#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
KHNYN	23351	genome.wustl.edu	37	14	24900739	24900739	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr14:24900739T>A	ENST00000251343.5	+	3	411	c.272T>A	c.(271-273)aTc>aAc	p.I91N	CBLN3_ENST00000555436.1_5'Flank|KHNYN_ENST00000556842.1_Missense_Mutation_p.I91N|KHNYN_ENST00000554268.1_5'Flank|KHNYN_ENST00000553935.1_Missense_Mutation_p.I91N|CBLN3_ENST00000267406.6_5'Flank			O15037	KHNYN_HUMAN	KH and NYN domain containing	91							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						CTGCACTGCATCTTTCTGGGA	0.597											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000100441																																					0													53.0	47.0	49.0					14																	24900739		2203	4300	6503	SO:0001583	missense	0			-	AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.272T>A	14.37:g.24900739T>A	ENSP00000251343:p.Ile91Asn	774	Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.I91N	ENST00000251343.5	37	c.272	CCDS32058.1	14	.	.	.	.	.	.	.	.	.	.	T	19.72	3.880195	0.72294	.	.	ENSG00000100441	ENST00000251343;ENST00000556842;ENST00000553935;ENST00000556510	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.03	3.88	0.44766	.	0.200125	0.41605	D	0.000860	T	0.52837	0.1759	M	0.65975	2.015	0.80722	D	1	D;D	0.60575	0.988;0.988	P;P	0.56398	0.797;0.797	T	0.54892	-0.8225	10	0.87932	D	0	.	8.9124	0.35561	0.0:0.0901:0.0:0.9099	.	132;91	D3DS77;O15037	.;KHNYN_HUMAN	N	91	ENSP00000251343:I91N;ENSP00000451106:I91N;ENSP00000450799:I91N;ENSP00000451004:I91N	ENSP00000251343:I91N	I	+	2	0	KHNYN	23970579	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.684000	0.68197	0.878000	0.35920	0.460000	0.39030	ATC	-	KHNYN	-	NULL		0.597	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KHNYN	HGNC	protein_coding	OTTHUMT00000412928.1	0	0	0	60	60	135	0.00	0.00	T			24900739	+1	11	20	20	74	tier1	no_errors	ENST00000251343	ensembl	human	known	74_37	missense	35.48	21.28	SNP	1.000	A	11	20
APBA1	320	genome.wustl.edu	37	9	72131055	72131055	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr9:72131055C>G	ENST00000265381.4	-	2	1294	c.1072G>C	c.(1072-1074)Gag>Cag	p.E358Q		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	358					axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						TTCACCTCCTCGATGGCCTCC	0.662													ENSG00000107282																																					0													128.0	97.0	108.0					9																	72131055		2203	4300	6503	SO:0001583	missense	0			-	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1072G>C	9.37:g.72131055C>G	ENSP00000265381:p.Glu358Gln		O14914|O60570|Q5VYR8	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.E358Q	ENST00000265381.4	37	c.1072	CCDS6630.1	9	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532240	0.85812	.	.	ENSG00000107282	ENST00000265381	T	0.05786	3.39	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.10208	0.0250	L	0.34521	1.04	0.80722	D	1	P	0.52577	0.954	P	0.48304	0.573	T	0.29088	-1.0023	10	0.22109	T	0.4	-19.4294	20.1772	0.98182	0.0:1.0:0.0:0.0	.	358	Q02410	APBA1_HUMAN	Q	358	ENSP00000265381:E358Q	ENSP00000265381:E358Q	E	-	1	0	APBA1	71320875	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.778000	0.95560	0.655000	0.94253	GAG	-	APBA1	-	NULL		0.662	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	HGNC	protein_coding	OTTHUMT00000052589.2	0	0	0	68	68	83	0.00	0.00	C	NM_001163		72131055	-1	19	24	27	20	tier1	no_errors	ENST00000265381	ensembl	human	known	74_37	missense	41.30	54.55	SNP	1.000	G	19	27
KRBOX1	100506243	genome.wustl.edu	37	3	42984102	42984102	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr3:42984102G>A	ENST00000418176.1	+	4	2384	c.350G>A	c.(349-351)cGa>cAa	p.R117Q	KRBOX1_ENST00000443313.1_Intron|KRBOX1_ENST00000418093.2_Intron|KRBOX1_ENST00000383748.4_Missense_Mutation_p.R117Q|KRBOX1_ENST00000426937.1_Missense_Mutation_p.R117Q			C9JBD0	KRBX1_HUMAN	KRAB box domain containing 1	117					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			lung(2)	2						AAAATTTTTCGAAATCGTCAA	0.348													ENSG00000240747																																					0																																										SO:0001583	missense	0			-		CCDS54572.1	3p22.1	2014-02-12	2010-07-29		ENSG00000240747	ENSG00000240747		"""-"""	38708	protein-coding gene	gene with protein product							Standard	NM_001205272		Approved		uc003cmm.4	C9JBD0	OTTHUMG00000156448	ENST00000418176.1:c.350G>A	3.37:g.42984102G>A	ENSP00000388094:p.Arg117Gln		B4DJE8	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.R117Q	ENST00000418176.1	37	c.350	CCDS54572.1	3	.	.	.	.	.	.	.	.	.	.	G	0.208	-1.039076	0.02013	.	.	ENSG00000240747	ENST00000426937;ENST00000383748;ENST00000418176	T;T;T	0.01203	5.18;5.18;5.18	3.26	-4.2	0.03823	.	.	.	.	.	T	0.00552	0.0018	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46775	-0.9167	9	0.13108	T	0.6	.	1.0148	0.01505	0.3065:0.17:0.3444:0.1791	.	117	C9JBD0	KRBX1_HUMAN	Q	117	ENSP00000413859:R117Q;ENSP00000373254:R117Q;ENSP00000388094:R117Q	ENSP00000373254:R117Q	R	+	2	0	KRBOX1	42959106	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.552000	0.06020	-0.873000	0.04032	-1.669000	0.00746	CGA	-	KRBOX1	-	NULL		0.348	KRBOX1-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KRBOX1	HGNC	protein_coding	OTTHUMT00000344236.1	0	0	0	181	181	90	0.00	0.00	G	NM_001205272		42984102	+1	6	5	64	34	tier1	no_errors	ENST00000426937	ensembl	human	putative	74_37	missense	8.57	12.50	SNP	0.000	A	6	64
