA1	HGNC	protein_coding	OTTHUMT00000373959.1	0	0	0	102	102	92	0.00	0.00	C			151202325	-1	33	27	86	89	tier1	no_errors	ENST00000455880	ensembl	human	known	74_37	missense	27.73	23.28	SNP	1.000	T	33	86
E4F1	1877	genome.wustl.edu	37	16	2284933	2284933	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:2284933G>A	ENST00000301727.4	+	12	1914	c.1866G>A	c.(1864-1866)acG>acA	p.T622T	DNASE1L2_ENST00000382437.4_5'Flank|DNASE1L2_ENST00000320700.5_5'Flank|E4F1_ENST00000564139.1_Silent_p.T622T|E4F1_ENST00000565090.1_Silent_p.T445T|DNASE1L2_ENST00000567494.1_5'Flank|RP11-304L19.12_ENST00000564055.1_lincRNA|DNASE1L2_ENST00000564065.1_5'Flank	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	622					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						CCGTCCTCACGGAAGACCCGC	0.657													ENSG00000167967																																					0													13.0	13.0	13.0					16																	2284933		2154	4275	6429	SO:0001819	synonymous_variant	0			-	U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.1866G>A	16.37:g.2284933G>A			A8K2R4|O00146	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T622	ENST00000301727.4	37	c.1866	CCDS32370.1	16																																																																																			-	E4F1	-	NULL		0.657	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E4F1	HGNC	protein_coding	OTTHUMT00000435225.1	0	0	0	25	25	30	0.00	0.00	G	NM_004424		2284933	+1	8	9	14	34	tier1	no_errors	ENST00000301727	ensembl	human	known	74_37	silent	34.78	20.93	SNP	0.002	A	8	14
HYKK	123688	genome.wustl.edu	37	15	78805653	78805653	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:78805653C>T	ENST00000569878.1	+	1	223	c.223C>T	c.(223-225)Cca>Tca	p.P75S	HYKK_ENST00000563233.1_Missense_Mutation_p.P75S|HYKK_ENST00000388988.4_Missense_Mutation_p.P75S|HYKK_ENST00000360519.3_Missense_Mutation_p.P75S|HYKK_ENST00000566332.1_Missense_Mutation_p.P75S|HYKK_ENST00000408962.2_Missense_Mutation_p.P75S			A2RU49	HYKK_HUMAN	hydroxylysine kinase	75						cytoplasm (GO:0005737)	hydroxylysine kinase activity (GO:0047992)										TAGCAAAAATCCAGACCTGAT	0.418													ENSG00000188266																																					0													120.0	115.0	117.0					15																	78805653		1891	4122	6013	SO:0001583	missense	0			-	BC132753, BC144383, BM045979	CCDS42063.1, CCDS45318.1	15q25.1	2013-06-11	2013-06-11	2013-06-11	ENSG00000188266	ENSG00000188266	2.7.1.81		34403	protein-coding gene	gene with protein product	"""5-hydroxylysine kinase"""	614681	"""aminoglycoside phosphotransferase domain containing 1"""	AGPHD1		18780872, 22241472	Standard	NM_001013619		Approved	LOC123688	uc010unc.2	A2RU49		ENST00000569878.1:c.223C>T	15.37:g.78805653C>T	ENSP00000455459:p.Pro75Ser		B7ZMA5|F8W6X5|Q6ZTN0	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.P75S	ENST00000569878.1	37	c.223	CCDS42063.1	15	.	.	.	.	.	.	.	.	.	.	C	3.504	-0.101310	0.06967	.	.	ENSG00000188266	ENST00000408962;ENST00000388988;ENST00000360519	T;T;T	0.29917	1.55;1.55;1.55	5.83	2.25	0.28309	Aminoglycoside phosphotransferase (1);Protein kinase-like domain (1);	0.532223	0.19961	N	0.102201	T	0.23492	0.0568	L	0.47016	1.485	0.09310	N	1	B;B	0.25719	0.005;0.132	B;B	0.27170	0.038;0.077	T	0.12656	-1.0539	10	0.22706	T	0.39	-11.0976	7.8779	0.29605	0.0:0.4596:0.417:0.1233	.	75;75	A2RU49;A2RU49-3	AGPD1_HUMAN;.	S	75	ENSP00000386197:P75S;ENSP00000373640:P75S;ENSP00000353710:P75S	ENSP00000353710:P75S	P	+	1	0	AGPHD1	76592708	0.002000	0.14202	0.848000	0.33437	0.680000	0.39746	0.564000	0.23563	1.428000	0.47296	0.655000	0.94253	CCA	-	HYKK	-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom		0.418	HYKK-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HYKK	HGNC	protein_coding	OTTHUMT00000435834.1	0	0	0	96	96	128	0.00	0.00	C	NM_001013619		78805653	+1	20	31	63	98	tier1	no_errors	ENST00000388988	ensembl	human	known	74_37	missense	24.10	24.03	SNP	0.001	T	20	63
FABP4	2167	genome.wustl.edu	37	8	82395393	82395393	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:82395393C>T	ENST00000256104.4	-	1	105	c.10G>A	c.(10-12)Gct>Act	p.A4T	RP11-157I4.4_ENST00000524085.2_RNA|FABP4_ENST00000518669.1_5'UTR	NM_001442.2	NP_001433.1	P15090	FABP4_HUMAN	fatty acid binding protein 4, adipocyte	4					brown fat cell differentiation (GO:0050873)|cellular response to lithium ion (GO:0071285)|cholesterol homeostasis (GO:0042632)|cytokine production (GO:0001816)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of inflammatory response (GO:0050729)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|nucleus (GO:0005634)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|large_intestine(1)|ovary(1)|skin(1)	6			Epithelial(68;0.213)			CCTACAAAAGCATCACACATT	0.393													ENSG00000170323																									NSCLC(35;550 1252 19644 48360)												0													94.0	90.0	91.0					8																	82395393		2202	4300	6502	SO:0001583	missense	0			-	J02874	CCDS6230.1	8q21.13	2013-03-01			ENSG00000170323	ENSG00000170323		"""Fatty acid binding protein family"""	3559	protein-coding gene	gene with protein product		600434				2481498	Standard	NM_001442		Approved	A-FABP, aP2	uc003ycd.2	P15090	OTTHUMG00000164602	ENST00000256104.4:c.10G>A	8.37:g.82395393C>T	ENSP00000256104:p.Ala4Thr		Q6IBA1	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.A4T	ENST00000256104.4	37	c.10	CCDS6230.1	8	.	.	.	.	.	.	.	.	.	.	C	17.13	3.309687	0.60414	.	.	ENSG00000170323	ENST00000256104	T	0.12255	2.7	6.07	6.07	0.98685	Calycin-like (1);Calycin (1);	0.221019	0.47093	D	0.000257	T	0.19087	0.0458	M	0.73962	2.25	0.26376	N	0.976816	B	0.18863	0.031	B	0.13407	0.009	T	0.20773	-1.0265	10	0.15952	T	0.53	.	16.3461	0.83133	0.0:0.8332:0.1668:0.0	.	4	P15090	FABP4_HUMAN	T	4	ENSP00000256104:A4T	ENSP00000256104:A4T	A	-	1	0	FABP4	82557948	0.072000	0.21174	0.609000	0.28983	0.976000	0.68499	3.199000	0.51043	2.885000	0.99019	0.655000	0.94253	GCT	-	FABP4	-	superfamily_Calycin-like		0.393	FABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP4	HGNC	protein_coding	OTTHUMT00000379368.1	0	0	0	44	44	123	0.00	0.00	C	NM_001442		82395393	-1	9	21	40	73	tier1	no_errors	ENST00000256104	ensembl	human	known	74_37	missense	18.37	22.11	SNP	0.506	T	9	40
ATAD5	79915	genome.wustl.edu	37	17	29182214	29182214	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:29182214G>A	ENST00000321990.4	+	7	2882	c.2504G>A	c.(2503-2505)cGt>cAt	p.R835H	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	835					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAAGCAAAGCGTGACTTCCTA	0.368													ENSG00000176208																																					0													75.0	68.0	71.0					17																	29182214		2203	4300	6503	SO:0001583	missense	0			-		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.2504G>A	17.37:g.29182214G>A	ENSP00000313171:p.Arg835His		Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R835H	ENST00000321990.4	37	c.2504	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909070	0.33721	.	.	ENSG00000176208	ENST00000321990	D	0.89050	-2.46	5.6	4.64	0.57946	.	0.106821	0.64402	D	0.000009	D	0.93552	0.7942	M	0.72894	2.215	0.46725	D	0.999176	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.93911	0.7197	10	0.62326	D	0.03	.	14.4754	0.67541	0.0709:0.0:0.9291:0.0	.	835;835	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	H	835	ENSP00000313171:R835H	ENSP00000313171:R835H	R	+	2	0	ATAD5	26206340	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	7.076000	0.76806	1.367000	0.46095	-0.346000	0.07831	CGT	-	ATAD5	-	NULL		0.368	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	HGNC	protein_coding	OTTHUMT00000256206.2	0	0	0	48	48	112	0.00	0.00	G	NM_024857		29182214	+1	12	25	28	62	tier1	no_errors	ENST00000321990	ensembl	human	known	74_37	missense	30.00	28.74	SNP	1.000	A	12	28
HPS4	89781	genome.wustl.edu	37	22	26860178	26860178	+	Missense_Mutation	SNP	C	C	T	rs139039617		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr22:26860178C>T	ENST00000398145.2	-	11	2034	c.1418G>A	c.(1417-1419)cGc>cAc	p.R473H	HPS4_ENST00000398141.1_Missense_Mutation_p.R486H|HPS4_ENST00000493455.2_5'Flank|HPS4_ENST00000336873.5_Missense_Mutation_p.R473H|HPS4_ENST00000402105.3_Missense_Mutation_p.R468H	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	473					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						TGGATCTAAGCGAGGCAATAA	0.592									Hermansky-Pudlak syndrome				ENSG00000100099																																					0								C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	133.0	130.0	131.0		1418,1403	-1.5	0.0	22	dbSNP_134	131	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	HPS4	NM_022081.4,NM_152841.1	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	473/709,468/704	26860178	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	-		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1418G>A	22.37:g.26860178C>T	ENSP00000381213:p.Arg473His		B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Missense_Mutation	SNP	NULL	p.R486H	ENST00000398145.2	37	c.1457	CCDS13835.1	22	.	.	.	.	.	.	.	.	.	.	C	9.764	1.170889	0.21621	0.0	1.16E-4	ENSG00000100099	ENST00000398145;ENST00000398141;ENST00000402105;ENST00000336873	T;T;T;T	0.32515	1.46;1.45;1.46;1.46	4.23	-1.51	0.08664	.	1.692980	0.02694	N	0.110997	T	0.18215	0.0437	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B;B	0.10296	0.002;0.003;0.003;0.002;0.003;0.001	B;B;B;B;B;B	0.06405	0.001;0.002;0.002;0.001;0.002;0.002	T	0.11494	-1.0585	9	.	.	.	0.4393	2.5995	0.04863	0.4054:0.283:0.0:0.3116	.	473;473;473;473;486;468	Q6ICH6;Q6P1K3;Q9NQG7;A8K2E6;Q9NQG7-4;Q9NQG7-3	.;.;HPS4_HUMAN;.;.;.	H	473;486;468;473	ENSP00000381213:R473H;ENSP00000381210:R486H;ENSP00000384185:R468H;ENSP00000338457:R473H	.	R	-	2	0	HPS4	25190178	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.973000	0.01500	-0.018000	0.14079	-1.251000	0.01509	CGC	rs139039617	HPS4	-	NULL		0.592	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPS4	HGNC	protein_coding	OTTHUMT00000320778.1	0	0	0	32	32	91	0.00	0.00	C	NM_022081		26860178	-1	5	36	18	75	tier1	no_errors	ENST00000398141	ensembl	human	known	74_37	missense	21.74	32.43	SNP	0.000	T	5	18
ZNF827	152485	genome.wustl.edu	37	4	146686150	146686150	+	Missense_Mutation	SNP	C	C	T	rs148875276		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:146686150C>T	ENST00000508784.1	-	13	3447	c.3220G>A	c.(3220-3222)Ggt>Agt	p.G1074S	ZNF827_ENST00000513320.1_Missense_Mutation_p.G724S|ZNF827_ENST00000379448.4_Missense_Mutation_p.G1074S			Q17R98	ZN827_HUMAN	zinc finger protein 827	1074					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					TTGAGCCCACCGGTGGGGACA	0.507													ENSG00000151612	C|||	1	0.000199681	0.0	0.0014	5008	,	,		20974	0.0		0.0	False		,,,				2504	0.0																0								C	SER/GLY	0,4406		0,0,2203	123.0	123.0	123.0		3220	4.8	1.0	4	dbSNP_134	123	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF827	NM_178835.3	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1074/1078	146686150	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.3220G>A	4.37:g.146686150C>T	ENSP00000421863:p.Gly1074Ser		B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G1074S	ENST00000508784.1	37	c.3220		4	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908627	0.92107	0.0	1.16E-4	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000503462;ENST00000440280	T;T;T;T	0.20881	3.01;2.8;2.04;3.24	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.28928	0.0718	N	0.08118	0	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.998	T	0.43814	-0.9368	10	0.62326	D	0.03	-9.5752	18.3139	0.90210	0.0:1.0:0.0:0.0	.	724;1074;1074;724	G5E9Z1;Q17R98;Q17R98-2;E7ESI8	.;ZN827_HUMAN;.;.	S	1074;724;1074;1073;20;724	ENSP00000421863:G1074S;ENSP00000423130:G724S;ENSP00000368761:G1074S;ENSP00000424541:G20S	ENSP00000281318:G1073S	G	-	1	0	ZNF827	146905600	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.445000	0.80570	2.368000	0.80403	0.655000	0.94253	GGT	rs148875276	ZNF827	-	NULL		0.507	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF827	HGNC	protein_coding	OTTHUMT00000364654.2	0	0	0	55	55	116	0.00	0.00	C	NM_178835		146686150	-1	15	37	26	73	tier1	no_errors	ENST00000508784	ensembl	human	known	74_37	missense	36.59	33.64	SNP	1.000	T	15	26
ZNF600	162966	genome.wustl.edu	37	19	53269192	53269192	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:53269192G>A	ENST00000338230.3	-	3	2084	c.1817C>T	c.(1816-1818)gCa>gTa	p.A606V		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	606					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		AGGTTTCTCTGCAGTGTGAAT	0.388													ENSG00000189190																									Esophageal Squamous(196;1235 2112 2375 33339 34207)												0													141.0	139.0	140.0					19																	53269192		2203	4300	6503	SO:0001583	missense	0			-	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.1817C>T	19.37:g.53269192G>A	ENSP00000344791:p.Ala606Val		Q6MZR0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A606V	ENST00000338230.3	37	c.1817	CCDS12856.1	19	.	.	.	.	.	.	.	.	.	.	.	14.17	2.456063	0.43634	.	.	ENSG00000189190	ENST00000338230	T	0.15487	2.42	1.61	-1.72	0.08107	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10465	0.0256	N	0.13098	0.295	0.22435	N	0.999104	B	0.34264	0.446	B	0.39379	0.298	T	0.33471	-0.9867	9	0.72032	D	0.01	.	5.6297	0.17504	0.2182:0.5586:0.2232:0.0	.	606	Q6ZNG1	ZN600_HUMAN	V	606	ENSP00000344791:A606V	ENSP00000344791:A606V	A	-	2	0	ZNF600	57961004	0.000000	0.05858	0.003000	0.11579	0.066000	0.16364	-0.261000	0.08694	-0.516000	0.06470	0.184000	0.17185	GCA	-	ZNF600	-	pfscan_Znf_C2H2		0.388	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF600	HGNC	protein_coding	OTTHUMT00000463093.1	0	0	0	132	132	46	0.00	0.00	G	NM_198457		53269192	-1	45	16	97	51	tier1	no_errors	ENST00000338230	ensembl	human	known	74_37	missense	31.69	23.53	SNP	0.955	A	45	97
SNRNP200	23020	genome.wustl.edu	37	2	96970557	96970557	+	Missense_Mutation	SNP	C	C	T	rs371058559		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:96970557C>T	ENST00000323853.5	-	2	172	c.95G>A	c.(94-96)cGc>cAc	p.R32H	SNRNP200_ENST00000349783.5_Missense_Mutation_p.R32H|AC021188.4_ENST00000421534.1_RNA	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	32					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TTCATCCCGGCGGGTCCGGTC	0.537													ENSG00000144028																																					0								C	HIS/ARG	0,4406		0,0,2203	73.0	67.0	69.0		95	5.6	1.0	2		69	1,8599	1.2+/-3.3	0,1,4299	no	missense	SNRNP200	NM_014014.4	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	32/2137	96970557	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.95G>A	2.37:g.96970557C>T	ENSP00000317123:p.Arg32His		O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R32H	ENST00000323853.5	37	c.95	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541871	0.85917	0.0	1.16E-4	ENSG00000144028	ENST00000323853;ENST00000349783	T;T	0.44083	0.93;0.93	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.49218	0.1544	M	0.77103	2.36	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46386	-0.9195	10	0.51188	T	0.08	-10.2621	18.4682	0.90763	0.0:1.0:0.0:0.0	.	32	O75643	U520_HUMAN	H	32	ENSP00000317123:R32H;ENSP00000326937:R32H	ENSP00000317123:R32H	R	-	2	0	SNRNP200	96334284	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.361000	0.79497	2.658000	0.90341	0.563000	0.77884	CGC	-	SNRNP200	-	NULL		0.537	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2	0	0	0	69	69	101	0.00	0.00	C	NM_014014		96970557	-1	35	41	59	86	tier1	no_errors	ENST00000323853	ensembl	human	known	74_37	missense	36.84	32.28	SNP	1.000	T	35	59
SALL3	27164	genome.wustl.edu	37	18	76757027	76757027	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr18:76757027G>A	ENST00000537592.2	+	3	3608	c.3608G>A	c.(3607-3609)cGg>cAg	p.R1203Q	SALL3_ENST00000575389.2_Missense_Mutation_p.R1131Q|SALL3_ENST00000536229.3_Missense_Mutation_p.R998Q	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1203					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CTGGCAGCTCGGGCAATGAAC	0.582													ENSG00000256463																																					0													76.0	73.0	74.0					18																	76757027		2203	4300	6503	SO:0001583	missense	0			-	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3608G>A	18.37:g.76757027G>A	ENSP00000441823:p.Arg1203Gln		Q9UGH1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1203Q	ENST00000537592.2	37	c.3608	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399268	0.25291	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.53206	0.63	5.2	5.2	0.72013	.	0.000000	0.47455	D	0.000230	T	0.67392	0.2888	M	0.72576	2.205	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	P;D	0.63957	0.897;0.92	T	0.70008	-0.4990	10	0.56958	D	0.05	-17.689	18.7722	0.91896	0.0:0.0:1.0:0.0	.	863;1203	F5GXY4;Q9BXA9	.;SALL3_HUMAN	Q	1203;1131;863	ENSP00000441823:R1203Q	ENSP00000299466:R1203Q	R	+	2	0	SALL3	74858015	1.000000	0.71417	0.051000	0.19133	0.298000	0.27526	7.869000	0.87170	2.423000	0.82170	0.561000	0.74099	CGG	-	SALL3	-	NULL		0.582	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	HGNC	protein_coding	OTTHUMT00000256397.1	0	0	0	64	64	108	0.00	0.00	G	NM_171999		76757027	+1	11	33	65	83	tier1	no_errors	ENST00000537592	ensembl	human	known	74_37	missense	14.47	28.21	SNP	0.999	A	11	65
YIF1A	10897	genome.wustl.edu	37	11	66055130	66055130	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:66055130G>A	ENST00000376901.4	-	4	550	c.366C>T	c.(364-366)taC>taT	p.Y122Y	YIF1A_ENST00000526497.1_5'Flank|YIF1A_ENST00000471387.2_5'UTR|YIF1A_ENST00000359461.6_Silent_p.Y122Y|YIF1A_ENST00000496746.1_5'Flank	NM_020470.2	NP_065203.2	O95070	YIF1A_HUMAN	Yip1 interacting factor homolog A (S. cerevisiae)	122					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)				endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	9						CATCACGACTGTACTGCACTT	0.622													ENSG00000174851																																					0													34.0	34.0	34.0					11																	66055130		2200	4295	6495	SO:0001819	synonymous_variant	0			-	AF004876	CCDS8132.1, CCDS73325.1	11q13	2009-01-05	2005-06-07	2005-06-07	ENSG00000174851	ENSG00000174851			16688	protein-coding gene	gene with protein product		611484	"""Yip1 interacting factor homolog (S. cerevisiae)"""	YIF1		8824393, 10970842, 18718466	Standard	NM_020470		Approved	YIF1P, 54TM, FinGER7	uc001ohk.4	O95070	OTTHUMG00000102079	ENST00000376901.4:c.366C>T	11.37:g.66055130G>A			A6NM00|Q96G83|Q9BVD0	Nonsense_Mutation	SNP	NULL	p.Q52*	ENST00000376901.4	37	c.154	CCDS8132.1	11																																																																																			-	YIF1A	-	NULL		0.622	YIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIF1A	HGNC	protein_coding	OTTHUMT00000219903.3	0	0	0	64	64	63	0.00	0.00	G	NM_020470		66055130	-1	21	22	33	53	tier1	no_errors	ENST00000484814	ensembl	human	known	74_37	nonsense	38.89	29.33	SNP	1.000	A	21	33
PDE4DIP	9659	genome.wustl.edu	37	1	144890626	144890626	+	Intron	SNP	G	G	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:144890626G>C	ENST00000369354.3	-	22	3094				PDE4DIP_ENST00000369351.3_3'UTR|PDE4DIP_ENST00000524974.1_Intron|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000313431.9_3'UTR|PDE4DIP_ENST00000369349.3_3'UTR|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369356.4_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATTGGTAGCAGGAGAGTCACA	0.358			T	PDGFRB	MPD								ENSG00000178104																												Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										SO:0001627	intron_variant	0			-	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2904+1874C>G	1.37:g.144890626G>C			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	R	SNP	-	NULL	ENST00000369354.3	37	NULL	CCDS30824.1	1																																																																																			-	PDE4DIP	-	-		0.358	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	0	0	0	227	227	197	0.00	0.00	G	NM_022359		144890626	-1	30	24	171	204	tier1	no_errors	ENST00000467859	ensembl	human	known	74_37	rna	14.93	10.53	SNP	0.801	C	30	171
IGF2BP2	10644	genome.wustl.edu	37	3	185407144	185407144	+	Splice_Site	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:185407144G>A	ENST00000382199.2	-	6	771	c.676C>T	c.(676-678)Cgg>Tgg	p.R226W	IGF2BP2_ENST00000421047.2_Splice_Site_p.R169W|IGF2BP2_ENST00000494906.1_5'Flank|IGF2BP2_ENST00000457616.2_Splice_Site_p.R232W|IGF2BP2_ENST00000346192.3_Splice_Site_p.R226W	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	226	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			GGCACGTACCGGGACTGGGTC	0.557													ENSG00000073792																																					0													80.0	76.0	78.0					3																	185407144		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.677+1C>T	3.37:g.185407144G>A			A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.R226W	ENST00000382199.2	37	c.676	CCDS3273.2	3	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857326	0.91433	.	.	ENSG00000073792	ENST00000382199;ENST00000421047;ENST00000457616;ENST00000346192	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.51	4.51	0.55191	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.056144	0.64402	D	0.000001	T	0.46464	0.1394	L	0.52126	1.63	0.53688	D	0.999977	D;D;D;D;P;D	0.76494	0.999;0.999;0.999;0.999;0.817;0.999	D;D;D;D;B;D	0.74674	0.964;0.964;0.964;0.964;0.435;0.984	T	0.38628	-0.9652	10	0.87932	D	0	-12.338	10.9468	0.47306	0.0:0.0:0.6541:0.3459	.	163;163;169;232;226;226	Q9Y6M1-5;Q9Y6M1-3;Q9Y6M1-4;F8W930;Q9Y6M1-1;Q9Y6M1	.;.;.;.;.;IF2B2_HUMAN	W	226;169;232;226	ENSP00000371634:R226W;ENSP00000413787:R169W;ENSP00000410242:R232W;ENSP00000320204:R226W	ENSP00000320204:R226W	R	-	1	2	IGF2BP2	186889838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.902000	0.75699	2.745000	0.94114	0.655000	0.94253	CGG	-	IGF2BP2	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.557	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGF2BP2	HGNC	protein_coding	OTTHUMT00000157087.2	0	0	0	56	56	70	0.00	0.00	G	NM_006548	Missense_Mutation	185407144	-1	15	32	30	65	tier1	no_errors	ENST00000382199	ensembl	human	known	74_37	missense	33.33	32.99	SNP	1.000	A	15	30
SAFB2	9667	genome.wustl.edu	37	19	5616451	5616451	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:5616451G>A	ENST00000252542.4	-	3	585	c.321C>T	c.(319-321)gaC>gaT	p.D107D		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	107					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CTCTGGAATCGTCTTCCAGGC	0.453													ENSG00000130254																									Ovarian(127;888 1728 23957 44128 52668)												0													221.0	188.0	199.0					19																	5616451		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.321C>T	19.37:g.5616451G>A			B4DKG3|Q8TB13	Silent	SNP	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.D107	ENST00000252542.4	37	c.321	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	G	0.026	-1.367487	0.01225	.	.	ENSG00000130254	ENST00000434962	.	.	.	5.38	-3.71	0.04424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.1262	0.03739	0.2563:0.3695:0.1743:0.1999	.	.	.	.	.	-1	.	.	.	-	.	.	SAFB2	5567451	0.029000	0.19370	0.821000	0.32701	0.001000	0.01503	-1.104000	0.03326	-1.359000	0.02174	-2.737000	0.00128	.	-	SAFB2	-	NULL		0.453	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	0	0	0	67	67	86	0.00	0.00	G	NM_014649		5616451	-1	13	17	49	66	tier1	no_errors	ENST00000252542	ensembl	human	known	74_37	silent	20.97	20.48	SNP	0.410	A	13	49
PKN1	5585	genome.wustl.edu	37	19	14561159	14561159	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:14561159C>T	ENST00000242783.6	+	5	805	c.640C>T	c.(640-642)Cgc>Tgc	p.R214C	PKN1_ENST00000342216.4_Missense_Mutation_p.R220C	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	214					activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						TGTGGAGCTGCGCATCGAAGA	0.667													ENSG00000123143																									NSCLC(185;2539 2965 10733 52867)												0													17.0	21.0	20.0					19																	14561159		2139	4233	6372	SO:0001583	missense	0			-	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.640C>T	19.37:g.14561159C>T	ENSP00000242783:p.Arg214Cys		A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_dom,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.R220C	ENST00000242783.6	37	c.658	CCDS42513.1	19	.	.	.	.	.	.	.	.	.	.	C	22.9	4.356085	0.82243	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.21734	1.99;1.99	3.96	3.96	0.45880	.	0.000000	0.64402	U	0.000001	T	0.49660	0.1570	M	0.85630	2.765	0.52501	D	0.999952	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.58989	-0.7538	10	0.72032	D	0.01	-13.1927	13.8642	0.63578	0.0:1.0:0.0:0.0	.	220;214	Q16512-2;Q16512	.;PKN1_HUMAN	C	214;220	ENSP00000242783:R214C;ENSP00000343325:R220C	ENSP00000242783:R214C	R	+	1	0	PKN1	14422159	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	3.474000	0.53129	1.933000	0.56026	0.491000	0.48974	CGC	-	PKN1	-	pfam_HR1_rho-bd,superfamily_HR1_rho-bd,smart_HR1_rho-bd		0.667	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN1	HGNC	protein_coding	OTTHUMT00000095510.1	0	0	0	83	83	15	0.00	0.00	C	NM_002741, NM_213560		14561159	+1	25	9	44	14	tier1	no_errors	ENST00000342216	ensembl	human	known	74_37	missense	36.23	39.13	SNP	1.000	T	25	44
C2CD5	9847	genome.wustl.edu	37	12	22677416	22677416	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:22677416C>T	ENST00000333957.4	-	6	846	c.591G>A	c.(589-591)tcG>tcA	p.S197S	C2CD5_ENST00000544930.1_5'UTR|C2CD5_ENST00000536386.1_Silent_p.S197S|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000542676.1_Silent_p.S197S|C2CD5_ENST00000396028.2_Silent_p.S197S|C2CD5_ENST00000545552.1_Silent_p.S197S|C2CD5_ENST00000446597.1_Silent_p.S197S	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	197					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CTGACATTAACGAAATGAGTC	0.353													ENSG00000111731																																					0													103.0	94.0	97.0					12																	22677416		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.591G>A	12.37:g.22677416C>T			B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.S197	ENST00000333957.4	37	c.591	CCDS31758.1	12																																																																																			-	C2CD5	-	NULL		0.353	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD5	HGNC	protein_coding	OTTHUMT00000402257.1	0	0	0	71	71	88	0.00	0.00	C	NM_014802		22677416	-1	15	23	48	70	tier1	no_errors	ENST00000333957	ensembl	human	known	74_37	silent	23.81	24.73	SNP	0.027	T	15	48
SCAF8	22828	genome.wustl.edu	37	6	155152087	155152087	+	Silent	SNP	G	G	A	rs138080868		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:155152087G>A	ENST00000367178.3	+	19	2748	c.2172G>A	c.(2170-2172)ccG>ccA	p.P724P	SCAF8_ENST00000367186.4_Silent_p.P790P|SCAF8_ENST00000417268.1_Silent_p.P724P|TIAM2_ENST00000461783.3_5'Flank	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	724	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						CCATGACACCGGAAACTGTGA	0.408													ENSG00000213079																																					0								G		1,4405	2.1+/-5.4	0,1,2202	80.0	82.0	82.0		2172	-1.0	1.0	6	dbSNP_134	82	0,8600		0,0,4300	no	coding-synonymous	SCAF8	NM_014892.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		724/1272	155152087	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.2172G>A	6.37:g.155152087G>A			B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	pfam_R_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_CID_dom,smart_RRM_dom,pfscan_RRM_dom	p.P790	ENST00000367178.3	37	c.2370	CCDS5247.1	6																																																																																			rs138080868	SCAF8	-	NULL		0.408	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF8	HGNC	protein_coding	OTTHUMT00000042798.1	0	0	0	59	59	133	0.00	0.00	G	NM_014892		155152087	+1	20	28	47	86	tier1	no_errors	ENST00000367186	ensembl	human	known	74_37	silent	29.85	24.56	SNP	0.998	A	20	47
PRAMEF12	390999	genome.wustl.edu	37	1	12835688	12835688	+	Missense_Mutation	SNP	G	G	A	rs369283541		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:12835688G>A	ENST00000357726.4	+	2	317	c.290G>A	c.(289-291)cGg>cAg	p.R97Q		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	97					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACCCACAGGCGGTGGAAACTT	0.517													ENSG00000116726																																					0								G	GLN/ARG	1,4321		0,1,2160	142.0	163.0	156.0		290	-0.5	0.0	1		156	0,8572		0,0,4286	no	missense	PRAMEF12	NM_001080830.1	43	0,1,6446	AA,AG,GG		0.0,0.0231,0.0078	benign	97/484	12835688	1,12893	2161	4286	6447	SO:0001583	missense	0			-		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.290G>A	1.37:g.12835688G>A	ENSP00000350358:p.Arg97Gln			Missense_Mutation	SNP	NULL	p.R97Q	ENST00000357726.4	37	c.290	CCDS41254.1	1	.	.	.	.	.	.	.	.	.	.	.	10.30	1.311352	0.23821	2.31E-4	0.0	ENSG00000116726	ENST00000357726	T	0.04317	3.65	2.8	-0.464	0.12160	.	0.177429	0.46442	D	0.000282	T	0.06325	0.0163	M	0.81497	2.545	0.09310	N	1	B	0.28400	0.21	B	0.22753	0.041	T	0.21759	-1.0236	10	0.62326	D	0.03	.	4.603	0.12363	0.1467:0.4484:0.4049:0.0	.	97	O95522	PRA12_HUMAN	Q	97	ENSP00000350358:R97Q	ENSP00000350358:R97Q	R	+	2	0	PRAMEF12	12758275	0.001000	0.12720	0.000000	0.03702	0.060000	0.15804	-0.048000	0.11944	-0.091000	0.12440	-0.802000	0.03209	CGG	-	PRAMEF12	-	NULL		0.517	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF12	HGNC	protein_coding	OTTHUMT00000005457.1	0	0	0	102	102	158	0.00	0.00	G	XM_372760		12835688	+1	37	43	75	99	tier1	no_errors	ENST00000357726	ensembl	human	known	74_37	missense	33.04	30.28	SNP	0.000	A	37	75
MAN1A1	4121	genome.wustl.edu	37	6	119509656	119509656	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:119509656G>A	ENST00000368468.3	-	11	2074	c.1633C>T	c.(1633-1635)Cgg>Tgg	p.R545W		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	545					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.R545W(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		ACTTCTGGCCGTAAGATGTAG	0.413													ENSG00000111885																									Ovarian(136;8 1825 12608 33541 47587)												1	Substitution - Missense(1)	prostate(1)											193.0	190.0	191.0					6																	119509656		2203	4300	6503	SO:0001583	missense	0			-	AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1633C>T	6.37:g.119509656G>A	ENSP00000357453:p.Arg545Trp		E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.R545W	ENST00000368468.3	37	c.1633	CCDS5122.1	6	.	.	.	.	.	.	.	.	.	.	G	22.1	4.244459	0.79912	.	.	ENSG00000111885	ENST00000368468	D	0.83837	-1.77	5.92	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.95608	0.8572	H	0.99806	4.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97318	0.9942	10	0.87932	D	0	-28.3893	17.0826	0.86603	0.0:0.0:0.8481:0.1519	.	545	P33908	MA1A1_HUMAN	W	545	ENSP00000357453:R545W	ENSP00000357453:R545W	R	-	1	2	MAN1A1	119551355	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	3.615000	0.54167	2.794000	0.96219	0.650000	0.86243	CGG	-	MAN1A1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47		0.413	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1A1	HGNC	protein_coding	OTTHUMT00000042015.1	0	0	0	73	73	124	0.00	0.00	G	NM_005907		119509656	-1	19	35	59	102	tier1	no_errors	ENST00000368468	ensembl	human	known	74_37	missense	24.36	25.55	SNP	1.000	A	19	59
CYP2A7	1549	genome.wustl.edu	37	19	41387540	41387540	+	Silent	SNP	G	G	A	rs112051160	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:41387540G>A	ENST00000301146.4	-	2	838	c.297C>T	c.(295-297)agC>agT	p.S99S	CYP2A7_ENST00000291764.3_Intron|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	99						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CGCCTCGCCCGCTGAACTCCT	0.642													ENSG00000198077	.|||	3	0.000599042	0.0023	0.0	5008	,	,		17262	0.0		0.0	False		,,,				2504	0.0																0								G	,	1,4405	2.1+/-5.4	0,1,2202	62.0	55.0	57.0		297,	-0.2	0.8	19	dbSNP_132	57	0,8592		0,0,4296	no	coding-synonymous,intron	CYP2A7	NM_000764.2,NM_030589.2	,	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	,	99/495,	41387540	1,12997	2203	4296	6499	SO:0001819	synonymous_variant	0			-	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.297C>T	19.37:g.41387540G>A			Q13121	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2B-like	p.S99	ENST00000301146.4	37	c.297	CCDS12569.1	19																																																																																			rs112051160	CYP2A7	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I		0.642	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A7	HGNC	protein_coding	OTTHUMT00000463269.2	0	0	0	48	48	22	0.00	0.00	G	NM_030589		41387540	-1	18	5	35	14	tier1	no_errors	ENST00000301146	ensembl	human	known	74_37	silent	33.33	26.32	SNP	0.136	A	18	35
IGFN1	91156	genome.wustl.edu	37	1	201174376	201174376	+	Silent	SNP	C	C	T	rs367631324	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:201174376C>T	ENST00000335211.4	+	11	1213	c.1083C>T	c.(1081-1083)gaC>gaT	p.D361D	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Silent_p.D361D	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	361	Ig-like 2.					nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGTCCCCTGACGGGCTGACCC	0.622													ENSG00000163395	C|||	2	0.000399361	0.0	0.0	5008	,	,		15511	0.002		0.0	False		,,,				2504	0.0																0								C		1,1383		0,1,691	28.0	28.0	28.0		1083	-3.6	0.5	1		28	0,3182		0,0,1591	no	coding-synonymous	IGFN1	NM_001164586.1		0,1,2282	TT,TC,CC		0.0,0.0723,0.0219		361/3709	201174376	1,4565	692	1591	2283	SO:0001819	synonymous_variant	0			-	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.1083C>T	1.37:g.201174376C>T			F8WAI1|Q9NT72	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D361	ENST00000335211.4	37	c.1083	CCDS53455.1	1																																																																																			-	IGFN1	-	smart_Ig_sub		0.622	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		0	0	0	49	49	37	0.00	0.00	C	NM_178275		201174376	+1	12	12	29	27	tier1	no_errors	ENST00000335211	ensembl	human	known	74_37	silent	29.27	30.77	SNP	0.943	T	12	29
LARP1	23367	genome.wustl.edu	37	5	154193507	154193507	+	Missense_Mutation	SNP	G	G	A	rs529943708		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:154193507G>A	ENST00000336314.4	+	19	2935	c.2911G>A	c.(2911-2913)Ggt>Agt	p.G971S		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	1048					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.G1048S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGGTGGCGGCGGTGAGGGCAG	0.637													ENSG00000155506	G|||	1	0.000199681	0.0	0.0	5008	,	,		13891	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	prostate(1)											69.0	66.0	67.0					5																	154193507		2203	4300	6503	SO:0001583	missense	0			-	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.2911G>A	5.37:g.154193507G>A	ENSP00000336721:p.Gly971Ser		O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	pfam_Lupus_La_R-bd,smart_Lupus_La_R-bd,smart_DM15,pfscan_Lupus_La_R-bd	p.G971S	ENST00000336314.4	37	c.2911	CCDS4328.1	5	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186161	0.38609	.	.	ENSG00000155506	ENST00000336314	T	0.23754	1.89	5.18	4.17	0.49024	.	0.144353	0.43919	N	0.000516	T	0.19565	0.0470	L	0.36672	1.1	0.52501	D	0.999953	B;P	0.41159	0.127;0.74	B;B	0.38985	0.01;0.287	T	0.02581	-1.1138	10	0.21014	T	0.42	-2.7818	11.3913	0.49815	0.1079:0.0:0.8921:0.0	.	1048;971	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	S	971	ENSP00000336721:G971S	ENSP00000336721:G971S	G	+	1	0	LARP1	154173700	1.000000	0.71417	0.876000	0.34364	0.347000	0.29111	2.437000	0.44828	0.942000	0.37525	0.561000	0.74099	GGT	-	LARP1	-	NULL		0.637	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	0	0	0	110	110	29	0.00	0.00	G	NM_033551		154193507	+1	17	7	71	23	tier1	no_errors	ENST00000336314	ensembl	human	known	74_37	missense	19.32	23.33	SNP	0.985	A	17	71
CACNA1I	8911	genome.wustl.edu	37	22	40077043	40077043	+	Missense_Mutation	SNP	C	C	T	rs183581233	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr22:40077043C>T	ENST00000402142.3	+	34	5650	c.5650C>T	c.(5650-5652)Cgc>Tgc	p.R1884C	CACNA1I_ENST00000400164.3_Missense_Mutation_p.R1849C|CACNA1I_ENST00000404898.1_Missense_Mutation_p.R1849C|CACNA1I_ENST00000336649.4_Missense_Mutation_p.R1890C|CACNA1I_ENST00000407673.1_Missense_Mutation_p.R1849C|CACNA1I_ENST00000401624.1_Missense_Mutation_p.R1884C	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1884					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CCCACCTGGCCGCAAAGACAG	0.652													ENSG00000100346	C|||	2	0.000399361	0.0	0.0014	5008	,	,		19431	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0			GMAF=0.0005	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.5650C>T	22.37:g.40077043C>T	ENSP00000385019:p.Arg1884Cys		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.R1890C	ENST00000402142.3	37	c.5668	CCDS46710.1	22	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	8.786	0.929438	0.18131	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.96967	-4.16;-4.13;-4.16;-4.13;-4.19;-4.09	4.29	-2.01	0.07410	.	.	.	.	.	D	0.89687	0.6787	N	0.22421	0.69	0.25893	N	0.983441	B;B;B;B	0.32653	0.0;0.379;0.0;0.0	B;B;B;B	0.33890	0.0;0.172;0.0;0.0	T	0.82892	-0.0232	9	0.51188	T	0.08	.	1.9367	0.03338	0.1397:0.4743:0.1363:0.2497	.	1849;1884;1849;1884	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	C	1884;1849;1884;1849;1890;1849	ENSP00000385019:R1884C;ENSP00000384093:R1849C;ENSP00000383887:R1884C;ENSP00000385680:R1849C;ENSP00000337829:R1890C;ENSP00000383028:R1849C	ENSP00000337829:R1890C	R	+	1	0	CACNA1I	38406989	0.047000	0.20315	0.791000	0.31998	0.100000	0.18952	0.269000	0.18589	0.057000	0.16193	0.561000	0.74099	CGC	rs183581233	CAC1I	-	NULL		0.652	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CAC1I	HGNC	protein_coding	OTTHUMT00000321290.1	0	0	0	67	67	31	0.00	0.00	C	NM_001003406		40077043	+1	17	6	51	38	tier1	no_errors	ENST00000336649	ensembl	human	known	74_37	missense	25.00	13.64	SNP	0.840	T	17	51
RYR2	6262	genome.wustl.edu	37	1	237758894	237758894	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:237758894G>A	ENST00000366574.2	+	34	4850	c.4533G>A	c.(4531-4533)gtG>gtA	p.V1511V	RYR2_ENST00000360064.6_Silent_p.V1509V|RYR2_ENST00000542537.1_Silent_p.V1495V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1511	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTGTGTGGTGGATGCTGCCA	0.527													ENSG00000198626																																					0													78.0	88.0	84.0					1																	237758894		2116	4237	6353	SO:0001819	synonymous_variant	0			-	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4533G>A	1.37:g.237758894G>A			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.V1509	ENST00000366574.2	37	c.4527	CCDS55691.1	1																																																																																			-	RYR2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.527	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	0	0	0	53	53	86	0.00	0.00	G	NM_001035		237758894	+1	13	22	30	80	tier1	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	30.23	21.57	SNP	1.000	A	13	30
COPG1	22820	genome.wustl.edu	37	3	128990636	128990636	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:128990636C>T	ENST00000314797.6	+	19	1974	c.1870C>T	c.(1870-1872)Cgc>Tgc	p.R624C		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	624	Interaction with ZNF289/ARFGAP2.				COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										GCCAGAGTTCCGCGGTCTTGG	0.547													ENSG00000181789																																					0													86.0	74.0	78.0					3																	128990636		2203	4300	6503	SO:0001583	missense	0			-	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.1870C>T	3.37:g.128990636C>T	ENSP00000325002:p.Arg624Cys		A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_gsu_app_Ig-like-sub,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_Coatomer/calthrin_app_sub_C,pirsf_Coatomer_gsu	p.R624C	ENST00000314797.6	37	c.1870	CCDS33851.1	3	.	.	.	.	.	.	.	.	.	.	C	11.55	1.672938	0.29693	.	.	ENSG00000181789	ENST00000314797	T	0.30981	1.51	5.68	-0.817	0.10836	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Coatomer, gamma subunit , appendage (1);Coatomer, gamma subunit, appendage, Ig-like subdomain (1);	1.470450	0.03966	N	0.290884	T	0.17066	0.0410	N	0.08118	0	0.21967	N	0.99945	B	0.02656	0.0	B	0.01281	0.0	T	0.28618	-1.0038	10	0.51188	T	0.08	-25.4288	7.0843	0.25249	0.5824:0.2785:0.0:0.1391	.	624	Q9Y678	COPG_HUMAN	C	624	ENSP00000325002:R624C	ENSP00000325002:R624C	R	+	1	0	COPG	130473326	0.012000	0.17670	0.007000	0.13788	0.004000	0.04260	0.251000	0.18257	-0.153000	0.11137	-0.175000	0.13238	CGC	-	COPG1	-	pfam_Coatomer_gsu_app_Ig-like-sub,superfamily_Coatomer/clathrin_app_Ig-like,pirsf_Coatomer_gsu		0.547	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPG1	HGNC	protein_coding	OTTHUMT00000355456.1	0	0	0	55	55	71	0.00	0.00	C	NM_016128		128990636	+1	28	28	38	65	tier1	no_errors	ENST00000314797	ensembl	human	known	74_37	missense	42.42	29.79	SNP	0.023	T	28	38
KRTAP16-1	100505753	genome.wustl.edu	37	17	39464603	39464603	+	Silent	SNP	A	A	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:39464603A>T	ENST00000391352.1	-	1	902	c.903T>A	c.(901-903)ccT>ccA	p.P301P		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	301	11 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						CACAACAAGAAGGCTCTTGGC	0.582													ENSG00000212657																																					0																																										SO:0001819	synonymous_variant	0			-	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.903T>A	17.37:g.39464603A>T				Silent	SNP	NULL	p.P301	ENST00000391352.1	37	c.903	CCDS56032.1	17																																																																																			-	KRTAP16-1	-	NULL		0.582	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP16-1	HGNC	protein_coding	OTTHUMT00000257785.1	0	0	0	34	34	65	0.00	0.00	A	NM_001146182		39464603	-1	8	24	6	43	tier1	no_errors	ENST00000391352	ensembl	human	known	74_37	silent	57.14	35.82	SNP	0.503	T	8	6
DDX51	317781	genome.wustl.edu	37	12	132625047	132625047	+	Missense_Mutation	SNP	C	C	T	rs370925243		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:132625047C>T	ENST00000397333.3	-	11	1632	c.1594G>A	c.(1594-1596)Gtg>Atg	p.V532M		NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	532	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		AACTCAGCCACGTCCACACCC	0.622													ENSG00000185163																																					0								C	MET/VAL	0,4262		0,0,2131	62.0	73.0	69.0		1594	4.2	0.1	12		69	1,8467		0,1,4233	no	missense	DDX51	NM_175066.3	21	0,1,6364	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging	532/667	132625047	1,12729	2131	4234	6365	SO:0001583	missense	0			-	BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.1594G>A	12.37:g.132625047C>T	ENSP00000380495:p.Val532Met		A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V532M	ENST00000397333.3	37	c.1594	CCDS41865.1	12	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417148	0.42918	0.0	1.18E-4	ENSG00000185163	ENST00000397333	T	0.78246	-1.16	5.09	4.2	0.49525	Helicase, C-terminal (3);	0.283341	0.33572	N	0.004774	D	0.87034	0.6077	M	0.80746	2.51	0.54753	D	0.999989	D	0.89917	1.0	D	0.76071	0.987	D	0.87928	0.2708	10	0.87932	D	0	-15.4738	11.3316	0.49479	0.0:0.9108:0.0:0.0892	.	532	Q8N8A6	DDX51_HUMAN	M	532	ENSP00000380495:V532M	ENSP00000380495:V532M	V	-	1	0	DDX51	131191000	1.000000	0.71417	0.125000	0.21846	0.001000	0.01503	6.890000	0.75633	1.146000	0.42352	-0.253000	0.11424	GTG	-	DDX51	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.622	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX51	HGNC	protein_coding	OTTHUMT00000398978.1	0	0	0	36	36	53	0.00	0.00	C	NM_175066		132625047	-1	6	16	20	42	tier1	no_errors	ENST00000397333	ensembl	human	known	74_37	missense	23.08	27.59	SNP	0.991	T	6	20
LRRC49	54839	genome.wustl.edu	37	15	71341850	71341850	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:71341850C>T	ENST00000260382.5	+	16	2220	c.1960C>T	c.(1960-1962)Cca>Tca	p.P654S	LRRC49_ENST00000544974.2_Missense_Mutation_p.P644S|LRRC49_ENST00000560158.2_Missense_Mutation_p.P342S|LRRC49_ENST00000560691.1_Missense_Mutation_p.P360S|LRRC49_ENST00000560369.1_Missense_Mutation_p.P659S|LRRC49_ENST00000443425.2_Missense_Mutation_p.P610S|LRRC49_ENST00000436542.2_3'UTR	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	654						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						GAAGCTTTGGCCACAGATGTT	0.358													ENSG00000137821																																					0													108.0	116.0	113.0					15																	71341850		2199	4297	6496	SO:0001583	missense	0			-		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1960C>T	15.37:g.71341850C>T	ENSP00000260382:p.Pro654Ser		B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P654S	ENST00000260382.5	37	c.1960	CCDS32282.1	15	.	.	.	.	.	.	.	.	.	.	c	21.2	4.120916	0.77436	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.51071	0.74;0.76;0.72	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.64583	0.2611	L	0.55743	1.74	0.49798	D	0.999824	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.986	D;D;D;D;P	0.79784	0.985;0.993;0.983;0.985;0.88	T	0.64232	-0.6456	10	0.56958	D	0.05	-12.8594	16.5586	0.84534	0.0:1.0:0.0:0.0	.	659;626;610;654;644	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	S	644;654;610;626	ENSP00000439600:P644S;ENSP00000260382:P654S;ENSP00000414065:P610S	ENSP00000260382:P654S	P	+	1	0	LRRC49	69128904	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.094000	0.64523	2.774000	0.95407	0.655000	0.94253	CCA	-	LRRC49	-	NULL		0.358	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRC49	HGNC	protein_coding	OTTHUMT00000417209.3	0	0	0	77	77	93	0.00	0.00	C	NM_017691		71341850	+1	31	35	59	86	tier1	no_errors	ENST00000260382	ensembl	human	known	74_37	missense	34.44	28.93	SNP	1.000	T	31	59
ALDOB	229	genome.wustl.edu	37	9	104187758	104187758	+	Missense_Mutation	SNP	C	C	T	rs565827286		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:104187758C>T	ENST00000374855.4	-	7	900	c.776G>A	c.(775-777)cGt>cAt	p.R259H	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	259					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				AGGAACAGTACGGTGGAGAGC	0.507													ENSG00000136872	C|||	1	0.000199681	0.0008	0.0	5008	,	,		21553	0.0		0.0	False		,,,				2504	0.0																0													233.0	184.0	200.0					9																	104187758		2203	4300	6503	SO:0001583	missense	0			-	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.776G>A	9.37:g.104187758C>T	ENSP00000363988:p.Arg259His		Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	pfam_Aldolase_I	p.R259H	ENST00000374855.4	37	c.776	CCDS6756.1	9	.	.	.	.	.	.	.	.	.	.	C	18.65	3.668552	0.67814	.	.	ENSG00000136872	ENST00000374855;ENST00000374853;ENST00000430164	D	0.89681	-2.55	6.06	6.06	0.98353	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.89649	0.6776	M	0.85373	2.75	0.80722	D	1	P	0.44690	0.841	B	0.33690	0.168	D	0.91351	0.5104	10	0.87932	D	0	-5.352	19.6279	0.95687	0.0:1.0:0.0:0.0	.	259	P05062	ALDOB_HUMAN	H	259;186;259	ENSP00000363988:R259H	ENSP00000363986:R186H	R	-	2	0	ALDOB	103227579	1.000000	0.71417	0.858000	0.33744	0.290000	0.27261	7.818000	0.86416	2.880000	0.98712	0.650000	0.86243	CGT	-	ALDOB	-	pfam_Aldolase_I		0.507	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDOB	HGNC	protein_coding	OTTHUMT00000053434.2	0	0	0	75	75	143	0.00	0.00	C			104187758	-1	22	29	77	128	tier1	no_errors	ENST00000374855	ensembl	human	known	74_37	missense	22.22	18.47	SNP	1.000	T	22	77
