#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PGS1	9489	genome.wustl.edu	37	17	76420060	76420060	+	Intron	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr17:76420060G>A	ENST00000262764.6	+	10	1707				PGS1_ENST00000588281.1_Intron|DNAH17_ENST00000585328.1_Missense_Mutation_p.T4434I|AC061992.1_ENST00000600087.1_5'Flank|DNAH17_ENST00000586052.1_5'UTR|PGS1_ENST00000329897.7_Intron|DNAH17_ENST00000389840.5_Missense_Mutation_p.T4462I	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			CAAGTTAAAGGTCCAGACATA	0.552													ENSG00000187775																									Esophageal Squamous(45;182 1126 10685 43198)												0													142.0	137.0	138.0					17																	76420060		2203	4300	6503	SO:0001627	intron_variant	0			-		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.1669-82G>A	17.37:g.76420060G>A			B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.T4462I	ENST00000262764.6	37	c.13385	CCDS42391.1	17	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013048	0.93346	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.09723	2.95	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000016	T	0.43456	0.1248	M	0.92691	3.335	0.53005	D	0.999969	D	0.57257	0.979	D	0.64877	0.93	T	0.55528	-0.8127	10	0.87932	D	0	.	19.0107	0.92871	0.0:0.0:1.0:0.0	.	4434	E7EUM8	.	I	4434;4462	ENSP00000374490:T4462I	ENSP00000300671:T4434I	T	-	2	0	DNAH17	73931655	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.050000	0.93843	2.713000	0.92767	0.655000	0.94253	ACC	-	DH17	-	pfam_Dynein_heavy_dom		0.552	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH17	HGNC	protein_coding	OTTHUMT00000437301.1	0	0	0	35	35	91	0.00	0.00	G	NM_024419		76420060	-1	7	18	31	48	tier1	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	18.42	27.27	SNP	1.000	A	7	31
CALU	813	genome.wustl.edu	37	7	128394753	128394753	+	Intron	SNP	A	A	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr7:128394753A>T	ENST00000249364.4	+	3	517				CALU_ENST00000449187.2_Missense_Mutation_p.N131I|CALU_ENST00000535623.1_3'UTR|CALU_ENST00000479257.1_Intron|CALU_ENST00000538546.1_Intron|CALU_ENST00000535011.2_Intron|CALU_ENST00000542996.2_Missense_Mutation_p.N139I	NM_001219.4	NP_001210.1	O43852	CALU_HUMAN	calumenin						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)			kidney(2)|large_intestine(3)|lung(5)	10						GAGTACAGAAACGTGACTTAT	0.448													ENSG00000128595																																					0													72.0	65.0	67.0					7																	128394753		692	1591	2283	SO:0001627	intron_variant	0			-	AF013759	CCDS5805.1, CCDS47703.1, CCDS56506.1, CCDS56507.1, CCDS56508.1	7q32	2013-01-10			ENSG00000128595	ENSG00000128595		"""EF-hand domain containing"""	1458	protein-coding gene	gene with protein product		603420				9598325	Standard	NM_001219		Approved		uc003vnq.3	O43852	OTTHUMG00000158274	ENST00000249364.4:c.415+244A>T	7.37:g.128394753A>T			B3KPG9|D6QS48|D6QS49|D6QS50|D6QS51|D6QS52|D6QS53|D6QS54|D6QS55|D6QS56|D6QS57|D6QS58|D6QS59|F5H1Q9|F5H879|O60456|Q6FHB9|Q96RL3|Q9NR43	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.N139I	ENST00000249364.4	37	c.416	CCDS5805.1	7	.	.	.	.	.	.	.	.	.	.	A	15.87	2.961944	0.53400	.	.	ENSG00000128595	ENST00000542996;ENST00000537667;ENST00000537014;ENST00000449187	T;T	0.71698	-0.59;-0.59	6.03	4.86	0.63082	.	.	.	.	.	T	0.80839	0.4700	M	0.76727	2.345	0.80722	D	1	D	0.61697	0.99	D	0.65773	0.938	T	0.79376	-0.1829	9	0.36615	T	0.2	.	10.9579	0.47368	0.86:0.0:0.0:0.14	.	139	D6QS48	.	I	139;131;131;131	ENSP00000438248:N139I;ENSP00000408838:N131I	ENSP00000408838:N131I	N	+	2	0	CALU	128181989	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.380000	0.79704	1.082000	0.41137	-0.327000	0.08410	AAC	-	CALU	-	smart_EF_hand_dom,pfscan_EF_hand_dom		0.448	CALU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALU	HGNC	protein_coding	OTTHUMT00000350533.1	0	0	0	57	57	92	0.00	0.00	A	NM_001219		128394753	+1	10	21	34	71	tier1	no_errors	ENST00000542996	ensembl	human	known	74_37	missense	22.73	22.83	SNP	1.000	T	10	34
SPEG	10290	genome.wustl.edu	37	2	220350080	220350080	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr2:220350080G>A	ENST00000312358.7	+	31	7754	c.7622G>A	c.(7621-7623)aGc>aAc	p.S2541N	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2541					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCAGGGGAAAGCCGAAGCCGG	0.612													ENSG00000072195																																					0													55.0	65.0	62.0					2																	220350080		1932	4124	6056	SO:0001583	missense	0			-	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.7622G>A	2.37:g.220350080G>A	ENSP00000311684:p.Ser2541Asn		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S2541N	ENST00000312358.7	37	c.7622	CCDS42824.1	2	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532028	0.64972	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.63255	-0.03	5.79	5.79	0.91817	.	0.133025	0.34802	N	0.003673	T	0.38453	0.1041	N	0.08118	0	0.80722	D	1	P	0.35433	0.501	B	0.29785	0.107	T	0.37150	-0.9718	10	0.16896	T	0.51	.	14.2202	0.65820	0.0712:0.0:0.9288:0.0	.	2541	Q15772	SPEG_HUMAN	N	2541	ENSP00000311684:S2541N	ENSP00000265327:S2541N	S	+	2	0	SPEG	220058324	0.963000	0.33076	1.000000	0.80357	0.995000	0.86356	2.941000	0.49011	2.743000	0.94032	0.655000	0.94253	AGC	-	SPEG	-	NULL		0.612	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	0	0	0	102	102	38	0.00	0.00	G	NM_005876		220350080	+1	65	20	148	73	tier1	no_errors	ENST00000312358	ensembl	human	novel	74_37	missense	30.37	21.51	SNP	1.000	A	65	148
HTR1A	3350	genome.wustl.edu	37	5	63257295	63257295	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr5:63257295C>A	ENST00000323865.3	-	1	485	c.252G>T	c.(250-252)atG>atT	p.M84I	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	84					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	ACACCGACACCATGAGGTCGG	0.607													ENSG00000178394																																					0													44.0	48.0	47.0					5																	63257295		2203	4300	6503	SO:0001583	missense	0			-	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.252G>T	5.37:g.63257295C>A	ENSP00000316244:p.Met84Ile		Q6LAE7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT1A_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.M84I	ENST00000323865.3	37	c.252	CCDS34168.1	5	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064830	0.76187	.	.	ENSG00000178394	ENST00000323865	T	0.35605	1.3	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.044538	0.85682	U	0.000000	T	0.39064	0.1064	L	0.52364	1.645	0.80722	D	1	P	0.41498	0.752	B	0.41764	0.366	T	0.42275	-0.9461	10	0.72032	D	0.01	.	16.6418	0.85128	0.0:1.0:0.0:0.0	.	84	P08908	5HT1A_HUMAN	I	84	ENSP00000316244:M84I	ENSP00000316244:M84I	M	-	3	0	HTR1A	63293051	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.353000	0.52247	2.170000	0.68504	0.561000	0.74099	ATG	-	HTR1A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.607	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	0	0	0	20	20	48	0.00	0.00	C	NM_000524		63257295	-1	6	9	7	18	tier1	no_errors	ENST00000323865	ensembl	human	known	74_37	missense	46.15	33.33	SNP	1.000	A	6	7
SHPRH	257218	genome.wustl.edu	37	6	146264415	146264415	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr6:146264415A>G	ENST00000367505.2	-	9	2366	c.2102T>C	c.(2101-2103)tTt>tCt	p.F701S	SHPRH_ENST00000438092.2_Missense_Mutation_p.F701S|SHPRH_ENST00000367503.3_Missense_Mutation_p.F701S|SHPRH_ENST00000275233.7_Missense_Mutation_p.F701S			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	701					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GGGGCAGTAAAAAGGCTTGAT	0.458													ENSG00000146414																																					0													71.0	73.0	72.0					6																	146264415		1954	4150	6104	SO:0001583	missense	0			-	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2102T>C	6.37:g.146264415A>G	ENSP00000356475:p.Phe701Ser		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Histone_H1/H5_H15,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,superfamily_WW_dom,smart_Helicase_ATP-bd,smart_Histone_H1/H5_H15,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.F701S	ENST00000367505.2	37	c.2102	CCDS43513.2	6	.	.	.	.	.	.	.	.	.	.	A	27.2	4.806833	0.90623	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.36	5.36	0.76844	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);DEAD-like helicase (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.79981	0.4540	M	0.83483	2.645	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	D	0.83551	0.0101	10	0.72032	D	0.01	-26.1917	15.6522	0.77108	1.0:0.0:0.0:0.0	.	590;701;701;590	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	S	701;701;701;701;590	ENSP00000356475:F701S;ENSP00000356473:F701S;ENSP00000412797:F701S;ENSP00000275233:F701S	ENSP00000275233:F701S	F	-	2	0	SHPRH	146306108	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.255000	0.95524	2.167000	0.68274	0.528000	0.53228	TTT	-	SHPRH	-	superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Znf_PHD		0.458	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2	0	0	0	25	25	94	0.00	0.00	A	NM_173082		146264415	-1	11	43	14	30	tier1	no_errors	ENST00000367503	ensembl	human	known	74_37	missense	44.00	58.90	SNP	1.000	G	11	14
ZNF141	7700	genome.wustl.edu	37	4	367650	367650	+	Silent	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr4:367650G>A	ENST00000240499.7	+	4	1573	c.1424G>A	c.(1423-1425)tGa>tAa	p.*475*	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	0					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						ATTCATACTTGAGAGAAATCC	0.323													ENSG00000131127																																					0													48.0	53.0	51.0					4																	367650		2185	4284	6469	SO:0001819	synonymous_variant	0			-	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.1424G>A	4.37:g.367650G>A			Q6DK07	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.*475	ENST00000240499.7	37	c.1424	CCDS33931.1	4																																																																																			-	ZNF141	-	NULL		0.323	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF141	HGNC	protein_coding	OTTHUMT00000357710.1	0	0	0	65	65	16	0.00	0.00	G	NM_003441		367650	+1	10	5	70	31	tier1	no_errors	ENST00000240499	ensembl	human	known	74_37	silent	12.50	13.51	SNP	0.173	A	10	70
DOCK3	1795	genome.wustl.edu	37	3	51297624	51297624	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr3:51297624G>A	ENST00000266037.9	+	23	2245	c.2222G>A	c.(2221-2223)cGg>cAg	p.R741Q		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	741					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GTACAGTCACGGATCCTGTAC	0.458													ENSG00000088538																																					0													88.0	88.0	88.0					3																	51297624		1933	4141	6074	SO:0001583	missense	0			-	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2222G>A	3.37:g.51297624G>A	ENSP00000266037:p.Arg741Gln		O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.R741Q	ENST00000266037.9	37	c.2222	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.917465	0.97105	.	.	ENSG00000088538	ENST00000266037	T	0.67523	-0.27	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.85856	0.5794	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87276	0.2289	10	0.87932	D	0	.	20.3368	0.98748	0.0:0.0:1.0:0.0	.	741	Q8IZD9	DOCK3_HUMAN	Q	741	ENSP00000266037:R741Q	ENSP00000266037:R741Q	R	+	2	0	DOCK3	51272664	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	9.869000	0.99810	2.805000	0.96524	0.655000	0.94253	CGG	-	DOCK3	-	superfamily_ARM-type_fold		0.458	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	0	0	0	49	49	93	0.00	0.00	G	NM_004947		51297624	+1	9	21	14	53	tier1	no_errors	ENST00000266037	ensembl	human	known	74_37	missense	39.13	28.38	SNP	1.000	A	9	14
