#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
CA4	762	genome.wustl.edu	37	17	58235772	58235772	+	Missense_Mutation	SNP	G	G	A	rs2229178	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr17:58235772G>A	ENST00000300900.4	+	7	808	c.709G>A	c.(709-711)Gtg>Atg	p.V237M		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	237			V -> L (in dbSNP:rs2229178).		bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	CGTCTGGACTGTGTTCCGGGA	0.602													ENSG00000167434																																					0													80.0	67.0	72.0					17																	58235772		2203	4300	6503	SO:0001583	missense	0			-	L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.709G>A	17.37:g.58235772G>A	ENSP00000300900:p.Val237Met		B4DQA4|Q6FHI7	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.V237M	ENST00000300900.4	37	c.709	CCDS11624.1	17	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316565	0.60524	.	.	ENSG00000167434	ENST00000300900	T	0.80738	-1.41	5.54	5.54	0.83059	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.202895	0.43110	D	0.000602	D	0.91805	0.7407	M	0.92219	3.285	0.51233	D	0.999916	D	0.89917	1.0	D	0.97110	1.0	D	0.93375	0.6738	10	0.87932	D	0	.	14.9783	0.71293	0.0:0.0:1.0:0.0	.	237	P22748	CAH4_HUMAN	M	237	ENSP00000300900:V237M	ENSP00000300900:V237M	V	+	1	0	CA4	55590554	0.982000	0.34865	0.961000	0.40146	0.495000	0.33615	1.752000	0.38349	2.589000	0.87451	0.491000	0.48974	GTG	-	CA4	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.602	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA4	HGNC	protein_coding	OTTHUMT00000449189.1	0	0	0	24	24	76	0.00	0.00	G	NM_000717		58235772	+1	10	30	46	123	tier1	no_errors	ENST00000300900	ensembl	human	known	74_37	missense	17.86	19.48	SNP	0.977	A	10	46
TRHDE	29953	genome.wustl.edu	37	12	73050729	73050729	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr12:73050729A>G	ENST00000261180.4	+	18	2968	c.2872A>G	c.(2872-2874)Aat>Gat	p.N958D		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	958				N -> Y (in Ref. 2; AAQ89125). {ECO:0000305}.	cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ATTGTTTATGAATTCCAAACT	0.264													ENSG00000072657																																					0													83.0	93.0	89.0					12																	73050729		2203	4298	6501	SO:0001583	missense	0			-	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2872A>G	12.37:g.73050729A>G	ENSP00000261180:p.Asn958Asp		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.N958D	ENST00000261180.4	37	c.2872	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	A	23.6	4.437620	0.83885	.	.	ENSG00000072657	ENST00000261180	T	0.05199	3.48	5.2	5.2	0.72013	.	0.048592	0.85682	D	0.000000	T	0.17365	0.0417	L	0.44542	1.39	0.58432	D	0.999999	D	0.64830	0.994	D	0.64506	0.926	T	0.00357	-1.1792	10	0.72032	D	0.01	.	15.3904	0.74739	1.0:0.0:0.0:0.0	.	958	Q9UKU6	TRHDE_HUMAN	D	958	ENSP00000261180:N958D	ENSP00000261180:N958D	N	+	1	0	TRHDE	71336996	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.910000	0.92685	2.090000	0.63153	0.460000	0.39030	AAT	-	TRHDE	-	NULL		0.264	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	0	0	0	158	158	47	0.00	0.00	A	NM_013381		73050729	+1	15	7	91	46	tier1	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	14.15	13.21	SNP	1.000	G	15	91
DPY19L3	147991	genome.wustl.edu	37	19	32899229	32899229	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:32899229G>C	ENST00000342179.5	+	2	285	c.70G>C	c.(70-72)Gaa>Caa	p.E24Q	DPY19L3_ENST00000587077.2_Missense_Mutation_p.E24Q|DPY19L3_ENST00000586987.1_Missense_Mutation_p.E24Q|AC007773.2_ENST00000595727.1_RNA|DPY19L3_ENST00000392250.2_Missense_Mutation_p.E24Q|AC007773.2_ENST00000592680.2_RNA	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	24						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					AGCCCAAGAAGAAAATGTGAA	0.373													ENSG00000178904																																					0													84.0	84.0	84.0					19																	32899229		2203	4300	6503	SO:0001583	missense	0			-		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.70G>C	19.37:g.32899229G>C	ENSP00000344937:p.Glu24Gln		Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	pfam_Dpy-19	p.E24Q	ENST00000342179.5	37	c.70	CCDS12422.1	19	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332548	0.41297	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179;ENST00000392248	T;T	0.60548	0.18;0.18	5.42	4.38	0.52667	.	0.192982	0.39210	N	0.001425	T	0.39708	0.1088	N	0.24115	0.695	0.24569	N	0.993933	B;P	0.41848	0.001;0.763	B;B	0.39027	0.004;0.288	T	0.26643	-1.0097	10	0.29301	T	0.29	-12.6132	9.4152	0.38517	0.0955:0.0:0.9045:0.0	.	24;24	Q6ZPD9;Q8N6Q4	D19L3_HUMAN;.	Q	24	ENSP00000376081:E24Q;ENSP00000344937:E24Q	ENSP00000315672:E24Q	E	+	1	0	DPY19L3	37591069	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.834000	0.48167	2.689000	0.91719	0.650000	0.86243	GAA	-	DPY19L3	-	NULL		0.373	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	HGNC	protein_coding	OTTHUMT00000450311.1	0	0	1	115	115	60	0.00	1.64	G	NM_207325		32899229	+1	38	40	132	98	tier1	no_errors	ENST00000342179	ensembl	human	known	74_37	missense	22.22	28.99	SNP	1.000	C	38	132
LRRIQ1	84125	genome.wustl.edu	37	12	85546891	85546891	+	Silent	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr12:85546891G>A	ENST00000393217.2	+	21	4570	c.4509G>A	c.(4507-4509)ttG>ttA	p.L1503L		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1503										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAGAAAATTTGTCTTCTTCAG	0.303													ENSG00000133640																																					0													91.0	87.0	88.0					12																	85546891		1827	4066	5893	SO:0001819	synonymous_variant	0			-	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4509G>A	12.37:g.85546891G>A			Q567P4|Q9BS17|Q9HA36	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.L1503	ENST00000393217.2	37	c.4509	CCDS41816.1	12																																																																																			-	LRRIQ1	-	NULL		0.303	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	0	0	0	153	153	64	0.00	0.00	G	NM_032165		85546891	+1	1029	471	57	52	tier1	no_errors	ENST00000393217	ensembl	human	known	74_37	silent	94.66	90.06	SNP	0.018	A	1029	57
MPZL1	9019	genome.wustl.edu	37	1	167757562	167757562	+	3'UTR	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:167757562G>A	ENST00000359523.2	+	0	1416				MPZL1_ENST00000403379.3_3'UTR|MPZL1_ENST00000392121.3_3'UTR	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1						cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					GCTTAAGACTGATTAGTCTTA	0.403													ENSG00000197965																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.*404G>A	1.37:g.167757562G>A			B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	R	SNP	-	NULL	ENST00000359523.2	37	NULL	CCDS1264.1	1																																																																																			-	MPZL1	-	-		0.403	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPZL1	HGNC	protein_coding	OTTHUMT00000083655.2	0	0	0	53	53	63	0.00	0.00	G	NM_024569		167757562	+1	81	97	53	59	tier1	no_errors	ENST00000403379	ensembl	human	putative	74_37	rna	60.00	62.18	SNP	0.359	A	81	53
EPHA1	2041	genome.wustl.edu	37	7	143095499	143095499	+	Missense_Mutation	SNP	G	G	A	rs202178565		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:143095499G>A	ENST00000275815.3	-	7	1465	c.1379C>T	c.(1378-1380)cCg>cTg	p.P460L		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	460	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TAGTTGCCTCGGTTCTTTCTT	0.552													ENSG00000146904																																					0													53.0	56.0	55.0					7																	143095499		2203	4300	6503	SO:0001583	missense	0			-	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1379C>T	7.37:g.143095499G>A	ENSP00000275815:p.Pro460Leu		A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.P460L	ENST00000275815.3	37	c.1379	CCDS5884.1	7	.	.	.	.	.	.	.	.	.	.	G	15.57	2.871811	0.51695	.	.	ENSG00000146904	ENST00000275815	T	0.58506	0.33	5.08	5.08	0.68730	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.232852	0.30840	N	0.008774	T	0.69477	0.3115	M	0.65498	2.005	0.40858	D	0.983818	D	0.76494	0.999	P	0.62089	0.898	T	0.70583	-0.4832	10	0.44086	T	0.13	.	12.122	0.53897	0.0:0.173:0.827:0.0	.	460	P21709	EPHA1_HUMAN	L	460	ENSP00000275815:P460L	ENSP00000275815:P460L	P	-	2	0	EPHA1	142805621	0.062000	0.20869	0.914000	0.36105	0.937000	0.57800	1.072000	0.30678	2.517000	0.84864	0.655000	0.94253	CCG	rs202178565	EPHA1	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.552	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	HGNC	protein_coding	OTTHUMT00000342154.1	0	0	0	57	57	50	0.00	0.00	G			143095499	-1	11	20	25	32	tier1	no_errors	ENST00000275815	ensembl	human	known	74_37	missense	30.56	38.46	SNP	0.686	A	11	25
