#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TMTC3	160418	genome.wustl.edu	37	12	88547274	88547274	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:88547274A>G	ENST00000266712.6	+	3	616	c.396A>G	c.(394-396)atA>atG	p.I132M		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	132					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						TGCACCCAATACATACAGAAG	0.313													ENSG00000139324																																					0													83.0	72.0	76.0					12																	88547274		2203	4299	6502	SO:0001583	missense	0			-		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.396A>G	12.37:g.88547274A>G	ENSP00000266712:p.Ile132Met		Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,pfam_DUF1736,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I132M	ENST00000266712.6	37	c.396	CCDS9032.1	12	.	.	.	.	.	.	.	.	.	.	A	18.09	3.545094	0.65198	.	.	ENSG00000139324	ENST00000549011;ENST00000266712	D;T	0.94092	-3.35;-0.26	5.89	2.22	0.28083	.	0.176280	0.64402	D	0.000014	D	0.93096	0.7802	M	0.77616	2.38	0.49687	D	0.999813	P	0.43788	0.817	P	0.49421	0.61	D	0.89522	0.3779	10	0.59425	D	0.04	-4.7892	4.5504	0.12108	0.6851:0.1305:0.0664:0.118	.	132	Q6ZXV5-2	.	M	132	ENSP00000447640:I132M;ENSP00000266712:I132M	ENSP00000266712:I132M	I	+	3	3	TMTC3	87071405	1.000000	0.71417	0.994000	0.49952	0.951000	0.60555	2.542000	0.45744	0.133000	0.18654	0.477000	0.44152	ATA	-	TMTC3	-	NULL		0.313	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC3	HGNC	protein_coding	OTTHUMT00000406421.1	0	0	0	44	44	66	0.00	0.00	A	NM_181783		88547274	+1	18	23	25	29	tier1	no_errors	ENST00000266712	ensembl	human	known	74_37	missense	41.86	44.23	SNP	1.000	G	18	25
MUC16	94025	genome.wustl.edu	37	19	9015716	9015716	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr19:9015716G>C	ENST00000397910.4	-	29	38310	c.38107C>G	c.(38107-38109)Ctc>Gtc	p.L12703V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12705	SEA 5. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGAAGTTGAGGGTGAACGGC	0.478													ENSG00000181143																																					0													201.0	175.0	184.0					19																	9015716		1982	4139	6121	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38107C>G	19.37:g.9015716G>C	ENSP00000381008:p.Leu12703Val		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L12703V	ENST00000397910.4	37	c.38107	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	8.667	0.901888	0.17760	.	.	ENSG00000181143	ENST00000397910	T	0.55413	0.52	3.44	1.12	0.20585	.	.	.	.	.	T	0.65080	0.2657	M	0.81497	2.545	.	.	.	D	0.53885	0.963	D	0.63033	0.91	T	0.66905	-0.5805	8	0.87932	D	0	.	3.5061	0.07691	0.1405:0.0:0.6073:0.2522	.	12703	B5ME49	.	V	12703	ENSP00000381008:L12703V	ENSP00000381008:L12703V	L	-	1	0	MUC16	8876716	0.019000	0.18553	0.978000	0.43139	0.302000	0.27658	-1.437000	0.02419	0.494000	0.27859	0.305000	0.20034	CTC	-	MUC16	-	pfam_SEA_dom		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	90	90	21	0.00	0.00	G	NM_024690		9015716	-1	14	10	26	15	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	35.00	40.00	SNP	1.000	C	14	26
RYR2	6262	genome.wustl.edu	37	1	237843759	237843759	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr1:237843759G>A	ENST00000366574.2	+	62	9216	c.8899G>A	c.(8899-8901)Gtt>Att	p.V2967I	RYR2_ENST00000542537.1_Missense_Mutation_p.V2951I|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.V2965I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2967					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTTCAGGTCGTTCTTCCTTT	0.428													ENSG00000198626																																					0													163.0	134.0	143.0					1																	237843759		1888	4115	6003	SO:0001583	missense	0			-	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8899G>A	1.37:g.237843759G>A	ENSP00000355533:p.Val2967Ile		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.V2965I	ENST00000366574.2	37	c.8893	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.950197	0.53186	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;D;D	0.97016	-0.03;-4.19;-4.21	5.84	5.84	0.93424	.	0.000000	0.56097	D	0.000039	D	0.92299	0.7557	L	0.35542	1.07	0.80722	D	1	P	0.50710	0.938	B	0.36030	0.216	D	0.92907	0.6344	10	0.54805	T	0.06	.	15.615	0.76760	0.0:0.1367:0.8633:0.0	.	2967	Q92736	RYR2_HUMAN	I	2967;2965;2951	ENSP00000355533:V2967I;ENSP00000353174:V2965I;ENSP00000443798:V2951I	ENSP00000353174:V2965I	V	+	1	0	RYR2	235910382	1.000000	0.71417	0.967000	0.41034	0.995000	0.86356	3.170000	0.50816	2.760000	0.94817	0.655000	0.94253	GTT	-	RYR2	-	NULL		0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	0	0	0	34	34	85	0.00	0.00	G	NM_001035		237843759	+1	7	19	17	51	tier1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	29.17	26.76	SNP	0.984	A	7	17
RAPGEF2	9693	genome.wustl.edu	37	4	160216908	160216908	+	Intron	SNP	C	C	T	rs66478721|rs373967945|rs4690935|rs113715111|rs60091174		TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr4:160216908C>T	ENST00000264431.4	+	2	479				RAPGEF2_ENST00000504604.1_Intron|AC105316.1_ENST00000401270.1_RNA	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2						adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		tgtgtgtgtgcgcgcgcgcgc	0.423													ENSG00000216089																																					0																																										SO:0001627	intron_variant	0			-	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.61-8586C>T	4.37:g.160216908C>T			D3DP27	R	SNP	-	NULL	ENST00000264431.4	37	NULL	CCDS43277.1	4																																																																																			rs4690935	AC105316.1	-	-		0.423	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216089	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000364980.2	0	0	0	33	33	9	0.00	0.00	C	NM_014247		160216908	+1	5	4	29	19	tier1	no_errors	ENST00000401270	ensembl	human	novel	74_37	rna	14.71	17.39	SNP	0.000	T	5	29