ERICH3	127254	genome.wustl.edu	37	1	75097467	75097467	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr1:75097467G>C	ENST00000326665.5	-	7	967	c.749C>G	c.(748-750)tCt>tGt	p.S250C	C1orf173_ENST00000420661.2_Missense_Mutation_p.S53C	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		250								p.S250Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCATGTTTCAGATCTATTTTC	0.373													ENSG00000178965																																					1	Substitution - Missense(1)	lung(1)											189.0	171.0	177.0					1																	75097467		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000326665.5:c.749C>G	1.37:g.75097467G>C	ENSP00000322609:p.Ser250Cys		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.S250C	ENST00000326665.5	37	c.749	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	7.573	0.667156	0.14710	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.19394	2.61;2.15	5.39	1.88	0.25563	.	.	.	.	.	T	0.08758	0.0217	L	0.29908	0.895	0.09310	N	1	D;D	0.63046	0.984;0.992	P;P	0.53146	0.639;0.719	T	0.12192	-1.0557	9	0.56958	D	0.05	0.1152	1.6943	0.02859	0.3545:0.1324:0.3782:0.1349	.	53;250	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	C	250;53	ENSP00000322609:S250C;ENSP00000398581:S53C	ENSP00000322609:S250C	S	-	2	0	C1orf173	74870055	0.000000	0.05858	0.026000	0.17262	0.021000	0.10359	-0.021000	0.12504	0.592000	0.29728	0.650000	0.86243	TCT	-	C1orf173	-	NULL		0.373	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	0	0	0	35	35	112	0.00	0.00	G			75097467	-1	23	35	30	75	tier1	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	43.40	31.82	SNP	0.000	C	23	30
RYR3	6263	genome.wustl.edu	37	15	33858928	33858928	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr15:33858928G>T	ENST00000389232.4	+	12	1266	c.1196G>T	c.(1195-1197)aGa>aTa	p.R399I	RYR3_ENST00000415757.3_Missense_Mutation_p.R399I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	399	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACACTGCAGAGATGCCAGCGT	0.507													ENSG00000198838																																					0													176.0	180.0	179.0					15																	33858928		2128	4235	6363	SO:0001583	missense	0			-		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1196G>T	15.37:g.33858928G>T	ENSP00000373884:p.Arg399Ile		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R399I	ENST00000389232.4	37	c.1196	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205029	0.79127	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.91792	-2.91;-2.91	4.43	4.43	0.53597	MIR motif (1);MIR (1);	0.122081	0.52532	D	0.000066	D	0.93354	0.7881	M	0.80982	2.52	0.58432	D	0.999999	P;B	0.46220	0.874;0.049	P;B	0.45712	0.491;0.026	D	0.94542	0.7746	10	0.66056	D	0.02	.	17.1922	0.86882	0.0:0.0:1.0:0.0	.	399;399	Q15413-2;Q15413	.;RYR3_HUMAN	I	399	ENSP00000373884:R399I;ENSP00000399610:R399I	ENSP00000354735:R399I	R	+	2	0	RYR3	31646220	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.295000	0.78780	2.459000	0.83118	0.650000	0.86243	AGA	-	RYR3	-	superfamily_MIR_motif		0.507	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	0	0	0	45	45	97	0.00	0.00	G			33858928	+1	29	24	15	42	tier1	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	65.91	36.36	SNP	1.000	T	29	15
OR2T2	401992	genome.wustl.edu	37	1	248616711	248616711	+	Missense_Mutation	SNP	G	G	A	rs199823862		TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr1:248616711G>A	ENST00000342927.3	+	1	635	c.613G>A	c.(613-615)Gtg>Atg	p.V205M		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGCCTGCTGCGTGCTGATGCT	0.527													ENSG00000196240																																					0													126.0	88.0	101.0					1																	248616711		2194	4265	6459	SO:0001583	missense	0			-	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.613G>A	1.37:g.248616711G>A	ENSP00000343062:p.Val205Met		B2RNM1|B9EH01	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V205M	ENST00000342927.3	37	c.613	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	g	8.304	0.820618	0.16678	.	.	ENSG00000196240	ENST00000342927	T	0.41065	1.01	3.72	0.777	0.18538	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000579	T	0.40119	0.1104	M	0.71871	2.18	0.09310	N	1	D	0.58970	0.984	P	0.44477	0.451	T	0.37888	-0.9686	10	0.87932	D	0	.	6.9421	0.24498	0.4061:0.0:0.5939:0.0	.	205	Q6IF00	OR2T2_HUMAN	M	205	ENSP00000343062:V205M	ENSP00000343062:V205M	V	+	1	0	OR2T2	246683334	0.000000	0.05858	0.234000	0.24042	0.031000	0.12232	-0.402000	0.07223	-0.015000	0.14150	-0.403000	0.06358	GTG	-	OR2T2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	0	0	0	9	9	71	0.00	0.00	G	NM_001004136		248616711	+1	7	29	2	18	tier1	no_errors	ENST00000342927	ensembl	human	known	74_37	missense	77.78	61.70	SNP	0.001	A	7	2
KRR1	11103	genome.wustl.edu	37	12	75897849	75897849	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:75897849T>G	ENST00000229214.4	-	7	689	c.666A>C	c.(664-666)ttA>ttC	p.L222F	KRR1_ENST00000438169.2_Intron	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	222					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						TCTTAATCATTAAGCTCTTTA	0.308													ENSG00000111615																																					0													88.0	83.0	85.0					12																	75897849		2203	4300	6503	SO:0001583	missense	0			-	U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.666A>C	12.37:g.75897849T>G	ENSP00000229214:p.Leu222Phe		A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom	p.L222F	ENST00000229214.4	37	c.666	CCDS9012.1	12	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878862	0.72294	.	.	ENSG00000111615	ENST00000229214	T	0.33654	1.4	5.86	3.55	0.40652	.	0.000000	0.64402	D	0.000001	T	0.63153	0.2487	M	0.93898	3.47	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.65763	-0.6089	10	0.87932	D	0	-2.2027	5.4745	0.16688	0.0:0.3429:0.0:0.6571	.	222	Q13601	KRR1_HUMAN	F	222	ENSP00000229214:L222F	ENSP00000229214:L222F	L	-	3	2	KRR1	74184116	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.385000	0.34408	1.069000	0.40788	0.477000	0.44152	TTA	-	KRR1	-	NULL		0.308	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRR1	HGNC	protein_coding	OTTHUMT00000405727.1	0	0	0	33	33	56	0.00	0.00	T	NM_007043		75897849	-1	58	202	378	1618	tier1	no_errors	ENST00000229214	ensembl	human	known	74_37	missense	13.30	11.09	SNP	1.000	G	58	378
SPATA31D1	389763	genome.wustl.edu	37	9	84608921	84608921	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr9:84608921C>T	ENST00000344803.2	+	4	3583	c.3536C>T	c.(3535-3537)tCc>tTc	p.S1179F		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1179					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCAAGCACTTCCAATGAAACT	0.403													ENSG00000214929																																					0													59.0	56.0	57.0					9																	84608921		1863	4117	5980	SO:0001583	missense	0			-		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3536C>T	9.37:g.84608921C>T	ENSP00000341988:p.Ser1179Phe			Missense_Mutation	SNP	NULL	p.S1179F	ENST00000344803.2	37	c.3536	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	12.18	1.859444	0.32884	.	.	ENSG00000214929	ENST00000344803	T	0.05139	3.49	2.66	-3.1	0.05315	.	.	.	.	.	T	0.03263	0.0095	N	0.08118	0	0.09310	N	1	P	0.36683	0.565	B	0.40134	0.32	T	0.38351	-0.9665	9	0.72032	D	0.01	0.0034	2.819	0.05467	0.2565:0.4056:0.0:0.3379	.	1179	Q6ZQQ2	F75D1_HUMAN	F	1179	ENSP00000341988:S1179F	ENSP00000341988:S1179F	S	+	2	0	FAM75D1	83798741	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.028000	0.12350	-0.592000	0.05851	0.603000	0.83216	TCC	-	SPATA31D1	-	NULL		0.403	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	0	0	0	59	59	24	0.00	0.00	C	NM_001001670		84608921	+1	27	3	48	17	tier1	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	36.00	15.00	SNP	0.000	T	27	48
FGFR1OP	11116	genome.wustl.edu	37	6	167413584	167413584	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr6:167413584G>C	ENST00000366847.4	+	2	370	c.139G>C	c.(139-141)Gag>Cag	p.E47Q	FGFR1OP_ENST00000349556.4_Missense_Mutation_p.E47Q|RP1-167A14.2_ENST00000444102.1_RNA|RP11-517H2.6_ENST00000609590.1_RNA|FGFR1OP_ENST00000476078.1_3'UTR|MIR3939_ENST00000582614.1_RNA	NM_007045.2	NP_008976.1	O95684	FR1OP_HUMAN	FGFR1 oncogene partner	47					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein tyrosine kinase activity (GO:0061099)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|protein tyrosine kinase inhibitor activity (GO:0030292)			large_intestine(2)|ovary(1)|stomach(1)	4		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		AGCACTAGAGGAGCAAGAAAA	0.308			T	FGFR1	"""MPD, NHL"""								ENSG00000213066																												Dom	yes		6	6q27	11116	FGFR1 oncogene partner (FOP)		L	0													96.0	102.0	100.0					6																	167413584		2203	4300	6503	SO:0001583	missense	0			-	Y18046	CCDS5296.1, CCDS5297.1, CCDS75550.1	6q27	2008-02-05			ENSG00000213066	ENSG00000213066			17012	protein-coding gene	gene with protein product		605392				9949182, 10373756	Standard	NM_007045		Approved	FOP	uc003qvj.3	O95684	OTTHUMG00000016011	ENST00000366847.4:c.139G>C	6.37:g.167413584G>C	ENSP00000355812:p.Glu47Gln		A8K1D1|B2R705|Q49AI0|Q5R3F6|Q96EW1	Missense_Mutation	SNP	pfam_FOP_dimerisation-dom_N,pfscan_LisH_dimerisation	p.E47Q	ENST00000366847.4	37	c.139	CCDS5296.1	6	.	.	.	.	.	.	.	.	.	.	G	18.85	3.712328	0.68730	.	.	ENSG00000213066	ENST00000366847;ENST00000420493;ENST00000349556	T;T	0.39406	1.08;1.08	4.19	4.19	0.49359	.	0.200999	0.41294	D	0.000920	T	0.45478	0.1344	L	0.48642	1.525	0.51233	D	0.999914	D;D;P	0.89917	1.0;1.0;0.715	D;D;B	0.71414	0.973;0.947;0.401	T	0.41484	-0.9506	10	0.44086	T	0.13	-24.1284	13.6923	0.62553	0.0:0.0:1.0:0.0	.	47;47;47	E7ET71;O95684-2;O95684	.;.;FR1OP_HUMAN	Q	47	ENSP00000355812:E47Q;ENSP00000230248:E47Q	ENSP00000230248:E47Q	E	+	1	0	FGFR1OP	167333574	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.674000	0.61612	1.864000	0.54056	0.555000	0.69702	GAG	-	FGFR1OP	-	NULL		0.308	FGFR1OP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1OP	HGNC	protein_coding	OTTHUMT00000043099.2	0	0	0	112	112	75	0.00	0.00	G	NM_007045		167413584	+1	16	18	90	59	tier1	no_errors	ENST00000366847	ensembl	human	known	74_37	missense	15.09	23.38	SNP	1.000	C	16	90