APBA1	320	genome.wustl.edu	37	9	72071280	72071280	+	Silent	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:72071280C>T	ENST00000265381.4	-	8	1893	c.1671G>A	c.(1669-1671)ctG>ctA	p.L557L	APBA1_ENST00000470082.1_5'UTR	NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	557	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GGCGGGCCATCAGCACAACGA	0.582													ENSG00000107282																																					0													247.0	231.0	237.0					9																	72071280		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1671G>A	9.37:g.72071280C>T			O14914|O60570|Q5VYR8	Silent	SNP	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.L557	ENST00000265381.4	37	c.1671	CCDS6630.1	9																																																																																			-	APBA1	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.582	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	HGNC	protein_coding	OTTHUMT00000052589.2	0	0	0	77	77	55	0.00	0.00	C	NM_001163		72071280	-1	21	22	34	36	tier1	no_errors	ENST00000265381	ensembl	human	known	74_37	silent	38.18	37.93	SNP	0.998	T	21	34
SLC16A10	117247	genome.wustl.edu	37	6	111498746	111498746	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr6:111498746A>C	ENST00000368851.5	+	3	995	c.820A>C	c.(820-822)Aaa>Caa	p.K274Q	SLC16A10_ENST00000465319.1_3'UTR|SLC16A10_ENST00000368850.3_5'UTR	NM_018593.4	NP_061063.2	Q8TF71	MOT10_HUMAN	solute carrier family 16 (aromatic amino acid transporter), member 10	274					amino acid transport (GO:0006865)|aromatic amino acid transport (GO:0015801)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)	12		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)	Droxidopa(DB06262)|Glycine(DB00145)|L-Alanine(DB00160)|L-Arginine(DB00125)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Cystine(DB00138)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Histidine(DB00117)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Lysine(DB00123)|L-Methionine(DB00134)|L-Phenylalanine(DB00120)|L-Proline(DB00172)|L-Serine(DB00133)|L-Threonine(DB00156)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|L-Valine(DB00161)|Liothyronine(DB00279)|Liotrix(DB01583)|Pyruvic acid(DB00119)	CTTTTCCAGGAAAAAGTTCAG	0.428													ENSG00000112394																																					0													60.0	62.0	61.0					6																	111498746		2203	4300	6503	SO:0001583	missense	0			-	AF116652	CCDS5089.1	6q21-q22	2014-01-28	2013-07-18		ENSG00000112394	ENSG00000112394		"""Solute carriers"""	17027	protein-coding gene	gene with protein product		607550	"""solute carrier family 16 (monocarboxylic acid transporters), member 10"""			11278508, 11827462	Standard	NM_018593		Approved	TAT1, MCT10	uc003pus.3	Q8TF71	OTTHUMG00000015371	ENST00000368851.5:c.820A>C	6.37:g.111498746A>C	ENSP00000357844:p.Lys274Gln		B3KWY0|Q6ZMG0|Q8WVI5	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.K274Q	ENST00000368851.5	37	c.820	CCDS5089.1	6	.	.	.	.	.	.	.	.	.	.	A	11.85	1.761923	0.31228	.	.	ENSG00000112394	ENST00000535637;ENST00000368851;ENST00000368853	T	0.61859	0.07	5.21	2.69	0.31865	Major facilitator superfamily domain, general substrate transporter (1);	3.694310	0.00682	N	0.000697	T	0.10852	0.0265	N	0.00926	-1.1	0.80722	D	1	B;B	0.20887	0.001;0.049	B;B	0.22152	0.007;0.038	T	0.32161	-0.9917	10	0.10636	T	0.68	.	7.5221	0.27635	0.5653:0.0:0.4347:0.0	.	274;274	Q8TF71;Q05BR4	MOT10_HUMAN;.	Q	274;274;165	ENSP00000357844:K274Q	ENSP00000357844:K274Q	K	+	1	0	SLC16A10	111605439	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	2.690000	0.47001	0.342000	0.23796	0.460000	0.39030	AAA	-	SLC16A10	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.428	SLC16A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A10	HGNC	protein_coding	OTTHUMT00000041822.2	0	0	0	20	20	54	0.00	0.00	A			111498746	+1	8	46	14	34	tier1	no_errors	ENST00000368851	ensembl	human	known	74_37	missense	36.36	56.79	SNP	1.000	C	8	14
ERBB3	2065	genome.wustl.edu	37	12	56486837	56486837	+	Silent	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr12:56486837C>T	ENST00000267101.3	+	11	1691	c.1251C>T	c.(1249-1251)acC>acT	p.T417T	ERBB3_ENST00000553131.1_5'Flank|ERBB3_ENST00000415288.2_Silent_p.T358T|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	417					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ATTTGACAACCATTGGAGGCA	0.473													ENSG00000065361																																					0													71.0	70.0	71.0					12																	56486837		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1251C>T	12.37:g.56486837C>T			A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T417	ENST00000267101.3	37	c.1251	CCDS31833.1	12																																																																																			-	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L		0.473	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	0	0	0	66	66	82	0.00	0.00	C			56486837	+1	21	26	26	42	tier1	no_errors	ENST00000267101	ensembl	human	known	74_37	silent	43.75	38.24	SNP	1.000	T	21	26
COL21A1	81578	genome.wustl.edu	37	6	55956320	55956320	+	Intron	SNP	T	T	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr6:55956320T>C	ENST00000244728.5	-	17	2210				COL21A1_ENST00000535941.1_Intron|COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370819.1_Intron	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			AAACACGGCATTCTTTTTCTC	0.438													ENSG00000124749																																					0																																										SO:0001627	intron_variant	0			-	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1812+9949A>G	6.37:g.55956320T>C			A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	R	SNP	-	NULL	ENST00000244728.5	37	NULL	CCDS55025.1	6																																																																																			-	COL21A1	-	-		0.438	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	HGNC	protein_coding	OTTHUMT00000041004.2	0	0	0	35	35	62	0.00	0.00	T			55956320	-1	13	28	20	58	tier1	no_errors	ENST00000467045	ensembl	human	known	74_37	rna	39.39	32.56	SNP	0.001	C	13	20
STEAP2	261729	genome.wustl.edu	37	7	89854616	89854616	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:89854616G>T	ENST00000287908.3	+	2	613	c.220G>T	c.(220-222)Gta>Tta	p.V74L	STEAP2_ENST00000394621.2_Missense_Mutation_p.V74L|STEAP2_ENST00000394622.2_Missense_Mutation_p.V74L|STEAP2_ENST00000394632.1_Missense_Mutation_p.V74L|STEAP2_ENST00000394629.2_Missense_Mutation_p.V74L|STEAP2_ENST00000394626.1_Missense_Mutation_p.V74L|STEAP2_ENST00000402625.2_Missense_Mutation_p.V74L	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	74					copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					TCCTCATGTGGTAGATGTCAC	0.378													ENSG00000157214																																					0													185.0	165.0	172.0					7																	89854616		2203	4300	6503	SO:0001583	missense	0			-	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.220G>T	7.37:g.89854616G>T	ENSP00000287908:p.Val74Leu		A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.V74L	ENST00000287908.3	37	c.220	CCDS5615.1	7	.	.	.	.	.	.	.	.	.	.	G	31	5.096264	0.94197	.	.	ENSG00000157214	ENST00000428074;ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000426158;ENST00000394621;ENST00000402625;ENST00000394629	T;T;T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.83	5.83	0.93111	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.62624	0.2443	L	0.51914	1.62	0.58432	D	0.999995	D;D;D;D	0.54397	0.958;0.966;0.964;0.964	P;P;P;P	0.58820	0.763;0.846;0.783;0.783	T	0.62067	-0.6932	10	0.66056	D	0.02	-19.5146	20.1338	0.98010	0.0:0.0:1.0:0.0	.	74;74;74;74	G5E9C6;Q6YPB2;Q8NFT2;B5MC02	.;.;STEA2_HUMAN;.	L	74	ENSP00000401783:V74L;ENSP00000287908:V74L;ENSP00000378123:V74L;ENSP00000378120:V74L;ENSP00000378128:V74L;ENSP00000415931:V74L;ENSP00000378119:V74L;ENSP00000384191:V74L;ENSP00000378125:V74L	ENSP00000287908:V74L	V	+	1	0	STEAP2	89692552	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.325000	0.72901	2.770000	0.95276	0.655000	0.94253	GTA	-	STEAP2	-	NULL		0.378	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP2	HGNC	protein_coding	OTTHUMT00000059662.4	0	0	0	53	53	74	0.00	0.00	G	NM_152999		89854616	+1	21	19	25	40	tier1	no_errors	ENST00000287908	ensembl	human	known	74_37	missense	45.65	32.20	SNP	1.000	T	21	25
SALL2	6297	genome.wustl.edu	37	14	21992685	21992685	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr14:21992685G>A	ENST00000327430.3	-	2	1471	c.1177C>T	c.(1177-1179)Cgt>Tgt	p.R393C	SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Missense_Mutation_p.R256C	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R393C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GTGTGGGAACGAAGGTGGATC	0.542													ENSG00000165821																																					1	Substitution - Missense(1)	large_intestine(1)											110.0	97.0	102.0					14																	21992685		2203	4300	6503	SO:0001583	missense	0			-	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.1177C>T	14.37:g.21992685G>A	ENSP00000333537:p.Arg393Cys		B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R393C	ENST00000327430.3	37	c.1177	CCDS32045.1	14	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174268	0.57692	.	.	ENSG00000165821	ENST00000327430;ENST00000450879;ENST00000541876	T;T	0.25749	1.78;1.78	4.3	3.42	0.39159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38605	N	0.001638	T	0.46756	0.1409	M	0.72894	2.215	0.80722	D	1	D;D;B;D	0.89917	1.0;1.0;0.358;1.0	D;D;B;D	0.87578	0.995;0.995;0.111;0.998	T	0.45731	-0.9241	10	0.87932	D	0	-24.515	9.89	0.41285	0.1005:0.0:0.8995:0.0	.	256;256;391;393	B4DK65;E7EW59;B4DFD9;Q9Y467	.;.;.;SALL2_HUMAN	C	393;256;393	ENSP00000333537:R393C;ENSP00000396773:R256C	ENSP00000333537:R393C	R	-	1	0	SALL2	21062525	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.657000	0.98554	1.031000	0.39867	-0.136000	0.14681	CGT	-	SALL2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.542	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL2	HGNC	protein_coding	OTTHUMT00000401242.1	0	0	0	22	22	86	0.00	0.00	G	NM_005407		21992685	-1	12	30	17	43	tier1	no_errors	ENST00000327430	ensembl	human	known	74_37	missense	41.38	41.10	SNP	1.000	A	12	17