OR4C46	119749	genome.wustl.edu	37	11	51516009	51516009	+	Missense_Mutation	SNP	C	C	T	rs137991158		TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr11:51516009C>T	ENST00000328188.1	+	1	728	c.728C>T	c.(727-729)aCg>aTg	p.T243M		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						TCCCACATCACGGTTGTCATC	0.468													ENSG00000185926	.|||	1	0.000199681	0.0	0.0	5008	,	,		19962	0.001		0.0	False		,,,				2504	0.0																0								C	MET/THR	1,4401		0,1,2200	135.0	114.0	121.0		728	1.4	0.3	11	dbSNP_134	121	0,8592		0,0,4296	no	missense	OR4C46	NM_001004703.1	81	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	243/310	51516009	1,12993	2201	4296	6497	SO:0001583	missense	0			-		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.728C>T	11.37:g.51516009C>T	ENSP00000329056:p.Thr243Met			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T243M	ENST00000328188.1	37	c.728	CCDS31498.1	11	.	.	.	.	.	.	.	.	.	.	.	7.494	0.651307	0.14516	2.27E-4	0.0	ENSG00000185926	ENST00000328188	T	0.38401	1.14	2.33	1.38	0.22167	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000249	T	0.40767	0.1130	L	0.60904	1.88	0.09310	N	1	D	0.59357	0.985	P	0.53146	0.719	T	0.19712	-1.0297	10	0.52906	T	0.07	.	6.9475	0.24526	0.0:0.8456:0.0:0.1544	.	243	A6NHA9	O4C46_HUMAN	M	243	ENSP00000329056:T243M	ENSP00000329056:T243M	T	+	2	0	OR4C46	51372585	0.000000	0.05858	0.345000	0.25642	0.051000	0.14879	-0.509000	0.06336	0.340000	0.23745	0.121000	0.15741	ACG	rs137991158	OR4C46	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.468	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C46	HGNC	protein_coding	OTTHUMT00000391155.1	0	0	0	93	93	25	0.00	0.00	C	NM_001004703		51516009	+1	12	13	24	13	tier1	no_errors	ENST00000328188	ensembl	human	known	74_37	missense	33.33	50.00	SNP	0.103	T	12	24
FAM83G	644815	genome.wustl.edu	37	17	18891589	18891589	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr17:18891589G>A	ENST00000388995.6	-	3	884	c.661C>T	c.(661-663)Cgg>Tgg	p.R221W	SLC5A10_ENST00000317977.6_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.R221W|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395645.3_Intron|FAM83G_ENST00000585154.2_Missense_Mutation_p.R221W|SLC5A10_ENST00000395643.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	221					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						ATGCAGGCCCGCTCACACATG	0.567													ENSG00000188522																																					0													98.0	102.0	101.0					17																	18891589		2096	4225	6321	SO:0001583	missense	0			-	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.661C>T	17.37:g.18891589G>A	ENSP00000373647:p.Arg221Trp		Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	pfam_DUF1669	p.R221W	ENST00000388995.6	37	c.661	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	G	12.08	1.829902	0.32329	.	.	ENSG00000188522	ENST00000388995;ENST00000345041;ENST00000399096	T;T	0.12984	2.63;2.63	5.29	4.26	0.50523	.	0.056249	0.64402	D	0.000003	T	0.25975	0.0633	M	0.65498	2.005	0.46725	D	0.999172	D	0.54772	0.968	P	0.52793	0.709	T	0.01326	-1.1384	10	0.87932	D	0	-38.2082	12.6507	0.56759	0.0:0.0:0.7102:0.2898	.	221	A6ND36	FA83G_HUMAN	W	221	ENSP00000373647:R221W;ENSP00000343279:R221W	ENSP00000343279:R221W	R	-	1	2	FAM83G	18832314	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	4.926000	0.63433	2.497000	0.84241	0.591000	0.81541	CGG	-	FAM83G	-	pfam_DUF1669		0.567	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	HGNC	protein_coding	OTTHUMT00000253108.4	0	0	0	44	44	70	0.00	0.00	G			18891589	-1	7	32	9	39	tier1	no_errors	ENST00000345041	ensembl	human	known	74_37	missense	43.75	45.07	SNP	1.000	A	7	9
ALKBH4	54784	genome.wustl.edu	37	7	102097908	102097908	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr7:102097908C>T	ENST00000292566.3	-	3	881	c.842G>A	c.(841-843)gGg>gAg	p.G281E		NM_017621.3	NP_060091.1	Q9NXW9	ALKB4_HUMAN	alkB, alkylation repair homolog 4 (E. coli)	281					actomyosin structure organization (GO:0031032)|cleavage furrow ingression (GO:0036090)|protein demethylation (GO:0006482)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	contractile ring (GO:0070938)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	actin binding (GO:0003779)|demethylase activity (GO:0032451)|metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			kidney(1)|lung(5)|skin(2)	8						TTGCTGCCTCCCTCCAGGGCC	0.647													ENSG00000160993																																					0													56.0	45.0	49.0					7																	102097908		2203	4300	6503	SO:0001583	missense	0			-	BC017096	CCDS5723.1	7q22.1	2006-02-09			ENSG00000160993	ENSG00000160993		"""Alkylation repair homologs"""	21900	protein-coding gene	gene with protein product		613302					Standard	NM_017621		Approved	FLJ20013	uc003uzl.3	Q9NXW9	OTTHUMG00000157720	ENST00000292566.3:c.842G>A	7.37:g.102097908C>T	ENSP00000292566:p.Gly281Glu		Q53H92|Q9H6A4	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase	p.G281E	ENST00000292566.3	37	c.842	CCDS5723.1	7	.	.	.	.	.	.	.	.	.	.	C	16.14	3.037934	0.54896	.	.	ENSG00000160993	ENST00000292566	T	0.57107	0.42	5.08	4.2	0.49525	.	0.051417	0.85682	N	0.000000	T	0.68924	0.3054	M	0.77820	2.39	0.80722	D	1	D	0.69078	0.997	P	0.62813	0.907	T	0.72243	-0.4350	10	0.59425	D	0.04	-10.1747	12.2608	0.54649	0.0:0.9183:0.0:0.0817	.	281	Q9NXW9	ALKB4_HUMAN	E	281	ENSP00000292566:G281E	ENSP00000292566:G281E	G	-	2	0	ALKBH4	101884913	1.000000	0.71417	0.057000	0.19452	0.088000	0.18126	7.235000	0.78143	1.137000	0.42214	0.561000	0.74099	GGG	-	ALKBH4	-	NULL		0.647	ALKBH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH4	HGNC	protein_coding	OTTHUMT00000349503.1	0	0	0	78	78	26	0.00	0.00	C	NM_017621		102097908	-1	30	9	32	12	tier1	no_errors	ENST00000292566	ensembl	human	known	74_37	missense	48.39	42.86	SNP	0.990	T	30	32