KIAA2022	340533	genome.wustl.edu	37	X	73961202	73961202	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chrX:73961202G>A	ENST00000055682.6	-	3	3801	c.3190C>T	c.(3190-3192)Cgc>Tgc	p.R1064C		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1064					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GAAGAGTGGCGGAATTTGTCA	0.493													ENSG00000050030																																					0													85.0	80.0	82.0					X																	73961202		2203	4300	6503	SO:0001583	missense	0			-		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3190C>T	X.37:g.73961202G>A	ENSP00000055682:p.Arg1064Cys		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.R1064C	ENST00000055682.6	37	c.3190	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388088	0.61956	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.56103	0.48;0.48	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.61850	0.2380	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65356	-0.6188	10	0.87932	D	0	-6.4016	13.0532	0.58966	0.0:0.0:0.8394:0.1606	.	1064	Q5QGS0	K2022_HUMAN	C	1064	ENSP00000362567:R1064C;ENSP00000055682:R1064C	ENSP00000055682:R1064C	R	-	1	0	KIAA2022	73877927	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.659000	0.68010	2.192000	0.70111	0.600000	0.82982	CGC	-	KIAA2022	-	NULL		0.493	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	0	0	0	16	16	63	0.00	0.00	G	NM_001008537		73961202	-1	10	29	12	40	tier1	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	45.45	42.03	SNP	1.000	A	10	12
ZNF141	7700	genome.wustl.edu	37	4	367589	367589	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr4:367589G>A	ENST00000240499.7	+	4	1512	c.1363G>A	c.(1363-1365)Gat>Aat	p.D455N	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	455					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D455H(1)		breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						CAAATGTAAAGATTGTGACAA	0.328													ENSG00000131127																																					1	Substitution - Missense(1)	breast(1)											69.0	76.0	74.0					4																	367589		2203	4299	6502	SO:0001583	missense	0			-	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.1363G>A	4.37:g.367589G>A	ENSP00000240499:p.Asp455Asn		Q6DK07	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D455N	ENST00000240499.7	37	c.1363	CCDS33931.1	4	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085623	0.36758	.	.	ENSG00000131127	ENST00000240499	T	0.35973	1.28	1.24	1.24	0.21308	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27832	0.0685	L	0.39467	1.215	0.09310	N	1	B	0.22003	0.063	B	0.27170	0.077	T	0.27706	-1.0066	8	.	.	.	.	7.8922	0.29684	0.0:0.0:1.0:0.0	.	455	Q15928	ZN141_HUMAN	N	455	ENSP00000240499:D455N	.	D	+	1	0	ZNF141	357589	0.000000	0.05858	0.871000	0.34182	0.719000	0.41307	-0.343000	0.07791	0.591000	0.29711	0.313000	0.20887	GAT	-	ZNF141	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.328	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF141	HGNC	protein_coding	OTTHUMT00000357710.1	0	0	0	99	99	29	0.00	0.00	G	NM_003441		367589	+1	9	6	95	28	tier1	no_errors	ENST00000240499	ensembl	human	known	74_37	missense	8.65	17.65	SNP	0.011	A	9	95
HYDIN	54768	genome.wustl.edu	37	16	70942292	70942292	+	Silent	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr16:70942292C>T	ENST00000393567.2	-	49	8409	c.8259G>A	c.(8257-8259)acG>acA	p.T2753T		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2753					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCACCTGCAACGTTACCTCGC	0.502													ENSG00000157423																																					0													7.0	7.0	7.0					16																	70942292		1756	3990	5746	SO:0001819	synonymous_variant	0			-	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.8259G>A	16.37:g.70942292C>T			A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.T2753	ENST00000393567.2	37	c.8259	CCDS59269.1	16																																																																																			-	HYDIN	-	NULL		0.502	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	0	0	0	40	40	25	0.00	0.00	C			70942292	-1	11	2	21	16	tier1	no_errors	ENST00000393567	ensembl	human	putative	74_37	silent	34.38	11.11	SNP	0.000	T	11	21
HLA-DQA2	3118	genome.wustl.edu	37	6	32712953	32712953	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr6:32712953T>A	ENST00000374940.3	+	2	202	c.100T>A	c.(100-102)Tat>Aat	p.Y34N		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	34	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TGTTGCCTCCTATGGTGTGAA	0.488													ENSG00000237541																																					0													207.0	206.0	206.0					6																	32712953		1511	2708	4219	SO:0001583	missense	0			-		CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.100T>A	6.37:g.32712953T>A	ENSP00000364076:p.Tyr34Asn		A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.Y34N	ENST00000374940.3	37	c.100	CCDS4753.1	6	.	.	.	.	.	.	.	.	.	.	.	13.63	2.293409	0.40594	.	.	ENSG00000237541	ENST00000374940	T	0.00873	5.59	3.16	3.16	0.36331	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (2);	1.134340	0.06545	U	0.744018	T	0.03434	0.0099	H	0.96333	3.805	0.09310	N	1	D	0.54047	0.964	P	0.59171	0.853	T	0.36089	-0.9762	10	0.87932	D	0	.	7.9968	0.30273	0.0:0.0:0.0:1.0	.	34	P01906	DQA2_HUMAN	N	34	ENSP00000364076:Y34N	ENSP00000364076:Y34N	Y	+	1	0	HLA-DQA2	32820931	0.006000	0.16342	0.027000	0.17364	0.004000	0.04260	0.756000	0.26419	1.442000	0.47568	0.315000	0.21342	TAT	-	HLA-DQA2	-	pfam_MHC_II_a_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N		0.488	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	HLA-DQA2	HGNC	protein_coding	OTTHUMT00000076179.2	0	0	0	36	36	71	0.00	0.00	T	NM_020056		32712953	+1	7	18	18	65	tier1	no_errors	ENST00000374940	ensembl	human	known	74_37	missense	28.00	21.69	SNP	0.054	A	7	18
WDSUB1	151525	genome.wustl.edu	37	2	160112887	160112887	+	Splice_Site	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr2:160112887C>T	ENST00000409990.3	-	9	1209		c.e9-1		WDSUB1_ENST00000358147.4_Splice_Site|WDSUB1_ENST00000409124.1_Splice_Site|WDSUB1_ENST00000359774.4_Splice_Site|WDSUB1_ENST00000392796.3_Splice_Site	NM_001128213.1	NP_001121685	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain containing 1								ubiquitin-protein transferase activity (GO:0004842)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|stomach(3)	16						GTGCGCCTTGCTTAAAATAAA	0.333													ENSG00000196151																																					0													74.0	71.0	72.0					2																	160112887		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AK093494	CCDS2208.1	2q24.2	2013-01-28	2006-02-17	2005-03-25	ENSG00000196151	ENSG00000196151		"""WD repeat domain containing"", ""Sterile alpha motif (SAM) domain containing"", ""U-box domain containing"""	26697	protein-coding gene	gene with protein product			"""WD repeat and SAM domain containing 1"", ""WD repeat, SAM and U-box domain containing 1"""	WDSAM1		12477932	Standard	NM_152528		Approved	UBOX6, FLJ36175	uc002ual.4	Q8N9V3	OTTHUMG00000132028	ENST00000409990.3:c.953-1G>A	2.37:g.160112887C>T			Q53TI9|Q8N6N8	Splice_Site	SNP	-	e8-1	ENST00000409990.3	37	c.953-1	CCDS2208.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.756395	0.96898	.	.	ENSG00000196151	ENST00000359774;ENST00000358147;ENST00000392796;ENST00000409990;ENST00000409124	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6558	0.88177	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDSUB1	159821133	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	6.268000	0.72552	2.596000	0.87737	0.655000	0.94253	.	-	WDSUB1	-	-		0.333	WDSUB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WDSUB1	HGNC	protein_coding	OTTHUMT00000333339.1	0	0	0	46	46	86	0.00	0.00	C	NM_152528	Intron	160112887	-1	11	11	20	17	tier1	no_errors	ENST00000359774	ensembl	human	known	74_37	splice_site	35.48	39.29	SNP	1.000	T	11	20
ZNF141	7700	genome.wustl.edu	37	4	367636	367636	+	Silent	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr4:367636G>A	ENST00000240499.7	+	4	1559	c.1410G>A	c.(1408-1410)aaG>aaA	p.K470K	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	470					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						ATAAACATAAGAAAATTCATA	0.323													ENSG00000131127																																					0													51.0	57.0	55.0					4																	367636		2194	4290	6484	SO:0001819	synonymous_variant	0			-	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.1410G>A	4.37:g.367636G>A			Q6DK07	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K470	ENST00000240499.7	37	c.1410	CCDS33931.1	4																																																																																			-	ZNF141	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.323	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF141	HGNC	protein_coding	OTTHUMT00000357710.1	0	0	0	71	71	20	0.00	0.00	G	NM_003441		367636	+1	9	5	73	33	tier1	no_errors	ENST00000240499	ensembl	human	known	74_37	silent	10.98	13.16	SNP	0.423	A	9	73
CYP27B1	1594	genome.wustl.edu	37	12	58159275	58159275	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:58159275C>T	ENST00000228606.4	-	3	603	c.394G>A	c.(394-396)Gaa>Aaa	p.E132K	CYP27B1_ENST00000546496.1_5'UTR	NM_000785.3	NP_000776.1	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B, polypeptide 1	132					bone mineralization (GO:0030282)|calcitriol biosynthetic process from calciol (GO:0036378)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|decidualization (GO:0046697)|G1 to G0 transition (GO:0070314)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of bone mineralization (GO:0030500)|response to estrogen (GO:0043627)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	calcidiol 1-monooxygenase activity (GO:0004498)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|urinary_tract(1)	15	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Alfacalcidol(DB01436)|Calcidiol(DB00146)|Corticotropin(DB01285)|Ergocalciferol(DB00153)	TGCCATTCTTCGCCTTCCCTG	0.672											OREG0021953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000111012																																					0													30.0	32.0	31.0					12																	58159275		2198	4290	6488	SO:0001583	missense	0			-	AB006987	CCDS8954.1	12q14.1	2013-11-13	2003-01-14		ENSG00000111012	ENSG00000111012		"""Cytochrome P450s"""	2606	protein-coding gene	gene with protein product	"""VDDR I"", ""1alpha(OH)ase"", ""25-Hydroxyvitamin D3 1alpha-hydroxylase"""	609506	"""cytochrome P450, subfamily XXVIIB (25-hydroxyvitamin D-1-alpha-hydroxylase), polypeptide 1"""	VDD1, PDDR		9295274, 9344864	Standard	NM_000785		Approved	CYP1, P450c1	uc001spz.1	O15528	OTTHUMG00000170457	ENST00000228606.4:c.394G>A	12.37:g.58159275C>T	ENSP00000228606:p.Glu132Lys	1028	B2RC61|Q548T3	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.E132K	ENST00000228606.4	37	c.394	CCDS8954.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.185180	0.94885	.	.	ENSG00000111012	ENST00000228606	T	0.70631	-0.5	5.06	4.17	0.49024	.	0.104838	0.64402	D	0.000005	T	0.64583	0.2611	L	0.37750	1.13	0.80722	D	1	P	0.42039	0.769	P	0.45449	0.481	T	0.61222	-0.7106	10	0.27785	T	0.31	.	12.3814	0.55309	0.0:0.9172:0.0:0.0828	.	132	O15528	CP27B_HUMAN	K	132	ENSP00000228606:E132K	ENSP00000228606:E132K	E	-	1	0	CYP27B1	56445542	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	7.502000	0.81614	1.354000	0.45846	0.561000	0.74099	GAA	-	CYP27B1	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.672	CYP27B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP27B1	HGNC	protein_coding	OTTHUMT00000409248.1	0	0	0	14	14	50	0.00	0.00	C	NM_000785		58159275	-1	96	121	298	444	tier1	no_errors	ENST00000228606	ensembl	human	known	74_37	missense	24.37	21.42	SNP	1.000	T	96	298