TRAPPC9	83696	genome.wustl.edu	37	8	141461086	141461086	+	Silent	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr8:141461086G>A	ENST00000438773.2	-	2	520	c.387C>T	c.(385-387)cgC>cgT	p.R129R	TRAPPC9_ENST00000389328.4_Silent_p.R227R|TRAPPC9_ENST00000389327.3_Silent_p.R129R	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	129					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CCACGTCGGTGCGCGGCTGCT	0.572													ENSG00000167632																																					0													69.0	59.0	63.0					8																	141461086		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.387C>T	8.37:g.141461086G>A			Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Silent	SNP	pfam_TRAPP_II_complex_Trs120	p.R227	ENST00000438773.2	37	c.681	CCDS55278.1	8																																																																																			-	TRAPPC9	-	NULL		0.572	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	0	0	0	54	54	43	0.00	0.00	G	NM_031466		141461086	-1	8	6	51	41	tier1	no_errors	ENST00000389328	ensembl	human	known	74_37	silent	13.56	12.77	SNP	0.837	A	8	51
ZSCAN12	9753	genome.wustl.edu	37	6	28358731	28358731	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr6:28358731C>G	ENST00000361028.1	-	4	1481	c.1336G>C	c.(1336-1338)Gaa>Caa	p.E446Q	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.E446Q			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	446					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						TTCCCACATTCCTTACACTGA	0.418													ENSG00000158691																																					0													109.0	94.0	99.0					6																	28358731		692	1591	2283	SO:0001583	missense	0			-	AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.1336G>C	6.37:g.28358731C>G	ENSP00000354305:p.Glu446Gln		O43724	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E446Q	ENST00000361028.1	37	c.1336		6	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613148	0.46631	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.07444	3.19;3.19	3.45	3.45	0.39498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05135	0.0137	N	0.16130	0.375	0.22330	N	0.999199	D;B	0.61697	0.99;0.002	P;B	0.55824	0.785;0.003	T	0.39440	-0.9614	9	0.49607	T	0.09	.	13.8207	0.63318	0.0:1.0:0.0:0.0	.	446;446	A8K187;O43309	.;ZSC12_HUMAN	Q	446	ENSP00000354305:E446Q;ENSP00000380039:E446Q	ENSP00000354305:E446Q	E	-	1	0	ZSCAN12	28466710	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-0.025000	0.12413	1.755000	0.51935	0.650000	0.86243	GAA	-	ZSCAN12	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	0	0	0	34	34	171	0.00	0.00	C	NM_014724		28358731	-1	5	22	20	76	tier1	no_errors	ENST00000361028	ensembl	human	known	74_37	missense	20.00	22.45	SNP	0.900	G	5	20
DMD	1756	genome.wustl.edu	37	X	32328228	32328228	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chrX:32328228C>A	ENST00000357033.4	-	42	6294	c.6088G>T	c.(6088-6090)Gat>Tat	p.D2030Y	DMD_ENST00000378677.2_Missense_Mutation_p.D2026Y	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2030					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTAAAGAGATCTTCAAAGTCC	0.393													ENSG00000198947																																					0													100.0	83.0	89.0					X																	32328228		2202	4300	6502	SO:0001583	missense	0			-	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6088G>T	X.37:g.32328228C>A	ENSP00000354923:p.Asp2030Tyr		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.D2030Y	ENST00000357033.4	37	c.6088	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455774	0.63401	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.51574	0.7;0.7	6.16	4.41	0.53225	.	0.000000	0.38164	U	0.001785	T	0.61476	0.2350	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.975;0.999;0.971;0.986	D;P;D;P;D	0.66847	0.912;0.832;0.947;0.837;0.923	T	0.64232	-0.6456	10	0.87932	D	0	.	9.7416	0.40422	0.0:0.7782:0.0:0.2218	.	2022;2030;2026;689;686	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	Y	2022;689;686;2026;2030;2030;1907	ENSP00000367948:D2026Y;ENSP00000354923:D2030Y	ENSP00000354923:D2030Y	D	-	1	0	DMD	32238149	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.339000	0.43965	1.356000	0.45884	-0.197000	0.12766	GAT	-	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	0	0	0	94	94	143	0.00	0.00	C	NM_004006		32328228	-1	11	10	23	19	tier1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	32.35	34.48	SNP	1.000	A	11	23
TSPYL6	388951	genome.wustl.edu	37	2	54482087	54482087	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:54482087A>G	ENST00000317802.7	-	1	1322	c.1202T>C	c.(1201-1203)aTc>aCc	p.I401T	ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000606865.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	401					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						GGGCCTGGGGATCTCCACTGG	0.537													ENSG00000178021																																					0													68.0	74.0	72.0					2																	54482087		2153	4286	6439	SO:0001583	missense	0			-	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.1202T>C	2.37:g.54482087A>G	ENSP00000417919:p.Ile401Thr		Q6NUJ3	Missense_Mutation	SNP	pfam_P_family	p.I401T	ENST00000317802.7	37	c.1202	CCDS42682.1	2	.	.	.	.	.	.	.	.	.	.	A	3.389	-0.124656	0.06795	.	.	ENSG00000178021	ENST00000317802	T	0.17854	2.25	1.83	0.638	0.17742	.	.	.	.	.	T	0.05593	0.0147	N	0.14661	0.345	0.09310	N	0.99999	P	0.37330	0.59	B	0.30251	0.113	T	0.22556	-1.0213	9	0.02654	T	1	.	3.6474	0.08189	0.7923:0.0:0.2077:0.0	.	401	Q8N831	TSYL6_HUMAN	T	401	ENSP00000417919:I401T	ENSP00000417919:I401T	I	-	2	0	TSPYL6	54335591	0.034000	0.19679	0.498000	0.27564	0.936000	0.57629	0.004000	0.13106	0.171000	0.19730	0.482000	0.46254	ATC	-	TSPYL6	-	NULL		0.537	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL6	HGNC	protein_coding	OTTHUMT00000324069.3	0	0	0	90	90	189	0.00	0.00	A	XM_371494		54482087	-1	22	47	38	70	tier1	no_errors	ENST00000317802	ensembl	human	known	74_37	missense	36.67	39.83	SNP	0.613	G	22	38