MEI1	150365	genome.wustl.edu	37	22	42166717	42166717	+	Silent	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr22:42166717C>T	ENST00000401548.3	+	20	2336	c.2296C>T	c.(2296-2298)Cta>Tta	p.L766L	MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000400107.1_Silent_p.L134L|MEI1_ENST00000540880.1_Silent_p.L84L	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CAGAAAATTCCTAGAAGGCAT	0.493													ENSG00000167077																																					0													70.0	66.0	67.0					22																	42166717		1930	4132	6062	SO:0001819	synonymous_variant	0			-	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.2296C>T	22.37:g.42166717C>T				Silent	SNP	superfamily_ARM-type_fold	p.L766	ENST00000401548.3	37	c.2296	CCDS46718.1	22																																																																																			-	MEI1	-	superfamily_ARM-type_fold		0.493	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	HGNC	protein_coding	OTTHUMT00000074937.3	0	0	0	14	14	84	0.00	0.00	C	NM_152513		42166717	+1	6	42	4	12	tier1	no_errors	ENST00000401548	ensembl	human	known	74_37	silent	60.00	76.36	SNP	0.972	T	6	4
MECR	51102	genome.wustl.edu	37	1	29542523	29542523	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:29542523C>T	ENST00000263702.6	-	3	425	c.400G>A	c.(400-402)Ggt>Agt	p.G134S	MECR_ENST00000489248.1_5'UTR|MECR_ENST00000373791.3_Missense_Mutation_p.G58S			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	134					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		TCACCTAAACCAGCATTTGCT	0.557													ENSG00000116353																																					0													106.0	98.0	101.0					1																	29542523		2203	4300	6503	SO:0001583	missense	0			-		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.400G>A	1.37:g.29542523C>T	ENSP00000263702:p.Gly134Ser		B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.G134S	ENST00000263702.6	37	c.400	CCDS30659.1	1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159303	0.78226	.	.	ENSG00000116353	ENST00000373791;ENST00000263702;ENST00000373792	T;T	0.40476	1.03;1.03	5.53	5.53	0.82687	GroES-like (1);	0.261642	0.43579	D	0.000560	T	0.38241	0.1033	L	0.37561	1.115	0.80722	D	1	B	0.14438	0.01	B	0.24269	0.052	T	0.11616	-1.0580	10	0.44086	T	0.13	.	16.963	0.86278	0.0:1.0:0.0:0.0	.	134	Q9BV79	MECR_HUMAN	S	58;134;46	ENSP00000362896:G58S;ENSP00000263702:G134S	ENSP00000263702:G134S	G	-	1	0	MECR	29415110	1.000000	0.71417	0.956000	0.39512	0.982000	0.71751	5.261000	0.65496	2.617000	0.88574	0.549000	0.68633	GGT	-	MECR	-	superfamily_GroES-like,smart_PKS_ER		0.557	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECR	HGNC	protein_coding	OTTHUMT00000130740.1	0	0	0	45	45	91	0.00	0.00	C	NM_016011		29542523	-1	13	40	18	57	tier1	no_errors	ENST00000263702	ensembl	human	known	74_37	missense	41.94	41.24	SNP	1.000	T	13	18
LILRA1	11024	genome.wustl.edu	37	19	55106778	55106778	+	Missense_Mutation	SNP	G	G	T	rs10418391	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:55106778G>T	ENST00000251372.3	+	5	754	c.572G>T	c.(571-573)cGc>cTc	p.R191L	LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000453777.1_Missense_Mutation_p.R191L|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	191	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGCCCGAGTCGCAGGTGGTCG	0.572													ENSG00000104974																																					0													152.0	157.0	156.0					19																	55106778		2203	4300	6503	SO:0001583	missense	0			-	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.572G>T	19.37:g.55106778G>T	ENSP00000251372:p.Arg191Leu		O75018|Q3MJA6	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.R191L	ENST00000251372.3	37	c.572	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	G	10.24	1.294833	0.23564	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.02974	4.09;4.09	2.24	-0.33	0.12683	Immunoglobulin-like fold (1);	1.389240	0.04584	N	0.395426	T	0.03390	0.0098	L	0.37850	1.14	0.09310	N	1	P;B	0.42375	0.778;0.001	B;B	0.43251	0.413;0.002	T	0.32241	-0.9914	10	0.42905	T	0.14	.	2.0528	0.03574	0.5644:0.0:0.1783:0.2573	.	191;191	O75019-2;O75019	.;LIRA1_HUMAN	L	191	ENSP00000251372:R191L;ENSP00000413715:R191L	ENSP00000251372:R191L	R	+	2	0	LILRA1	59798590	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.058000	0.11750	-0.319000	0.08652	0.194000	0.17425	CGC	-	LILRA1	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt		0.572	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	HGNC	protein_coding	OTTHUMT00000140807.2	0	0	0	82	82	25	0.00	0.00	G	NM_006863		55106778	+1	17	10	19	30	tier1	no_errors	ENST00000251372	ensembl	human	known	74_37	missense	45.95	25.00	SNP	0.000	T	17	19
LNPEP	4012	genome.wustl.edu	37	5	96358015	96358015	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr5:96358015T>G	ENST00000231368.5	+	14	3080	c.2388T>G	c.(2386-2388)ttT>ttG	p.F796L	LNPEP_ENST00000395770.3_Missense_Mutation_p.F782L	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	796					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CTAGGGTATTTAAATTACTTC	0.403													ENSG00000113441																																					0													56.0	57.0	57.0					5																	96358015		2203	4300	6503	SO:0001583	missense	0			-	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2388T>G	5.37:g.96358015T>G	ENSP00000231368:p.Phe796Leu		O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.F796L	ENST00000231368.5	37	c.2388	CCDS4087.1	5	.	.	.	.	.	.	.	.	.	.	T	0.489	-0.876381	0.02550	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.04454	3.62;3.62	5.6	1.85	0.25348	.	0.735084	0.14162	N	0.337287	T	0.00967	0.0032	N	0.00377	-1.585	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47586	-0.9106	10	0.05833	T	0.94	.	2.8149	0.05453	0.2622:0.2502:0.0:0.4876	.	796	Q9UIQ6	LCAP_HUMAN	L	796;782	ENSP00000231368:F796L;ENSP00000379117:F782L	ENSP00000231368:F796L	F	+	3	2	LNPEP	96383771	0.001000	0.12720	0.996000	0.52242	0.486000	0.33341	-0.211000	0.09332	1.066000	0.40716	0.533000	0.62120	TTT	-	LNPEP	-	NULL		0.403	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNPEP	HGNC	protein_coding	OTTHUMT00000250624.1	0	0	0	52	52	37	0.00	0.00	T	NM_005575		96358015	+1	11	15	27	39	tier1	no_errors	ENST00000231368	ensembl	human	known	74_37	missense	28.95	27.78	SNP	0.121	G	11	27
RUNX3	864	genome.wustl.edu	37	1	25291022	25291022	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:25291022G>T	ENST00000338888.3	-	2	286	c.41C>A	c.(40-42)tCg>tAg	p.S14*	RP11-84D1.1_ENST00000456316.1_RNA|RUNX3_ENST00000399916.1_Nonsense_Mutation_p.S14*			Q13761	RUNX3_HUMAN	runt-related transcription factor 3	0					axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GAAGGTCGGCGAGTAGGTCGG	0.627													ENSG00000020633																																					0													63.0	51.0	55.0					1																	25291022		2202	4300	6502	SO:0001587	stop_gained	0			-	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000338888.3:c.41C>A	1.37:g.25291022G>T	ENSP00000343477:p.Ser14*		B1AJV5|Q12969|Q13760	Nonsense_Mutation	SNP	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_D-bd,pirsf_TF_Runt-rel_RUNX,pfscan_Runt_dom,prints_AML1_Runt	p.S14*	ENST00000338888.3	37	c.41	CCDS30633.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.902034	0.97920	.	.	ENSG00000020633	ENST00000399916;ENST00000338888	.	.	.	5.67	5.67	0.87782	.	0.738391	0.11146	N	0.594662	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-1.2643	15.2825	0.73797	0.0:0.0:1.0:0.0	.	.	.	.	X	14	.	ENSP00000343477:S14X	S	-	2	0	RUNX3	25163609	1.000000	0.71417	0.996000	0.52242	0.491000	0.33493	5.755000	0.68750	2.677000	0.91161	0.561000	0.74099	TCG	-	RUNX3	-	pirsf_TF_Runt-rel_RUNX		0.627	RUNX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX3	HGNC	protein_coding	OTTHUMT00000009285.1	0	0	0	80	80	54	0.00	0.00	G	NM_004350		25291022	-1	31	16	71	33	tier1	no_errors	ENST00000338888	ensembl	human	known	74_37	nonsense	30.39	32.65	SNP	0.965	T	31	71
TUBE1	51175	genome.wustl.edu	37	6	112406880	112406880	+	Intron	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr6:112406880C>T	ENST00000368662.5	-	3	231				FAM229B_ENST00000368656.2_5'Flank|FAM229B_ENST00000604268.1_5'Flank|TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1						centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	taactaacttcctttggtctg	0.333													ENSG00000074935																																					0																																										SO:0001627	intron_variant	0			-	AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.152+878G>A	6.37:g.112406880C>T			Q5H8W8|Q8NEG3	R	SNP	-	NULL	ENST00000368662.5	37	NULL	CCDS5100.1	6																																																																																			-	TUBE1	-	-		0.333	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBE1	HGNC	protein_coding	OTTHUMT00000041867.1	0	0	0	76	76	68	0.00	0.00	C	NM_016262		112406880	-1	13	18	36	49	tier1	no_errors	ENST00000441191	ensembl	human	known	74_37	rna	26.53	26.87	SNP	0.000	T	13	36