S100PBP	64766	genome.wustl.edu	37	1	33292387	33292387	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:33292387T>C	ENST00000373475.5	+	3	941	c.687T>C	c.(685-687)ccT>ccC	p.P229P	S100PBP_ENST00000398243.3_Silent_p.P229P|S100PBP_ENST00000356689.3_3'UTR|S100PBP_ENST00000373476.1_Silent_p.P229P	NM_022753.3	NP_073590.2			S100P binding protein											endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|stomach(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				AAAATATGCCTGACAGTGAGA	0.443													ENSG00000116497																																					0													72.0	75.0	74.0					1																	33292387		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BX647916	CCDS30666.1	1p35.1	2008-02-05			ENSG00000116497	ENSG00000116497			25768	protein-coding gene	gene with protein product	"""S100P binding protein 1"""	611889				12477932	Standard	NM_022753		Approved	FLJ12903, S100PBPR	uc001bwc.4	Q96BU1	OTTHUMG00000003955	ENST00000373475.5:c.687T>C	1.37:g.33292387T>C				Silent	SNP	NULL	p.P229	ENST00000373475.5	37	c.687	CCDS30666.1	1																																																																																			-	S100PBP	-	NULL		0.443	S100PBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100PBP	HGNC	protein_coding	OTTHUMT00000011266.1	0	0	0	48	48	93	0.00	0.00	T	NM_022753		33292387	+1	17	21	37	68	tier1	no_errors	ENST00000373475	ensembl	human	known	74_37	silent	31.48	23.60	SNP	0.131	C	17	37
SLC3A2	6520	genome.wustl.edu	37	11	62622704	62622704	+	5'Flank	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:62622704C>A	ENST00000377890.2	+	0	0				SNHG1_ENST00000384147.1_RNA|SNHG1_ENST00000384756.1_RNA|SNHG1_ENST00000384706.1_RNA|SNHG1_ENST00000364799.1_RNA|SNHG1_ENST00000363981.1_RNA|SNHG1_ENST00000365607.1_RNA|SNHG1_ENST00000384693.1_RNA|SLC3A2_ENST00000377891.2_5'Flank|SNHG1_ENST00000516331.1_RNA|SLC3A2_ENST00000377892.1_5'Flank|SLC3A2_ENST00000535296.1_5'Flank|SLC3A2_ENST00000377889.2_5'Flank|SNHG1_ENST00000383926.1_RNA	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						AAAATAACACCCTTCACTAAC	0.428													ENSG00000255717																																					0																																										SO:0001631	upstream_gene_variant	0			-		CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091		11.37:g.62622704C>A	Exception_encountered		Q13543	R	SNP	-	NULL	ENST00000377890.2	37	NULL	CCDS8039.2	11																																																																																			-	SNHG1	-	-		0.428	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	SNHG1	HGNC	protein_coding	OTTHUMT00000157306.1	0	0	0	57	57	144	0.00	0.00	C	NM_001012661		62622704	-1	6	53	45	126	tier1	no_errors	ENST00000539921	ensembl	human	known	74_37	rna	11.76	29.61	SNP	0.000	A	6	45
PCDHGB4	8641	genome.wustl.edu	37	5	140769482	140769482	+	Silent	SNP	C	C	T	rs371220204		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:140769482C>T	ENST00000519479.1	+	1	2031	c.2031C>T	c.(2029-2031)ccC>ccT	p.P677P	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA8_ENST00000398604.2_5'Flank|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	677					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGACCGCCCCGACCCCTCTG	0.612													ENSG00000253953																																					0								C	,,,,,,,,,,,	0,4302		0,0,2151	131.0	143.0	139.0		2031,,,,,,,,,,,2031	-10.8	0.0	5		139	1,8497		0,1,4248	no	coding-synonymous,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,coding-synonymous	PCDHGB4,PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA7,PCDHGA6,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_003736.2,NM_018912.2,NM_018915.2,NM_018916.3,NM_018917.2,NM_018918.2,NM_018919.2,NM_018920.2,NM_018922.2,NM_018923.2,NM_018924.2,NM_032098.1	,,,,,,,,,,,	0,1,6399	TT,TC,CC		0.0118,0.0,0.0078	,,,,,,,,,,,	677/924,,,,,,,,,,,677/804	140769482	1,12799	2151	4249	6400	SO:0001819	synonymous_variant	0			-	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.2031C>T	5.37:g.140769482C>T			O15099|Q2M267|Q9UN64	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P677	ENST00000519479.1	37	c.2031	CCDS54928.1	5																																																																																			-	PCDHGB4	-	NULL		0.612	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	0	0	0	21	21	12	0.00	0.00	C	NM_003736		140769482	+1	8	6	14	19	tier1	no_errors	ENST00000519479	ensembl	human	known	74_37	silent	36.36	24.00	SNP	0.000	T	8	14
WDR3	10885	genome.wustl.edu	37	1	118499757	118499757	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:118499757C>T	ENST00000349139.5	+	25	2567	c.2520C>T	c.(2518-2520)aaC>aaT	p.N840N	SPAG17_ENST00000336338.5_Intron	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	840						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		AACTCTTTAACGAATTCATTC	0.388													ENSG00000065183																																					0													184.0	185.0	185.0					1																	118499757		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.2520C>T	1.37:g.118499757C>T				Silent	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.N840	ENST00000349139.5	37	c.2520	CCDS898.1	1																																																																																			-	WDR3	-	pfam_SSU_processome_Utp12		0.388	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	HGNC	protein_coding	OTTHUMT00000033720.2	0	0	0	65	65	104	0.00	0.00	C	NM_006784		118499757	+1	20	27	46	76	tier1	no_errors	ENST00000349139	ensembl	human	known	74_37	silent	30.30	26.21	SNP	0.111	T	20	46
DSP	1832	genome.wustl.edu	37	6	7558370	7558370	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:7558370A>G	ENST00000379802.3	+	3	636	c.295A>G	c.(295-297)Ata>Gta	p.I99V	DSP_ENST00000418664.2_Missense_Mutation_p.I99V	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	99	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TGGAGATGGAATACAACTGAC	0.448													ENSG00000096696																																					0													112.0	108.0	109.0					6																	7558370		2203	4300	6503	SO:0001583	missense	0			-	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.295A>G	6.37:g.7558370A>G	ENSP00000369129:p.Ile99Val		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.I99V	ENST00000379802.3	37	c.295	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	A	0.698	-0.791964	0.02884	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.73363	-0.42;-0.74	5.82	0.51	0.16983	.	0.581631	0.17351	N	0.177386	T	0.22859	0.0552	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29731	-1.0002	10	0.27082	T	0.32	.	5.5058	0.16854	0.4887:0.2501:0.2613:0.0	.	146;99	Q4LE79;P15924	.;DESP_HUMAN	V	99	ENSP00000369129:I99V;ENSP00000396591:I99V	ENSP00000369129:I99V	I	+	1	0	DSP	7503369	0.163000	0.22920	0.025000	0.17156	0.943000	0.58893	0.666000	0.25097	0.107000	0.17824	0.533000	0.62120	ATA	-	DSP	-	NULL		0.448	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	0	0	0	88	88	112	0.00	0.00	A	NM_004415		7558370	+1	27	33	40	75	tier1	no_errors	ENST00000379802	ensembl	human	known	74_37	missense	40.30	30.56	SNP	0.006	G	27	40
GBP6	163351	genome.wustl.edu	37	1	89835160	89835160	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:89835160C>T	ENST00000370456.4	+	3	339	c.246C>T	c.(244-246)tgC>tgT	p.C82C	GBP6_ENST00000535065.1_Intron	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	82	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		GGATGTGGTGCGTGCCCCACC	0.582													ENSG00000183347																																					0													103.0	92.0	96.0					1																	89835160		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.246C>T	1.37:g.89835160C>T			A2RRM3|Q6ZN86|Q7Z3F0	Silent	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.C82	ENST00000370456.4	37	c.246	CCDS723.1	1																																																																																			-	GBP6	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase		0.582	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP6	HGNC	protein_coding	OTTHUMT00000028001.1	0	0	0	31	31	72	0.00	0.00	C	NM_198460		89835160	+1	16	24	30	74	tier1	no_errors	ENST00000370456	ensembl	human	known	74_37	silent	34.78	24.49	SNP	0.997	T	16	30
NLRC5	84166	genome.wustl.edu	37	16	57059999	57059999	+	Missense_Mutation	SNP	G	G	A	rs200058658	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:57059999G>A	ENST00000262510.6	+	6	1369	c.1144G>A	c.(1144-1146)Gcc>Acc	p.A382T	NLRC5_ENST00000436936.1_Missense_Mutation_p.A382T|NLRC5_ENST00000308149.7_Missense_Mutation_p.A382T|NLRC5_ENST00000539144.1_Missense_Mutation_p.A382T	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	382	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CTTCTTCAGCGCCCAGCCATC	0.612													ENSG00000140853	G|||	4	0.000798722	0.0008	0.0014	5008	,	,		20052	0.0		0.001	False		,,,				2504	0.001																0								G	THR/ALA	1,4395	2.1+/-5.4	0,1,2197	95.0	104.0	101.0		1144	1.7	0.0	16		101	0,8600		0,0,4300	yes	missense	NLRC5	NM_032206.3	58	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	382/1867	57059999	1,12995	2198	4300	6498	SO:0001583	missense	0			GMAF=0.0005	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.1144G>A	16.37:g.57059999G>A	ENSP00000262510:p.Ala382Thr		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_CHT_NTPase	p.A382T	ENST00000262510.6	37	c.1144	CCDS10773.1	16	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	0.072|0.072	-1.200493|-1.200493	0.01581|0.01581	2.27E-4|2.27E-4	0.0|0.0	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144|ENST00000538805	T;T;T;T|.	0.79653|.	-1.29;-1.29;-1.29;-1.29|.	4.69|4.69	1.68|1.68	0.24146|0.24146	.|.	1.227190|.	0.06315|.	N|.	0.703447|.	T|T	0.24928|0.24928	0.0605|0.0605	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.15141|.	0.009;0.005;0.012;0.002|.	B;B;B;B|.	0.13407|.	0.004;0.004;0.005;0.009|.	T|T	0.23013|0.23013	-1.0200|-1.0200	10|5	0.52906|.	T|.	0.07|.	.|.	4.6739|4.6739	0.12703|0.12703	0.3478:0.1642:0.488:0.0|0.3478:0.1642:0.488:0.0	.|.	382;382;382;382|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	T|H	382|134	ENSP00000262510:A382T;ENSP00000308886:A382T;ENSP00000389739:A382T;ENSP00000441727:A382T|.	ENSP00000262510:A382T|.	A|R	+|+	1|2	0|0	NLRC5|NLRC5	55617500|55617500	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.012000|0.012000	0.07955|0.07955	0.153000|0.153000	0.16323|0.16323	0.217000|0.217000	0.20800|0.20800	-0.254000|-0.254000	0.11334|0.11334	GCC|CGC	rs200058658	NLRC5	-	NULL		0.612	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	0	0	0	35	35	67	0.00	0.00	G	NM_032206		57059999	+1	6	29	13	20	tier1	no_errors	ENST00000262510	ensembl	human	known	74_37	missense	31.58	59.18	SNP	0.001	A	6	13
KALRN	8997	genome.wustl.edu	37	3	124281829	124281829	+	Missense_Mutation	SNP	C	C	T	rs202002851	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:124281829C>T	ENST00000393496.1	+	2	352	c.188C>T	c.(187-189)aCc>aTc	p.T63I	KALRN_ENST00000360013.3_Missense_Mutation_p.T1690I			O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1690	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CTGGTCCGTACCACCGAACGG	0.657													ENSG00000160145																																					0													40.0	46.0	44.0					3																	124281829		2060	4206	6266	SO:0001583	missense	0			-	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000393496.1:c.188C>T	3.37:g.124281829C>T	ENSP00000377134:p.Thr63Ile		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.T1690I	ENST00000393496.1	37	c.5069		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.244250|4.244250	0.79912|0.79912	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000393496	.|T;T	.|0.61040	.|0.14;0.84	4.64|4.64	4.64|4.64	0.57946|0.57946	.|Src homology-3 domain (3);	.|0.062141	.|0.64402	.|D	.|0.000005	T|T	0.69378|0.69378	0.3104|0.3104	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	.|D;P	.|0.89917	.|1.0;0.952	.|D;P	.|0.87578	.|0.998;0.601	T|T	0.63906|0.63906	-0.6531|-0.6531	5|10	.|0.23302	.|T	.|0.38	.|.	18.089|18.089	0.89468|0.89468	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|63;1690	.|O60229-5;O60229	.|.;KALRN_HUMAN	S|I	1659|1690;63	.|ENSP00000353109:T1690I;ENSP00000377134:T63I	.|ENSP00000353109:T1690I	P|T	+|+	1|2	0|0	KALRN|KALRN	125764519|125764519	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.516000|0.516000	0.34256|0.34256	7.606000|7.606000	0.82863|0.82863	2.578000|2.578000	0.87016|0.87016	0.655000|0.655000	0.94253|0.94253	CCA|ACC	-	KALRN	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.657	KALRN-002	NOVEL	basic	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258840.2	0	0	0	59	59	25	0.00	0.00	C	NM_003947		124281829	+1	8	11	28	22	tier1	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	22.22	33.33	SNP	1.000	T	8	28
SVOPL	136306	genome.wustl.edu	37	7	138344683	138344683	+	Silent	SNP	C	C	T	rs538349256		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:138344683C>T	ENST00000419765.3	-	5	429	c.396G>A	c.(394-396)tcG>tcA	p.S132S	SVOPL_ENST00000421622.1_Intron|SVOPL_ENST00000288513.5_Intron|SVOPL_ENST00000436657.1_Intron	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	132						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						AAGGAGCAAACGAGGTCAGCA	0.552													ENSG00000157703	C|||	1	0.000199681	0.0	0.0014	5008	,	,		22573	0.0		0.0	False		,,,				2504	0.0																0													183.0	181.0	182.0					7																	138344683		692	1591	2283	SO:0001819	synonymous_variant	0			-	BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.396G>A	7.37:g.138344683C>T				Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S132	ENST00000419765.3	37	c.396	CCDS47721.1	7																																																																																			-	SVOPL	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.552	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SVOPL	HGNC	protein_coding	OTTHUMT00000342092.4	0	0	0	88	88	104	0.00	0.00	C	NM_174959		138344683	-1	30	36	65	77	tier1	no_errors	ENST00000419765	ensembl	human	novel	74_37	silent	31.25	31.86	SNP	0.767	T	30	65
MYH9	4627	genome.wustl.edu	37	22	36737437	36737437	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr22:36737437G>A	ENST00000216181.5	-	3	698	c.468C>T	c.(466-468)acC>acT	p.T156T	MYH9_ENST00000401701.1_Silent_p.T156T	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	156	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.T156T(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TCCTGTAGGCGGTGTCTGTGA	0.527			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated				ENSG00000100345																												Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	1	Substitution - coding silent(1)	large_intestine(1)											188.0	145.0	160.0					22																	36737437		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	-		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.468C>T	22.37:g.36737437G>A			A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tR-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T156	ENST00000216181.5	37	c.468	CCDS13927.1	22																																																																																			-	MYH9	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.527	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	0	0	0	45	45	106	0.00	0.00	G	NM_002473		36737437	-1	15	27	29	75	tier1	no_errors	ENST00000216181	ensembl	human	known	74_37	silent	34.09	26.21	SNP	0.890	A	15	29
PLTP	5360	genome.wustl.edu	37	20	44539885	44539885	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:44539885G>A	ENST00000477313.1	-	2	700	c.106C>T	c.(106-108)Cag>Tag	p.Q36*	PLTP_ENST00000542937.1_Nonsense_Mutation_p.Q56*|PLTP_ENST00000354050.4_Nonsense_Mutation_p.Q36*|PLTP_ENST00000372431.3_Nonsense_Mutation_p.Q36*|PLTP_ENST00000420868.2_Nonsense_Mutation_p.Q36*|PLTP_ENST00000372420.1_5'Flank			P55058	PLTP_HUMAN	phospholipid transfer protein	36					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				AGCCCCTCCTGCTTCACTGAA	0.597													ENSG00000100979																																					0													70.0	72.0	71.0					20																	44539885		2203	4300	6503	SO:0001587	stop_gained	0			-	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.106C>T	20.37:g.44539885G>A	ENSP00000417138:p.Gln36*		A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Nonsense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.Q56*	ENST00000477313.1	37	c.166	CCDS13386.1	20	.	.	.	.	.	.	.	.	.	.	G	37	6.219277	0.97385	.	.	ENSG00000100979	ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	.	.	.	5.2	5.2	0.72013	.	0.475254	0.24750	N	0.035911	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-25.7989	18.9155	0.92505	0.0:0.0:1.0:0.0	.	.	.	.	X	36;36;36;56;36	.	ENSP00000335290:Q36X	Q	-	1	0	PLTP	43973292	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	2.768000	0.47645	2.700000	0.92200	0.563000	0.77884	CAG	-	PLTP	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N		0.597	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLTP	HGNC	protein_coding	OTTHUMT00000354633.1	0	0	0	64	64	62	0.00	0.00	G	NM_006227		44539885	-1	14	16	55	50	tier1	no_errors	ENST00000542937	ensembl	human	known	74_37	nonsense	20.29	24.24	SNP	1.000	A	14	55
TET1	80312	genome.wustl.edu	37	10	70405282	70405282	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:70405282T>C	ENST00000373644.4	+	4	3005	c.2796T>C	c.(2794-2796)gcT>gcC	p.A932A		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	932					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GCTGCAAAGCTATCCTCTACA	0.438													ENSG00000138336																																					0													72.0	73.0	73.0					10																	70405282		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2796T>C	10.37:g.70405282T>C			Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.A932	ENST00000373644.4	37	c.2796	CCDS7281.1	10																																																																																			-	TET1	-	NULL		0.438	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	0	0	0	64	64	83	0.00	0.00	T	NM_030625		70405282	+1	23	16	27	83	tier1	no_errors	ENST00000373644	ensembl	human	known	74_37	silent	46.00	16.16	SNP	0.001	C	23	27
RPTN	126638	genome.wustl.edu	37	1	152129217	152129217	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:152129217G>T	ENST00000316073.3	-	3	422	c.358C>A	c.(358-360)Caa>Aaa	p.Q120K		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	120	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TGTCTGTGTTGTCTGCCTGTG	0.522													ENSG00000215853																																					0													497.0	409.0	436.0					1																	152129217		1568	3582	5150	SO:0001583	missense	0			-	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.358C>A	1.37:g.152129217G>T	ENSP00000317895:p.Gln120Lys		B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.Q120K	ENST00000316073.3	37	c.358	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.479513	0.44044	.	.	ENSG00000215853	ENST00000316073	T	0.11821	2.74	4.77	3.83	0.44106	.	.	.	.	.	T	0.04543	0.0124	M	0.67953	2.075	0.09310	N	1	P	0.44734	0.842	B	0.28849	0.095	T	0.27434	-1.0074	9	0.25751	T	0.34	-2.6422	10.6398	0.45586	0.0:0.1944:0.8056:0.0	.	120	Q6XPR3	RPTN_HUMAN	K	120	ENSP00000317895:Q120K	ENSP00000317895:Q120K	Q	-	1	0	RPTN	150395841	0.319000	0.24607	0.340000	0.25575	0.072000	0.16883	0.729000	0.26028	1.180000	0.42898	0.542000	0.68232	CAA	-	RPTN	-	NULL		0.522	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	0	0	1	95	95	150	0.00	0.66	G	XM_371312		152129217	-1	20	51	76	91	tier1	no_errors	ENST00000316073	ensembl	human	known	74_37	missense	20.83	35.92	SNP	0.192	T	20	76
PPFIA4	8497	genome.wustl.edu	37	1	203014996	203014996	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:203014996G>T	ENST00000447715.2	+	12	1327	c.886G>T	c.(886-888)Gag>Tag	p.E296*	PPFIA4_ENST00000414050.2_Nonsense_Mutation_p.E3*|PPFIA4_ENST00000367240.2_Nonsense_Mutation_p.E296*|PPFIA4_ENST00000295706.4_5'UTR			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	296					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						GGACATGGAAGAGCGGATTAC	0.567													ENSG00000143847																																					0													143.0	133.0	136.0					1																	203014996		876	1991	2867	SO:0001587	stop_gained	0			-	AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.886G>T	1.37:g.203014996G>T	ENSP00000402576:p.Glu296*		A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Nonsense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E3*	ENST00000447715.2	37	c.7		1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010434	0.93346	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000414050	.	.	.	4.72	3.8	0.43715	.	0.000000	0.45867	D	0.000330	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-8.0701	13.3314	0.60490	0.0772:0.0:0.9228:0.0	.	.	.	.	X	296;296;3	.	ENSP00000356209:E296X	E	+	1	0	PPFIA4	201281619	1.000000	0.71417	0.998000	0.56505	0.436000	0.31835	7.709000	0.84645	1.205000	0.43262	0.557000	0.71058	GAG	-	PPFIA4	-	NULL		0.567	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	PPFIA4	HGNC	protein_coding	OTTHUMT00000462949.1	0	0	0	37	37	92	0.00	0.00	G	NM_015053		203014996	+1	9	24	23	46	tier1	no_errors	ENST00000414050	ensembl	human	known	74_37	nonsense	28.12	34.29	SNP	1.000	T	9	23
MORC3	23515	genome.wustl.edu	37	21	37741473	37741473	+	Missense_Mutation	SNP	G	G	A	rs545559328		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr21:37741473G>A	ENST00000400485.1	+	15	1883	c.1807G>A	c.(1807-1809)Gtt>Att	p.V603I	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	603					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						ACAGAGTCACGTTGAGCAAGG	0.458													ENSG00000159256																																					0													246.0	239.0	242.0					21																	37741473		2155	4263	6418	SO:0001583	missense	0			-	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1807G>A	21.37:g.37741473G>A	ENSP00000383333:p.Val603Ile		A8KA92|Q9UEZ2	Missense_Mutation	SNP	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,pfscan_Znf_CW	p.V603I	ENST00000400485.1	37	c.1807	CCDS42924.1	21	.	.	.	.	.	.	.	.	.	.	G	4.044	0.005812	0.07866	.	.	ENSG00000159256	ENST00000400485	T	0.13901	2.55	5.73	-11.5	0.00074	.	1.749840	0.02487	N	0.089111	T	0.04048	0.0113	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26467	-1.0102	10	0.24483	T	0.36	1.8841	6.5023	0.22176	0.1772:0.2118:0.4688:0.1423	.	603	Q14149	MORC3_HUMAN	I	603	ENSP00000383333:V603I	ENSP00000383333:V603I	V	+	1	0	MORC3	36663343	0.000000	0.05858	0.000000	0.03702	0.520000	0.34377	-3.386000	0.00489	-2.739000	0.00380	-0.658000	0.03865	GTT	-	MORC3	-	NULL		0.458	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MORC3	HGNC	protein_coding	OTTHUMT00000194640.1	0	0	0	61	61	150	0.00	0.00	G	NM_015358		37741473	+1	13	37	20	74	tier1	no_errors	ENST00000400485	ensembl	human	known	74_37	missense	39.39	33.33	SNP	0.000	A	13	20
KCNC3	3748	genome.wustl.edu	37	19	50826791	50826791	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:50826791G>A	ENST00000477616.1	-	2	1713	c.1419C>T	c.(1417-1419)ggC>ggT	p.G473G	KCNC3_ENST00000391818.2_Intron|KCNC3_ENST00000376959.2_Silent_p.G473G|KCNC3_ENST00000474951.1_Intron	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	473					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	CGGGGTCGGCGCCAATGCGCT	0.597													ENSG00000131398																									Melanoma(91;1496 2324 50908)												0													99.0	97.0	97.0					19																	50826791		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.1419C>T	19.37:g.50826791G>A				Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_K_chnl_volt-dep_Kv3_ID,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3.3,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv	p.G473	ENST00000477616.1	37	c.1419	CCDS12793.1	19																																																																																			-	KCNC3	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom		0.597	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNC3	HGNC	protein_coding	OTTHUMT00000314288.2	0	0	1	49	49	58	0.00	1.69	G	NM_004977		50826791	-1	5	28	25	58	tier1	no_errors	ENST00000477616	ensembl	human	known	74_37	silent	16.67	32.18	SNP	1.000	A	5	25
ABCG8	64241	genome.wustl.edu	37	2	44102440	44102440	+	Silent	SNP	C	C	T	rs200018072		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:44102440C>T	ENST00000272286.2	+	11	1734	c.1644C>T	c.(1642-1644)gcC>gcT	p.A548A		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	548	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	TGGCCCTGGCCGCCGCGGCCC	0.612													ENSG00000143921	C|||	1	0.000199681	0.0	0.0	5008	,	,		16091	0.0		0.0	False		,,,				2504	0.001																0								C		0,4406		0,0,2203	67.0	65.0	65.0		1644	-9.4	0.0	2		65	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ABCG8	NM_022437.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		548/674	44102440	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1644C>T	2.37:g.44102440C>T			Q53QN8	Silent	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,pfscan_ABC_transporter-like	p.A548	ENST00000272286.2	37	c.1644	CCDS1815.1	2																																																																																			rs200018072	ABCG8	-	pfam_ABC_2_trans		0.612	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG8	HGNC	protein_coding	OTTHUMT00000250671.1	0	0	0	30	30	50	0.00	0.00	C	NM_022437		44102440	+1	9	6	11	20	tier1	no_errors	ENST00000272286	ensembl	human	known	74_37	silent	45.00	23.08	SNP	0.001	T	9	11
LOC63930	63930	genome.wustl.edu	37	20	61711537	61711537	+	lincRNA	SNP	C	C	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:61711537C>G	ENST00000607802.1	+	0	285					NR_033370.1																						cctcagaactcagacagtgaa	0.567													ENSG00000272259																																					0																																												0			-																													20.37:g.61711537C>G				R	SNP	-	NULL	ENST00000607802.1	37	NULL		20																																																																																			-	RP11-305P22.9	-	-		0.567	RP11-305P22.9-001	KNOWN	basic	lincRNA	LOC63930	Clone_based_vega_gene	lincRNA	OTTHUMT00000470475.1	0	0	0	60	60	133	0.00	0.00	C			61711537	+1	12	33	73	133	tier1	no_errors	ENST00000607802	ensembl	human	known	74_37	rna	14.12	19.88	SNP	0.012	G	12	73
SGSM2	9905	genome.wustl.edu	37	17	2268616	2268616	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:2268616C>T	ENST00000426855.2	+	11	1444	c.1269C>T	c.(1267-1269)ccC>ccT	p.P423P	SGSM2_ENST00000574563.1_Silent_p.P423P|SGSM2_ENST00000268989.3_Silent_p.P423P	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	423					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		TCATCTACCCCGGCCACAGGC	0.642													ENSG00000141258																																					0													40.0	33.0	36.0					17																	2268616		2193	4298	6491	SO:0001819	synonymous_variant	0			-	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1269C>T	17.37:g.2268616C>T			A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.P423	ENST00000426855.2	37	c.1269	CCDS45570.1	17																																																																																			-	SGSM2	-	NULL		0.642	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM2	HGNC	protein_coding	OTTHUMT00000438186.1	0	0	0	57	57	50	0.00	0.00	C	NM_014853		2268616	+1	19	16	29	39	tier1	no_errors	ENST00000268989	ensembl	human	known	74_37	silent	39.58	28.57	SNP	0.021	T	19	29
STON2	85439	genome.wustl.edu	37	14	81743643	81743643	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr14:81743643C>T	ENST00000267540.2	-	4	2212	c.2012G>A	c.(2011-2013)cGg>cAg	p.R671Q	STON2_ENST00000556280.1_5'Flank|STON2_ENST00000555447.1_Missense_Mutation_p.R671Q	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	671	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		TAGCTCAAACCGGCACGCATC	0.527													ENSG00000140022																																					0													104.0	93.0	97.0					14																	81743643		2203	4300	6503	SO:0001583	missense	0			-	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.2012G>A	14.37:g.81743643C>T	ENSP00000267540:p.Arg671Gln		G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	pfam_Stonin2_N,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C,pfscan_SHD	p.R671Q	ENST00000267540.2	37	c.2012	CCDS9875.1	14	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857504	0.71834	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.21031	2.03;2.03	6.06	6.06	0.98353	Clathrin adaptor, mu subunit, C-terminal (3);	0.070655	0.56097	D	0.000032	T	0.44222	0.1283	M	0.69358	2.11	0.41004	D	0.984953	D;D	0.89917	1.0;1.0	D;D	0.72982	0.979;0.965	T	0.26950	-1.0088	10	0.59425	D	0.04	-21.3364	13.774	0.63041	0.0:0.9304:0.0:0.0696	.	671;671	Q8WXE9;G3V2T7	STON2_HUMAN;.	Q	671;683;671	ENSP00000450857:R671Q;ENSP00000267540:R671Q	ENSP00000267540:R671Q	R	-	2	0	STON2	80813396	1.000000	0.71417	0.985000	0.45067	0.941000	0.58515	4.982000	0.63825	2.879000	0.98667	0.650000	0.86243	CGG	-	STON2	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C		0.527	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STON2	HGNC	protein_coding	OTTHUMT00000413317.1	0	0	0	39	39	117	0.00	0.00	C	NM_033104		81743643	-1	10	39	8	53	tier1	no_errors	ENST00000267540	ensembl	human	known	74_37	missense	55.56	42.39	SNP	0.998	T	10	8
BRD9	65980	genome.wustl.edu	37	5	887533	887533	+	Silent	SNP	G	G	A	rs73733976	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:887533G>A	ENST00000467963.1	-	6	826	c.660C>T	c.(658-660)acC>acT	p.T220T	BRD9_ENST00000323510.4_Silent_p.T104T|BRD9_ENST00000388890.4_Silent_p.T104T|BRD9_ENST00000483173.1_Silent_p.T167T|BRD9_ENST00000435709.2_Silent_p.T104T|BRD9_ENST00000494422.1_5'Flank	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	220	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			TGTAGTACACGGTATCTGGCC	0.448													ENSG00000028310	G|||	2	0.000399361	0.0	0.0	5008	,	,		22109	0.0		0.0	False		,,,				2504	0.002																0													208.0	197.0	201.0					5																	887533		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.660C>T	5.37:g.887533G>A			A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Silent	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.T220	ENST00000467963.1	37	c.660	CCDS34127.2	5																																																																																			-	BRD9	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain		0.448	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD9	HGNC	protein_coding	OTTHUMT00000354113.1	0	0	0	43	43	94	0.00	0.00	G	NM_023924		887533	-1	11	24	16	54	tier1	no_errors	ENST00000467963	ensembl	human	known	74_37	silent	40.74	30.77	SNP	0.120	A	11	16
SIGLEC7	27036	genome.wustl.edu	37	19	51645979	51645979	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:51645979C>T	ENST00000317643.6	+	1	422	c.353C>T	c.(352-354)gCg>gTg	p.A118V	SIGLEC7_ENST00000305628.7_Missense_Mutation_p.A118V|SIGLEC7_ENST00000600577.1_Missense_Mutation_p.A118V	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	118	Ig-like V-type.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		ATGAGTGATGCGGGGAGATAC	0.488													ENSG00000168995																																					0													98.0	97.0	97.0					19																	51645979		2203	4300	6503	SO:0001583	missense	0			-	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.353C>T	19.37:g.51645979C>T	ENSP00000323328:p.Ala118Val		Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A118V	ENST00000317643.6	37	c.353	CCDS12826.1	19	.	.	.	.	.	.	.	.	.	.	.	6.716	0.500800	0.12822	.	.	ENSG00000168995	ENST00000317643;ENST00000305628;ENST00000536156	T;T;T	0.66460	-0.21;-0.21;-0.21	2.72	-5.44	0.02624	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	11.161200	0.00357	N	0.000030	T	0.49490	0.1560	L	0.59436	1.845	0.09310	N	1	P;P;P	0.52842	0.956;0.937;0.819	B;B;B	0.30716	0.119;0.009;0.117	T	0.57370	-0.7823	10	0.46703	T	0.11	.	1.5931	0.02658	0.2013:0.2721:0.4002:0.1264	.	118;118;118	Q9Y286-4;Q9Y286-2;Q9Y286	.;.;SIGL7_HUMAN	V	118	ENSP00000323328:A118V;ENSP00000306757:A118V;ENSP00000437609:A118V	ENSP00000306757:A118V	A	+	2	0	SIGLEC7	56337791	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.173000	0.00572	-2.550000	0.00480	-1.373000	0.01185	GCG	-	SIGLEC7	-	pfam_Ig_V-set,smart_Ig_sub		0.488	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2	0	0	0	81	81	44	0.00	0.00	C	NM_016543		51645979	+1	18	11	46	47	tier1	no_errors	ENST00000317643	ensembl	human	known	74_37	missense	28.12	18.97	SNP	0.000	T	18	46
PCM1	5108	genome.wustl.edu	37	8	17849059	17849059	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:17849059G>A	ENST00000519253.1	+	28	4791	c.4540G>A	c.(4540-4542)Gtg>Atg	p.V1514M	PCM1_ENST00000524226.1_Missense_Mutation_p.V1460M|PCM1_ENST00000327578.8_Missense_Mutation_p.V213M|PCM1_ENST00000325083.8_Missense_Mutation_p.V1514M			Q15154	PCM1_HUMAN	pericentriolar material 1	1514	Interaction with HAP1.				centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AGGTAACACCGTGATTCACTT	0.323			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""								ENSG00000078674																												Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	0													70.0	63.0	65.0					8																	17849059		1896	4118	6014	SO:0001583	missense	0			-		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.4540G>A	8.37:g.17849059G>A	ENSP00000431099:p.Val1514Met		Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	NULL	p.V1514M	ENST00000519253.1	37	c.4540		8	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273265	0.59649	.	.	ENSG00000078674	ENST00000325083;ENST00000519253;ENST00000524226;ENST00000327578	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.82962	0.5151	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.994;0.999;0.999;0.997;0.999	D	0.83718	0.0191	10	0.87932	D	0	-11.7394	19.811	0.96545	0.0:0.0:1.0:0.0	.	1514;1514;321;1514;1459;1460;1514	B9EIS5;D3DSQ0;B4DJ00;E7ETA6;Q15154-2;E7EV56;Q15154	.;.;.;.;.;.;PCM1_HUMAN	M	1514;1514;1460;213	ENSP00000327077:V1514M;ENSP00000431099:V1514M;ENSP00000430521:V1460M;ENSP00000328332:V213M	ENSP00000327077:V1514M	V	+	1	0	PCM1	17893339	1.000000	0.71417	0.996000	0.52242	0.622000	0.37654	9.156000	0.94705	2.756000	0.94617	0.650000	0.86243	GTG	-	PCM1	-	NULL		0.323	PCM1-003	NOVEL	basic|exp_conf	protein_coding	PCM1	HGNC	protein_coding	OTTHUMT00000374800.1	0	0	0	67	67	60	0.00	0.00	G	NM_006197		17849059	+1	9	25	27	40	tier1	no_errors	ENST00000325083	ensembl	human	known	74_37	missense	25.00	38.46	SNP	1.000	A	9	27
OVCH2	341277	genome.wustl.edu	37	11	7712590	7712590	+	RNA	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:7712590G>T	ENST00000533663.1	-	0	267				OVCH2_ENST00000454689.1_RNA|OVCH2_ENST00000534193.2_RNA			Q7RTZ1	OVCH2_HUMAN	ovochymase 2 (gene/pseudogene)							extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(2)	15				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		ATGCTGGAGGGGCTCAGCACA	0.537													ENSG00000183378																																					0													57.0	60.0	59.0					11																	7712590		1996	4166	6162			0			-	BN000120	CCDS73251.1	11p15.4	2012-10-02	2010-06-08		ENSG00000183378	ENSG00000183378			29970	protein-coding gene	gene with protein product			"""ovochymase 2"""			12838346	Standard	XM_006718221		Approved	OVTN	uc031pyw.1	Q7RTZ1	OTTHUMG00000165418		11.37:g.7712590G>T				Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,smart_Peptidase_S1,smart_CUB_dom,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.P517T	ENST00000533663.1	37	c.1549		11	.	.	.	.	.	.	.	.	.	.	G	4.648	0.120375	0.08881	.	.	ENSG00000183378	ENST00000454689	T	0.15603	2.41	5.53	-2.13	0.07144	CUB (5);	0.551240	0.15273	N	0.271112	T	0.03520	0.0101	N	0.01235	-0.94	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37244	-0.9714	10	0.02654	T	1	0.0164	5.955	0.19269	0.3823:0.0:0.0871:0.5306	.	517	Q7RTZ1	OVCH2_HUMAN	T	517	ENSP00000407158:P517T	ENSP00000407158:P517T	P	-	1	0	OVCH2	7669166	0.023000	0.18921	0.034000	0.17996	0.858000	0.48976	-0.314000	0.08092	-0.784000	0.04528	-0.252000	0.11476	CCC	-	OVCH2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.537	OVCH2-002	KNOWN	basic	processed_transcript	OVCH2	HGNC	polymorphic_pseudogene	OTTHUMT00000383928.1	0	0	0	31	31	102	0.00	0.00	G	NM_198185		7712590	-1	9	23	25	69	tier1	no_errors	ENST00000454689	ensembl	human	known	74_37	missense	26.47	25.00	SNP	0.035	T	9	25
LRP1B	53353	genome.wustl.edu	37	2	141474275	141474275	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:141474275C>A	ENST00000389484.3	-	36	6840	c.5869G>T	c.(5869-5871)Ggg>Tgg	p.G1957W		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1957					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACAGCTATCCCTTCCACTCTT	0.388										TSP Lung(27;0.18)			ENSG00000168702																									Colon(99;50 2074 2507 20106)												0													146.0	131.0	136.0					2																	141474275		2203	4300	6503	SO:0001583	missense	0			-	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5869G>T	2.37:g.141474275C>A	ENSP00000374135:p.Gly1957Trp		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.G1957W	ENST00000389484.3	37	c.5869	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728303	0.89390	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.96745	-4.11	5.47	5.47	0.80525	Six-bladed beta-propeller, TolB-like (1);	0.071052	0.56097	U	0.000028	D	0.98789	0.9592	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.99548	1.0965	10	0.87932	D	0	.	19.3164	0.94215	0.0:1.0:0.0:0.0	.	1957	Q9NZR2	LRP1B_HUMAN	W	1957;1895	ENSP00000374135:G1957W	ENSP00000374135:G1957W	G	-	1	0	LRP1B	141190745	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.583000	0.82559	2.572000	0.86782	0.460000	0.39030	GGG	-	LRP1B	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	0	0	0	80	80	118	0.00	0.00	C	NM_018557		141474275	-1	22	29	52	110	tier1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	29.73	20.86	SNP	1.000	A	22	52
UGGT2	55757	genome.wustl.edu	37	13	96622469	96622469	+	Missense_Mutation	SNP	C	C	T	rs140859099		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr13:96622469C>T	ENST00000376747.3	-	12	1302	c.1232G>A	c.(1231-1233)cGc>cAc	p.R411H		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	411					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						CCCAAGATTGCGAAGGCCATT	0.264													ENSG00000102595																																					0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	99.0	108.0	105.0		1232	-3.6	0.1	13	dbSNP_134	105	1,8587	1.2+/-3.3	0,1,4293	no	missense	UGGT2	NM_020121.3	29	0,2,6495	TT,TC,CC		0.0116,0.0227,0.0154	benign	411/1517	96622469	2,12992	2203	4294	6497	SO:0001583	missense	0			-	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.1232G>A	13.37:g.96622469C>T	ENSP00000365938:p.Arg411His		A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.R411H	ENST00000376747.3	37	c.1232	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	C	1.763	-0.486368	0.04352	2.27E-4	1.16E-4	ENSG00000102595	ENST00000376747	T	0.26067	1.76	5.45	-3.57	0.04612	.	0.524779	0.21736	N	0.069881	T	0.05181	0.0138	N	0.00960	-1.095	0.26455	N	0.97554	B	0.06786	0.001	B	0.01281	0.0	T	0.37502	-0.9703	10	0.02654	T	1	0.2208	8.4217	0.32705	0.0:0.4956:0.1198:0.3846	.	411	Q9NYU1	UGGG2_HUMAN	H	411	ENSP00000365938:R411H	ENSP00000365938:R411H	R	-	2	0	UGGT2	95420470	0.008000	0.16893	0.133000	0.22050	0.971000	0.66376	-0.799000	0.04560	-0.570000	0.06022	0.455000	0.32223	CGC	rs140859099	UGGT2	-	NULL		0.264	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	0	0	0	107	107	69	0.00	0.00	C	NM_020121		96622469	-1	26	17	74	47	tier1	no_errors	ENST00000376747	ensembl	human	known	74_37	missense	26.00	26.56	SNP	0.148	T	26	74
LRP8	7804	genome.wustl.edu	37	1	53724100	53724100	+	Silent	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:53724100A>G	ENST00000306052.6	-	14	2201	c.2100T>C	c.(2098-2100)tgT>tgC	p.C700C	LRP8_ENST00000460214.1_5'UTR|LRP8_ENST00000354412.3_Silent_p.C571C|LRP8_ENST00000371454.2_Silent_p.C700C|LRP8_ENST00000347547.2_Silent_p.C530C|LRP8_ENST00000465675.1_Silent_p.C253C	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	700					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						ACAGGTATTCACAGCCTCCAT	0.562													ENSG00000157193																																					0													130.0	113.0	119.0					1																	53724100		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2100T>C	1.37:g.53724100A>G			B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.C700	ENST00000306052.6	37	c.2100	CCDS578.1	1																																																																																			-	LRP8	-	superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom		0.562	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	HGNC	protein_coding	OTTHUMT00000024699.1	0	0	0	25	25	36	0.00	0.00	A	NM_004631		53724100	-1	11	12	10	44	tier1	no_errors	ENST00000306052	ensembl	human	known	74_37	silent	52.38	21.43	SNP	1.000	G	11	10
RXRG	6258	genome.wustl.edu	37	1	165370516	165370516	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:165370516G>A	ENST00000359842.5	-	10	1678	c.1376C>T	c.(1375-1377)cCg>cTg	p.P459L		NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	459	Ligand-binding. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	GATCTGCAGCGGGGTCTCCAA	0.607													ENSG00000143171																																					0													85.0	83.0	84.0					1																	165370516		2203	4300	6503	SO:0001583	missense	0			-	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.1376C>T	1.37:g.165370516G>A	ENSP00000352900:p.Pro459Leu		A6NIP1|Q6IBU7	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Nuc_recep-AF1,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF	p.P459L	ENST00000359842.5	37	c.1376	CCDS1248.1	1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700413	0.88924	.	.	ENSG00000143171	ENST00000359842	D	0.92299	-3.01	4.62	4.62	0.57501	Nuclear hormone receptor, ligand-binding (1);	0.000000	0.85682	D	0.000000	D	0.94515	0.8234	M	0.62723	1.935	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.95133	0.8257	9	0.87932	D	0	.	16.1865	0.81959	0.0:0.0:1.0:0.0	.	459	P48443	RXRG_HUMAN	L	459	ENSP00000352900:P459L	ENSP00000352900:P459L	P	-	2	0	RXRG	163637140	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	9.291000	0.96070	2.377000	0.81083	0.555000	0.69702	CCG	-	RXRG	-	superfamily_Nucl_hormone_rcpt_ligand-bd		0.607	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRG	HGNC	protein_coding	OTTHUMT00000083794.2	0	0	0	117	117	31	0.00	0.00	G	NM_006917		165370516	-1	25	11	62	17	tier1	no_errors	ENST00000359842	ensembl	human	known	74_37	missense	28.74	39.29	SNP	1.000	A	25	62
DIXDC1	85458	genome.wustl.edu	37	11	111808168	111808168	+	5'UTR	SNP	A	A	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:111808168A>C	ENST00000531396.1	+	0	18				DIXDC1_ENST00000529225.1_Intron|DIXDC1_ENST00000440460.2_5'UTR|DIXDC1_ENST00000389821.4_3'UTR			Q155Q3	DIXC1_HUMAN	DIX domain containing 1						camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		GAGGAGGAGGAGGCGGCGGCG	0.657													ENSG00000150764																																					0													10.0	16.0	14.0					11																	111808168		691	1588	2279	SO:0001623	5_prime_UTR_variant	0			-	AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000531396.1:c.-56A>C	11.37:g.111808168A>C			A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	R	SNP	-	NULL	ENST00000531396.1	37	NULL		11																																																																																			-	DIXDC1	-	-		0.657	DIXDC1-003	KNOWN	basic	protein_coding	DIXDC1	HGNC	protein_coding	OTTHUMT00000391835.1	0	0	0	25	25	13	0.00	0.00	A	NM_001037954		111808168	+1	5	3	14	19	tier1	no_errors	ENST00000389821	ensembl	human	known	74_37	rna	26.32	13.64	SNP	0.085	C	5	14
DHX37	57647	genome.wustl.edu	37	12	125461958	125461958	+	Missense_Mutation	SNP	C	C	T	rs376228891		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:125461958C>T	ENST00000308736.2	-	5	915	c.817G>A	c.(817-819)Gtg>Atg	p.V273M	DHX37_ENST00000544745.1_Missense_Mutation_p.V60M	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	273	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		TCACCACACACGATGACGATG	0.572													ENSG00000150990																																					0								C	MET/VAL	0,4406		0,0,2203	110.0	97.0	101.0		817	1.3	1.0	12		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	DHX37	NM_032656.3	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	273/1158	125461958	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.817G>A	12.37:g.125461958C>T	ENSP00000311135:p.Val273Met		Q9BUI7|Q9P211	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_D/R_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V273M	ENST00000308736.2	37	c.817	CCDS9261.1	12	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906795	0.33628	0.0	1.16E-4	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.03607	3.87;3.87	5.23	1.26	0.21427	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.369343	0.28889	N	0.013817	T	0.12689	0.0308	M	0.86343	2.81	0.43698	D	0.996151	D	0.63046	0.992	D	0.63793	0.918	T	0.02424	-1.1161	10	0.87932	D	0	-14.8683	1.0324	0.01541	0.1631:0.3901:0.1601:0.2867	.	273	Q8IY37	DHX37_HUMAN	M	273;60	ENSP00000311135:V273M;ENSP00000439009:V60M	ENSP00000311135:V273M	V	-	1	0	DHX37	124027911	1.000000	0.71417	0.999000	0.59377	0.036000	0.12997	0.728000	0.26013	0.582000	0.29556	-0.282000	0.10007	GTG	-	DHX37	-	pfam_D/R_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.572	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX37	HGNC	protein_coding		0	0	0	42	42	60	0.00	0.00	C	NM_032656		125461958	-1	9	12	27	49	tier1	no_errors	ENST00000308736	ensembl	human	known	74_37	missense	25.00	19.35	SNP	0.976	T	9	27
PAPD4	167153	genome.wustl.edu	37	5	78944893	78944893	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:78944893C>T	ENST00000296783.3	+	11	1206	c.907C>T	c.(907-909)Cga>Tga	p.R303*	PAPD4_ENST00000453514.1_Nonsense_Mutation_p.R303*|PAPD4_ENST00000504233.1_Intron|PAPD4_ENST00000428308.2_Nonsense_Mutation_p.R303*|PAPD4_ENST00000423041.2_Nonsense_Mutation_p.R299*			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	303					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		AGTTGAAAATCGAGTTCGTCC	0.363													ENSG00000164329																																					0													107.0	102.0	104.0					5																	78944893		2203	4300	6503	SO:0001587	stop_gained	0			-	AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.907C>T	5.37:g.78944893C>T	ENSP00000296783:p.Arg303*		Q86WZ2|Q8N927	Nonsense_Mutation	SNP	pfam_PAP_assoc	p.R303*	ENST00000296783.3	37	c.907	CCDS4048.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.462959	0.99178	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000428308;ENST00000296783	.	.	.	5.86	5.86	0.93980	.	0.117372	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.2003	19.7843	0.96430	0.0:1.0:0.0:0.0	.	.	.	.	X	303;299;303;303	.	ENSP00000296783:R303X	R	+	1	2	PAPD4	78980649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.891000	0.56227	2.774000	0.95407	0.585000	0.79938	CGA	-	PAPD4	-	NULL		0.363	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD4	HGNC	protein_coding	OTTHUMT00000226967.1	0	0	1	82	82	99	0.00	1.00	C	NM_173797		78944893	+1	28	23	62	77	tier1	no_errors	ENST00000296783	ensembl	human	known	74_37	nonsense	30.43	23.00	SNP	1.000	T	28	62
PLXNA1	5361	genome.wustl.edu	37	3	126748378	126748378	+	Splice_Site	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:126748378C>T	ENST00000393409.2	+	26	4869	c.4869C>T	c.(4867-4869)taC>taT	p.Y1623Y	PLXNA1_ENST00000251772.4_Splice_Site_p.Y1600Y	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1623					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TCAGCAGATACGGTGAGGGGC	0.682													ENSG00000114554																																					0													101.0	90.0	94.0					3																	126748378		2203	4300	6503	SO:0001630	splice_region_variant	0			-	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.4870+1C>T	3.37:g.126748378C>T				Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.Y1623	ENST00000393409.2	37	c.4869	CCDS33847.2	3																																																																																			-	PLX1	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot		0.682	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLX1	HGNC	protein_coding	OTTHUMT00000356451.1	0	0	0	51	51	80	0.00	0.00	C	NM_032242	Silent	126748378	+1	11	16	44	56	tier1	no_errors	ENST00000393409	ensembl	human	known	74_37	silent	20.00	22.22	SNP	0.967	T	11	44