MUT	4594	genome.wustl.edu	37	6	49427080	49427080	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr6:49427080G>A	ENST00000274813.3	-	2	227	c.100C>T	c.(100-102)Cac>Tac	p.H34Y		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	34					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGTTGCTGGTGTAGAAGTCGT	0.478													ENSG00000146085																																					0													118.0	116.0	117.0					6																	49427080		2203	4300	6503	SO:0001583	missense	0			-		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.100C>T	6.37:g.49427080G>A	ENSP00000274813:p.His34Tyr		A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	pfam_MeMalonylCoA_mutase_a/b_cat,pfam_Cobalamin-bd,superfamily_Cbl-dep_enz_cat,superfamily_Cobalamin-bd,tigrfam_MMCoA_mutase_a_cat,tigrfam_Acid_CoA_mut_C	p.H34Y	ENST00000274813.3	37	c.100	CCDS4924.1	6	.	.	.	.	.	.	.	.	.	.	G	10.88	1.474417	0.26423	.	.	ENSG00000146085	ENST00000274813	D	0.97850	-4.57	5.38	4.51	0.55191	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);	0.295869	0.37483	N	0.002075	D	0.86965	0.6060	N	0.08118	0	0.38104	D	0.937358	B	0.02656	0.0	B	0.01281	0.0	T	0.82018	-0.0665	10	0.15499	T	0.54	-18.3439	11.5829	0.50902	0.0823:0.0:0.9177:0.0	.	34	P22033	MUTA_HUMAN	Y	34	ENSP00000274813:H34Y	ENSP00000274813:H34Y	H	-	1	0	MUT	49535039	1.000000	0.71417	0.962000	0.40283	0.869000	0.49853	3.873000	0.56093	1.408000	0.46895	0.655000	0.94253	CAC	-	MUT	-	superfamily_Cbl-dep_enz_cat		0.478	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUT	HGNC	protein_coding	OTTHUMT00000040854.1	0	0	1	26	26	56	0.00	1.75	G			49427080	-1	8	13	25	43	tier1	no_errors	ENST00000274813	ensembl	human	known	74_37	missense	24.24	23.21	SNP	0.994	A	8	25
TVP23C	201158	genome.wustl.edu	37	17	15441452	15441452	+	Intron	SNP	G	G	C			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr17:15441452G>C	ENST00000225576.3	-	5	558				TVP23C_ENST00000584811.1_Missense_Mutation_p.Q139E|TVP23C_ENST00000428082.2_Missense_Mutation_p.Q203E|TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.Q203E|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000583206.1_5'Flank	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)							integral component of membrane (GO:0016021)											CAGGAAGTCTGATCATCTCCA	0.413													ENSG00000175106																																					0																																										SO:0001627	intron_variant	0			-	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.462+7646C>G	17.37:g.15441452G>C			Q3LIC7	Missense_Mutation	SNP	pfam_DUF846_euk	p.Q203E	ENST00000225576.3	37	c.607	CCDS11170.1	17	.	.	.	.	.	.	.	.	.	.	.	10.15	1.271535	0.23221	.	.	ENSG00000175106	ENST00000438826	T	0.28895	1.59	4.5	4.5	0.54988	.	.	.	.	.	T	0.18299	0.0439	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03068	-1.1076	6	0.02654	T	1	.	12.8715	0.57968	0.0:0.0:1.0:0.0	.	.	.	.	E	203	ENSP00000413355:Q203E	ENSP00000413355:Q203E	Q	-	1	0	FAM18B2	15382177	0.995000	0.38212	0.984000	0.44739	0.666000	0.39218	4.022000	0.57203	2.474000	0.83562	0.585000	0.79938	CAG	-	TVP23C	-	NULL		0.413	TVP23C-001	KNOWN	basic|CCDS	protein_coding	TVP23C	HGNC	protein_coding	OTTHUMT00000130705.2	0	0	0	118	118	67	0.00	0.00	G	NM_145301		15441452	-1	12	10	103	41	tier1	no_errors	ENST00000428082	ensembl	human	novel	74_37	missense	10.43	19.61	SNP	0.997	C	12	103
OR1F1	4992	genome.wustl.edu	37	16	3254696	3254696	+	Silent	SNP	G	G	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr16:3254696G>T	ENST00000304646.2	+	1	450	c.450G>T	c.(448-450)gtG>gtT	p.V150V	AJ003147.9_ENST00000576468.1_RNA	NM_012360.1	NP_036492.1	O43749	OR1F1_HUMAN	olfactory receptor, family 1, subfamily F, member 1	150					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(2)|lung(7)	11						GATTATGGGTGGTTGCCAACC	0.532													ENSG00000168124																																					0													169.0	131.0	144.0					16																	3254696		2197	4300	6497	SO:0001819	synonymous_variant	0			-	Y14442	CCDS10496.1	16p13.3	2012-08-09			ENSG00000168124	ENSG00000168124		"""GPCR / Class A : Olfactory receptors"""	8194	protein-coding gene	gene with protein product		603232		OR1F4, OR1F6, OR1F7, OR1F8, OR1F9, OR1F5, OR1F10, OR1F13P		9288094, 9500546	Standard	NM_012360		Approved	Olfmf, OR16-36, OR16-37, OR16-88, OR16-89, OR16-90, OLFMF, OR3-145	uc010uwu.2	O43749	OTTHUMG00000133153	ENST00000304646.2:c.450G>T	16.37:g.3254696G>T			O15246|Q6IFL5	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V150	ENST00000304646.2	37	c.450	CCDS10496.1	16																																																																																			-	OR1F1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.532	OR1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1F1	HGNC	protein_coding	OTTHUMT00000206985.1	0	0	0	25	25	29	0.00	0.00	G			3254696	+1	11	16	15	16	tier1	no_errors	ENST00000304646	ensembl	human	known	74_37	silent	42.31	50.00	SNP	0.000	T	11	15
RAB18	22931	genome.wustl.edu	37	10	27827289	27827289	+	3'UTR	SNP	A	A	G			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr10:27827289A>G	ENST00000356940.6	+	0	1032				RAB18_ENST00000535776.1_3'UTR|RAB18_ENST00000465772.1_3'UTR	NM_001256410.1|NM_001256415.1|NM_021252.4	NP_001243339.1|NP_001243344.1|NP_067075.1	Q9NP72	RAB18_HUMAN	RAB18, member RAS oncogene family						brain development (GO:0007420)|endoplasmic reticulum tubular network organization (GO:0071786)|eye development (GO:0001654)|GTP catabolic process (GO:0006184)|lipid particle organization (GO:0034389)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(1)|lung(1)	3						ATATGTTGATACAAAGTCTGC	0.299													ENSG00000099246																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AJ277145	CCDS7155.1, CCDS58073.1, CCDS73080.1, CCDS73081.1	10p12	2011-03-07			ENSG00000099246	ENSG00000099246		"""RAB, member RAS oncogene"""	14244	protein-coding gene	gene with protein product		602207				10648831	Standard	NM_021252		Approved		uc001itw.4	Q9NP72	OTTHUMG00000017861	ENST00000356940.6:c.*309A>G	10.37:g.27827289A>G			B3KMC7|B7Z333|D3DRW1|Q53FX8|Q56UN9|Q6FIH1	R	SNP	-	NULL	ENST00000356940.6	37	NULL	CCDS7155.1	10																																																																																			-	RAB18	-	-		0.299	RAB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB18	HGNC	protein_coding	OTTHUMT00000047326.2	0	0	0	20	20	70	0.00	0.00	A	NM_021252		27827289	+1	8	16	7	42	tier1	no_errors	ENST00000465772	ensembl	human	known	74_37	rna	53.33	27.59	SNP	0.001	G	8	7
ZZZ3	26009	genome.wustl.edu	37	1	78044547	78044547	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr1:78044547C>T	ENST00000370801.3	-	11	2565	c.2090G>A	c.(2089-2091)aGc>aAc	p.S697N	ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.S203N	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	697	HTH myb-type. {ECO:0000255|PROSITE- ProRule:PRU00625}.				chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						CTGTACTCGGCTGGCAACCTA	0.343													ENSG00000036549																																					0													66.0	67.0	66.0					1																	78044547		2203	4300	6503	SO:0001583	missense	0			-	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.2090G>A	1.37:g.78044547C>T	ENSP00000359837:p.Ser697Asn		B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.S697N	ENST00000370801.3	37	c.2090	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.125906	0.94429	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	T;T	0.49139	0.79;0.79	5.84	5.84	0.93424	Transcription regulator HTH, Myb-type, DNA-binding (1);Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);	0.040117	0.85682	D	0.000000	T	0.67804	0.2932	M	0.77616	2.38	0.80722	D	1	P;D;P	0.89917	0.557;1.0;0.787	B;D;P	0.91635	0.295;0.999;0.526	T	0.67304	-0.5704	10	0.59425	D	0.04	.	20.5276	0.99231	0.0:1.0:0.0:0.0	.	203;697;696	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	N	697;203	ENSP00000359837:S697N;ENSP00000359834:S203N	ENSP00000359834:S203N	S	-	2	0	ZZZ3	77817135	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.378000	0.79679	2.937000	0.99478	0.650000	0.86243	AGC	-	ZZZ3	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom		0.343	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1	0	0	0	33	33	96	0.00	0.00	C	NM_015534		78044547	-1	7	11	11	47	tier1	no_errors	ENST00000370801	ensembl	human	known	74_37	missense	38.89	18.97	SNP	1.000	T	7	11
CALCOCO1	57658	genome.wustl.edu	37	12	54117527	54117527	+	Silent	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:54117527G>A	ENST00000550804.1	-	4	360	c.300C>T	c.(298-300)ttC>ttT	p.F100F	CALCOCO1_ENST00000547885.1_5'Flank|CALCOCO1_ENST00000262059.4_Silent_p.F100F|CALCOCO1_ENST00000430117.2_Intron|CALCOCO1_ENST00000548263.1_Silent_p.F100F			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	100	N-terminal AD (CTNNB1 binding site). {ECO:0000250}.				intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						TCACATATCGGAACTGGTAGA	0.607													ENSG00000012822																																					0													49.0	53.0	52.0					12																	54117527		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.300C>T	12.37:g.54117527G>A			B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Silent	SNP	pfam_CoCoA	p.F100	ENST00000550804.1	37	c.300	CCDS8864.1	12																																																																																			-	CALCOCO1	-	pfam_CoCoA		0.607	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CALCOCO1	HGNC	protein_coding	OTTHUMT00000407233.2	0	0	0	23	23	49	0.00	0.00	G	NM_020898		54117527	-1	6	5	16	27	tier1	no_errors	ENST00000550804	ensembl	human	known	74_37	silent	27.27	15.62	SNP	1.000	A	6	16
DUSP22	56940	genome.wustl.edu	37	6	311931	311931	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr6:311931C>G	ENST00000344450.5	+	3	550	c.107C>G	c.(106-108)tCt>tGt	p.S36C	DUSP22_ENST00000605315.1_Intron|DUSP22_ENST00000605863.1_Intron|DUSP22_ENST00000603453.1_Intron|DUSP22_ENST00000419235.2_Missense_Mutation_p.S36C|DUSP22_ENST00000605035.1_5'UTR	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	36					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		CATATTCTGTCTGTCCACGAT	0.478													ENSG00000112679																																					0													170.0	130.0	144.0					6																	311931		2203	4300	6503	SO:0001583	missense	0			-	AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.107C>G	6.37:g.311931C>G	ENSP00000345281:p.Ser36Cys		B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.S36C	ENST00000344450.5	37	c.107	CCDS4468.1	6	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666281	0.88251	.	.	ENSG00000112679	ENST00000344450	D	0.86366	-2.11	5.99	5.99	0.97316	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.178066	0.39909	N	0.001227	D	0.92306	0.7559	M	0.75447	2.3	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.92590	0.6082	10	0.87932	D	0	.	15.9778	0.80083	0.0:1.0:0.0:0.0	.	36;36	Q9NRW4-2;Q9NRW4	.;DUS22_HUMAN	C	36	ENSP00000345281:S36C	ENSP00000345281:S36C	S	+	2	0	DUSP22	256931	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.643000	0.61390	2.840000	0.97914	0.655000	0.94253	TCT	-	DUSP22	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,pfscan_Dual-sp_phosphatase_subgr_cat		0.478	DUSP22-001	KNOWN	basic|CCDS	protein_coding	DUSP22	HGNC	protein_coding	OTTHUMT00000039621.1	0	0	0	60	60	79	0.00	0.00	C	NM_020185		311931	+1	16	13	56	68	tier1	no_errors	ENST00000419235	ensembl	human	known	74_37	missense	22.22	16.05	SNP	1.000	G	16	56
