#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
LILRB5	10990	genome.wustl.edu	37	19	54760201	54760201	+	Silent	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr19:54760201G>A	ENST00000316219.5	-	4	467	c.360C>T	c.(358-360)ttC>ttT	p.F120F	LILRB5_ENST00000449561.2_Silent_p.F120F|LILRB5_ENST00000450632.1_Intron|LILRB5_ENST00000345866.6_Intron	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	120	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTTCTGCATAGAATCCTAGCA	0.572													ENSG00000105609																																					0													59.0	63.0	61.0					19																	54760201		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.360C>T	19.37:g.54760201G>A			Q8N760	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F120	ENST00000316219.5	37	c.360	CCDS12885.1	19																																																																																			-	LILRB5	-	NULL		0.572	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	0	0	0	50	50	67	0.00	0.00	G			54760201	-1	25	44	45	64	tier1	no_errors	ENST00000449561	ensembl	human	known	74_37	silent	35.71	40.74	SNP	0.000	A	25	45
SRGAP3	9901	genome.wustl.edu	37	3	9055464	9055464	+	Missense_Mutation	SNP	C	C	T	rs547978979		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr3:9055464C>T	ENST00000383836.3	-	16	2303	c.1876G>A	c.(1876-1878)Gtg>Atg	p.V626M	SRGAP3_ENST00000433332.3_5'Flank|SRGAP3-AS1_ENST00000414633.1_RNA|SRGAP3_ENST00000360413.3_Missense_Mutation_p.V602M	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	626	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		ACAATGACCACGCGGGGAAGG	0.557			T	RAF1	pilocytic astrocytoma								ENSG00000196220	C|||	1	0.000199681	0.0008	0.0	5008	,	,		17488	0.0		0.0	False		,,,				2504	0.0							Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													152.0	139.0	144.0					3																	9055464		2203	4300	6503	SO:0001583	missense	0			-	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1876G>A	3.37:g.9055464C>T	ENSP00000373347:p.Val626Met		Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.V626M	ENST00000383836.3	37	c.1876	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678124	0.47886	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.19938	2.11;2.11	5.26	5.26	0.73747	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.350897	0.28853	N	0.013939	T	0.28234	0.0697	L	0.43554	1.36	0.32238	N	0.573092	P;P	0.48230	0.897;0.907	P;P	0.50109	0.498;0.631	T	0.30650	-0.9971	10	0.72032	D	0.01	.	13.4604	0.61223	0.1567:0.8433:0.0:0.0	.	602;626	O43295-2;O43295	.;SRGP2_HUMAN	M	626;602	ENSP00000373347:V626M;ENSP00000353587:V602M	ENSP00000353587:V602M	V	-	1	0	SRGAP3	9030464	0.830000	0.29337	1.000000	0.80357	0.981000	0.71138	1.473000	0.35387	2.465000	0.83290	0.655000	0.94253	GTG	-	SRGAP3	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.557	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	0	0	0	77	77	98	0.00	0.00	C			9055464	-1	32	30	61	70	tier1	no_errors	ENST00000383836	ensembl	human	known	74_37	missense	34.41	30.00	SNP	0.985	T	32	61
S1PR1	1901	genome.wustl.edu	37	1	101704603	101704603	+	Silent	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:101704603C>T	ENST00000305352.6	+	2	438	c.63C>T	c.(61-63)aaC>aaT	p.N21N	RP4-575N6.4_ENST00000432195.1_RNA|S1PR1_ENST00000475821.1_3'UTR	NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	21					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						ACTACGTCAACTATGATATCA	0.577											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000170989																																					0													64.0	62.0	62.0					1																	101704603		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.63C>T	1.37:g.101704603C>T		1360	D3DT66|Q9BYY4|Q9NYN8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_EDG1_rcpt,prints_S1P_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.N21	ENST00000305352.6	37	c.63	CCDS777.1	1																																																																																			-	S1PR1	-	prints_S1P_rcpt		0.577	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR1	HGNC	protein_coding	OTTHUMT00000029908.1	0	0	0	39	39	48	0.00	0.00	C	NM_001400		101704603	+1	17	14	24	44	tier1	no_errors	ENST00000305352	ensembl	human	known	74_37	silent	41.46	24.14	SNP	1.000	T	17	24