KCNQ2	3785	genome.wustl.edu	37	20	62046292	62046292	+	Missense_Mutation	SNP	G	G	A	rs540461827		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:62046292G>A	ENST00000359125.2	-	13	1663	c.1489C>T	c.(1489-1491)Cgc>Tgc	p.R497C	KCNQ2_ENST00000357249.2_Missense_Mutation_p.R479C|KCNQ2_ENST00000344462.4_Missense_Mutation_p.R467C|KCNQ2_ENST00000370224.1_Missense_Mutation_p.R469C|KCNQ2_ENST00000359689.1_Missense_Mutation_p.R497C|KCNQ2_ENST00000354587.3_Missense_Mutation_p.R469C|KCNQ2_ENST00000360480.3_Missense_Mutation_p.R469C	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	497					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CCCTTGATGCGGAAAGCCTGG	0.677													ENSG00000075043	G|||	1	0.000199681	0.0	0.0	5008	,	,		12203	0.0		0.0	False		,,,				2504	0.001																0													68.0	78.0	74.0					20																	62046292		2203	4300	6503	SO:0001583	missense	0			-	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1489C>T	20.37:g.62046292G>A	ENSP00000352035:p.Arg497Cys		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.R469C	ENST00000359125.2	37	c.1405	CCDS13520.1	20	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917228	0.52546	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222	D;D;D;D;D;D;D;D;D;D	0.99741	-6.6;-6.6;-6.6;-6.6;-6.6;-6.6;-6.6;-6.6;-6.6;-6.6	5.15	5.15	0.70609	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.063176	0.64402	D	0.000015	D	0.99597	0.9854	M	0.71206	2.165	0.80722	D	1	B;B;B;D	0.89917	0.14;0.14;0.268;1.0	B;B;B;D	0.65874	0.016;0.023;0.024;0.939	D	0.98096	1.0412	10	0.87932	D	0	0.0067	18.5933	0.91222	0.0:0.0:1.0:0.0	.	469;479;467;497	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	C	479;497;467;469;497;467;469;457;469;469	ENSP00000349789:R479C;ENSP00000352035:R497C;ENSP00000359246:R467C;ENSP00000346601:R469C;ENSP00000352718:R497C;ENSP00000399612:R467C;ENSP00000353668:R469C;ENSP00000339611:R457C;ENSP00000359244:R469C;ENSP00000359242:R469C	ENSP00000339611:R457C	R	-	1	0	KCNQ2	61516736	1.000000	0.71417	0.999000	0.59377	0.723000	0.41478	3.733000	0.55029	2.390000	0.81377	0.478000	0.44815	CGC	-	KCNQ2	-	pfam_K_chnl_volt-dep_KCNQ_C		0.677	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	KCNQ2	HGNC	protein_coding	OTTHUMT00000080353.1	0	0	0	86	86	33	0.00	0.00	G	NM_172109		62046292	-1	18	7	32	14	tier1	no_errors	ENST00000354587	ensembl	human	known	74_37	missense	36.00	33.33	SNP	1.000	A	18	32
BTRC	8945	genome.wustl.edu	37	10	103291028	103291028	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:103291028G>A	ENST00000370187.3	+	7	896	c.778G>A	c.(778-780)Ggg>Agg	p.G260R	BTRC_ENST00000408038.2_Missense_Mutation_p.G224R|BTRC_ENST00000393441.4_Missense_Mutation_p.G219R	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	260					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G260W(3)		endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		ACCTCCTGACGGGAATGCTCC	0.313													ENSG00000166167																																					3	Substitution - Missense(3)	lung(3)											96.0	108.0	104.0					10																	103291028		2203	4300	6503	SO:0001583	missense	0			-	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.778G>A	10.37:g.103291028G>A	ENSP00000359206:p.Gly260Arg		B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Beta-TrCP_D,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G260R	ENST00000370187.3	37	c.778	CCDS7512.1	10	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836802	0.50951	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.22134	1.97;1.97;1.97	5.44	5.44	0.79542	F-box domain, Skp2-like (1);	0.071942	0.56097	D	0.000021	T	0.16981	0.0408	L	0.34521	1.04	0.53005	D	0.999969	B;P;B	0.42827	0.029;0.791;0.296	B;B;B	0.35607	0.011;0.206;0.106	T	0.04565	-1.0942	10	0.18710	T	0.47	-6.4172	19.2602	0.93964	0.0:0.0:1.0:0.0	.	234;224;260	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	R	260;219;224	ENSP00000359206:G260R;ENSP00000377088:G219R;ENSP00000385339:G224R	ENSP00000359206:G260R	G	+	1	0	BTRC	103281018	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	5.853000	0.69496	2.552000	0.86080	0.484000	0.47621	GGG	-	BTRC	-	superfamily_F-box_dom		0.313	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTRC	HGNC	protein_coding	OTTHUMT00000049936.1	0	0	0	92	92	120	0.00	0.00	G	NM_033637		103291028	+1	27	40	91	84	tier1	no_errors	ENST00000370187	ensembl	human	known	74_37	missense	22.88	32.26	SNP	1.000	A	27	91
CDHR5	53841	genome.wustl.edu	37	11	619384	619384	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:619384C>T	ENST00000358353.3	-	13	1622	c.1300G>A	c.(1300-1302)Gcc>Acc	p.A434T	CDHR5_ENST00000349570.7_Missense_Mutation_p.A434T|CDHR5_ENST00000397542.2_Missense_Mutation_p.A434T			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	434	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						GTGTTGTGGGCCTCAACCTGG	0.612													ENSG00000099834																																					0													66.0	65.0	65.0					11																	619384		2203	4299	6502	SO:0001583	missense	0			-	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1300G>A	11.37:g.619384C>T	ENSP00000351118:p.Ala434Thr		C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	p.A434T	ENST00000358353.3	37	c.1300	CCDS7707.1	11	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861160	0.71949	.	.	ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000349570	T;T;T	0.27104	1.69;1.69;1.69	3.73	3.73	0.42828	Cadherin (2);	.	.	.	.	T	0.37598	0.1009	L	0.34521	1.04	0.23298	N	0.997954	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.71870	0.964;0.975;0.964	T	0.09314	-1.0680	9	0.66056	D	0.02	-37.4316	11.2174	0.48833	0.0:1.0:0.0:0.0	.	434;434;434	Q9HBB8-4;Q9HBB8-2;Q9HBB8	.;.;CDHR5_HUMAN	T	434	ENSP00000380676:A434T;ENSP00000351118:A434T;ENSP00000345726:A434T	ENSP00000345726:A434T	A	-	1	0	CDHR5	609384	0.970000	0.33590	0.388000	0.26195	0.007000	0.05969	2.167000	0.42415	2.087000	0.62958	0.462000	0.41574	GCC	-	CDHR5	-	superfamily_Cadherin-like,pfscan_Cadherin		0.612	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR5	HGNC	protein_coding	OTTHUMT00000255023.2	0	0	0	70	70	82	0.00	0.00	C	NM_021924		619384	-1	17	23	80	65	tier1	no_errors	ENST00000358353	ensembl	human	known	74_37	missense	17.53	26.14	SNP	0.533	T	17	80
POTEF	728378	genome.wustl.edu	37	2	130877846	130877846	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:130877846G>A	ENST00000409914.2	-	3	642	c.243C>T	c.(241-243)ggC>ggT	p.G81G	POTEF_ENST00000357462.5_Silent_p.G81G|POTEF_ENST00000360967.5_Silent_p.G81G|POTEF_ENST00000361163.4_Silent_p.G81G	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	81					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTCCAGAAGCGCCCACGTTGC	0.597													ENSG00000196604																																					0													92.0	122.0	112.0					2																	130877846		2202	4295	6497	SO:0001819	synonymous_variant	0			-	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.243C>T	2.37:g.130877846G>A			A6NC34	Silent	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.G81	ENST00000409914.2	37	c.243	CCDS46409.1	2																																																																																			-	POTEF	-	NULL		0.597	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	0	0	0	143	143	25	0.00	0.00	G	NM_001099771		130877846	-1	23	5	82	17	tier1	no_errors	ENST00000357462	ensembl	human	known	74_37	silent	21.70	22.73	SNP	0.002	A	23	82
TMPRSS7	344805	genome.wustl.edu	37	3	111769565	111769565	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:111769565A>G	ENST00000452346.2	+	9	1141	c.1138A>G	c.(1138-1140)Aaa>Gaa	p.K380E	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.K254E			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	380	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CTTTGAAGGGAAAATTTCAAG	0.403													ENSG00000176040																																					0													213.0	197.0	202.0					3																	111769565		1848	4092	5940	SO:0001583	missense	0			-	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1138A>G	3.37:g.111769565A>G	ENSP00000398236:p.Lys380Glu		C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.K254E	ENST00000452346.2	37	c.760		3	.	.	.	.	.	.	.	.	.	.	A	14.26	2.482995	0.44147	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	T;T	0.32988	1.43;1.43	4.86	4.86	0.63082	CUB (4);	0.303860	0.31577	N	0.007403	T	0.20251	0.0487	N	0.22421	0.69	0.27112	N	0.962343	P;B	0.35656	0.514;0.228	B;B	0.36030	0.216;0.083	T	0.12344	-1.0551	10	0.15499	T	0.54	.	12.2556	0.54621	1.0:0.0:0.0:0.0	.	380;254	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	E	380;368;354;254	ENSP00000398236:K380E;ENSP00000411645:K254E	ENSP00000411645:K254E	K	+	1	0	TMPRSS7	113252255	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.614000	0.61183	1.946000	0.56461	0.377000	0.23210	AAA	-	TMPRSS7	-	pfam_CUB_dom,superfamily_CUB_dom,pfscan_CUB_dom		0.403	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	TMPRSS7	HGNC	protein_coding	OTTHUMT00000347592.2	0	0	0	102	102	122	0.00	0.00	A	XM_293599		111769565	+1	28	39	67	101	tier1	no_errors	ENST00000419127	ensembl	human	known	74_37	missense	29.47	27.86	SNP	1.000	G	28	67
FAM124A	220108	genome.wustl.edu	37	13	51825713	51825713	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr13:51825713G>A	ENST00000322475.8	+	3	345	c.210G>A	c.(208-210)gcG>gcA	p.A70A	FAM124A_ENST00000280057.6_Silent_p.A106A	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	70										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		ACGTCCTGGCGTGGATCCACC	0.697													ENSG00000150510																																					0													24.0	21.0	22.0					13																	51825713		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.210G>A	13.37:g.51825713G>A			A2A324|Q8N8P9|Q8NE66|Q96NJ9	Silent	SNP	NULL	p.A106	ENST00000322475.8	37	c.318	CCDS55900.1	13																																																																																			-	FAM124A	-	NULL		0.697	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM124A	HGNC	protein_coding	OTTHUMT00000045019.3	0	0	0	21	21	28	0.00	0.00	G	NM_145019		51825713	+1	4	7	22	20	tier1	no_errors	ENST00000280057	ensembl	human	known	74_37	silent	15.38	25.93	SNP	0.029	A	4	22
MR1	3140	genome.wustl.edu	37	1	181018220	181018220	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:181018220G>A	ENST00000367580.5	+	2	105	c.100G>A	c.(100-102)Gtt>Att	p.V34I	MR1_ENST00000282990.6_Missense_Mutation_p.V34I|MR1_ENST00000438435.2_3'UTR|MR1_ENST00000434571.2_Missense_Mutation_p.V34I|MR1_ENST00000367579.3_Missense_Mutation_p.V34I	NM_001531.2	NP_001522.1	Q95460	HMR1_HUMAN	major histocompatibility complex, class I-related	34	Alpha-1.|Ligand-binding.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	MHC class I receptor activity (GO:0032393)|peptide antigen binding (GO:0042605)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	18					Antithymocyte globulin(DB00098)	TCGCCTGGGCGTTTCGGATCC	0.517													ENSG00000153029																									Colon(174;1412 1962 45296 46549 47110)												0													47.0	48.0	48.0					1																	181018220		2203	4299	6502	SO:0001583	missense	0			-	AF010446	CCDS1342.1, CCDS53440.1, CCDS53441.1, CCDS53442.1	1q25.3	2013-01-11	2003-03-05	2003-03-07	ENSG00000153029	ENSG00000153029		"""Immunoglobulin superfamily / C1-set domain containing"""	4975	protein-coding gene	gene with protein product		600764	"""major histocompatibility complex, class I-like sequence"""	HLALS		7624800, 9784382	Standard	NM_001194999		Approved		uc001goq.2	Q95460	OTTHUMG00000035175	ENST00000367580.5:c.100G>A	1.37:g.181018220G>A	ENSP00000356552:p.Val34Ile		A8K2V9|B4E3B1|O97985|O97986|Q53GM1|Q95HB8|Q9MY23|Q9NPL2|Q9TQB3|Q9TQB9|Q9TQK3	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.V34I	ENST00000367580.5	37	c.100	CCDS1342.1	1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664967	0.29604	.	.	ENSG00000153029	ENST00000434571;ENST00000367580;ENST00000282990;ENST00000367579	T;T;T;T	0.01005	5.45;5.45;5.45;5.45	4.78	-8.9	0.00782	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	2.214490	0.01953	N	0.042827	T	0.01029	0.0034	L	0.39692	1.235	0.23743	N	0.996966	B;B;B;B;B	0.20780	0.006;0.048;0.006;0.008;0.002	B;B;B;B;B	0.19148	0.004;0.024;0.006;0.01;0.003	T	0.44251	-0.9340	9	0.87932	D	0	.	7.9448	0.29980	0.5072:0.3333:0.1596:0.0	.	34;34;34;34;34	B4E3B1;Q95460-3;Q95460-2;Q95460;Q95460-4	.;.;.;HMR1_HUMAN;.	I	34	ENSP00000388504:V34I;ENSP00000356552:V34I;ENSP00000282990:V34I;ENSP00000356551:V34I	ENSP00000282990:V34I	V	+	1	0	MR1	179284843	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-0.877000	0.04197	-1.494000	0.01833	-1.200000	0.01667	GTT	-	MR1	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog		0.517	MR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MR1	HGNC	protein_coding	OTTHUMT00000085134.2	0	0	0	58	58	32	0.00	0.00	G	NM_001531		181018220	+1	15	14	40	27	tier1	no_errors	ENST00000367580	ensembl	human	known	74_37	missense	27.27	34.15	SNP	0.000	A	15	40
EPC1	80314	genome.wustl.edu	37	10	32580192	32580192	+	Missense_Mutation	SNP	G	G	A	rs377321302		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:32580192G>A	ENST00000263062.8	-	6	1143	c.874C>T	c.(874-876)Cca>Tca	p.P292S	EPC1_ENST00000319778.6_Missense_Mutation_p.P292S|EPC1_ENST00000375110.2_Missense_Mutation_p.P242S	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	292					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GGTTTCATTGGCTGTCTCTGT	0.338													ENSG00000120616																																					0								G	SER/PRO	0,4406		0,0,2203	123.0	118.0	119.0		874	4.7	1.0	10		119	1,8599	1.2+/-3.3	0,1,4299	no	missense	EPC1	NM_025209.2	74	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	292/837	32580192	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.874C>T	10.37:g.32580192G>A	ENSP00000263062:p.Pro292Ser		B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.P292S	ENST00000263062.8	37	c.874	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402984	0.42613	0.0	1.16E-4	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.65364	-0.15;-0.15;-0.15	5.62	4.7	0.59300	.	0.110120	0.64402	D	0.000004	T	0.50326	0.1609	L	0.28458	0.855	0.45307	D	0.998306	B;P;B;B	0.47302	0.006;0.893;0.375;0.068	B;B;B;B	0.41510	0.01;0.359;0.236;0.04	T	0.44967	-0.9293	10	0.16896	T	0.51	-2.2351	16.0665	0.80887	0.0:0.0:0.8648:0.1352	.	292;242;292;292	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	S	242;292;292	ENSP00000364251:P242S;ENSP00000318559:P292S;ENSP00000263062:P292S	ENSP00000263062:P292S	P	-	1	0	EPC1	32620198	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	7.291000	0.78721	1.471000	0.48121	0.467000	0.42956	CCA	-	EPC1	-	NULL		0.338	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	HGNC	protein_coding	OTTHUMT00000047484.1	0	0	1	132	132	60	0.00	1.64	G			32580192	-1	38	20	54	39	tier1	no_errors	ENST00000263062	ensembl	human	known	74_37	missense	41.30	33.90	SNP	1.000	A	38	54
ARHGEF2	9181	genome.wustl.edu	37	1	155931509	155931509	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:155931509G>A	ENST00000361247.4	-	11	1510	c.1411C>T	c.(1411-1413)Cgc>Tgc	p.R471C	ARHGEF2_ENST00000368316.1_Missense_Mutation_p.R443C|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.R516C|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.R472C|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.R443C|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.R470C	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	471					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					ATGAGTTTGCGCCTCAGAAGT	0.602													ENSG00000116584																									Melanoma(178;35 2768 6610 28839)												0													68.0	66.0	67.0					1																	155931509		2203	4300	6503	SO:0001583	missense	0			-	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1411C>T	1.37:g.155931509G>A	ENSP00000354837:p.Arg471Cys		D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.R472C	ENST00000361247.4	37	c.1414	CCDS53376.1	1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722804	0.68959	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88	4.95	4.01	0.46588	Pleckstrin homology-type (1);	0.000000	0.44902	D	0.000416	T	0.76499	0.3996	L	0.55481	1.735	0.54753	D	0.999989	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.996;1.0	T	0.79748	-0.1673	10	0.87932	D	0	-19.7999	10.3279	0.43805	0.0:0.0:0.6282:0.3718	.	515;471;470	D3DVA5;Q92974;Q92974-2	.;ARHG2_HUMAN;.	C	443;471;472;443;470	ENSP00000315325:R443C;ENSP00000354837:R471C;ENSP00000357298:R472C;ENSP00000357299:R443C;ENSP00000314787:R470C	ENSP00000314787:R470C	R	-	1	0	ARHGEF2	154198133	0.313000	0.24554	1.000000	0.80357	0.950000	0.60333	0.789000	0.26886	1.378000	0.46305	0.655000	0.94253	CGC	-	ARHGEF2	-	NULL		0.602	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	0	0	0	34	34	42	0.00	0.00	G	NM_004723		155931509	-1	8	11	20	38	tier1	no_errors	ENST00000368315	ensembl	human	known	74_37	missense	28.57	22.45	SNP	0.992	A	8	20
GBF1	8729	genome.wustl.edu	37	10	104126938	104126938	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:104126938C>T	ENST00000369983.3	+	20	2787	c.2527C>T	c.(2527-2529)Cgt>Tgt	p.R843C		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	843	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CCACAATGTTCGTAAACAGAA	0.498													ENSG00000107862																																					0													190.0	167.0	174.0					10																	104126938		2203	4300	6503	SO:0001583	missense	0			-	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2527C>T	10.37:g.104126938C>T	ENSP00000359000:p.Arg843Cys		Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.R843C	ENST00000369983.3	37	c.2527	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	C	27.2	4.809073	0.90707	.	.	ENSG00000107862	ENST00000369983	T	0.55930	0.49	5.47	4.54	0.55810	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.048630	0.85682	D	0.000000	T	0.74627	0.3741	M	0.84219	2.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.993;0.986	T	0.79911	-0.1603	10	0.87932	D	0	-11.9262	16.1117	0.81270	0.0:0.8659:0.1341:0.0	.	843;843;843	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	C	843	ENSP00000359000:R843C	ENSP00000359000:R843C	R	+	1	0	GBF1	104116928	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	1.258000	0.44101	0.563000	0.77884	CGT	-	GBF1	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom		0.498	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	HGNC	protein_coding	OTTHUMT00000050051.1	0	0	0	47	47	147	0.00	0.00	C			104126938	+1	7	37	27	137	tier1	no_errors	ENST00000369983	ensembl	human	known	74_37	missense	20.00	21.26	SNP	1.000	T	7	27
AMPD1	270	genome.wustl.edu	37	1	115226834	115226834	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:115226834T>C	ENST00000520113.2	-	5	647	c.632A>G	c.(631-633)gAg>gGg	p.E211G	AMPD1_ENST00000369538.3_Missense_Mutation_p.E207G|AMPD1_ENST00000353928.6_Missense_Mutation_p.E178G			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	211					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	ATAGAAGCTCTCATTTGCTAC	0.338													ENSG00000116748																																					0													107.0	100.0	102.0					1																	115226834		2203	4300	6503	SO:0001583	missense	0			-	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.632A>G	1.37:g.115226834T>C	ENSP00000430075:p.Glu211Gly		A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.E211G	ENST00000520113.2	37	c.632	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690976	0.48097	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	T;T;T	0.35236	1.32;1.32;1.32	5.72	5.72	0.89469	.	0.047565	0.85682	D	0.000000	T	0.23572	0.0570	M	0.61703	1.905	0.58432	D	0.999995	P;B	0.40144	0.704;0.004	B;B	0.36719	0.231;0.002	T	0.04307	-1.0961	10	0.27785	T	0.31	-23.1886	16.0011	0.80292	0.0:0.0:0.0:1.0	.	207;178	Q5TF02;P23109	.;AMPD1_HUMAN	G	211;207;178	ENSP00000430075:E211G;ENSP00000358551:E207G;ENSP00000316520:E178G	ENSP00000316520:E178G	E	-	2	0	AMPD1	115028357	1.000000	0.71417	0.854000	0.33618	0.544000	0.35116	7.591000	0.82666	2.177000	0.69029	0.528000	0.53228	GAG	-	AMPD1	-	pirsf_AMP_deaminase,tigrfam_AMP_deaminase		0.338	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	0	0	0	121	121	130	0.00	0.00	T			115226834	-1	24	32	82	78	tier1	no_errors	ENST00000520113	ensembl	human	known	74_37	missense	22.64	29.09	SNP	0.997	C	24	82
ARPC1B	10095	genome.wustl.edu	37	7	98988806	98988806	+	Missense_Mutation	SNP	C	C	T	rs369966813		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:98988806C>T	ENST00000451682.1	+	9	1022	c.713C>T	c.(712-714)gCg>gTg	p.A238V	ARPC1B_ENST00000252725.5_Missense_Mutation_p.A238V|PDAP1_ENST00000496335.1_5'Flank			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	238					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CTCAGCGTCGCGACTCTGGCC	0.622													ENSG00000130429	C|||	1	0.000199681	0.0	0.0	5008	,	,		18764	0.0		0.0	False		,,,				2504	0.001																0								C	VAL/ALA	0,4406		0,0,2203	97.0	73.0	81.0		713	5.6	0.0	7		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	ARPC1B	NM_005720.3	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	238/373	98988806	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.713C>T	7.37:g.98988806C>T	ENSP00000389631:p.Ala238Val		Q9BU00	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A238V	ENST00000451682.1	37	c.713	CCDS5661.1	7	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946646	0.53186	0.0	1.16E-4	ENSG00000130429	ENST00000252725;ENST00000451682	T;T	0.67171	-0.25;-0.25	5.59	5.59	0.84812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.325006	0.37577	N	0.002034	T	0.47507	0.1449	N	0.14661	0.345	0.34817	D	0.738346	B;B	0.31227	0.314;0.314	B;B	0.18561	0.022;0.022	T	0.54302	-0.8314	10	0.13853	T	0.58	-16.62	18.3563	0.90358	0.0:1.0:0.0:0.0	.	238;238	A4D275;O15143	.;ARC1B_HUMAN	V	238	ENSP00000252725:A238V;ENSP00000389631:A238V	ENSP00000252725:A238V	A	+	2	0	ARPC1B	98826742	0.323000	0.24643	0.014000	0.15608	0.825000	0.46686	2.976000	0.49289	2.636000	0.89361	0.561000	0.74099	GCG	-	ARPC1B	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1		0.622	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARPC1B	HGNC	protein_coding	OTTHUMT00000335894.1	0	0	0	26	26	59	0.00	0.00	C	NM_005720		98988806	+1	4	14	27	55	tier1	no_errors	ENST00000252725	ensembl	human	known	74_37	missense	12.90	20.29	SNP	0.794	T	4	27
KIAA1429	25962	genome.wustl.edu	37	8	95504027	95504027	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:95504027C>T	ENST00000297591.5	-	22	4994	c.4919G>A	c.(4918-4920)cGt>cAt	p.R1640H	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1640					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TTTTCTCTGACGAAAAATATC	0.453													ENSG00000164944																																					0													159.0	145.0	150.0					8																	95504027		2203	4300	6503	SO:0001583	missense	0			-	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.4919G>A	8.37:g.95504027C>T	ENSP00000297591:p.Arg1640His		Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R1640H	ENST00000297591.5	37	c.4919	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.267788	0.95399	.	.	ENSG00000164944	ENST00000297591	D	0.86097	-2.07	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.92645	0.7663	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.93199	0.6590	10	0.87932	D	0	-11.8833	19.3054	0.94161	0.0:1.0:0.0:0.0	.	1640	Q69YN4	VIR_HUMAN	H	1640	ENSP00000297591:R1640H	ENSP00000297591:R1640H	R	-	2	0	KIAA1429	95573203	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.568000	0.86640	0.650000	0.86243	CGT	-	KIAA1429	-	NULL		0.453	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2	0	0	0	115	115	74	0.00	0.00	C	NM_015496		95504027	-1	41	19	96	46	tier1	no_errors	ENST00000297591	ensembl	human	known	74_37	missense	29.93	29.23	SNP	1.000	T	41	96
ACAN	176	genome.wustl.edu	37	15	89391218	89391218	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:89391218C>T	ENST00000561243.1	+	8	1681	c.1681C>T	c.(1681-1683)Cgc>Tgc	p.R561C	ACAN_ENST00000559004.1_Missense_Mutation_p.R561C|ACAN_ENST00000558207.1_Missense_Mutation_p.R561C|ACAN_ENST00000439576.2_Missense_Mutation_p.R561C|ACAN_ENST00000352105.7_Missense_Mutation_p.R561C			P16112	PGCA_HUMAN	aggrecan	561	G2-B.|Link 3. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CTATGGCGTGCGCCCATCAAC	0.582													ENSG00000157766																																					0													114.0	121.0	119.0					15																	89391218		1993	4165	6158	SO:0001583	missense	0			-	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.1681C>T	15.37:g.89391218C>T	ENSP00000453342:p.Arg561Cys		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.R561C	ENST00000561243.1	37	c.1681	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023625	0.54683	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.14266	2.52;2.52	5.35	4.38	0.52667	.	.	.	.	.	T	0.44746	0.1308	M	0.92459	3.31	0.54753	D	0.999988	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.995	T	0.54098	-0.8344	9	0.72032	D	0.01	-16.0762	11.904	0.52701	0.1739:0.826:0.0:0.0	.	561;561;561	E7ENV9;E7EX88;Q6PID9	.;.;.	C	561	ENSP00000387356:R561C;ENSP00000341615:R561C	ENSP00000268134:R561C	R	+	1	0	ACAN	87192222	1.000000	0.71417	0.955000	0.39395	0.759000	0.43091	1.613000	0.36900	2.518000	0.84900	0.563000	0.77884	CGC	-	ACAN	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link		0.582	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	0	0	0	43	43	49	0.00	0.00	C	NM_001135		89391218	+1	12	15	27	57	tier1	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	30.77	20.83	SNP	1.000	T	12	27
FMOD	2331	genome.wustl.edu	37	1	203316599	203316599	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:203316599G>A	ENST00000354955.4	-	2	1263	c.800C>T	c.(799-801)gCg>gTg	p.A267V	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	267					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			CAGCTTGGGCGCCCCCCGGAA	0.577													ENSG00000122176																																					0																																										SO:0001583	missense	0			-	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.800C>T	1.37:g.203316599G>A	ENSP00000347041:p.Ala267Val		Q15331|Q8IV47	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.A267V	ENST00000354955.4	37	c.800	CCDS30976.1	1	.	.	.	.	.	.	.	.	.	.	G	8.238	0.806281	0.16467	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.56776	0.44	5.18	5.18	0.71444	.	0.453471	0.23893	N	0.043529	T	0.26846	0.0657	N	0.01771	-0.73	0.09310	N	1	B	0.20261	0.043	B	0.18263	0.021	T	0.15492	-1.0435	10	0.36615	T	0.2	-11.572	12.3941	0.55374	0.0:0.0:0.8318:0.1682	.	267	Q06828	FMOD_HUMAN	V	254;267	ENSP00000347041:A267V	ENSP00000347041:A267V	A	-	2	0	FMOD	201583222	0.105000	0.21958	0.058000	0.19502	0.892000	0.51952	1.745000	0.38278	2.414000	0.81942	0.655000	0.94253	GCG	-	FMOD	-	NULL		0.577	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMOD	HGNC	protein_coding	OTTHUMT00000087472.1	0	0	0	57	57	94	0.00	0.00	G	NM_002023		203316599	-1	23	58	50	90	tier1	no_errors	ENST00000354955	ensembl	human	known	74_37	missense	31.51	39.19	SNP	0.002	A	23	50
TPGS1	91978	genome.wustl.edu	37	19	507660	507660	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:507660C>T	ENST00000359315.5	+	1	362	c.154C>T	c.(154-156)Ctg>Ttg	p.L52L	AC005775.2_ENST00000592413.1_RNA	NM_033513.2	NP_277048.2	Q6ZTW0	TPGS1_HUMAN	tubulin polyglutamylase complex subunit 1	52					adult behavior (GO:0030534)|multicellular organismal development (GO:0007275)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|synaptic transmission (GO:0007268)|vesicle localization (GO:0051648)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)	tubulin-glutamic acid ligase activity (GO:0070740)										ACGTGCGGCCCTGCTGAAGGT	0.711													ENSG00000141933																																					0													7.0	12.0	10.0					19																	507660		1899	4032	5931	SO:0001819	synonymous_variant	0			-	BC009520	CCDS42454.1	19p13.3	2011-11-23	2011-11-23	2011-11-23	ENSG00000141933	ENSG00000141933			25058	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 20"""	C19orf20		11441184, 12972506	Standard	NM_033513		Approved	GTRGEO22, PGs1	uc002lou.3	Q6ZTW0		ENST00000359315.5:c.154C>T	19.37:g.507660C>T			Q96GE2	Silent	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.L52	ENST00000359315.5	37	c.154	CCDS42454.1	19																																																																																			-	TPGS1	-	superfamily_cAMP_dep_PK_reg_su_I/II_a/b		0.711	TPGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPGS1	HGNC	protein_coding	OTTHUMT00000451887.2	0	0	0	34	34	17	0.00	0.00	C	NM_033513		507660	+1	7	4	23	14	tier1	no_errors	ENST00000359315	ensembl	human	known	74_37	silent	23.33	22.22	SNP	1.000	T	7	23
KRT16P6	353194	genome.wustl.edu	37	17	16725746	16725746	+	RNA	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:16725746C>T	ENST00000417510.1	-	0	147																											atgccgcccccgatgccgcAG	0.692													ENSG00000226145																																					0																																												0			-																													17.37:g.16725746C>T				R	SNP	-	NULL	ENST00000417510.1	37	NULL		17																																																																																			-	AC022596.6	-	-		0.692	AC022596.6-002	KNOWN	basic	processed_transcript	ENSG00000226145	Clone_based_vega_gene	pseudogene	OTTHUMT00000131123.1	0	0	0	137	137	22	0.00	0.00	C			16725746	-1	29	4	55	11	tier1	no_errors	ENST00000417510	ensembl	human	known	74_37	rna	34.52	26.67	SNP	0.013	T	29	55
KIAA1211	57482	genome.wustl.edu	37	4	57164406	57164406	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:57164406G>A	ENST00000504228.1	+	2	116	c.11G>A	c.(10-12)cGg>cAg	p.R4Q	KIAA1211_ENST00000264229.6_Missense_Mutation_p.R4Q|KIAA1211_ENST00000541073.1_5'UTR			Q6ZU35	K1211_HUMAN	KIAA1211	4										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					ATGGGAACCCGGGCATTTTCC	0.408													ENSG00000109265																																					0													92.0	87.0	89.0					4																	57164406		1812	4090	5902	SO:0001583	missense	0			-	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.11G>A	4.37:g.57164406G>A	ENSP00000423366:p.Arg4Gln		Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	NULL	p.R4Q	ENST00000504228.1	37	c.11	CCDS43230.1	4	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067944	0.76301	.	.	ENSG00000109265	ENST00000264229;ENST00000504228	T;T	0.21361	2.01;2.01	5.18	5.18	0.71444	.	.	.	.	.	T	0.48554	0.1506	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48547	-0.9026	9	0.87932	D	0	-26.7437	18.8905	0.92399	0.0:0.0:1.0:0.0	.	4	Q6ZU35	K1211_HUMAN	Q	4	ENSP00000264229:R4Q;ENSP00000423366:R4Q	ENSP00000264229:R4Q	R	+	2	0	KIAA1211	56859163	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.981000	0.76166	2.707000	0.92482	0.655000	0.94253	CGG	-	KIAA1211	-	NULL		0.408	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	0	0	0	124	124	118	0.00	0.00	G	NM_020722		57164406	+1	43	19	102	83	tier1	no_errors	ENST00000504228	ensembl	human	known	74_37	missense	29.66	18.63	SNP	1.000	A	43	102
MAP3K6	9064	genome.wustl.edu	37	1	27690425	27690425	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:27690425A>G	ENST00000493901.1	-	6	1086	c.847T>C	c.(847-849)Tcc>Ccc	p.S283P	MAP3K6_ENST00000374040.3_Missense_Mutation_p.S275P|MAP3K6_ENST00000357582.2_Missense_Mutation_p.S283P	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	283					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TCGCGGTAGGAGAGCAGCAAG	0.607													ENSG00000142733																																					0													53.0	51.0	52.0					1																	27690425		2203	4300	6503	SO:0001583	missense	0			-	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.847T>C	1.37:g.27690425A>G	ENSP00000419591:p.Ser283Pro		A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S283P	ENST00000493901.1	37	c.847	CCDS299.1	1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.751916	0.69533	.	.	ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582	T;T;T	0.20200	2.09;2.09;2.09	5.29	5.29	0.74685	.	.	.	.	.	T	0.46288	0.1385	M	0.76727	2.345	0.53688	D	0.999974	D;D	0.89917	1.0;1.0	D;D	0.77557	0.984;0.99	T	0.48055	-0.9068	9	0.87932	D	0	.	13.6049	0.62041	1.0:0.0:0.0:0.0	.	275;283	O95382-3;O95382	.;M3K6_HUMAN	P	275;283;6;283	ENSP00000363152:S275P;ENSP00000419591:S283P;ENSP00000350195:S283P	ENSP00000350195:S283P	S	-	1	0	MAP3K6	27563012	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	6.125000	0.71627	2.228000	0.72767	0.533000	0.62120	TCC	-	MAP3K6	-	NULL		0.607	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MAP3K6	HGNC	protein_coding	OTTHUMT00000013469.2	0	0	0	59	59	64	0.00	0.00	A	NM_004672		27690425	-1	21	15	36	38	tier1	no_errors	ENST00000357582	ensembl	human	known	74_37	missense	36.84	28.30	SNP	1.000	G	21	36
CD244	51744	genome.wustl.edu	37	1	160811420	160811420	+	Silent	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:160811420A>G	ENST00000368033.3	-	2	415	c.333T>C	c.(331-333)agT>agC	p.S111S	CD244_ENST00000481677.1_5'Flank|CD244_ENST00000322302.7_Silent_p.S111S|CD244_ENST00000368034.4_Silent_p.S111S|CD244_ENST00000368032.2_Silent_p.S111S			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	111	Ig-like 1.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TTCCAGATATACTGGTGACCT	0.458													ENSG00000122223																																					0													62.0	61.0	61.0					1																	160811420		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.333T>C	1.37:g.160811420A>G			Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Silent	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like_dom	p.S111	ENST00000368033.3	37	c.333	CCDS53399.1	1																																																																																			-	CD244	-	pfam_NK_rcpt_2B4_Ig_dom		0.458	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1	0	0	0	62	62	94	0.00	0.00	A	NM_016382		160811420	-1	16	24	27	110	tier1	no_errors	ENST00000368033	ensembl	human	known	74_37	silent	37.21	17.78	SNP	0.000	G	16	27
INA	9118	genome.wustl.edu	37	10	105048132	105048132	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:105048132C>T	ENST00000369849.4	+	3	1255	c.1206C>T	c.(1204-1206)ggC>ggT	p.G402G		NM_032727.3	NP_116116.1	Q16352	AINX_HUMAN	internexin neuronal intermediate filament protein, alpha	402	Coil 2.|Rod.				cell differentiation (GO:0030154)|neurofilament cytoskeleton organization (GO:0060052)|substantia nigra development (GO:0021762)	cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular space (GO:0005615)|neurofilament (GO:0005883)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)	13				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TGCTGGAAGGCGAGGAGACAC	0.463													ENSG00000148798																																					0													94.0	93.0	94.0					10																	105048132		2203	4300	6503	SO:0001819	synonymous_variant	0			-	S78296	CCDS7545.1	10q24	2013-01-16			ENSG00000148798	ENSG00000148798		"""Intermediate filaments type IV"""	6057	protein-coding gene	gene with protein product		605338		NEF5		7769995	Standard	NM_032727		Approved	NF-66	uc001kws.3	Q16352	OTTHUMG00000018986	ENST00000369849.4:c.1206C>T	10.37:g.105048132C>T			B1AQK0|Q9BRC5	Silent	SNP	pfam_IF,pfam_Intermed_filament_D-bd,superfamily_Prefoldin	p.G402	ENST00000369849.4	37	c.1206	CCDS7545.1	10																																																																																			-	I	-	pfam_IF		0.463	INA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	I	HGNC	protein_coding	OTTHUMT00000050145.1	0	0	0	115	115	95	0.00	0.00	C	NM_032727		105048132	+1	29	17	93	87	tier1	no_errors	ENST00000369849	ensembl	human	known	74_37	silent	23.77	16.35	SNP	0.211	T	29	93
UBXN6	80700	genome.wustl.edu	37	19	4446615	4446615	+	Missense_Mutation	SNP	C	C	T	rs151060057		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:4446615C>T	ENST00000301281.6	-	8	926	c.802G>A	c.(802-804)Gcc>Acc	p.A268T	MIR4746_ENST00000579802.1_RNA|CTB-50L17.7_ENST00000588798.1_RNA|UBXN6_ENST00000394765.3_Missense_Mutation_p.A215T	NM_025241.2	NP_079517.1	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	268						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	12						TCCAGCTTGGCGCGCACGGGC	0.657													ENSG00000167671																																					0								C	THR/ALA,THR/ALA	0,4406		0,0,2203	36.0	38.0	38.0		643,802	3.0	0.7	19	dbSNP_134	38	1,8595		0,1,4297	yes	missense,missense	UBXN6	NM_001171091.1,NM_025241.2	58,58	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	215/389,268/442	4446615	1,13001	2203	4298	6501	SO:0001583	missense	0			-	AF272893	CCDS12129.1, CCDS54201.1	19p13	2008-07-25	2008-07-25	2008-07-25		ENSG00000167671		"""UBX domain containing"""	14928	protein-coding gene	gene with protein product		611946	"""UBX domain-containing 1"", ""UBX domain containing 1"""	UBXD1		11342112	Standard	NM_025241		Approved	UBXDC2	uc002man.2	Q9BZV1		ENST00000301281.6:c.802G>A	19.37:g.4446615C>T	ENSP00000301281:p.Ala268Thr		D6W626|Q96AH1|Q96IK9|Q9BZV0	Missense_Mutation	SNP	pfam_PUB_domain,pfam_UBX,smart_PUG-dom,smart_UBX,pfscan_UBX	p.A268T	ENST00000301281.6	37	c.802	CCDS12129.1	19	.	.	.	.	.	.	.	.	.	.	C	9.213	1.031473	0.19590	0.0	1.16E-4	ENSG00000167671	ENST00000301281;ENST00000394765	T;T	0.31769	1.9;1.48	5.2	3.04	0.35103	.	0.348370	0.33023	N	0.005363	T	0.26304	0.0642	M	0.70595	2.14	0.42444	D	0.992725	B;D	0.53151	0.331;0.958	B;B	0.41571	0.065;0.36	T	0.18493	-1.0335	10	0.10636	T	0.68	-25.5001	7.0678	0.25161	0.0:0.6012:0.2436:0.1552	.	215;268	Q9BZV1-2;Q9BZV1	.;UBXN6_HUMAN	T	268;215	ENSP00000301281:A268T;ENSP00000378246:A215T	ENSP00000301281:A268T	A	-	1	0	UBXN6	4397615	1.000000	0.71417	0.712000	0.30502	0.048000	0.14542	4.365000	0.59486	1.196000	0.43129	0.491000	0.48974	GCC	rs151060057	UBXN6	-	NULL		0.657	UBXN6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN6	HGNC	protein_coding	OTTHUMT00000458447.3	0	0	0	20	20	4	0.00	0.00	C	NM_025241		4446615	-1	7	2	11	14	tier1	no_errors	ENST00000301281	ensembl	human	known	74_37	missense	38.89	12.50	SNP	0.952	T	7	11
RYR2	6262	genome.wustl.edu	37	1	237919660	237919660	+	Missense_Mutation	SNP	G	G	T	rs536555602		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:237919660G>T	ENST00000366574.2	+	81	11535	c.11218G>T	c.(11218-11220)Gtg>Ttg	p.V3740L	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.V3746L|RYR2_ENST00000542537.1_Missense_Mutation_p.V3724L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3740					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.V3738M(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGCTGAGATGGTGCTACAGAC	0.483													ENSG00000198626	G|||	1	0.000199681	0.0008	0.0	5008	,	,		17618	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)											97.0	101.0	99.0					1																	237919660		1970	4169	6139	SO:0001583	missense	0			-	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11218G>T	1.37:g.237919660G>T	ENSP00000355533:p.Val3740Leu		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.V3746L	ENST00000366574.2	37	c.11236	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292083	0.40594	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.93426	-3.22;-3.22;-3.22	5.44	5.44	0.79542	.	0.000000	0.53938	U	0.000058	D	0.96923	0.8995	M	0.82630	2.6	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.75484	0.986;0.986	D	0.97243	0.9892	10	0.87932	D	0	.	18.6247	0.91333	0.0:0.0:1.0:0.0	.	714;3740	B4DGV4;Q92736	.;RYR2_HUMAN	L	3740;3746;3724;714	ENSP00000355533:V3740L;ENSP00000353174:V3746L;ENSP00000443798:V3724L	ENSP00000353174:V3746L	V	+	1	0	RYR2	235986283	1.000000	0.71417	0.998000	0.56505	0.105000	0.19272	9.813000	0.99286	2.717000	0.92951	0.563000	0.77884	GTG	-	RYR2	-	NULL		0.483	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	0	0	0	46	46	99	0.00	0.00	G	NM_001035		237919660	+1	9	25	35	68	tier1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	20.45	26.88	SNP	1.000	T	9	35
RICTOR	253260	genome.wustl.edu	37	5	38996934	38996934	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:38996934C>T	ENST00000357387.3	-	6	473	c.443G>A	c.(442-444)cGa>cAa	p.R148Q	RICTOR_ENST00000296782.5_Missense_Mutation_p.R148Q	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TCTGACTAATCGAAGTGCTTG	0.299													ENSG00000164327																																					0													170.0	167.0	168.0					5																	38996934		2203	4300	6503	SO:0001583	missense	0			-		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.443G>A	5.37:g.38996934C>T	ENSP00000349959:p.Arg148Gln			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R148Q	ENST00000357387.3	37	c.443	CCDS34148.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.550322	0.96501	.	.	ENSG00000164327	ENST00000357387;ENST00000296782;ENST00000514735	T;T;T	0.65916	-0.18;-0.18;-0.18	5.49	5.49	0.81192	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79873	0.4521	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.998	D;D;D;D	0.91635	0.99;0.999;0.988;0.986	T	0.81044	-0.1111	10	0.87932	D	0	-8.8043	19.7399	0.96223	0.0:1.0:0.0:0.0	.	148;148;148;148	Q8N6M7;E7ETT0;Q6R327;Q6R327-3	.;.;RICTR_HUMAN;.	Q	148;148;132	ENSP00000349959:R148Q;ENSP00000296782:R148Q;ENSP00000423162:R132Q	ENSP00000296782:R148Q	R	-	2	0	RICTOR	39032691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.299000	0.78831	2.736000	0.93811	0.561000	0.74099	CGA	-	RICTOR	-	superfamily_ARM-type_fold		0.299	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	0	0	0	80	80	97	0.00	0.00	C	NM_152756		38996934	-1	23	25	51	74	tier1	no_errors	ENST00000296782	ensembl	human	known	74_37	missense	31.08	25.25	SNP	1.000	T	23	51
ARMC3	219681	genome.wustl.edu	37	10	23287301	23287301	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:23287301C>T	ENST00000298032.5	+	11	1484	c.1400C>T	c.(1399-1401)gCg>gTg	p.A467V	ARMC3_ENST00000376528.4_Missense_Mutation_p.A204V|ARMC3_ENST00000409983.3_Missense_Mutation_p.A467V|RNA5SP304_ENST00000411199.1_RNA|ARMC3_ENST00000409049.3_Missense_Mutation_p.A467V	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	467						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ACCGCAACTGCGTGTGACGTT	0.458													ENSG00000165309																																					0													59.0	57.0	57.0					10																	23287301		2203	4300	6503	SO:0001583	missense	0			-	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1400C>T	10.37:g.23287301C>T	ENSP00000298032:p.Ala467Val		A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A467V	ENST00000298032.5	37	c.1400	CCDS7142.1	10	.	.	.	.	.	.	.	.	.	.	C	10.61	1.397573	0.25205	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	T;T;T;T	0.65916	-0.18;-0.18;1.41;0.6	5.44	4.44	0.53790	Armadillo-like helical (1);Armadillo-type fold (1);	0.341113	0.33092	N	0.005283	T	0.52419	0.1733	L	0.52759	1.655	0.35458	D	0.796233	B;B	0.18310	0.006;0.027	B;B	0.13407	0.009;0.004	T	0.55302	-0.8162	10	0.22706	T	0.39	-18.7917	9.9229	0.41474	0.0:0.74:0.173:0.087	.	467;467	Q5W041-4;Q5W041	.;ARMC3_HUMAN	V	467;467;403;467;204	ENSP00000298032:A467V;ENSP00000386943:A467V;ENSP00000387288:A467V;ENSP00000365711:A204V	ENSP00000298032:A467V	A	+	2	0	ARMC3	23327307	0.824000	0.29247	0.034000	0.17996	0.010000	0.07245	1.449000	0.35123	1.128000	0.42052	0.467000	0.42956	GCG	-	ARMC3	-	superfamily_ARM-type_fold		0.458	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARMC3	HGNC	protein_coding	OTTHUMT00000047197.2	0	0	0	12	12	39	0.00	0.00	C	NM_173081		23287301	+1	5	15	5	22	tier1	no_errors	ENST00000298032	ensembl	human	known	74_37	missense	50.00	40.54	SNP	0.675	T	5	5
SLC25A44	9673	genome.wustl.edu	37	1	156180795	156180795	+	3'UTR	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:156180795G>A	ENST00000359511.4	+	0	1690				PMF1_ENST00000368279.3_5'Flank|PMF1-BGLAP_ENST00000368276.4_5'Flank|PMF1_ENST00000565805.1_5'Flank|PMF1_ENST00000567140.1_5'Flank|SLC25A44_ENST00000469537.1_3'UTR|PMF1-BGLAP_ENST00000320139.5_5'Flank|PMF1_ENST00000368273.4_5'Flank|PMF1_ENST00000368277.3_5'Flank|PMF1-BGLAP_ENST00000490491.1_5'Flank	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					CAGAGCACTCGTCCTCTCTTT	0.463													ENSG00000160785																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.*573G>A	1.37:g.156180795G>A			O75034	R	SNP	-	NULL	ENST00000359511.4	37	NULL	CCDS1133.1	1																																																																																			-	SLC25A44	-	-		0.463	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	HGNC	protein_coding	OTTHUMT00000040856.1	0	0	0	20	20	70	0.00	0.00	G	NM_014655		156180795	+1	4	18	12	61	tier1	no_errors	ENST00000469537	ensembl	human	known	74_37	rna	25.00	22.78	SNP	0.000	A	4	12
KMT2D	8085	genome.wustl.edu	37	12	49416528	49416528	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:49416528A>G	ENST00000301067.7	-	51	16182	c.16183T>C	c.(16183-16185)Tgg>Cgg	p.W5395R		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5395					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TTGTTCTTCCATTCGGTGCGC	0.547													ENSG00000167548																																					0													104.0	117.0	113.0					12																	49416528		2068	4200	6268	SO:0001583	missense	0			-	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.16183T>C	12.37:g.49416528A>G	ENSP00000301067:p.Trp5395Arg		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.W5395R	ENST00000301067.7	37	c.16183	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	A	13.30	2.194752	0.38806	.	.	ENSG00000167548	ENST00000301067;ENST00000526209	D;D	0.85088	-1.94;-1.94	5.09	5.09	0.68999	.	0.000000	0.33534	N	0.004814	D	0.91603	0.7347	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92619	0.6106	10	0.87932	D	0	.	14.1527	0.65398	1.0:0.0:0.0:0.0	.	5395	O14686	MLL2_HUMAN	R	5395;76	ENSP00000301067:W5395R;ENSP00000435714:W76R	ENSP00000301067:W5395R	W	-	1	0	MLL2	47702795	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.237000	0.95368	2.059000	0.61396	0.482000	0.46254	TGG	-	KMT2D	-	NULL		0.547	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	0	0	0	57	57	71	0.00	0.00	A			49416528	-1	19	15	47	72	tier1	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	28.79	17.24	SNP	1.000	G	19	47
UBL3	5412	genome.wustl.edu	37	13	30341763	30341763	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr13:30341763T>C	ENST00000380680.4	-	4	1438	c.293A>G	c.(292-294)aAc>aGc	p.N98S		NM_007106.3	NP_009037.1	O95164	UBL3_HUMAN	ubiquitin-like 3	98						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				large_intestine(3)|lung(1)	4		Lung SC(185;0.0281)		all cancers(112;0.0598)|GBM - Glioblastoma multiforme(144;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.147)		ACCTTGAGAGTTTGGCTCTGG	0.408													ENSG00000122042																																					0													160.0	135.0	143.0					13																	30341763		2203	4300	6503	SO:0001583	missense	0			-	AF044221	CCDS9334.1	13q12-q13	2008-07-18			ENSG00000122042	ENSG00000122042			12504	protein-coding gene	gene with protein product		604711		PNSC1		10375635	Standard	NM_007106		Approved	HCG-1, DKFZP434K151, FLJ32018	uc001usp.3	O95164	OTTHUMG00000016661	ENST00000380680.4:c.293A>G	13.37:g.30341763T>C	ENSP00000370055:p.Asn98Ser		B2R4J1|Q5RL72|Q5VZS0|Q6FIG8|Q96SG7	Missense_Mutation	SNP	pirsf_M-anchored_Ub-fold_HCG-1,pfscan_Ubiquitin_supergroup	p.N98S	ENST00000380680.4	37	c.293	CCDS9334.1	13	.	.	.	.	.	.	.	.	.	.	T	16.34	3.096468	0.56075	.	.	ENSG00000122042	ENST00000380680	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.57533	0.2060	L	0.53671	1.685	0.80722	D	1	B	0.20164	0.042	B	0.20955	0.032	T	0.53201	-0.8472	9	0.18710	T	0.47	-15.0698	15.5232	0.75881	0.0:0.0:0.0:1.0	.	98	O95164	UBL3_HUMAN	S	98	.	ENSP00000370055:N98S	N	-	2	0	UBL3	29239763	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.351000	0.79395	2.317000	0.78254	0.460000	0.39030	AAC	-	UBL3	-	pirsf_M-anchored_Ub-fold_HCG-1		0.408	UBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBL3	HGNC	protein_coding	OTTHUMT00000044342.1	0	0	0	61	61	158	0.00	0.00	T	NM_007106		30341763	-1	11	38	49	135	tier1	no_errors	ENST00000380680	ensembl	human	known	74_37	missense	18.33	21.97	SNP	1.000	C	11	49