CHPF2	54480	genome.wustl.edu	37	7	150935155	150935155	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr7:150935155G>T	ENST00000035307.2	+	4	3220	c.1707G>T	c.(1705-1707)gaG>gaT	p.E569D	MIR671_ENST00000390183.1_RNA|CHPF2_ENST00000495645.1_Missense_Mutation_p.E561D|RP4-548D19.3_ENST00000607902.1_RNA	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	569					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						TGCGAGCAGAGGCCCCTTCCC	0.627													ENSG00000033100																																					0													35.0	38.0	37.0					7																	150935155		2203	4300	6503	SO:0001583	missense	0			-	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.1707G>T	7.37:g.150935155G>T	ENSP00000035307:p.Glu569Asp		B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	pfam_Chond_Galc,pfam_Fringe-like	p.E569D	ENST00000035307.2	37	c.1707	CCDS34779.1	7	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239838	0.22711	.	.	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.16324	2.35;2.35	4.71	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.12561	0.0305	L	0.28740	0.885	0.53688	D	0.999973	B;B	0.23058	0.046;0.079	B;B	0.29524	0.103;0.035	T	0.10474	-1.0628	10	0.17369	T	0.5	-25.1034	10.28	0.43534	0.165:0.0:0.835:0.0	.	569;561	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	D	561;569;569	ENSP00000418914:E561D;ENSP00000035307:E569D	ENSP00000035307:E569D	E	+	3	2	CHPF2	150566088	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.164000	0.42387	1.210000	0.43336	-0.225000	0.12378	GAG	-	CHPF2	-	pfam_Chond_Galc		0.627	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF2	HGNC	protein_coding	OTTHUMT00000348648.2	0	0	0	42	42	86	0.00	0.00	G	NM_019015		150935155	+1	8	30	13	54	tier1	no_errors	ENST00000035307	ensembl	human	known	74_37	missense	38.10	35.71	SNP	1.000	T	8	13
TBC1D15	64786	genome.wustl.edu	37	12	72291723	72291723	+	Splice_Site	SNP	T	T	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:72291723T>A	ENST00000550746.1	+	11	1298		c.e11+2		TBC1D15_ENST00000319106.8_Splice_Site|TBC1D15_ENST00000485960.2_Splice_Site|TBC1D15_ENST00000548679.1_Splice_Site|TBC1D15_ENST00000393309.3_Splice_Site	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15						positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTCTTATCGGTAATTTTTTCT	0.353													ENSG00000121749																																					0													56.0	59.0	58.0					12																	72291723		2203	4295	6498	SO:0001630	splice_region_variant	0			-	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.1234+2T>A	12.37:g.72291723T>A			B4DMT9|B9A6L6|J3KNI9|Q9HA83	Splice_Site	SNP	-	e11+2	ENST00000550746.1	37	c.1234+2	CCDS31858.1	12	.	.	.	.	.	.	.	.	.	.	T	20.2	3.951515	0.73787	.	.	ENSG00000121749	ENST00000550746;ENST00000319106;ENST00000485960;ENST00000393309	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3365	0.43852	0.0:0.0733:0.0:0.9267	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D15	70577990	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.027000	0.70881	2.173000	0.68751	0.460000	0.39030	.	-	TBC1D15	-	-		0.353	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	TBC1D15	HGNC	protein_coding	OTTHUMT00000351266.2	0	0	0	66	66	83	0.00	0.00	T	NM_022771	Intron	72291723	+1	56	27	31	44	tier1	no_errors	ENST00000550746	ensembl	human	known	74_37	splice_site	64.37	37.50	SNP	1.000	A	56	31
IKBKAP	8518	genome.wustl.edu	37	9	111685148	111685148	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr9:111685148T>C	ENST00000374647.5	-	6	833	c.526A>G	c.(526-528)Aga>Gga	p.R176G	IKBKAP_ENST00000537196.1_Intron	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	176					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GCTGCTTGTCTGCCTTCTGAT	0.428													ENSG00000070061																																					0													214.0	188.0	197.0					9																	111685148		2203	4300	6503	SO:0001583	missense	0			-	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.526A>G	9.37:g.111685148T>C	ENSP00000363779:p.Arg176Gly		Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	pfam_IKI3,superfamily_ARM-type_fold,superfamily_UBA-like,pirsf_IKI3	p.R176G	ENST00000374647.5	37	c.526	CCDS6773.1	9	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565710	0.65651	.	.	ENSG00000070061	ENST00000374647	T	0.31247	1.5	5.62	4.48	0.54585	.	0.041576	0.85682	D	0.000000	T	0.37156	0.0993	M	0.73962	2.25	0.80722	D	1	P	0.48998	0.918	B	0.43701	0.428	T	0.32025	-0.9922	10	0.72032	D	0.01	-18.6106	11.0021	0.47611	0.0:0.0:0.1671:0.8329	.	176	O95163	ELP1_HUMAN	G	176	ENSP00000363779:R176G	ENSP00000363779:R176G	R	-	1	2	IKBKAP	110724969	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.742000	0.68646	0.955000	0.37878	0.528000	0.53228	AGA	-	IKBKAP	-	pfam_IKI3,pirsf_IKI3		0.428	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	HGNC	protein_coding	OTTHUMT00000053574.1	0	0	0	58	58	120	0.00	0.00	T			111685148	-1	16	33	30	91	tier1	no_errors	ENST00000374647	ensembl	human	known	74_37	missense	34.78	26.40	SNP	1.000	C	16	30