RCL1	10171	genome.wustl.edu	37	9	4860199	4860199	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr9:4860199A>T	ENST00000381750.4	+	9	1269	c.1046A>T	c.(1045-1047)gAa>gTa	p.E349V	RCL1_ENST00000381730.1_Missense_Mutation_p.E163V|RCL1_ENST00000381728.1_Missense_Mutation_p.E163V|AL158147.2_ENST00000599351.1_5'Flank|RCL1_ENST00000448872.2_Missense_Mutation_p.E163V	NM_005772.3	NP_005763.3	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1	349					ribosome biogenesis (GO:0042254)|RNA processing (GO:0006396)	nucleolus (GO:0005730)	catalytic activity (GO:0003824)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		TGTGGTGAAGAACTCAAGGGT	0.383													ENSG00000120158																																					0													99.0	92.0	94.0					9																	4860199		2203	4300	6503	SO:0001583	missense	0			-	AJ276894	CCDS6456.1, CCDS69565.1, CCDS75810.1	9p24.1-p23	2008-02-05			ENSG00000120158	ENSG00000120158			17687	protein-coding gene	gene with protein product		611405					Standard	NM_001286701		Approved	RPCL1, RNAC	uc003zis.2	Q9Y2P8	OTTHUMG00000019474	ENST00000381750.4:c.1046A>T	9.37:g.4860199A>T	ENSP00000371169:p.Glu349Val		D3DRI2|Q5VYW9|Q5VZU1|Q9H9D0|Q9NY00|Q9P044	Missense_Mutation	SNP	pfam_R3'_phos_cyclase_dom,pfam_R3'-term_phos_cycl_insert,superfamily_R3'P_cycl/enolpyr_Trfase_a/b,pirsf_R3'_term_phos_cyc,tigrfam_R3'_term_phos_cyc_type_2	p.E349V	ENST00000381750.4	37	c.1046	CCDS6456.1	9	.	.	.	.	.	.	.	.	.	.	A	19.82	3.899210	0.72754	.	.	ENSG00000120158	ENST00000381750;ENST00000381730;ENST00000381728;ENST00000448872	.	.	.	5.8	5.8	0.92144	-terminal phosphate cyclase-like, eukaryotic (2);RNA 3&apos (3);-terminal phosphate cyclase (1);	0.112447	0.64402	D	0.000004	T	0.45617	0.1351	N	0.22421	0.69	0.80722	D	1	B;B	0.33022	0.394;0.016	B;B	0.30401	0.115;0.01	T	0.47837	-0.9086	9	0.54805	T	0.06	-17.5406	15.8123	0.78573	1.0:0.0:0.0:0.0	.	163;349	Q5VZU1;Q9Y2P8	.;RCL1_HUMAN	V	349;163;163;163	.	ENSP00000371147:E163V	E	+	2	0	RCL1	4850199	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.780000	0.91799	2.207000	0.71202	0.528000	0.53228	GAA	-	RCL1	-	pirsf_R3'_term_phos_cyc,tigrfam_R3'_term_phos_cyc_type_2		0.383	RCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCL1	HGNC	protein_coding	OTTHUMT00000051587.1	0	0	0	182	182	132	0.00	0.00	A	NM_005772		4860199	+1	41	25	95	51	tier1	no_errors	ENST00000381750	ensembl	human	known	74_37	missense	30.15	32.89	SNP	1.000	T	41	95
C1QA	712	genome.wustl.edu	37	1	22965616	22965616	+	Missense_Mutation	SNP	G	G	A	rs201517118		TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr1:22965616G>A	ENST00000374642.3	+	3	658	c.454G>A	c.(454-456)Gtc>Atc	p.V152I	C1QA_ENST00000402322.1_Missense_Mutation_p.V152I	NM_015991.2	NP_057075.1	P02745	C1QA_HUMAN	complement component 1, q subcomponent, A chain	152	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cell-cell signaling (GO:0007267)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	collagen trimer (GO:0005581)|complement component C1 complex (GO:0005602)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|liver(1)|lung(3)|skin(1)	6		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CGGCCGATTCGTCTGCACTGT	0.602													ENSG00000173372	G|||	1	0.000199681	0.0008	0.0	5008	,	,		17525	0.0		0.0	False		,,,				2504	0.0																0													89.0	80.0	83.0					1																	22965616		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AF135157	CCDS226.1	1p36.3-p34.1	2014-09-17	2006-02-09		ENSG00000173372	ENSG00000173372		"""Complement system"""	1241	protein-coding gene	gene with protein product		120550	"""complement component 1, q subcomponent, alpha polypeptide"""			1537612	Standard	NM_015991		Approved		uc001bfy.3	P02745	OTTHUMG00000002893	ENST00000374642.3:c.454G>A	1.37:g.22965616G>A	ENSP00000363773:p.Val152Ile		B2R4X2|Q5T963	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.V152I	ENST00000374642.3	37	c.454	CCDS226.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	3.569	-0.087984	0.07097	.	.	ENSG00000173372	ENST00000374642;ENST00000438241;ENST00000402322	T;T;T	0.21932	1.98;1.98;1.98	5.67	-7.39	0.01402	Tumour necrosis factor-like (2);Complement C1q protein (4);	.	.	.	.	T	0.07593	0.0191	N	0.10664	0.02	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42015	-0.9476	9	0.13470	T	0.59	-2.0698	8.5141	0.33235	0.5673:0.3111:0.1216:0.0	.	152	P02745	C1QA_HUMAN	I	152	ENSP00000363773:V152I;ENSP00000416841:V152I;ENSP00000385564:V152I	ENSP00000363773:V152I	V	+	1	0	C1QA	22838203	0.031000	0.19500	0.055000	0.19348	0.034000	0.12701	-0.598000	0.05706	-1.288000	0.02378	0.561000	0.74099	GTC	rs201517118	C1QA	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q		0.602	C1QA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QA	HGNC	protein_coding	OTTHUMT00000008087.2	0	0	0	29	29	97	0.00	0.00	G	NM_015991		22965616	+1	5	42	34	101	tier1	no_errors	ENST00000374642	ensembl	human	known	74_37	missense	12.82	29.37	SNP	0.087	A	5	34
RYR3	6263	genome.wustl.edu	37	15	33941420	33941420	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr15:33941420G>A	ENST00000389232.4	+	31	4196	c.4126G>A	c.(4126-4128)Ggc>Agc	p.G1376S	RYR3_ENST00000415757.3_Missense_Mutation_p.G1376S	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1376	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGATGAAAGAGGCCGGGTCCA	0.532													ENSG00000198838																																					0													99.0	102.0	101.0					15																	33941420		1904	4113	6017	SO:0001583	missense	0			-		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.4126G>A	15.37:g.33941420G>A	ENSP00000373884:p.Gly1376Ser		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.G1376S	ENST00000389232.4	37	c.4126	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.200263	0.94997	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.63255	-0.03;-0.03	5.18	5.18	0.71444	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.77198	0.4095	M	0.66378	2.025	0.80722	D	1	D;D	0.69078	0.997;0.976	D;P	0.64877	0.93;0.908	T	0.78321	-0.2249	10	0.59425	D	0.04	.	18.8751	0.92331	0.0:0.0:1.0:0.0	.	1376;1376	Q15413-2;Q15413	.;RYR3_HUMAN	S	1376	ENSP00000373884:G1376S;ENSP00000399610:G1376S	ENSP00000354735:G1376S	G	+	1	0	RYR3	31728712	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.595000	0.98260	2.705000	0.92388	0.650000	0.86243	GGC	-	RYR3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.532	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	0	0	0	60	60	63	0.00	0.00	G			33941420	+1	14	20	31	37	tier1	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	31.11	35.09	SNP	1.000	A	14	31
CALN1	83698	genome.wustl.edu	37	7	71252869	71252869	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr7:71252869T>C	ENST00000329008.5	-	6	849	c.551A>G	c.(550-552)aAc>aGc	p.N184S	CALN1_ENST00000395275.2_Missense_Mutation_p.N226S|CALN1_ENST00000431984.1_Missense_Mutation_p.N184S|CALN1_ENST00000412588.1_Missense_Mutation_p.N226S|CALN1_ENST00000405452.2_Missense_Mutation_p.N184S|CALN1_ENST00000395276.2_Missense_Mutation_p.N184S	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GGTCTGTCTGTTCTGCTTCTG	0.532													ENSG00000183166																																					0													116.0	93.0	101.0					7																	71252869		2203	4300	6503	SO:0001583	missense	0			-	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.551A>G	7.37:g.71252869T>C	ENSP00000332498:p.Asn184Ser		J3KQA7	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.N226S	ENST00000329008.5	37	c.677	CCDS5541.1	7	.	.	.	.	.	.	.	.	.	.	T	19.68	3.872169	0.72180	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452	T;T;T;T;T;T	0.69806	-0.32;-0.43;-0.32;-0.32;-0.43;-0.32	5.12	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	N	0.14661	0.345	0.44745	D	0.997741	P;P	0.36483	0.555;0.555	B;B	0.31495	0.131;0.131	T	0.33752	-0.9856	10	0.13108	T	0.6	-43.6598	10.1265	0.42652	0.1495:0.0:0.0:0.8505	.	184;184	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	S	184;226;184;184;226;184	ENSP00000332498:N184S;ENSP00000378690:N226S;ENSP00000378691:N184S;ENSP00000410704:N184S;ENSP00000391882:N226S;ENSP00000384354:N184S	ENSP00000332498:N184S	N	-	2	0	CALN1	70890805	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.123000	0.71614	1.922000	0.55676	0.459000	0.35465	AAC	-	CALN1	-	NULL		0.532	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALN1	HGNC	protein_coding	OTTHUMT00000320044.2	0	0	0	26	26	69	0.00	0.00	T	NM_031468		71252869	-1	7	32	2	38	tier1	no_errors	ENST00000395275	ensembl	human	known	74_37	missense	77.78	45.71	SNP	1.000	C	7	2
COL6A5	256076	genome.wustl.edu	37	3	130098262	130098262	+	Splice_Site	SNP	T	T	C			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr3:130098262T>C	ENST00000432398.2	+	4	1163	c.669T>C	c.(667-669)gtT>gtC	p.V223V	COL6A5_ENST00000265379.6_Splice_Site_p.V223V	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	223	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TCTGCATAGTTCACTTCCCCA	0.433													ENSG00000172752																																					0													35.0	30.0	31.0					3																	130098262		692	1591	2283	SO:0001630	splice_region_variant	0			-	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.668-1T>C	3.37:g.130098262T>C			A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.V223	ENST00000432398.2	37	c.669		3																																																																																			-	COL6A5	-	NULL		0.433	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		0	0	1	19	19	123	0.00	0.81	T	NM_153264	Silent	130098262	+1	10	41	14	48	tier1	no_errors	ENST00000265379	ensembl	human	known	74_37	silent	41.67	46.07	SNP	0.206	C	10	14
HLA-DQA2	3118	genome.wustl.edu	37	6	32712940	32712940	+	Missense_Mutation	SNP	C	C	G	rs369556704	byFrequency	TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr6:32712940C>G	ENST00000374940.3	+	2	189	c.87C>G	c.(85-87)gaC>gaG	p.D29E		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	29	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	CGTCAGCTGACCATGTTGCCT	0.473													ENSG00000237541																																					0													204.0	204.0	204.0					6																	32712940		1511	2709	4220	SO:0001583	missense	0			-		CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.87C>G	6.37:g.32712940C>G	ENSP00000364076:p.Asp29Glu		A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.D29E	ENST00000374940.3	37	c.87	CCDS4753.1	6	.	.	.	.	.	.	.	.	.	.	.	11.36	1.615788	0.28801	.	.	ENSG00000237541	ENST00000374940	T	0.00760	5.73	3.16	2.27	0.28462	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (1);	0.555807	0.18762	U	0.131856	T	0.01489	0.0048	M	0.86740	2.835	0.25401	N	0.988449	D	0.76494	0.999	D	0.73708	0.981	T	0.46512	-0.9186	10	0.39692	T	0.17	.	6.234	0.20752	0.0:0.8519:0.0:0.1481	.	29	P01906	DQA2_HUMAN	E	29	ENSP00000364076:D29E	ENSP00000364076:D29E	D	+	3	2	HLA-DQA2	32820918	0.083000	0.21467	0.984000	0.44739	0.027000	0.11550	-1.308000	0.02730	0.644000	0.30656	0.384000	0.25694	GAC	-	HLA-DQA2	-	pfam_MHC_II_a_N,superfamily_MHC_I/II-like_Ag-recog		0.473	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	HLA-DQA2	HGNC	protein_coding	OTTHUMT00000076179.2	0	0	0	30	30	73	0.00	0.00	C	NM_020056		32712940	+1	8	17	17	63	tier1	no_errors	ENST00000374940	ensembl	human	known	74_37	missense	32.00	21.25	SNP	0.995	G	8	17