FGD5	152273	genome.wustl.edu	37	3	14949168	14949168	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:14949168C>G	ENST00000285046.5	+	10	3396	c.3286C>G	c.(3286-3288)Cac>Gac	p.H1096D	FGD5_ENST00000543601.1_Missense_Mutation_p.H855D|FGD5_ENST00000476851.1_3'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1096					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GAAGCTGGTCCACATTGAGCA	0.632													ENSG00000154783																																					0													51.0	56.0	54.0					3																	14949168		1982	4155	6137	SO:0001583	missense	0			-	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3286C>G	3.37:g.14949168C>G	ENSP00000285046:p.His1096Asp		B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.H1096D	ENST00000285046.5	37	c.3286	CCDS46767.1	3	.	.	.	.	.	.	.	.	.	.	C	16.48	3.134487	0.56828	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.27402	1.67;1.67	5.24	5.24	0.73138	Dbl homology (DH) domain (1);Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000013	T	0.24547	0.0595	L	0.38175	1.15	0.46336	D	0.998995	P;P	0.42620	0.672;0.785	B;B	0.36766	0.181;0.232	T	0.03157	-1.1066	10	0.44086	T	0.13	-34.0352	14.3422	0.66636	0.0:1.0:0.0:0.0	.	855;1096	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	D	1096;855	ENSP00000285046:H1096D;ENSP00000445949:H855D	ENSP00000285046:H1096D	H	+	1	0	FGD5	14924172	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.731000	0.55013	2.443000	0.82685	0.591000	0.81541	CAC	-	FGD5	-	superfamily_DH-domain		0.632	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	0	0	0	98	98	79	0.00	0.00	C	NM_152536		14949168	+1	57	42	372	323	tier1	no_errors	ENST00000285046	ensembl	human	known	74_37	missense	13.26	11.48	SNP	1.000	G	57	372
KIAA1958	158405	genome.wustl.edu	37	9	115380914	115380914	+	Intron	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:115380914C>T	ENST00000337530.6	+	3	1467				KIAA1958_ENST00000374244.3_Silent_p.V645V|KIAA1958_ENST00000536272.1_Intron	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958											endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						TCAAGCCAGTCGTGAACCTGG	0.577													ENSG00000165185																																					0																																										SO:0001627	intron_variant	0			-	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1172-27016C>T	9.37:g.115380914C>T			B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Silent	SNP	pfam_DUF3504	p.V645	ENST00000337530.6	37	c.1935	CCDS35108.1	9																																																																																			-	KIAA1958	-	pfam_DUF3504		0.577	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	KIAA1958	HGNC	protein_coding	OTTHUMT00000053690.1	0	0	0	40	40	97	0.00	0.00	C	NM_133465		115380914	+1	13	15	28	50	tier1	no_errors	ENST00000374244	ensembl	human	known	74_37	silent	31.71	23.08	SNP	0.000	T	13	28
MAD1L1	8379	genome.wustl.edu	37	7	1885976	1885976	+	Intron	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:1885976G>A	ENST00000406869.1	-	19	2556				MAD1L1_ENST00000402746.1_Intron|AC110781.3_ENST00000480694.1_3'UTR|AC110781.3_ENST00000318959.3_Intron|MIR4655_ENST00000580817.1_RNA|MAD1L1_ENST00000399654.2_Intron|MAD1L1_ENST00000265854.7_Intron|AC110781.3_ENST00000402221.1_Intron			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GCCAGGACACGGGACATAAAG	0.572													ENSG00000176349																																					0																																										SO:0001627	intron_variant	0			-	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1999-30112C>T	7.37:g.1885976G>A			B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	R	SNP	-	NULL	ENST00000406869.1	37	NULL	CCDS43539.1	7																																																																																			-	AC110781.3	-	-		0.572	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100128374	Clone_based_vega_gene	protein_coding	OTTHUMT00000322871.1	0	0	0	67	67	75	0.00	0.00	G	NM_003550		1885976	+1	15	23	32	54	tier1	no_errors	ENST00000480694	ensembl	human	known	74_37	rna	31.91	29.87	SNP	0.000	A	15	32
UMPS	7372	genome.wustl.edu	37	3	124458975	124458975	+	Missense_Mutation	SNP	C	C	T	rs377750200		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:124458975C>T	ENST00000232607.2	+	4	1193	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	UMPS_ENST00000536109.1_Missense_Mutation_p.R271W|UMPS_ENST00000413078.2_Intron|UMPS_ENST00000538242.1_Missense_Mutation_p.R185W	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	363	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	GCCTTTGCATCGGGGGTGCCT	0.567													ENSG00000114491																																					0								C	TRP/ARG	0,4406		0,0,2203	122.0	124.0	123.0		1087	6.2	1.0	3		123	1,8599	1.2+/-3.3	0,1,4299	no	missense	UMPS	NM_000373.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	363/481	124458975	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.1087C>T	3.37:g.124458975C>T	ENSP00000232607:p.Arg363Trp		B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Missense_Mutation	SNP	pfam_OMPdeCOase_dom,pfam_PRibTrfase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase,tigrfam_Or_phspho_trans_dom	p.R363W	ENST00000232607.2	37	c.1087	CCDS3029.1	3	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022566	0.93462	0.0	1.16E-4	ENSG00000114491	ENST00000232607;ENST00000536109;ENST00000538242	T;T;T	0.69685	-0.42;-0.42;-0.42	6.17	6.17	0.99709	Orotidine 5&apos (2);Aldolase-type TIM barrel (1);-phosphate decarboxylase domain (2);Ribulose-phosphate binding barrel (1);	0.057044	0.64402	D	0.000001	D	0.86781	0.6015	H	0.94658	3.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.89383	0.3683	10	0.87932	D	0	-16.3139	15.581	0.76439	0.1377:0.8623:0.0:0.0	.	185;363	B5LY70;P11172	.;UMPS_HUMAN	W	363;271;185	ENSP00000232607:R363W;ENSP00000443577:R271W;ENSP00000444988:R185W	ENSP00000232607:R363W	R	+	1	2	UMPS	125941665	0.999000	0.42202	0.952000	0.39060	0.962000	0.63368	4.182000	0.58310	2.941000	0.99782	0.655000	0.94253	CGG	-	UMPS	-	pfam_OMPdeCOase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase		0.567	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UMPS	HGNC	protein_coding	OTTHUMT00000355271.1	0	0	0	35	35	65	0.00	0.00	C	NM_000373		124458975	+1	16	20	35	85	tier1	no_errors	ENST00000232607	ensembl	human	known	74_37	missense	31.37	19.05	SNP	0.998	T	16	35
COG8	84342	genome.wustl.edu	37	16	69354328	69354328	+	5'UTR	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:69354328G>A	ENST00000564419.1	-	0	650				RP11-343C2.11_ENST00000570054.2_Intron|VPS4A_ENST00000254950.11_Intron			Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8						protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						CTCAGGGCACGGGTGGACTTC	0.627													ENSG00000213380																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000564419.1:c.-286C>T	16.37:g.69354328G>A			Q0VAK2|Q8WVV6|Q9H6F8	R	SNP	-	NULL	ENST00000564419.1	37	NULL		16																																																																																			-	COG8	-	-		0.627	COG8-005	PUTATIVE	basic	processed_transcript	COG8	HGNC	protein_coding	OTTHUMT00000430567.1	0	0	0	20	20	64	0.00	0.00	G	NM_032382		69354328	-1	4	20	12	14	tier1	no_errors	ENST00000564419	ensembl	human	putative	74_37	rna	23.53	58.82	SNP	0.000	A	4	12
OTUD7A	161725	genome.wustl.edu	37	15	31819495	31819495	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:31819495G>A	ENST00000307050.4	-	5	761	c.669C>T	c.(667-669)caC>caT	p.H223H	OTUD7A_ENST00000382902.1_Silent_p.H223H	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	223	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GGTCCCGGTCGTGAAACCCCC	0.577													ENSG00000169918																																					0													112.0	108.0	109.0					15																	31819495		2202	4300	6502	SO:0001819	synonymous_variant	0			-	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.669C>T	15.37:g.31819495G>A			Q8IWK5	Silent	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.H223	ENST00000307050.4	37	c.669	CCDS10026.1	15																																																																																			-	OTUD7A	-	pfam_OTU,pfscan_OTU		0.577	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2	0	0	0	45	45	90	0.00	0.00	G	NM_130901		31819495	-1	12	31	29	97	tier1	no_errors	ENST00000382902	ensembl	human	known	74_37	silent	29.27	24.22	SNP	0.522	A	12	29
VPS18	57617	genome.wustl.edu	37	15	41191385	41191385	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:41191385C>T	ENST00000220509.5	+	4	708	c.369C>T	c.(367-369)taC>taT	p.Y123Y	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	123					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		AGGTCCTCTACGTGAACCGAA	0.622													ENSG00000104142																																					0													80.0	79.0	79.0					15																	41191385		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.369C>T	15.37:g.41191385C>T			Q8TCG0|Q96DI3|Q9H268	Silent	SNP	pfam_Pep3_Vps18,pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold	p.Y123	ENST00000220509.5	37	c.369	CCDS10069.1	15																																																																																			-	VPS18	-	NULL		0.622	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS18	HGNC	protein_coding	OTTHUMT00000252443.2	0	0	0	38	38	60	0.00	0.00	C			41191385	+1	7	18	37	62	tier1	no_errors	ENST00000220509	ensembl	human	known	74_37	silent	15.91	22.50	SNP	0.899	T	7	37
TTN	7273	genome.wustl.edu	37	2	179469795	179469795	+	Missense_Mutation	SNP	G	G	A	rs201623791		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:179469795G>A	ENST00000591111.1	-	230	49410	c.49186C>T	c.(49186-49188)Cgg>Tgg	p.R16396W	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R18037W|TTN_ENST00000460472.2_Missense_Mutation_p.R8972W|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R15469W|TTN_ENST00000359218.5_Missense_Mutation_p.R9097W|TTN_ENST00000342175.6_Missense_Mutation_p.R9164W|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16396	Ig-like 100.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGTCCTCCCGGACCGCTTTG	0.448													ENSG00000155657																																					0								G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,3840		0,0,1920	243.0	227.0	232.0		26914,46405,27289,27490	4.9	0.2	2		232	3,8247		0,3,4122	yes	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	101,101,101,101	0,3,6042	AA,AG,GG		0.0364,0.0,0.0248	probably-damaging,probably-damaging,probably-damaging,probably-damaging	8972/26927,15469/33424,9097/27052,9164/27119	179469795	3,12087	1920	4125	6045	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49186C>T	2.37:g.179469795G>A	ENSP00000465570:p.Arg16396Trp		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R15469W	ENST00000591111.1	37	c.46405		2	.	.	.	.	.	.	.	.	.	.	G	8.559	0.877302	0.17395	0.0	3.64E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.78	4.88	0.63580	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69672	0.3137	M	0.89968	3.075	0.47659	D	0.99948	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.76594	-0.2902	9	0.87932	D	0	.	12.9857	0.58590	0.0:0.0:0.5569:0.443	.	8972;9097;9164;16396	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	W	15469;8972;9164;9097;8972	ENSP00000343764:R15469W;ENSP00000434586:R8972W;ENSP00000340554:R9164W;ENSP00000352154:R9097W	ENSP00000340554:R9164W	R	-	1	2	TTN	179178040	1.000000	0.71417	0.212000	0.23672	0.675000	0.39556	3.181000	0.50903	1.413000	0.46997	0.563000	0.77884	CGG	rs201623791	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.448	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	1	35	35	210	0.00	0.47	G	NM_133378		179469795	-1	8	47	27	170	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	22.86	21.56	SNP	0.829	A	8	27
AHR	196	genome.wustl.edu	37	7	17369626	17369626	+	Silent	SNP	A	A	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:17369626A>C	ENST00000242057.4	+	5	1144	c.501A>C	c.(499-501)cgA>cgC	p.R167R		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	167	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	CCGAAGACCGAGCTGAATTTC	0.358													ENSG00000106546																																					0													85.0	86.0	86.0					7																	17369626		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.501A>C	7.37:g.17369626A>C			A4D130|Q13728|Q13803|Q13804	Silent	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom	p.R167	ENST00000242057.4	37	c.501	CCDS5366.1	7																																																																																			-	AHR	-	pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS		0.358	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AHR	HGNC	protein_coding	OTTHUMT00000314620.2	0	0	0	54	54	89	0.00	0.00	A	NM_001621		17369626	+1	15	9	52	54	tier1	no_errors	ENST00000242057	ensembl	human	known	74_37	silent	22.39	14.29	SNP	0.838	C	15	52
SLC38A1	81539	genome.wustl.edu	37	12	46601385	46601385	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:46601385C>G	ENST00000398637.5	-	7	1102	c.408G>C	c.(406-408)aaG>aaC	p.K136N	SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000439706.1_Missense_Mutation_p.K136N|SLC38A1_ENST00000552197.1_Missense_Mutation_p.K136N|SLC38A1_ENST00000549049.1_Missense_Mutation_p.K136N|SLC38A1_ENST00000546893.1_Missense_Mutation_p.K136N	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	136					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			GTTCCCCCAGCTTTTCATACA	0.378													ENSG00000111371																																					0													107.0	105.0	106.0					12																	46601385		1831	4084	5915	SO:0001583	missense	0			-	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.408G>C	12.37:g.46601385C>G	ENSP00000381634:p.Lys136Asn		Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.K136N	ENST00000398637.5	37	c.408	CCDS41774.1	12	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644817	0.67358	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197	T;T;T;T;T	0.02301	4.35;4.35;4.35;4.35;4.35	5.61	4.73	0.59995	.	0.076263	0.56097	D	0.000034	T	0.05823	0.0152	L	0.54323	1.7	0.46113	D	0.998876	P;P;P	0.44309	0.645;0.832;0.791	P;P;P	0.52710	0.707;0.674;0.707	T	0.53457	-0.8436	10	0.21014	T	0.42	-17.9357	11.5623	0.50785	0.0:0.857:0.0:0.143	.	136;136;136	B5MEC5;F8VX04;Q9H2H9	.;.;S38A1_HUMAN	N	136	ENSP00000449607:K136N;ENSP00000398142:K136N;ENSP00000381634:K136N;ENSP00000447853:K136N;ENSP00000449756:K136N	ENSP00000381634:K136N	K	-	3	2	SLC38A1	44887652	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.488000	0.45276	1.383000	0.46405	-0.251000	0.11542	AAG	-	SLC38A1	-	pfam_AA_transpt_TM		0.378	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A1	HGNC	protein_coding	OTTHUMT00000404218.2	0	0	0	85	85	115	0.00	0.00	C			46601385	-1	31	41	57	90	tier1	no_errors	ENST00000398637	ensembl	human	known	74_37	missense	35.23	31.30	SNP	1.000	G	31	57
USP47	55031	genome.wustl.edu	37	11	11969622	11969622	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:11969622C>T	ENST00000399455.2	+	22	3402	c.3282C>T	c.(3280-3282)agC>agT	p.S1094S	USP47_ENST00000339865.5_Silent_p.S1006S|USP47_ENST00000527733.1_Silent_p.S1074S|USP47_ENST00000539466.1_5'UTR	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	1094					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		AGTTTGAGAGCGTCCGGCTGA	0.383													ENSG00000170242																																					0													145.0	132.0	136.0					11																	11969622		1839	4096	5935	SO:0001819	synonymous_variant	0			-	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.3282C>T	11.37:g.11969622C>T			B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.S1094	ENST00000399455.2	37	c.3282		11																																																																																			-	USP47	-	NULL		0.383	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	USP47	HGNC	protein_coding	OTTHUMT00000385853.2	0	0	0	67	67	110	0.00	0.00	C	NM_017944		11969622	+1	20	26	44	81	tier1	no_errors	ENST00000399455	ensembl	human	known	74_37	silent	30.77	24.30	SNP	1.000	T	20	44
MGAT4C	25834	genome.wustl.edu	37	12	86374058	86374058	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:86374058C>T	ENST00000604798.1	-	8	1650	c.446G>A	c.(445-447)cGt>cAt	p.R149H	MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000548651.1_Missense_Mutation_p.R149H|MGAT4C_ENST00000552808.2_Missense_Mutation_p.R149H|MGAT4C_ENST00000393205.2_Missense_Mutation_p.R178H|MGAT4C_ENST00000549405.2_Missense_Mutation_p.R149H|MGAT4C_ENST00000332156.1_Missense_Mutation_p.R149H			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	149					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.R149H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CATGGCATCACGCCAGGAAGA	0.398													ENSG00000182050																																					1	Substitution - Missense(1)	lung(1)											83.0	81.0	82.0					12																	86374058		2203	4300	6503	SO:0001583	missense	0			-		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.446G>A	12.37:g.86374058C>T	ENSP00000474896:p.Arg149His		B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	pfam_Glyco_transf_54,superfamily_LSM_dom	p.R178H	ENST00000604798.1	37	c.533	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111685	0.37242	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225	D;D;D;D;D;D	0.85556	-2.0;-2.0;-2.0;-2.0;-2.0;-2.0	5.58	2.62	0.31277	.	0.169518	0.52532	D	0.000061	D	0.82568	0.5065	L	0.38175	1.15	0.40016	D	0.975341	D;D	0.57571	0.98;0.965	P;P	0.52109	0.69;0.69	T	0.78196	-0.2298	10	0.14252	T	0.57	-17.5819	14.8367	0.70190	0.3749:0.6251:0.0:0.0	.	178;149	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	H	149;178;149;149;149;149;149	ENSP00000331664:R149H;ENSP00000376900:R178H;ENSP00000449022:R149H;ENSP00000446647:R149H;ENSP00000447253:R149H;ENSP00000449172:R149H	ENSP00000331664:R149H	R	-	2	0	MGAT4C	84898189	1.000000	0.71417	0.998000	0.56505	0.018000	0.09664	6.064000	0.71169	0.683000	0.31428	-0.169000	0.13324	CGT	-	MGAT4C	-	pfam_Glyco_transf_54		0.398	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	HGNC	protein_coding	OTTHUMT00000406212.2	0	0	0	41	41	84	0.00	0.00	C	NM_013244		86374058	-1	12	11	21	77	tier1	no_errors	ENST00000393205	ensembl	human	known	74_37	missense	36.36	12.50	SNP	1.000	T	12	21
MAP3K13	9175	genome.wustl.edu	37	3	185181425	185181425	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:185181425C>G	ENST00000265026.3	+	8	1700	c.1366C>G	c.(1366-1368)Cga>Gga	p.R456G	MAP3K13_ENST00000443863.1_Missense_Mutation_p.R312G|MAP3K13_ENST00000446828.1_Missense_Mutation_p.R249G|MAP3K13_ENST00000424227.1_Missense_Mutation_p.R456G|MAP3K13_ENST00000535426.1_Missense_Mutation_p.R312G	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13									p.R456R(2)|p.R456*(2)		NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			AGAACTGATTCGAAGGCGCAG	0.468													ENSG00000073803																																					4	Substitution - Nonsense(2)|Substitution - coding silent(2)	large_intestine(2)|lung(2)											125.0	111.0	116.0					3																	185181425		2203	4300	6503	SO:0001583	missense	0			-	BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.1366C>G	3.37:g.185181425C>G	ENSP00000265026:p.Arg456Gly			Missense_Mutation	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R456G	ENST00000265026.3	37	c.1366	CCDS3270.1	3	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258730	0.39896	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026;ENST00000420577	T;T;T;T;T;T	0.79352	-1.26;-1.19;-1.13;-1.13;-1.19;-0.99	5.82	3.83	0.44106	Protein kinase-like domain (1);	0.070231	0.64402	D	0.000018	T	0.80737	0.4680	L	0.32530	0.975	0.80722	D	1	D;D;D	0.59767	0.986;0.986;0.975	P;P;P	0.60473	0.875;0.875;0.753	D	0.83925	0.0303	10	0.87932	D	0	.	16.4722	0.84114	0.2502:0.7498:0.0:0.0	.	312;249;456	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	G	249;456;312;312;456;201	ENSP00000411483:R249G;ENSP00000399910:R456G;ENSP00000409325:R312G;ENSP00000439257:R312G;ENSP00000265026:R456G;ENSP00000415712:R201G	ENSP00000265026:R456G	R	+	1	2	MAP3K13	186664119	1.000000	0.71417	0.918000	0.36340	0.408000	0.30992	4.054000	0.57434	1.428000	0.47296	0.655000	0.94253	CGA	-	MAP3K13	-	pirsf_MAP3K12_MAP3K13,superfamily_Kinase-like_dom		0.468	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K13	HGNC	protein_coding	OTTHUMT00000345268.1	0	0	0	72	72	103	0.00	0.00	C	NM_004721		185181425	+1	19	24	69	79	tier1	no_errors	ENST00000265026	ensembl	human	known	74_37	missense	21.59	23.30	SNP	0.999	G	19	69
SRP54	6729	genome.wustl.edu	37	14	35480757	35480757	+	Silent	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr14:35480757A>G	ENST00000556994.1	+	9	925	c.528A>G	c.(526-528)gtA>gtG	p.V176V	SRP54_ENST00000216774.6_Silent_p.V176V|SRP54_ENST00000555557.1_Silent_p.V112V|SRP54_ENST00000546080.1_Silent_p.V127V			P61011	SRP54_HUMAN	signal recognition particle 54kDa	176	G-domain.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition (GO:0006617)|SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|drug binding (GO:0008144)|endoplasmic reticulum signal peptide binding (GO:0030942)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		CTGAAGGAGTAGAGAAATTTA	0.308													ENSG00000100883																																					0													64.0	70.0	68.0					14																	35480757		2203	4291	6494	SO:0001819	synonymous_variant	0			-	X86373	CCDS9652.1, CCDS53893.1	14q13.2	2014-06-02	2002-08-29		ENSG00000100883	ENSG00000100883			11301	protein-coding gene	gene with protein product		604857	"""signal recognition particle 54kD"""			8722571	Standard	NM_003136		Approved		uc001wso.3	P61011	OTTHUMG00000140214	ENST00000556994.1:c.528A>G	14.37:g.35480757A>G			B2R759|B4DUW6|P13624	Silent	SNP	pfam_SRP54_GTPase_dom,pfam_Signal_recog_particle_SRP54_M,pfam_Signal_recog_particl_SRP54_hlx,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP54_M,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk	p.V176	ENST00000556994.1	37	c.528	CCDS9652.1	14																																																																																			-	SRP54	-	pfam_SRP54_GTPase_dom,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk		0.308	SRP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP54	HGNC	protein_coding	OTTHUMT00000276643.2	0	0	0	55	55	27	0.00	0.00	A	NM_003136		35480757	+1	12	19	24	26	tier1	no_errors	ENST00000216774	ensembl	human	known	74_37	silent	33.33	42.22	SNP	1.000	G	12	24
ALMS1P	200420	genome.wustl.edu	37	2	73912108	73912108	+	RNA	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:73912108T>C	ENST00000450720.1	+	0	1006					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												GGAGGAACAGTAGCACAAAGG	0.478													ENSG00000163016																																					0													12.0	13.0	13.0					2																	73912108		691	1588	2279			0			-	BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73912108T>C				R	SNP	-	NULL	ENST00000450720.1	37	NULL		2																																																																																			-	ALMS1P	-	-		0.478	ALMS1P-002	KNOWN	basic	processed_transcript	ALMS1P	HGNC	pseudogene	OTTHUMT00000339824.1	1	1	0	168	168	139	0.59	0.00	T	NR_003683		73912108	+1	24	28	133	128	tier1	no_errors	ENST00000450720	ensembl	human	known	74_37	rna	15.29	17.83	SNP	0.014	C	24	133
CCT3	7203	genome.wustl.edu	37	1	156280431	156280431	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:156280431G>A	ENST00000295688.3	-	13	1731	c.1451C>T	c.(1450-1452)aCg>aTg	p.T484M	CCT3_ENST00000472765.2_Missense_Mutation_p.T439M|CCT3_ENST00000368259.2_Missense_Mutation_p.T446M|CCT3_ENST00000368261.3_Missense_Mutation_p.T439M	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	484					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CAAAGTACCCGTCTCACCATT	0.478													ENSG00000163468																																					0													117.0	100.0	106.0					1																	156280431		2203	4300	6503	SO:0001583	missense	0			-	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.1451C>T	1.37:g.156280431G>A	ENSP00000295688:p.Thr484Met		A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_gamma	p.T484M	ENST00000295688.3	37	c.1451	CCDS1140.2	1	.	.	.	.	.	.	.	.	.	.	g	18.59	3.656225	0.67586	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38	5.1	5.1	0.69264	.	0.175419	0.47093	D	0.000256	D	0.82958	0.5150	M	0.92649	3.33	0.44927	D	0.99794	P;P;P	0.50819	0.939;0.746;0.864	B;P;P	0.44447	0.351;0.448;0.45	D	0.87639	0.2521	10	0.87932	D	0	-7.6994	13.9148	0.63890	0.0:0.0:1.0:0.0	.	446;483;484	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	M	484;446;439;439	ENSP00000295688:T484M;ENSP00000357242:T446M;ENSP00000357244:T439M;ENSP00000431543:T439M	ENSP00000295688:T484M	T	-	2	0	CCT3	154547055	1.000000	0.71417	0.935000	0.37517	0.971000	0.66376	3.954000	0.56708	2.653000	0.90120	0.552000	0.68991	ACG	-	CCT3	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_gamma		0.478	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	0	0	0	83	83	123	0.00	0.00	G	NM_005998		156280431	-1	23	33	58	119	tier1	no_errors	ENST00000295688	ensembl	human	known	74_37	missense	28.40	21.71	SNP	0.975	A	23	58
AP5S1	55317	genome.wustl.edu	37	20	3804825	3804825	+	Missense_Mutation	SNP	C	C	T	rs531687236		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:3804825C>T	ENST00000246041.2	+	3	703	c.484C>T	c.(484-486)Cgg>Tgg	p.R162W	AP5S1_ENST00000379573.2_3'UTR|AP5S1_ENST00000379567.2_Missense_Mutation_p.R162W			Q9NUS5	AP5S1_HUMAN	adaptor-related protein complex 5, sigma 1 subunit	162					double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)											CCTTCTGCTGCGGGCTGACCG	0.622													ENSG00000125843																																					0													73.0	58.0	63.0					20																	3804825		2203	4300	6503	SO:0001583	missense	0			-	AK002030	CCDS13070.1	20p13	2012-02-27	2012-02-27	2012-02-27	ENSG00000125843	ENSG00000125843			15875	protein-coding gene	gene with protein product		614824	"""chromosome 20 open reading frame 29"""	C20orf29		11780052, 22022230	Standard	NM_001204446		Approved	FLJ11168	uc002wjs.2	Q9NUS5	OTTHUMG00000031760	ENST00000246041.2:c.484C>T	20.37:g.3804825C>T	ENSP00000246041:p.Arg162Trp		B3KSD0|D3DVY7	Missense_Mutation	SNP	NULL	p.R162W	ENST00000246041.2	37	c.484	CCDS13070.1	20	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419545	0.62622	.	.	ENSG00000125843	ENST00000379567;ENST00000246041	.	.	.	5.72	1.1	0.20463	.	0.343135	0.28589	N	0.014816	T	0.60983	0.2311	L	0.56769	1.78	0.27907	N	0.938756	D	0.89917	1.0	D	0.76071	0.987	T	0.57081	-0.7872	9	0.87932	D	0	-19.6433	12.311	0.54927	0.5405:0.4595:0.0:0.0	.	162	Q9NUS5	CT029_HUMAN	W	162	.	ENSP00000246041:R162W	R	+	1	2	C20orf29	3752825	0.911000	0.30947	0.999000	0.59377	0.551000	0.35334	0.366000	0.20365	0.732000	0.32470	0.561000	0.74099	CGG	-	AP5S1	-	NULL		0.622	AP5S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5S1	HGNC	protein_coding	OTTHUMT00000077768.2	0	0	0	49	49	24	0.00	0.00	C	NM_018347		3804825	+1	12	4	32	10	tier1	no_errors	ENST00000246041	ensembl	human	known	74_37	missense	27.27	28.57	SNP	0.988	T	12	32
CACNA1B	774	genome.wustl.edu	37	9	140865850	140865850	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:140865850G>A	ENST00000371372.1	+	11	1494	c.1349G>A	c.(1348-1350)cGc>cAc	p.R450H	CACNA1B_ENST00000277551.2_Missense_Mutation_p.R450H|CACNA1B_ENST00000371363.1_Missense_Mutation_p.R450H|CACNA1B_ENST00000371355.4_Missense_Mutation_p.R451H|CACNA1B_ENST00000371357.1_Missense_Mutation_p.R451H|CACNA1B_ENST00000277549.5_5'UTR	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	450					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCTTCGCCCGCGCCAGCCTC	0.612													ENSG00000148408																																					0													36.0	41.0	39.0					9																	140865850		1964	4132	6096	SO:0001583	missense	0			-	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1349G>A	9.37:g.140865850G>A	ENSP00000360423:p.Arg450His		B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.R451H	ENST00000371372.1	37	c.1352	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153399	0.57259	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.97041	-4.21;-4.22;-4.21;-4.18;-4.18	5.26	5.26	0.73747	.	1.023770	0.07831	N	0.961311	D	0.98588	0.9528	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96217	0.9157	10	0.87932	D	0	.	18.8606	0.92270	0.0:0.0:1.0:0.0	.	450	B1AQK6	.	H	450;450;450;451;451	ENSP00000360423:R450H;ENSP00000277551:R450H;ENSP00000360414:R450H;ENSP00000360408:R451H;ENSP00000360406:R451H	ENSP00000277551:R450H	R	+	2	0	CACNA1B	139985671	1.000000	0.71417	0.178000	0.23040	0.001000	0.01503	9.645000	0.98471	2.448000	0.82819	0.462000	0.41574	CGC	-	CAC1B	-	NULL		0.612	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CAC1B	HGNC	protein_coding	OTTHUMT00000055380.1	0	0	0	115	115	87	0.00	0.00	G	NM_000718		140865850	+1	27	26	49	37	tier1	no_errors	ENST00000371355	ensembl	human	known	74_37	missense	35.53	41.27	SNP	0.999	A	27	49
HIST1H2BO	8348	genome.wustl.edu	37	6	27861357	27861357	+	Silent	SNP	T	T	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:27861357T>A	ENST00000303806.4	+	1	155	c.117T>A	c.(115-117)tcT>tcA	p.S39S	HIST1H2AM_ENST00000359611.2_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H3J_ENST00000479986.1_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	39					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										AGAGTTACTCTATCTACGTGT	0.532													ENSG00000196331																																					0													148.0	137.0	141.0					6																	27861357		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.117T>A	6.37:g.27861357T>A			Q3KPI7|Q8TCV6	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.S39	ENST00000303806.4	37	c.117	CCDS4640.1	6																																																																																			-	HIST1H2BO	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B		0.532	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BO	HGNC	protein_coding	OTTHUMT00000040161.1	0	0	0	100	100	13	0.00	0.00	T	NM_003527		27861357	+1	29	6	49	14	tier1	no_errors	ENST00000303806	ensembl	human	known	74_37	silent	37.18	30.00	SNP	0.001	A	29	49
HMCN1	83872	genome.wustl.edu	37	1	186147733	186147733	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:186147733C>A	ENST00000271588.4	+	104	16358	c.16129C>A	c.(16129-16131)Cct>Act	p.P5377T	HMCN1_ENST00000367492.2_Intron|GS1-174L6.4_ENST00000428391.1_RNA	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5377					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ACGGTTCTCCCCTGTGAGAAA	0.453													ENSG00000143341																																					0													196.0	191.0	192.0					1																	186147733		2203	4300	6503	SO:0001583	missense	0			-	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16129C>A	1.37:g.186147733C>A	ENSP00000271588:p.Pro5377Thr		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.P5377T	ENST00000271588.4	37	c.16129	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.658068	0.29425	.	.	ENSG00000143341	ENST00000271588	T	0.64618	-0.11	5.77	3.86	0.44501	Growth factor, receptor (1);	0.270868	0.43579	D	0.000548	T	0.49558	0.1564	L	0.40543	1.245	0.80722	D	1	B	0.32573	0.376	B	0.32149	0.141	T	0.46275	-0.9203	10	0.30078	T	0.28	.	10.1092	0.42552	0.0:0.7899:0.1377:0.0724	.	5377	Q96RW7	HMCN1_HUMAN	T	5377	ENSP00000271588:P5377T	ENSP00000271588:P5377T	P	+	1	0	HMCN1	184414356	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.088000	0.41663	1.548000	0.49413	0.655000	0.94253	CCT	-	HMCN1	-	superfamily_Growth_fac_rcpt_N_dom		0.453	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	0	0	1	41	41	120	0.00	0.82	C	NM_031935		186147733	+1	10	38	32	82	tier1	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	23.81	31.67	SNP	1.000	A	10	32
RPN2	6185	genome.wustl.edu	37	20	35858442	35858442	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:35858442A>G	ENST00000237530.6	+	13	1872	c.1561A>G	c.(1561-1563)Act>Gct	p.T521A	RPN2_ENST00000373622.5_Missense_Mutation_p.T489A|RPN2_ENST00000470352.1_3'UTR	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	521					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GAACCTTTTCACTCCAAAACA	0.483													ENSG00000118705																																					0													115.0	112.0	113.0					20																	35858442		2203	4300	6503	SO:0001583	missense	0			-	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1561A>G	20.37:g.35858442A>G	ENSP00000237530:p.Thr521Ala		Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	pfam_Swp1	p.T521A	ENST00000237530.6	37	c.1561	CCDS13291.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.01|13.01	2.108959|2.108959	0.37242|0.37242	.|.	.|.	ENSG00000118705|ENSG00000118705	ENST00000456400|ENST00000237530;ENST00000373622;ENST00000397161;ENST00000373623;ENST00000437329	.|T;T;T	.|0.40225	.|1.04;1.04;1.04	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.141818	.|0.64402	.|D	.|0.000014	T|T	0.25791|0.25791	0.0628|0.0628	N|N	0.22421|0.22421	0.69|0.69	0.36902|0.36902	D|D	0.890466|0.890466	.|B;B	.|0.22800	.|0.075;0.044	.|B;B	.|0.15870	.|0.014;0.013	T|T	0.13899|0.13899	-1.0492|-1.0492	5|10	.|0.02654	.|T	.|1	-23.3181|-23.3181	13.8738|13.8738	0.63638|0.63638	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|489;521	.|Q5JYR6;P04844	.|.;RPN2_HUMAN	R|A	45|521;489;60;45;60	.|ENSP00000237530:T521A;ENSP00000362724:T489A;ENSP00000409580:T60A	.|ENSP00000237530:T521A	H|T	+|+	2|1	0|0	RPN2|RPN2	35291856|35291856	0.994000|0.994000	0.37717|0.37717	0.991000|0.991000	0.47740|0.47740	0.961000|0.961000	0.63080|0.63080	3.582000|3.582000	0.53921|0.53921	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	CAC|ACT	-	RPN2	-	pfam_Swp1		0.483	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN2	HGNC	protein_coding	OTTHUMT00000079076.2	0	0	0	63	63	135	0.00	0.00	A	NM_002951		35858442	+1	17	30	64	73	tier1	no_errors	ENST00000237530	ensembl	human	known	74_37	missense	20.99	29.13	SNP	1.000	G	17	64
LACTBL1	646262	genome.wustl.edu	37	1	23286554	23286554	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:23286554G>A	ENST00000426928.2	-	3	197	c.198C>T	c.(196-198)ggC>ggT	p.G66G				A8MY62	BLML_HUMAN	lactamase, beta-like 1	37																	TGGCAGCCACGCCTGGGGCAG	0.587													ENSG00000215906																																					0																																										SO:0001819	synonymous_variant	0			-			1p36.12	2010-07-20			ENSG00000215906	ENSG00000215906			35445	protein-coding gene	gene with protein product							Standard	XM_003846622		Approved			A8MY62	OTTHUMG00000003228	ENST00000426928.2:c.198C>T	1.37:g.23286554G>A				Silent	SNP	pfam_Beta-lactam-related,superfamily_Beta-lactam/transpept-like	p.G66	ENST00000426928.2	37	c.198		1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.242915	0.22796	.	.	ENSG00000215906	ENST00000426928	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	T	0.63402	0.2508	.	.	.	.	.	.	.	.	.	.	.	.	T	0.70092	-0.4967	3	.	.	.	-15.7966	13.4491	0.61161	0.0:0.0:1.0:0.0	.	.	.	.	V	55	.	.	A	-	2	0	LACTBL1	23159141	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	0.474000	0.22148	2.219000	0.72066	0.549000	0.68633	GCG	-	LACTBL1	-	pfam_Beta-lactam-related,superfamily_Beta-lactam/transpept-like		0.587	LACTBL1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LACTBL1	HGNC	protein_coding	OTTHUMT00000008903.4	0	0	0	48	48	32	0.00	0.00	G	XM_002342035.1		23286554	-1	4	7	32	36	tier1	no_errors	ENST00000426928	ensembl	human	putative	74_37	silent	11.11	15.56	SNP	1.000	A	4	32
KIFAP3	22920	genome.wustl.edu	37	1	170024465	170024465	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:170024465G>A	ENST00000361580.2	-	2	372	c.145C>T	c.(145-147)Cga>Tga	p.R49*	KIFAP3_ENST00000367767.1_Intron|KIFAP3_ENST00000490550.1_5'UTR|KIFAP3_ENST00000538366.1_De_novo_Start_InFrame|KIFAP3_ENST00000367765.1_Nonsense_Mutation_p.R9*	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	49					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CATTCTTTTCGTTCTCCCAAC	0.338													ENSG00000075945																																					0													91.0	89.0	89.0					1																	170024465		2203	4300	6503	SO:0001587	stop_gained	0			-	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.145C>T	1.37:g.170024465G>A	ENSP00000354560:p.Arg49*		B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Nonsense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R49*	ENST00000361580.2	37	c.145	CCDS1288.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.695692	0.97768	.	.	ENSG00000075945	ENST00000361580;ENST00000367765	.	.	.	5.19	3.29	0.37713	.	0.062125	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.4869	9.7572	0.40510	0.0738:0.0:0.786:0.1402	.	.	.	.	X	49;9	.	.	R	-	1	2	KIFAP3	168291089	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.362000	0.59467	0.568000	0.29311	0.591000	0.81541	CGA	-	KIFAP3	-	NULL		0.338	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFAP3	HGNC	protein_coding	OTTHUMT00000087568.1	0	0	0	93	93	90	0.00	0.00	G	NM_014970		170024465	-1	11	16	80	77	tier1	no_errors	ENST00000361580	ensembl	human	known	74_37	nonsense	12.09	17.02	SNP	1.000	A	11	80
FRYL	285527	genome.wustl.edu	37	4	48569313	48569313	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:48569313G>A	ENST00000503238.1	-	25	3120	c.3121C>T	c.(3121-3123)Cga>Tga	p.R1041*	FRYL_ENST00000537810.1_Nonsense_Mutation_p.R1041*|FRYL_ENST00000507711.1_Nonsense_Mutation_p.R1041*|FRYL_ENST00000358350.4_Nonsense_Mutation_p.R1041*|FRYL_ENST00000264319.7_De_novo_Start_OutOfFrame			O94915	FRYL_HUMAN	FRY-like	1041					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AAATGGCATCGTATATCCTTC	0.333													ENSG00000075539																																					0													138.0	123.0	128.0					4																	48569313		1868	4112	5980	SO:0001587	stop_gained	0			-	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.3121C>T	4.37:g.48569313G>A	ENSP00000426064:p.Arg1041*		O95640|Q8WTZ5|Q9NT40	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.R1041*	ENST00000503238.1	37	c.3121	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	G	46	12.952888	0.99709	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	.	.	.	5.36	4.52	0.55395	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5628	0.68153	0.0709:0.0:0.9291:0.0	.	.	.	.	X	1041	.	ENSP00000351113:R1041X	R	-	1	2	FRYL	48264070	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.433000	0.80362	1.409000	0.46915	0.650000	0.86243	CGA	-	FRYL	-	superfamily_ARM-type_fold		0.333	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	0	0	0	83	83	96	0.00	0.00	G			48569313	-1	28	25	84	73	tier1	no_errors	ENST00000358350	ensembl	human	known	74_37	nonsense	25.00	25.51	SNP	1.000	A	28	84
CCDC42	146849	genome.wustl.edu	37	17	8638826	8638826	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:8638826G>A	ENST00000293845.3	-	5	822	c.596C>T	c.(595-597)gCc>gTc	p.A199V	CCDC42_ENST00000539522.2_Intron	NM_144681.2	NP_653282.2	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42	199										kidney(1)|large_intestine(4)|lung(3)|ovary(1)	9						CCGGGCCTTGGCGCGCTCAAT	0.592													ENSG00000161973																																					0													61.0	56.0	58.0					17																	8638826		2203	4300	6503	SO:0001583	missense	0			-	AK057296	CCDS11145.1, CCDS54088.1	17p13.1	2012-05-28			ENSG00000161973	ENSG00000161973			26528	protein-coding gene	gene with protein product							Standard	NM_144681		Approved	FLJ32734, CCDC42A	uc002gln.3	Q96M95		ENST00000293845.3:c.596C>T	17.37:g.8638826G>A	ENSP00000293845:p.Ala199Val		Q8N6Q0	Missense_Mutation	SNP	NULL	p.A199V	ENST00000293845.3	37	c.596	CCDS11145.1	17	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321186	0.23994	.	.	ENSG00000161973	ENST00000293845	T	0.23950	1.88	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000014	T	0.29817	0.0745	L	0.31752	0.955	0.80722	D	1	D	0.63880	0.993	P	0.54629	0.757	T	0.00498	-1.1704	10	0.29301	T	0.29	-16.0321	13.3047	0.60345	0.0:0.0:0.8417:0.1583	.	199	Q96M95	CCD42_HUMAN	V	199	ENSP00000293845:A199V	ENSP00000293845:A199V	A	-	2	0	CCDC42	8579551	1.000000	0.71417	0.997000	0.53966	0.490000	0.33462	2.267000	0.43329	2.868000	0.98415	0.557000	0.71058	GCC	-	CCDC42	-	NULL		0.592	CCDC42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC42	HGNC	protein_coding	OTTHUMT00000442491.1	0	0	0	23	23	27	0.00	0.00	G	NM_144681		8638826	-1	7	10	6	21	tier1	no_errors	ENST00000293845	ensembl	human	known	74_37	missense	53.85	32.26	SNP	1.000	A	7	6
DSCC1	79075	genome.wustl.edu	37	8	120862621	120862621	+	Splice_Site	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:120862621C>T	ENST00000313655.4	-	3	701		c.e3+1			NM_024094.2	NP_076999.2	Q9BVC3	DCC1_HUMAN	DNA replication and sister chromatid cohesion 1						DNA replication (GO:0006260)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|pancreas(1)	9	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATAAGTCTTACTTTTGAGCTA	0.294													ENSG00000136982																																					0													66.0	69.0	68.0					8																	120862621		2199	4294	6493	SO:0001630	splice_region_variant	0			-		CCDS6330.1	8q24.12	2013-05-24	2013-05-24		ENSG00000136982	ENSG00000136982			24453	protein-coding gene	gene with protein product	"""defective in sister chromatid cohesion homolog 1 (S. cerevisiae)"""	613203	"""defective in sister chromatid cohesion 1 homolog (S. cerevisiae)"""			12766176, 20826785	Standard	NM_024094		Approved	DCC1, hDCC1, MGC5528	uc003yov.3	Q9BVC3	OTTHUMG00000165010	ENST00000313655.4:c.486+1G>A	8.37:g.120862621C>T			Q969N5	Splice_Site	SNP	-	e3+1	ENST00000313655.4	37	c.486+1	CCDS6330.1	8	.	.	.	.	.	.	.	.	.	.	C	10.89	1.477460	0.26511	.	.	ENSG00000136982	ENST00000313655	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1941	0.82015	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DSCC1	120931802	0.998000	0.40836	1.000000	0.80357	0.323000	0.28346	3.128000	0.50492	2.508000	0.84585	0.655000	0.94253	.	-	DSCC1	-	-		0.294	DSCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCC1	HGNC	protein_coding	OTTHUMT00000381443.1	0	0	0	103	103	76	0.00	0.00	C	NM_024094	Intron	120862621	-1	39	15	108	81	tier1	no_errors	ENST00000313655	ensembl	human	known	74_37	splice_site	26.35	15.62	SNP	1.000	T	39	108
ZNF225	7768	genome.wustl.edu	37	19	44636829	44636829	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:44636829C>T	ENST00000262894.6	+	5	2342	c.2062C>T	c.(2062-2064)Cgc>Tgc	p.R688C	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Missense_Mutation_p.R688C	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	688					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				CTGTGGGAAGCGCTACAAGAG	0.408													ENSG00000256294																																					0													43.0	42.0	43.0					19																	44636829		2203	4300	6503	SO:0001583	missense	0			-	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.2062C>T	19.37:g.44636829C>T	ENSP00000262894:p.Arg688Cys		A8K8S2|Q53F12|Q9NS46|Q9UID8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R688C	ENST00000262894.6	37	c.2062	CCDS46100.1	19	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710537	0.30322	.	.	ENSG00000256294	ENST00000262894;ENST00000544184	T	0.15487	2.42	2.0	0.879	0.19155	.	.	.	.	.	T	0.14356	0.0347	N	0.17594	0.5	0.09310	N	1	D	0.76494	0.999	P	0.56216	0.794	T	0.12553	-1.0543	9	0.52906	T	0.07	.	0.9733	0.01420	0.1575:0.2475:0.3735:0.2215	.	688	Q9UK10	ZN225_HUMAN	C	688;652	ENSP00000262894:R688C	ENSP00000262894:R688C	R	+	1	0	ZNF225	49328669	0.000000	0.05858	0.009000	0.14445	0.005000	0.04900	-1.173000	0.03108	0.154000	0.19237	-0.479000	0.04858	CGC	-	ZNF225	-	NULL		0.408	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	HGNC	protein_coding	OTTHUMT00000460581.1	0	0	0	69	69	68	0.00	0.00	C			44636829	+1	17	26	54	66	tier1	no_errors	ENST00000262894	ensembl	human	known	74_37	missense	23.94	28.26	SNP	0.123	T	17	54
TFAP4	7023	genome.wustl.edu	37	16	4308077	4308077	+	Silent	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:4308077C>A	ENST00000204517.6	-	7	1324	c.996G>T	c.(994-996)tcG>tcT	p.S332S		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	332					cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CCCCGTCCCCCGACGGCTCCT	0.706													ENSG00000090447																																					0																																										SO:0001819	synonymous_variant	0			-	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.996G>T	16.37:g.4308077C>A			O60409	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S332	ENST00000204517.6	37	c.996	CCDS10510.1	16																																																																																			-	TFAP4	-	NULL		0.706	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP4	HGNC	protein_coding	OTTHUMT00000251595.2	0	0	0	62	62	8	0.00	0.00	C	NM_003223		4308077	-1	12	2	36	11	tier1	no_errors	ENST00000204517	ensembl	human	known	74_37	silent	25.00	15.38	SNP	0.004	A	12	36
AKAP2	11217	genome.wustl.edu	37	9	112900711	112900711	+	Silent	SNP	A	A	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:112900711A>C	ENST00000259318.7	+	2	2401	c.2194A>C	c.(2194-2196)Agg>Cgg	p.R732R	AKAP2_ENST00000434623.2_Silent_p.R821R|PALM2-AKAP2_ENST00000374530.3_Silent_p.R963R|AKAP2_ENST00000555236.1_Silent_p.R963R|PALM2-AKAP2_ENST00000302798.7_Silent_p.R963R|AKAP2_ENST00000482335.1_3'UTR|AKAP2_ENST00000510514.5_Silent_p.R963R|AKAP2_ENST00000374525.1_Silent_p.R821R	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	732										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						AGCTCAGGAAAGGGAAGAGGA	0.522													ENSG00000157654																																					0													85.0	79.0	81.0					9																	112900711		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.2194A>C	9.37:g.112900711A>C			B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Silent	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.R963	ENST00000259318.7	37	c.2887	CCDS48003.1	9																																																																																			-	PALM2-AKAP2	-	NULL		0.522	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	0	0	0	66	66	84	0.00	0.00	A	NM_001004065		112900711	+1	15	28	42	57	tier1	no_errors	ENST00000374530	ensembl	human	known	74_37	silent	26.32	32.94	SNP	0.995	C	15	42
RBM17	84991	genome.wustl.edu	37	10	6157416	6157416	+	Splice_Site	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:6157416C>T	ENST00000446108.1	+	12	1747	c.1103C>T	c.(1102-1104)gCg>gTg	p.A368V	RBM17_ENST00000379888.4_Splice_Site_p.A368V|RBM17_ENST00000476706.1_3'UTR	NM_001145547.1	NP_001139019.1	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	368	RRM.				alternative mRNA splicing, via spliceosome (GO:0000380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	19						TGCCTTTCAGCGGTTGTTGAC	0.353													ENSG00000134453																																					0													173.0	159.0	164.0					10																	6157416		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF083384	CCDS7077.1	10p15.1	2013-01-28			ENSG00000134453	ENSG00000134453		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	16944	protein-coding gene	gene with protein product	"""splicing factor 45kDa"""	606935				9731529	Standard	NM_032905		Approved	SPF45, MGC14439	uc001ijb.3	Q96I25	OTTHUMG00000017618	ENST00000446108.1:c.1103-1C>T	10.37:g.6157416C>T			Q96GY6	Missense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,smart_RRM_dom_euk,pirsf_Splicing_factor_SPF45,pfscan_G_patch_dom	p.A368V	ENST00000446108.1	37	c.1103	CCDS7077.1	10	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653982	0.88056	.	.	ENSG00000134453	ENST00000379888;ENST00000446108	.	.	.	4.93	4.93	0.64822	RNA recognition motif domain, eukaryote (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.87617	0.6222	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91544	0.5252	8	.	.	.	.	18.519	0.90944	0.0:1.0:0.0:0.0	.	368	Q96I25	SPF45_HUMAN	V	368	.	.	A	+	2	0	RBM17	6197422	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	7.091000	0.76923	2.424000	0.82194	0.655000	0.94253	GCG	-	RBM17	-	smart_RRM_dom_euk,pirsf_Splicing_factor_SPF45		0.353	RBM17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM17	HGNC	protein_coding	OTTHUMT00000046635.1	0	0	0	82	82	147	0.00	0.00	C	NM_032905	Missense_Mutation	6157416	+1	25	38	52	95	tier1	no_errors	ENST00000379888	ensembl	human	known	74_37	missense	32.47	28.36	SNP	1.000	T	25	52