AVIL	10677	genome.wustl.edu	37	12	58207134	58207134	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:58207134G>C	ENST00000257861.3	-	3	644	c.214C>G	c.(214-216)Caa>Gaa	p.Q72E	RP11-571M6.18_ENST00000602327.1_lincRNA|AVIL_ENST00000537081.1_Missense_Mutation_p.Q65E	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	72	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GCGCAGCTTTGCTCATCCTGG	0.577													ENSG00000135407																																					0													123.0	111.0	115.0					12																	58207134		2203	4300	6503	SO:0001583	missense	0			-	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.214C>G	12.37:g.58207134G>C	ENSP00000257861:p.Gln72Glu		B2RAU7|Q2NKM9	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.Q72E	ENST00000257861.3	37	c.214	CCDS8959.1	12	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584145	0.65992	.	.	ENSG00000135407	ENST00000537081;ENST00000257861;ENST00000549994	T;T;T	0.54279	0.58;0.58;0.58	4.92	4.02	0.46733	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	T	0.77987	0.4213	M	0.93594	3.435	0.58432	D	0.999995	D;P;D	0.65815	0.968;0.943;0.995	P;P;D	0.70487	0.882;0.742;0.969	D	0.84215	0.0458	10	0.66056	D	0.02	-12.1337	14.1085	0.65107	0.0:0.0:0.8485:0.1515	.	65;72;72	O75366-2;F8VVU1;O75366	.;.;AVIL_HUMAN	E	65;72;72	ENSP00000443207:Q65E;ENSP00000257861:Q72E;ENSP00000449239:Q72E	ENSP00000257861:Q72E	Q	-	1	0	AVIL	56493401	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.625000	0.83145	1.419000	0.47118	0.650000	0.86243	CAA	-	AVIL	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin		0.577	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1	0	0	0	17	17	30	0.00	0.00	G	NM_006576		58207134	-1	128	310	330	1108	tier1	no_errors	ENST00000257861	ensembl	human	known	74_37	missense	27.95	21.80	SNP	1.000	C	128	330
CSRNP3	80034	genome.wustl.edu	37	2	166536009	166536009	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr2:166536009G>A	ENST00000342316.4	+	5	1776	c.1504G>A	c.(1504-1506)Gtt>Att	p.V502I	CSRNP3_ENST00000409420.1_Missense_Mutation_p.V534I|CSRNP3_ENST00000314499.7_Missense_Mutation_p.V502I	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	502					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						CTCTGTAATCGTTTGCTGCTC	0.507													ENSG00000178662																																					0													89.0	75.0	80.0					2																	166536009		2203	4300	6503	SO:0001583	missense	0			-	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.1504G>A	2.37:g.166536009G>A	ENSP00000344042:p.Val502Ile		B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	prints_Cys/Ser-rich_nuc_prot	p.V502I	ENST00000342316.4	37	c.1504	CCDS2225.1	2	.	.	.	.	.	.	.	.	.	.	G	12.06	1.825289	0.32237	.	.	ENSG00000178662	ENST00000314499;ENST00000342316;ENST00000409420	T;T;T	0.49432	0.78;0.78;0.78	5.88	5.88	0.94601	.	0.182840	0.43579	D	0.000554	T	0.36276	0.0961	L	0.27053	0.805	0.37107	D	0.900175	B	0.31581	0.329	B	0.22880	0.042	T	0.24621	-1.0155	9	.	.	.	-17.3619	20.2422	0.98381	0.0:0.0:1.0:0.0	.	502	Q8WYN3	CSRN3_HUMAN	I	502;502;534	ENSP00000318258:V502I;ENSP00000344042:V502I;ENSP00000387195:V534I	.	V	+	1	0	CSRNP3	166244255	0.996000	0.38824	0.916000	0.36221	0.933000	0.57130	2.615000	0.46368	2.782000	0.95742	0.655000	0.94253	GTT	-	CSRNP3	-	NULL		0.507	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP3	HGNC	protein_coding	OTTHUMT00000255191.2	0	0	0	27	27	59	0.00	0.00	G	NM_024969		166536009	+1	12	29	12	32	tier1	no_errors	ENST00000314499	ensembl	human	known	74_37	missense	50.00	47.54	SNP	0.893	A	12	12
TCP10L	140290	genome.wustl.edu	37	21	33947970	33947970	+	IGR	SNP	G	G	A	rs528991484	byFrequency	TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr21:33947970G>A	ENST00000300258.3	-	0	984				LINC00846_ENST00000334165.4_lincRNA	NM_144659.5	NP_653260.1	Q8TDR4	TCP1L_HUMAN	t-complex 10-like						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	protein self-association (GO:0043621)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)			breast(1)|central_nervous_system(1)|liver(1)|skin(1)	4						TGCAGAGGTCGTGAAGCTGCT	0.567													ENSG00000186842	G|||	2	0.000399361	0.0015	0.0	5008	,	,		19669	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001628	intergenic_variant	0			-	AF115967	CCDS13616.1	21p22.11	2012-09-20	2012-09-20		ENSG00000242220	ENSG00000242220			11657	protein-coding gene	gene with protein product		608365	"""t-complex 10 (a murine tcp homolog)-like"", ""t-complex 10 (mouse)-like"""			10830953	Standard	NM_144659		Approved	PRED77		Q8TDR4	OTTHUMG00000064901		21.37:g.33947970G>A			Q53EW0|Q96LN5	R	SNP	-	NULL	ENST00000300258.3	37	NULL	CCDS13616.1	21																																																																																			-	LINC00846	-	-		0.567	TCP10L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LINC00846	HGNC	protein_coding	OTTHUMT00000139350.1	0	0	0	41	41	83	0.00	0.00	G	NM_144659		33947970	-1	9	35	15	56	tier1	no_errors	ENST00000334165	ensembl	human	known	74_37	rna	37.50	38.46	SNP	0.005	A	9	15
RPF2	84154	genome.wustl.edu	37	6	111346637	111346637	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:111346637C>G	ENST00000441448.2	+	10	865	c.773C>G	c.(772-774)aCt>aGt	p.T258S		NM_032194.1	NP_115570.1	Q9H7B2	RPF2_HUMAN	ribosome production factor 2 homolog (S. cerevisiae)	258						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)	7						TCCCATGATACTTTTGGTACA	0.358													ENSG00000197498																																					0													79.0	82.0	81.0					6																	111346637		2203	4300	6503	SO:0001583	missense	0			-	AK024740	CCDS5088.1	6q21	2009-09-25	2009-09-25	2009-09-25	ENSG00000197498	ENSG00000197498			20870	protein-coding gene	gene with protein product	"""ribosomal processing factor 2 homolog (S. cerevisiae)"""		"""brix domain containing 1"""	BXDC1		12048200	Standard	NM_032194		Approved	FLJ21087, bA397G5.4	uc003pun.3	Q9H7B2	OTTHUMG00000015368	ENST00000441448.2:c.773C>G	6.37:g.111346637C>G	ENSP00000402338:p.Thr258Ser		Q5VXN1|Q8N4A1	Missense_Mutation	SNP	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.T258S	ENST00000441448.2	37	c.773	CCDS5088.1	6	.	.	.	.	.	.	.	.	.	.	c	10.23	1.292566	0.23564	.	.	ENSG00000197498	ENST00000441448	T	0.71698	-0.59	5.8	4.93	0.64822	.	0.100576	0.64402	D	0.000002	T	0.31734	0.0806	L	0.28608	0.87	0.31528	N	0.661575	B;B	0.25441	0.016;0.126	B;B	0.21546	0.005;0.035	T	0.08146	-1.0736	10	0.10377	T	0.69	-12.7754	7.7445	0.28860	0.1601:0.7374:0.0:0.1026	.	258;258	A8K800;Q9H7B2	.;RPF2_HUMAN	S	258	ENSP00000402338:T258S	ENSP00000402338:T258S	T	+	2	0	RPF2	111453330	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.271000	0.43364	1.453000	0.47775	0.563000	0.77884	ACT	-	RPF2	-	NULL		0.358	RPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPF2	HGNC	protein_coding	OTTHUMT00000041813.2	0	0	0	30	30	43	0.00	0.00	C	NM_032194		111346637	+1	15	9	13	23	tier1	no_errors	ENST00000441448	ensembl	human	known	74_37	missense	53.57	28.12	SNP	1.000	G	15	13