THRB	7068	genome.wustl.edu	37	3	24169081	24169081	+	Silent	SNP	G	G	A	rs115445992	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:24169081G>A	ENST00000356447.4	-	9	1337	c.1053C>T	c.(1051-1053)gaC>gaT	p.D351D	THRB_ENST00000396671.2_Silent_p.D351D|THRB_ENST00000416420.1_Silent_p.D351D|THRB_ENST00000280696.5_Silent_p.D366D	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	351	Interaction with NR2F6.|Ligand-binding.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CAAAGATGGCGTCTGACACCA	0.532													ENSG00000151090	G|||	3	0.000599042	0.0	0.0014	5008	,	,		18935	0.002		0.0	False		,,,				2504	0.0				Melanoma(21;896 1043 15021 37958)												0								G	,,	1,4405	2.1+/-5.4	0,1,2202	144.0	133.0	136.0		1053,1053,1053	-6.5	0.8	3	dbSNP_132	136	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	THRB	NM_000461.4,NM_001128176.1,NM_001128177.1	,,	0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308	,,	351/462,351/462,351/462	24169081	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.1053C>T	3.37:g.24169081G>A			B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.D351	ENST00000356447.4	37	c.1053	CCDS2641.1	3																																																																																			rs115445992	THRB	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.532	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	THRB	HGNC	protein_coding	OTTHUMT00000252877.3	0	0	0	100	100	119	0.00	0.00	G	NM_000461		24169081	-1	45	53	61	66	tier1	no_errors	ENST00000356447	ensembl	human	known	74_37	silent	42.45	44.54	SNP	0.894	A	45	61
ARHGEF11	9826	genome.wustl.edu	37	1	156917189	156917189	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:156917189T>C	ENST00000361409.2	-	25	3017	c.2275A>G	c.(2275-2277)Atc>Gtc	p.I759V	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.I799V|ARHGEF11_ENST00000487682.1_5'Flank|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.I175V	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	759	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGGTAGAAGATCAGGTCCAGG	0.562													ENSG00000132694																																					0													45.0	50.0	49.0					1																	156917189		2203	4300	6503	SO:0001583	missense	0			-	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2275A>G	1.37:g.156917189T>C	ENSP00000354644:p.Ile759Val		D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,pfam_RGS_dom,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal_superfam,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_DH-domain	p.I799V	ENST00000361409.2	37	c.2395	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	T	0.020	-1.438214	0.01098	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.65916	-0.18;-0.18;-0.18	5.44	5.44	0.79542	Dbl homology (DH) domain (5);	0.111649	0.40222	N	0.001156	T	0.11067	0.0270	N	0.01473	-0.845	0.31576	N	0.655742	B;B;B	0.19935	0.04;0.018;0.003	B;B;B	0.24974	0.057;0.03;0.012	T	0.21008	-1.0258	10	0.02654	T	1	-18.4605	7.0627	0.25135	0.0:0.0771:0.1505:0.7724	.	175;759;799	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	V	799;759;175	ENSP00000357177:I799V;ENSP00000354644:I759V;ENSP00000313470:I175V	ENSP00000313470:I175V	I	-	1	0	ARHGEF11	155183813	0.390000	0.25213	0.997000	0.53966	0.138000	0.21146	0.797000	0.26999	2.278000	0.76064	0.533000	0.62120	ATC	-	ARHGEF11	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.562	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	0	0	0	32	32	66	0.00	0.00	T	NM_198236		156917189	-1	15	16	24	29	tier1	no_errors	ENST00000368194	ensembl	human	known	74_37	missense	38.46	35.56	SNP	0.675	C	15	24
APC	324	genome.wustl.edu	37	5	112116600	112116600	+	Splice_Site	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr5:112116600G>T	ENST00000457016.1	+	6	1025	c.645G>T	c.(643-645)caG>caT	p.Q215H	APC_ENST00000257430.4_Splice_Site_p.Q215H|RNU6-482P_ENST00000391068.1_RNA|APC_ENST00000508376.2_Splice_Site_p.Q215H			P25054	APC_HUMAN	adenomatous polyposis coli	215	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)			NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AACGAGCACAGGTAAGTTACT	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)			ENSG00000134982																									NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	0													53.0	52.0	53.0					5																	112116600		2202	4300	6502	SO:0001630	splice_region_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	-	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.645+1G>T	5.37:g.112116600G>T			D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q215H	ENST00000457016.1	37	c.645	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839048	0.91117	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.95281	0.8469	M	0.76328	2.33	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.73708	0.981;0.981	D	0.95405	0.8493	10	0.87932	D	0	-7.1624	19.5353	0.95251	0.0:0.0:1.0:0.0	.	217;215	Q4LE70;P25054	.;APC_HUMAN	H	215;225;215;215;215	ENSP00000413133:Q215H;ENSP00000423224:Q225H;ENSP00000257430:Q215H;ENSP00000427089:Q215H;ENSP00000423828:Q215H	ENSP00000257430:Q215H	Q	+	3	2	APC	112144499	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	8.834000	0.92094	2.607000	0.88179	0.655000	0.94253	CAG	-	APC	-	NULL		0.348	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	0	0	1	121	121	83	0.00	1.19	G	NM_000038	Missense_Mutation	112116600	+1	18	14	103	123	tier1	no_errors	ENST00000257430	ensembl	human	known	74_37	missense	14.88	10.14	SNP	1.000	T	18	103
LINC01317	104355287	genome.wustl.edu	37	2	33953017	33953017	+	lincRNA	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:33953017G>A	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							GGGACCGCATGGTGGTCGTGA	0.632													ENSG00000239649																																					0																																												0			-																													2.37:g.33953017G>A				R	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	MYADML	-	-		0.632	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1	0	0	0	28	28	24	0.00	0.00	G			33953017	-1	9	11	21	17	tier1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	30.00	39.29	SNP	0.815	A	9	21
IFT80	57560	genome.wustl.edu	37	3	160083847	160083847	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:160083847T>A	ENST00000326448.7	-	6	965	c.533A>T	c.(532-534)aAt>aTt	p.N178I	RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.N349I|IFT80_ENST00000496589.1_Missense_Mutation_p.N41I|IFT80_ENST00000483465.1_Missense_Mutation_p.N41I	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	178					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AACTTTAGCATTTGGTTGAAG	0.428													ENSG00000248710																																					0													140.0	133.0	135.0					3																	160083847		2203	4300	6503	SO:0001583	missense	0			-	AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.533A>T	3.37:g.160083847T>A	ENSP00000312778:p.Asn178Ile		B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N349I	ENST00000326448.7	37	c.1046	CCDS3188.1	3	.	.	.	.	.	.	.	.	.	.	T	18.00	3.524891	0.64747	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589;ENST00000465537;ENST00000475677;ENST00000498409;ENST00000468218	T;T;T;T;T	0.61274	1.52;5.0;5.0;1.53;0.12	5.63	4.46	0.54185	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.114051	0.36002	U	0.002856	T	0.50735	0.1633	M	0.73217	2.22	0.58432	D	0.999997	P	0.39216	0.664	B	0.31191	0.125	T	0.54323	-0.8311	10	0.66056	D	0.02	-1.1854	8.9078	0.35535	0.0:0.1443:0.0:0.8557	.	178	Q9P2H3	IFT80_HUMAN	I	178;41;41;41;41;178;41	ENSP00000312778:N178I;ENSP00000418196:N41I;ENSP00000420646:N41I;ENSP00000418602:N41I;ENSP00000420001:N178I	ENSP00000312778:N178I	N	-	2	0	IFT80	161566541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.807000	0.47955	0.951000	0.37770	0.533000	0.62120	AAT	-	RP11-432B6.3	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.428	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT80	Clone_based_vega_gene	protein_coding	OTTHUMT00000352651.2	0	0	0	88	88	60	0.00	0.00	T	NM_020800		160083847	-1	14	13	44	51	tier1	no_errors	ENST00000483754	ensembl	human	known	74_37	missense	24.14	20.31	SNP	1.000	A	14	44
IRF2BP2	359948	genome.wustl.edu	37	1	234743418	234743418	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:234743418T>C	ENST00000366609.3	-	2	1259	c.1229A>G	c.(1228-1230)aAc>aGc	p.N410S	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'UTR|IRF2BP2_ENST00000366610.3_Missense_Mutation_p.N394S	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			TGTGGTCCGGTTGGAATGAGG	0.587													ENSG00000168264																																					0													96.0	103.0	101.0					1																	234743418		2203	4300	6503	SO:0001583	missense	0			-	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1229A>G	1.37:g.234743418T>C	ENSP00000355568:p.Asn410Ser		B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Missense_Mutation	SNP	pfam_Interferon_reg_fac2-bd1_2_Znf	p.N410S	ENST00000366609.3	37	c.1229	CCDS1602.1	1	.	.	.	.	.	.	.	.	.	.	T	12.53	1.965076	0.34659	.	.	ENSG00000168264	ENST00000366610;ENST00000366609	T;T	0.30714	1.52;1.52	5.44	5.44	0.79542	.	0.177493	0.49305	D	0.000144	T	0.30417	0.0764	L	0.29908	0.895	0.46901	D	0.999241	P;D	0.55385	0.951;0.971	B;P	0.50659	0.444;0.647	T	0.03051	-1.1078	10	0.10636	T	0.68	-4.8531	15.4818	0.75534	0.0:0.0:0.0:1.0	.	410;394	Q7Z5L9;Q7Z5L9-2	I2BP2_HUMAN;.	S	394;410	ENSP00000355569:N394S;ENSP00000355568:N410S	ENSP00000355568:N410S	N	-	2	0	IRF2BP2	232810041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.596000	0.67570	2.073000	0.62155	0.533000	0.62120	AAC	-	IRF2BP2	-	pfam_Interferon_reg_fac2-bd1_2_Znf		0.587	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	IRF2BP2	HGNC	protein_coding	OTTHUMT00000092705.1	0	0	0	43	43	61	0.00	0.00	T	NM_182972		234743418	-1	19	18	13	12	tier1	no_errors	ENST00000366609	ensembl	human	novel	74_37	missense	59.38	60.00	SNP	1.000	C	19	13