GUSBP11	91316	genome.wustl.edu	37	22	23980848	23980848	+	RNA	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr22:23980848G>A	ENST00000455485.1	-	0	3641				AP000347.4_ENST00000430707.2_RNA|KB-1572G7.3_ENST00000390329.3_RNA			Q6P575	BGP11_HUMAN	glucuronidase, beta pseudogene 11						carbohydrate metabolic process (GO:0005975)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										CTTCTCCACGGTGCTCCCTTC	0.622													ENSG00000228315																																					0																																												0			-			22q11.23	2011-06-09			ENSG00000228315	ENSG00000228315			42325	pseudogene	pseudogene							Standard	NR_024448		Approved		uc011aiz.2	Q6P575	OTTHUMG00000150709		22.37:g.23980848G>A				R	SNP	-	NULL	ENST00000455485.1	37	NULL		22																																																																																			-	GUSBP11	-	-		0.622	GUSBP11-005	KNOWN	basic|readthrough_transcript	processed_transcript	GUSBP11	HGNC	processed_transcript	OTTHUMT00000319697.1	0	0	0	80	80	10	0.00	0.00	G			23980848	-1	14	2	42	10	tier1	no_errors	ENST00000422506	ensembl	human	known	74_37	rna	25.00	16.67	SNP	0.212	A	14	42
LRFN5	145581	genome.wustl.edu	37	14	42356845	42356845	+	Silent	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr14:42356845C>T	ENST00000298119.4	+	3	2206	c.1017C>T	c.(1015-1017)aaC>aaT	p.N339N	LRFN5_ENST00000554171.1_Silent_p.N339N|LRFN5_ENST00000554120.1_Silent_p.N339N	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	339	Ig-like.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGTATGATAACGGAACACTTG	0.448										HNSCC(30;0.082)			ENSG00000165379																																					0													126.0	122.0	124.0					14																	42356845		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1017C>T	14.37:g.42356845C>T			B3KU78|Q86XL2	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N339	ENST00000298119.4	37	c.1017	CCDS9678.1	14																																																																																			-	LRFN5	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.448	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	HGNC	protein_coding	OTTHUMT00000276786.1	0	0	0	112	112	198	0.00	0.00	C	NM_152447		42356845	+1	6	11	67	86	tier1	no_errors	ENST00000298119	ensembl	human	known	74_37	silent	8.22	11.34	SNP	0.999	T	6	67
NCOA4	8031	genome.wustl.edu	37	10	51585393	51585393	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr10:51585393C>T	ENST00000443446.1	+	8	1721	c.1492C>T	c.(1492-1494)Ctt>Ttt	p.L498F	NCOA4_ENST00000430396.2_Missense_Mutation_p.L398F|NCOA4_ENST00000452682.1_Missense_Mutation_p.L514F|NCOA4_ENST00000374087.4_Missense_Mutation_p.L498F|NCOA4_ENST00000374082.1_Missense_Mutation_p.L498F|NCOA4_ENST00000414907.2_Missense_Mutation_p.L332F|NCOA4_ENST00000438493.1_Missense_Mutation_p.L514F|NCOA4_ENST00000344348.6_Missense_Mutation_p.L498F	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	498					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GTCGGAGTGGCTTATCAGGCC	0.443			T	RET	papillary thyroid								ENSG00000138293																												Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	0													86.0	95.0	92.0					10																	51585393		2203	4300	6503	SO:0001583	missense	0			-	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1492C>T	10.37:g.51585393C>T	ENSP00000390713:p.Leu498Phe		A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	pfam_ARA70	p.L514F	ENST00000443446.1	37	c.1540	CCDS7237.1	10	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512582	0.64522	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31;1.31	6.16	6.16	0.99307	.	0.210828	0.41938	D	0.000799	T	0.54029	0.1833	M	0.68952	2.095	0.47659	D	0.999482	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.68765	0.96;0.96;0.96;0.96	T	0.52756	-0.8533	9	.	.	.	-21.1684	9.8046	0.40786	0.1404:0.7906:0.0:0.069	.	398;514;514;498	B4DF87;B4E260;E9PAV7;Q13772	.;.;.;NCOA4_HUMAN	F	514;514;398;498;332;498;498;498	ENSP00000405146:L514F;ENSP00000395465:L514F;ENSP00000393053:L398F;ENSP00000363200:L498F;ENSP00000411018:L332F;ENSP00000344552:L498F;ENSP00000363195:L498F;ENSP00000390713:L498F	.	L	+	1	0	NCOA4	51255399	1.000000	0.71417	0.990000	0.47175	0.549000	0.35272	2.148000	0.42235	2.937000	0.99478	0.650000	0.86243	CTT	-	NCOA4	-	NULL		0.443	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA4	HGNC	protein_coding	OTTHUMT00000048052.1	0	0	0	121	121	76	0.00	0.00	C	NM_005437		51585393	+1	46	27	45	17	tier1	no_errors	ENST00000452682	ensembl	human	known	74_37	missense	50.55	61.36	SNP	1.000	T	46	45
SCN8A	6334	genome.wustl.edu	37	12	52162854	52162854	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr12:52162854A>C	ENST00000354534.6	+	17	3285	c.3107A>C	c.(3106-3108)gAg>gCg	p.E1036A	SCN8A_ENST00000545061.1_Missense_Mutation_p.E1036A	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1036					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CCTCTGGATGAGTTGTATGAA	0.532													ENSG00000196876																																					0													68.0	71.0	70.0					12																	52162854		2100	4235	6335	SO:0001583	missense	0			-	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.3107A>C	12.37:g.52162854A>C	ENSP00000346534:p.Glu1036Ala		B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.E1036A	ENST00000354534.6	37	c.3107	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	A	14.97	2.692875	0.48202	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D	0.83914	-1.78;-1.78;-1.78	4.55	4.55	0.56014	Sodium ion transport-associated (1);	0.311519	0.35207	N	0.003369	D	0.85566	0.5726	M	0.75777	2.31	0.80722	D	1	P;P	0.48834	0.916;0.584	P;B	0.49708	0.62;0.393	D	0.84080	0.0384	10	0.24483	T	0.36	.	14.9638	0.71176	1.0:0.0:0.0:0.0	.	1036;1036	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	A	1036;1036;1036;949	ENSP00000346534:E1036A;ENSP00000440360:E1036A;ENSP00000347255:E1036A	ENSP00000346534:E1036A	E	+	2	0	SCN8A	50449121	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	8.916000	0.92745	2.272000	0.75746	0.460000	0.39030	GAG	-	SCN8A	-	pfam_Na_trans_assoc,prints_Na_channel_a8su		0.532	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	0	0	0	43	43	92	0.00	0.00	A	NM_014191		52162854	+1	6	5	36	43	tier1	no_errors	ENST00000354534	ensembl	human	known	74_37	missense	14.29	10.42	SNP	1.000	C	6	36