EYA4	2070	genome.wustl.edu	37	6	133804184	133804184	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:133804184G>A	ENST00000367895.5	+	13	1586	c.1122G>A	c.(1120-1122)tgG>tgA	p.W374*	EYA4_ENST00000452339.2_Nonsense_Mutation_p.W320*|EYA4_ENST00000431403.2_Nonsense_Mutation_p.W374*|EYA4_ENST00000531901.1_Nonsense_Mutation_p.W380*|EYA4_ENST00000430974.2_Nonsense_Mutation_p.W326*|EYA4_ENST00000525849.1_Nonsense_Mutation_p.W351*|EYA4_ENST00000355167.3_Nonsense_Mutation_p.W374*|EYA4_ENST00000355286.6_Nonsense_Mutation_p.W351*	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	374					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TGTTTGTCTGGGATTTGGATG	0.368													ENSG00000112319																									Melanoma(57;398 1237 3528 4702 7415)												0													130.0	125.0	127.0					6																	133804184		2203	4300	6503	SO:0001587	stop_gained	0			-	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1122G>A	6.37:g.133804184G>A	ENSP00000356870:p.Trp374*		B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Nonsense_Mutation	SNP	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.W374*	ENST00000367895.5	37	c.1122	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	G	43	9.984172	0.99310	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.104	19.5117	0.95144	0.0:0.0:1.0:0.0	.	.	.	.	X	320;326;374;374;351;380;351;374	.	ENSP00000347294:W374X	W	+	3	0	EYA4	133845877	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.604000	0.88044	0.650000	0.86243	TGG	-	EYA4	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA		0.368	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	HGNC	protein_coding	OTTHUMT00000042282.2	0	0	0	62	62	76	0.00	0.00	G	NM_004100		133804184	+1	4	9	34	58	tier1	no_errors	ENST00000355167	ensembl	human	known	74_37	nonsense	10.53	13.24	SNP	1.000	A	4	34
FRK	2444	genome.wustl.edu	37	6	116381270	116381270	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:116381270G>A	ENST00000606080.1	-	1	651	c.205C>T	c.(205-207)Ctt>Ttt	p.L69F		NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	69	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	AGAACTTGAAGTTTGTCACCT	0.507													ENSG00000111816																																					0													131.0	130.0	131.0					6																	116381270		2203	4300	6503	SO:0001583	missense	0			-	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.205C>T	6.37:g.116381270G>A	ENSP00000476145:p.Leu69Phe		B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.L69F	ENST00000606080.1	37	c.205	CCDS5103.1	6	.	.	.	.	.	.	.	.	.	.	G	10.42	1.345016	0.24426	.	.	ENSG00000111816	ENST00000368626	T	0.38887	1.11	4.74	3.87	0.44632	Src homology-3 domain (5);	0.134545	0.32041	N	0.006679	T	0.39306	0.1073	L	0.41027	1.25	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.16778	-1.0391	10	0.31617	T	0.26	.	11.6729	0.51413	0.0828:0.0:0.9172:0.0	.	69	P42685	FRK_HUMAN	F	69	ENSP00000357615:L69F	ENSP00000357615:L69F	L	-	1	0	FRK	116487963	1.000000	0.71417	1.000000	0.80357	0.041000	0.13682	3.863000	0.56016	1.344000	0.45657	-0.140000	0.14226	CTT	-	FRK	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain		0.507	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRK	HGNC	protein_coding	OTTHUMT00000041924.2	0	0	0	26	26	126	0.00	0.00	G	NM_002031		116381270	-1	15	30	15	62	tier1	no_errors	ENST00000606080	ensembl	human	known	74_37	missense	50.00	32.61	SNP	1.000	A	15	15
SYNE1	23345	genome.wustl.edu	37	6	152697665	152697665	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:152697665G>A	ENST00000367255.5	-	58	9776	c.9175C>T	c.(9175-9177)Cag>Tag	p.Q3059*	SYNE1_ENST00000423061.1_Nonsense_Mutation_p.Q3066*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.Q3066*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.Q3098*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.Q3059*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3059					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTTATTCTGGCAGCCCTTG	0.383										HNSCC(10;0.0054)			ENSG00000131018																																					0													62.0	64.0	63.0					6																	152697665		2203	4300	6503	SO:0001587	stop_gained	0			-	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.9175C>T	6.37:g.152697665G>A	ENSP00000356224:p.Gln3059*		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q3059*	ENST00000367255.5	37	c.9175	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	33	5.231761	0.95207	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	.	.	.	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8557	0.96758	0.0:0.0:1.0:0.0	.	.	.	.	X	3059;3066;3059;3066;3098	.	ENSP00000265368:Q3059X	Q	-	1	0	SYNE1	152739358	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.397000	0.97276	2.707000	0.92482	0.655000	0.94253	CAG	-	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom		0.383	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	0	0	0	103	103	104	0.00	0.00	G	NM_182961		152697665	-1	27	21	48	50	tier1	no_errors	ENST00000265368	ensembl	human	known	74_37	nonsense	36.00	29.58	SNP	1.000	A	27	48