LINC00910	100130581	genome.wustl.edu	37	17	41454985	41454985	+	IGR	SNP	T	T	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr17:41454985T>C								LINC00854 (71647 upstream) : LINC00910 (9608 downstream)																							AAGCCACACCTCCACCTCCCC	0.557													ENSG00000188825																																					0																																										SO:0001628	intergenic_variant	0			-																													17.37:g.41454985T>C				R	SNP	-	NULL		37	NULL		17																																																																																			-	LINC00910	-	-	0	0.557					LINC00910	HGNC			0	0	0	36	36	41	0.00	0.00	T			41454985	-1	10	4	48	30	tier1	no_errors	ENST00000587874	ensembl	human	known	74_37	rna	17.24	11.76	SNP	0.002	C	10	48
CFAP46	54777	genome.wustl.edu	37	10	134686254	134686254	+	Silent	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr10:134686254G>A	ENST00000368586.5	-	32	4537	c.4437C>T	c.(4435-4437)ccC>ccT	p.P1479P	TTC40_ENST00000368582.2_Silent_p.P1479P	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						ACTGCAGGACGGGAACCGTGA	0.552													ENSG00000171811																																					0																																										SO:0001819	synonymous_variant	0			-																												ENST00000368586.5:c.4437C>T	10.37:g.134686254G>A				Silent	SNP	NULL	p.P1479	ENST00000368586.5	37	c.4437	CCDS58101.1	10																																																																																			-	TTC40	-	NULL		0.552	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	0	0	0	38	38	71	0.00	0.00	G			134686254	-1	6	15	38	53	tier1	no_errors	ENST00000368582	ensembl	human	known	74_37	silent	13.64	22.06	SNP	0.000	A	6	38
AP003730.1	0	genome.wustl.edu	37	11	97783853	97783853	+	RNA	SNP	T	T	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr11:97783853T>A	ENST00000401254.2	-	0	36																											ttactttcagttgcagaaatt	0.348													ENSG00000216073																																					0																																												0			-																													11.37:g.97783853T>A				R	SNP	-	NULL	ENST00000401254.2	37	NULL		11																																																																																			-	AP003730.1	-	-		0.348	AP003730.1-201	NOVEL	basic	miRNA	ENSG00000216073	Clone_based_ensembl_gene	miRNA		0	0	0	27	27	13	0.00	0.00	T			97783853	-1	4	9	5	14	tier1	no_errors	ENST00000401254	ensembl	human	novel	74_37	rna	44.44	39.13	SNP	0.071	A	4	5
MYF5	4617	genome.wustl.edu	37	12	81111197	81111197	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr12:81111197C>T	ENST00000228644.3	+	1	507	c.355C>T	c.(355-357)Ccc>Tcc	p.P119S		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	119	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						CCAGAGGCTGCCCAAGGTGGA	0.587													ENSG00000111049																																					0													80.0	77.0	78.0					12																	81111197		2203	4300	6503	SO:0001583	missense	0			-		CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.355C>T	12.37:g.81111197C>T	ENSP00000228644:p.Pro119Ser		Q6ISR9	Missense_Mutation	SNP	pfam_Basic,pfam_Myf5,pfam_bHLH_dom,superfamily_bHLH_dom,smart_Basic,smart_bHLH_dom,pfscan_bHLH_dom	p.P119S	ENST00000228644.3	37	c.355	CCDS9020.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.101529	0.94245	.	.	ENSG00000111049	ENST00000228644	D	0.96200	-3.94	6.06	6.06	0.98353	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.95392	0.8504	N	0.12611	0.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95585	0.8650	10	0.46703	T	0.11	-8.3696	20.6208	0.99490	0.0:1.0:0.0:0.0	.	119	P13349	MYF5_HUMAN	S	119	ENSP00000228644:P119S	ENSP00000228644:P119S	P	+	1	0	MYF5	79635328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.882000	0.98803	0.655000	0.94253	CCC	-	MYF5	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom		0.587	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF5	HGNC	protein_coding	OTTHUMT00000407757.1	0	0	0	38	38	98	0.00	0.00	C	NM_005593		81111197	+1	11	30	55	83	tier1	no_errors	ENST00000228644	ensembl	human	known	74_37	missense	16.67	26.32	SNP	1.000	T	11	55