WNT2	7472	genome.wustl.edu	37	7	116960808	116960808	+	Silent	SNP	G	G	A	rs140391205		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr7:116960808G>A	ENST00000265441.3	-	2	422	c.123C>T	c.(121-123)tgC>tgT	p.C41C	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	41					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		GCACATTATCGCACATCACCC	0.597													ENSG00000105989																																					0								G		1,4405	2.1+/-5.4	0,1,2202	53.0	45.0	48.0		123	2.9	1.0	7	dbSNP_134	48	0,8600		0,0,4300	no	coding-synonymous	WNT2	NM_003391.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		41/361	116960808	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.123C>T	7.37:g.116960808G>A			A4D0V1|Q75N05|Q9UDP9	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.C41	ENST00000265441.3	37	c.123	CCDS5771.1	7																																																																																			rs140391205	WNT2	-	pfam_Wnt,prints_Wnt2		0.597	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2	HGNC	protein_coding	OTTHUMT00000059749.3	0	0	0	22	22	63	0.00	0.00	G	NM_003391		116960808	-1	6	5	10	21	tier1	no_errors	ENST00000265441	ensembl	human	known	74_37	silent	37.50	19.23	SNP	1.000	A	6	10
SYNJ2BP	55333	genome.wustl.edu	37	14	70839377	70839377	+	3'UTR	SNP	C	C	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr14:70839377C>G	ENST00000256366.4	-	0	850				SYNJ2BP-COX16_ENST00000555276.1_RNA|SYNJ2BP_ENST00000554216.1_5'UTR	NM_018373.2	NP_060843.2	P57105	SYJ2B_HUMAN	synaptojanin 2 binding protein						intracellular distribution of mitochondria (GO:0048312)|negative regulation of activin receptor signaling pathway (GO:0032926)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of receptor internalization (GO:0002092)	cell surface (GO:0009986)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)				central_nervous_system(1)|kidney(2)|large_intestine(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.00367)|BRCA - Breast invasive adenocarcinoma(234;0.00716)|OV - Ovarian serous cystadenocarcinoma(108;0.0377)		TATGGCATGCCAGCTAAGAAA	0.338													ENSG00000213463																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK002133	CCDS9803.1	14q24.2	2013-05-10			ENSG00000213463	ENSG00000213463			18955	protein-coding gene	gene with protein product	"""activin receptor interacting protein 5"""	609411				11882656	Standard	NM_018373		Approved	Arip2		P57105	OTTHUMG00000171240	ENST00000256366.4:c.*331G>C	14.37:g.70839377C>G			Q49SH3|Q96IA4	R	SNP	-	NULL	ENST00000256366.4	37	NULL	CCDS9803.1	14																																																																																			-	SYNJ2BP	-	-		0.338	SYNJ2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2BP	HGNC	protein_coding	OTTHUMT00000412472.1	0	0	0	82	82	106	0.00	0.00	C	NM_018373		70839377	-1	12	6	54	33	tier1	no_errors	ENST00000554216	ensembl	human	putative	74_37	rna	18.18	15.38	SNP	0.479	G	12	54
TANGO6	79613	genome.wustl.edu	37	16	68894024	68894024	+	Missense_Mutation	SNP	G	G	A	rs199965791		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr16:68894024G>A	ENST00000261778.1	+	2	344	c.332G>A	c.(331-333)cGc>cAc	p.R111H		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	111						integral component of membrane (GO:0016021)											ACCATGATCCGCCTTGCAGCT	0.478													ENSG00000103047	g|||	1	0.000199681	0.0	0.0	5008	,	,		19778	0.0		0.0	False		,,,				2504	0.001																0								T	HIS/ARG	5,3905		0,5,1950	189.0	182.0	185.0		332	-10.2	0.0	16		185	16,8292		0,16,4138	yes	missense	TMCO7	NM_024562.1	29	0,21,6088	AA,AG,GG		0.1926,0.1279,0.1719	benign	111/1095	68894024	21,12197	1955	4154	6109	SO:0001583	missense	0			-		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.332G>A	16.37:g.68894024G>A	ENSP00000261778:p.Arg111His		Q569F9|Q9H9K1	Missense_Mutation	SNP	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.R111H	ENST00000261778.1	37	c.332	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	g	0.033	-1.320855	0.01320	0.001279	0.001926	ENSG00000103047	ENST00000261778	.	.	.	5.41	-10.2	0.00374	.	.	.	.	.	T	0.13200	0.0320	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.29518	-1.0009	8	0.41790	T	0.15	0.4957	6.6906	0.23169	0.4194:0.0:0.2917:0.2888	.	111	Q9C0B7	TMCO7_HUMAN	H	111	.	ENSP00000261778:R111H	R	+	2	0	TMCO7	67451525	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.628000	0.05515	-2.002000	0.00963	-3.105000	0.00063	CGC	rs199965791	TANGO6	-	NULL		0.478	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	HGNC	protein_coding	OTTHUMT00000433471.2	0	0	0	56	56	158	0.00	0.00	G	XM_928235.2		68894024	+1	15	30	41	106	tier1	no_errors	ENST00000261778	ensembl	human	known	74_37	missense	26.79	22.06	SNP	0.000	A	15	41
GPR124	25960	genome.wustl.edu	37	8	37696483	37696483	+	Missense_Mutation	SNP	G	G	A	rs143113584		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr8:37696483G>A	ENST00000412232.2	+	15	2282	c.2269G>A	c.(2269-2271)Gcc>Acc	p.A757T	GPR124_ENST00000315215.7_Missense_Mutation_p.A540T	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	757	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GGAGCTGAGCGCCTTTCCCAG	0.672													ENSG00000020181																																					0								G	THR/ALA	0,4406		0,0,2203	33.0	36.0	35.0		2269	2.2	0.2	8	dbSNP_134	35	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GPR124	NM_032777.9	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	757/1339	37696483	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2269G>A	8.37:g.37696483G>A	ENSP00000406367:p.Ala757Thr		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.A757T	ENST00000412232.2	37	c.2269	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	G	6.071	0.381330	0.11466	0.0	1.16E-4	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.58210	0.35;0.45	5.37	2.16	0.27623	GPS domain (2);	0.528406	0.20165	N	0.097878	T	0.22781	0.0550	N	0.02539	-0.55	0.09310	N	1	B;B	0.15473	0.013;0.001	B;B	0.09377	0.004;0.0	T	0.19353	-1.0308	10	0.14656	T	0.56	-13.0176	9.8117	0.40826	0.364:0.0:0.6359:0.0	.	540;757	Q96PE1-2;Q96PE1	.;GP124_HUMAN	T	750;540;757	ENSP00000323508:A540T;ENSP00000406367:A757T	ENSP00000323508:A540T	A	+	1	0	GPR124	37815641	0.078000	0.21339	0.241000	0.24154	0.108000	0.19459	0.717000	0.25851	0.670000	0.31165	-1.049000	0.02347	GCC	rs143113584	GPR124	-	pfscan_GPS_dom		0.672	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	HGNC	protein_coding	OTTHUMT00000343331.2	0	0	0	70	70	39	0.00	0.00	G			37696483	+1	11	7	50	27	tier1	no_errors	ENST00000412232	ensembl	human	known	74_37	missense	18.03	20.59	SNP	0.016	A	11	50