MUC16	94025	genome.wustl.edu	37	19	9071242	9071242	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:9071242T>A	ENST00000397910.4	-	3	16407	c.16204A>T	c.(16204-16206)Aga>Tga	p.R5402*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5404	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGCCGGTCTCTCATGAGTG	0.502													ENSG00000181143																																					0													393.0	370.0	378.0					19																	9071242		2088	4228	6316	SO:0001587	stop_gained	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16204A>T	19.37:g.9071242T>A	ENSP00000381008:p.Arg5402*		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.R5402*	ENST00000397910.4	37	c.16204	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	56	27.128994	0.99970	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.38	0.193	0.15139	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.5048	0.11881	0.0:0.3313:0.0:0.6687	.	.	.	.	X	5402	.	ENSP00000381008:R5402X	R	-	1	2	MUC16	8932242	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.103000	0.10940	-0.025000	0.13918	0.260000	0.18958	AGA	-	MUC16	-	NULL		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	77	77	78	0.00	0.00	T	NM_024690		9071242	-1	32	45	37	32	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	nonsense	46.38	58.44	SNP	0.000	A	32	37
MRPL44	65080	genome.wustl.edu	37	2	224824624	224824624	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:224824624C>T	ENST00000258383.3	+	2	622	c.553C>T	c.(553-555)Cca>Tca	p.P185S		NM_022915.3	NP_075066.1	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44	185	RNase III.				mitochondrial translational elongation (GO:0070125)|RNA processing (GO:0006396)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGAAGAATTCCCAGTGCCCCC	0.483													ENSG00000135900																																					0													117.0	114.0	115.0					2																	224824624		2203	4300	6503	SO:0001583	missense	0			-	AK022763	CCDS2459.1	2p24.3-p24.1	2012-09-13			ENSG00000135900	ENSG00000135900		"""Mitochondrial ribosomal proteins / large subunits"""	16650	protein-coding gene	gene with protein product	"""39S ribosomal protein L44, mitochondrial"""	611849					Standard	NM_022915		Approved	FLJ12701, FLJ13990	uc002vnr.4	Q9H9J2	OTTHUMG00000133164	ENST00000258383.3:c.553C>T	2.37:g.224824624C>T	ENSP00000258383:p.Pro185Ser		Q53S16|Q6IA62|Q9H821	Missense_Mutation	SNP	superfamily_RNase_III_dom,pfscan_dsR-bd_dom	p.P185S	ENST00000258383.3	37	c.553	CCDS2459.1	2	.	.	.	.	.	.	.	.	.	.	C	18.12	3.554077	0.65425	.	.	ENSG00000135900	ENST00000258383	T	0.42513	0.97	5.7	5.7	0.88788	Ribonuclease III (3);	0.000000	0.85682	D	0.000000	T	0.67590	0.2909	M	0.88377	2.95	0.80722	D	1	D	0.76494	0.999	D	0.65010	0.931	T	0.67007	-0.5779	10	0.23302	T	0.38	-11.3184	17.3321	0.87268	0.0:1.0:0.0:0.0	.	185	Q9H9J2	RM44_HUMAN	S	185	ENSP00000258383:P185S	ENSP00000258383:P185S	P	+	1	0	MRPL44	224532868	1.000000	0.71417	0.995000	0.50966	0.299000	0.27559	7.338000	0.79269	2.683000	0.91414	0.650000	0.86243	CCA	-	MRPL44	-	superfamily_RNase_III_dom		0.483	MRPL44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL44	HGNC	protein_coding	OTTHUMT00000256866.2	0	0	0	50	50	101	0.00	0.00	C	NM_022915		224824624	+1	17	22	17	65	tier1	no_errors	ENST00000258383	ensembl	human	known	74_37	missense	50.00	25.29	SNP	1.000	T	17	17
OR2T8	343172	genome.wustl.edu	37	1	248085156	248085156	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:248085156C>A	ENST00000319968.4	+	1	837	c.837C>A	c.(835-837)ttC>ttA	p.F279L		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATACTATGTTCACCCCTTTAC	0.478													ENSG00000177462																																					0													140.0	131.0	134.0					1																	248085156		2203	4298	6501	SO:0001583	missense	0			-		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.837C>A	1.37:g.248085156C>A	ENSP00000326225:p.Phe279Leu			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F279L	ENST00000319968.4	37	c.837	CCDS31100.1	1	.	.	.	.	.	.	.	.	.	.	C	0.026	-1.367797	0.01225	.	.	ENSG00000177462	ENST00000319968	T	0.00027	8.93	3.56	1.53	0.23141	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34531	U	0.003884	T	0.00039	0.0001	N	0.00453	-1.485	0.09310	N	1	B	0.20052	0.041	B	0.26864	0.074	T	0.44034	-0.9354	10	0.02654	T	1	.	2.2641	0.04074	0.3126:0.284:0.306:0.0973	.	279	A6NH00	OR2T8_HUMAN	L	279	ENSP00000326225:F279L	ENSP00000326225:F279L	F	+	3	2	OR2T8	246151779	0.000000	0.05858	0.069000	0.20011	0.049000	0.14656	-0.284000	0.08422	0.162000	0.19483	0.404000	0.27445	TTC	-	OR2T8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.478	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	0	0	0	80	80	42	0.00	0.00	C	NM_001005522		248085156	+1	7	4	41	23	tier1	no_errors	ENST00000319968	ensembl	human	known	74_37	missense	14.58	14.81	SNP	0.022	A	7	41
TACR1	6869	genome.wustl.edu	37	2	75425694	75425698	+	Frame_Shift_Del	DEL	TGGAG	TGGAG	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	TGGAG	TGGAG	TGGAG	-	TGGAG	TGGAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:75425694_75425698delTGGAG	ENST00000305249.5	-	1	1128_1132	c.363_367delCTCCA	c.(361-369)tactccatgfs	p.SM122fs	TACR1_ENST00000409848.3_Frame_Shift_Del_p.SM122fs	NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	122					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	ACAGCCGTCATGGAGTAGATACTGG	0.502													ENSG00000115353																									Pancreas(64;62 1268 3653 14826 43765)												0																																										SO:0001589	frameshift_variant	0				M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.363_367delCTCCA	2.37:g.75425694_75425698delTGGAG	ENSP00000303522:p.Ser122fs		A8K150	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_NK1_rcpt,prints_Neurokn_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NK3_rcpt	p.S122fs	ENST00000305249.5	37	c.367_363	CCDS1958.1	2																																																																																				TACR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt		0.502	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR1	HGNC	protein_coding	OTTHUMT00000252239.3	0	0	0	94	94	94	0.00	0.00	TGGAG	NM_001058		75425698	-1	12	12	57	57	tier1	no_errors	ENST00000305249	ensembl	human	known	74_37	frame_shift_del	17.39	17.39	DEL	1.000:1.000:1.000:1.000:1.000	-	12	57
ISCA1	81689	genome.wustl.edu	37	9	88886926	88886927	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-	-	GA	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:88886926_88886927insGA	ENST00000375991.4	-	3	306_307	c.236_237insTC	c.(235-237)caafs	p.Q79fs	ISCA1_ENST00000452279.2_Frame_Shift_Ins_p.Q126fs|ISCA1_ENST00000326094.4_Frame_Shift_Ins_p.Q79fs|ISCA1_ENST00000311534.6_5'UTR	NM_030940.3	NP_112202.2	Q9BUE6	ISCA1_HUMAN	iron-sulfur cluster assembly 1	79					iron-sulfur cluster assembly (GO:0016226)	mitochondrion (GO:0005739)	iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)	8				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		ACTCACCATCTTGAATAACTTC	0.356													ENSG00000135070																																					0																																										SO:0001589	frameshift_variant	0				AF038186	CCDS35056.1	9q22.1	2013-08-06	2013-08-06	2007-01-18	ENSG00000135070	ENSG00000135070			28660	protein-coding gene	gene with protein product		611006	"""HESB like domain containing 2"", ""iron-sulfur cluster assembly 1 homolog (S. cerevisiae)"""	HBLD2		15262227, 22323289	Standard	NM_030940		Approved	MGC4276, ISA1, hIscA	uc004aop.3	Q9BUE6	OTTHUMG00000020135	ENST00000375991.4:c.236_237insTC	9.37:g.88886926_88886927insGA	ENSP00000365159:p.Gln79fs		B3KP34|B4DJI5|Q8ND75|Q9BZR2	Frame_Shift_Ins	INS	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion	p.Q126fs	ENST00000375991.4	37	c.378_377	CCDS35056.1	9																																																																																				ISCA1	-	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion		0.356	ISCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISCA1	HGNC	protein_coding	OTTHUMT00000052914.1	0	0	0	119	119	28	0.00	0.00	-	NM_030940		88886927	-1	8	5	72	32	tier1	no_errors	ENST00000452279	ensembl	human	known	74_37	frame_shift_ins	10.00	13.51	INS	1.000:1.000	GA	8	72
ATRX	546	genome.wustl.edu	37	X	76937678	76937678	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chrX:76937678C>A	ENST00000373344.5	-	9	3284	c.3070G>T	c.(3070-3072)Gaa>Taa	p.E1024*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.E986*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1024					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TGACAAATTTCTTCTCGCTCA	0.289			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											65.0	68.0	67.0					X																	76937678		2195	4286	6481	SO:0001587	stop_gained	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3070G>T	X.37:g.76937678C>A	ENSP00000362441:p.Glu1024*		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1024*	ENST00000373344.5	37	c.3070	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	42	9.546347	0.99201	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.56	4.7	0.59300	.	1.074000	0.07091	N	0.838731	.	.	.	.	.	.	0.29270	N	0.870732	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-1.164	2.4962	0.04622	0.1437:0.5322:0.1549:0.1692	.	.	.	.	X	1024;986;951	.	ENSP00000362441:E1024X	E	-	1	0	ATRX	76824334	0.975000	0.34042	0.147000	0.22382	0.925000	0.55904	1.203000	0.32284	1.104000	0.41587	0.513000	0.50165	GAA	-	ATRX	-	NULL		0.289	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	27	27	43	0.00	0.00	C	NM_000489		76937678	-1	17	33	0	5	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	100.00	86.84	SNP	0.416	A	17	0