AVIL	10677	genome.wustl.edu	37	12	58207180	58207180	+	Silent	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:58207180G>A	ENST00000257861.3	-	3	598	c.168C>T	c.(166-168)tcC>tcT	p.S56S	RP11-571M6.18_ENST00000602327.1_lincRNA|AVIL_ENST00000537081.1_Silent_p.S49S	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	56	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GGATGTCCTGGGATAGGAGAC	0.597													ENSG00000135407																																					0													74.0	68.0	70.0					12																	58207180		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.168C>T	12.37:g.58207180G>A			B2RAU7|Q2NKM9	Silent	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.S56	ENST00000257861.3	37	c.168	CCDS8959.1	12																																																																																			-	AVIL	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin		0.597	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1	0	0	0	11	11	29	0.00	0.00	G	NM_006576		58207180	-1	104	318	269	1159	tier1	no_errors	ENST00000257861	ensembl	human	known	74_37	silent	27.88	21.49	SNP	1.000	A	104	269
SPR	6697	genome.wustl.edu	37	2	73115591	73115591	+	Silent	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr2:73115591C>T	ENST00000234454.5	+	2	526	c.453C>T	c.(451-453)acC>acT	p.T151T	SPR_ENST00000498749.1_3'UTR	NM_003124.4	NP_003115.1	P35270	SPRE_HUMAN	sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)	151					cell morphogenesis involved in neuron differentiation (GO:0048667)|death (GO:0016265)|dopamine metabolic process (GO:0042417)|L-phenylalanine metabolic process (GO:0006558)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|norepinephrine metabolic process (GO:0042415)|oxidation-reduction process (GO:0055114)|pteridine metabolic process (GO:0019889)|regulation of multicellular organism growth (GO:0040014)|regulation of nitric-oxide synthase activity (GO:0050999)|serotonin metabolic process (GO:0042428)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldo-keto reductase (NADP) activity (GO:0004033)|NADP binding (GO:0050661)|sepiapterin reductase activity (GO:0004757)			lung(4)|ovary(2)	6						TCAACAGAACCGTGGTTAACA	0.562											OREG0014704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000116096																																					0													162.0	141.0	148.0					2																	73115591		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS1920.1	2p14-p12	2013-06-03			ENSG00000116096	ENSG00000116096	1.1.1.153	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	11257	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 38C, member 1"""	182125				1883349, 19027726	Standard	NM_003124		Approved	SDR38C1	uc002sik.2	P35270	OTTHUMG00000129777	ENST00000234454.5:c.453C>T	2.37:g.73115591C>T		1142	A8K741|D6W5H2|Q53GI9|Q9UBB1	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,tigrfam_Sepiapterin_red	p.T151	ENST00000234454.5	37	c.453	CCDS1920.1	2																																																																																			-	SPR	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,tigrfam_Sepiapterin_red		0.562	SPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPR	HGNC	protein_coding	OTTHUMT00000251993.2	0	0	0	54	54	107	0.00	0.00	C			73115591	+1	14	33	13	54	tier1	no_errors	ENST00000234454	ensembl	human	known	74_37	silent	51.85	37.50	SNP	0.000	T	14	13
BTN1A1	696	genome.wustl.edu	37	6	26508941	26508941	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:26508941G>A	ENST00000244513.6	+	7	1186	c.1120G>A	c.(1120-1122)Gtg>Atg	p.V374M		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	374	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						GGCAATCGGCGTGTGTAGGGA	0.542													ENSG00000124557																																					0													164.0	145.0	152.0					6																	26508941		2203	4300	6503	SO:0001583	missense	0			-	U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.1120G>A	6.37:g.26508941G>A	ENSP00000244513:p.Val374Met		Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.V374M	ENST00000244513.6	37	c.1120	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306882	0.60305	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.74421	-0.84	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.52532	D	0.000063	D	0.87087	0.6090	M	0.88377	2.95	0.51012	D	0.9999	D	0.89917	1.0	D	0.87578	0.998	D	0.88814	0.3294	10	0.87932	D	0	.	17.1811	0.86855	0.0:0.0:1.0:0.0	.	374	Q13410	BT1A1_HUMAN	M	374	ENSP00000244513:V374M	ENSP00000244513:V374M	V	+	1	0	BTN1A1	26616920	1.000000	0.71417	0.919000	0.36401	0.093000	0.18481	4.612000	0.61169	2.727000	0.93392	0.655000	0.94253	GTG	-	BTN1A1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.542	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	HGNC	protein_coding	OTTHUMT00000043776.1	0	0	0	44	44	82	0.00	0.00	G	NM_001732		26508941	+1	12	30	20	43	tier1	no_errors	ENST00000244513	ensembl	human	known	74_37	missense	37.50	41.10	SNP	1.000	A	12	20
CATSPER1	117144	genome.wustl.edu	37	11	65793082	65793082	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr11:65793082G>A	ENST00000312106.5	-	1	906	c.769C>T	c.(769-771)Cag>Tag	p.Q257*		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	257	His-rich.				calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						ATCCCACGCTGGTAGGACCCC	0.567													ENSG00000175294																																					0													120.0	104.0	109.0					11																	65793082		2201	4296	6497	SO:0001587	stop_gained	0			-	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.769C>T	11.37:g.65793082G>A	ENSP00000309052:p.Gln257*		Q96P76	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.Q257*	ENST00000312106.5	37	c.769	CCDS8127.1	11	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385200	0.61956	.	.	ENSG00000175294	ENST00000312106	.	.	.	3.87	0.698	0.18087	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	4.4697	0.11706	0.1612:0.0:0.5291:0.3097	.	.	.	.	X	257	.	ENSP00000309052:Q257X	Q	-	1	0	CATSPER1	65549658	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.200000	0.09478	0.039000	0.15632	0.404000	0.27445	CAG	-	CATSPER1	-	NULL		0.567	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER1	HGNC	protein_coding	OTTHUMT00000391055.1	0	0	0	18	18	74	0.00	0.00	G	NM_053054		65793082	-1	5	17	4	51	tier1	no_errors	ENST00000312106	ensembl	human	known	74_37	nonsense	55.56	25.00	SNP	0.000	A	5	4