RYR1	6261	genome.wustl.edu	37	19	39075732	39075732	+	Silent	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr19:39075732C>T	ENST00000359596.3	+	102	14796	c.14796C>T	c.(14794-14796)atC>atT	p.I4932I	RYR1_ENST00000355481.4_Silent_p.I4927I|RYR1_ENST00000360985.3_Silent_p.I4927I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4932					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGTTGGCCATCATCCAGGGTC	0.597													ENSG00000196218																																					0													179.0	124.0	143.0					19																	39075732		2203	4300	6503	SO:0001819	synonymous_variant	0			-	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14796C>T	19.37:g.39075732C>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.I4932	ENST00000359596.3	37	c.14796	CCDS33011.1	19																																																																																			-	RYR1	-	pfam_Ion_trans_dom		0.597	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	0	0	0	40	40	68	0.00	0.00	C			39075732	+1	28	38	92	122	tier1	no_errors	ENST00000359596	ensembl	human	known	74_37	silent	23.33	23.75	SNP	1.000	T	28	92
KIF2B	84643	genome.wustl.edu	37	17	51901724	51901724	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr17:51901724T>C	ENST00000268919.4	+	1	1486	c.1330T>C	c.(1330-1332)Tcc>Ccc	p.S444P		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	444	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGGCAAGTTTTCCCTCGTTGA	0.507													ENSG00000141200																																					0													63.0	56.0	58.0					17																	51901724		2203	4300	6503	SO:0001583	missense	0			-	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1330T>C	17.37:g.51901724T>C	ENSP00000268919:p.Ser444Pro		Q96MA2|Q9BXG6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S444P	ENST00000268919.4	37	c.1330	CCDS32685.1	17	.	.	.	.	.	.	.	.	.	.	T	19.15	3.771006	0.69992	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.76709	-1.04	5.73	5.73	0.89815	Kinesin, motor domain (5);Kinesin, motor region, conserved site (1);	0.000000	0.44097	D	0.000496	D	0.92280	0.7551	H	0.97440	4.005	0.58432	D	0.99999	D	0.76494	0.999	D	0.79784	0.993	D	0.94786	0.7958	10	0.87932	D	0	.	15.5002	0.75691	0.0:0.0:0.0:1.0	.	444	Q8N4N8	KIF2B_HUMAN	P	444;332	ENSP00000268919:S444P	ENSP00000268919:S444P	S	+	1	0	KIF2B	49256723	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	6.146000	0.71777	2.302000	0.77476	0.533000	0.62120	TCC	-	KIF2B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom		0.507	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	0	0	0	35	35	58	0.00	0.00	T	NM_032559		51901724	+1	12	19	22	49	tier1	no_errors	ENST00000268919	ensembl	human	known	74_37	missense	35.29	27.94	SNP	1.000	C	12	22
LRP1	4035	genome.wustl.edu	37	12	57600488	57600488	+	Silent	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr12:57600488C>T	ENST00000243077.3	+	76	12289	c.11823C>T	c.(11821-11823)caC>caT	p.H3941H		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3941					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCAACCGCCACCGGCGACAGA	0.622													ENSG00000123384																																					0													79.0	61.0	67.0					12																	57600488		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.11823C>T	12.37:g.57600488C>T			Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.H3941	ENST00000243077.3	37	c.11823	CCDS8932.1	12																																																																																			-	LRP1	-	superfamily_Growth_fac_rcpt_N_dom		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	0	0	0	41	41	33	0.00	0.00	C	NM_002332		57600488	+1	10	7	26	20	tier1	no_errors	ENST00000243077	ensembl	human	known	74_37	silent	27.78	25.93	SNP	1.000	T	10	26