C22orf42	150297	genome.wustl.edu	37	22	32545908	32545908	+	Intron	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr22:32545908C>T	ENST00000382097.3	-	8	727				C22orf42_ENST00000490640.1_5'UTR	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42											NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						GAAGCATAGACGATGTGTGTG	0.418													ENSG00000205856																																					0																																										SO:0001627	intron_variant	0			-	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.655-141G>A	22.37:g.32545908C>T			A4QPH5	R	SNP	-	NULL	ENST00000382097.3	37	NULL	CCDS33639.1	22																																																																																			-	C22orf42	-	-		0.418	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf42	HGNC	protein_coding	OTTHUMT00000075268.2	0	0	0	43	43	77	0.00	0.00	C	NM_001010859		32545908	-1	19	32	12	7	tier1	no_errors	ENST00000490640	ensembl	human	known	74_37	rna	61.29	82.05	SNP	0.000	T	19	12
AC069285.1	0	genome.wustl.edu	37	7	62528467	62528467	+	RNA	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:62528467C>T	ENST00000581408.1	-	0	62																											AACACCCATCCGAGTTGGACA	0.652													ENSG00000265865																																					0																																												0			-																													7.37:g.62528467C>T				R	SNP	-	NULL	ENST00000581408.1	37	NULL		7																																																																																			-	AC069285.1	-	-		0.652	AC069285.1-201	NOVEL	basic	miRNA	ENSG00000265865	Clone_based_ensembl_gene	miRNA		0	0	0	29	29	23	0.00	0.00	C			62528467	-1	3	5	8	5	tier1	no_errors	ENST00000581408	ensembl	human	novel	74_37	rna	27.27	50.00	SNP	0.006	T	3	8
KIF26A	26153	genome.wustl.edu	37	14	104646007	104646007	+	Silent	SNP	C	C	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr14:104646007C>A	ENST00000423312.2	+	15	5529	c.5529C>A	c.(5527-5529)gcC>gcA	p.A1843A	KIF26A_ENST00000315264.7_Silent_p.A1704A	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1843					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		TGGAGCGAGCCACGGCGGCCC	0.692													ENSG00000066735																																					0													11.0	15.0	14.0					14																	104646007		1883	3817	5700	SO:0001819	synonymous_variant	0			-	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.5529C>A	14.37:g.104646007C>A			Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.A1843	ENST00000423312.2	37	c.5529	CCDS45171.1	14																																																																																			-	KIF26A	-	NULL		0.692	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	0	0	0	39	39	5	0.00	0.00	C			104646007	+1	20	5	24	4	tier1	no_errors	ENST00000423312	ensembl	human	known	74_37	silent	45.45	55.56	SNP	1.000	A	20	24
KSR2	283455	genome.wustl.edu	37	12	118199117	118199117	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr12:118199117C>T	ENST00000339824.5	-	4	1412	c.685G>A	c.(685-687)Gtg>Atg	p.V229M	KSR2_ENST00000425217.1_Missense_Mutation_p.V200M			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	229	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TAGGCGTCCACGGTAAGCCTG	0.726													ENSG00000171435																																					0													14.0	17.0	16.0					12																	118199117		1860	4070	5930	SO:0001583	missense	0			-	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.685G>A	12.37:g.118199117C>T	ENSP00000339952:p.Val229Met		A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.V229M	ENST00000339824.5	37	c.685		12	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857650	0.71834	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	T;T	0.56444	0.46;0.46	5.16	5.16	0.70880	.	0.251641	0.33253	N	0.005109	T	0.46092	0.1375	L	0.44542	1.39	0.45464	D	0.998433	B	0.30709	0.291	B	0.21917	0.037	T	0.40997	-0.9533	10	0.38643	T	0.18	.	18.2313	0.89936	0.0:1.0:0.0:0.0	.	229	Q6VAB6	KSR2_HUMAN	M	200;229	ENSP00000389715:V200M;ENSP00000339952:V229M	ENSP00000339952:V229M	V	-	1	0	KSR2	116683500	1.000000	0.71417	0.922000	0.36590	0.405000	0.30901	7.404000	0.79996	2.385000	0.81259	0.491000	0.48974	GTG	-	KSR2	-	NULL		0.726	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	0	0	0	71	71	13	0.00	0.00	C	NM_173598		118199117	-1	16	6	39	8	tier1	no_errors	ENST00000339824	ensembl	human	known	74_37	missense	29.09	42.86	SNP	1.000	T	16	39
EDAR	10913	genome.wustl.edu	37	2	109545698	109545698	+	Silent	SNP	T	T	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:109545698T>A	ENST00000258443.2	-	4	742	c.312A>T	c.(310-312)ccA>ccT	p.P104P	EDAR_ENST00000376651.1_Silent_p.P104P|EDAR_ENST00000409271.1_Silent_p.P104P	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	104					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						CCATGTCCCCTGGTGTCAGCA	0.607													ENSG00000135960																																					0													83.0	63.0	70.0					2																	109545698		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.312A>T	2.37:g.109545698T>A			B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Silent	SNP	pfam_Death_domain,superfamily_DEATH-like_dom	p.P104	ENST00000258443.2	37	c.312	CCDS2081.1	2																																																																																			-	EDAR	-	NULL		0.607	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDAR	HGNC	protein_coding	OTTHUMT00000253595.1	0	0	0	76	76	80	0.00	0.00	T			109545698	-1	5	5	54	84	tier1	no_errors	ENST00000376651	ensembl	human	known	74_37	silent	8.47	5.62	SNP	0.011	A	5	54
CELP	1057	genome.wustl.edu	37	9	135962555	135962556	+	RNA	INS	-	-	CTGCC	rs370202675|rs58402826|rs112009079		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:135962555_135962556insCTGCC	ENST00000411440.2	+	0	1062_1063					NR_001275.2				carboxyl ester lipase pseudogene																		TGACTCTGAGGCCCGTGCCCAC	0.624													ENSG00000170827																																					0																																												0				L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962555_135962556insCTGCC				R	INS	-	NULL	ENST00000411440.2	37	NULL		9																																																																																				CELP	-	-		0.624	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	0	0	0	10	10	10	0.00	0.00	-	NM_001808		135962556	+1	1	1	7	7	tier1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	12.50	12.50	INS	0.038:0.013	CTGCC	1	7
CABLES1	91768	genome.wustl.edu	37	18	20716015	20716023	+	In_Frame_Del	DEL	GGCGCCGGC	GGCGCCGGC	-	rs201595073|rs139352344	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	GGCGCCGGC	GGCGCCGGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr18:20716015_20716023delGGCGCCGGC	ENST00000256925.7	+	1	289_297	c.289_297delGGCGCCGGC	c.(289-297)ggcgccggcdel	p.GAG97del	CABLES1_ENST00000400473.2_Intron|AC105247.1_ENST00000411067.1_RNA	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	97	Ala-rich.|Interacts with TDRD7. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ggccaagccgggcgccggcggcgcctgcg	0.785													ENSG00000134508		1123	0.224241	0.2602	0.17	5008	,	,		3844	0.244		0.2048	False		,,,				2504	0.2137																0																																										SO:0001651	inframe_deletion	0				BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.289_297delGGCGCCGGC	18.37:g.20716015_20716023delGGCGCCGGC	ENSP00000256925:p.Gly97_Gly99del		B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	In_Frame_Del	DEL	pfam_Cyclin_N,superfamily_Cyclin-like,pirsf_Cdk5/c-Abl_linker_Cables	p.GGA99in_frame_del	ENST00000256925.7	37	c.289_297	CCDS42417.1	18																																																																																				CABLES1	-	pirsf_Cdk5/c-Abl_linker_Cables		0.785	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CABLES1	HGNC	protein_coding	OTTHUMT00000445198.2	0	0	0	0	0	0	0.00	0.00	GGCGCCGGC	NM_138375		20716023	+1	0	0	0	0	tier1	no_errors	ENST00000256925	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.983:0.981:0.990:0.998:0.999:0.997:0.999:0.999:0.997	-	0	0