ZNF707	286075	genome.wustl.edu	37	8	144776688	144776688	+	Silent	SNP	C	C	T	rs371296133	byFrequency	TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr8:144776688C>T	ENST00000532205.1	+	8	2003	c.1104C>T	c.(1102-1104)caC>caT	p.H368H	ZNF707_ENST00000532158.1_Silent_p.H368H|ZNF707_ENST00000358656.4_Silent_p.H368H|ZNF707_ENST00000418203.2_Silent_p.H368H|RP11-429J17.2_ENST00000531565.1_RNA|ZNF707_ENST00000454097.1_Silent_p.H368H			Q96C28	ZN707_HUMAN	zinc finger protein 707	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H368H(1)		breast(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CTCACAGGCACGGGGAGGTGT	0.632													ENSG00000181135	C|||	3	0.000599042	0.0023	0.0	5008	,	,		16201	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	endometrium(1)						C	,,	3,4165		0,3,2081	19.0	22.0	21.0		1104,1104,1104	-5.4	0.0	8		21	6,8420		0,6,4207	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF707	NM_001100598.1,NM_001100599.1,NM_173831.3	,,	0,9,6288	TT,TC,CC		0.0712,0.072,0.0715	,,	368/372,368/372,368/372	144776688	9,12585	2084	4213	6297	SO:0001819	synonymous_variant	0			-	AK001126	CCDS47932.1	8q24.3	2013-01-08				ENSG00000181135		"""Zinc fingers, C2H2-type"", ""-"""	27815	protein-coding gene	gene with protein product						12477932	Standard	NM_173831		Approved		uc010mfi.3	Q96C28		ENST00000532205.1:c.1104C>T	8.37:g.144776688C>T			A8K317|B3KNY1|D3DWK7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H368	ENST00000532205.1	37	c.1104	CCDS47932.1	8																																																																																			-	ZNF707	-	NULL		0.632	ZNF707-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF707	HGNC	protein_coding	OTTHUMT00000382197.1	0	0	0	99	99	53	0.00	0.00	C	NM_173831		144776688	+1	36	19	41	35	tier1	no_errors	ENST00000358656	ensembl	human	known	74_37	silent	46.75	35.19	SNP	0.000	T	36	41
SCN2A	6326	genome.wustl.edu	37	2	166245201	166245201	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:166245201C>T	ENST00000375437.2	+	27	5175	c.4885C>T	c.(4885-4887)Cgt>Tgt	p.R1629C	SCN2A_ENST00000375427.2_Missense_Mutation_p.R1629C|SCN2A_ENST00000283256.6_Missense_Mutation_p.R1629C|SCN2A_ENST00000357398.3_Missense_Mutation_p.R1629C	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1629			R -> L (in EIEE11). {ECO:0000269|PubMed:23935176}.		intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCGAGTGATCCGTCTTGCCAG	0.433													ENSG00000136531																																					0													110.0	111.0	111.0					2																	166245201		2203	4300	6503	SO:0001583	missense	0			-	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4885C>T	2.37:g.166245201C>T	ENSP00000364586:p.Arg1629Cys		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R1629C	ENST00000375437.2	37	c.4885	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319556	0.60524	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98617	-5.03;-5.03;-5.03;-5.03	5.49	5.49	0.81192	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99691	0.9883	H	0.99946	5.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.977	D	0.96880	0.9645	10	0.87932	D	0	.	19.8035	0.96518	0.0:1.0:0.0:0.0	.	1629;1629	Q99250-2;Q99250	.;SCN2A_HUMAN	C	1629	ENSP00000364586:R1629C;ENSP00000349973:R1629C;ENSP00000283256:R1629C;ENSP00000364576:R1629C	ENSP00000283256:R1629C	R	+	1	0	SCN2A	165953447	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.813000	0.55636	2.751000	0.94390	0.552000	0.68991	CGT	-	SCN2A	-	pfam_Ion_trans_dom		0.433	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	0	0	1	220	220	93	0.00	1.06	C	NM_021007		166245201	+1	23	9	132	34	tier1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	14.84	20.93	SNP	1.000	T	23	132
SLC17A4	10050	genome.wustl.edu	37	6	25777120	25777120	+	Silent	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr6:25777120C>T	ENST00000377905.4	+	10	1320	c.1201C>T	c.(1201-1203)Ctg>Ttg	p.L401L	SLC17A4_ENST00000397076.2_Silent_p.L199L|SLC17A4_ENST00000439485.2_Silent_p.L171L	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	401					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CTTCTTGGTGCTGTCTTCTGC	0.532													ENSG00000146039																																					0													151.0	130.0	137.0					6																	25777120		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1201C>T	6.37:g.25777120C>T			B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L401	ENST00000377905.4	37	c.1201	CCDS4564.1	6																																																																																			-	SLC17A4	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.532	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	HGNC	protein_coding	OTTHUMT00000040068.1	0	0	0	38	38	59	0.00	0.00	C			25777120	+1	7	12	21	45	tier1	no_errors	ENST00000377905	ensembl	human	known	74_37	silent	25.00	21.05	SNP	0.000	T	7	21