FAM53B	9679	genome.wustl.edu	37	10	126311826	126311826	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr10:126311826C>A	ENST00000337318.3	-	5	1465	c.1254G>T	c.(1252-1254)caG>caT	p.Q418H	RP11-12J10.3_ENST00000494792.1_Intron|FAM53B_ENST00000392754.3_Missense_Mutation_p.Q418H	NM_014661.3	NP_055476.3	Q14153	FA53B_HUMAN	family with sequence similarity 53, member B	418										cervix(1)|lung(5)|ovary(2)|pancreas(1)	9		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)		TCTTCTCTATCTGCTCAATGT	0.677													ENSG00000189319																																					0													61.0	65.0	64.0					10																	126311826		2118	4147	6265	SO:0001583	missense	0			-	D50930	CCDS7641.1	10q26.13	2004-11-24	2004-11-24	2004-11-24	ENSG00000189319	ENSG00000189319			28968	protein-coding gene	gene with protein product			"""KIAA0140"""	KIAA0140		8590280	Standard	NM_014661		Approved	bA12J10.2	uc001lhv.1	Q14153	OTTHUMG00000019215	ENST00000337318.3:c.1254G>T	10.37:g.126311826C>A	ENSP00000338532:p.Gln418His		D3DRF1|Q5VUW1|Q5VUW2|Q8N5S6	Missense_Mutation	SNP	NULL	p.Q418H	ENST00000337318.3	37	c.1254	CCDS7641.1	10	.	.	.	.	.	.	.	.	.	.	C	18.00	3.526215	0.64860	.	.	ENSG00000189319	ENST00000337318;ENST00000392754	.	.	.	5.08	2.17	0.27698	.	0.071997	0.56097	D	0.000026	T	0.65207	0.2669	L	0.47716	1.5	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.65134	-0.6242	9	0.87932	D	0	-8.0732	8.7385	0.34543	0.0:0.7564:0.0:0.2436	.	418	Q14153	FA53B_HUMAN	H	418	.	ENSP00000338532:Q418H	Q	-	3	2	FAM53B	126301816	0.997000	0.39634	1.000000	0.80357	0.897000	0.52465	0.200000	0.17257	0.727000	0.32360	-0.150000	0.13652	CAG	-	FAM53B	-	NULL		0.677	FAM53B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM53B	HGNC	protein_coding	OTTHUMT00000050879.1	0	0	0	43	43	30	0.00	0.00	C	NM_014661		126311826	-1	6	3	28	22	tier1	no_errors	ENST00000337318	ensembl	human	known	74_37	missense	17.65	12.00	SNP	1.000	A	6	28
CALD1	800	genome.wustl.edu	37	7	134632457	134632457	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr7:134632457G>T	ENST00000361675.2	+	8	1960	c.1731G>T	c.(1729-1731)aaG>aaT	p.K577N	CALD1_ENST00000424922.1_Missense_Mutation_p.K316N|CALD1_ENST00000495522.1_Missense_Mutation_p.K342N|CALD1_ENST00000543443.1_Missense_Mutation_p.K327N|CALD1_ENST00000361388.2_Missense_Mutation_p.K348N|CALD1_ENST00000361901.2_Missense_Mutation_p.K322N|CALD1_ENST00000393118.2_Missense_Mutation_p.K342N|CALD1_ENST00000422748.1_Missense_Mutation_p.K348N|CALD1_ENST00000417172.1_Missense_Mutation_p.K322N			Q05682	CALD1_HUMAN	caldesmon 1	577	Tropomyosin-binding. {ECO:0000255}.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						agagaaggaaggtcctggagg	0.577													ENSG00000122786																																					0													41.0	41.0	41.0					7																	134632457		2203	4300	6503	SO:0001583	missense	0			-	M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1731G>T	7.37:g.134632457G>T	ENSP00000354826:p.Lys577Asn		A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.K348N	ENST00000361675.2	37	c.1044	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	G	14.13	2.442354	0.43326	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000361675;ENST00000361901;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.58	1.67	0.24075	.	0.258292	0.26808	N	0.022396	T	0.63141	0.2486	M	0.81942	2.565	0.46874	D	0.999239	P;D;D;D;D;D;D;D;D;D	0.58620	0.946;0.979;0.983;0.983;0.979;0.979;0.979;0.979;0.983;0.983	P;P;P;P;P;P;P;P;P;P	0.62649	0.775;0.801;0.825;0.905;0.732;0.732;0.732;0.732;0.905;0.874	T	0.61778	-0.6993	10	0.62326	D	0.03	-17.2794	8.8455	0.35168	0.3262:0.0:0.6738:0.0	.	271;327;348;342;316;342;322;348;577;322	B4DPW5;F5H1Z9;A8K0X1;E7EX44;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;.;.;CALD1_HUMAN;.	N	322;322;348;348;577;322;342;316;342;327	ENSP00000398826:K322N;ENSP00000411476:K322N;ENSP00000355000:K348N;ENSP00000395710:K348N;ENSP00000354826:K577N;ENSP00000354513:K322N;ENSP00000376826:K342N;ENSP00000393621:K316N;ENSP00000419673:K342N;ENSP00000445641:K327N	ENSP00000355000:K348N	K	+	3	2	CALD1	134282997	1.000000	0.71417	0.995000	0.50966	0.572000	0.35998	2.047000	0.41269	0.025000	0.15241	0.563000	0.77884	AAG	-	CALD1	-	pfam_Caldesmon_LSP		0.577	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	0	0	1	55	55	57	0.00	1.72	G	NM_033138		134632457	+1	24	21	22	39	tier1	no_errors	ENST00000361388	ensembl	human	known	74_37	missense	52.17	35.00	SNP	1.000	T	24	22
HELLS	3070	genome.wustl.edu	37	10	96313980	96313980	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr10:96313980C>T	ENST00000348459.5	+	3	356	c.251C>T	c.(250-252)aCg>aTg	p.T84M	HELLS_ENST00000394036.1_Missense_Mutation_p.T84M|HELLS_ENST00000239026.6_Missense_Mutation_p.T84M|HELLS_ENST00000394044.1_Missense_Mutation_p.T84M|HELLS_ENST00000462057.1_3'UTR|HELLS_ENST00000394045.1_Missense_Mutation_p.T84M|HELLS_ENST00000371332.4_Missense_Mutation_p.T84M	NM_018063.3	NP_060533.2			helicase, lymphoid-specific											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		TTTTTATTGACGAAAATGGAA	0.313													ENSG00000119969																																					0													67.0	75.0	72.0					10																	96313980		2203	4300	6503	SO:0001583	missense	0			-	AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.251C>T	10.37:g.96313980C>T	ENSP00000239027:p.Thr84Met			Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T84M	ENST00000348459.5	37	c.251	CCDS7434.1	10	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143974	0.77888	.	.	ENSG00000119969	ENST00000419900;ENST00000348459;ENST00000394045;ENST00000394044;ENST00000394036;ENST00000371332;ENST00000239026	T;T;D;T	0.95756	0.49;0.49;-3.8;0.49	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.96552	0.8875	L	0.47716	1.5	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.973;0.996;0.997;0.973	D	0.97168	0.9842	10	0.72032	D	0.01	-1.1981	15.5318	0.75970	0.0:1.0:0.0:0.0	.	84;84;84;84	Q6I7N8;Q9NRZ9-6;Q9NRZ9-5;Q9NRZ9	.;.;.;HELLS_HUMAN	M	68;84;84;84;84;84;84	ENSP00000239027:T84M;ENSP00000377609:T84M;ENSP00000377608:T84M;ENSP00000360383:T84M	ENSP00000239026:T84M	T	+	2	0	HELLS	96303970	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.802000	0.75175	2.238000	0.73509	0.585000	0.79938	ACG	-	HELLS	-	NULL		0.313	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELLS	HGNC	protein_coding	OTTHUMT00000049475.1	0	0	0	68	68	50	0.00	0.00	C	NM_018063		96313980	+1	20	26	41	33	tier1	no_errors	ENST00000371332	ensembl	human	known	74_37	missense	32.79	44.07	SNP	1.000	T	20	41
MBD6	114785	genome.wustl.edu	37	12	57919428	57919428	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:57919428C>T	ENST00000355673.3	+	6	1033	c.677C>T	c.(676-678)tCa>tTa	p.S226L	MBD6_ENST00000431731.2_Missense_Mutation_p.S226L	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	226	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						AATGCTCCCTCATACAACTGG	0.647													ENSG00000166987																																					0													103.0	118.0	113.0					12																	57919428		2203	4300	6503	SO:0001583	missense	0			-	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.677C>T	12.37:g.57919428C>T	ENSP00000347896:p.Ser226Leu		Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	superfamily_D-bd_dom,smart_Methyl_CpG_D-bd,pfscan_Methyl_CpG_D-bd	p.S226L	ENST00000355673.3	37	c.677	CCDS8944.1	12	.	.	.	.	.	.	.	.	.	.	c	15.41	2.825120	0.50739	.	.	ENSG00000166987	ENST00000355673;ENST00000431731	.	.	.	3.37	3.37	0.38596	.	1.662290	0.04361	U	0.357535	T	0.42630	0.1211	N	0.08118	0	0.33924	D	0.64123	B;D	0.56968	0.007;0.978	B;P	0.52554	0.038;0.702	T	0.49153	-0.8969	8	.	.	.	-1.1593	12.7608	0.57363	0.0:1.0:0.0:0.0	.	226;226	Q6P0P0;Q96DN6	.;MBD6_HUMAN	L	226	.	.	S	+	2	0	MBD6	56205695	0.306000	0.24490	0.995000	0.50966	0.992000	0.81027	1.502000	0.35704	2.173000	0.68751	0.444000	0.29173	TCA	-	MBD6	-	NULL		0.647	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	HGNC	protein_coding	OTTHUMT00000407250.1	0	0	0	20	20	34	0.00	0.00	C			57919428	+1	10	14	18	41	tier1	no_errors	ENST00000355673	ensembl	human	known	74_37	missense	35.71	25.45	SNP	1.000	T	10	18
PTPRB	5787	genome.wustl.edu	37	12	71016412	71016412	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:71016412C>T	ENST00000550358.1	-	3	491	c.466G>A	c.(466-468)Gaa>Aaa	p.E156K	PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000551525.1_Missense_Mutation_p.E155K|PTPRB_ENST00000334414.6_Missense_Mutation_p.E156K			P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	0	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ACCGAAACTTCTGCTCCCAGG	0.408													ENSG00000127329																																					0													29.0	31.0	30.0					12																	71016412		1838	4091	5929	SO:0001583	missense	0			-	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000550358.1:c.466G>A	12.37:g.71016412C>T	ENSP00000448058:p.Glu156Lys		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.E156K	ENST00000550358.1	37	c.466		12	.	.	.	.	.	.	.	.	.	.	C	22.9	4.347238	0.82022	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000551525	T;T;T	0.05925	3.91;3.86;3.37	5.42	5.42	0.78866	.	.	.	.	.	T	0.11196	0.0273	L	0.27053	0.805	0.80722	D	1	D;P;P;P	0.59767	0.986;0.925;0.925;0.925	P;P;P;P	0.53266	0.722;0.54;0.54;0.54	T	0.02484	-1.1152	9	0.56958	D	0.05	.	17.3726	0.87382	0.0:1.0:0.0:0.0	.	156;155;156;156	Q6ZTX7;F8VSD5;P23467-3;F8VU56	.;.;.;.	K	156;156;156;155	ENSP00000334928:E156K;ENSP00000448058:E156K;ENSP00000448349:E155K	ENSP00000334928:E156K	E	-	1	0	PTPRB	69302679	1.000000	0.71417	1.000000	0.80357	0.517000	0.34286	1.904000	0.39868	2.691000	0.91804	0.655000	0.94253	GAA	-	PTPRB	-	NULL		0.408	PTPRB-003	NOVEL	basic|exp_conf	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404436.1	0	0	0	46	46	74	0.00	0.00	C			71016412	-1	134	292	182	316	tier1	no_errors	ENST00000334414	ensembl	human	known	74_37	missense	42.41	48.03	SNP	1.000	T	134	182
TVP23C	201158	genome.wustl.edu	37	17	15443775	15443775	+	Intron	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr17:15443775G>A	ENST00000225576.3	-	5	558				TVP23C_ENST00000584811.1_Missense_Mutation_p.S124L|TVP23C_ENST00000428082.2_Missense_Mutation_p.S188L|TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.S188L|TVP23C_ENST00000519970.1_Missense_Mutation_p.S102L|TVP23C_ENST00000583206.1_5'Flank|TVP23C_ENST00000518321.1_Missense_Mutation_p.S188L	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)							integral component of membrane (GO:0016021)											TCCAAAATATGAAGTAGCCAT	0.378													ENSG00000175106																																					0													38.0	31.0	33.0					17																	15443775		692	1578	2270	SO:0001627	intron_variant	0			-	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.462+5323C>T	17.37:g.15443775G>A			Q3LIC7	Missense_Mutation	SNP	pfam_DUF846_euk	p.S188L	ENST00000225576.3	37	c.563	CCDS11170.1	17	.	.	.	.	.	.	.	.	.	.	.	13.18	2.161592	0.38119	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000557349;ENST00000519970;ENST00000428082;ENST00000438826	T;T;T	0.33438	2.36;1.41;1.41	5.36	4.39	0.52855	.	.	.	.	.	T	0.27798	0.0684	L	0.49513	1.565	0.37713	D	0.924658	B;B	0.15473	0.013;0.0	B;B	0.16722	0.016;0.004	T	0.18085	-1.0348	9	0.62326	D	0.03	.	8.262	0.31790	0.0801:0.0:0.7646:0.1553	.	102;188	B4E0Q0;Q96ET8-3	.;.	L	102;102;188;188	ENSP00000428961:S102L;ENSP00000406387:S188L;ENSP00000413355:S188L	ENSP00000406387:S188L	S	-	2	0	RP11-726O12.1;FAM18B2	15384500	1.000000	0.71417	0.116000	0.21606	0.611000	0.37282	3.371000	0.52379	1.404000	0.46819	0.650000	0.86243	TCA	-	TVP23C	-	NULL		0.378	TVP23C-001	KNOWN	basic|CCDS	protein_coding	TVP23C	HGNC	protein_coding	OTTHUMT00000130705.2	0	0	0	29	29	19	0.00	0.00	G	NM_145301		15443775	-1	7	3	35	18	tier1	no_errors	ENST00000518321	ensembl	human	known	74_37	missense	16.67	14.29	SNP	0.959	A	7	35