MYO7A	4647	genome.wustl.edu	37	11	76901827	76901827	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:76901827C>T	ENST00000409709.3	+	30	4108	c.3836C>T	c.(3835-3837)aCg>aTg	p.T1279M	MYO7A_ENST00000409619.2_Missense_Mutation_p.T1268M|MYO7A_ENST00000458637.2_Missense_Mutation_p.T1279M	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1279	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TCGGCAACCACGGCCAAGGAG	0.587													ENSG00000137474																																					0													55.0	67.0	63.0					11																	76901827		2124	4200	6324	SO:0001583	missense	0			-	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.3836C>T	11.37:g.76901827C>T	ENSP00000386331:p.Thr1279Met		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.T1279M	ENST00000409709.3	37	c.3836	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478920	0.84747	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37	4.97	4.97	0.65823	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.91720	0.7382	M	0.90425	3.115	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.995;0.979;0.997	D	0.93543	0.6879	10	0.87932	D	0	.	18.21	0.89867	0.0:1.0:0.0:0.0	.	1268;1279;1279	B9A011;F8VUN5;Q13402	.;.;MYO7A_HUMAN	M	1279;1279;1268;490;1278;1248;1155;460	ENSP00000386331:T1279M;ENSP00000392185:T1279M;ENSP00000386635:T1268M;ENSP00000417017:T460M	ENSP00000345075:T1155M	T	+	2	0	MYO7A	76579475	1.000000	0.71417	0.985000	0.45067	0.754000	0.42855	5.768000	0.68858	2.289000	0.77006	0.579000	0.79373	ACG	-	MYO7A	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain		0.587	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	0	0	0	32	32	58	0.00	0.00	C	NM_000260		76901827	+1	11	22	29	47	tier1	no_errors	ENST00000409709	ensembl	human	known	74_37	missense	27.50	31.88	SNP	1.000	T	11	29
UNC5B	219699	genome.wustl.edu	37	10	73046509	73046509	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:73046509A>G	ENST00000335350.6	+	5	1032	c.616A>G	c.(616-618)Atc>Gtc	p.I206V	UNC5B_ENST00000373192.4_Missense_Mutation_p.I206V	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	206	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CCTGCTCACCATCGACCACAA	0.612													ENSG00000107731																																					0													254.0	222.0	233.0					10																	73046509		2203	4300	6503	SO:0001583	missense	0			-	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.616A>G	10.37:g.73046509A>G	ENSP00000334329:p.Ile206Val		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Death_domain,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.I206V	ENST00000335350.6	37	c.616	CCDS7309.1	10	.	.	.	.	.	.	.	.	.	.	A	18.75	3.690215	0.68271	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.66638	-0.22;-0.22	5.43	5.43	0.79202	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.101665	0.64402	D	0.000003	T	0.69672	0.3137	N	0.20845	0.615	0.58432	D	0.999999	D;D	0.71674	0.997;0.998	D;D	0.80764	0.99;0.994	T	0.68857	-0.5298	10	0.29301	T	0.29	-22.9808	15.4961	0.75653	1.0:0.0:0.0:0.0	.	206;206	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	V	206	ENSP00000334329:I206V;ENSP00000362288:I206V	ENSP00000334329:I206V	I	+	1	0	UNC5B	72716515	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.505000	0.60421	2.072000	0.62099	0.459000	0.35465	ATC	-	UNC5B	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.612	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5B	HGNC	protein_coding	OTTHUMT00000048541.1	0	0	0	54	54	112	0.00	0.00	A	NM_170744		73046509	+1	13	31	39	103	tier1	no_errors	ENST00000335350	ensembl	human	known	74_37	missense	25.00	23.13	SNP	1.000	G	13	39
C9orf9	11092	genome.wustl.edu	37	9	135763753	135763753	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:135763753C>A	ENST00000372136.3	+	4	871	c.424C>A	c.(424-426)Ccc>Acc	p.P142T	C9orf9_ENST00000356311.5_Missense_Mutation_p.P142T|C9orf9_ENST00000350499.6_Missense_Mutation_p.P142T			Q96E40	CI009_HUMAN	chromosome 9 open reading frame 9	142						cytoplasmic microtubule (GO:0005881)		p.?(1)		cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		CAGCCTCATCCCCCTCATCCT	0.617													ENSG00000165698																																					1	Unknown(1)	bone(1)											93.0	73.0	80.0					9																	135763753		2203	4300	6503	SO:0001583	missense	0			-		CCDS6955.1	9q34.13	2012-03-06			ENSG00000165698	ENSG00000165698			1367	protein-coding gene	gene with protein product							Standard	NM_018956		Approved		uc004cby.1	Q96E40	OTTHUMG00000020847	ENST00000372136.3:c.424C>A	9.37:g.135763753C>A	ENSP00000361209:p.Pro142Thr		Q9UGQ0	Missense_Mutation	SNP	NULL	p.P142T	ENST00000372136.3	37	c.424		9	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852998	0.71719	.	.	ENSG00000165698	ENST00000372136;ENST00000356311;ENST00000350499	T;T;T	0.66638	-0.22;-0.22;-0.22	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.81922	0.4925	M	0.73962	2.25	0.58432	D	0.999999	D;D	0.89917	0.996;1.0	P;D	0.91635	0.9;0.999	D	0.84054	0.0371	10	0.72032	D	0.01	-35.9113	17.3573	0.87340	0.0:1.0:0.0:0.0	.	142;142	Q96E40-2;Q96E40	.;CI009_HUMAN	T	142	ENSP00000361209:P142T;ENSP00000348659:P142T;ENSP00000298546:P142T	ENSP00000298546:P142T	P	+	1	0	C9orf9	134753574	1.000000	0.71417	0.998000	0.56505	0.508000	0.34012	5.962000	0.70364	2.425000	0.82216	0.561000	0.74099	CCC	-	C9orf9	-	NULL		0.617	C9orf9-001	KNOWN	basic	protein_coding	C9orf9	HGNC	protein_coding	OTTHUMT00000054806.1	0	0	0	90	90	40	0.00	0.00	C	NM_018956		135763753	+1	14	7	43	14	tier1	no_errors	ENST00000356311	ensembl	human	known	74_37	missense	24.56	33.33	SNP	1.000	A	14	43
SYNCRIP	10492	genome.wustl.edu	37	6	86329023	86329023	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:86329023G>A	ENST00000369622.3	-	9	1621	c.1121C>T	c.(1120-1122)gCg>gTg	p.A374V	SYNCRIP_ENST00000355238.6_Missense_Mutation_p.A374V	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	374	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A374V(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		ATGAATGAACGCATAATCTTT	0.358													ENSG00000135316																																					1	Substitution - Missense(1)	endometrium(1)											142.0	135.0	138.0					6																	86329023		2203	4300	6503	SO:0001583	missense	0			-	AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.1121C>T	6.37:g.86329023G>A	ENSP00000358635:p.Ala374Val		E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.A374V	ENST00000369622.3	37	c.1121	CCDS5005.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.583069	0.96578	.	.	ENSG00000135316	ENST00000355238;ENST00000369622	D;D	0.82167	-1.58;-1.58	5.19	5.19	0.71726	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.92348	0.7572	M	0.90252	3.1	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D	0.85130	0.997;0.993;0.997;0.994;0.973;0.994;0.997	D	0.93465	0.6814	10	0.87932	D	0	.	19.0791	0.93175	0.0:0.0:1.0:0.0	.	374;339;276;222;339;374;374	O60506;O60506-2;B7Z645;O60506-5;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.;.;.	V	374	ENSP00000347380:A374V;ENSP00000358635:A374V	ENSP00000347380:A374V	A	-	2	0	SYNCRIP	86385742	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.812000	0.99227	2.577000	0.86979	0.655000	0.94253	GCG	-	SYNCRIP	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac		0.358	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNCRIP	HGNC	protein_coding	OTTHUMT00000041396.1	0	0	0	58	58	54	0.00	0.00	G	NM_006372		86329023	-1	13	11	35	24	tier1	no_errors	ENST00000369622	ensembl	human	known	74_37	missense	26.53	31.43	SNP	1.000	A	13	35
INSL4	3641	genome.wustl.edu	37	9	5233699	5233699	+	Missense_Mutation	SNP	C	C	T	rs150771132		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:5233699C>T	ENST00000239316.4	+	2	347	c.242C>T	c.(241-243)aCg>aTg	p.T81M		NM_002195.1	NP_002186.1	Q14641	INSL4_HUMAN	insulin-like 4 (placenta)	81					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	insulin-like growth factor receptor binding (GO:0005159)|receptor binding (GO:0005102)			endometrium(2)|lung(2)|skin(1)|urinary_tract(1)	6	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.14)		GCCTTAGGTACGACATCAGAA	0.403													ENSG00000120211																																					0								C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	77.0	72.0	74.0		242	-4.1	0.0	9	dbSNP_134	74	0,8600		0,0,4300	no	missense	INSL4	NM_002195.1	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	81/140	5233699	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS6459.1	9p24	2008-02-05			ENSG00000120211	ENSG00000120211			6087	protein-coding gene	gene with protein product		600910				8666396, 9730618	Standard	NM_002195		Approved	EPIL	uc003ziy.3	Q14641	OTTHUMG00000019494	ENST00000239316.4:c.242C>T	9.37:g.5233699C>T	ENSP00000239316:p.Thr81Met		A8K678|Q5W127	Missense_Mutation	SNP	superfamily_Insulin-like,prints_Placentin,prints_Relaxin	p.T81M	ENST00000239316.4	37	c.242	CCDS6459.1	9	.	.	.	.	.	.	.	.	.	.	C	4.573	0.106524	0.08780	2.27E-4	0.0	ENSG00000120211	ENST00000239316	T	0.16457	2.34	2.03	-4.06	0.03986	.	4.493320	0.02149	N	0.057826	T	0.07683	0.0193	N	0.11756	0.17	0.09310	N	1	B	0.23854	0.092	B	0.08055	0.003	T	0.19031	-1.0318	10	0.14656	T	0.56	.	4.0282	0.09697	0.0:0.285:0.1847:0.5303	.	81	Q14641	INSL4_HUMAN	M	81	ENSP00000239316:T81M	ENSP00000239316:T81M	T	+	2	0	INSL4	5223699	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.430000	0.00473	-1.290000	0.02372	-1.407000	0.01130	ACG	rs150771132	INSL4	-	superfamily_Insulin-like,prints_Relaxin		0.403	INSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSL4	HGNC	protein_coding	OTTHUMT00000051616.2	0	0	1	87	87	134	0.00	0.74	C	NM_002195		5233699	+1	41	39	42	64	tier1	no_errors	ENST00000239316	ensembl	human	known	74_37	missense	49.40	37.86	SNP	0.000	T	41	42
PTPRB	5787	genome.wustl.edu	37	12	70956827	70956827	+	Missense_Mutation	SNP	C	C	T	rs376975449		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:70956827C>T	ENST00000261266.5	-	14	3340	c.3311G>A	c.(3310-3312)cGc>cAc	p.R1104H	PTPRB_ENST00000538708.1_Missense_Mutation_p.R1014H|PTPRB_ENST00000334414.6_Missense_Mutation_p.R1322H|PTPRB_ENST00000550358.1_Missense_Mutation_p.R1234H|PTPRB_ENST00000551525.1_Missense_Mutation_p.R1321H|PTPRB_ENST00000550857.1_Missense_Mutation_p.R1014H|PTPRB_ENST00000451516.2_Missense_Mutation_p.R1014H	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1104	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GGCGGTCCAGCGGAAGGACAG	0.552													ENSG00000127329																																					0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,3870		0,0,1935	49.0	47.0	47.0		3965,3041,3041,3311	1.8	1.0	12		47	1,8301		0,1,4150	no	missense,missense,missense,missense	PTPRB	NM_001109754.2,NM_001206971.1,NM_001206972.1,NM_002837.4	29,29,29,29	0,1,6085	TT,TC,CC		0.012,0.0,0.0082	benign,benign,benign,benign	1322/2216,1014/1908,1014/1908,1104/1998	70956827	1,12171	1935	4151	6086	SO:0001583	missense	0			-	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.3311G>A	12.37:g.70956827C>T	ENSP00000261266:p.Arg1104His		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R1322H	ENST00000261266.5	37	c.3965	CCDS44944.1	12	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882081	0.33255	0.0	1.2E-4	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35;0.35;0.35;0.35	5.89	1.76	0.24704	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.507136	0.24046	N	0.042058	T	0.28764	0.0713	N	0.03608	-0.345	0.22330	N	0.999194	B;B;B;B;B;B;B	0.14805	0.001;0.001;0.009;0.003;0.001;0.001;0.011	B;B;B;B;B;B;B	0.13407	0.003;0.005;0.009;0.005;0.003;0.005;0.008	T	0.22417	-1.0217	10	0.44086	T	0.13	.	13.1703	0.59593	0.0:0.4889:0.443:0.0682	.	1014;1014;1201;1321;1322;1104;1234	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;PTPRB_HUMAN;.	H	1322;1014;1234;1014;1014;1104;1321;1201	ENSP00000334928:R1322H;ENSP00000393028:R1014H;ENSP00000448058:R1234H;ENSP00000438927:R1014H;ENSP00000447302:R1014H;ENSP00000261266:R1104H;ENSP00000448349:R1321H;ENSP00000446982:R1201H	ENSP00000261266:R1104H	R	-	2	0	PTPRB	69243094	0.530000	0.26330	0.994000	0.49952	0.891000	0.51852	-0.002000	0.12924	0.353000	0.24079	0.591000	0.81541	CGC	-	PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.552	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	0	0	0	46	46	95	0.00	0.00	C			70956827	-1	14	21	36	97	tier1	no_errors	ENST00000334414	ensembl	human	known	74_37	missense	28.00	17.80	SNP	0.981	T	14	36
ZMYND11	10771	genome.wustl.edu	37	10	226045	226045	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:226045T>C	ENST00000397962.3	+	2	521	c.93T>C	c.(91-93)atT>atC	p.I31I	ZMYND11_ENST00000381602.4_5'UTR|ZMYND11_ENST00000402736.1_Silent_p.I31I|ZMYND11_ENST00000509513.2_Silent_p.I31I|ZMYND11_ENST00000381584.1_5'UTR|ZMYND11_ENST00000397959.3_Silent_p.I31I|ZMYND11_ENST00000381604.4_5'UTR|ZMYND11_ENST00000558098.2_Silent_p.I31I|ZMYND11_ENST00000381607.4_5'UTR|ZMYND11_ENST00000381591.1_Silent_p.I31I|ZMYND11_ENST00000309776.4_5'UTR|ZMYND11_ENST00000403354.1_Silent_p.I31I|ZMYND11_ENST00000602682.1_Silent_p.I31I			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	31					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AGAAGCAGATTGCCAACATTG	0.383													ENSG00000015171																																					0													122.0	111.0	114.0					10																	226045		1568	3582	5150	SO:0001819	synonymous_variant	0			-	X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.93T>C	10.37:g.226045T>C			B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Silent	SNP	pfam_PWWP_dom,pfam_Bromodomain,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_MYND,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.I31	ENST00000397962.3	37	c.93	CCDS7052.2	10																																																																																			-	ZMYND11	-	NULL		0.383	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND11	HGNC	protein_coding	OTTHUMT00000046382.4	0	0	0	106	106	111	0.00	0.00	T	NM_006624		226045	+1	19	17	51	57	tier1	no_errors	ENST00000381591	ensembl	human	known	74_37	silent	27.14	22.97	SNP	1.000	C	19	51
SH2D3A	10045	genome.wustl.edu	37	19	6760806	6760806	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:6760806T>A	ENST00000245908.6	-	3	531	c.262A>T	c.(262-264)Ata>Tta	p.I88L	SH2D3A_ENST00000599563.1_5'UTR|SH2D3A_ENST00000437152.3_Intron	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	88	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						AGAGCCGGTATGCTGGGGAAT	0.637													ENSG00000125731																																					0													72.0	69.0	70.0					19																	6760806		2203	4300	6503	SO:0001583	missense	0			-	AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.262A>T	19.37:g.6760806T>A	ENSP00000245908:p.Ile88Leu		A8K9R6|B4DRS7|Q9Y2X4	Missense_Mutation	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,prints_SH2	p.I88L	ENST00000245908.6	37	c.262	CCDS12173.1	19	.	.	.	.	.	.	.	.	.	.	T	1.667	-0.509886	0.04231	.	.	ENSG00000125731	ENST00000245908	T	0.55588	0.51	4.97	0.516	0.17019	SH2 motif (5);	0.621797	0.13259	N	0.401434	T	0.27933	0.0688	N	0.10733	0.035	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.03739	-1.1008	10	0.35671	T	0.21	-2.572	6.8989	0.24271	0.0:0.3378:0.2542:0.408	.	88	Q9BRG2	SH23A_HUMAN	L	88	ENSP00000245908:I88L	ENSP00000245908:I88L	I	-	1	0	SH2D3A	6711806	1.000000	0.71417	0.057000	0.19452	0.002000	0.02628	0.659000	0.24994	-0.022000	0.13986	-0.451000	0.05528	ATA	-	SH2D3A	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2		0.637	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D3A	HGNC	protein_coding	OTTHUMT00000458016.1	0	0	0	58	58	71	0.00	0.00	T	NM_005490		6760806	-1	16	27	44	70	tier1	no_errors	ENST00000245908	ensembl	human	known	74_37	missense	26.67	27.84	SNP	0.790	A	16	44
RECQL5	9400	genome.wustl.edu	37	17	73620669	73620669	+	IGR	SNP	C	C	T	rs547975613		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:73620669C>T	ENST00000317905.5	-	0	3704				MYO15B_ENST00000578382.2_3'UTR|RECQL5_ENST00000443199.2_5'Flank	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			ATGGGTATCACGGAGCCTCAG	0.617								Other identified genes with known or suspected DNA repair function					ENSG00000266714	C|||	1	0.000199681	0.0	0.0014	5008	,	,		19021	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001628	intergenic_variant	0			-	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762			17.37:g.73620669C>T			Q9H0B1|Q9P1W7|Q9UNC8	R	SNP	-	NULL	ENST00000317905.5	37	NULL	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	C	9.648	1.140708	0.21205	.	.	ENSG00000188126	ENST00000293201	D	0.86627	-2.15	4.95	-1.61	0.08399	.	.	.	.	.	T	0.78110	0.4232	.	.	.	0.09310	N	1	B;B	0.16802	0.019;0.007	B;B	0.06405	0.002;0.002	T	0.63537	-0.6615	8	0.40728	T	0.16	-22.1495	9.2007	0.37256	0.0:0.5362:0.2517:0.2122	.	222;196	Q9H614;Q8TCJ6	.;.	M	222	ENSP00000293201:T222M	ENSP00000293201:T222M	T	+	2	0	MYO15B	71132264	0.000000	0.05858	0.128000	0.21923	0.017000	0.09413	-1.630000	0.02028	-0.088000	0.12506	-0.448000	0.05591	ACG	-	MYO15B	-	-		0.617	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	MYO15B	HGNC	protein_coding	OTTHUMT00000448207.1	0	0	0	16	16	103	0.00	0.00	C	NM_004259		73620669	+1	5	34	16	89	tier1	no_errors	ENST00000577948	ensembl	human	known	74_37	rna	23.81	27.64	SNP	0.000	T	5	16
ZNF268	10795	genome.wustl.edu	37	12	133779442	133779442	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:133779442T>C	ENST00000536435.2	+	6	1500	c.1170T>C	c.(1168-1170)tgT>tgC	p.C390C	ZNF268_ENST00000228289.5_Silent_p.C390C|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000537565.1_Silent_p.C229C|ZNF268_ENST00000542986.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	390					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CATATGTGTGTAATGAATGTG	0.378													ENSG00000090612																																					0													21.0	21.0	21.0					12																	133779442		2085	4231	6316	SO:0001819	synonymous_variant	0			-	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.1170T>C	12.37:g.133779442T>C			Q8TDG8|Q96RH4|Q9BZJ9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C390	ENST00000536435.2	37	c.1170	CCDS45012.1	12																																																																																			-	ZNF268	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2	0	0	0	57	57	170	0.00	0.00	T	NM_152943		133779442	+1	13	52	43	123	tier1	no_errors	ENST00000228289	ensembl	human	known	74_37	silent	23.21	29.71	SNP	0.057	C	13	43
POM121	9883	genome.wustl.edu	37	7	72418883	72418883	+	IGR	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:72418883C>T	ENST00000434423.2	+	0	3750				POM121_ENST00000446813.1_Silent_p.H958H|NSUN5P2_ENST00000388955.4_RNA|POM121_ENST00000395270.1_Silent_p.H958H			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CTTTTGCTCACCAGCAAGAAC	0.473													ENSG00000196313																																					0													30.0	36.0	34.0					7																	72418883		2198	4296	6494	SO:0001628	intergenic_variant	0			-	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527		7.37:g.72418883C>T			A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Silent	SNP	NULL	p.H958	ENST00000434423.2	37	c.2874		7																																																																																			-	POM121	-	NULL		0.473	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	0	0	0	48	48	40	0.00	0.00	C			72418883	+1	15	9	52	51	tier1	no_errors	ENST00000395270	ensembl	human	known	74_37	silent	22.39	15.00	SNP	0.001	T	15	52
C1orf43	25912	genome.wustl.edu	37	1	154179927	154179927	+	3'UTR	SNP	C	C	T	rs375042634		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:154179927C>T	ENST00000368521.5	-	0	962				C1orf189_ENST00000368525.3_5'Flank|C1orf43_ENST00000483282.1_5'UTR|C1orf43_ENST00000368519.1_3'UTR|C1orf43_ENST00000350592.3_3'UTR|C1orf43_ENST00000362076.4_3'UTR	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43							integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					CCTTCAGCTCCGTCACAGAGT	0.517													ENSG00000143612																																					0								C	,,	2,4404	4.2+/-10.8	0,2,2201	121.0	124.0	123.0		,,	-3.0	0.0	1		123	0,8600		0,0,4300	no	utr-3,utr-3,utr-3	C1orf43	NM_001098616.1,NM_015449.2,NM_138740.2	,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,	,,	154179927	2,13004	2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.*2G>A	1.37:g.154179927C>T			A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	R	SNP	-	NULL	ENST00000368521.5	37	NULL	CCDS41404.1	1																																																																																			-	C1orf43	-	-		0.517	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf43	HGNC	protein_coding	OTTHUMT00000087664.2	0	0	0	62	62	71	0.00	0.00	C	NM_015449		154179927	-1	14	20	56	77	tier1	no_errors	ENST00000483282	ensembl	human	known	74_37	rna	20.00	20.62	SNP	0.001	T	14	56
IGSF11	152404	genome.wustl.edu	37	3	118621566	118621566	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:118621566G>A	ENST00000393775.2	-	7	1402	c.1097C>T	c.(1096-1098)cCg>cTg	p.P366L	IGSF11_ENST00000491903.1_Missense_Mutation_p.P338L|IGSF11_ENST00000441144.2_Missense_Mutation_p.P341L|IGSF11_ENST00000425327.2_Missense_Mutation_p.P365L|IGSF11_ENST00000489689.1_Missense_Mutation_p.P342L|IGSF11_ENST00000354673.2_Missense_Mutation_p.P365L	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	366					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						ATGTTGACCCGGGACCAGATG	0.522													ENSG00000144847																																					0													117.0	103.0	108.0					3																	118621566		2203	4300	6503	SO:0001583	missense	0			-	AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.1097C>T	3.37:g.118621566G>A	ENSP00000377370:p.Pro366Leu		C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P366L	ENST00000393775.2	37	c.1097	CCDS46891.1	3	.	.	.	.	.	.	.	.	.	.	G	10.46	1.355091	0.24512	.	.	ENSG00000144847	ENST00000425327;ENST00000393775;ENST00000489689;ENST00000354673;ENST00000441144;ENST00000491903	T;D;D;T;D;D	0.87571	-1.37;-1.57;-2.27;-1.37;-2.24;-2.16	5.28	4.39	0.52855	.	1.163760	0.06062	N	0.658464	T	0.76492	0.3995	N	0.08118	0	0.80722	D	1	B;B;B;B;B	0.25667	0.08;0.131;0.131;0.08;0.08	B;B;B;B;B	0.20384	0.008;0.029;0.018;0.013;0.013	T	0.55730	-0.8095	10	0.20519	T	0.43	.	12.221	0.54433	0.0828:0.0:0.9172:0.0	.	338;341;365;342;366	C9JBA5;Q5DX21-3;Q5DX21-2;C9JMW0;Q5DX21	.;.;.;.;IGS11_HUMAN	L	365;366;342;365;341;338	ENSP00000406092:P365L;ENSP00000377370:P366L;ENSP00000420486:P342L;ENSP00000346700:P365L;ENSP00000401240:P341L;ENSP00000417413:P338L	ENSP00000346700:P365L	P	-	2	0	IGSF11	120104256	1.000000	0.71417	0.111000	0.21465	0.105000	0.19272	6.806000	0.75195	1.440000	0.47531	0.655000	0.94253	CCG	-	IGSF11	-	NULL		0.522	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF11	HGNC	protein_coding	OTTHUMT00000355075.2	0	0	0	37	37	96	0.00	0.00	G			118621566	-1	11	18	34	60	tier1	no_errors	ENST00000393775	ensembl	human	known	74_37	missense	24.44	23.08	SNP	0.995	A	11	34
CACNA1H	8912	genome.wustl.edu	37	16	1271958	1271958	+	IGR	SNP	G	G	A	rs146886017		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:1271958G>A	ENST00000348261.5	+	0	8084				TPSG1_ENST00000234798.4_Missense_Mutation_p.R266C	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit						aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	ATGTGGCGGCGGATCCAGTTC	0.662													ENSG00000116176	g|||	1	0.000199681	0.0	0.0	5008	,	,		13674	0.001		0.0	False		,,,				2504	0.0																0									CYS/ARG	0,4392		0,0,2196	29.0	39.0	36.0		796	2.1	0.1	16	dbSNP_134	36	1,8595	1.2+/-3.3	0,1,4297	yes	missense	TPSG1	NM_012467.3	180	0,1,6493	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	266/322	1271958	1,12987	2196	4298	6494	SO:0001628	intergenic_variant	0			-	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180			16.37:g.1271958G>A			B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R266C	ENST00000348261.5	37	c.796	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	g	6.320	0.427207	0.11987	0.0	1.16E-4	ENSG00000116176	ENST00000234798	D	0.93426	-3.22	4.14	2.12	0.27331	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	.	.	.	.	D	0.89791	0.6817	L	0.58583	1.82	0.21105	N	0.999781	B	0.24721	0.11	B	0.15052	0.012	T	0.81803	-0.0765	9	0.72032	D	0.01	.	6.6357	0.22881	0.318:0.0:0.682:0.0	.	266	Q9NRR2	TRYG1_HUMAN	C	266	ENSP00000234798:R266C	ENSP00000234798:R266C	R	-	1	0	TPSG1	1211959	0.330000	0.24705	0.129000	0.21949	0.084000	0.17831	0.440000	0.21592	0.294000	0.22547	0.645000	0.84053	CGC	rs146886017	TPSG1	-	superfamily_Trypsin-like_Pept_dom,pfscan_Peptidase_S1		0.662	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	TPSG1	HGNC	protein_coding	OTTHUMT00000421601.1	0	0	0	27	27	32	0.00	0.00	G	NM_001005407		1271958	-1	6	17	11	29	tier1	no_errors	ENST00000234798	ensembl	human	known	74_37	missense	35.29	36.96	SNP	0.030	A	6	11
ZNF672	79894	genome.wustl.edu	37	1	249142625	249142625	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:249142625G>A	ENST00000306562.3	+	4	1898	c.1152G>A	c.(1150-1152)ctG>ctA	p.L384L		NM_024836.1	NP_079112.1	Q499Z4	ZN672_HUMAN	zinc finger protein 672	384					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(1)	5	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			AGCTTGCACTGCACCGCAAGA	0.642													ENSG00000171161																																					0													35.0	32.0	33.0					1																	249142625		2200	4300	6500	SO:0001819	synonymous_variant	0			-	AK027476	CCDS1638.1	1q44	2013-01-08			ENSG00000171161	ENSG00000171161		"""Zinc fingers, C2H2-type"""	26179	protein-coding gene	gene with protein product	"""hypothetical protein FLJ22301"""					12477932	Standard	NM_024836		Approved	FLJ22301	uc001iex.3	Q499Z4	OTTHUMG00000040377	ENST00000306562.3:c.1152G>A	1.37:g.249142625G>A			Q96H65|Q96IM3|Q9H6G5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L384	ENST00000306562.3	37	c.1152	CCDS1638.1	1																																																																																			-	ZNF672	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.642	ZNF672-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF672	HGNC	protein_coding	OTTHUMT00000097125.2	0	0	0	63	63	6	0.00	0.00	G	NM_024836		249142625	+1	20	2	34	10	tier1	no_errors	ENST00000306562	ensembl	human	known	74_37	silent	37.04	16.67	SNP	0.050	A	20	34
OR7G3	390883	genome.wustl.edu	37	19	9237062	9237062	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:9237062A>G	ENST00000305444.2	-	1	564	c.565T>C	c.(565-567)Tgt>Cgt	p.C189R		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						ACATCAGAACAGGCGAGCTTG	0.458													ENSG00000170920																																					0													73.0	71.0	71.0					19																	9237062		2203	4300	6503	SO:0001583	missense	0			-		CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.565T>C	19.37:g.9237062A>G	ENSP00000302867:p.Cys189Arg		Q6IFJ6|Q96R99	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C189R	ENST00000305444.2	37	c.565	CCDS32899.1	19	.	.	.	.	.	.	.	.	.	.	A	17.98	3.521841	0.64747	.	.	ENSG00000170920	ENST00000305444	T	0.00460	7.27	3.96	3.96	0.45880	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	U	0.000445	T	0.02727	0.0082	H	0.97962	4.115	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.02411	-1.1163	10	0.66056	D	0.02	.	12.2397	0.54536	1.0:0.0:0.0:0.0	.	189	Q8NG95	OR7G3_HUMAN	R	189	ENSP00000302867:C189R	ENSP00000302867:C189R	C	-	1	0	OR7G3	9098062	0.997000	0.39634	0.082000	0.20525	0.198000	0.23893	5.885000	0.69736	1.825000	0.53177	0.450000	0.29827	TGT	-	OR7G3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.458	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G3	HGNC	protein_coding	OTTHUMT00000384611.1	0	0	0	48	48	88	0.00	0.00	A			9237062	-1	12	22	29	72	tier1	no_errors	ENST00000305444	ensembl	human	known	74_37	missense	29.27	23.40	SNP	0.978	G	12	29
EHMT2	10919	genome.wustl.edu	37	6	31856193	31856193	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr6:31856193C>T	ENST00000375537.4	-	12	1462	c.1456G>A	c.(1456-1458)Gcc>Acc	p.A486T	EHMT2_ENST00000375528.4_Missense_Mutation_p.A509T|EHMT2_ENST00000375530.4_Missense_Mutation_p.A452T|EHMT2_ENST00000395728.3_Missense_Mutation_p.A543T|EHMT2_ENST00000480912.1_5'UTR	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	486					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						ACCATGCGGGCGCGGTGGGTC	0.657													ENSG00000204371																																					0													30.0	29.0	29.0					6																	31856193		1511	2708	4219	SO:0001583	missense	0			-	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1456G>A	6.37:g.31856193C>T	ENSP00000364687:p.Ala486Thr		B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.A543T	ENST00000375537.4	37	c.1627	CCDS4725.1	6	.	.	.	.	.	.	.	.	.	.	C	13.68	2.308804	0.40895	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.69435	-0.4;-0.37;-0.31;-0.39	4.62	4.62	0.57501	.	0.082618	0.47093	D	0.000243	T	0.18923	0.0454	N	0.01705	-0.755	0.42281	D	0.992099	P;P;P;P	0.41265	0.627;0.744;0.627;0.627	B;B;B;B	0.31245	0.087;0.115;0.053;0.126	T	0.19418	-1.0306	10	0.34782	T	0.22	.	10.0629	0.42286	0.0:0.9061:0.0:0.0939	.	509;452;486;300	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	T	543;509;452;486;300	ENSP00000379078:A543T;ENSP00000364678:A509T;ENSP00000364680:A452T;ENSP00000364687:A486T	ENSP00000364678:A509T	A	-	1	0	EHMT2	31964172	0.994000	0.37717	0.959000	0.39883	0.923000	0.55619	3.278000	0.51662	2.394000	0.81467	0.555000	0.69702	GCC	-	EHMT2	-	NULL		0.657	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	HGNC	protein_coding	OTTHUMT00000076355.5	0	0	0	41	41	12	0.00	0.00	C	NM_006709		31856193	-1	16	8	19	10	tier1	no_errors	ENST00000395728	ensembl	human	known	74_37	missense	45.71	44.44	SNP	0.895	T	16	19
TKTL2	84076	genome.wustl.edu	37	4	164394067	164394067	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:164394067T>C	ENST00000280605.3	-	1	980	c.820A>G	c.(820-822)Att>Gtt	p.I274V		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	274						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AATTTGACAATTGCATCTGCT	0.393													ENSG00000151005																																					0													151.0	154.0	153.0					4																	164394067		2203	4300	6503	SO:0001583	missense	0			-	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.820A>G	4.37:g.164394067T>C	ENSP00000280605:p.Ile274Val		A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.I274V	ENST00000280605.3	37	c.820	CCDS3805.1	4	.	.	.	.	.	.	.	.	.	.	T	0.138	-1.105229	0.01828	.	.	ENSG00000151005	ENST00000280605	T	0.21543	2.0	4.3	-3.9	0.04181	.	0.260506	0.33553	N	0.004797	T	0.10252	0.0251	N	0.16862	0.45	0.09310	N	1	B	0.10296	0.003	B	0.22152	0.038	T	0.29397	-1.0013	10	0.21014	T	0.42	-4.2401	11.0097	0.47654	0.0:0.465:0.0:0.535	.	274	Q9H0I9	TKTL2_HUMAN	V	274	ENSP00000280605:I274V	ENSP00000280605:I274V	I	-	1	0	TKTL2	164613517	0.000000	0.05858	0.000000	0.03702	0.240000	0.25518	-0.397000	0.07269	-0.718000	0.04949	-0.250000	0.11733	ATT	-	TKTL2	-	NULL		0.393	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL2	HGNC	protein_coding	OTTHUMT00000365207.1	0	0	0	26	26	71	0.00	0.00	T	NM_032136		164394067	-1	8	20	11	27	tier1	no_errors	ENST00000280605	ensembl	human	known	74_37	missense	42.11	42.55	SNP	0.000	C	8	11
DPYD	1806	genome.wustl.edu	37	1	98293695	98293695	+	Nonsense_Mutation	SNP	G	G	A	rs141597515		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:98293695G>A	ENST00000370192.3	-	3	308	c.208C>T	c.(208-210)Cga>Tga	p.R70*	DPYD_ENST00000423006.2_Nonsense_Mutation_p.R33*|DPYD_ENST00000306031.5_Nonsense_Mutation_p.R70*	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	70	4Fe-4S ferredoxin-type 1. {ECO:0000255|PROSITE-ProRule:PRU00711}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	AGAGCTCCTCGCTCACCAAGA	0.393													ENSG00000188641																																					0								G	stop/ARG,stop/ARG	0,4406		0,0,2203	104.0	92.0	96.0		208,208	4.8	1.0	1	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained	DPYD	NM_000110.3,NM_001160301.1	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	70/1026,70/174	98293695	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			-	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.208C>T	1.37:g.98293695G>A	ENSP00000359211:p.Arg70*		A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Nonsense_Mutation	SNP	pfam_Dihydroorotate_DH_1_2,pfam_Pyr_nucl-diS_OxRdtase_FAD/D,pfam_tR_hU_synthase,superfamily_Helical_ferredxn,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Dihydroorotate_DH	p.R70*	ENST00000370192.3	37	c.208	CCDS30777.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.284804	0.95517	0.0	1.16E-4	ENSG00000188641	ENST00000370192;ENST00000423006;ENST00000306031	.	.	.	5.68	4.75	0.60458	.	0.073205	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-10.178	15.7881	0.78326	0.0:0.0:0.8626:0.1374	.	.	.	.	X	70;33;70	.	ENSP00000307107:R70X	R	-	1	2	DPYD	98066283	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.334000	0.59291	1.356000	0.45884	0.563000	0.77884	CGA	rs141597515	DPYD	-	superfamily_Helical_ferredxn		0.393	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	HGNC	protein_coding	OTTHUMT00000095698.3	0	0	0	43	43	58	0.00	0.00	G	NM_000110		98293695	-1	7	16	19	36	tier1	no_errors	ENST00000370192	ensembl	human	known	74_37	nonsense	26.92	30.77	SNP	1.000	A	7	19
TFAP4	7023	genome.wustl.edu	37	16	4308095	4308095	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:4308095C>G	ENST00000204517.6	-	7	1306	c.978G>C	c.(976-978)caG>caC	p.Q326H		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	326					cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CCTCCCGGCTCTGGTCCATGG	0.711													ENSG00000090447																																					0													22.0	25.0	24.0					16																	4308095		2195	4299	6494	SO:0001583	missense	0			-	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.978G>C	16.37:g.4308095C>G	ENSP00000204517:p.Gln326His		O60409	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.Q326H	ENST00000204517.6	37	c.978	CCDS10510.1	16	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532369	0.45073	.	.	ENSG00000090447	ENST00000204517	D	0.98996	-5.31	4.57	4.57	0.56435	.	0.000000	0.45606	D	0.000343	D	0.97300	0.9117	L	0.44542	1.39	0.33943	D	0.643434	B	0.30824	0.296	B	0.35550	0.205	D	0.99972	1.2049	10	0.87932	D	0	.	10.8232	0.46617	0.0:0.9119:0.0:0.0881	.	326	Q01664	TFAP4_HUMAN	H	326	ENSP00000204517:Q326H	ENSP00000204517:Q326H	Q	-	3	2	TFAP4	4248096	.	.	1.000000	0.80357	0.979000	0.70002	.	.	2.376000	0.81061	0.585000	0.79938	CAG	-	TFAP4	-	NULL		0.711	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP4	HGNC	protein_coding	OTTHUMT00000251595.2	0	0	0	54	54	8	0.00	0.00	C	NM_003223		4308095	-1	10	2	26	10	tier1	no_errors	ENST00000204517	ensembl	human	known	74_37	missense	27.78	16.67	SNP	1.000	G	10	26
IFNW1	3467	genome.wustl.edu	37	9	21141119	21141119	+	Missense_Mutation	SNP	G	G	A	rs141528866	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:21141119G>A	ENST00000380229.2	-	1	1025	c.451C>T	c.(451-453)Cgt>Tgt	p.R151C		NM_002177.1	NP_002168.1	P05000	IFNW1_HUMAN	interferon, omega 1	151					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cell cycle arrest (GO:0007050)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|lung(2)|ovary(1)	5				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		AGGTAGACACGGATTCCCTGG	0.483													ENSG00000177047	G|||	2	0.000399361	0.0	0.0	5008	,	,		20561	0.0		0.002	False		,,,				2504	0.0																0								G	CYS/ARG	0,4406		0,0,2203	95.0	89.0	91.0		451	-5.1	0.0	9	dbSNP_134	91	1,8599	1.2+/-3.3	0,1,4299	yes	missense	IFNW1	NM_002177.1	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	151/196	21141119	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS6496.1	9p22	2010-12-10			ENSG00000177047	ENSG00000177047		"""Interferons"""	5448	protein-coding gene	gene with protein product	"""IFN-omega 1, interferon omega-1"""	147553				1385305	Standard	NM_002177		Approved		uc003zol.1	P05000	OTTHUMG00000019656	ENST00000380229.2:c.451C>T	9.37:g.21141119G>A	ENSP00000369578:p.Arg151Cys		Q13168|Q5U802|Q5VWD0|Q7M4P5	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.R151C	ENST00000380229.2	37	c.451	CCDS6496.1	9	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098409	0.37048	0.0	1.16E-4	ENSG00000177047	ENST00000380229	T	0.03524	3.9	4.44	-5.11	0.02901	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.357460	0.04432	N	0.369433	T	0.03871	0.0109	L	0.54323	1.7	0.09310	N	1	B	0.29253	0.239	B	0.28232	0.087	T	0.42378	-0.9455	10	0.56958	D	0.05	.	1.0381	0.01553	0.2381:0.1172:0.1844:0.4603	.	151	P05000	IFNW1_HUMAN	C	151	ENSP00000369578:R151C	ENSP00000369578:R151C	R	-	1	0	IFNW1	21131119	0.000000	0.05858	0.000000	0.03702	0.525000	0.34531	-1.339000	0.02652	-0.706000	0.05028	0.460000	0.39030	CGT	rs141528866	IFNW1	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta		0.483	IFNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNW1	HGNC	protein_coding	OTTHUMT00000051885.1	0	0	0	39	39	60	0.00	0.00	G	NM_002177		21141119	-1	8	16	18	36	tier1	no_errors	ENST00000380229	ensembl	human	known	74_37	missense	30.77	30.77	SNP	0.000	A	8	18
DTX1	1840	genome.wustl.edu	37	12	113515459	113515459	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:113515459C>T	ENST00000257600.3	+	2	993	c.490C>T	c.(490-492)Cgc>Tgc	p.R164C		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	164	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CCGCCAGAcgcgccggcgccg	0.677													ENSG00000135144																																					0													29.0	22.0	24.0					12																	113515459		2199	4295	6494	SO:0001583	missense	0			-	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.490C>T	12.37:g.113515459C>T	ENSP00000257600:p.Arg164Cys		O60630|Q9BS04	Missense_Mutation	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.R164C	ENST00000257600.3	37	c.490	CCDS9164.1	12	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869802	0.72065	.	.	ENSG00000135144	ENST00000257600	T	0.29655	1.56	3.32	2.39	0.29439	WWE domain (2);WWE domain, subgroup (1);	0.337915	0.27941	U	0.017224	T	0.23451	0.0567	N	0.24115	0.695	0.47547	D	0.999457	P	0.50710	0.938	P	0.45099	0.469	T	0.02288	-1.1182	10	0.66056	D	0.02	-12.3275	11.0069	0.47639	0.0:0.8077:0.1923:0.0	.	164	Q86Y01	DTX1_HUMAN	C	164	ENSP00000257600:R164C	ENSP00000257600:R164C	R	+	1	0	DTX1	111999842	1.000000	0.71417	0.997000	0.53966	0.899000	0.52679	5.370000	0.66144	0.326000	0.23384	0.205000	0.17691	CGC	-	DTX1	-	pfam_WWE-dom,smart_WWE-dom_subgr,pfscan_WWE-dom		0.677	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX1	HGNC	protein_coding	OTTHUMT00000405045.2	0	0	0	41	41	15	0.00	0.00	C			113515459	+1	9	5	22	12	tier1	no_errors	ENST00000257600	ensembl	human	known	74_37	missense	29.03	29.41	SNP	1.000	T	9	22
PDSS1	23590	genome.wustl.edu	37	10	27031457	27031457	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:27031457G>A	ENST00000376215.5	+	11	1111	c.1058G>A	c.(1057-1059)cGg>cAg	p.R353Q	PDSS1_ENST00000376203.5_Silent_p.T289T|PDSS1_ENST00000470978.1_3'UTR	NM_014317.3	NP_055132.2	Q5T2R2	DPS1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 1	353					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			autonomic_ganglia(1)|endometrium(1)|kidney(7)|large_intestine(6)|lung(5)|prostate(1)	21						ATCATGCGACGGTTCAGTTTG	0.378													ENSG00000148459																																					0													87.0	83.0	85.0					10																	27031457		2203	4300	6503	SO:0001583	missense	0			-	AF118395	CCDS31168.1	10p12.2	2006-04-12	2006-02-14	2006-02-14	ENSG00000148459	ENSG00000148459			17759	protein-coding gene	gene with protein product	"""coenzyme Q1 homolog (yeast)"""	607429	"""trans-prenyltransferase"""	TPRT		10972372	Standard	NM_014317		Approved	TPT, COQ1	uc001isv.3	Q5T2R2	OTTHUMG00000017844	ENST00000376215.5:c.1058G>A	10.37:g.27031457G>A	ENSP00000365388:p.Arg353Gln		Q53F75|Q6P473|Q86WQ8|Q9Y2W5	Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.R353Q	ENST00000376215.5	37	c.1058	CCDS31168.1	10	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032080	0.93575	.	.	ENSG00000148459	ENST00000376215;ENST00000396343	T	0.62232	0.04	4.94	4.94	0.65067	Terpenoid synthase (2);	0.000000	0.85682	D	0.000000	T	0.67664	0.2917	L	0.52759	1.655	0.80722	D	1	P;P	0.50710	0.659;0.938	B;P	0.50231	0.327;0.635	T	0.71550	-0.4559	10	0.62326	D	0.03	-21.3888	18.506	0.90897	0.0:0.0:1.0:0.0	.	91;353	B4DJY1;Q5T2R2	.;DPS1_HUMAN	Q	353;314	ENSP00000365388:R353Q	ENSP00000365388:R353Q	R	+	2	0	PDSS1	27071463	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	9.485000	0.97942	2.443000	0.82685	0.650000	0.86243	CGG	-	PDSS1	-	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth		0.378	PDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDSS1	HGNC	protein_coding	OTTHUMT00000047276.1	0	0	0	45	45	35	0.00	0.00	G			27031457	+1	7	5	23	15	tier1	no_errors	ENST00000376215	ensembl	human	known	74_37	missense	23.33	25.00	SNP	1.000	A	7	23
LRRK1	79705	genome.wustl.edu	37	15	101464888	101464888	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:101464888G>A	ENST00000388948.3	+	2	410	c.51G>A	c.(49-51)ccG>ccA	p.P17P	LRRK1_ENST00000284395.5_5'UTR|LRRK1_ENST00000532029.2_Silent_p.P17P	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.P17P(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTGTGGGGCCGGAGGAGTCAG	0.592													ENSG00000154237																																					1	Substitution - coding silent(1)	lung(1)											115.0	134.0	128.0					15																	101464888		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.51G>A	15.37:g.101464888G>A				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.P17	ENST00000388948.3	37	c.51	CCDS42086.1	15																																																																																			-	LRRK1	-	NULL		0.592	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	0	0	0	77	77	68	0.00	0.00	G	NM_024652		101464888	+1	12	20	48	58	tier1	no_errors	ENST00000388948	ensembl	human	known	74_37	silent	20.00	25.64	SNP	0.622	A	12	48
ZNF623	9831	genome.wustl.edu	37	8	144732482	144732482	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr8:144732482G>T	ENST00000501748.2	+	1	529	c.440G>T	c.(439-441)gGg>gTg	p.G147V	ZNF623_ENST00000458270.2_Missense_Mutation_p.G107V|ZNF623_ENST00000526926.1_Missense_Mutation_p.G107V	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	147					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCGCATGCTGGGGAGAAACCT	0.498													ENSG00000183309																																					0													107.0	91.0	97.0					8																	144732482		2203	4300	6503	SO:0001583	missense	0			-	AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.440G>T	8.37:g.144732482G>T	ENSP00000445979:p.Gly147Val		A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G147V	ENST00000501748.2	37	c.440	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	G	16.29	3.082104	0.55861	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.23552	1.9;1.9;1.9	4.02	2.2	0.27929	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46541	0.1398	M	0.79614	2.46	0.54753	D	0.999984	D	0.65815	0.995	D	0.70016	0.967	T	0.41106	-0.9527	9	0.87932	D	0	-17.9429	8.3959	0.32557	0.1781:0.0:0.8219:0.0	.	147	O75123	ZN623_HUMAN	V	107;107;107;147;147	ENSP00000435232:G107V;ENSP00000411139:G107V;ENSP00000445979:G147V	ENSP00000330358:G107V	G	+	2	0	ZNF623	144803625	0.909000	0.30893	0.827000	0.32855	0.517000	0.34286	2.367000	0.44213	0.477000	0.27464	0.655000	0.94253	GGG	-	ZNF623	-	pfscan_Znf_C2H2		0.498	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3	0	0	1	15	15	145	0.00	0.68	G	NM_014789		144732482	+1	8	42	17	126	tier1	no_errors	ENST00000501748	ensembl	human	known	74_37	missense	32.00	25.00	SNP	1.000	T	8	17
DLEC1	9940	genome.wustl.edu	37	3	38136528	38136528	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:38136528A>G	ENST00000308059.6	+	13	2099	c.2078A>G	c.(2077-2079)gAc>gGc	p.D693G	DLEC1_ENST00000452631.2_Missense_Mutation_p.D693G|DLEC1_ENST00000346219.3_Missense_Mutation_p.D693G					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CCCCACACAGACCACGAGTTC	0.522													ENSG00000008226																																					0													82.0	89.0	87.0					3																	38136528		2026	4186	6212	SO:0001583	missense	0			-	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.2078A>G	3.37:g.38136528A>G	ENSP00000308597:p.Asp693Gly			Missense_Mutation	SNP	superfamily_PapD-like	p.D693G	ENST00000308059.6	37	c.2078	CCDS2672.2	3	.	.	.	.	.	.	.	.	.	.	A	17.71	3.457317	0.63401	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.05513	3.44;3.43;3.66	5.25	4.01	0.46588	.	0.115140	0.56097	D	0.000023	T	0.19846	0.0477	M	0.71581	2.175	0.49798	D	0.999821	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.74023	0.982;0.925;0.982	T	0.00465	-1.1723	10	0.39692	T	0.17	-28.2272	10.1531	0.42805	0.8504:0.0:0.0:0.1496	.	693;693;693	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	G	693	ENSP00000308597:D693G;ENSP00000315914:D693G;ENSP00000410427:D693G	ENSP00000308597:D693G	D	+	2	0	DLEC1	38111532	1.000000	0.71417	0.977000	0.42913	0.279000	0.26890	6.594000	0.74104	1.955000	0.56771	0.533000	0.62120	GAC	-	DLEC1	-	NULL		0.522	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DLEC1	HGNC	protein_coding	OTTHUMT00000253745.3	0	0	0	21	21	75	0.00	0.00	A	NM_007337		38136528	+1	8	23	7	31	tier1	no_errors	ENST00000346219	ensembl	human	known	74_37	missense	53.33	42.59	SNP	1.000	G	8	7
ZMYND8	23613	genome.wustl.edu	37	20	45910883	45910883	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:45910883C>T	ENST00000311275.7	-	10	1154	c.901G>A	c.(901-903)Ggg>Agg	p.G301R	ZMYND8_ENST00000471951.2_Missense_Mutation_p.G321R|ZMYND8_ENST00000262975.4_Missense_Mutation_p.G301R|ZMYND8_ENST00000458360.2_Missense_Mutation_p.G296R|ZMYND8_ENST00000372023.3_Missense_Mutation_p.G296R|ZMYND8_ENST00000446994.2_Missense_Mutation_p.G238R|ZMYND8_ENST00000396281.4_Missense_Mutation_p.G301R|ZMYND8_ENST00000461685.1_Missense_Mutation_p.G321R|ZMYND8_ENST00000540497.1_Missense_Mutation_p.G296R|ZMYND8_ENST00000360911.3_Missense_Mutation_p.G296R|ZMYND8_ENST00000536340.1_Missense_Mutation_p.G328R|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000352431.2_Missense_Mutation_p.G321R|ZMYND8_ENST00000355972.4_Missense_Mutation_p.G301R	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	301	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			TCGACCTGCCCGTCTTTATCC	0.448													ENSG00000101040																																					0													109.0	108.0	108.0					20																	45910883		2203	4300	6503	SO:0001583	missense	0			-	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.901G>A	20.37:g.45910883C>T	ENSP00000312237:p.Gly301Arg		B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	pfam_DUF3544,pfam_Bromodomain,pfam_PWWP_dom,pfam_Znf_PHD-finger,pfam_Znf_MYND,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_MYND,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.G328R	ENST00000311275.7	37	c.982		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.997031|4.997031	0.93167|0.93167	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497|ENST00000467200	T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.72051|.	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62|.	6.03|6.03	5.1|5.1	0.69264|0.69264	PWWP (2);|.	0.147984|.	0.64402|.	N|.	0.000008|.	T|T	0.56499|0.56499	0.1989|0.1989	L|L	0.37630|0.37630	1.12|1.12	0.54753|0.54753	D|D	0.999987|0.999987	D;D;D;D;D;P;D;P;P;D;D;D;D;D;B;D;D|.	0.89917|.	0.999;0.995;1.0;1.0;1.0;0.695;1.0;0.923;0.526;1.0;1.0;1.0;1.0;1.0;0.427;0.992;0.992|.	D;P;D;D;D;B;D;B;B;D;D;D;D;D;B;P;P|.	0.79784|.	0.96;0.9;0.991;0.993;0.993;0.246;0.985;0.446;0.246;0.985;0.991;0.991;0.991;0.991;0.089;0.83;0.882|.	T|T	0.53272|0.53272	-0.8462|-0.8462	10|5	0.87932|.	D|.	0|.	-19.5952|-19.5952	13.5965|13.5965	0.61994|0.61994	0.0:0.9288:0.0:0.0712|0.0:0.9288:0.0:0.0712	.|.	296;328;296;296;295;321;301;296;321;321;301;238;296;296;321;296;301|.	B7ZM62;F5H0X3;Q2HXV7;Q2HXV3;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8|.	.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.|.	R|Q	296;301;296;301;321;321;301;328;301;238;321;296;296|227	ENSP00000354166:G296R;ENSP00000312237:G301R;ENSP00000392964:G296R;ENSP00000262975:G301R;ENSP00000420095:G321R;ENSP00000335537:G321R;ENSP00000379577:G301R;ENSP00000439800:G328R;ENSP00000348246:G301R;ENSP00000396725:G238R;ENSP00000418210:G321R;ENSP00000361093:G296R;ENSP00000443086:G296R|.	ENSP00000262975:G301R|.	G|R	-|-	1|2	0|0	ZMYND8|ZMYND8	45344290|45344290	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.834000|0.834000	0.47266|0.47266	7.818000|7.818000	0.86416|0.86416	1.572000|1.572000	0.49736|0.49736	0.557000|0.557000	0.71058|0.71058	GGG|CGG	-	ZMYND8	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom		0.448	ZMYND8-007	KNOWN	basic	protein_coding	ZMYND8	HGNC	protein_coding	OTTHUMT00000079596.2	0	0	0	75	75	136	0.00	0.00	C	NM_183047		45910883	-1	27	40	52	109	tier1	no_errors	ENST00000536340	ensembl	human	known	74_37	missense	34.18	26.85	SNP	1.000	T	27	52