PLA2G4E	123745	genome.wustl.edu	37	15	42302375	42302375	+	Missense_Mutation	SNP	G	G	A	rs535569211		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr15:42302375G>A	ENST00000413860.2	-	1	70	c.71C>T	c.(70-72)cCg>cTg	p.P24L	CTD-2382E5.2_ENST00000552704.1_RNA|PLA2G4E_ENST00000399518.3_Intron			Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	34					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		GTCTGTCTCCGGTACGCTGGG	0.602													ENSG00000188089	G|||	1	0.000199681	0.0	0.0	5008	,	,		14077	0.001		0.0	False		,,,				2504	0.0																0													74.0	84.0	81.0					15																	42302375		1874	4099	5973	SO:0001583	missense	0			-		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000413860.2:c.71C>T	15.37:g.42302375G>A	ENSP00000413897:p.Pro24Leu		Q6ZSC0	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.P24L	ENST00000413860.2	37	c.71		15	.	.	.	.	.	.	.	.	.	.	G	9.180	1.023309	0.19433	.	.	ENSG00000188089	ENST00000413860	T	0.01484	4.84	3.51	1.18	0.20946	.	.	.	.	.	T	0.01523	0.0049	.	.	.	0.09310	N	1	B	0.24317	0.101	B	0.14578	0.011	T	0.47032	-0.9148	8	0.72032	D	0.01	.	3.8465	0.08937	0.0:0.1175:0.2228:0.6597	.	24	C9JK77	.	L	24	ENSP00000413897:P24L	ENSP00000413897:P24L	P	-	2	0	PLA2G4E	40089667	0.013000	0.17824	0.005000	0.12908	0.001000	0.01503	0.522000	0.22909	0.237000	0.21200	-0.364000	0.07487	CCG	-	PLA2G4E	-	NULL		0.602	PLA2G4E-201	KNOWN	basic	protein_coding	PLA2G4E	HGNC	protein_coding		0	0	1	161	161	65	0.00	1.52	G	NM_198442		42302375	-1	18	9	136	38	tier1	no_errors	ENST00000413860	ensembl	human	known	74_37	missense	11.61	19.15	SNP	0.006	A	18	136
SP140	11262	genome.wustl.edu	37	2	231109717	231109717	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:231109717T>C	ENST00000392045.3	+	6	700	c.586T>C	c.(586-588)Tct>Cct	p.S196P	SP140_ENST00000343805.6_Missense_Mutation_p.S196P|SP140_ENST00000350136.5_Missense_Mutation_p.S176P|SP140_ENST00000486687.2_Missense_Mutation_p.S196P|SP140_ENST00000420434.3_Missense_Mutation_p.S196P|SP140_ENST00000417495.3_Missense_Mutation_p.S196P	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	196					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CTCTTCAGAGTCTTGTGAGCA	0.493													ENSG00000079263																																					0													136.0	127.0	130.0					2																	231109717		1949	4171	6120	SO:0001583	missense	0			-	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.586T>C	2.37:g.231109717T>C	ENSP00000375899:p.Ser196Pro		E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.S196P	ENST00000392045.3	37	c.586	CCDS42831.1	2	.	.	.	.	.	.	.	.	.	.	T	9.250	1.040450	0.19669	.	.	ENSG00000079263	ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.58940	0.67;0.73;0.59;0.3;0.54	2.48	1.25	0.21368	.	.	.	.	.	T	0.51363	0.1670	N	0.24115	0.695	0.09310	N	1	D;D;D;D;P	0.61080	0.963;0.978;0.987;0.989;0.808	B;B;P;P;B	0.56278	0.425;0.278;0.696;0.795;0.362	T	0.37337	-0.9710	9	0.62326	D	0.03	1.5666	4.6696	0.12682	0.2822:0.0:0.0:0.7178	.	196;196;196;196;196	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75	.;.;.;LY10_HUMAN;.	P	196;196;176;196;196;196;196	ENSP00000440107:S196P;ENSP00000345846:S176P;ENSP00000375899:S196P;ENSP00000342096:S196P;ENSP00000398210:S196P	ENSP00000342096:S196P	S	+	1	0	SP140	230817961	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.161000	0.16481	0.347000	0.23924	0.523000	0.50628	TCT	-	SP140	-	NULL		0.493	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	HGNC	protein_coding	OTTHUMT00000332015.1	0	0	0	58	58	124	0.00	0.00	T	NM_007237		231109717	+1	17	8	26	49	tier1	no_errors	ENST00000392045	ensembl	human	known	74_37	missense	39.53	14.04	SNP	0.001	C	17	26
TULP2	7288	genome.wustl.edu	37	19	49399789	49399789	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr19:49399789G>C	ENST00000221399.3	-	4	253	c.109C>G	c.(109-111)Cga>Gga	p.R37G		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	37					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		CGCTTCTGTCGCTGCTTCTTT	0.612													ENSG00000104804																																					0													37.0	38.0	37.0					19																	49399789		2203	4300	6503	SO:0001583	missense	0			-	U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.109C>G	19.37:g.49399789G>C	ENSP00000221399:p.Arg37Gly		Q8TC50	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C,prints_Tubby_N	p.R37G	ENST00000221399.3	37	c.109	CCDS12739.1	19	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793606	0.70452	.	.	ENSG00000104804	ENST00000221399;ENST00000518572;ENST00000522945;ENST00000520977	D;T;T;T	0.87887	-2.31;1.48;0.8;-0.32	5.03	3.93	0.45458	Tubby, N-terminal (1);	0.861105	0.10352	N	0.684980	D	0.91415	0.7291	L	0.54323	1.7	0.38078	D	0.936599	D	0.89917	1.0	D	0.87578	0.998	D	0.89897	0.4041	10	0.87932	D	0	-16.2267	11.4063	0.49900	0.0:0.0:0.7276:0.2724	.	37	O00295	TULP2_HUMAN	G	37;37;37;18	ENSP00000221399:R37G;ENSP00000428420:R37G;ENSP00000430040:R37G;ENSP00000428535:R18G	ENSP00000221399:R37G	R	-	1	2	TULP2	54091601	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	1.660000	0.37397	2.499000	0.84300	0.596000	0.82720	CGA	-	TULP2	-	prints_Tubby_N		0.612	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP2	HGNC	protein_coding	OTTHUMT00000378633.1	0	0	0	111	111	50	0.00	0.00	G	NM_003323		49399789	-1	27	8	90	36	tier1	no_errors	ENST00000221399	ensembl	human	known	74_37	missense	23.08	18.18	SNP	1.000	C	27	90
PMS1	5378	genome.wustl.edu	37	2	190660493	190660495	+	Splice_Site	DEL	AGG	AGG	-			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	AGG	AGG	AGG	-	AGG	AGG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:190660493_190660495delAGG	ENST00000441310.2	+	3	365_366	c.132_133delAGG	c.(130-135)ctagga>ctga	p.G45del	PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000432292.3_Intron|PMS1_ENST00000409823.3_Splice_Site_p.G45del|PMS1_ENST00000418224.3_5'UTR|PMS1_ENST00000447232.2_Splice_Site_p.G45del|PMS1_ENST00000409985.1_Splice_Site_p.G45del|PMS1_ENST00000374826.4_Splice_Site_p.G45del	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	45					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			GACATTTTATAGGAGAACTATGG	0.31			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)					ENSG00000064933																											yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0																																										SO:0001630	splice_region_variant	0					CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.133-1AGG>-	2.37:g.190660493_190660495delAGG			D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Splice_Site	DEL	-	e2-1	ENST00000441310.2	37	c.133-2_133-1	CCDS2302.1	2																																																																																				PMS1	-	-		0.310	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	0	0	0	189	189	99	0.00	0.00	AGG		In_Frame_Del	190660495	+1	14	7	105	49	tier1	no_errors	ENST00000441310	ensembl	human	known	74_37	splice_site_del	11.76	12.50	DEL	0.998:1.000:1.000	-	14	105