CTBP2	1488	genome.wustl.edu	37	10	126715159	126715160	+	Intron	INS	-	-	GCCGCAGGCTGGGGCTGCAGG	rs529129641|rs372118432	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr10:126715159_126715160insGCCGCAGGCTGGGGCTGCAGG	ENST00000337195.5	-	3	458				CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000309035.6_In_Frame_Ins_p.390_390A>ALQPQPAA	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TCTGCAGAGGAGCCGCAGCGCC	0.698													ENSG00000175029		537	0.107228	0.1006	0.2478	5008	,	,		14420	0.0417		0.1093	False		,,,				2504	0.0818																0									,,	295,3727		33,229,1749					,,	-1.1	0.0			8	694,7122		93,508,3307	no	coding,intron,intron	CTBP2	NM_022802.2,NM_001329.2,NM_001083914.1	,,	126,737,5056	A1A1,A1R,RR		8.8792,7.3347,8.3545	,,	,,		989,10849				SO:0001627	intron_variant	0				AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12405->CCTGCAGCCCCAGCCTGCGGC	10.37:g.126715159_126715160insGCCGCAGGCTGGGGCTGCAGG			A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	In_Frame_Ins	INS	pfam_D-isomer_2_OHA_DH_D-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.391in_frame_insLQPQPAA	ENST00000337195.5	37	c.1170_1169	CCDS7643.1	10																																																																																				CTBP2	-	NULL		0.698	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	HGNC	protein_coding	OTTHUMT00000050900.3	0	0	0	2	2	2	0.00	0.00	-	NM_001083914		126715160	-1	0	0	2	2	tier1	no_errors	ENST00000309035	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.257:0.112	GCCGCAGGCTGGGGCTGCAGG	0	2
SCN11A	11280	genome.wustl.edu	37	3	38948849	38948856	+	Intron	DEL	ACACACAC	ACACACAC	-	rs376599495|rs74884713|rs377500548|rs75317406|rs370348256|rs75658739|rs76050581		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	ACACACAC	ACACACAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:38948849_38948856delACACACAC	ENST00000302328.3	-	10	1672				AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000456224.3_Intron|SCN11A_ENST00000444237.2_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATCTATATATacacacacacacacacac	0.385													ENSG00000215941																																					0																																										SO:0001627	intron_variant	0				AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+583GTGTGTGT>-	3.37:g.38948857_38948864delACACACAC			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	R	DEL	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																				AC116038.1	-	-		0.385	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000109746.4	0	0	0	0	0	0	0.00	0.00	ACACACAC	NM_014139		38948856	+1	0	0	0	0	tier1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-	0	0
GOLGA6L4	643707	genome.wustl.edu	37	15	82932257	82932288	+	5'UTR	DEL	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC	-	rs555363824	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr15:82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC	ENST00000560844.1	-	0	2502_2533																				NS(1)	1						taaattagaaacacaaataaatttaaactataaattagaaacacaaataaat	0.207													ENSG00000215749																																					0																																										SO:0001623	5_prime_UTR_variant	0																															ENST00000560844.1:c.-1851GTTTCTAATTTATAGTTTAAATTTATTTGTGT>-	15.37:g.82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC				R	DEL	-	NULL	ENST00000560844.1	37	NULL		15																																																																																				RP13-996F3.5	-	-		0.207	RP13-996F3.5-002	KNOWN	basic	processed_transcript	GOLGA6L4	Clone_based_vega_gene	protein_coding	OTTHUMT00000419267.1	0	0	0	0	0	0	0.00	0.00	ACACAAATAAATTTAAACTATAAATTAGAAAC			82932288	-1	0	0	0	0	tier1	no_errors	ENST00000560844	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.140:0.148:0.154:0.160:0.165:0.169:0.172:0.175:0.177:0.178:0.179:0.179:0.180:0.179:0.135:0.131:0.126:0.121:0.112:0.097:0.077:0.050:0.041:0.040:0.045:0.047:0.048:0.046:0.049:0.052:0.050:0.046	-	0	0
KIR3DL1	3811	genome.wustl.edu	37	19	55281331	55281331	+	Intron	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:55281331G>A	ENST00000538269.1	+	1	61				KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR2DL3_ENST00000434419.2_Intron|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.C10Y|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.C10Y|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000541392.1_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		AGCATGGCGTGTGTTGGTGAG	0.607											OREG0003674	type=REGULATORY REGION|Gene=KIR2DL1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	ENSG00000125498																																					0													124.0	110.0	115.0					19																	55281331		2158	4193	6351	SO:0001627	intron_variant	0			-	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.34+45296G>A	19.37:g.55281331G>A		1006	O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.C10Y	ENST00000538269.1	37	c.29		19	.	.	.	.	.	.	.	.	.	.	G	3.084	-0.188410	0.06299	.	.	ENSG00000125498	ENST00000336077;ENST00000291633	T;T	0.00510	6.9;6.91	0.514	-0.85	0.10720	.	.	.	.	.	T	0.00666	0.0022	M	0.87827	2.91	0.18873	N	0.999989	B;B	0.10296	0.0;0.003	B;B	0.11329	0.002;0.006	T	0.35773	-0.9775	8	0.46703	T	0.11	.	.	.	.	.	10;10	Q6IST4;Q6H2H3	.;.	Y	10	ENSP00000336769:C10Y;ENSP00000291633:C10Y	ENSP00000291633:C10Y	C	+	2	0	KIR2DL1	59973143	0.239000	0.23836	0.098000	0.21074	0.009000	0.06853	0.713000	0.25794	-0.262000	0.09392	-0.552000	0.04208	TGT	-	KIR2DL1	-	NULL		0.607	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL1	HGNC	protein_coding		0	0	0	54	54	0	0.00	0.00	G	NM_013289		55281331	+1	28	0	7	0	tier1	no_errors	ENST00000336077	ensembl	human	known	74_37	missense	80.00	0.00	SNP	0.960	A	28	7
NBPF9	400818	genome.wustl.edu	37	1	144815234	144815234	+	Intron	SNP	C	C	G			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:144815234C>G	ENST00000468645.1	+	3	528				NBPF9_ENST00000440491.2_Intron|NBPF9_ENST00000338347.4_Intron|NBPF9_ENST00000281815.8_Intron			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						CCCAGGCTGTCTTTTCGGCAA	0.468													ENSG00000168614																																					0																																										SO:0001627	intron_variant	0			-		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.528+340C>G	1.37:g.144815234C>G				R	SNP	-	NULL	ENST00000468645.1	37	NULL		1																																																																																			-	NBPF9	-	-		0.468	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NBPF9	HGNC	protein_coding	OTTHUMT00000038846.1	0	0	0	8	8	0	0.00	0.00	C	NM_001037675		144815234	+1	47	1	4	0	tier1	no_errors	ENST00000483630	ensembl	human	known	74_37	rna	92.16	100.00	SNP	0.000	G	47	4
NUDT16	131870	genome.wustl.edu	37	3	131101009	131101009	+	Silent	SNP	C	C	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:131101009C>A	ENST00000521288.1	+	2	289	c.258C>A	c.(256-258)gcC>gcA	p.A86A	NUDT16_ENST00000359850.3_Silent_p.A53A|NUDT16_ENST00000537561.1_Silent_p.A40A|NUDT16_ENST00000502852.1_Silent_p.A86A|RP11-933H2.4_ENST00000502521.1_RNA			Q96DE0	NUD16_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16	86	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				adenosine to inosine editing (GO:0006382)|dephosphorylation (GO:0016311)|dITP catabolic process (GO:0035863)|IDP catabolic process (GO:0046709)|mRNA catabolic process (GO:0006402)|negative regulation of rRNA processing (GO:2000233)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|snoRNA catabolic process (GO:0016077)|XDP catabolic process (GO:1901639)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cobalt ion binding (GO:0050897)|dIDP diphosphatase activity (GO:0097383)|dITP diphosphatase activity (GO:0035870)|GTP binding (GO:0005525)|inosine-diphosphatase activity (GO:0090450)|ITP binding (GO:1901641)|m7G(5')pppN diphosphatase activity (GO:0050072)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)|mRNA binding (GO:0003729)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|protein homodimerization activity (GO:0042803)|snoRNA binding (GO:0030515)|XTP binding (GO:1901640)			large_intestine(1)|lung(6)	7						AAGCGGCTGCCGCTTTCCGCG	0.682													ENSG00000198585																																					0													23.0	27.0	25.0					3																	131101009		2169	4234	6403	SO:0001819	synonymous_variant	0			-	AK055827	CCDS3070.1, CCDS3070.2, CCDS54640.1, CCDS54641.1	3q21.3	2005-01-25						"""Nudix motif containing"""	26442	protein-coding gene	gene with protein product						12477932	Standard	NM_152395		Approved	FLJ31265	uc021xec.1	Q96DE0		ENST00000521288.1:c.258C>A	3.37:g.131101009C>A			B4E3B4|E9PED4|F5GYJ1|Q96N82	Silent	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.A86	ENST00000521288.1	37	c.258	CCDS3070.2	3																																																																																			-	NUDT16	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like		0.682	NUDT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT16	HGNC	protein_coding	OTTHUMT00000356537.9	0	0	0	53	53	3	0.00	0.00	C	NM_152395		131101009	+1	17	1	67	6	tier1	no_errors	ENST00000521288	ensembl	human	known	74_37	silent	20.00	14.29	SNP	0.752	A	17	67
ASAP3	55616	genome.wustl.edu	37	1	23763476	23763476	+	Silent	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:23763476G>A	ENST00000336689.3	-	15	1448	c.1404C>T	c.(1402-1404)caC>caT	p.H468H	ASAP3_ENST00000495646.1_5'Flank|ASAP3_ENST00000437606.2_Silent_p.H459H	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	468	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CCAGTTCGCGGTGGACGCCCG	0.682													ENSG00000088280																																					0													25.0	24.0	24.0					1																	23763476		2202	4299	6501	SO:0001819	synonymous_variant	0			-	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.1404C>T	1.37:g.23763476G>A			B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.H468	ENST00000336689.3	37	c.1404	CCDS235.1	1																																																																																			-	ASAP3	-	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP		0.682	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP3	HGNC	protein_coding	OTTHUMT00000008916.2	0	0	0	15	15	3	0.00	0.00	G	NM_017707		23763476	-1	7	6	3	0	tier1	no_errors	ENST00000336689	ensembl	human	known	74_37	silent	70.00	100.00	SNP	1.000	A	7	3