TELO2	9894	genome.wustl.edu	37	16	1547054	1547054	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:1547054G>A	ENST00000262319.6	+	4	910	c.631G>A	c.(631-633)Gtg>Atg	p.V211M		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	211					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GGATTCCTCCGTGTCCTTCGT	0.617													ENSG00000100726																																					0													121.0	84.0	97.0					16																	1547054		2199	4300	6499	SO:0001583	missense	0			-	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.631G>A	16.37:g.1547054G>A	ENSP00000262319:p.Val211Met		D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	pfam_Telomere_length_regulation_dom,superfamily_ARM-type_fold	p.V211M	ENST00000262319.6	37	c.631	CCDS32363.1	16	.	.	.	.	.	.	.	.	.	.	g	12.38	1.919452	0.33908	.	.	ENSG00000100726	ENST00000262319	T	0.33216	1.42	5.05	1.6	0.23607	.	0.387835	0.26851	N	0.022163	T	0.21718	0.0523	L	0.60455	1.87	0.33543	D	0.595114	P	0.44986	0.847	B	0.36378	0.223	T	0.29761	-1.0001	10	0.32370	T	0.25	-30.0137	5.5524	0.17097	0.5511:0.0:0.4489:0.0	.	211	Q9Y4R8	TELO2_HUMAN	M	211	ENSP00000262319:V211M	ENSP00000262319:V211M	V	+	1	0	TELO2	1487055	0.038000	0.19896	0.151000	0.22473	0.015000	0.08874	0.281000	0.18810	0.535000	0.28714	-0.144000	0.13903	GTG	-	TELO2	-	NULL		0.617	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TELO2	HGNC	protein_coding	OTTHUMT00000103602.2	0	0	0	40	40	85	0.00	0.00	G	NM_016111		1547054	+1	7	21	36	79	tier1	no_errors	ENST00000262319	ensembl	human	known	74_37	missense	16.28	20.79	SNP	0.791	A	7	36
ALDH4A1	8659	genome.wustl.edu	37	1	19209672	19209672	+	Silent	SNP	C	C	T	rs142063145		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:19209672C>T	ENST00000375341.3	-	7	881	c.624G>A	c.(622-624)tcG>tcA	p.S208S	RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000454547.1_5'UTR|MIR4695_ENST00000577305.1_RNA|ALDH4A1_ENST00000538309.1_Silent_p.S148S|ALDH4A1_ENST00000538839.1_Silent_p.S208S|ALDH4A1_ENST00000290597.5_Silent_p.S208S	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	208					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGTTAAAGGGCGAGATGGCCG	0.667													ENSG00000159423	C|||	1	0.000199681	0.0008	0.0	5008	,	,		16822	0.0		0.0	False		,,,				2504	0.0																0								C	,,	1,4403	2.1+/-5.4	0,1,2201	38.0	41.0	40.0		444,624,624	-10.8	0.2	1	dbSNP_134	40	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	ALDH4A1	NM_001161504.1,NM_003748.3,NM_170726.2	,,	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	,,	148/504,208/564,208/564	19209672	1,12999	2202	4298	6500	SO:0001819	synonymous_variant	0			-	U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.624G>A	1.37:g.19209672C>T			A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Silent	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH	p.S208	ENST00000375341.3	37	c.624	CCDS188.1	1																																																																																			rs142063145	ALDH4A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH		0.667	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH4A1	HGNC	protein_coding	OTTHUMT00000006954.1	0	0	0	94	94	32	0.00	0.00	C			19209672	-1	13	5	59	29	tier1	no_errors	ENST00000290597	ensembl	human	known	74_37	silent	17.57	14.71	SNP	0.030	T	13	59
RB1	5925	genome.wustl.edu	37	13	48947629	48947629	+	Splice_Site	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr13:48947629G>A	ENST00000267163.4	+	12	1353		c.e12+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.?(23)|p.0?(15)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTATTTTAACGTAAGCCATAT	0.279		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	38	Unknown(23)|Whole gene deletion(15)	bone(12)|eye(6)|urinary_tract(5)|breast(5)|endometrium(3)|central_nervous_system(2)|lung(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)	GRCh37	CS890133|CS982341	RB1	S							80.0	87.0	84.0					13																	48947629		2202	4287	6489	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1215+1G>A	13.37:g.48947629G>A			A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	-	e12+1	ENST00000267163.4	37	c.1215+1	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681750	0.68042	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0805	0.93179	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47845630	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	7.247000	0.78257	2.510000	0.84645	0.563000	0.77884	.	-	RB1	-	-		0.279	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	27	27	57	0.00	0.00	G		Intron	48947629	+1	15	21	24	30	tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	splice_site	38.46	41.18	SNP	1.000	A	15	24
ZNF835	90485	genome.wustl.edu	37	19	57175104	57175104	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:57175104G>A	ENST00000537055.2	-	2	1694	c.1463C>T	c.(1462-1464)gCg>gTg	p.A488V		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						TCGGATGAGCGCGGAGGAGAA	0.627													ENSG00000127903																																					0													129.0	142.0	138.0					19																	57175104		2203	4300	6503	SO:0001583	missense	0			-	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1463C>T	19.37:g.57175104G>A	ENSP00000444747:p.Ala488Val		B7Z5Y0|G3V1S0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A488V	ENST00000537055.2	37	c.1463	CCDS56105.1	19	.	.	.	.	.	.	.	.	.	.	G	9.657	1.143228	0.21205	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.35973	1.28	2.17	1.04	0.20106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15262	0.0368	N	0.14661	0.345	0.09310	N	1	P	0.36959	0.575	B	0.15484	0.013	T	0.10474	-1.0628	9	0.27785	T	0.31	.	8.4197	0.32692	0.0:0.245:0.755:0.0	.	510	Q9Y2P0	ZN835_HUMAN	V	510;488	ENSP00000444747:A488V	ENSP00000341756:A510V	A	-	2	0	ZNF835	61866916	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	0.148000	0.16224	0.425000	0.26087	0.561000	0.74099	GCG	-	ZNF835	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.627	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF835	HGNC	protein_coding	OTTHUMT00000459800.1	0	0	0	26	26	28	0.00	0.00	G	NM_001005850		57175104	-1	10	4	26	16	tier1	no_errors	ENST00000537055	ensembl	human	known	74_37	missense	27.78	20.00	SNP	0.280	A	10	26
KIF9	64147	genome.wustl.edu	37	3	47281289	47281289	+	Intron	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:47281289A>G	ENST00000265529.3	-	18	2605				KIF9_ENST00000335044.2_Intron|KIF9_ENST00000352910.4_Intron|KIF9_ENST00000452770.2_Intron|KIF9_ENST00000444589.2_Intron|KIF9_ENST00000487440.1_5'UTR|KIF9-AS1_ENST00000429315.3_RNA			Q9HAQ2	KIF9_HUMAN	kinesin family member 9						ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GAGTGAGATGATGCATCTGAC	0.498													ENSG00000227398																									Colon(44;962 1147 15977 24541)												0													83.0	76.0	78.0					3																	47281289		2203	4300	6503	SO:0001627	intron_variant	0			-	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.1924+1001T>C	3.37:g.47281289A>G			Q86Z28|Q9H8A4	R	SNP	-	NULL	ENST00000265529.3	37	NULL	CCDS2752.1	3																																																																																			-	KIF9-AS1	-	-		0.498	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF9-AS1	HGNC	protein_coding	OTTHUMT00000257475.2	0	0	0	69	69	120	0.00	0.00	A			47281289	+1	13	23	33	61	tier1	no_errors	ENST00000429315	ensembl	human	known	74_37	rna	28.26	27.38	SNP	0.000	G	13	33
TSC2	7249	genome.wustl.edu	37	16	2126103	2126103	+	Missense_Mutation	SNP	G	G	A	rs137854068|rs397515098|rs376801256		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:2126103G>A	ENST00000219476.3	+	24	3304	c.2674G>A	c.(2674-2676)Gtc>Atc	p.V892I	TSC2_ENST00000350773.4_Missense_Mutation_p.V892I|TSC2_ENST00000439673.2_Missense_Mutation_p.V855I|TSC2_ENST00000382538.6_Missense_Mutation_p.V843I|TSC2_ENST00000353929.4_Missense_Mutation_p.V892I|TSC2_ENST00000401874.2_Missense_Mutation_p.V892I|TSC2_ENST00000568454.1_Missense_Mutation_p.V903I	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	892					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GGCCCATCACGTCATAGCCAT	0.562			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis				ENSG00000103197																											yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0								G	ILE/VAL,ILE/VAL,ILE/VAL	0,4396		0,0,2198	129.0	106.0	114.0		2674,2674,2674	5.1	1.0	16		114	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	TSC2	NM_000548.3,NM_001077183.1,NM_001114382.1	29,29,29	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	892/1808,892/1741,892/1785	2126103	1,12993	2198	4299	6497	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	-	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2674G>A	16.37:g.2126103G>A	ENSP00000219476:p.Val892Ile		A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom,prints_Tuberin	p.V892I	ENST00000219476.3	37	c.2674	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.213774	0.95069	0.0	1.16E-4	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.77;-2.77;-2.77	5.09	5.09	0.68999	Tuberin-type domain (1);	0.000000	0.85682	D	0.000000	D	0.94052	0.8094	L	0.55743	1.74	0.80722	D	1	D;P;D;D;D;D	0.89917	0.999;0.882;1.0;0.998;0.999;0.994	D;B;D;D;D;D	0.80764	0.974;0.411;0.97;0.934;0.994;0.972	D	0.93947	0.7228	10	0.49607	T	0.09	-46.1221	18.5131	0.90925	0.0:0.0:1.0:0.0	.	843;855;892;892;892;892	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	I	892;892;892;855;843;892	ENSP00000219476:V892I;ENSP00000384468:V892I;ENSP00000248099:V892I;ENSP00000399232:V855I;ENSP00000371978:V843I;ENSP00000344383:V892I	ENSP00000219476:V892I	V	+	1	0	TSC2	2066104	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.787000	0.99055	2.367000	0.80283	0.561000	0.74099	GTC	-	TSC2	-	pfam_Tuberin-type_domain,prints_Tuberin		0.562	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	0	0	1	60	60	129	0.00	0.77	G	NM_000548		2126103	+1	18	20	60	101	tier1	no_errors	ENST00000219476	ensembl	human	known	74_37	missense	23.08	16.53	SNP	1.000	A	18	60
GPCPD1	56261	genome.wustl.edu	37	20	5564938	5564938	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:5564938A>G	ENST00000379019.4	-	6	550	c.338T>C	c.(337-339)tTt>tCt	p.F113S	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	113	CBM20. {ECO:0000255|PROSITE- ProRule:PRU00594}.				glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						GTGGATTCCAAATTGTCCATC	0.303													ENSG00000125772																																					0													98.0	93.0	95.0					20																	5564938		2202	4299	6501	SO:0001583	missense	0			-		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.338T>C	20.37:g.5564938A>G	ENSP00000368305:p.Phe113Ser		D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,pfam_CBM_fam20,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Carb-bd-like_fold,pfscan_CBM_fam20	p.F113S	ENST00000379019.4	37	c.338	CCDS13090.1	20	.	.	.	.	.	.	.	.	.	.	A	21.3	4.128279	0.77549	.	.	ENSG00000125772	ENST00000379019	T	0.69806	-0.43	5.47	5.47	0.80525	Carbohydrate-binding-like fold (1);Glycoside hydrolase, carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.83496	0.5267	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86515	0.1812	10	0.87932	D	0	-13.2466	15.5399	0.76035	1.0:0.0:0.0:0.0	.	113	Q9NPB8	GPCP1_HUMAN	S	113	ENSP00000368305:F113S	ENSP00000368305:F113S	F	-	2	0	GPCPD1	5512938	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.006000	0.88564	2.074000	0.62210	0.482000	0.46254	TTT	-	GPCPD1	-	superfamily_Carb-bd-like_fold,pfscan_CBM_fam20		0.303	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPCPD1	HGNC	protein_coding	OTTHUMT00000077869.1	0	0	0	128	128	74	0.00	0.00	A	NM_019593		5564938	-1	39	27	68	35	tier1	no_errors	ENST00000379019	ensembl	human	known	74_37	missense	36.45	43.55	SNP	1.000	G	39	68
ZNF610	162963	genome.wustl.edu	37	19	52856965	52856965	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:52856965G>A	ENST00000403906.3	+	4	550	c.94G>A	c.(94-96)Gaa>Aaa	p.E32K	ZNF610_ENST00000601151.1_Missense_Mutation_p.E32K|ZNF610_ENST00000321287.8_Missense_Mutation_p.E32K|ZNF610_ENST00000327920.8_Missense_Mutation_p.E32K	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	32	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E32K(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		CGTGGCCATCGAATTCTCTCA	0.438													ENSG00000167554																																					1	Substitution - Missense(1)	large_intestine(1)											99.0	99.0	99.0					19																	52856965		2203	4300	6503	SO:0001583	missense	0			-	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.94G>A	19.37:g.52856965G>A	ENSP00000383922:p.Glu32Lys		A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E32K	ENST00000403906.3	37	c.94	CCDS12851.1	19	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795448	0.31777	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T;T	0.01767	4.65;4.65;4.65	1.47	0.375	0.16188	Krueppel-associated box (4);	.	.	.	.	T	0.02455	0.0075	M	0.79926	2.475	0.22292	N	0.999225	B;B	0.31611	0.284;0.331	B;B	0.18561	0.007;0.022	T	0.40001	-0.9586	9	0.56958	D	0.05	.	2.203	0.03928	0.1998:0.0:0.4993:0.3009	.	32;32	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	K	32	ENSP00000383922:E32K;ENSP00000324441:E32K;ENSP00000327597:E32K	ENSP00000324441:E32K	E	+	1	0	ZNF610	57548777	0.170000	0.23016	0.914000	0.36105	0.277000	0.26821	1.766000	0.38491	0.178000	0.19917	0.563000	0.77884	GAA	-	ZNF610	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.438	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	HGNC	protein_coding	OTTHUMT00000462880.1	0	0	0	117	117	65	0.00	0.00	G	NM_173530		52856965	+1	25	12	86	53	tier1	no_errors	ENST00000321287	ensembl	human	known	74_37	missense	22.52	18.46	SNP	0.891	A	25	86
PRLHR	2834	genome.wustl.edu	37	10	120353718	120353718	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:120353718G>A	ENST00000369169.1	-	1	1038	c.1039C>T	c.(1039-1041)Cgc>Tgc	p.R347C	PRLHR_ENST00000239032.2_Missense_Mutation_p.R347C			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	347					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		AACAGTTTGCGCAGCTCCTCG	0.612													ENSG00000119973																																					0													52.0	50.0	51.0					10																	120353718		2203	4300	6503	SO:0001583	missense	0			-	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.1039C>T	10.37:g.120353718G>A	ENSP00000358167:p.Arg347Cys		O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.R347C	ENST00000369169.1	37	c.1039	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	G	12.76	2.033463	0.35893	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.56275	0.47;0.47	4.53	2.52	0.30459	.	0.171828	0.39687	N	0.001289	T	0.40145	0.1105	L	0.55481	1.735	0.45995	D	0.998808	P	0.45212	0.853	B	0.29598	0.104	T	0.51260	-0.8728	10	0.87932	D	0	.	12.0806	0.53669	0.0:0.0:0.4401:0.5599	.	347	P49683	PRLHR_HUMAN	C	347	ENSP00000239032:R347C;ENSP00000358167:R347C	ENSP00000239032:R347C	R	-	1	0	PRLHR	120343708	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	3.991000	0.56973	1.079000	0.41038	0.561000	0.74099	CGC	-	PRLHR	-	pfam_7TM_GPCR_olfarory/Srsx,prints_Prolrel_pep_rcpt		0.612	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	HGNC	protein_coding	OTTHUMT00000050610.1	0	0	0	39	39	42	0.00	0.00	G	NM_004248		120353718	-1	9	14	27	26	tier1	no_errors	ENST00000239032	ensembl	human	known	74_37	missense	25.00	35.00	SNP	0.995	A	9	27
LENG8	114823	genome.wustl.edu	37	19	54967838	54967838	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:54967838G>A	ENST00000326764.5	+	11	1948	c.1469G>A	c.(1468-1470)cGc>cAc	p.R490H	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	453										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CCCACCAAGCGCAGTCGAAAG	0.672													ENSG00000167615																																					0													16.0	21.0	19.0					19																	54967838		2200	4292	6492	SO:0001583	missense	0			-	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.1469G>A	19.37:g.54967838G>A	ENSP00000318374:p.Arg490His		B0VJY9|Q8IZ27|Q8NCX6	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.R490H	ENST00000326764.5	37	c.1469	CCDS12894.1	19	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560161	0.65538	.	.	ENSG00000167615	ENST00000326764;ENST00000301196;ENST00000376526;ENST00000431846	T;T;T	0.34275	1.41;1.38;1.37	4.17	4.17	0.49024	.	0.073354	0.56097	D	0.000028	T	0.37156	0.0993	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.60117	0.843;0.869	T	0.04708	-1.0932	10	0.30078	T	0.28	-29.7529	8.5804	0.33626	0.1097:0.0:0.8903:0.0	.	490;453	Q96PV6-2;F8W9Q9	.;.	H	490;453;453;490	ENSP00000318374:R490H;ENSP00000365709:R453H;ENSP00000388053:R490H	ENSP00000301196:R453H	R	+	2	0	LENG8	59659650	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	3.477000	0.53151	2.275000	0.75901	0.462000	0.41574	CGC	-	LENG8	-	NULL		0.672	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG8	HGNC	protein_coding	OTTHUMT00000140523.2	0	0	0	65	65	11	0.00	0.00	G	NM_052925		54967838	+1	17	3	54	17	tier1	no_errors	ENST00000326764	ensembl	human	known	74_37	missense	23.94	15.00	SNP	1.000	A	17	54
LOC100190940	100190940	genome.wustl.edu	37	12	130521541	130521541	+	lincRNA	SNP	G	G	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:130521541G>T	ENST00000567788.1	-	0	1160				RP11-474D1.4_ENST00000561864.1_lincRNA																							TGGCTCGGCAGGTGCTCTGCG	0.592													ENSG00000214039																																					0																																												0			-																													12.37:g.130521541G>T				R	SNP	-	NULL	ENST00000567788.1	37	NULL		12																																																																																			-	RP11-474D1.3	-	-		0.592	RP11-474D1.3-001	KNOWN	basic	lincRNA	LOC100190940	Clone_based_vega_gene	lincRNA	OTTHUMT00000399498.1	0	0	0	17	17	68	0.00	0.00	G			130521541	-1	6	27	8	67	tier1	no_errors	ENST00000291374	ensembl	human	known	74_37	rna	42.86	28.72	SNP	0.142	T	6	8
GRK7	131890	genome.wustl.edu	37	3	141499460	141499460	+	Missense_Mutation	SNP	G	G	A	rs370398949		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:141499460G>A	ENST00000264952.2	+	2	994	c.857G>A	c.(856-858)cGt>cAt	p.R286H		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	286	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						GTGGGCACGCGTGGCCTGGAC	0.557													ENSG00000114124																																					0								G	HIS/ARG	0,4406		0,0,2203	106.0	99.0	101.0		857	1.8	0.4	3		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRK7	NM_139209.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	286/554	141499460	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.857G>A	3.37:g.141499460G>A	ENSP00000264952:p.Arg286His			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.R286H	ENST00000264952.2	37	c.857	CCDS3120.1	3	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093576	0.36952	0.0	1.16E-4	ENSG00000114124	ENST00000264952	T	0.66460	-0.21	4.79	1.78	0.24846	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.120019	0.56097	D	0.000030	T	0.63283	0.2498	L	0.38733	1.17	0.21697	N	0.99958	D	0.76494	0.999	P	0.59643	0.861	T	0.53718	-0.8399	10	0.66056	D	0.02	-6.1678	2.7919	0.05390	0.1573:0.1453:0.5472:0.1503	.	286	Q8WTQ7	GRK7_HUMAN	H	286	ENSP00000264952:R286H	ENSP00000264952:R286H	R	+	2	0	GRK7	142982150	0.754000	0.28360	0.380000	0.26093	0.081000	0.17604	1.652000	0.37313	0.432000	0.26286	-0.136000	0.14681	CGT	-	GRK7	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.557	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK7	HGNC	protein_coding	OTTHUMT00000353168.1	0	0	0	26	26	84	0.00	0.00	G	NM_139209		141499460	+1	11	20	21	53	tier1	no_errors	ENST00000264952	ensembl	human	known	74_37	missense	34.38	27.03	SNP	0.070	A	11	21
RFPL1	5988	genome.wustl.edu	37	22	29837909	29837909	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr22:29837909T>C	ENST00000354373.2	+	2	961	c.752T>C	c.(751-753)aTg>aCg	p.M251T	RFPL1S_ENST00000539579.1_RNA|RFPL1S_ENST00000461286.3_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1	251	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						TTTCTGGATATGGGCATGCAG	0.507													ENSG00000128250																																					0													145.0	114.0	125.0					22																	29837909		2203	4300	6503	SO:0001583	missense	0			-	AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516	ENST00000354373.2:c.752T>C	22.37:g.29837909T>C	ENSP00000346342:p.Met251Thr		Q6IC06|Q9UJ97	Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.M251T	ENST00000354373.2	37	c.752	CCDS13857.2	22	.	.	.	.	.	.	.	.	.	.	T	9.392	1.075667	0.20227	.	.	ENSG00000128250	ENST00000354373	T	0.60797	0.16	1.42	1.42	0.22433	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.51550	0.1681	M	0.69823	2.125	0.21184	N	0.999766	B	0.26318	0.146	B	0.25987	0.065	T	0.51803	-0.8659	9	0.62326	D	0.03	.	3.792	0.08724	0.3302:0.0:0.0:0.6698	.	251	O75677	RFPL1_HUMAN	T	251	ENSP00000346342:M251T	ENSP00000346342:M251T	M	+	2	0	RFPL1	28167909	0.719000	0.27986	0.031000	0.17742	0.304000	0.27724	1.855000	0.39378	0.563000	0.29222	0.164000	0.16699	ATG	-	RFPL1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.507	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFPL1	HGNC	protein_coding	OTTHUMT00000318719.1	0	0	0	146	146	124	0.00	0.00	T	NM_021026		29837909	+1	37	39	117	95	tier1	no_errors	ENST00000354373	ensembl	human	known	74_37	missense	23.87	29.10	SNP	0.857	C	37	117
FOXJ3	22887	genome.wustl.edu	37	1	42657144	42657144	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:42657144G>A	ENST00000372572.1	-	11	1492	c.1181C>T	c.(1180-1182)cCg>cTg	p.P394L	FOXJ3_ENST00000372573.1_Missense_Mutation_p.P394L|FOXJ3_ENST00000361346.1_Missense_Mutation_p.P394L|FOXJ3_ENST00000545068.1_Missense_Mutation_p.P394L|FOXJ3_ENST00000372571.1_5'Flank|FOXJ3_ENST00000361776.1_Missense_Mutation_p.P360L	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	394					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGAACGCTGCGGATGCTGCGG	0.592													ENSG00000198815																																					0													387.0	296.0	327.0					1																	42657144		2203	4300	6503	SO:0001583	missense	0			-	AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.1181C>T	1.37:g.42657144G>A	ENSP00000361653:p.Pro394Leu		A7MBL7|A7MD18|D3DPW2|Q9NSS7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P394L	ENST00000372572.1	37	c.1181	CCDS30689.1	1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446219	0.43429	.	.	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000361346;ENST00000361776;ENST00000545068;ENST00000445886	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	5.06	3.04	0.35103	.	0.877384	0.09715	N	0.765217	T	0.23249	0.0562	N	0.08118	0	0.54753	D	0.999986	P;B	0.34546	0.456;0.001	B;B	0.25291	0.059;0.001	T	0.07539	-1.0767	10	0.49607	T	0.09	.	5.6914	0.17831	0.1002:0.0:0.7065:0.1933	.	360;394	Q9UPW0-2;Q9UPW0	.;FOXJ3_HUMAN	L	394;394;394;360;394;360	ENSP00000361654:P394L;ENSP00000361653:P394L;ENSP00000354620:P394L;ENSP00000354449:P360L;ENSP00000439044:P394L;ENSP00000393408:P360L	ENSP00000354620:P394L	P	-	2	0	FOXJ3	42429731	1.000000	0.71417	0.990000	0.47175	0.871000	0.50021	1.063000	0.30567	1.269000	0.44280	0.484000	0.47621	CCG	-	FOXJ3	-	NULL		0.592	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FOXJ3	HGNC	protein_coding	OTTHUMT00000018310.1	0	0	0	48	48	72	0.00	0.00	G	NM_014947		42657144	-1	25	19	39	59	tier1	no_errors	ENST00000361346	ensembl	human	known	74_37	missense	38.46	24.36	SNP	0.981	A	25	39
TSSC4	10078	genome.wustl.edu	37	11	2423909	2423909	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:2423909G>A	ENST00000333256.6	+	3	489	c.46G>A	c.(46-48)Gaa>Aaa	p.E16K	TSSC4_ENST00000451491.2_Missense_Mutation_p.E16K|AC124057.5_ENST00000433035.1_RNA|TSSC4_ENST00000380996.5_Intron|TSSC4_ENST00000380992.1_Intron			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	16										endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGTGGAGGGCGAACACGGGAC	0.597													ENSG00000184281																																					0													61.0	44.0	50.0					11																	2423909		2184	4290	6474	SO:0001583	missense	0			-	AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895	ENST00000333256.6:c.46G>A	11.37:g.2423909G>A	ENSP00000331087:p.Glu16Lys		C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	NULL	p.E16K	ENST00000333256.6	37	c.46	CCDS7735.1	11	.	.	.	.	.	.	.	.	.	.	G	8.955	0.969076	0.18659	.	.	ENSG00000184281	ENST00000333256;ENST00000437110;ENST00000435795;ENST00000485682;ENST00000496468;ENST00000451491	T;T;T;T;T;T	0.47528	2.41;1.4;0.84;0.84;1.41;2.41	2.08	-0.176	0.13311	.	1.283990	0.05621	N	0.579924	T	0.30603	0.0770	N	0.22421	0.69	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.17018	-1.0383	9	.	.	.	.	5.5441	0.17053	0.3471:0.0:0.6529:0.0	.	16	Q9Y5U2	TSSC4_HUMAN	K	16	ENSP00000331087:E16K;ENSP00000396925:E16K;ENSP00000403475:E16K;ENSP00000431430:E16K;ENSP00000435013:E16K;ENSP00000411224:E16K	.	E	+	1	0	TSSC4	2380485	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.490000	0.22403	-0.047000	0.13423	-0.379000	0.06801	GAA	-	TSSC4	-	NULL		0.597	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC4	HGNC	protein_coding	OTTHUMT00000027369.3	0	0	0	53	53	40	0.00	0.00	G	NM_005706		2423909	+1	9	9	34	36	tier1	no_errors	ENST00000333256	ensembl	human	known	74_37	missense	20.93	20.00	SNP	0.000	A	9	34
C11orf57	55216	genome.wustl.edu	37	11	111952739	111952739	+	Silent	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:111952739T>C	ENST00000280352.9	+	5	990	c.354T>C	c.(352-354)ccT>ccC	p.P118P	C11orf57_ENST00000393047.3_Silent_p.P118P|C11orf57_ENST00000532163.1_Silent_p.P89P|C11orf57_ENST00000530104.1_3'UTR|C11orf57_ENST00000420986.2_Silent_p.P118P	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	118										autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AGTTATACCCTGAAGAATTTG	0.308													ENSG00000150776																																					0													86.0	84.0	85.0					11																	111952739		2201	4296	6497	SO:0001819	synonymous_variant	0			-	BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.354T>C	11.37:g.111952739T>C			Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Silent	SNP	NULL	p.P118	ENST00000280352.9	37	c.354	CCDS41715.1	11																																																																																			-	C11orf57	-	NULL		0.308	C11orf57-001	KNOWN	basic|CCDS	protein_coding	C11orf57	HGNC	protein_coding	OTTHUMT00000316852.1	0	0	0	66	66	112	0.00	0.00	T	NM_018195		111952739	+1	19	31	26	68	tier1	no_errors	ENST00000393047	ensembl	human	known	74_37	silent	42.22	31.31	SNP	1.000	C	19	26
ANKRD13A	88455	genome.wustl.edu	37	12	110474119	110474119	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:110474119C>T	ENST00000261739.4	+	14	1729	c.1563C>T	c.(1561-1563)gaC>gaT	p.D521D	C12orf76_ENST00000546651.2_Intron	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	521						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						ACACCTATGACGCCCAGTATG	0.498													ENSG00000076513																																					0													204.0	181.0	189.0					12																	110474119		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.1563C>T	12.37:g.110474119C>T			O60736	Silent	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.D521	ENST00000261739.4	37	c.1563	CCDS9140.1	12																																																																																			-	ANKRD13A	-	smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif		0.498	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD13A	HGNC	protein_coding	OTTHUMT00000403430.1	0	0	0	34	34	125	0.00	0.00	C	NM_033121		110474119	+1	9	18	41	92	tier1	no_errors	ENST00000261739	ensembl	human	known	74_37	silent	18.00	15.93	SNP	0.066	T	9	41
CPA3	1359	genome.wustl.edu	37	3	148601470	148601470	+	Silent	SNP	G	G	A	rs200538548		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:148601470G>A	ENST00000296046.3	+	9	901	c.849G>A	c.(847-849)acG>acA	p.T283T	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	283					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			AGAAAGAGACGAAAGCTGTCA	0.448													ENSG00000163751																																					0								G		0,4406		0,0,2203	89.0	84.0	86.0		849	-5.6	1.0	3		86	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CPA3	NM_001870.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		283/418	148601470	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.849G>A	3.37:g.148601470G>A			Q96E94	Silent	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.T283	ENST00000296046.3	37	c.849	CCDS3138.1	3																																																																																			rs200538548	CPA3	-	pfam_Peptidase_M14,smart_Peptidase_M14		0.448	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA3	HGNC	protein_coding	OTTHUMT00000355974.1	0	0	0	39	39	86	0.00	0.00	G	NM_001870		148601470	+1	13	18	47	68	tier1	no_errors	ENST00000296046	ensembl	human	known	74_37	silent	21.67	20.93	SNP	0.972	A	13	47
FXR1	8087	genome.wustl.edu	37	3	180680695	180680695	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:180680695C>T	ENST00000357559.4	+	12	1486	c.1102C>T	c.(1102-1104)Cgc>Tgc	p.R368C	FXR1_ENST00000305586.7_Missense_Mutation_p.R283C|FXR1_ENST00000445140.2_Missense_Mutation_p.R368C|FXR1_ENST00000480918.1_Missense_Mutation_p.R355C|FXR1_ENST00000468861.1_Missense_Mutation_p.R283C|FXR1_ENST00000491062.1_Missense_Mutation_p.R319C	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	368					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			AAGAATGGAACGCCTACAGAT	0.388													ENSG00000114416																																					0													155.0	160.0	158.0					3																	180680695		2203	4300	6503	SO:0001583	missense	0			-	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1102C>T	3.37:g.180680695C>T	ENSP00000350170:p.Arg368Cys		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,superfamily_-bd_OB-fold,smart_KH_dom,pfscan_KH_dom_type_1	p.R368C	ENST00000357559.4	37	c.1102	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	C	19.58	3.853650	0.71719	.	.	ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000480918	T;T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29;0.29	5.38	4.39	0.52855	.	0.000000	0.85682	D	0.000000	T	0.71350	0.3329	M	0.68952	2.095	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D	0.79784	0.975;0.984;0.984;0.959;0.921;0.993	T	0.73448	-0.3979	10	0.87932	D	0	-39.738	11.1738	0.48588	0.3929:0.6071:0.0:0.0	.	355;319;283;283;368;368	B4DXZ6;E9PFF5;E7EU85;E7ERF5;P51114-2;P51114	.;.;.;.;.;FXR1_HUMAN	C	368;283;319;283;368;355	ENSP00000350170:R368C;ENSP00000307633:R283C;ENSP00000420643:R319C;ENSP00000420515:R283C;ENSP00000388828:R368C;ENSP00000418097:R355C	ENSP00000307633:R283C	R	+	1	0	FXR1	182163389	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.120000	0.41968	2.682000	0.91365	0.591000	0.81541	CGC	-	FXR1	-	pfam_Frag_X_MRP_fam		0.388	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	0	0	0	72	72	93	0.00	0.00	C			180680695	+1	23	25	62	98	tier1	no_errors	ENST00000357559	ensembl	human	known	74_37	missense	27.06	20.33	SNP	1.000	T	23	62
KIAA1147	57189	genome.wustl.edu	37	7	141364761	141364761	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:141364761G>A	ENST00000536163.1	-	7	1045	c.1046C>T	c.(1045-1047)cCg>cTg	p.P349L	RP5-894A10.6_ENST00000602609.1_RNA|KIAA1147_ENST00000482493.1_Missense_Mutation_p.P245L	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	349										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					CTTCAGCAGCGGCTGCAGGTG	0.567													ENSG00000257093																																					0													71.0	77.0	75.0					7																	141364761		2056	4192	6248	SO:0001583	missense	0			-	AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.1046C>T	7.37:g.141364761G>A	ENSP00000445768:p.Pro349Leu		Q9ULS3	Missense_Mutation	SNP	pfam_DUF2347	p.P349L	ENST00000536163.1	37	c.1046	CCDS47726.1	7	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245097	0.79912	.	.	ENSG00000257093	ENST00000536163;ENST00000482493	.	.	.	5.27	5.27	0.74061	.	0.053651	0.85682	D	0.000000	T	0.52709	0.1751	L	0.60455	1.87	0.80722	D	1	P	0.49307	0.922	B	0.37888	0.26	T	0.56275	-0.8006	9	0.32370	T	0.25	-24.2287	17.0701	0.86571	0.0:0.0:1.0:0.0	.	349	A4D1U4	LCHN_HUMAN	L	349;245	.	ENSP00000297761:P349L	P	-	2	0	KIAA1147	141011230	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.839000	0.69395	2.447000	0.82792	0.561000	0.74099	CCG	-	KIAA1147	-	pfam_DUF2347		0.567	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1147	HGNC	protein_coding	OTTHUMT00000349104.1	0	0	0	24	24	27	0.00	0.00	G			141364761	-1	7	10	15	41	tier1	no_errors	ENST00000536163	ensembl	human	known	74_37	missense	31.82	19.23	SNP	1.000	A	7	15
SYNJ1	8867	genome.wustl.edu	37	21	34060616	34060616	+	Splice_Site	SNP	C	C	A	rs565013600	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr21:34060616C>A	ENST00000322229.7	-	6	850	c.851G>T	c.(850-852)aGg>aTg	p.R284M	SYNJ1_ENST00000357345.3_Splice_Site_p.R284M|SYNJ1_ENST00000433931.2_Splice_Site_p.R323M|SYNJ1_ENST00000382491.3_Splice_Site_p.R284M|SYNJ1_ENST00000382499.2_Splice_Site_p.R323M			O43426	SYNJ1_HUMAN	synaptojanin 1	284	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						ATTGTCTTACCTGTCAAAAGC	0.348													ENSG00000159082																																					0													76.0	64.0	68.0					21																	34060616		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.851+1G>T	21.37:g.34060616C>A			O43425|O94984|Q4KMR1	Missense_Mutation	SNP	pfam_Syja_N,pfam_Endo/exonuclease/phosphatase,pfam_DUF1866,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.R323M	ENST00000322229.7	37	c.968	CCDS54484.1	21	.	.	.	.	.	.	.	.	.	.	C	34	5.311300	0.95655	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236	T;T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23;0.23	6.16	6.16	0.99307	Synaptojanin, N-terminal (2);	0.038124	0.85682	D	0.000000	T	0.79953	0.4535	M	0.82193	2.58	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.997;0.998;0.997;0.996	T	0.78510	-0.2176	9	.	.	.	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	284;323;284;284;284	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	M	284;284;323;323;284;284	ENSP00000371931:R284M;ENSP00000349903:R284M;ENSP00000371939:R323M;ENSP00000409667:R323M;ENSP00000322234:R284M;ENSP00000413649:R284M	.	R	-	2	0	SYNJ1	32982487	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.193000	0.77780	2.937000	0.99478	0.650000	0.86243	AGG	-	SYNJ1	-	pfam_Syja_N,pfscan_Syja_N		0.348	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	HGNC	protein_coding		0	0	0	62	62	115	0.00	0.00	C		Missense_Mutation	34060616	-1	18	29	40	52	tier1	no_errors	ENST00000433931	ensembl	human	known	74_37	missense	31.03	35.80	SNP	1.000	A	18	40
DUOX1	53905	genome.wustl.edu	37	15	45455992	45455992	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr15:45455992T>C	ENST00000321429.4	+	34	4816	c.4409T>C	c.(4408-4410)aTc>aCc	p.I1470T	DUOX1_ENST00000561166.1_Missense_Mutation_p.I1116T|DUOX1_ENST00000389037.3_Missense_Mutation_p.I1470T|CTD-2651B20.1_ENST00000558039.1_lincRNA	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1470					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CCATAGTACATCTGTGAGCGG	0.572											OREG0023103	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000137857																																					0													139.0	125.0	130.0					15																	45455992		2198	4298	6496	SO:0001583	missense	0			-	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.4409T>C	15.37:g.45455992T>C	ENSP00000317997:p.Ile1470Thr	931	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_D-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF_hand_dom,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_hand_dom,pfscan_Haem_peroxidase_animal	p.I1470T	ENST00000321429.4	37	c.4409	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	T	20.3	3.970246	0.74246	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.94828	-3.53;-3.53	4.21	4.21	0.49690	Ferric reductase, NAD binding (1);	0.054958	0.64402	D	0.000001	D	0.95526	0.8546	L	0.52364	1.645	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	D	0.95564	0.8632	10	0.87932	D	0	-26.9461	11.2976	0.49288	0.0:0.0:0.0:1.0	.	1470	Q9NRD9	DUOX1_HUMAN	T	1470	ENSP00000317997:I1470T;ENSP00000373689:I1470T	ENSP00000317997:I1470T	I	+	2	0	DUOX1	43243284	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.752000	0.85141	1.764000	0.52075	0.402000	0.26972	ATC	-	DUOX1	-	pfam_Fe_red_D-bd_6		0.572	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	0	0	0	61	61	118	0.00	0.00	T	NM_017434		45455992	+1	19	34	42	87	tier1	no_errors	ENST00000321429	ensembl	human	known	74_37	missense	31.15	28.10	SNP	1.000	C	19	42
ADARB2	105	genome.wustl.edu	37	10	1262943	1262943	+	Missense_Mutation	SNP	C	C	T	rs151300637		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:1262943C>T	ENST00000381312.1	-	7	1955	c.1630G>A	c.(1630-1632)Gtc>Atc	p.V544I	ADARB2_ENST00000469464.1_5'UTR	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	544	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CCCAGCAGGACGCCGTCCCAG	0.687													ENSG00000185736																																					0								C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	53.0	45.0	47.0		1630	-0.1	1.0	10	dbSNP_134	47	0,8600		0,0,4300	no	missense	ADARB2	NM_018702.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	544/740	1262943	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1630G>A	10.37:g.1262943C>T	ENSP00000370713:p.Val544Ile		B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsR-bd_dom,smart_dsR-bd_dom,smart_A_deamin,pfscan_dsR-bd_dom,pfscan_A_deamin	p.V544I	ENST00000381312.1	37	c.1630	CCDS7058.1	10	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441435	0.43326	2.27E-4	0.0	ENSG00000185736	ENST00000381312	D	0.93488	-3.23	5.31	-0.102	0.13613	Adenosine deaminase/editase (3);	0.191423	0.44902	N	0.000418	D	0.87325	0.6149	L	0.38531	1.155	0.80722	D	1	B	0.12630	0.006	B	0.21546	0.035	T	0.74269	-0.3720	10	0.33141	T	0.24	-27.591	9.0992	0.36658	0.0:0.5989:0.0:0.4011	.	544	Q9NS39	RED2_HUMAN	I	544	ENSP00000370713:V544I	ENSP00000370713:V544I	V	-	1	0	ADARB2	1252943	1.000000	0.71417	0.989000	0.46669	0.867000	0.49689	2.661000	0.46758	-0.333000	0.08476	-0.657000	0.03884	GTC	rs151300637	ADARB2	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.687	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	HGNC	protein_coding	OTTHUMT00000046426.1	0	0	0	118	118	16	0.00	0.00	C	NM_018702		1262943	-1	28	3	51	10	tier1	no_errors	ENST00000381312	ensembl	human	known	74_37	missense	35.00	23.08	SNP	1.000	T	28	51
LILRB1	10859	genome.wustl.edu	37	19	55147800	55147800	+	Intron	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:55147800C>T	ENST00000396331.1	+	15	2007				LILRB1_ENST00000396327.3_Intron|LILRB1_ENST00000434867.2_Intron|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396315.1_Intron|LILRB1_ENST00000396317.1_Intron|LILRB1_ENST00000427581.2_Intron|LILRB1_ENST00000324602.7_Intron|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396332.4_Intron|LILRB1_ENST00000418536.2_Intron	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		agcgagggagcggccagaccC	0.622										HNSCC(37;0.09)			ENSG00000104972																																					0																																										SO:0001627	intron_variant	0			-	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1651-148C>T	19.37:g.55147800C>T			A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	R	SNP	-	NULL	ENST00000396331.1	37	NULL	CCDS42617.1	19																																																																																			-	LILRB1	-	-		0.622	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	0	0	0	29	29	53	0.00	0.00	C			55147800	+1	7	16	8	36	tier1	no_errors	ENST00000462628	ensembl	human	known	74_37	rna	46.67	30.77	SNP	0.000	T	7	8
PIK3C2A	5286	genome.wustl.edu	37	11	17121490	17121490	+	Silent	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:17121490A>G	ENST00000265970.7	-	25	4034	c.4035T>C	c.(4033-4035)ctT>ctC	p.L1345L	PIK3C2A_ENST00000531428.1_5'UTR|PIK3C2A_ENST00000540361.1_Silent_p.L965L	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1345	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						GAATACTTGTAAGTTCTGGTA	0.353													ENSG00000011405																																					0													97.0	99.0	98.0					11																	17121490		2200	4292	6492	SO:0001819	synonymous_variant	0			-	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.4035T>C	11.37:g.17121490A>G			B0LPH2|B4E2G4|Q14CQ9	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,pfscan_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.L1345	ENST00000265970.7	37	c.4035	CCDS7824.1	11																																																																																			-	PIK3C2A	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.353	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2A	HGNC	protein_coding	OTTHUMT00000387553.1	0	0	0	130	130	120	0.00	0.00	A	NM_002645		17121490	-1	40	46	91	95	tier1	no_errors	ENST00000265970	ensembl	human	known	74_37	silent	30.53	32.62	SNP	0.997	G	40	91
STAB1	23166	genome.wustl.edu	37	3	52554459	52554459	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:52554459G>A	ENST00000321725.6	+	53	5619	c.5543G>A	c.(5542-5544)cGg>cAg	p.R1848Q		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1848	FAS1 6. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		ATTGTGCAGCGGCACTTGCCC	0.607													ENSG00000010327																																					0													70.0	65.0	67.0					3																	52554459		2203	4300	6503	SO:0001583	missense	0			-	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5543G>A	3.37:g.52554459G>A	ENSP00000312946:p.Arg1848Gln		A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.R1848Q	ENST00000321725.6	37	c.5543	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.940252	0.97128	.	.	ENSG00000010327	ENST00000321725	D	0.90620	-2.7	6.07	6.07	0.98685	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.95153	0.8429	M	0.71581	2.175	0.52501	D	0.999958	D	0.89917	1.0	D	0.97110	1.0	D	0.94874	0.8033	10	0.72032	D	0.01	.	18.8245	0.92111	0.0:0.0:1.0:0.0	.	1848	Q9NY15	STAB1_HUMAN	Q	1848	ENSP00000312946:R1848Q	ENSP00000312946:R1848Q	R	+	2	0	STAB1	52529499	0.995000	0.38212	0.997000	0.53966	0.969000	0.65631	5.770000	0.68873	2.884000	0.98904	0.655000	0.94253	CGG	-	STAB1	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain		0.607	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	0	0	0	26	26	53	0.00	0.00	G	NM_015136		52554459	+1	6	6	7	16	tier1	no_errors	ENST00000321725	ensembl	human	known	74_37	missense	46.15	27.27	SNP	1.000	A	6	7
TENM2	57451	genome.wustl.edu	37	5	167552021	167552021	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:167552021C>T	ENST00000518659.1	+	11	2214	c.2175C>T	c.(2173-2175)tgC>tgT	p.C725C	TENM2_ENST00000520394.1_Silent_p.C493C|TENM2_ENST00000519204.1_Silent_p.C604C|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000545108.1_Silent_p.C725C|TENM2_ENST00000403607.2_Silent_p.C558C	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	725	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TCTGCAGCTGCGATCCCAACT	0.602													ENSG00000145934																																					0													42.0	48.0	46.0					5																	167552021		2102	4199	6301	SO:0001819	synonymous_variant	0			-	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2175C>T	5.37:g.167552021C>T			Q9ULU2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.C725	ENST00000518659.1	37	c.2175		5																																																																																			-	TENM2	-	pfam_EGF_extracell,smart_EG-like_dom,pfscan_EG-like_dom		0.602	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	0	0	0	48	48	81	0.00	0.00	C	NM_001122679		167552021	+1	10	37	31	85	tier1	no_errors	ENST00000518659	ensembl	human	known	74_37	silent	24.39	30.33	SNP	0.929	T	10	31
ADRBK1	156	genome.wustl.edu	37	11	67049161	67049161	+	Missense_Mutation	SNP	C	C	T	rs543467610		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:67049161C>T	ENST00000308595.5	+	10	1078	c.788C>T	c.(787-789)aCg>aTg	p.T263M	ADRBK1_ENST00000526285.1_Missense_Mutation_p.T263M	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	GCGTTCCACACGCCAGACAAG	0.662													ENSG00000173020	C|||	1	0.000199681	0.0	0.0	5008	,	,		15530	0.0		0.0	False		,,,				2504	0.001																0													95.0	83.0	87.0					11																	67049161		2200	4295	6495	SO:0001583	missense	0			-	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.788C>T	11.37:g.67049161C>T	ENSP00000312262:p.Thr263Met		B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.T263M	ENST00000308595.5	37	c.788	CCDS8156.1	11	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652631	0.47362	.	.	ENSG00000173020	ENST00000308595;ENST00000526285	T;T	0.67865	-0.29;-0.29	5.0	4.09	0.47781	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.090634	0.47852	N	0.000215	D	0.83031	0.5166	M	0.87758	2.905	0.49582	D	0.9998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.993	D	0.86144	0.1583	10	0.87932	D	0	-17.13	13.5882	0.61944	0.0:0.9242:0.0:0.0758	.	263;263	P25098;E9PRV7	ARBK1_HUMAN;.	M	263	ENSP00000312262:T263M;ENSP00000434126:T263M	ENSP00000312262:T263M	T	+	2	0	ADRBK1	66805737	1.000000	0.71417	0.862000	0.33874	0.001000	0.01503	7.079000	0.76829	1.252000	0.44001	-0.218000	0.12543	ACG	-	ADRBK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.662	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRBK1	HGNC	protein_coding	OTTHUMT00000393153.1	0	0	0	34	34	45	0.00	0.00	C	NM_001619		67049161	+1	4	9	15	26	tier1	no_errors	ENST00000308595	ensembl	human	known	74_37	missense	21.05	25.71	SNP	0.997	T	4	15
OSBPL10	114884	genome.wustl.edu	37	3	31871582	31871582	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:31871582C>T	ENST00000396556.2	-	4	801	c.679G>A	c.(679-681)Gcc>Acc	p.A227T	OSBPL10_ENST00000467647.1_5'UTR|OSBPL10_ENST00000438237.2_Intron	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	227					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GCTCTTCGGGCGGCTGCAGGC	0.587													ENSG00000144645																																					0													62.0	55.0	57.0					3																	31871582		2203	4300	6503	SO:0001583	missense	0			-	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.679G>A	3.37:g.31871582C>T	ENSP00000379804:p.Ala227Thr		B4E212|Q9BTU5	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A227T	ENST00000396556.2	37	c.679	CCDS2651.1	3	.	.	.	.	.	.	.	.	.	.	C	31	5.079806	0.94050	.	.	ENSG00000144645	ENST00000396556;ENST00000428241	T;T	0.44083	0.93;0.93	5.81	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.36690	0.0976	L	0.59436	1.845	0.80722	D	1	P	0.52061	0.95	B	0.39258	0.295	T	0.24083	-1.0170	10	0.14252	T	0.57	-21.3896	14.865	0.70406	0.0:0.9312:0.0:0.0688	.	227	Q9BXB5	OSB10_HUMAN	T	227;6	ENSP00000379804:A227T;ENSP00000399200:A6T	ENSP00000379804:A227T	A	-	1	0	OSBPL10	31846586	1.000000	0.71417	0.929000	0.37066	0.996000	0.88848	6.829000	0.75314	1.471000	0.48121	0.561000	0.74099	GCC	-	OSBPL10	-	NULL		0.587	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL10	HGNC	protein_coding	OTTHUMT00000253165.2	0	0	0	55	55	68	0.00	0.00	C			31871582	-1	11	26	29	49	tier1	no_errors	ENST00000396556	ensembl	human	known	74_37	missense	27.50	34.67	SNP	0.998	T	11	29
CSF2RA	1438	genome.wustl.edu	37	X	1407438	1407438	+	Silent	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chrX:1407438A>G	ENST00000381524.3	+	5	432	c.246A>G	c.(244-246)acA>acG	p.T82T	CSF2RA_ENST00000417535.2_Silent_p.T82T|CSF2RA_ENST00000501036.2_5'UTR|CSF2RA_ENST00000432318.2_Silent_p.T82T|CSF2RA_ENST00000381529.3_Silent_p.T82T|CSF2RA_ENST00000381509.3_Silent_p.T82T|CSF2RA_ENST00000355805.2_Silent_p.T82T|CSF2RA_ENST00000361536.3_Silent_p.T82T|CSF2RA_ENST00000355432.3_Silent_p.T82T|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_Silent_p.T82T			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	82					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GTTCGTGCACATTTCGTGAAA	0.433													ENSG00000198223																									Esophageal Squamous(131;723 1707 25334 40494 41806)												0													369.0	338.0	348.0					X																	1407438		2203	4296	6499	SO:0001819	synonymous_variant	0			-	M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.246A>G	X.37:g.1407438A>G			A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Silent	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.T82	ENST00000381524.3	37	c.246	CCDS35191.1	X																																																																																			-	CSF2RA	-	NULL		0.433	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	HGNC	protein_coding	OTTHUMT00000035013.2	0	0	0	115	115	118	0.00	0.00	A			1407438	+1	44	42	98	118	tier1	no_errors	ENST00000417535	ensembl	human	known	74_37	silent	30.99	26.25	SNP	0.002	G	44	98