HSD17B6	8630	genome.wustl.edu	37	12	57167823	57167823	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:57167823G>T	ENST00000554643.1	+	3	536	c.187G>T	c.(187-189)Gag>Tag	p.E63*	HSD17B6_ENST00000322165.1_Nonsense_Mutation_p.E63*|HSD17B6_ENST00000554150.1_Nonsense_Mutation_p.E63*|HSD17B6_ENST00000555805.1_Nonsense_Mutation_p.E63*|HSD17B6_ENST00000555159.1_Nonsense_Mutation_p.E63*			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	63				E -> D (in Ref. 1; AAB88252). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	GTGTCTGACGGAGAAGGGGGC	0.597													ENSG00000025423																																					0													56.0	57.0	56.0					12																	57167823		2203	4300	6503	SO:0001587	stop_gained	0			-	AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.187G>T	12.37:g.57167823G>T	ENSP00000451406:p.Glu63*		O43275	Nonsense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.E63*	ENST00000554643.1	37	c.187	CCDS8925.1	12	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543119	0.65198	.	.	ENSG00000025423	ENST00000555159;ENST00000555805;ENST00000554643;ENST00000556650;ENST00000554150;ENST00000554155;ENST00000322165	.	.	.	5.08	5.08	0.68730	.	0.106321	0.40385	N	0.001117	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	12.443	0.55635	0.0:0.2736:0.7264:0.0	.	.	.	.	X	63	.	ENSP00000318631:E63X	E	+	1	0	HSD17B6	55454090	0.993000	0.37304	0.931000	0.37212	0.140000	0.21249	2.177000	0.42509	2.810000	0.96702	0.655000	0.94253	GAG	-	HSD17B6	-	pfam_DH_sc/Rdtase_SDR		0.597	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSD17B6	HGNC	protein_coding	OTTHUMT00000410714.1	0	0	0	37	37	6	0.00	0.00	G	NM_003725		57167823	+1	146	82	27	7	tier1	no_errors	ENST00000322165	ensembl	human	known	74_37	nonsense	84.39	92.13	SNP	0.991	T	146	27
HSD17B6	8630	genome.wustl.edu	37	12	57167840	57167840	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:57167840G>T	ENST00000554643.1	+	3	553	c.204G>T	c.(202-204)caG>caT	p.Q68H	HSD17B6_ENST00000322165.1_Missense_Mutation_p.Q68H|HSD17B6_ENST00000554150.1_Missense_Mutation_p.Q68H|HSD17B6_ENST00000555805.1_Missense_Mutation_p.Q68H|HSD17B6_ENST00000555159.1_Missense_Mutation_p.Q68H			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	68					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	GGGCCGAGCAGCTGAGGGGCC	0.622													ENSG00000025423																																					0													59.0	60.0	60.0					12																	57167840		2203	4300	6503	SO:0001583	missense	0			-	AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.204G>T	12.37:g.57167840G>T	ENSP00000451406:p.Gln68His		O43275	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.Q68H	ENST00000554643.1	37	c.204	CCDS8925.1	12	.	.	.	.	.	.	.	.	.	.	G	11.81	1.751137	0.31046	.	.	ENSG00000025423	ENST00000555159;ENST00000555805;ENST00000554643;ENST00000556650;ENST00000554150;ENST00000554155;ENST00000322165	D;D;D;T;D;D;D	0.88124	-2.34;-2.34;-2.34;-0.57;-2.34;-2.34;-2.34	5.08	3.25	0.37280	NAD(P)-binding domain (1);	1.000740	0.08065	N	0.998820	D	0.82393	0.5027	N	0.11892	0.195	0.20764	N	0.99985	B	0.30361	0.277	B	0.43123	0.409	T	0.74362	-0.3690	10	0.66056	D	0.02	.	8.562	0.33516	0.2508:0.0:0.7492:0.0	.	68	O14756	H17B6_HUMAN	H	68	ENSP00000450698:Q68H;ENSP00000451753:Q68H;ENSP00000451406:Q68H;ENSP00000452103:Q68H;ENSP00000452273:Q68H;ENSP00000451497:Q68H;ENSP00000318631:Q68H	ENSP00000318631:Q68H	Q	+	3	2	HSD17B6	55454107	0.998000	0.40836	0.883000	0.34634	0.075000	0.17131	0.939000	0.28978	0.846000	0.35142	0.655000	0.94253	CAG	-	HSD17B6	-	pfam_DH_sc/Rdtase_SDR		0.622	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSD17B6	HGNC	protein_coding	OTTHUMT00000410714.1	0	0	0	37	37	8	0.00	0.00	G	NM_003725		57167840	+1	143	98	25	9	tier1	no_errors	ENST00000322165	ensembl	human	known	74_37	missense	85.12	91.59	SNP	0.873	T	143	25
HSD17B6	8630	genome.wustl.edu	37	12	57167862	57167862	+	Silent	SNP	A	A	C			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:57167862A>C	ENST00000554643.1	+	3	575	c.226A>C	c.(226-228)Agg>Cgg	p.R76R	HSD17B6_ENST00000322165.1_Silent_p.R76R|HSD17B6_ENST00000554150.1_Silent_p.R76R|HSD17B6_ENST00000555805.1_Silent_p.R76R|HSD17B6_ENST00000555159.1_Silent_p.R76R			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	76					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	GACGTCTGACAGGCTGGAGAC	0.587													ENSG00000025423																																					0													65.0	66.0	66.0					12																	57167862		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.226A>C	12.37:g.57167862A>C			O43275	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.R76	ENST00000554643.1	37	c.226	CCDS8925.1	12																																																																																			-	HSD17B6	-	pfam_DH_sc/Rdtase_SDR		0.587	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSD17B6	HGNC	protein_coding	OTTHUMT00000410714.1	0	0	0	38	38	11	0.00	0.00	A	NM_003725		57167862	+1	168	101	24	8	tier1	no_errors	ENST00000322165	ensembl	human	known	74_37	silent	87.50	92.66	SNP	0.155	C	168	24
HSD17B6	8630	genome.wustl.edu	37	12	57167910	57167910	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr12:57167910G>A	ENST00000554643.1	+	3	623	c.274G>A	c.(274-276)Gca>Aca	p.A92T	HSD17B6_ENST00000322165.1_Missense_Mutation_p.A92T|HSD17B6_ENST00000554150.1_Missense_Mutation_p.A92T|HSD17B6_ENST00000555805.1_Missense_Mutation_p.A92T|HSD17B6_ENST00000555159.1_Missense_Mutation_p.A92T			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	92					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	GAGCATCGCTGCAGCTACTCA	0.507													ENSG00000025423																																					0													72.0	75.0	74.0					12																	57167910		2203	4300	6503	SO:0001583	missense	0			-	AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.274G>A	12.37:g.57167910G>A	ENSP00000451406:p.Ala92Thr		O43275	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.A92T	ENST00000554643.1	37	c.274	CCDS8925.1	12	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539745	0.27563	.	.	ENSG00000025423	ENST00000555159;ENST00000555805;ENST00000554643;ENST00000554150;ENST00000322165	D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51	5.08	5.08	0.68730	NAD(P)-binding domain (1);	0.110360	0.37577	N	0.002036	D	0.84460	0.5477	L	0.43757	1.38	0.09310	N	1	B	0.28055	0.199	B	0.34722	0.188	T	0.70124	-0.4958	10	0.17369	T	0.5	.	11.2404	0.48966	0.0851:0.0:0.9149:0.0	.	92	O14756	H17B6_HUMAN	T	92	ENSP00000450698:A92T;ENSP00000451753:A92T;ENSP00000451406:A92T;ENSP00000452273:A92T;ENSP00000318631:A92T	ENSP00000318631:A92T	A	+	1	0	HSD17B6	55454177	0.001000	0.12720	0.413000	0.26509	0.086000	0.17979	1.365000	0.34182	2.810000	0.96702	0.655000	0.94253	GCA	-	HSD17B6	-	pfam_DH_sc/Rdtase_SDR		0.507	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSD17B6	HGNC	protein_coding	OTTHUMT00000410714.1	0	0	0	36	36	12	0.00	0.00	G	NM_003725		57167910	+1	182	107	20	8	tier1	no_errors	ENST00000322165	ensembl	human	known	74_37	missense	90.10	93.04	SNP	0.126	A	182	20
KCNJ3	3760	genome.wustl.edu	37	2	155555781	155555781	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr2:155555781A>T	ENST00000295101.2	+	1	971	c.494A>T	c.(493-495)cAg>cTg	p.Q165L	KCNJ3_ENST00000544049.1_Missense_Mutation_p.Q165L|AC061961.2_ENST00000443901.1_RNA	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	165					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	TTCCTCTTCCAGTCCATCCTG	0.577													ENSG00000162989																																					0													103.0	83.0	90.0					2																	155555781		2203	4300	6503	SO:0001583	missense	0			-	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.494A>T	2.37:g.155555781A>T	ENSP00000295101:p.Gln165Leu		B4DEW7|Q8TBI0	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.1,prints_K_chnl_inward-rec_Kir	p.Q165L	ENST00000295101.2	37	c.494	CCDS2200.1	2	.	.	.	.	.	.	.	.	.	.	A	21.4	4.141353	0.77775	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;D	0.96232	-3.95;-3.95	5.4	5.4	0.78164	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	H	0.97806	4.08	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.993	D	0.99457	1.0942	10	0.87932	D	0	.	14.2459	0.65988	1.0:0.0:0.0:0.0	.	165;165	B4DEW7;P48549	.;IRK3_HUMAN	L	165	ENSP00000295101:Q165L;ENSP00000438410:Q165L	ENSP00000295101:Q165L	Q	+	2	0	KCNJ3	155264027	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.269000	0.95684	2.048000	0.60808	0.454000	0.30748	CAG	-	KCNJ3	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir		0.577	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ3	HGNC	protein_coding	OTTHUMT00000254890.2	0	0	0	19	19	32	0.00	0.00	A	NM_002239		155555781	+1	6	23	2	4	tier1	no_errors	ENST00000295101	ensembl	human	known	74_37	missense	75.00	85.19	SNP	1.000	T	6	2
RELB	5971	genome.wustl.edu	37	19	45525438	45525438	+	Missense_Mutation	SNP	G	G	A	rs55723886		TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr19:45525438G>A	ENST00000221452.8	+	5	782	c.632G>A	c.(631-633)cGg>cAg	p.R211Q	RELB_ENST00000540120.1_Missense_Mutation_p.R211Q|RELB_ENST00000505236.1_Missense_Mutation_p.R208Q	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	211	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		TGCAGGGTGCGGCTCCGGCCT	0.647													ENSG00000104856																																					0								G	GLN/ARG	0,4150		0,0,2075	43.0	50.0	48.0		632	4.7	1.0	19	dbSNP_129	48	1,8415		0,1,4207	no	missense	RELB	NM_006509.3	43	0,1,6282	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging	211/580	45525438	1,12565	2075	4208	6283	SO:0001583	missense	0			-	M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.632G>A	19.37:g.45525438G>A	ENSP00000221452:p.Arg211Gln		Q6GTX7|Q9UEI7	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_D-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NF_Rel_Dor	p.R211Q	ENST00000221452.8	37	c.632	CCDS46110.1	19	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098603	0.76870	0.0	1.19E-4	ENSG00000104856	ENST00000221452;ENST00000540120;ENST00000505236	T;T;T	0.41065	1.01;1.01;1.01	4.74	4.74	0.60224	.	0.363608	0.25386	N	0.031049	T	0.35335	0.0928	L	0.28014	0.82	0.26734	N	0.970539	D	0.67145	0.996	P	0.47744	0.556	T	0.21621	-1.0240	10	0.51188	T	0.08	-10.885	11.0129	0.47673	0.0:0.1884:0.8116:0.0	rs55723886	208	D6R992	.	Q	211;211;208	ENSP00000221452:R211Q;ENSP00000445542:R211Q;ENSP00000423287:R208Q	ENSP00000221452:R211Q	R	+	2	0	RELB	50217278	0.057000	0.20700	0.999000	0.59377	0.946000	0.59487	0.890000	0.28295	2.449000	0.82847	0.462000	0.41574	CGG	rs55723886	RELB	-	pfam_RHD,superfamily_p53-like_TF_D-bd,pfscan_RHD		0.647	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELB	HGNC	protein_coding	OTTHUMT00000367361.2	0	0	0	31	31	19	0.00	0.00	G			45525438	+1	7	6	30	9	tier1	no_errors	ENST00000221452	ensembl	human	known	74_37	missense	18.92	40.00	SNP	0.995	A	7	30