ABTB2	25841	genome.wustl.edu	37	11	34194817	34194817	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr11:34194817G>A	ENST00000435224.2	-	4	1706	c.1282C>T	c.(1282-1284)Cgc>Tgc	p.R428C	ABTB2_ENST00000298992.2_Missense_Mutation_p.R242C|ABTB2_ENST00000530814.1_5'UTR	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	428					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				ATGGCCACGCGCATCCACTCC	0.692													ENSG00000166016																																					0													16.0	17.0	17.0					11																	34194817		2201	4296	6497	SO:0001583	missense	0			-	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.1282C>T	11.37:g.34194817G>A	ENSP00000410157:p.Arg428Cys		A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Histone-fold,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.R428C	ENST00000435224.2	37	c.1282	CCDS7890.2	11	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419560	0.83559	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.71817	-0.56;-0.6	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.84023	0.5381	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86031	0.1513	10	0.87932	D	0	-15.3747	15.3726	0.74577	0.0:0.0:0.8601:0.1399	.	242	Q8N961	ABTB2_HUMAN	C	428;242	ENSP00000410157:R428C;ENSP00000298992:R242C	ENSP00000298992:R242C	R	-	1	0	ABTB2	34151393	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	2.500000	0.45381	2.481000	0.83766	0.561000	0.74099	CGC	-	ABTB2	-	NULL		0.692	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	HGNC	protein_coding	OTTHUMT00000388703.3	0	0	0	93	93	14	0.00	0.00	G	NM_145804		34194817	-1	16	2	57	3	tier1	no_errors	ENST00000435224	ensembl	human	known	74_37	missense	21.92	40.00	SNP	1.000	A	16	57
LIAS	11019	genome.wustl.edu	37	4	39482041	39482041	+	IGR	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr4:39482041C>T	ENST00000261434.3	+	0	1775				RP11-472B18.1_ENST00000513652.1_RNA	NM_006859.2	NP_006850.2			lipoic acid synthetase											breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)|ovary(2)	12						CGCAGCAGCCCGGCAGACTGC	0.647													ENSG00000224097																																					0																																										SO:0001628	intergenic_variant	0			-	AJ224162	CCDS3453.1, CCDS3454.1, CCDS63950.1	4p14	2008-02-05			ENSG00000121897	ENSG00000121897			16429	protein-coding gene	gene with protein product		607031				11124703	Standard	NM_006859		Approved	LAS	uc003guf.3	O43766	OTTHUMG00000099369		4.37:g.39482041C>T				R	SNP	-	NULL	ENST00000261434.3	37	NULL	CCDS3453.1	4																																																																																			-	RP11-472B18.1	-	-		0.647	LIAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC401127	Clone_based_vega_gene	protein_coding	OTTHUMT00000216815.1	0	0	0	23	23	9	0.00	0.00	C	NM_194451		39482041	+1	5	2	27	0	tier1	no_errors	ENST00000513652	ensembl	human	known	74_37	rna	15.62	100.00	SNP	0.015	T	5	27
SYNPO2L	79933	genome.wustl.edu	37	10	75407274	75407274	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr10:75407274C>A	ENST00000394810.2	-	4	2285	c.2136G>T	c.(2134-2136)aaG>aaT	p.K712N	SYNPO2L_ENST00000372873.4_Missense_Mutation_p.K488N	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	712	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					GGGGCGGGGTCTTGGGAGCCA	0.622													ENSG00000166317																																					0													50.0	62.0	58.0					10																	75407274		2203	4300	6503	SO:0001583	missense	0			-	AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.2136G>T	10.37:g.75407274C>A	ENSP00000378289:p.Lys712Asn		A5PKV9|Q68A20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K712N	ENST00000394810.2	37	c.2136	CCDS44438.1	10	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977169	0.34848	.	.	ENSG00000166317	ENST00000372873;ENST00000394810	T;T	0.23552	1.9;2.24	5.16	4.25	0.50352	.	0.121946	0.37053	N	0.002279	T	0.29389	0.0732	L	0.44542	1.39	0.33783	D	0.624547	P;P	0.50617	0.671;0.937	B;P	0.50754	0.203;0.649	T	0.34527	-0.9825	10	0.19147	T	0.46	-9.4066	12.921	0.58232	0.0:0.9208:0.0:0.0792	.	712;488	Q9H987;Q9H987-2	SYP2L_HUMAN;.	N	488;712	ENSP00000361964:K488N;ENSP00000378289:K712N	ENSP00000361964:K488N	K	-	3	2	SYNPO2L	75077280	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	0.540000	0.23191	1.373000	0.46208	0.561000	0.74099	AAG	-	SYNPO2L	-	NULL		0.622	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNPO2L	HGNC	protein_coding	OTTHUMT00000316562.2	0	0	0	15	15	7	0.00	0.00	C	NM_024875		75407274	-1	6	2	19	2	tier1	no_errors	ENST00000394810	ensembl	human	known	74_37	missense	24.00	50.00	SNP	1.000	A	6	19
VPS39	23339	genome.wustl.edu	37	15	42479973	42479973	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr15:42479973C>T	ENST00000348544.4	-	7	456	c.457G>A	c.(457-459)Gaa>Aaa	p.E153K	VPS39_ENST00000318006.5_Missense_Mutation_p.E142K			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	153	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		TCATGAAATTCCCTGTCCTTC	0.512													ENSG00000166887																																					0													228.0	227.0	228.0					15																	42479973		2203	4299	6502	SO:0001583	missense	0			-	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.457G>A	15.37:g.42479973C>T	ENSP00000335193:p.Glu153Lys		O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	pfam_Citron,pfam_VPS39/TGF_beta_rcpt-assoc_2,pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,smart_Citron	p.E153K	ENST00000348544.4	37	c.457	CCDS10083.1	15	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323359	0.60634	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.16597	2.33;2.33	4.95	4.95	0.65309	Citron-like (2);	0.056898	0.64402	D	0.000001	T	0.19087	0.0458	L	0.45581	1.43	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.15052	0.012;0.007	T	0.03000	-1.1084	10	0.30854	T	0.27	-10.1613	18.5746	0.91150	0.0:1.0:0.0:0.0	.	