HAPLN4	404037	genome.wustl.edu	37	19	19369469	19369469	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:19369469C>T	ENST00000291481.7	-	4	743	c.680G>A	c.(679-681)cGg>cAg	p.R227Q	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	227	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	GCAGGGCTCCCGGGGCCGGTT	0.716													ENSG00000187664																																					0													16.0	19.0	18.0					19																	19369469		2195	4271	6466	SO:0001583	missense	0			-	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.680G>A	19.37:g.19369469C>T	ENSP00000291481:p.Arg227Gln		A5PKW5|Q96PW2	Missense_Mutation	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.R227Q	ENST00000291481.7	37	c.680	CCDS12398.1	19	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352613	0.82132	.	.	ENSG00000187664	ENST00000291481	T	0.13538	2.58	3.97	3.97	0.46021	C-type lectin fold (1);Link (5);C-type lectin-like (1);	0.000000	0.64402	D	0.000001	T	0.52273	0.1724	H	0.97659	4.05	0.46542	D	0.999098	D	0.89917	1.0	D	0.91635	0.999	T	0.71745	-0.4500	10	0.87932	D	0	-33.8438	14.7601	0.69600	0.0:1.0:0.0:0.0	.	227	Q86UW8	HPLN4_HUMAN	Q	227	ENSP00000291481:R227Q	ENSP00000291481:R227Q	R	-	2	0	HAPLN4	19230469	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	7.167000	0.77562	2.055000	0.61198	0.313000	0.20887	CGG	-	HAPLN4	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link,prints_Link		0.716	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN4	HGNC	protein_coding	OTTHUMT00000460117.2	0	0	0	132	132	14	0.00	0.00	C	NM_023002		19369469	-1	29	3	86	14	tier1	no_errors	ENST00000291481	ensembl	human	known	74_37	missense	25.22	17.65	SNP	1.000	T	29	86
STXBP5L	9515	genome.wustl.edu	37	3	121132018	121132018	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr3:121132018C>T	ENST00000273666.6	+	25	3305	c.3034C>T	c.(3034-3036)Cgc>Tgc	p.R1012C	STXBP5L_ENST00000471454.1_Missense_Mutation_p.R988C	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	1012					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		ACCTAGTCTTCGCCCAATGTT	0.348													ENSG00000145087																																					0													144.0	129.0	133.0					3																	121132018		1904	4121	6025	SO:0001583	missense	0			-	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.3034C>T	3.37:g.121132018C>T	ENSP00000273666:p.Arg1012Cys		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.R1012C	ENST00000273666.6	37	c.3034	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	C	24.3	4.520814	0.85495	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000471262	T;T;T	0.49432	0.78;0.78;0.78	6.08	6.08	0.98989	Lethal giant larvae (Lgl)-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76271	0.3964	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78919	-0.2014	10	0.87932	D	0	-8.6419	20.6721	0.99693	0.0:1.0:0.0:0.0	.	988;1012	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	C	1012;988;955	ENSP00000273666:R1012C;ENSP00000420019:R988C;ENSP00000420167:R955C	ENSP00000273666:R1012C	R	+	1	0	STXBP5L	122614708	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.904000	0.63279	2.894000	0.99253	0.591000	0.81541	CGC	-	STXBP5L	-	pfam_Lgl_C_dom		0.348	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	0	0	0	58	58	124	0.00	0.00	C			121132018	+1	16	30	40	78	tier1	no_errors	ENST00000273666	ensembl	human	known	74_37	missense	28.57	27.52	SNP	1.000	T	16	40
GLIS2	84662	genome.wustl.edu	37	16	4383462	4383462	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:4383462G>A	ENST00000262366.3	+	4	1108	c.287G>A	c.(286-288)aGc>aAc	p.S96N	GLIS2_ENST00000433375.1_Missense_Mutation_p.S96N|RP11-295D4.1_ENST00000574705.1_RNA|PAM16_ENST00000577031.1_Intron			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	96	Interaction with CTNND1. {ECO:0000250}.|Transcription activation. {ECO:0000250}.				cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						AATGGCAGCAGCTCGCTGTCC	0.652													ENSG00000126603																																					0													29.0	26.0	27.0					16																	4383462		2196	4299	6495	SO:0001583	missense	0			-	AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.287G>A	16.37:g.4383462G>A	ENSP00000262366:p.Ser96Asn		B3KX84	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S96N	ENST00000262366.3	37	c.287	CCDS10511.1	16	.	.	.	.	.	.	.	.	.	.	G	13.99	2.400514	0.42613	.	.	ENSG00000126603	ENST00000262366;ENST00000433375	T;T	0.10763	2.84;2.84	4.83	1.54	0.23209	.	0.425529	0.23217	N	0.050603	T	0.05502	0.0145	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38972	-0.9636	10	0.22109	T	0.4	.	8.1939	0.31385	0.105:0.5443:0.3506:0.0	.	96	Q9BZE0	GLIS2_HUMAN	N	96	ENSP00000262366:S96N;ENSP00000395547:S96N	ENSP00000262366:S96N	S	+	2	0	GLIS2	4323463	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	0.859000	0.27858	0.440000	0.26502	0.485000	0.47835	AGC	-	GLIS2	-	NULL		0.652	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS2	HGNC	protein_coding	OTTHUMT00000251630.1	0	0	0	76	76	16	0.00	0.00	G	NM_032575		4383462	+1	25	9	58	10	tier1	no_errors	ENST00000262366	ensembl	human	known	74_37	missense	29.76	47.37	SNP	1.000	A	25	58
DPY19L2P1	554236	genome.wustl.edu	37	7	35121280	35121280	+	IGR	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:35121280G>A								DPY19L1 (43627 upstream) : DPY19L2P1 (8175 downstream)																							TGAGCAGGACGCTACATAAGG	0.433													ENSG00000189212																																					0																																										SO:0001628	intergenic_variant	0			-																													7.37:g.35121280G>A				R	SNP	-	NULL		37	NULL		7																																																																																			-	DPY19L2P1	-	-	0	0.433					DPY19L2P1	HGNC			0	0	0	98	98	35	0.00	0.00	G			35121280	-1	25	13	69	29	tier1	no_errors	ENST00000458672	ensembl	human	known	74_37	rna	26.60	30.95	SNP	0.916	A	25	69
FAM188A	80013	genome.wustl.edu	37	10	15902295	15902295	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:15902295A>G	ENST00000277632.3	-	1	224	c.4T>C	c.(4-6)Tcc>Ccc	p.S2P	FAM188A_ENST00000477891.1_5'UTR	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	2					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						GTCAGTTCGGACATGATGAGG	0.637													ENSG00000148481																									Pancreas(159;946 1953 2111 4475 22008)												0													31.0	30.0	30.0					10																	15902295		2203	4300	6503	SO:0001583	missense	0			-	AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.4T>C	10.37:g.15902295A>G	ENSP00000277632:p.Ser2Pro		Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Missense_Mutation	SNP	NULL	p.S2P	ENST00000277632.3	37	c.4	CCDS7110.1	10	.	.	.	.	.	.	.	.	.	.	A	17.16	3.317588	0.60524	.	.	ENSG00000148481	ENST00000277632	T	0.34472	1.36	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	L	0.44542	1.39	0.80722	D	1	P	0.42039	0.769	B	0.37346	0.247	T	0.06127	-1.0844	10	0.40728	T	0.16	-6.5684	10.6954	0.45896	1.0:0.0:0.0:0.0	.	2	Q9H8M7	F188A_HUMAN	P	2	ENSP00000277632:S2P	ENSP00000277632:S2P	S	-	1	0	FAM188A	15942301	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.610000	0.46325	2.012000	0.59069	0.533000	0.62120	TCC	-	FAM188A	-	NULL		0.637	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188A	HGNC	protein_coding	OTTHUMT00000046990.2	0	0	0	69	69	74	0.00	0.00	A	NM_024948		15902295	-1	15	17	35	49	tier1	no_errors	ENST00000277632	ensembl	human	known	74_37	missense	30.00	25.76	SNP	1.000	G	15	35
TP53	7157	genome.wustl.edu	37	17	7577525	7577527	+	In_Frame_Del	DEL	GAG	GAG	-	rs121912653		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	GAG	GAG	GAG	-	GAG	GAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:7577525_7577527delGAG	ENST00000269305.4	-	7	943_945	c.754_756delCTC	c.(754-756)ctcdel	p.L252del	TP53_ENST00000455263.2_In_Frame_Del_p.L252del|TP53_ENST00000445888.2_In_Frame_Del_p.L252del|TP53_ENST00000359597.4_In_Frame_Del_p.L252del|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_In_Frame_Del_p.L252del|TP53_ENST00000420246.2_In_Frame_Del_p.L252del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	252	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in a sporadic cancer; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1978757}.|L -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L252P(10)|p.L252F(9)|p.0?(8)|p.L252fs*93(5)|p.L252del(5)|p.L252_I254delLTI(4)|p.I251_T253delILT(4)|p.L252delL(3)|p.L252L(3)|p.T253_I255del(2)|p.P250_L252delPIL(2)|p.L252H(2)|p.L252_T253delLT(1)|p.P250_T253delPILT(1)|p.T253fs*92(1)|p.?(1)|p.I251_L252insX(1)|p.L252fs*12(1)|p.L252fs*13(1)|p.T253fs*11(1)|p.R249_T256delRPILTIIT(1)|p.L252fs*92(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGATGATGGTGAGGATGGGCCTC	0.591		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Deletion - In frame(23)|Substitution - Missense(21)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(3)|Substitution - coding silent(3)|Insertion - In frame(1)|Unknown(1)	lung(11)|large_intestine(8)|stomach(8)|upper_aerodigestive_tract(7)|haematopoietic_and_lymphoid_tissue(6)|skin(6)|bone(4)|central_nervous_system(3)|liver(3)|peritoneum(2)|endometrium(2)|breast(2)|soft_tissue(1)|biliary_tract(1)|urinary_tract(1)|oesophagus(1)|ovary(1)	GRCh37	CM900212	TP53	M	rs121912653																																			SO:0001651	inframe_deletion	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.754_756delCTC	17.37:g.7577525_7577527delGAG	ENSP00000269305:p.Leu252del		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L252in_frame_del	ENST00000269305.4	37	c.756_754	CCDS11118.1	17																																																																																				TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.591	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	41	41	74	0.00	0.00	GAG	NM_000546		7577527	-1	7	17	20	48	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	in_frame_del	25.93	26.15	DEL	1.000:1.000:1.000	-	7	20
CFH	3075	genome.wustl.edu	37	1	196654365	196654365	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:196654365delC	ENST00000359637.2	+	6	832	c.770delC	c.(769-771)accfs	p.T257fs	CFH_ENST00000439155.2_Frame_Shift_Del_p.T321fs|CFH_ENST00000367429.4_Frame_Shift_Del_p.T321fs			P08603	CFAH_HUMAN	complement factor H	321	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CCGAGATGTACCTGTAAGTTC	0.358													ENSG00000000971																																					0													98.0	89.0	92.0					1																	196654365		2203	4300	6503	SO:0001589	frameshift_variant	0				Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.770delC	1.37:g.196654365delC	ENSP00000352658:p.Thr257fs		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Frame_Shift_Del	DEL	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.L322fs	ENST00000359637.2	37	c.962		1																																																																																				CFH	-	pfscan_Sushi_SCR_CCP		0.358	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000087502.1	0	0	0	76	76	122	0.00	0.00	C	NM_000186		196654365	+1	14	15	62	74	tier1	no_errors	ENST00000367429	ensembl	human	known	74_37	frame_shift_del	18.42	16.85	DEL	0.001	-	14	62
TFCP2	7024	genome.wustl.edu	37	12	51501087	51501087	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:51501087delT	ENST00000257915.5	-	7	1218	c.760delA	c.(760-762)atgfs	p.M254fs	TFCP2_ENST00000548115.1_Frame_Shift_Del_p.M203fs|TFCP2_ENST00000307660.4_Frame_Shift_Del_p.M203fs|TFCP2_ENST00000549867.1_Frame_Shift_Del_p.M254fs	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	254	DNA-binding.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						CGTTTCTCCATTTTTTCCCTA	0.353													ENSG00000135457																																					0													266.0	255.0	259.0					12																	51501087		2203	4300	6503	SO:0001589	frameshift_variant	0				U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.760delA	12.37:g.51501087delT	ENSP00000257915:p.Met254fs		A8K5E9|Q12801|Q9UD75|Q9UD77	Frame_Shift_Del	DEL	pfam_CP2,superfamily_SAM/pointed	p.M254fs	ENST00000257915.5	37	c.760	CCDS8808.1	12																																																																																				TFCP2	-	pfam_CP2		0.353	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2	HGNC	protein_coding	OTTHUMT00000405119.1	0	0	0	70	70	165	0.00	0.00	T	NM_005653		51501087	-1	12	43	63	115	tier1	no_errors	ENST00000257915	ensembl	human	known	74_37	frame_shift_del	16.00	27.22	DEL	1.000	-	12	63
PAPD5	64282	genome.wustl.edu	37	16	50263693	50263693	+	3'UTR	DEL	T	T	-			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:50263693delT	ENST00000561678.1	+	0	2295				PAPD5_ENST00000357464.3_3'UTR|PAPD5_ENST00000436909.3_3'UTR|PAPD5_ENST00000573002.1_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TCTGTGCATGTTTTTTTTTTA	0.308													ENSG00000121274																																					0																																										SO:0001624	3_prime_UTR_variant	0				AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.*454T>-	16.37:g.50263693delT			B4DV38|Q9NW67|Q9Y6C0	R	DEL	-	NULL	ENST00000561678.1	37	NULL		16																																																																																				PAPD5	-	-		0.308	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423150.1	0	0	1	74	74	59	0.00	1.67	T	NM_022447		50263693	+1	11	12	53	47	tier1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	17.19	20.34	DEL	0.737	-	11	53
CCDC107	203260	genome.wustl.edu	37	9	35660635	35660635	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:35660635delT	ENST00000426546.2	+	4	467	c.401delT	c.(400-402)cttfs	p.L134fs	CCDC107_ENST00000378409.3_Frame_Shift_Del_p.L134fs|CCDC107_ENST00000378406.1_Frame_Shift_Del_p.L134fs|ARHGEF39_ENST00000378395.2_3'UTR|ARHGEF39_ENST00000378387.3_3'UTR|ARHGEF39_ENST00000343259.3_3'UTR|ARHGEF39_ENST00000490970.1_5'Flank|CCDC107_ENST00000378407.3_Frame_Shift_Del_p.L134fs|CCDC107_ENST00000327351.2_Frame_Shift_Del_p.L134fs|RMRP_ENST00000602361.1_lincRNA|CCDC107_ENST00000421582.2_3'UTR	NM_001195200.1|NM_001195201.1|NM_001195217.1|NM_174923.2	NP_001182129.1|NP_001182130.1|NP_001182146.1|NP_777583.2	Q8WV48	CC107_HUMAN	coiled-coil domain containing 107	134						integral component of membrane (GO:0016021)				endometrium(1)|lung(3)|skin(1)	5	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTGGACCCCCTTTTTGAGCGG	0.532													ENSG00000159884																																					0													67.0	73.0	71.0					9																	35660635		2203	4300	6503	SO:0001589	frameshift_variant	0				AK075523	CCDS6583.1, CCDS56573.1, CCDS56574.1, CCDS56575.1	9q13.3	2008-02-05			ENSG00000159884	ENSG00000159884			28465	protein-coding gene	gene with protein product						12477932	Standard	NM_174923		Approved	MGC31967	uc011lox.2	Q8WV48	OTTHUMG00000019868	ENST00000426546.2:c.401delT	9.37:g.35660635delT	ENSP00000414964:p.Leu134fs		A6XND6|Q5T4R5|Q5T4R8|Q5T4R9|Q86VB6|Q8N2E4	Frame_Shift_Del	DEL	NULL	p.F135fs	ENST00000426546.2	37	c.401	CCDS6583.1	9																																																																																				CCDC107	-	NULL		0.532	CCDC107-001	KNOWN	basic|CCDS	protein_coding	CCDC107	HGNC	protein_coding	OTTHUMT00000052325.1	0	0	0	55	55	98	0.00	0.00	T	NM_174923		35660635	+1	10	27	64	143	tier1	no_errors	ENST00000426546	ensembl	human	known	74_37	frame_shift_del	13.51	15.88	DEL	0.998	-	10	64
ADH4	127	genome.wustl.edu	37	4	100060216	100060216	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:100060216delT	ENST00000265512.7	-	4	420	c.346delA	c.(346-348)atcfs	p.I116fs	ADH4_ENST00000504581.1_5'Flank|ADH4_ENST00000423445.1_Frame_Shift_Del_p.I135fs|RP11-696N14.1_ENST00000500358.2_RNA|ADH4_ENST00000505590.1_Frame_Shift_Del_p.I135fs|ADH4_ENST00000508393.1_Frame_Shift_Del_p.I135fs	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	116					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		GCTTACCTGATTTTCCCACAC	0.358													ENSG00000198099																																					0													77.0	72.0	73.0					4																	100060216		2203	4300	6503	SO:0001589	frameshift_variant	0				M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.346delA	4.37:g.100060216delT	ENSP00000265512:p.Ile116fs		A8K470|B4DIE7|C9J4A9|Q8TCD7	Frame_Shift_Del	DEL	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.I135fs	ENST00000265512.7	37	c.403	CCDS34032.1	4																																																																																				ADH4	-	pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER		0.358	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH4	HGNC	protein_coding	OTTHUMT00000364220.2	0	0	0	66	66	107	0.00	0.00	T	NM_000670		100060216	-1	14	18	29	36	tier1	no_errors	ENST00000423445	ensembl	human	known	74_37	frame_shift_del	32.56	33.33	DEL	0.147	-	14	29
CDC14A	8556	genome.wustl.edu	37	1	100908566	100908567	+	Intron	INS	-	-	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:100908566_100908567insT	ENST00000336454.3	+	7	874				CDC14A_ENST00000469387.1_3'UTR|CDC14A_ENST00000544534.1_Intron|CDC14A_ENST00000370125.2_Intron|CDC14A_ENST00000370124.3_Intron|CDC14A_ENST00000361544.6_Intron|CDC14A_ENST00000542213.1_Intron	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A						cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		TGTACATTTAATTTTTTTTACA	0.302													ENSG00000079335																																					0																																										SO:0001627	intron_variant	0				AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.519+14->T	1.37:g.100908574_100908574dupT			A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	R	INS	-	NULL	ENST00000336454.3	37	NULL	CCDS769.1	1																																																																																				CDC14A	-	-		0.302	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDC14A	HGNC	protein_coding	OTTHUMT00000030220.1	0	0	0	61	61	82	0.00	0.00	-	NM_033312		100908567	+1	15	18	54	72	tier1	no_errors	ENST00000469387	ensembl	human	known	74_37	rna	21.74	20.00	INS	0.384:0.000	T	15	54
ADAMTSL1	92949	genome.wustl.edu	37	9	18777457	18777457	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:18777457G>A	ENST00000380548.4	+	19	3569	c.3230G>A	c.(3229-3231)cGc>cAc	p.R1077H		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1077						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GAGCAGCGGCGCCTGGACGAC	0.667													ENSG00000178031																																					0													13.0	17.0	15.0					9																	18777457		2070	4185	6255	SO:0001583	missense	0			-	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3230G>A	9.37:g.18777457G>A	ENSP00000369921:p.Arg1077His		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R1077H	ENST00000380548.4	37	c.3230	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142282	0.77775	.	.	ENSG00000178031	ENST00000380548	T	0.65732	-0.17	5.88	4.99	0.66335	.	0.379473	0.08080	U	1.000000	T	0.51058	0.1652	N	0.14661	0.345	0.80722	D	1	B	0.18968	0.032	B	0.12156	0.007	T	0.23119	-1.0197	10	0.62326	D	0.03	.	15.2282	0.73367	0.0675:0.0:0.9325:0.0	.	1077	Q8N6G6	ATL1_HUMAN	H	1077	ENSP00000369921:R1077H	ENSP00000369921:R1077H	R	+	2	0	ADAMTSL1	18767457	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.584000	0.53936	1.499000	0.48617	0.557000	0.71058	CGC	-	ADAMTSL1	-	NULL		0.667	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	0	0	0	42	42	18	0.00	0.00	G			18777457	+1	12	3	18	5	tier1	no_errors	ENST00000380548	ensembl	human	novel	74_37	missense	40.00	37.50	SNP	0.998	A	12	18
ARHGAP23	57636	genome.wustl.edu	37	17	36623383	36623383	+	Missense_Mutation	SNP	G	G	A	rs571662439		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:36623383G>A	ENST00000431231.2	+	7	1527	c.1459G>A	c.(1459-1461)Gat>Aat	p.D487N	ARHGAP23_ENST00000443378.1_Missense_Mutation_p.D393N|ARHGAP23_ENST00000437668.3_Missense_Mutation_p.D487N	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	487					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGATCGCGGCGATGAGGTGGT	0.672													ENSG00000225485	G|||	1	0.000199681	0.0	0.0	5008	,	,		14872	0.0		0.0	False		,,,				2504	0.001																0													14.0	17.0	16.0					17																	36623383		692	1590	2282	SO:0001583	missense	0			-	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.1459G>A	17.37:g.36623383G>A	ENSP00000393539:p.Asp487Asn			Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.D487N	ENST00000431231.2	37	c.1459	CCDS56027.1	17	.	.	.	.	.	.	.	.	.	.	G	16.58	3.161672	0.57368	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.14766	2.48;2.84;2.8	4.75	4.75	0.60458	.	0.307901	0.29631	N	0.011606	T	0.12603	0.0306	N	0.24115	0.695	0.34569	D	0.713251	P;P	0.43169	0.8;0.642	B;B	0.41174	0.349;0.085	T	0.16571	-1.0398	10	0.72032	D	0.01	.	16.5075	0.84276	0.0:0.0:1.0:0.0	.	487;487	Q9P227;Q9P227-2	RHG23_HUMAN;.	N	487;487;393	ENSP00000394153:D487N;ENSP00000393539:D487N;ENSP00000407333:D393N	ENSP00000393539:D487N	D	+	1	0	ARHGAP23	33876909	1.000000	0.71417	0.174000	0.22961	0.835000	0.47333	4.410000	0.59774	2.200000	0.70718	0.462000	0.41574	GAT	-	ARHGAP23	-	NULL		0.672	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1	0	0	0	60	60	12	0.00	0.00	G	XM_290799		36623383	+1	23	7	34	8	tier1	no_errors	ENST00000431231	ensembl	human	known	74_37	missense	40.35	46.67	SNP	0.974	A	23	34
ATAD3B	83858	genome.wustl.edu	37	1	1417600	1417600	+	Silent	SNP	C	C	T	rs544884479	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:1417600C>T	ENST00000308647.7	+	6	713	c.597C>T	c.(595-597)gcC>gcT	p.A199A	ATAD3B_ENST00000378741.3_Silent_p.A31A|ATAD3B_ENST00000378736.3_3'UTR	NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	199						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GCGCCAAGGCCGAGCGGGAGA	0.667													ENSG00000160072																																					0													30.0	34.0	33.0					1																	1417600		2202	4295	6497	SO:0001819	synonymous_variant	0			-	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.597C>T	1.37:g.1417600C>T			A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Silent	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A199	ENST00000308647.7	37	c.597	CCDS30.1	1																																																																																			-	ATAD3B	-	pfam_DUF3523		0.667	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	0	0	0	84	84	16	0.00	0.00	C	NM_031921		1417600	+1	31	8	27	4	tier1	no_errors	ENST00000308647	ensembl	human	known	74_37	silent	53.45	66.67	SNP	0.931	T	31	27
CARD14	79092	genome.wustl.edu	37	17	78172401	78172401	+	Intron	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:78172401C>T	ENST00000573882.1	+	15	2387				RP11-334C17.5_ENST00000573346.1_RNA|CARD14_ENST00000392434.2_Intron|RP11-334C17.5_ENST00000570309.1_RNA|CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000344227.2_Intron|CARD14_ENST00000570421.1_Intron			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14						activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GTGAGCCGTGCGAGGCCCCTC	0.687													ENSG00000141527																																					0													30.0	35.0	33.0					17																	78172401		2203	4299	6502	SO:0001627	intron_variant	0			-	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1851+11C>T	17.37:g.78172401C>T			B8QQJ3|Q9BVB5	R	SNP	-	NULL	ENST00000573882.1	37	NULL	CCDS11768.1	17	.	.	.	.	.	.	.	.	.	.	C	5.497	0.276784	0.10403	.	.	ENSG00000141527	ENST00000309710	.	.	.	3.08	-0.57	0.11753	.	.	.	.	.	T	0.15176	0.0366	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.27872	-1.0061	5	.	.	.	.	5.3164	0.15858	0.0:0.469:0.4027:0.1283	.	.	.	.	V	384	.	.	A	+	2	0	CARD14	75786996	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.680000	0.05197	-0.199000	0.10317	-0.339000	0.08088	GCG	-	CARD14	-	-		0.687	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD14	HGNC	protein_coding	OTTHUMT00000437507.1	0	0	0	67	67	15	0.00	0.00	C			78172401	+1	19	4	44	9	tier1	no_errors	ENST00000573754	ensembl	human	known	74_37	rna	29.69	30.77	SNP	0.000	T	19	44
CORO7	79585	genome.wustl.edu	37	16	4411429	4411429	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:4411429C>T	ENST00000251166.4	-	17	1765	c.1620G>A	c.(1618-1620)acG>acA	p.T540T	CORO7_ENST00000539968.1_Silent_p.T320T|CORO7_ENST00000574025.1_Silent_p.T455T|CORO7_ENST00000423908.2_3'UTR|CORO7_ENST00000537233.2_Silent_p.T522T|CORO7-PAM16_ENST00000572467.1_Silent_p.T540T|CORO7-PAM16_ENST00000572274.1_5'Flank	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	540					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						CATTCTGCAGCGTGGGCAGTG	0.672													ENSG00000262246																																					0													51.0	54.0	53.0					16																	4411429		2197	4299	6496	SO:0001819	synonymous_variant	0			-	AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.1620G>A	16.37:g.4411429C>T			B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	NULL	p.R102H	ENST00000251166.4	37	c.305	CCDS10513.1	16																																																																																			-	CORO7	-	NULL		0.672	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7	HGNC	protein_coding	OTTHUMT00000251628.2	0	0	0	57	57	9	0.00	0.00	C	NM_024535		4411429	-1	7	3	34	8	tier1	no_errors	ENST00000576437	ensembl	human	known	74_37	missense	17.07	27.27	SNP	0.996	T	7	34
CTDP1	9150	genome.wustl.edu	37	18	77513722	77513722	+	Missense_Mutation	SNP	G	G	A	rs139811552		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr18:77513722G>A	ENST00000299543.7	+	13	2965	c.2818G>A	c.(2818-2820)Gag>Aag	p.E940K	CTDP1_ENST00000075430.7_3'UTR	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	940					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CAACGAGGATGAGGGCAGCAG	0.632													ENSG00000060069																																					0								G	LYS/GLU,LYS/GLU,	2,4404	2.1+/-5.4	0,2,2201	47.0	47.0	47.0		2461,2818,	5.5	1.0	18	dbSNP_134	47	0,8600		0,0,4300	no	missense,missense,utr-3	CTDP1	NM_001202504.1,NM_004715.4,NM_048368.3	56,56,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging,	821/843,940/962,	77513722	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.2818G>A	18.37:g.77513722G>A	ENSP00000299543:p.Glu940Lys		A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	pfam_FCP1_C,pfam_NIF,superfamily_HAD-like_dom,superfamily_BRCT_dom,superfamily_Single_hybrid_motif,smart_NIF,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_NIF,tigrfam_FCP1_euk	p.E940K	ENST00000299543.7	37	c.2818	CCDS12017.1	18	.	.	.	.	.	.	.	.	.	.	G	36	5.767413	0.96914	4.54E-4	0.0	ENSG00000060069	ENST00000299543	T	0.58506	0.33	5.48	5.48	0.80851	FCP1-like phosphatase, C-terminal (1);	0.307433	0.33938	N	0.004415	T	0.73385	0.3580	L	0.60455	1.87	0.80722	D	1	D	0.64830	0.994	D	0.66716	0.946	T	0.74337	-0.3698	10	0.59425	D	0.04	-32.5404	19.3405	0.94339	0.0:0.0:1.0:0.0	.	940	Q9Y5B0	CTDP1_HUMAN	K	940	ENSP00000299543:E940K	ENSP00000299543:E940K	E	+	1	0	CTDP1	75614710	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.996000	0.88334	2.564000	0.86499	0.655000	0.94253	GAG	rs139811552	CTDP1	-	pfam_FCP1_C		0.632	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDP1	HGNC	protein_coding	OTTHUMT00000256432.1	0	0	0	59	59	20	0.00	0.00	G	NM_004715		77513722	+1	14	4	31	9	tier1	no_errors	ENST00000299543	ensembl	human	known	74_37	missense	31.11	30.77	SNP	1.000	A	14	31
FCGBP	8857	genome.wustl.edu	37	19	40411970	40411970	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:40411970C>T	ENST00000221347.6	-	7	3665	c.3658G>A	c.(3658-3660)Ggc>Agc	p.G1220S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1220	Cys-rich.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GACACCAGGCCGCCCTCCTGG	0.677													ENSG00000090920																																					0													43.0	44.0	44.0					19																	40411970		2203	4300	6503	SO:0001583	missense	0			-	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3658G>A	19.37:g.40411970C>T	ENSP00000221347:p.Gly1220Ser		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.G1220S	ENST00000221347.6	37	c.3658	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918045	0.73098	.	.	ENSG00000090920	ENST00000221347	T	0.07021	3.23	4.39	4.39	0.52855	.	0.000000	0.64402	D	0.000001	T	0.29256	0.0728	M	0.77616	2.38	0.41596	D	0.988828	D	0.89917	1.0	D	0.87578	0.998	T	0.03278	-1.1053	10	0.37606	T	0.19	.	15.8855	0.79244	0.0:1.0:0.0:0.0	.	1220	Q9Y6R7	FCGBP_HUMAN	S	1220	ENSP00000221347:G1220S	ENSP00000221347:G1220S	G	-	1	0	FCGBP	45103810	0.794000	0.28838	0.843000	0.33291	0.476000	0.33039	1.965000	0.40471	2.278000	0.76064	0.436000	0.28706	GGC	-	FCGBP	-	smart_VWC_out,smart_VWF_C		0.677	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	0	0	0	72	72	12	0.00	0.00	C	NM_003890		40411970	-1	14	2	34	5	tier1	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	29.17	28.57	SNP	0.991	T	14	34
INSC	387755	genome.wustl.edu	37	11	15197525	15197525	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:15197525C>T	ENST00000379554.3	+	3	482	c.436C>T	c.(436-438)Cgc>Tgc	p.R146C	INSC_ENST00000528567.1_Missense_Mutation_p.R99C|INSC_ENST00000379556.3_Missense_Mutation_p.R99C|INSC_ENST00000530161.1_Missense_Mutation_p.R99C|INSC_ENST00000525218.1_Missense_Mutation_p.R99C|INSC_ENST00000424273.1_Missense_Mutation_p.R99C	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	146					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						GGCCCAGGACCGCTGGGCACG	0.632													ENSG00000188487																																					0													23.0	26.0	25.0					11																	15197525		2063	4191	6254	SO:0001583	missense	0			-	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.436C>T	11.37:g.15197525C>T	ENSP00000368872:p.Arg146Cys		A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo	p.R146C	ENST00000379554.3	37	c.436	CCDS41621.1	11	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939212	0.73557	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000416761;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.37752	1.19;1.22;1.18;1.19;1.22;1.18	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.54695	0.1874	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.56878	-0.7906	10	0.87932	D	0	-23.4233	11.9963	0.53206	0.2954:0.7046:0.0:0.0	.	99;99;99;146	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	C	146;99;99;99;99;99;99	ENSP00000368872:R146C;ENSP00000368874:R99C;ENSP00000389161:R99C;ENSP00000435022:R99C;ENSP00000436194:R99C;ENSP00000436113:R99C	ENSP00000368872:R146C	R	+	1	0	INSC	15154101	0.999000	0.42202	1.000000	0.80357	0.984000	0.73092	3.716000	0.54904	2.420000	0.82092	0.462000	0.41574	CGC	-	INSC	-	NULL		0.632	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSC	HGNC	protein_coding	OTTHUMT00000386590.1	0	0	0	31	31	13	0.00	0.00	C	NM_001031853		15197525	+1	6	2	11	6	tier1	no_errors	ENST00000379554	ensembl	human	known	74_37	missense	35.29	25.00	SNP	1.000	T	6	11
PCDHA10	56139	genome.wustl.edu	37	5	140235763	140235763	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:140235763G>A	ENST00000307360.5	+	1	130	c.130G>A	c.(130-132)Gtg>Atg	p.V44M	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.V44M|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	44	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCACCTTCGTGGGCCGCAT	0.657													ENSG00000250120																																					0													46.0	53.0	51.0					5																	140235763		2196	4269	6465	SO:0001583	missense	0			-	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.130G>A	5.37:g.140235763G>A	ENSP00000304234:p.Val44Met		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V44M	ENST00000307360.5	37	c.130	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685024	0.68157	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.54866	0.55;0.55	4.27	4.27	0.50696	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	D	0.84297	0.5441	H	0.99249	4.485	0.36744	D	0.882409	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.93135	0.6536	9	0.87932	D	0	.	17.329	0.87258	0.0:0.0:1.0:0.0	.	44;44;44	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	M	44	ENSP00000421030:V44M;ENSP00000304234:V44M	ENSP00000304234:V44M	V	+	1	0	PCDHA10	140215947	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.503000	0.66962	2.391000	0.81399	0.556000	0.70494	GTG	-	PCDHA10	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.657	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	HGNC	protein_coding	OTTHUMT00000372895.2	0	0	0	98	98	7	0.00	0.00	G	NM_018901		140235763	+1	13	3	66	4	tier1	no_errors	ENST00000307360	ensembl	human	known	74_37	missense	16.46	42.86	SNP	1.000	A	13	66
STAG3L1	54441	genome.wustl.edu	37	7	74991273	74991273	+	RNA	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:74991273C>T	ENST00000402225.5	+	0	349							P0CL83	ST3L1_HUMAN	stromal antigen 3-like 1 (pseudogene)							nucleus (GO:0005634)											GGGTCCCAAGCGGTACATCGT	0.408													ENSG00000205583																																					0													2.0	5.0	4.0					7																	74991273		460	1817	2277			0			-			7q11.23	2013-06-26	2013-06-26		ENSG00000205583	ENSG00000205583			33852	pseudogene	pseudogene			"""stromal antigen 3-like 1"""				Standard	NR_040583		Approved	DKFZP434A0131, STAG3L1P	uc022agf.1	P0CL83	OTTHUMG00000155940		7.37:g.74991273C>T			A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	R	SNP	-	NULL	ENST00000402225.5	37	NULL		7																																																																																			-	STAG3L1	-	-		0.408	STAG3L1-012	KNOWN	basic	processed_transcript	STAG3L1	HGNC	pseudogene	OTTHUMT00000437242.1	0	0	0	44	44	6	0.00	0.00	C	NM_001002840		74991273	+1	24	11	16	8	tier1	no_errors	ENST00000402225	ensembl	human	known	74_37	rna	60.00	57.89	SNP	0.959	T	24	16
TADA2B	93624	genome.wustl.edu	37	4	7055968	7055968	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr4:7055968G>A	ENST00000310074.7	+	2	639	c.450G>A	c.(448-450)ccG>ccA	p.P150P	TADA2B_ENST00000515646.1_Silent_p.P58P|TADA2B_ENST00000512388.1_Silent_p.P75P	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	150					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						TCACCACCCCGCTGCCCCCGC	0.657													ENSG00000173011																																					0													14.0	16.0	15.0					4																	7055968		2052	4167	6219	SO:0001819	synonymous_variant	0			-	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.450G>A	4.37:g.7055968G>A			A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Silent	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_Znf_ZZ,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.P150	ENST00000310074.7	37	c.450	CCDS47007.1	4																																																																																			-	TADA2B	-	pirsf_Transcriptional_adaptor_2		0.657	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2B	HGNC	protein_coding	OTTHUMT00000358687.2	0	0	0	46	46	16	0.00	0.00	G	NM_152293		7055968	+1	10	3	20	9	tier1	no_errors	ENST00000310074	ensembl	human	known	74_37	silent	33.33	25.00	SNP	0.140	A	10	20
WIZ	58525	genome.wustl.edu	37	19	15550925	15550925	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:15550925G>A	ENST00000389282.4	-	3	949	c.736C>T	c.(736-738)Ctg>Ttg	p.L246L	WIZ_ENST00000263381.7_Intron			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	246					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						ACCTCCTCCAGCAGCTCACAC	0.642													ENSG00000011451																																					0																																										SO:0001819	synonymous_variant	0			-	AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.736C>T	19.37:g.15550925G>A			B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L246	ENST00000389282.4	37	c.736		19																																																																																			-	WIZ	-	NULL		0.642	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		0	0	0	18	18	16	0.00	0.00	G	NM_021241		15550925	-1	10	8	18	5	tier1	no_errors	ENST00000389282	ensembl	human	known	74_37	silent	35.71	61.54	SNP	0.769	A	10	18
PDE4DIP	9659	genome.wustl.edu	37	1	144852395	144852395	+	3'UTR	SNP	T	T	G	rs587677611	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:144852395T>G	ENST00000369354.3	-	0	7293				PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_3'UTR|PDE4DIP_ENST00000369359.4_3'UTR|PDE4DIP_ENST00000313382.9_3'UTR|PDE4DIP_ENST00000369356.4_Silent_p.R2350R			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CAGGCCCACCTTTCCTGCTGT	0.562			T	PDGFRB	MPD								ENSG00000178104																												Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													59.0	53.0	55.0					1																	144852395		1568	3582	5150	SO:0001624	3_prime_UTR_variant	0			-	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.*63A>C	1.37:g.144852395T>G			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.R2350	ENST00000369354.3	37	c.7048	CCDS30824.1	1																																																																																			-	PDE4DIP	-	NULL		0.562	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	0	0	0	257	257	117	0.00	0.00	T	NM_022359		144852395	-1	26	13	211	123	tier1	no_errors	ENST00000369356	ensembl	human	known	74_37	silent	10.97	9.56	SNP	0.484	G	26	211
LOC63930	63930	genome.wustl.edu	37	20	61711624	61711624	+	lincRNA	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:61711624C>T	ENST00000607802.1	+	0	372					NR_033370.1																						GCAGCCCCTGCAGCAAATCTC	0.512													ENSG00000272259																																					0																																												0			-																													20.37:g.61711624C>T				R	SNP	-	NULL	ENST00000607802.1	37	NULL		20																																																																																			-	RP11-305P22.9	-	-		0.512	RP11-305P22.9-001	KNOWN	basic	lincRNA	LOC63930	Clone_based_vega_gene	lincRNA	OTTHUMT00000470475.1	0	0	0	34	34	140	0.00	0.00	C			61711624	+1	8	15	41	148	tier1	no_errors	ENST00000607802	ensembl	human	known	74_37	rna	16.33	9.20	SNP	0.007	T	8	41
PTPN4	5775	genome.wustl.edu	37	2	120692378	120692378	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:120692378G>A	ENST00000263708.2	+	15	1970	c.1199G>A	c.(1198-1200)cGa>cAa	p.R400Q	PTPN4_ENST00000544261.1_Missense_Mutation_p.R33Q	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	400					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	TTATTTAGTCGAAATTCTACA	0.368													ENSG00000088179																																					0													86.0	80.0	82.0					2																	120692378		2203	4300	6503	SO:0001583	missense	0			-		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.1199G>A	2.37:g.120692378G>A	ENSP00000263708:p.Arg400Gln		B2RBV8|Q9UDA7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R400Q	ENST00000263708.2	37	c.1199	CCDS2129.1	2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435714	0.83885	.	.	ENSG00000088179	ENST00000263708;ENST00000544261;ENST00000431283	T;T;T	0.52057	0.68;0.68;0.68	5.77	5.77	0.91146	.	0.187463	0.45126	D	0.000395	T	0.41190	0.1148	L	0.53249	1.67	0.50632	D	0.999885	P	0.39782	0.688	B	0.27380	0.079	T	0.32052	-0.9921	10	0.19590	T	0.45	.	20.3472	0.98799	0.0:0.0:1.0:0.0	.	400	P29074	PTN4_HUMAN	Q	400;33;26	ENSP00000263708:R400Q;ENSP00000445841:R33Q;ENSP00000387457:R26Q	ENSP00000263708:R400Q	R	+	2	0	PTPN4	120408848	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.847000	0.92166	2.890000	0.99128	0.650000	0.86243	CGA	-	PTPN4	-	pirsf_Tyr_Pase_non-rcpt_typ-3/4		0.368	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2	0	0	0	130	130	132	0.00	0.00	G			120692378	+1	14	10	116	95	tier1	no_errors	ENST00000263708	ensembl	human	known	74_37	missense	10.77	9.52	SNP	1.000	A	14	116
PRDM10	56980	genome.wustl.edu	37	11	129794819	129794819	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:129794819G>C	ENST00000360871.3	-	12	2067	c.1836C>G	c.(1834-1836)ttC>ttG	p.F612L	PRDM10_ENST00000423662.2_Missense_Mutation_p.F530L|PRDM10_ENST00000358825.5_Missense_Mutation_p.F616L|PRDM10_ENST00000304538.6_Missense_Mutation_p.F526L|PRDM10_ENST00000526082.1_Missense_Mutation_p.F530L|PRDM10_ENST00000528746.1_Missense_Mutation_p.F586L	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	616					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TTGGGCAGGTGAAGTAGCCAT	0.423													ENSG00000170325																																					0													105.0	108.0	107.0					11																	129794819		2201	4297	6498	SO:0001583	missense	0			-	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1836C>G	11.37:g.129794819G>C	ENSP00000354118:p.Phe612Leu		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F616L	ENST00000360871.3	37	c.1848	CCDS8484.1	11	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982156	0.74474	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.71	2.87	0.33458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.050083	0.85682	D	0.000000	T	0.29158	0.0725	L	0.52206	1.635	0.48452	D	0.999653	P;P;P;P;D;P	0.69078	0.953;0.942;0.953;0.942;0.997;0.942	P;P;P;P;P;P	0.62813	0.672;0.543;0.672;0.543;0.907;0.543	T	0.01033	-1.1474	10	0.72032	D	0.01	-27.2871	8.7974	0.34887	0.2759:0.0:0.7241:0.0	.	526;612;616;530;526;530	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	L	616;526;612;530;586;530;329	ENSP00000351686:F616L;ENSP00000302669:F526L;ENSP00000354118:F612L;ENSP00000398431:F530L;ENSP00000431262:F586L;ENSP00000432237:F530L;ENSP00000435940:F329L	ENSP00000302669:F526L	F	-	3	2	PRDM10	129300029	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.022000	0.41030	0.359000	0.24239	0.655000	0.94253	TTC	-	PRDM10	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1	0	0	0	49	49	91	0.00	0.00	G	NM_199437		129794819	-1	5	6	38	93	tier1	no_errors	ENST00000358825	ensembl	human	known	74_37	missense	11.63	6.06	SNP	1.000	C	5	38
KCNH6	81033	genome.wustl.edu	37	17	61620974	61620974	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:61620974C>A	ENST00000583023.1	+	10	2197	c.2186C>A	c.(2185-2187)cCt>cAt	p.P729H	KCNH6_ENST00000314672.5_Missense_Mutation_p.P729H|KCNH6_ENST00000456941.2_Missense_Mutation_p.P676H|KCNH6_ENST00000581784.1_Missense_Mutation_p.P676H	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	729					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CGACAGGCTCCTGGCAGCCAA	0.597													ENSG00000173826																																					0													62.0	66.0	65.0					17																	61620974		2203	4300	6503	SO:0001583	missense	0			-	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2186C>A	17.37:g.61620974C>A	ENSP00000463533:p.Pro729His		Q9BRD7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_ELK,prints_2pore_dom_K_chnl,pfscan_cNMP-bd_dom	p.P729H	ENST00000583023.1	37	c.2186	CCDS11638.1	17	.	.	.	.	.	.	.	.	.	.	C	14.15	2.449041	0.43531	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.99252	-5.1;-5.63	4.92	2.64	0.31445	.	0.638140	0.14362	U	0.324380	D	0.97838	0.9290	L	0.40543	1.245	0.33840	D	0.631324	B;B;P;B	0.35982	0.26;0.412;0.531;0.001	B;B;P;B	0.45474	0.289;0.219;0.482;0.002	D	0.99942	1.1416	10	0.52906	T	0.07	.	5.2281	0.15406	0.2019:0.6748:0.0:0.1233	.	606;729;676;729	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	H	729;676	ENSP00000318212:P729H;ENSP00000396900:P676H	ENSP00000318212:P729H	P	+	2	0	KCNH6	58974706	0.001000	0.12720	0.963000	0.40424	0.486000	0.33341	1.298000	0.33412	1.134000	0.42165	0.655000	0.94253	CCT	-	KCNH6	-	NULL		0.597	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	HGNC	protein_coding	OTTHUMT00000443853.1	0	0	0	76	76	57	0.00	0.00	C	NM_030779		61620974	+1	7	5	73	66	tier1	no_errors	ENST00000583023	ensembl	human	known	74_37	missense	8.75	7.04	SNP	0.651	A	7	73
PGLYRP2	114770	genome.wustl.edu	37	19	15586656	15586656	+	Silent	SNP	G	G	A	rs374756265		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:15586656G>A	ENST00000340880.4	-	2	1305	c.825C>T	c.(823-825)ggC>ggT	p.G275G	PGLYRP2_ENST00000292609.4_Silent_p.G275G	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	275					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						CATCCAGGGCGCCATTGAGGA	0.617													ENSG00000161031	G|||	1	0.000199681	0.0	0.0	5008	,	,		18580	0.0		0.0	False		,,,				2504	0.001																0								G		0,4406		0,0,2203	36.0	38.0	38.0		825	-9.8	0.8	19		38	1,8595		0,1,4297	no	coding-synonymous	PGLYRP2	NM_052890.3		0,1,6500	AA,AG,GG		0.0116,0.0,0.0077		275/577	15586656	1,13001	2203	4298	6501	SO:0001819	synonymous_variant	0			-	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.825C>T	19.37:g.15586656G>A			A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Silent	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.G275	ENST00000340880.4	37	c.825	CCDS12330.2	19																																																																																			-	PGLYRP2	-	NULL		0.617	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP2	HGNC	protein_coding	OTTHUMT00000319626.1	0	0	0	59	59	108	0.00	0.00	G	NM_052890		15586656	-1	6	4	37	117	tier1	no_errors	ENST00000292609	ensembl	human	known	74_37	silent	13.95	3.31	SNP	0.380	A	6	37
LOC63930	63930	genome.wustl.edu	37	20	61711627	61711627	+	lincRNA	SNP	C	C	T	rs558823515		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:61711627C>T	ENST00000607802.1	+	0	375					NR_033370.1																						GCCCCTGCAGCAAATCTCAGT	0.512													ENSG00000272259	C|||	1	0.000199681	0.0	0.0	5008	,	,		19104	0.001		0.0	False		,,,				2504	0.0																0																																												0			-																													20.37:g.61711627C>T				R	SNP	-	NULL	ENST00000607802.1	37	NULL		20																																																																																			-	RP11-305P22.9	-	-		0.512	RP11-305P22.9-001	KNOWN	basic	lincRNA	LOC63930	Clone_based_vega_gene	lincRNA	OTTHUMT00000470475.1	0	0	0	33	33	135	0.00	0.00	C			61711627	+1	8	15	40	145	tier1	no_errors	ENST00000607802	ensembl	human	known	74_37	rna	16.67	9.38	SNP	0.004	T	8	40
CYLC2	1539	genome.wustl.edu	37	9	105767654	105767654	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:105767654delA	ENST00000374798.3	+	5	811	c.741delA	c.(739-741)ggafs	p.G247fs	CYLC2_ENST00000487798.1_Frame_Shift_Del_p.G247fs	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	247	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				ATGAGGATGGAAAAAAAGATG	0.363													ENSG00000155833																																					0													111.0	106.0	108.0					9																	105767654		2203	4300	6503	SO:0001589	frameshift_variant	0				Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.741delA	9.37:g.105767654delA	ENSP00000420256:p.Gly247fs		B2R8F4|Q5VVJ9	Frame_Shift_Del	DEL	NULL	p.D250fs	ENST00000374798.3	37	c.741	CCDS35085.1	9																																																																																				CYLC2	-	NULL		0.363	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	0	0	0	73	73	144	0.00	0.00	A	NM_001340		105767654	+1	8	10	56	143	tier1	no_errors	ENST00000374798	ensembl	human	known	74_37	frame_shift_del	12.50	6.54	DEL	0.000	-	8	56
KANK1	23189	genome.wustl.edu	37	9	732477	732477	+	Silent	SNP	G	G	A	rs569686873|rs370051574		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:732477G>A	ENST00000382303.1	+	10	3757	c.3105G>A	c.(3103-3105)gaG>gaA	p.E1035E	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Silent_p.E1035E|KANK1_ENST00000382293.3_Silent_p.E877E	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1035					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TTGAAGAAGAGGAGGAGGAGG	0.468													ENSG00000107104	G|||	1	0.000199681	0.0	0.0	5008	,	,		19819	0.0		0.0	False		,,,				2504	0.001																0													153.0	134.0	140.0					9																	732477		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3105G>A	9.37:g.732477G>A			A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1035	ENST00000382303.1	37	c.3105	CCDS34976.1	9																																																																																			-	KANK1	-	NULL		0.468	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	0	0	0	59	59	72	0.00	0.00	G	NM_015158		732477	+1	12	23	30	41	tier1	no_errors	ENST00000382297	ensembl	human	known	74_37	silent	28.57	35.38	SNP	1.000	A	12	30