VPS13C	54832	genome.wustl.edu	37	15	62234079	62234079	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr15:62234079G>C	ENST00000261517.5	-	46	5409	c.5336C>G	c.(5335-5337)gCa>gGa	p.A1779G	VPS13C_ENST00000395898.3_Missense_Mutation_p.A1736G|VPS13C_ENST00000249837.3_Missense_Mutation_p.A1736G|VPS13C_ENST00000395896.4_Missense_Mutation_p.A1779G	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ACCCAGATCTGCTATAACAGC	0.363													ENSG00000129003																																					0													83.0	83.0	83.0					15																	62234079		2203	4300	6503	SO:0001583	missense	0			-	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.5336C>G	15.37:g.62234079G>C	ENSP00000261517:p.Ala1779Gly			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.A1779G	ENST00000261517.5	37	c.5336	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087743	0.76642	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.15487	2.42;2.42;2.42	5.09	5.09	0.68999	.	0.186729	0.48767	D	0.000170	T	0.46908	0.1417	M	0.83953	2.67	0.52099	D	0.999946	D;D;D;D	0.69078	0.962;0.995;0.995;0.997	P;D;D;D	0.69142	0.878;0.962;0.962;0.947	T	0.53143	-0.8480	10	0.87932	D	0	.	18.8527	0.92238	0.0:0.0:1.0:0.0	.	1736;1779;1736;1779	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	G	1736;1779;1779;1779	ENSP00000249837:A1736G;ENSP00000261517:A1779G;ENSP00000379233:A1779G	ENSP00000249837:A1736G	A	-	2	0	VPS13C	60021371	1.000000	0.71417	0.990000	0.47175	0.987000	0.75469	5.010000	0.64004	2.533000	0.85409	0.655000	0.94253	GCA	-	VPS13C	-	NULL		0.363	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	0	0	0	79	79	80	0.00	0.00	G	NM_017684		62234079	-1	5	2	42	102	tier1	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	10.20	1.92	SNP	1.000	C	5	42
SIGLEC7	27036	genome.wustl.edu	37	19	51650058	51650058	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:51650058G>A	ENST00000317643.6	+	5	1144	c.1075G>A	c.(1075-1077)Gct>Act	p.A359T	SIGLEC7_ENST00000305628.7_Missense_Mutation_p.A266T|SIGLEC7_ENST00000600577.1_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	359					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		GGTCGGGGGAGCTGGAGCCAC	0.572													ENSG00000168995																																					0													99.0	95.0	97.0					19																	51650058		2203	4300	6503	SO:0001583	missense	0			-	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.1075G>A	19.37:g.51650058G>A	ENSP00000323328:p.Ala359Thr		Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A359T	ENST00000317643.6	37	c.1075	CCDS12826.1	19	.	.	.	.	.	.	.	.	.	.	.	15.96	2.985993	0.53934	.	.	ENSG00000168995	ENST00000317643;ENST00000305628	T;T	0.08634	3.07;3.07	2.75	1.63	0.23807	.	1.071740	0.07440	N	0.897080	T	0.23532	0.0569	M	0.87097	2.86	0.18873	N	0.999989	D;D	0.59357	0.963;0.985	B;P	0.53518	0.349;0.728	T	0.10776	-1.0615	10	0.52906	T	0.07	.	6.6314	0.22859	0.0:0.0:0.6992:0.3008	.	266;359	Q9Y286-2;Q9Y286	.;SIGL7_HUMAN	T	359;266	ENSP00000323328:A359T;ENSP00000306757:A266T	ENSP00000306757:A266T	A	+	1	0	SIGLEC7	56341870	0.003000	0.15002	0.002000	0.10522	0.369000	0.29798	0.776000	0.26704	0.451000	0.26802	0.420000	0.28162	GCT	-	SIGLEC7	-	NULL		0.572	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2	0	0	0	37	37	32	0.00	0.00	G	NM_016543		51650058	+1	9	2	41	26	tier1	no_errors	ENST00000317643	ensembl	human	known	74_37	missense	18.00	7.14	SNP	0.005	A	9	41
CCDC80	151887	genome.wustl.edu	37	3	112357638	112357638	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:112357638G>T	ENST00000206423.3	-	2	2068	c.1115C>A	c.(1114-1116)gCt>gAt	p.A372D	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.A372D	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	372	Thr-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						AGGTCTTGCAGCAACTGTTAC	0.642													ENSG00000091986																																					0													81.0	71.0	75.0					3																	112357638		2203	4300	6503	SO:0001583	missense	0			-	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1115C>A	3.37:g.112357638G>T	ENSP00000206423:p.Ala372Asp		D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	NULL	p.A372D	ENST00000206423.3	37	c.1115	CCDS2968.1	3	.	.	.	.	.	.	.	.	.	.	G	16.83	3.232225	0.58777	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.50548	0.74;0.74	4.89	4.89	0.63831	.	0.110597	0.64402	D	0.000007	T	0.45915	0.1366	L	0.27053	0.805	0.80722	D	1	P;P;P	0.52577	0.835;0.954;0.745	B;P;B	0.49752	0.429;0.621;0.247	T	0.33137	-0.9880	10	0.32370	T	0.25	-7.3048	18.2349	0.89946	0.0:0.0:1.0:0.0	.	383;372;372	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	D	372	ENSP00000206423:A372D;ENSP00000411814:A372D	ENSP00000206423:A372D	A	-	2	0	CCDC80	113840328	0.994000	0.37717	0.108000	0.21378	0.034000	0.12701	5.501000	0.66950	2.535000	0.85469	0.555000	0.69702	GCT	-	CCDC80	-	NULL		0.642	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	HGNC	protein_coding	OTTHUMT00000354219.1	0	0	0	26	26	38	0.00	0.00	G	NM_199511		112357638	-1	4	2	28	37	tier1	no_errors	ENST00000206423	ensembl	human	known	74_37	missense	12.50	5.13	SNP	0.796	T	4	28
ISCA1	81689	genome.wustl.edu	37	9	88886929	88886929	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:88886929delA	ENST00000375991.4	-	3	304	c.234delT	c.(232-234)attfs	p.I78fs	ISCA1_ENST00000452279.2_Frame_Shift_Del_p.I125fs|ISCA1_ENST00000326094.4_Frame_Shift_Del_p.I78fs|ISCA1_ENST00000311534.6_5'UTR	NM_030940.3	NP_112202.2	Q9BUE6	ISCA1_HUMAN	iron-sulfur cluster assembly 1	78					iron-sulfur cluster assembly (GO:0016226)	mitochondrion (GO:0005739)	iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)	8				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		CACCATCTTGAATAACTTCTT	0.363													ENSG00000135070																																					0													125.0	121.0	122.0					9																	88886929		2203	4300	6503	SO:0001589	frameshift_variant	0				AF038186	CCDS35056.1	9q22.1	2013-08-06	2013-08-06	2007-01-18	ENSG00000135070	ENSG00000135070			28660	protein-coding gene	gene with protein product		611006	"""HESB like domain containing 2"", ""iron-sulfur cluster assembly 1 homolog (S. cerevisiae)"""	HBLD2		15262227, 22323289	Standard	NM_030940		Approved	MGC4276, ISA1, hIscA	uc004aop.3	Q9BUE6	OTTHUMG00000020135	ENST00000375991.4:c.234delT	9.37:g.88886929delA	ENSP00000365159:p.Ile78fs		B3KP34|B4DJI5|Q8ND75|Q9BZR2	Frame_Shift_Del	DEL	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion	p.Q126fs	ENST00000375991.4	37	c.375	CCDS35056.1	9																																																																																				ISCA1	-	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion		0.363	ISCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISCA1	HGNC	protein_coding	OTTHUMT00000052914.1	0	0	0	122	122	28	0.00	0.00	A	NM_030940		88886929	-1	13	2	65	35	tier1	no_errors	ENST00000452279	ensembl	human	known	74_37	frame_shift_del	16.67	5.41	DEL	0.997	-	13	65
ISCA1	81689	genome.wustl.edu	37	9	88886934	88886943	+	Frame_Shift_Del	DEL	CTTCTTCATC	CTTCTTCATC	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	CTTCTTCATC	CTTCTTCATC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:88886934_88886943delCTTCTTCATC	ENST00000375991.4	-	3	290_299	c.220_229delGATGAAGAAG	c.(220-231)gatgaagaagttfs	p.DEEV74fs	ISCA1_ENST00000452279.2_Frame_Shift_Del_p.DEEV121fs|ISCA1_ENST00000326094.4_Frame_Shift_Del_p.DEEV74fs|ISCA1_ENST00000311534.6_5'UTR	NM_030940.3	NP_112202.2	Q9BUE6	ISCA1_HUMAN	iron-sulfur cluster assembly 1	74					iron-sulfur cluster assembly (GO:0016226)	mitochondrion (GO:0005739)	iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)	8				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		TCTTGAATAACTTCTTCATCAGAATCTCCT	0.348													ENSG00000135070																																					0																																										SO:0001589	frameshift_variant	0				AF038186	CCDS35056.1	9q22.1	2013-08-06	2013-08-06	2007-01-18	ENSG00000135070	ENSG00000135070			28660	protein-coding gene	gene with protein product		611006	"""HESB like domain containing 2"", ""iron-sulfur cluster assembly 1 homolog (S. cerevisiae)"""	HBLD2		15262227, 22323289	Standard	NM_030940		Approved	MGC4276, ISA1, hIscA	uc004aop.3	Q9BUE6	OTTHUMG00000020135	ENST00000375991.4:c.220_229delGATGAAGAAG	9.37:g.88886934_88886943delCTTCTTCATC	ENSP00000365159:p.Asp74fs		B3KP34|B4DJI5|Q8ND75|Q9BZR2	Frame_Shift_Del	DEL	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion	p.D121fs	ENST00000375991.4	37	c.370_361	CCDS35056.1	9																																																																																				ISCA1	-	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion		0.348	ISCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISCA1	HGNC	protein_coding	OTTHUMT00000052914.1	0	0	0	28	28	28	0.00	0.00	CTTCTTCATC	NM_030940		88886943	-1	2	2	35	35	tier1	no_errors	ENST00000452279	ensembl	human	known	74_37	frame_shift_del	5.41	5.41	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	2	35