153;142	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	K	142;153	ENSP00000326534:E142K;ENSP00000335193:E153K	ENSP00000326534:E142K	E	-	1	0	VPS39	40267265	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.359000	0.79477	2.449000	0.82847	0.655000	0.94253	GAA	-	VPS39	-	pfam_Citron,superfamily_WD40_repeat_dom,smart_Citron		0.512	VPS39-002	KNOWN	basic|CCDS	protein_coding	VPS39	HGNC	protein_coding	OTTHUMT00000420472.1	0	0	0	54	54	147	0.00	0.00	C	NM_015289		42479973	-1	4	8	38	78	tier1	no_errors	ENST00000348544	ensembl	human	known	74_37	missense	9.52	9.30	SNP	1.000	T	4	38
KMT2C	58508	genome.wustl.edu	37	7	151833996	151833996	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr7:151833996T>G	ENST00000262189.6	-	59	14875	c.14657A>C	c.(14656-14658)tAt>tCt	p.Y4886S	KMT2C_ENST00000355193.2_Missense_Mutation_p.Y4943S|KMT2C_ENST00000485655.2_Missense_Mutation_p.Y91S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4886	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GTCAAACTTATAGTCATAGCA	0.473													ENSG00000055609																																					0													94.0	80.0	85.0					7																	151833996		2203	4300	6503	SO:0001583	missense	0			-	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14657A>C	7.37:g.151833996T>G	ENSP00000262189:p.Tyr4886Ser		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Y4943S	ENST00000262189.6	37	c.14828	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	T	13.67	2.307398	0.40795	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000485655;ENST00000424877	D;D;D;D	0.98968	-5.28;-5.28;-5.28;-5.28	5.19	5.19	0.71726	SET domain (3);	0.000000	0.39083	U	0.001480	D	0.99573	0.9846	H	0.99545	4.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97507	1.0064	10	0.87932	D	0	.	15.3533	0.74405	0.0:0.0:0.0:1.0	.	4886;4000	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	S	4886;4943;91;1499	ENSP00000262189:Y4886S;ENSP00000347325:Y4943S;ENSP00000439909:Y91S;ENSP00000410411:Y1499S	ENSP00000262189:Y4886S	Y	-	2	0	MLL3	151464929	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.870000	0.87175	2.072000	0.62099	0.533000	0.62120	TAT	-	KMT2C	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	0	0	0	44	44	100	0.00	0.00	T			151833996	-1	4	3	34	57	tier1	no_errors	ENST00000355193	ensembl	human	known	74_37	missense	10.53	4.92	SNP	1.000	G	4	34
ARMCX1	51309	genome.wustl.edu	37	X	100808828	100808828	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chrX:100808828G>T	ENST00000372829.3	+	4	1286	c.915G>T	c.(913-915)caG>caT	p.Q305H		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	305						integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						CAGCTGTGCAGATGGCTGGGC	0.423													ENSG00000126947																																					0													146.0	99.0	115.0					X																	100808828		2203	4300	6503	SO:0001583	missense	0			-	AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.915G>T	X.37:g.100808828G>T	ENSP00000361917:p.Gln305His		Q53HK2|Q9H2Q0	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q305H	ENST00000372829.3	37	c.915	CCDS14487.1	X	.	.	.	.	.	.	.	.	.	.	g	13.87	2.366709	0.41902	.	.	ENSG00000126947	ENST00000372829;ENST00000538894	T	0.58358	0.34	3.21	2.34	0.29019	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	M	0.66939	2.045	0.42436	D	0.992698	D	0.89917	1.0	D	0.91635	0.999	T	0.62718	-0.6795	10	0.56958	D	0.05	-7.4303	5.558	0.17127	0.1573:0.0:0.8427:0.0	.	305	Q9P291	ARMX1_HUMAN	H	305;10	ENSP00000361917:Q305H	ENSP00000361917:Q305H	Q	+	3	2	ARMCX1	100695484	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.300000	0.33436	0.741000	0.32674	0.544000	0.68410	CAG	-	ARMCX1	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold		0.423	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX1	HGNC	protein_coding	OTTHUMT00000057561.1	0	0	0	53	53	203	0.00	0.00	G	NM_016608		100808828	+1	3	2	22	61	tier1	no_errors	ENST00000372829	ensembl	human	known	74_37	missense	12.00	3.17	SNP	1.000	T	3	22
LAMA1	284217	genome.wustl.edu	37	18	7015825	7015825	+	Missense_Mutation	SNP	C	C	A	rs201891641		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr18:7015825C>A	ENST00000389658.3	-	22	3115	c.3022G>T	c.(3022-3024)Gac>Tac	p.D1008Y		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1008	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GTTTCTGGGTCGCAGGTATTC	0.532													ENSG00000101680																																					0													117.0	110.0	112.0					18																	7015825		2203	4300	6503	SO:0001583	missense	0			-	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3022G>T	18.37:g.7015825C>A	ENSP00000374309:p.Asp1008Tyr			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.D1008Y	ENST00000389658.3	37	c.3022	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814980	0.32053	.	.	ENSG00000101680	ENST00000389658	T	0.58797	0.31	5.09	4.21	0.49690	EGF-like, laminin (3);	0.205916	0.39341	N	0.001383	T	0.78336	0.4267	H	0.94847	3.59	0.47819	D	0.999525	D	0.71674	0.998	D	0.67900	0.954	T	0.80455	-0.1375	10	0.87932	D	0	.	6.7961	0.23727	0.0:0.6895:0.1562:0.1543	.	1008	P25391	LAMA1_HUMAN	Y	1008	ENSP00000374309:D1008Y	ENSP00000374309:D1008Y	D	-	1	0	LAMA1	7005825	0.935000	0.31712	0.933000	0.37362	0.022000	0.10575	0.853000	0.27777	1.254000	0.44035	0.643000	0.83706	GAC	-	LAMA1	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin,pfscan_EGF_laminin		0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	0	0	0	45	45	83	0.00	0.00	C	NM_005559		7015825	-1	4	2	35	43	tier1	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	10.26	4.44	SNP	1.000	A	4	35