MPDZ	8777	genome.wustl.edu	37	9	13150632	13150632	+	Nonsense_Mutation	SNP	G	G	A	rs200131423		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr9:13150632G>A	ENST00000319217.7	-	25	3755	c.3508C>T	c.(3508-3510)Cga>Tga	p.R1170*	MPDZ_ENST00000536827.1_Nonsense_Mutation_p.R1170*|MPDZ_ENST00000538841.1_Nonsense_Mutation_p.R62*|MPDZ_ENST00000447879.1_Nonsense_Mutation_p.R1170*|MPDZ_ENST00000541718.1_Nonsense_Mutation_p.R1170*|MPDZ_ENST00000546205.1_Nonsense_Mutation_p.R1184*|MPDZ_ENST00000381015.4_Nonsense_Mutation_p.R1170*|MPDZ_ENST00000381022.2_Nonsense_Mutation_p.R1170*	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1170	PDZ 7. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.R1170*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CCCATCCCTCGTCCACCAACA	0.418													ENSG00000107186																																					1	Substitution - Nonsense(1)	large_intestine(1)						G	stop/ARG	1,3777		0,1,1888	95.0	93.0	93.0		3508	5.1	1.0	9		93	0,8262		0,0,4131	yes	stop-gained	MPDZ	NM_003829.3		0,1,6019	AA,AG,GG		0.0,0.0265,0.0083		1170/2042	13150632	1,12039	1889	4131	6020	SO:0001587	stop_gained	0			-	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.3508C>T	9.37:g.13150632G>A	ENSP00000320006:p.Arg1170*		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Nonsense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.R1170*	ENST00000319217.7	37	c.3508		9	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744547	0.89663	2.65E-4	0.0	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205;ENST00000433359;ENST00000542239	.	.	.	5.95	5.05	0.67936	.	0.000000	0.38326	N	0.001721	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6315	0.85035	0.0:0.0:0.869:0.131	.	.	.	.	X	1170;1170;1170;176;62;1170;1170;1170;1120;1184;62;62	.	ENSP00000320006:R1170X	R	-	1	2	MPDZ	13140632	1.000000	0.71417	0.997000	0.53966	0.212000	0.24457	3.556000	0.53734	1.509000	0.48786	0.655000	0.94253	CGA	rs200131423	MPDZ	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.418	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	HGNC	protein_coding	OTTHUMT00000055485.2	0	0	0	71	71	140	0.00	0.00	G	NM_003829		13150632	-1	14	33	35	79	tier1	no_errors	ENST00000319217	ensembl	human	known	74_37	nonsense	28.57	29.46	SNP	1.000	A	14	35
PCDH1	5097	genome.wustl.edu	37	5	141242814	141242815	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	-	-	-	G	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr5:141242814_141242815insG	ENST00000394536.3	-	3	3220_3221	c.3081_3082insC	c.(3079-3084)cccaaafs	p.K1028fs	PCDH1_ENST00000287008.3_Frame_Shift_Ins_p.K1028fs|PCDH1_ENST00000456271.1_Frame_Shift_Ins_p.K1016fs|PCDH1_ENST00000536585.1_Frame_Shift_Ins_p.K1006fs|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000503492.1_Intron	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	1028					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CTGGGGTATTTGGGGGGGTTGG	0.634													ENSG00000156453																									Ovarian(132;1609 1739 4190 14731 45037)												0																																										SO:0001589	frameshift_variant	0				AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.3082dupC	5.37:g.141242821_141242821dupG	ENSP00000378043:p.Lys1028fs		Q8IUP2	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K1027fs	ENST00000394536.3	37	c.3082_3081	CCDS43375.1	5																																																																																				PCDH1	-	pfam_Protocadherin		0.634	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	0	0	0	58	58	37	0.00	0.00	-	NM_032420		141242815	-1	12	9	45	22	tier1	no_errors	ENST00000287008	ensembl	human	known	74_37	frame_shift_ins	21.05	29.03	INS	1.000:1.000	G	12	45
MSH6	2956	genome.wustl.edu	37	2	48030639	48030640	+	Frame_Shift_Ins	INS	-	-	C	rs267608087|rs267608078|rs587782425		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:48030639_48030640insC	ENST00000234420.5	+	5	3405_3406	c.3253_3254insC	c.(3253-3255)accfs	p.T1085fs	MSH6_ENST00000540021.1_Frame_Shift_Ins_p.T955fs|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000538136.1_Frame_Shift_Ins_p.T783fs	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1085					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.F1088fs*5(1)|p.F1088fs*2(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCCGGAAGATACCCCCCCCTTC	0.436			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome				ENSG00000116062																											yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	4	Whole gene deletion(2)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)								0,22,4244		0,0,0,0,22,2111				http://www.ncbi.nlm.nih.gov/sites/varvu?gene		1.8	0.1		dbSNP_130	121	1,13,8240		0,0,1,0,13,4113	no	codingComplex	MSH6	NM_000179.2		0,0,1,0,35,6224	A1A1,A1A2,A1R,A2A2,A2R,RR		0.1696,0.5157,0.2875				1,35,12484				SO:0001589	frameshift_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3261dupC	2.37:g.48030647_48030647dupC	ENSP00000234420:p.Thr1085fs		B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Frame_Shift_Ins	INS	pfam_D_mismatch_repair_MutS_C,pfam_D_mismatch_repair_MutS-lik_N,pfam_D_mismatch_repair_MutS_core,pfam_PWWP_dom,pfam_D_mismatch_repair_MutS_clamp,pfam_D_mmatch_repair_MutS_con_dom,superfamily_D_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_D_mismatch_repair_MutS_N,superfamily_D_mmatch_repair_MutS_con_dom,smart_PWWP_dom,smart_D_mismatch_repair_MutS_core,smart_D_mismatch_repair_MutS_C,pirsf_D_mismatch_repair_Msh6,pfscan_PWWP_dom	p.F1088fs	ENST00000234420.5	37	c.3253_3254	CCDS1836.1	2																																																																																				MSH6	-	pfam_D_mismatch_repair_MutS_C,superfamily_P-loop_NTPase,smart_D_mismatch_repair_MutS_core,pirsf_D_mismatch_repair_Msh6		0.436	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH6	HGNC	protein_coding	OTTHUMT00000251180.4	0	0	1	108	108	148	0.00	0.67	-	NM_000179		48030640	+1	18	35	74	95	tier1	no_errors	ENST00000234420	ensembl	human	known	74_37	frame_shift_ins	19.57	26.92	INS	0.001:0.003	C	18	74
ABCA10	10349	genome.wustl.edu	37	17	67218780	67218780	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:67218780delT	ENST00000269081.4	-	5	1002	c.93delA	c.(91-93)aaafs	p.K31fs	ABCA10_ENST00000432313.2_Frame_Shift_Del_p.K31fs|ABCA10_ENST00000423818.2_Frame_Shift_Del_p.K31fs|ABCA10_ENST00000416101.2_Frame_Shift_Del_p.K31fs	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	31					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TTTCATGGTATTTTTTTGGAA	0.338													ENSG00000154263																																					0													106.0	102.0	103.0					17																	67218780		2203	4299	6502	SO:0001589	frameshift_variant	0				AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.93delA	17.37:g.67218780delT	ENSP00000269081:p.Lys31fs		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K31fs	ENST00000269081.4	37	c.93	CCDS11684.1	17																																																																																				ABCA10	-	NULL		0.338	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	0	0	0	116	116	121	0.00	0.00	T	NM_080282		67218780	-1	35	31	121	90	tier1	no_errors	ENST00000269081	ensembl	human	known	74_37	frame_shift_del	22.44	25.62	DEL	0.000	-	35	121
EGFR	1956	genome.wustl.edu	37	7	55087060	55087060	+	Splice_Site	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:55087060T>C	ENST00000275493.2	+	1	265		c.e1+2		EGFR_ENST00000420316.2_Splice_Site|EGFR_ENST00000342916.3_Splice_Site|EGFR_ENST00000463948.1_Splice_Site|EGFR_ENST00000455089.1_Splice_Site|EGFR_ENST00000344576.2_Splice_Site|EGFR_ENST00000442591.1_Splice_Site	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor						activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	AAAAGAAAGGTAAGGGCGTGT	0.786		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			ENSG00000146648																											yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0													6.0	8.0	7.0					7																	55087060		2092	4160	6252	SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	-		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.88+2T>C	7.37:g.55087060T>C			O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Splice_Site	SNP	-	e1+2	ENST00000275493.2	37	c.88+2	CCDS5514.1	7	.	.	.	.	.	.	.	.	.	.	T	17.25	3.340802	0.60963	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591	.	.	.	4.34	3.15	0.36227	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0313	0.30467	0.0:0.0:0.2072:0.7928	.	.	.	.	.	-1	.	.	.	+	.	.	EGFR	55054554	1.000000	0.71417	0.973000	0.42090	0.830000	0.47004	1.093000	0.30939	0.602000	0.29896	0.374000	0.22700	.	-	EGFR	-	-		0.786	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	HGNC	protein_coding	OTTHUMT00000251456.2	0	0	0	20	20	8	0.00	0.00	T	NM_005228	Intron	55087060	+1	4	0	18	2	tier1	no_errors	ENST00000275493	ensembl	human	known	74_37	splice_site	17.39	0.00	SNP	0.976	C	4	18
NLRP2	55655	genome.wustl.edu	37	19	55494501	55494501	+	Missense_Mutation	SNP	G	G	A	rs143361632		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:55494501G>A	ENST00000543010.1	+	6	1578	c.1435G>A	c.(1435-1437)Gac>Aac	p.D479N	NLRP2_ENST00000427260.2_Missense_Mutation_p.D456N|NLRP2_ENST00000391721.4_Missense_Mutation_p.D455N|NLRP2_ENST00000537859.1_Missense_Mutation_p.D457N|NLRP2_ENST00000448584.2_Missense_Mutation_p.D479N|NLRP2_ENST00000538819.1_Missense_Mutation_p.D455N|NLRP2_ENST00000263437.6_Missense_Mutation_p.D476N|NLRP2_ENST00000339757.7_Missense_Mutation_p.D457N	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	479	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GCAGGAGTCCGACCTCCGTCT	0.642													ENSG00000022556																																					0								G	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP	1,4405		0,1,2202	39.0	38.0	38.0		1435,1369,1366,1435	0.8	0.0	19	dbSNP_134	38	0,8600		0,0,4300	no	missense,missense,missense,missense	NLRP2	NM_001174081.1,NM_001174082.1,NM_001174083.1,NM_017852.3	23,23,23,23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign	479/1063,457/1041,456/1040,479/1063	55494501	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1435G>A	19.37:g.55494501G>A	ENSP00000445135:p.Asp479Asn		B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.D479N	ENST00000543010.1	37	c.1435	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933190	0.34096	2.27E-4	0.0	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.76448	-1.0;-0.92;-0.93;-1.0;-0.93;-1.02;-0.92;-1.0	1.85	0.794	0.18638	.	0.778678	0.10493	N	0.668237	T	0.71668	0.3367	M	0.62209	1.925	0.09310	N	1	P;P;P;P;P	0.42973	0.796;0.735;0.617;0.735;0.617	B;B;B;B;B	0.41646	0.177;0.362;0.198;0.362;0.198	T	0.61540	-0.7042	10	0.51188	T	0.08	.	4.417	0.11461	0.1989:0.0:0.8011:0.0	.	456;457;476;455;479	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	N	479;455;457;479;457;456;455;476	ENSP00000445135:D479N;ENSP00000375601:D455N;ENSP00000344074:D457N;ENSP00000409370:D479N;ENSP00000440601:D457N;ENSP00000402474:D456N;ENSP00000441133:D455N;ENSP00000263437:D476N	ENSP00000263437:D476N	D	+	1	0	NLRP2	60186313	0.009000	0.17119	0.001000	0.08648	0.018000	0.09664	0.936000	0.28938	0.374000	0.24650	0.556000	0.70494	GAC	rs143361632	NLRP2	-	NULL		0.642	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	0	0	0	35	35	6	0.00	0.00	G	NM_017852		55494501	+1	10	0	19	5	tier1	no_errors	ENST00000448584	ensembl	human	known	74_37	missense	34.48	0.00	SNP	0.000	A	10	19
POTEC	388468	genome.wustl.edu	37	18	14537923	14537923	+	Silent	SNP	G	G	A	rs373166777		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr18:14537923G>A	ENST00000358970.5	-	3	686	c.687C>T	c.(685-687)ggC>ggT	p.G229G	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	229										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						TTTGATCAGCGCCATGTTCCA	0.378													ENSG00000183206	.|||	1	0.000199681	0.0	0.0014	5008	,	,		18302	0.0		0.0	False		,,,				2504	0.0																0								G		0,1384		0,0,692	445.0	346.0	376.0		687	0.2	0.0	18		376	1,3181		0,1,1590	no	coding-synonymous	POTEC	NM_001137671.1		0,1,2282	AA,AG,GG		0.0314,0.0,0.0219		229/543	14537923	1,4565	692	1591	2283	SO:0001819	synonymous_variant	0			-	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.687C>T	18.37:g.14537923G>A				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G229	ENST00000358970.5	37	c.687	CCDS45835.1	18																																																																																			-	POTEC	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt		0.378	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	0	0	0	353	353	10	0.00	0.00	G	XM_496269		14537923	-1	64	0	162	7	tier1	no_errors	ENST00000358970	ensembl	human	known	74_37	silent	28.32	0.00	SNP	0.939	A	64	162
ZNF629	23361	genome.wustl.edu	37	16	30795100	30795100	+	Silent	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:30795100G>A	ENST00000262525.4	-	3	756	c.549C>T	c.(547-549)tgC>tgT	p.C183C		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	183					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			AGCTCTTGCCGCACTCGGAGC	0.647													ENSG00000102870																																					0													41.0	43.0	42.0					16																	30795100		2197	4300	6497	SO:0001819	synonymous_variant	0			-	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.549C>T	16.37:g.30795100G>A			Q15938	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C183	ENST00000262525.4	37	c.549	CCDS45463.1	16																																																																																			-	ZNF629	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.647	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF629	HGNC	protein_coding	OTTHUMT00000434291.1	0	0	0	35	35	8	0.00	0.00	G	NM_015309		30795100	-1	6	0	18	4	tier1	no_errors	ENST00000262525	ensembl	human	known	74_37	silent	25.00	0.00	SNP	1.000	A	6	18
ALPP	250	genome.wustl.edu	37	2	233246473	233246475	+	In_Frame_Del	DEL	CTG	CTG	-	rs1048998	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr2:233246473_233246475delCTG	ENST00000392027.2	+	11	1845_1847	c.1576_1578delCTG	c.(1576-1578)ctgdel	p.L529del	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	529					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GGCCGGGACCCTGCTGCTGCTGG	0.734													ENSG00000163283																																					0																																										SO:0001651	inframe_deletion	0				M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.1576_1578delCTG	2.37:g.233246482_233246484delCTG	ENSP00000375881:p.Leu529del		P05188|P06861|Q53S78|Q96DB7	In_Frame_Del	DEL	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.L529in_frame_del	ENST00000392027.2	37	c.1576_1578	CCDS2490.1	2																																																																																				ALPP	-	NULL		0.734	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	HGNC	protein_coding	OTTHUMT00000257032.3	0	0	0	21	21	0	0.00	0.00	CTG	NM_001632		233246475	+1	3	0	18	5	tier1	no_errors	ENST00000392027	ensembl	human	known	74_37	in_frame_del	14.29	0.00	DEL	0.007:0.103:0.307	-	3	18
C1orf86	199990	genome.wustl.edu	37	1	2125187	2125187	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:2125187G>A	ENST00000378546.4	-	3	385	c.361C>T	c.(361-363)Cgc>Tgc	p.R121C	C1orf86_ENST00000400919.3_5'UTR|C1orf86_ENST00000378545.3_Missense_Mutation_p.R224C|C1orf86_ENST00000487186.1_5'UTR	NM_182533.2	NP_872339	Q6NZ36	FAP20_HUMAN	chromosome 1 open reading frame 86	121					cellular response to DNA damage stimulus (GO:0006974)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	cell junction (GO:0030054)|chromosome (GO:0005694)|Fanconi anaemia nuclear complex (GO:0043240)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)			central_nervous_system(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		GGTGCCGGGCGCTGGGGCAGG	0.726													ENSG00000162585																																					0													13.0	18.0	16.0					1																	2125187		2144	4263	6407	SO:0001583	missense	0			-	AK126870	CCDS38.2, CCDS57965.1, CCDS72686.1, CCDS72687.1	1p36.33	2013-05-22			ENSG00000162585	ENSG00000162585			26428	protein-coding gene	gene with protein product		615183				14702039	Standard	NM_182533		Approved	FLJ31031, FAAP20	uc031pkt.1	Q6NZ36	OTTHUMG00000001404	ENST00000378546.4:c.361C>T	1.37:g.2125187G>A	ENSP00000367808:p.Arg121Cys		A6PW39|A6PW40|A6PW41|A8MQT6|F2Z2L4|Q6ZT64|Q71M24|Q96ND7	Missense_Mutation	SNP	NULL	p.R224C	ENST00000378546.4	37	c.670	CCDS38.2	1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095047	0.36952	.	.	ENSG00000162585	ENST00000400918;ENST00000378546;ENST00000378545	T;T;T	0.45668	0.96;0.97;0.89	3.6	-6.06	0.02165	.	1.682180	0.03744	N	0.255451	T	0.24967	0.0606	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14090	-1.0485	9	0.34782	T	0.22	-0.1747	5.7423	0.18100	0.4582:0.1443:0.3975:0.0	.	121	Q6NZ36	CA086_HUMAN	C	121;121;224	ENSP00000383709:R121C;ENSP00000367808:R121C;ENSP00000367807:R224C	ENSP00000367807:R224C	R	-	1	0	C1orf86	2115047	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.380000	0.02551	-1.283000	0.02393	0.561000	0.74099	CGC	-	C1orf86	-	NULL		0.726	C1orf86-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf86	HGNC	protein_coding	OTTHUMT00000316541.1	0	0	0	51	51	2	0.00	0.00	G	NM_182533		2125187	-1	15	0	28	5	tier1	no_errors	ENST00000378545	ensembl	human	known	74_37	missense	34.88	0.00	SNP	0.000	A	15	28
CHRM1	1128	genome.wustl.edu	37	11	62677864	62677864	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:62677864T>C	ENST00000306960.3	-	2	1250	c.709A>G	c.(709-711)Agc>Ggc	p.S237G	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	237					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	CTGCTGCTGCTGCCACCCCCT	0.677													ENSG00000168539																																					0													23.0	27.0	26.0					11																	62677864		2201	4298	6499	SO:0001583	missense	0			-	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.709A>G	11.37:g.62677864T>C	ENSP00000306490:p.Ser237Gly		Q96RH1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M1_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.S237G	ENST00000306960.3	37	c.709	CCDS8040.1	11	.	.	.	.	.	.	.	.	.	.	T	10.45	1.355024	0.24512	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.60672	0.21;0.17	4.3	4.3	0.51218	GPCR, rhodopsin-like superfamily (1);	0.348645	0.23815	N	0.044288	T	0.38904	0.1058	L	0.29908	0.895	0.30999	N	0.720536	P	0.40534	0.72	B	0.33690	0.168	T	0.40515	-0.9559	10	0.17369	T	0.5	-28.7861	11.4279	0.50022	0.0:0.0:0.0:1.0	.	237	P11229	ACM1_HUMAN	G	237	ENSP00000306490:S237G;ENSP00000441188:S237G	ENSP00000306490:S237G	S	-	1	0	CHRM1	62434440	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.936000	0.28938	1.813000	0.52934	0.460000	0.39030	AGC	-	CHRM1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.677	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM1	HGNC	protein_coding	OTTHUMT00000396178.1	0	0	0	21	21	1	0.00	0.00	T	NM_000738		62677864	-1	6	1	7	4	tier1	no_errors	ENST00000306960	ensembl	human	known	74_37	missense	46.15	20.00	SNP	1.000	C	6	7
EHD2	30846	genome.wustl.edu	37	19	48244692	48244693	+	3'UTR	INS	-	-	G	rs3833256|rs397747084	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:48244692_48244693insG	ENST00000263277.3	+	0	1886_1887				EHD2_ENST00000540884.1_3'UTR|EHD2_ENST00000538399.1_3'UTR	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2						blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		CCGAGTGAGCCGGCCCCCCTCC	0.728													ENSG00000024422	GGg|GG|GGG|deletion	3557	0.710264	0.8487	0.6916	5008	,	,		14502	0.5556		0.6809	False		,,,				2504	0.726																0										3369,711		1461,447,132						2.0	1.0		dbSNP_107	7	5498,2404		2048,1402,501	no	utr-3	EHD2	NM_014601.3		3509,1849,633	A1A1,A1R,RR		30.4227,17.4265,25.9973				8867,3115				SO:0001624	3_prime_UTR_variant	0				AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.*4->G	19.37:g.48244694_48244694dupG			B2RDH9|B4DNU6|Q96CB6	R	INS	-	NULL	ENST00000263277.3	37	NULL	CCDS12704.1	19																																																																																				EHD2	-	-		0.728	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD2	HGNC	protein_coding	OTTHUMT00000465851.1	0	0	0	9	9	0	0.00	0.00	-			48244693	+1	4	0	10	0	tier1	no_errors	ENST00000540884	ensembl	human	known	74_37	rna	28.57	0.00	INS	0.938:0.089	G	4	10
RP11-680F20.6	0	genome.wustl.edu	37	11	125821790	125821790	+	RNA	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr11:125821790C>T	ENST00000531193.1	+	0	104				RP11-680F20.6_ENST00000524962.2_RNA|RP11-680F20.6_ENST00000529072.1_RNA																							AGTGGCCTGGCGGCGAGCCCC	0.662													ENSG00000254967																																					0																																												0			-																													11.37:g.125821790C>T				R	SNP	-	NULL	ENST00000531193.1	37	NULL		11																																																																																			-	RP11-680F20.6	-	-		0.662	RP11-680F20.6-002	KNOWN	basic	antisense	ENSG00000254967	Clone_based_vega_gene	antisense	OTTHUMT00000386745.1	0	0	0	42	42	4	0.00	0.00	C			125821790	+1	14	0	23	4	tier1	no_errors	ENST00000524962	ensembl	human	known	74_37	rna	37.84	0.00	SNP	0.915	T	14	23
HECTD4	283450	genome.wustl.edu	37	12	112601463	112601463	+	Silent	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:112601463C>T	ENST00000430131.2	-	73	12659	c.11514G>A	c.(11512-11514)acG>acA	p.T3838T	HECTD4_ENST00000550722.1_Silent_p.T4114T|HECTD4_ENST00000549141.1_5'Flank|HECTD4_ENST00000377560.5_Silent_p.T4088T			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3838	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CCCGCACGGCCGTCACGCACT	0.677													ENSG00000173064																																					0													8.0	13.0	11.0					12																	112601463		1591	3072	4663	SO:0001819	synonymous_variant	0			-	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11514G>A	12.37:g.112601463C>T			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.T4088	ENST00000430131.2	37	c.12264		12																																																																																			-	HECTD4	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.677	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		0	0	0	19	19	3	0.00	0.00	C	NM_173813		112601463	-1	4	0	18	3	tier1	no_errors	ENST00000377560	ensembl	human	known	74_37	silent	18.18	0.00	SNP	0.014	T	4	18
LATS2	26524	genome.wustl.edu	37	13	21563156	21563156	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr13:21563156G>A	ENST00000382592.4	-	4	1168	c.763C>T	c.(763-765)Cgg>Tgg	p.R255W	LATS2_ENST00000472754.1_5'UTR|LATS2_ENST00000542899.1_Missense_Mutation_p.R255W	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		AGGTGCGGCCGCCCGTAGTGC	0.726													ENSG00000150457																																					0													5.0	6.0	6.0					13																	21563156		2086	4113	6199	SO:0001583	missense	0			-	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.763C>T	13.37:g.21563156G>A	ENSP00000372035:p.Arg255Trp			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.R255W	ENST00000382592.4	37	c.763	CCDS9294.1	13	.	.	.	.	.	.	.	.	.	.	G	12.69	2.013433	0.35511	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.60797	0.16;0.16	3.9	1.8	0.24995	.	0.087086	0.46442	D	0.000289	T	0.58807	0.2148	L	0.29908	0.895	0.41734	D	0.989576	D	0.89917	1.0	D	0.79784	0.993	T	0.58983	-0.7539	10	0.87932	D	0	.	6.2678	0.20936	0.118:0.0:0.5915:0.2905	.	255	Q9NRM7	LATS2_HUMAN	W	255	ENSP00000372035:R255W;ENSP00000441817:R255W	ENSP00000372035:R255W	R	-	1	2	LATS2	20461156	0.996000	0.38824	0.017000	0.16124	0.049000	0.14656	1.640000	0.37186	0.608000	0.30000	0.485000	0.47835	CGG	-	LATS2	-	NULL		0.726	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	HGNC	protein_coding	OTTHUMT00000044102.1	0	0	0	17	17	2	0.00	0.00	G			21563156	-1	9	0	11	3	tier1	no_errors	ENST00000382592	ensembl	human	known	74_37	missense	42.86	0.00	SNP	0.999	A	9	11
MAP3K6	9064	genome.wustl.edu	37	1	27684949	27684949	+	Missense_Mutation	SNP	G	G	A	rs376352782		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:27684949G>A	ENST00000493901.1	-	21	2976	c.2737C>T	c.(2737-2739)Cgc>Tgc	p.R913C	MAP3K6_ENST00000374040.3_Missense_Mutation_p.R905C|MAP3K6_ENST00000357582.2_Missense_Mutation_p.R913C	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	913					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CTGGGGCTGCGGCTCCTTTTC	0.667													ENSG00000142733																																					0								G	CYS/ARG	1,4373		0,1,2186	26.0	33.0	31.0		2737	3.7	1.0	1		31	0,8564		0,0,4282	no	missense	MAP3K6	NM_004672.3	180	0,1,6468	AA,AG,GG		0.0,0.0229,0.0077	benign	913/1289	27684949	1,12937	2187	4282	6469	SO:0001583	missense	0			-	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2737C>T	1.37:g.27684949G>A	ENSP00000419591:p.Arg913Cys		A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R913C	ENST00000493901.1	37	c.2737	CCDS299.1	1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844519	0.71488	2.29E-4	0.0	ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582	T;T;T	0.25085	1.82;1.82;1.82	4.56	3.65	0.41850	Protein kinase-like domain (1);	.	.	.	.	T	0.18173	0.0436	L	0.27053	0.805	0.44234	D	0.997072	B;B	0.18968	0.032;0.009	B;B	0.16722	0.016;0.002	T	0.04509	-1.0946	9	0.62326	D	0.03	.	9.5427	0.39262	0.0988:0.0:0.9012:0.0	.	905;913	O95382-3;O95382	.;M3K6_HUMAN	C	905;913;636;913	ENSP00000363152:R905C;ENSP00000419591:R913C;ENSP00000350195:R913C	ENSP00000350195:R913C	R	-	1	0	MAP3K6	27557536	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	1.495000	0.35627	1.154000	0.42482	0.655000	0.94253	CGC	-	MAP3K6	-	superfamily_Kinase-like_dom		0.667	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MAP3K6	HGNC	protein_coding	OTTHUMT00000013469.2	0	0	0	52	52	2	0.00	0.00	G	NM_004672		27684949	-1	15	0	40	8	tier1	no_errors	ENST00000357582	ensembl	human	known	74_37	missense	27.27	0.00	SNP	1.000	A	15	40
LINC00623	728855	genome.wustl.edu	37	1	149576483	149576483	+	lincRNA	SNP	G	G	A	rs28475661		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr1:149576483G>A	ENST00000447883.2	-	0	1116				RP11-277L2.4_ENST00000596960.1_lincRNA																							GATCACTTCCGAAACCACTTG	0.572													ENSG00000269501																																					0																																												0			-																													1.37:g.149576483G>A				R	SNP	-	NULL	ENST00000447883.2	37	NULL		1																																																																																			-	RP11-353N4.6	-	-		0.572	RP11-277L2.3-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LINC00623	Clone_based_vega_gene	lincRNA	OTTHUMT00000039131.2	0	0	0	21	21	0	0.00	0.00	G			149576483	+1	4	0	16	0	tier1	no_errors	ENST00000455295	ensembl	human	known	74_37	rna	20.00	0.00	SNP	1.000	A	4	16
NGFR	4804	genome.wustl.edu	37	17	47590304	47590304	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:47590304G>A	ENST00000172229.3	+	6	1342	c.1217G>A	c.(1216-1218)cGc>cAc	p.R406H	NGFR_ENST00000504201.1_Missense_Mutation_p.R312H|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	406	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GCCGCCCTGCGCCGCATCCAG	0.692													ENSG00000064300																																					0																																										SO:0001583	missense	0			-	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1217G>A	17.37:g.47590304G>A	ENSP00000172229:p.Arg406His		B2R961|B4E096	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_16	p.R406H	ENST00000172229.3	37	c.1217	CCDS11549.1	17	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305889	0.81247	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.86627	-2.15;-2.15	4.55	2.52	0.30459	Death (3);DEATH-like (2);	0.580848	0.16229	N	0.223695	D	0.89691	0.6788	L	0.52759	1.655	0.40555	D	0.981154	D	0.89917	1.0	D	0.77004	0.989	D	0.87399	0.2368	10	0.42905	T	0.14	-28.8598	9.3431	0.38091	0.1823:0.0:0.8177:0.0	.	406	P08138	TNR16_HUMAN	H	406;312	ENSP00000172229:R406H;ENSP00000421731:R312H	ENSP00000172229:R406H	R	+	2	0	NGFR	44945303	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.627000	0.61276	1.029000	0.39812	0.561000	0.74099	CGC	-	NGFR	-	pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain		0.692	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGFR	HGNC	protein_coding	OTTHUMT00000365150.1	0	0	0	52	52	2	0.00	0.00	G			47590304	+1	21	0	41	1	tier1	no_errors	ENST00000172229	ensembl	human	known	74_37	missense	33.33	0.00	SNP	1.000	A	21	41
NPIPB4	440345	genome.wustl.edu	37	16	21854779	21854779	+	Missense_Mutation	SNP	C	C	T	rs572442379	byFrequency	TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:21854779C>T	ENST00000415645.2	-	4	512	c.473G>A	c.(472-474)cGt>cAt	p.R158H	NPIPB4_ENST00000451409.1_5'UTR|NPIPB4_ENST00000539318.1_5'UTR|NPIPB4_ENST00000357370.5_Missense_Mutation_p.R158H			C9JG80	NPIB4_HUMAN	nuclear pore complex interacting protein family, member B4	158						integral component of membrane (GO:0016021)											CTTCCTCTTACGGATTTTAGC	0.383													ENSG00000185864	.|||	2	0.000399361	0.0015	0.0	5008	,	,		35710	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0			-			16p12.2	2013-06-11			ENSG00000185864	ENSG00000185864			41985	protein-coding gene	gene with protein product							Standard	XM_006721108		Approved			C9JG80	OTTHUMG00000163555	ENST00000415645.2:c.473G>A	16.37:g.21854779C>T	ENSP00000404439:p.Arg158His			Missense_Mutation	SNP	NULL	p.R158H	ENST00000415645.2	37	c.473		16	.	.	.	.	.	.	.	.	.	.	.	5.254	0.232233	0.09969	.	.	ENSG00000185864	ENST00000415645;ENST00000357370;ENST00000341400	T;T;T	0.43688	0.94;0.94;0.94	0.589	-1.18	0.09617	.	.	.	.	.	T	0.14527	0.0351	.	.	.	.	.	.	P;B	0.35174	0.488;0.337	B;B	0.31390	0.081;0.129	T	0.35226	-0.9797	6	0.02654	T	1	.	.	.	.	.	158;158	C9JG80;Q92617	.;NPPL3_HUMAN	H	158	ENSP00000404439:R158H;ENSP00000349936:R158H;ENSP00000339196:R158H	ENSP00000339196:R158H	R	-	2	0	RP11-645C24.1	21762280	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.341000	0.07811	-0.348000	0.08286	-1.176000	0.01726	CGT	-	NPIPB4	-	NULL		0.383	NPIPB4-202	KNOWN	basic|appris_principal	protein_coding	NPIPB4	HGNC	protein_coding		0	0	0	684	684	0	0.00	0.00	C			21854779	-1	69	0	592	0	tier1	no_errors	ENST00000415645	ensembl	human	known	74_37	missense	10.44	0.00	SNP	0.000	T	69	592
PSG2	5670	genome.wustl.edu	37	19	43585129	43585129	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr19:43585129C>T	ENST00000406487.1	-	2	432	c.334G>A	c.(334-336)Gtc>Atc	p.V112I	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	112	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				TCCCGGGTGACATTCTGGATC	0.438													ENSG00000242221																																					0													101.0	103.0	102.0					19																	43585129		2203	4282	6485	SO:0001583	missense	0			-		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.334G>A	19.37:g.43585129C>T	ENSP00000385706:p.Val112Ile		Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V112I	ENST00000406487.1	37	c.334	CCDS12616.1	19	.	.	.	.	.	.	.	.	.	.	N	10.56	1.383342	0.25031	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.66815	-0.23	0.569	0.569	0.17340	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77864	0.4194	M	0.77103	2.36	0.09310	N	1	P;D	0.63880	0.661;0.993	P;D	0.74674	0.863;0.984	T	0.63932	-0.6525	8	0.42905	T	0.14	.	.	.	.	.	112;112	B5MCM8;P11465	.;PSG2_HUMAN	I	112	ENSP00000385706:V112I	ENSP00000332984:V112I	V	-	1	0	PSG2	48276969	0.003000	0.15002	0.206000	0.23566	0.036000	0.12997	0.086000	0.14935	0.567000	0.29293	0.184000	0.17185	GTC	-	PSG2	-	pfam_Ig_V-set,smart_Ig_sub		0.438	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG2	HGNC	protein_coding	OTTHUMT00000323083.1	0	0	0	240	240	0	0.00	0.00	C	NM_031246		43585129	-1	65	0	171	0	tier1	no_errors	ENST00000406487	ensembl	human	known	74_37	missense	27.54	0.00	SNP	0.304	T	65	171
PTMAP5	150928	genome.wustl.edu	37	13	82264110	82264110	+	RNA	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr13:82264110C>T	ENST00000607242.1	+	0	65									prothymosin, alpha pseudogene 5																		gcgcctcctccgccgccgcGG	0.587													ENSG00000214182																																					0																																												0			-	S38627		13q13.1	2008-11-06	2008-04-03		ENSG00000214182	ENSG00000214182			9628	pseudogene	pseudogene	"""gene sequence 150"""		"""prothymosin, alpha pseudogene 5 (gene sequence 150)"""			1612591	Standard	NG_004798		Approved				OTTHUMG00000017147		13.37:g.82264110C>T				R	SNP	-	NULL	ENST00000607242.1	37	NULL		13																																																																																			-	PTMAP5	-	-		0.587	PTMAP5-002	KNOWN	basic	processed_transcript	PTMAP5	HGNC	pseudogene	OTTHUMT00000470311.1	0	0	0	21	21	3	0.00	0.00	C			82264110	+1	15	1	17	2	tier1	no_errors	ENST00000607242	ensembl	human	known	74_37	rna	46.88	33.33	SNP	0.945	T	15	17
SFMBT2	57713	genome.wustl.edu	37	10	7213964	7213964	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr10:7213964C>T	ENST00000361972.4	-	19	2398	c.2308G>A	c.(2308-2310)Gtg>Atg	p.V770M	SFMBT2_ENST00000397167.1_Missense_Mutation_p.V770M	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	770					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GGCCGGCGCACGGGCTCTGAG	0.761													ENSG00000198879																																					0													8.0	10.0	9.0					10																	7213964		2041	3987	6028	SO:0001583	missense	0			-	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2308G>A	10.37:g.7213964C>T	ENSP00000355109:p.Val770Met		A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.V770M	ENST00000361972.4	37	c.2308	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091346	0.36855	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.14640	2.49;2.49	5.25	1.27	0.21489	.	0.968493	0.08608	N	0.920495	T	0.08133	0.0203	L	0.29908	0.895	0.19945	N	0.999943	P	0.36027	0.533	B	0.23419	0.046	T	0.30736	-0.9968	10	0.48119	T	0.1	.	5.2985	0.15766	0.1201:0.648:0.1162:0.1157	.	770	Q5VUG0	SMBT2_HUMAN	M	770	ENSP00000355109:V770M;ENSP00000380353:V770M	ENSP00000355109:V770M	V	-	1	0	SFMBT2	7253970	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.645000	0.24782	-0.029000	0.13827	-0.264000	0.10439	GTG	-	SFMBT2	-	NULL		0.761	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	0	0	0	49	49	0	0.00	0.00	C	NM_001029880		7213964	-1	9	0	21	0	tier1	no_errors	ENST00000361972	ensembl	human	known	74_37	missense	30.00	0.00	SNP	0.002	T	9	21
TNRC18	84629	genome.wustl.edu	37	7	5352432	5352432	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr7:5352432G>A	ENST00000430969.1	-	27	8438	c.8090C>T	c.(8089-8091)gCg>gTg	p.A2697V	TNRC18_ENST00000399537.4_Missense_Mutation_p.A2697V	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2697							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGGGAGCGCCGCCTGCGCGGA	0.721													ENSG00000182095																																					0													6.0	7.0	7.0					7																	5352432		1537	3503	5040	SO:0001583	missense	0			-	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.8090C>T	7.37:g.5352432G>A	ENSP00000395538:p.Ala2697Val		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.A2697V	ENST00000430969.1	37	c.8090	CCDS47534.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	3.995|3.995	-0.003753|-0.003753	0.07773|0.07773	.|.	.|.	ENSG00000182095|ENSG00000182095	ENST00000399537;ENST00000430969|ENST00000399544	T;T|.	0.06142|.	3.34;3.34|.	4.54|4.54	3.65|3.65	0.41850|0.41850	.|.	.|2.867570	.|0.02136	.|N	.|0.056775	T|T	0.24774|0.24774	0.0601|0.0601	N|N	0.08118|0.08118	0|0	0.27044|0.27044	N|N	0.963934|0.963934	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.28839|0.28839	-1.0031|-1.0031	9|7	0.25751|0.87932	T|D	0.34|0	.|.	6.0846|6.0846	0.19960|0.19960	0.1001:0.0:0.6608:0.2391|0.1001:0.0:0.6608:0.2391	.|.	2697|.	O15417|.	TNC18_HUMAN|.	V|W	2697|1210	ENSP00000382452:A2697V;ENSP00000395538:A2697V|.	ENSP00000382452:A2697V|ENSP00000382459:R1210W	A|R	-|-	2|1	0|2	TNRC18|TNRC18	5318958|5318958	0.887000|0.887000	0.30362|0.30362	0.005000|0.005000	0.12908|0.12908	0.000000|0.000000	0.00434|0.00434	2.577000|2.577000	0.46042|0.46042	0.861000|0.861000	0.35504|0.35504	-0.350000|-0.350000	0.07774|0.07774	GCG|CGG	-	TNRC18	-	NULL		0.721	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		0	0	0	34	34	1	0.00	0.00	G			5352432	-1	17	1	23	0	tier1	no_errors	ENST00000399537	ensembl	human	known	74_37	missense	40.48	100.00	SNP	0.652	A	17	23
TSEN54	283989	genome.wustl.edu	37	17	73518349	73518349	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:73518349G>A	ENST00000333213.6	+	8	1223	c.1187G>A	c.(1186-1188)cGg>cAg	p.R396Q		NM_207346.2	NP_997229.2	Q7Z6J9	SEN54_HUMAN	TSEN54 tRNA splicing endonuclease subunit	396					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)	13	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGCCAGCGCCGGGCCCCTCAC	0.701													ENSG00000182173																																					0													4.0	4.0	4.0					17																	73518349		1848	3677	5525	SO:0001583	missense	0			-	AK097583	CCDS11724.1	17q25.1	2013-08-06	2013-08-06		ENSG00000182173	ENSG00000182173		"""tRNA splicing endonuclease subunits"""	27561	protein-coding gene	gene with protein product		608755	"""tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae)"", ""tRNA splicing endonuclease 54 homolog (S. cerevisiae)"""			15109492	Standard	NM_207346		Approved	SEN54, SEN54L	uc002jof.1	Q7Z6J9		ENST00000333213.6:c.1187G>A	17.37:g.73518349G>A	ENSP00000327487:p.Arg396Gln		Q86WV3|Q86XE4|Q8N9H2	Missense_Mutation	SNP	NULL	p.R396Q	ENST00000333213.6	37	c.1187	CCDS11724.1	17	.	.	.	.	.	.	.	.	.	.	G	5.467	0.271176	0.10349	.	.	ENSG00000182173	ENST00000333213	T	0.63744	-0.06	5.47	-1.44	0.08856	.	0.503387	0.22344	N	0.061296	T	0.38188	0.1031	L	0.54323	1.7	0.09310	N	1	P	0.41710	0.76	B	0.27076	0.076	T	0.31138	-0.9954	10	0.30078	T	0.28	-0.1438	0.7064	0.00917	0.2446:0.2062:0.3381:0.211	.	396	Q7Z6J9	SEN54_HUMAN	Q	396	ENSP00000327487:R396Q	ENSP00000327487:R396Q	R	+	2	0	TSEN54	71029944	0.010000	0.17322	0.004000	0.12327	0.002000	0.02628	1.694000	0.37752	-0.217000	0.10033	-0.899000	0.02877	CGG	-	TSEN54	-	NULL		0.701	TSEN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN54	HGNC	protein_coding	OTTHUMT00000447618.1	0	0	0	19	19	1	0.00	0.00	G	NM_207346		73518349	+1	5	1	8	2	tier1	no_errors	ENST00000333213	ensembl	human	known	74_37	missense	38.46	33.33	SNP	0.000	A	5	8
ULK1	8408	genome.wustl.edu	37	12	132403074	132403074	+	Missense_Mutation	SNP	C	C	T	rs374570609		TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr12:132403074C>T	ENST00000321867.4	+	23	2710	c.2359C>T	c.(2359-2361)Cgc>Tgc	p.R787C	ULK1_ENST00000540647.1_Missense_Mutation_p.R32C	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	787					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CTCTTCTGCCCGCCACCTGGT	0.697													ENSG00000177169																																					0								C	CYS/ARG	1,4363		0,1,2181	15.0	18.0	17.0		2359	5.6	1.0	12		17	0,8544		0,0,4272	no	missense	ULK1	NM_003565.2	180	0,1,6453	TT,TC,CC		0.0,0.0229,0.0077	probably-damaging	787/1051	132403074	1,12907	2182	4272	6454	SO:0001583	missense	0			-	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2359C>T	12.37:g.132403074C>T	ENSP00000324560:p.Arg787Cys		Q9UQ28	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R787C	ENST00000321867.4	37	c.2359	CCDS9274.1	12	.	.	.	.	.	.	.	.	.	.	C	17.08	3.296995	0.60086	2.29E-4	0.0	ENSG00000177169	ENST00000321867;ENST00000541761;ENST00000540647	T;T;T	0.50277	0.75;0.75;0.75	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.64616	0.2614	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.66468	-0.5916	10	0.72032	D	0.01	-37.7429	13.5763	0.61877	0.2599:0.7401:0.0:0.0	.	787	O75385	ULK1_HUMAN	C	787;135;32	ENSP00000324560:R787C;ENSP00000444298:R135C;ENSP00000441794:R32C	ENSP00000324560:R787C	R	+	1	0	ULK1	130969027	0.921000	0.31238	0.981000	0.43875	0.222000	0.24845	1.717000	0.37991	2.631000	0.89168	0.561000	0.74099	CGC	-	ULK1	-	pirsf_Ser/Thr_kin_STPK_Ulk-1/2		0.697	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK1	HGNC	protein_coding	OTTHUMT00000397769.3	0	0	0	96	96	2	0.00	0.00	C			132403074	+1	28	1	53	4	tier1	no_errors	ENST00000321867	ensembl	human	known	74_37	missense	34.57	20.00	SNP	0.965	T	28	53
COL1A1	1277	genome.wustl.edu	37	17	48266268	48266268	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr17:48266268C>T	ENST00000225964.5	-	41	3159	c.3041G>A	c.(3040-3042)cGt>cAt	p.R1014H		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1014	Triple-helical region.		R -> C (in CAFFD). {ECO:0000269|PubMed:15864348}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GCTCACCTCACGTCCAGATTC	0.622			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta						ENSG00000108821																												Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0													47.0	52.0	50.0					17																	48266268		2203	4300	6503	SO:0001583	missense	0			-	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.3041G>A	17.37:g.48266268C>T	ENSP00000225964:p.Arg1014His		O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.R1014H	ENST00000225964.5	37	c.3041	CCDS11561.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.975001	0.74360	.	.	ENSG00000108821	ENST00000225964	D	0.93366	-3.21	4.02	4.02	0.46733	.	0.322809	0.29684	N	0.011461	D	0.94837	0.8332	L	0.45422	1.42	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	D	0.95224	0.8336	10	0.62326	D	0.03	.	15.1435	0.72630	0.0:1.0:0.0:0.0	.	1014	P02452	CO1A1_HUMAN	H	1014	ENSP00000225964:R1014H	ENSP00000225964:R1014H	R	-	2	0	COL1A1	45621267	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.850000	0.69473	2.103000	0.63969	0.298000	0.19748	CGT	-	COL1A1	-	NULL		0.622	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	HGNC	protein_coding	OTTHUMT00000309036.2	0	0	0	41	41	3	0.00	0.00	C			48266268	-1	6	2	27	5	tier1	no_errors	ENST00000225964	ensembl	human	known	74_37	missense	18.18	28.57	SNP	1.000	T	6	27
MAPK3	5595	genome.wustl.edu	37	16	30128165	30128165	+	Intron	SNP	C	C	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr16:30128165C>T	ENST00000263025.4	-	7	1102				MAPK3_ENST00000395200.1_Intron|MAPK3_ENST00000484663.1_Intron|MAPK3_ENST00000494643.1_5'Flank|MAPK3_ENST00000395202.1_Intron|MAPK3_ENST00000395199.3_Missense_Mutation_p.G356D|GDPD3_ENST00000406256.3_5'Flank|MAPK3_ENST00000403394.1_Missense_Mutation_p.G356D|MAPK3_ENST00000322266.5_Intron	NM_002746.2	NP_002737.2	P27361	MK03_HUMAN	mitogen-activated protein kinase 3						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage induced protein phosphorylation (GO:0006975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-1-mediated signaling pathway (GO:0070498)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apolipoprotein binding (GO:2000657)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to exogenous dsRNA (GO:0043330)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)									Arsenic trioxide(DB01169)|Sulindac(DB00605)	TGCCTACGTGCCCCCCTGCTC	0.667													ENSG00000102882																																					0													32.0	36.0	34.0					16																	30128165		2197	4296	6493	SO:0001627	intron_variant	0			-	M84490	CCDS10672.1, CCDS42148.1, CCDS42149.1	16p11.2	2011-06-10			ENSG00000102882	ENSG00000102882	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6877	protein-coding gene	gene with protein product		601795		PRKM3		9628824	Standard	NM_001109891		Approved	ERK1, p44mapk, p44erk1	uc002dws.3	P27361	OTTHUMG00000132149	ENST00000263025.4:c.1017+49G>A	16.37:g.30128165C>T			A8CZ58|B0LPG3|Q8NHX1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.G356D	ENST00000263025.4	37	c.1067	CCDS10672.1	16	.	.	.	.	.	.	.	.	.	.	C	3.750	-0.051802	0.07362	.	.	ENSG00000102882	ENST00000403394;ENST00000395199	T;T	0.77620	-1.11;-1.11	5.59	-2.31	0.06765	.	.	.	.	.	T	0.62744	0.2453	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49447	-0.8939	8	0.44086	T	0.13	.	6.6362	0.22885	0.1134:0.4869:0.0:0.3997	.	356	P27361-3	.	D	356	ENSP00000384895:G356D;ENSP00000378625:G356D	ENSP00000378625:G356D	G	-	2	0	MAPK3	30035666	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.226000	0.17776	-0.373000	0.07979	-0.152000	0.13540	GGC	-	MAPK3	-	NULL		0.667	MAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK3	HGNC	protein_coding	OTTHUMT00000255196.2	0	0	0	50	50	4	0.00	0.00	C			30128165	-1	11	5	42	7	tier1	no_errors	ENST00000403394	ensembl	human	known	74_37	missense	20.75	41.67	SNP	0.000	T	11	42
LOXHD1	125336	genome.wustl.edu	37	18	44121827	44121827	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr18:44121827A>T	ENST00000398722.4	-	18	2990	c.2991T>A	c.(2989-2991)tgT>tgA	p.C997*	LOXHD1_ENST00000579038.1_Nonsense_Mutation_p.C68*|LOXHD1_ENST00000441893.2_Nonsense_Mutation_p.C208*|LOXHD1_ENST00000441551.2_Nonsense_Mutation_p.C1069*|LOXHD1_ENST00000300591.6_Nonsense_Mutation_p.C164*|LOXHD1_ENST00000582408.1_Nonsense_Mutation_p.C164*|LOXHD1_ENST00000536736.1_Nonsense_Mutation_p.C1275*			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	997	PLAT 7. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GCCAGCGGCCACAGGGAAACG	0.552													ENSG00000167210																																					0													91.0	89.0	90.0					18																	44121827		692	1591	2283	SO:0001587	stop_gained	0			-	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2991T>A	18.37:g.44121827A>T	ENSP00000381707:p.Cys997*		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Nonsense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.C1275*	ENST00000398722.4	37	c.3825		18	.	.	.	.	.	.	.	.	.	.	A	38	6.903410	0.97924	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111	.	.	.	4.85	0.978	0.19740	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.8445	0.35162	0.7765:0.0:0.2235:0.0	.	.	.	.	X	164;997;1275;208;997;177	.	ENSP00000300591:C164X	C	-	3	2	LOXHD1	42375825	0.998000	0.40836	0.999000	0.59377	0.962000	0.63368	0.770000	0.26618	-0.068000	0.12953	0.379000	0.24179	TGT	-	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.552	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		0	0	0	65	65	53	0.00	0.00	A	NM_144612		44121827	-1	9	3	38	62	tier1	no_errors	ENST00000536736	ensembl	human	known	74_37	nonsense	19.15	4.62	SNP	1.000	T	9	38
TCEA2	6919	genome.wustl.edu	37	20	62694711	62694711	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB32-01A-11D-A417-09	TCGA-DX-AB32-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec03515c-a013-4a2d-82e0-8a2b4cd25321	5706f461-3e8d-4d11-99cd-adb6d97ae6ca	g.chr20:62694711G>A	ENST00000343484.5	+	1	215	c.46G>A	c.(46-48)Gac>Aac	p.D16N	TCEA2_ENST00000395053.3_Missense_Mutation_p.D16N|TCEA2_ENST00000361317.2_Intron	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	16	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					CCGGAGGCTGGACAAGATGGT	0.746													ENSG00000171703																																					0													28.0	26.0	26.0					20																	62694711		2020	4000	6020	SO:0001583	missense	0			-	U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.46G>A	20.37:g.62694711G>A	ENSP00000343515:p.Asp16Asn		B3KNM1|Q8TD37|Q8TD38	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_TFIIS_N,pfam_Znf_TFIIS,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.D16N	ENST00000343484.5	37	c.46	CCDS13553.1	20	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701220	0.88924	.	.	ENSG00000171703	ENST00000343484;ENST00000395053	.	.	.	3.3	3.3	0.37823	Transcription factor IIS, N-terminal (3);Transcription elongation factor, TFIIS/CRSP70, N-terminal, sub-type (1);	0.065404	0.64402	U	0.000016	T	0.46908	0.1417	L	0.43646	1.37	0.51767	D	0.999938	P	0.36577	0.558	B	0.33620	0.167	T	0.48445	-0.9035	9	0.33141	T	0.24	-20.3337	13.495	0.61421	0.0:0.0:1.0:0.0	.	16	Q15560	TCEA2_HUMAN	N	16	.	ENSP00000343515:D16N	D	+	1	0	TCEA2	62165155	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.440000	0.73435	1.646000	0.50622	0.313000	0.20887	GAC	-	TCEA2	-	superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pirsf_TF_IIS-rel,tigrfam_TFSII		0.746	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA2	HGNC	protein_coding	OTTHUMT00000080277.2	0	0	0	31	31	24	0.00	0.00	G	NM_198723		62694711	+1	6	2	3	21	tier1	no_errors	ENST00000343484	ensembl	human	known	74_37	missense	66.67	8.70	SNP	1.000	A	6	3