TMPRSS5	80975	genome.wustl.edu	37	11	113565326	113565326	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr11:113565326C>T	ENST00000299882.5	-	8	807	c.659G>A	c.(658-660)gGt>gAt	p.G220D	TMPRSS5_ENST00000544476.1_Intron|TMPRSS5_ENST00000544634.1_Intron|TMPRSS5_ENST00000545579.1_Missense_Mutation_p.G211D|TMPRSS5_ENST00000545265.1_5'Flank|TMPRSS5_ENST00000540540.1_De_novo_Start_OutOfFrame|TMPRSS5_ENST00000536856.1_De_novo_Start_OutOfFrame|TMPRSS5_ENST00000538955.1_Missense_Mutation_p.G176D	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	220	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		AGACTGCCCACCAACTATCCG	0.642													ENSG00000166682																																					0													11.0	16.0	14.0					11																	113565326		1935	4044	5979	SO:0001583	missense	0			-	AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.659G>A	11.37:g.113565326C>T	ENSP00000299882:p.Gly220Asp			Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G220D	ENST00000299882.5	37	c.659	CCDS44735.1	11	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531561	0.64972	.	.	ENSG00000166682	ENST00000299882;ENST00000545579;ENST00000538955	T;T;T	0.68624	-0.34;-0.34;-0.34	4.53	4.53	0.55603	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.64402	D	0.000001	D	0.84270	0.5435	M	0.88310	2.945	0.80722	D	1	D;P	0.89917	1.0;0.954	D;P	0.91635	0.999;0.833	D	0.88063	0.2795	10	0.87932	D	0	.	16.0656	0.80867	0.0:1.0:0.0:0.0	.	211;220	F5GX83;Q9H3S3	.;TMPS5_HUMAN	D	220;211;176	ENSP00000299882:G220D;ENSP00000441104:G211D;ENSP00000445528:G176D	ENSP00000299882:G220D	G	-	2	0	TMPRSS5	113070536	1.000000	0.71417	0.446000	0.26920	0.345000	0.29048	6.659000	0.74412	2.065000	0.61736	0.205000	0.17691	GGT	-	TMPRSS5	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.642	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS5	HGNC	protein_coding	OTTHUMT00000398652.1	0	0	0	60	60	13	0.00	0.00	C	NM_030770		113565326	-1	3	0	17	4	tier1	no_errors	ENST00000299882	ensembl	human	known	74_37	missense	15.00	0.00	SNP	0.982	T	3	17
TRAF7	84231	genome.wustl.edu	37	16	2220714	2220716	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr16:2220714_2220716delGAG	ENST00000326181.6	+	5	463_465	c.331_333delGAG	c.(331-333)gagdel	p.E115del		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	115					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						CTCACTGCCCGAGGAGGAGGAGG	0.69													ENSG00000131653																																					0																																										SO:0001651	inframe_deletion	0				AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.331_333delGAG	16.37:g.2220723_2220725delGAG	ENSP00000318944:p.Glu115del		Q9H073	In_Frame_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_TRAF-like,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING,pfscan_Znf_TRAF,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E114in_frame_del	ENST00000326181.6	37	c.331_333	CCDS10461.1	16																																																																																				TRAF7	-	NULL		0.690	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF7	HGNC	protein_coding	OTTHUMT00000250762.1	0	0	0	32	32	13	0.00	0.00	GAG	NM_032271		2220716	+1	3	0	15	9	tier1	no_errors	ENST00000326181	ensembl	human	known	74_37	in_frame_del	16.67	0.00	DEL	1.000:1.000:1.000	-	3	15
COL4A2	1284	genome.wustl.edu	37	13	111109209	111109209	+	Intron	SNP	G	G	A	rs561182370	byFrequency	TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr13:111109209G>A	ENST00000360467.5	+	21	1645				COL4A2-AS2_ENST00000458403.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GATGCCCTGCGTCTGCGTGGG	0.711													ENSG00000224821	-|||	35	0.00698882	0.0038	0.0086	5008	,	,		13528	0.001		0.0099	False		,,,				2504	0.0133																0																																										SO:0001627	intron_variant	0			-	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1340-481G>A	13.37:g.111109209G>A			Q14052|Q548C3|Q5VZA9|Q66K23	R	SNP	-	NULL	ENST00000360467.5	37	NULL	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	-	5.897	0.349665	0.11182	.	.	ENSG00000224821	ENST00000458403	.	.	.	1.24	0.2	0.15181	.	.	.	.	.	T	0.56746	0.2006	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49476	-0.8936	5	0.46703	T	0.11	.	6.1362	0.20235	0.2129:0.0:0.7871:0.0	.	.	.	.	M	325	.	ENSP00000390212:T325M	T	-	2	0	COL4A2-AS2	109907210	0.160000	0.22878	0.021000	0.16686	0.014000	0.08584	-0.441000	0.06879	-0.503000	0.06586	-1.054000	0.02325	ACG	-	COL4A2-AS2	-	-		0.711	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2-AS2	HGNC	protein_coding	OTTHUMT00000045761.2	0	0	0	33	33	0	0.00	0.00	G	NM_001846		111109209	-1	3	0	21	0	tier1	no_errors	ENST00000458403	ensembl	human	known	74_37	rna	12.50	0.00	SNP	0.997	A	3	21
RP11-509A17.3	0	genome.wustl.edu	37	15	20563408	20563417	+	lincRNA	DEL	CCTCTCCCTT	CCTCTCCCTT	-	rs537093760|rs537797892	byFrequency	TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	CCTCTCCCTT	CCTCTCCCTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr15:20563408_20563417delCCTCTCCCTT	ENST00000557528.1	+	0	1812				AC026495.1_ENST00000581090.1_RNA																							CCTCCCAGAGcctctcccttcctctccctt	0.671													ENSG00000265002		795	0.158746	0.1793	0.1427	5008	,	,		62278	0.1319		0.1322	False		,,,				2504	0.1973																0																																												0																																15.37:g.20563418_20563427delCCTCTCCCTT				R	DEL	-	NULL	ENST00000557528.1	37	NULL		15																																																																																				AC026495.1	-	-		0.671	RP11-509A17.3-001	KNOWN	basic	lincRNA	ENSG00000265002	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000414658.1	0	0	0	3	3	3	0.00	0.00	CCTCTCCCTT			20563417	+1	0	0	4	4	tier1	no_errors	ENST00000581090	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.055:0.047:0.032:0.034:0.033:0.036:0.075:0.098:0.111:0.132	-	0	4
FAM230C	26080	genome.wustl.edu	37	22	21663770	21663770	+	lincRNA	SNP	G	G	A			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr22:21663770G>A	ENST00000436681.1	-	0	400																											TGTCGTGTGTGGCGTCCTCGT	0.577													ENSG00000206142																																					0																																												0			-																													22.37:g.21663770G>A				R	SNP	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			-	KB-1183D5.13	-	-		0.577	KB-1183D5.13-003	KNOWN	basic	lincRNA	FAM230C	Clone_based_vega_gene	lincRNA	OTTHUMT00000320109.1	0	0	0	43	43	4	0.00	0.00	G			21663770	-1	5	0	47	6	tier1	no_errors	ENST00000436681	ensembl	human	known	74_37	rna	9.62	0.00	SNP	0.996	A	5	47
PRSS41	360226	genome.wustl.edu	37	16	2848500	2848511	+	RNA	DEL	GGCGCTGCTGCT	GGCGCTGCTGCT	-	rs182642527|rs537639635|rs568540119	byFrequency	TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	GGCGCTGCTGCT	GGCGCTGCTGCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr16:2848500_2848511delGGCGCTGCTGCT	ENST00000399677.1	+	0	15_26				SNORA3_ENST00000408792.1_RNA			Q7RTY9	PRS41_HUMAN	protease, serine, 41							anchored component of membrane (GO:0031225)|intracellular organelle (GO:0043229)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)										GCGCGCGCGGggcgctgctgctggcgctgctg	0.797													ENSG00000215148		102	0.0203674	0.0015	0.0288	5008	,	,		11815	0.0		0.0666	False		,,,				2504	0.0133																0										70,2006		31,8,999						0.4	0.0			6	223,4141		68,87,2027	no	coding	PRSS41	NM_001135086.1		99,95,3026	A1A1,A1R,RR		5.11,3.3719,4.5497				293,6147						0						16p13.3	2014-04-01			ENSG00000215148	ENSG00000215148		"""Serine peptidases / Serine peptidases"""	30715	other	unknown	"""testis serine protease 1"""					12838346	Standard	NM_001135086		Approved	TESSP1	uc010uwi.2	Q7RTY9	OTTHUMG00000128932		16.37:g.2848500_2848511delGGCGCTGCTGCT				R	DEL	-	NULL	ENST00000399677.1	37	NULL		16																																																																																				PRSS41	-	-		0.797	PRSS41-002	KNOWN	basic	processed_transcript	PRSS41	HGNC	pseudogene	OTTHUMT00000436450.1	0	0	0	0	0	0	0.00	0.00	GGCGCTGCTGCT	NM_183379		2848511	+1	0	0	0	0	tier1	no_errors	ENST00000399677	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.001:0.000:0.000:0.000:0.000:0.001:0.004:0.000:0.001:0.001:0.000:0.000	-	0	0
TPRXL	348825	genome.wustl.edu	37	3	14105964	14105965	+	In_Frame_Ins	INS	-	-	AGC	rs138518200|rs142895893	byFrequency	TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr3:14105964_14105965insAGC	ENST00000424053.1	+	3	835_836	c.288_289insAGC	c.(289-291)agc>AGCagc	p.97_97S>SS	TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000429201.1_In_Frame_Ins_p.97_97S>SS|TPRXL_ENST00000326972.8_In_Frame_Ins_p.97_97S>SS			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						gtagcagctctagcagcagcag	0.678													ENSG00000180438		1496	0.298722	0.1505	0.3473	5008	,	,		10201	0.4385		0.2982	False		,,,				2504	0.3211																0																																										SO:0001652	inframe_insertion	0				AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.304_306dupAGC	3.37:g.14105971_14105973dupAGC	ENSP00000400448:p.Ser102dup		Q8NAM5	In_Frame_Ins	INS	NULL	p.100in_frame_insS	ENST00000424053.1	37	c.288_289		3																																																																																				TPRXL	-	NULL		0.678	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	HGNC	protein_coding	OTTHUMT00000340436.1	0	0	0	12	12	0	0.00	0.00	-	NR_002223		14105965	+1	6	0	11	0	tier1	no_errors	ENST00000326972	ensembl	human	known	74_37	in_frame_ins	35.29	0.00	INS	0.893:0.892	AGC	6	11
FAM230A	653203	genome.wustl.edu	37	22	20709111	20709111	+	Silent	SNP	C	C	T			TCGA-DX-AB35-01A-21D-A417-09	TCGA-DX-AB35-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e6f1c2d9-3f78-45f4-ae85-1d8e8eccf797	7f0069c9-21bd-456c-808f-b7604c8e6d10	g.chr22:20709111C>T	ENST00000434783.3	+	8	1027	c.843C>T	c.(841-843)caC>caT	p.H281H	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		ACGCCGCCCACGGCATCGCAA	0.667													ENSG00000188280																																					0																																										SO:0001819	synonymous_variant	0			-	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.843C>T	22.37:g.20709111C>T				Silent	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.H281	ENST00000434783.3	37	c.843		22																																																																																			-	FAM230A	-	superfamily_Kinase-like_dom		0.667	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	0	0	0	40	40	1	0.00	0.00	C			20709111	+1	13	5	21	0	tier1	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	36.11	100.00	SNP	0.001	T	13	21