NUTM2B	729262	genome.wustl.edu	37	10	81463657	81463657	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr10:81463657T>C	ENST00000429828.1	+	1	675	c.292T>C	c.(292-294)Tct>Cct	p.S98P	RP11-119F19.2_ENST00000596088.1_RNA|NUTM2B_ENST00000372321.1_Missense_Mutation_p.S31P|RP11-119F19.2_ENST00000600376.1_RNA|NUTM2B_ENST00000448135.1_Missense_Mutation_p.S98P|RP11-119F19.2_ENST00000601369.1_RNA	NM_001278495.1	NP_001265424.1	A6NNL0	NTM2B_HUMAN	NUT family member 2B	98																	GCCAGGTCACTCTCTGGGTCT	0.527													ENSG00000188199																																					0																																										SO:0001583	missense	0			-		CCDS60574.1	10q22.3	2014-08-13	2013-03-14	2013-03-14	ENSG00000188199	ENSG00000188199			23445	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member B"""	FAM22B			Standard	NM_001278495		Approved	bA119F19.1		A6NNL0	OTTHUMG00000018572	ENST00000429828.1:c.292T>C	10.37:g.81463657T>C	ENSP00000394623:p.Ser98Pro		A6NM73	Missense_Mutation	SNP	NULL	p.S98P	ENST00000429828.1	37	c.292		10	.	.	.	.	.	.	.	.	.	.	.	4.683	0.126931	0.08931	.	.	ENSG00000188199	ENST00000448135;ENST00000429828;ENST00000372321	T;T;T	0.30714	1.52;2.35;1.66	1.37	-2.74	0.05932	.	.	.	.	.	T	0.21631	0.0521	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32268	-0.9913	6	0.66056	D	0.02	.	0.1105	0.00056	0.2411:0.1785:0.2448:0.3356	.	.	.	.	P	98;98;31	ENSP00000391631:S98P;ENSP00000394623:S98P;ENSP00000361396:S31P	ENSP00000361396:S31P	S	+	1	0	FAM22B	81133663	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.456000	0.02377	-0.892000	0.03935	0.000000	0.15137	TCT	-	NUTM2B	-	NULL		0.527	NUTM2B-201	KNOWN	basic|appris_principal	protein_coding	NUTM2B	HGNC	protein_coding		0	0	0	54	54	19	0.00	0.00	T	NG_012780		81463657	+1	7	4	19	15	tier1	no_errors	ENST00000429828	ensembl	human	known	74_37	missense	26.92	21.05	SNP	0.000	C	7	19
SLC35A5	55032	genome.wustl.edu	37	3	112300024	112300024	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr3:112300024A>G	ENST00000492406.1	+	6	1343	c.1060A>G	c.(1060-1062)Agg>Ggg	p.R354G	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	354					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						CTTTGACTTCAGGCCCTCCCT	0.458													ENSG00000138459																																					0													68.0	68.0	68.0					3																	112300024		2203	4299	6502	SO:0001583	missense	0			-	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.1060A>G	3.37:g.112300024A>G	ENSP00000417654:p.Arg354Gly		D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Splice_Site	SNP	-	e6-2	ENST00000492406.1	37	c.590-2	CCDS2967.1	3	.	.	.	.	.	.	.	.	.	.	A	17.07	3.294178	0.60086	.	.	ENSG00000138459	ENST00000492406	T	0.45668	0.89	5.77	4.6	0.57074	.	0.282543	0.46145	D	0.000309	T	0.39064	0.1064	M	0.64997	1.995	0.41381	D	0.987555	P	0.38677	0.642	B	0.34418	0.182	T	0.24190	-1.0167	9	.	.	.	-2.2642	13.3771	0.60745	0.8685:0.1315:0.0:0.0	.	354	Q9BS91	S35A5_HUMAN	G	354	ENSP00000417654:R354G	.	R	+	1	2	SLC35A5	113782714	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.060000	0.64312	1.093000	0.41377	0.477000	0.44152	AGG	-	SLC35A5	-	-		0.458	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A5	HGNC	protein_coding	OTTHUMT00000354184.1	0	0	1	39	39	116	0.00	0.85	A	NM_017945		112300024	+1	6	18	20	50	tier1	no_errors	ENST00000261034	ensembl	human	known	74_37	splice_site	23.08	26.47	SNP	0.998	G	6	20
RAI1	10743	genome.wustl.edu	37	17	17682439	17682442	+	Intron	DEL	ACAC	ACAC	-			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	ACAC	ACAC	ACAC	-	ACAC	ACAC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr17:17682439_17682442delACAC	ENST00000353383.1	+	3	453				SMCR5_ENST00000543475.1_RNA|RP1-253P7.1_ENST00000583598.1_RNA	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1						circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GTCCATTCAGACACAAGACAAGGC	0.549													ENSG00000226746																																					0																																										SO:0001627	intron_variant	0				AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.-16-13805ACAC>-	17.37:g.17682439_17682442delACAC			Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	R	DEL	-	NULL	ENST00000353383.1	37	NULL	CCDS11188.1	17																																																																																				SMCR5	-	-		0.549	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR5	HGNC	protein_coding	OTTHUMT00000131775.1	0	0	0	45	45	107	0.00	0.00	ACAC	NM_030665		17682442	-1	8	19	16	87	tier1	no_errors	ENST00000543475	ensembl	human	known	74_37	rna	33.33	17.92	DEL	0.002:0.004:0.000:0.001	-	8	16
SHROOM2	357	genome.wustl.edu	37	X	9862480	9862480	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chrX:9862480G>A	ENST00000380913.3	+	4	622	c.532G>A	c.(532-534)Gtt>Att	p.V178I		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	178					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				CTTGGGGAGCGTTGACAGCCT	0.602													ENSG00000146950																																					0													84.0	67.0	73.0					X																	9862480		2203	4300	6503	SO:0001583	missense	0			-	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.532G>A	X.37:g.9862480G>A	ENSP00000370299:p.Val178Ile		B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V178I	ENST00000380913.3	37	c.532	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	G	5.937	0.356901	0.11239	.	.	ENSG00000146950	ENST00000380913	T	0.64438	-0.1	4.21	0.732	0.18283	.	0.179093	0.46442	N	0.000291	T	0.31638	0.0803	N	0.13043	0.29	0.80722	D	1	P	0.37525	0.598	B	0.21151	0.033	T	0.04767	-1.0928	10	0.32370	T	0.25	-16.4046	6.4179	0.21728	0.7541:0.0:0.2459:0.0	.	178	Q13796	SHRM2_HUMAN	I	178	ENSP00000370299:V178I	ENSP00000370299:V178I	V	+	1	0	SHROOM2	9822480	1.000000	0.71417	0.005000	0.12908	0.069000	0.16628	2.875000	0.48491	0.142000	0.18901	-0.268000	0.10319	GTT	-	SHROOM2	-	NULL		0.602	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	0	0	0	12	12	14	0.00	0.00	G	NM_001649		9862480	+1	6	16	2	5	tier1	no_errors	ENST00000380913	ensembl	human	known	74_37	missense	75.00	76.19	SNP	0.932	A	6	2
CHM	1121	genome.wustl.edu	37	X	85282554	85282554	+	Silent	SNP	A	A	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chrX:85282554A>C	ENST00000357749.2	-	2	86	c.57T>G	c.(55-57)ccT>ccG	p.P19P	CHM_ENST00000537751.1_Intron|CHM_ENST00000467744.2_5'UTR|CHM_ENST00000358786.4_Silent_p.P19P	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	19					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TGATGGATTCAGGCAAACCTA	0.338													ENSG00000188419																																					0													69.0	61.0	64.0					X																	85282554		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.57T>G	X.37:g.85282554A>C			A1L4D2|O43732	Silent	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.P19	ENST00000357749.2	37	c.57	CCDS14454.1	X																																																																																			-	CHM	-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_GDP_dissociation_inhibitor		0.338	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	0	0	0	141	141	24	0.00	0.00	A	NM_000390		85282554	-1	67	14	11	3	tier1	no_errors	ENST00000357749	ensembl	human	known	74_37	silent	85.90	82.35	SNP	1.000	C	67	11
ZNF853	54753	genome.wustl.edu	37	7	6661387	6661389	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr7:6661387_6661389delGCA	ENST00000457543.3	+	3	1323_1325	c.765_767delGCA	c.(763-768)ttgcag>ttg	p.Q259del		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	259	Gln-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						agcaactgttgcagcagcagcag	0.537													ENSG00000236609																																					0																																										SO:0001651	inframe_deletion	0				AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.765_767delGCA	7.37:g.6661396_6661398delGCA	ENSP00000455585:p.Gln259del			In_Frame_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q259in_frame_del	ENST00000457543.3	37	c.765_767	CCDS59048.1	7																																																																																				ZNF853	-	NULL		0.537	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF853	HGNC	protein_coding	OTTHUMT00000324169.2	0	0	0	47	47	16	0.00	0.00	GCA	NM_017560		6661389	+1	2	0	21	7	tier1	no_errors	ENST00000457543	ensembl	human	known	74_37	in_frame_del	8.70	0.00	DEL	0.002:0.000:0.000	-	2	21
MUC4	4585	genome.wustl.edu	37	3	195515372	195515372	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr3:195515372C>T	ENST00000463781.3	-	2	3538	c.3079G>A	c.(3079-3081)Gtc>Atc	p.V1027I	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V1027I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	459	Repeat.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S1013_T1028delSPSSVSTGHTTPLPVT(4)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGTCGGTGACAGGAAGAGGG	0.567													ENSG00000145113																																					4	Deletion - In frame(4)	stomach(4)											49.0	25.0	32.0					3																	195515372		692	1590	2282	SO:0001583	missense	0			-	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3079G>A	3.37:g.195515372C>T	ENSP00000417498:p.Val1027Ile		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V1027I	ENST00000463781.3	37	c.3079	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	0.325	-0.959577	0.02267	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.40756	1.02;1.03	1.0	-2.01	0.07410	.	.	.	.	.	T	0.19725	0.0474	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.15896	-1.0421	8	.	.	.	.	0.4901	0.00562	0.1801:0.2589:0.1806:0.3804	.	1027	E7ESK3	.	I	1027	ENSP00000417498:V1027I;ENSP00000420243:V1027I	.	V	-	1	0	MUC4	196999767	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.881000	0.01626	-2.293000	0.00664	0.064000	0.15345	GTC	-	MUC4	-	NULL		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	86	86	2	0.00	0.00	C	NM_018406		195515372	-1	4	0	37	1	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	9.76	0.00	SNP	0.000	T	4	37
CLVS1	157807	genome.wustl.edu	37	8	62412295	62412295	+	3'UTR	DEL	T	T	-			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr8:62412295delT	ENST00000519846.1	+	0	1731				CLVS1_ENST00000325897.4_3'UTR|CLVS1_ENST00000518858.1_3'UTR|CLVS1_ENST00000518592.1_3'UTR			Q8IUQ0	CLVS1_HUMAN	clavesin 1						lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						TGAGAGATGCTTTTTTTTTCC	0.438													ENSG00000177182																																					0																																										SO:0001624	3_prime_UTR_variant	0				AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.*194T>-	8.37:g.62412295delT			B2R7M5|C8UZT3|Q8NB32	R	DEL	-	NULL	ENST00000519846.1	37	NULL	CCDS6176.1	8																																																																																				CLVS1	-	-		0.438	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLVS1	HGNC	protein_coding	OTTHUMT00000378323.1	0	0	0	48	48	79	0.00	0.00	T	NM_173519		62412295	+1	2	2	23	65	tier1	no_errors	ENST00000518858	ensembl	human	known	74_37	rna	8.00	2.99	DEL	0.005	-	2	23