ABCB6	10058	genome.wustl.edu	37	2	220074953	220074953	+	Splice_Site	SNP	G	G	A	rs201568572		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:220074953G>A	ENST00000265316.3	-	18	2735	c.2419C>T	c.(2419-2421)Cga>Tga	p.R807*	ABCB6_ENST00000439002.2_Splice_Site_p.R761*	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	807	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTCTCTTACCGTCCCCTCTCC	0.552													ENSG00000115657																																					0													106.0	100.0	102.0					2																	220074953		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.2420+1C>T	2.37:g.220074953G>A			O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.R807*	ENST00000265316.3	37	c.2419	CCDS2436.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.513863	0.98843	.	.	ENSG00000115657	ENST00000265316;ENST00000439002	.	.	.	4.76	2.75	0.32379	.	0.108054	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.9748	11.1539	0.48476	0.0:0.0:0.4282:0.5718	.	.	.	.	X	807;761	.	ENSP00000265316:R807X	R	-	1	2	ABCB6	219783197	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	2.779000	0.47734	1.306000	0.44926	0.603000	0.83216	CGA	rs201568572	ABCB6	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.552	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB6	HGNC	protein_coding	OTTHUMT00000256820.2	0	0	0	63	63	82	0.00	0.00	G	NM_005689	Nonsense_Mutation	220074953	-1	23	15	42	50	tier1	no_errors	ENST00000265316	ensembl	human	known	74_37	nonsense	35.38	23.08	SNP	1.000	A	23	42
NID1	4811	genome.wustl.edu	37	1	236142371	236142371	+	Silent	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:236142371C>T	ENST00000264187.6	-	19	3628	c.3546G>A	c.(3544-3546)aaG>aaA	p.K1182K	NID1_ENST00000366595.3_Silent_p.K1049K	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	1182					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CATCCGTCTCCTTGGAAATTG	0.498													ENSG00000116962																																					0													129.0	116.0	121.0					1																	236142371		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.3546G>A	1.37:g.236142371C>T			Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.K1182	ENST00000264187.6	37	c.3546	CCDS1608.1	1																																																																																			-	NID1	-	NULL		0.498	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	0	0	1	37	37	68	0.00	1.45	C	NM_002508		236142371	-1	80	127	99	197	tier1	no_errors	ENST00000264187	ensembl	human	known	74_37	silent	44.69	39.20	SNP	0.813	T	80	99
DBF4	10926	genome.wustl.edu	37	7	87514432	87514432	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr7:87514432C>G	ENST00000265728.1	+	3	862	c.358C>G	c.(358-360)Cat>Gat	p.H120D		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	120	BRCT 1.				DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				CACTTCACCTCATCCCAGCCA	0.408													ENSG00000006634																																					0													79.0	76.0	77.0					7																	87514432		2203	4300	6503	SO:0001583	missense	0			-	AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.358C>G	7.37:g.87514432C>G	ENSP00000265728:p.His120Asp		A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Missense_Mutation	SNP	pfam_Znf_DBF,superfamily_BRCT_dom,smart_Znf_DBF	p.H120D	ENST00000265728.1	37	c.358	CCDS5611.1	7	.	.	.	.	.	.	.	.	.	.	C	9.085	1.000317	0.19121	.	.	ENSG00000006634	ENST00000265728	T	0.10668	2.85	5.43	4.49	0.54785	BRCT (1);	0.412442	0.27008	N	0.021392	T	0.06826	0.0174	L	0.27053	0.805	0.42541	D	0.993074	P	0.36874	0.572	B	0.27170	0.077	T	0.30297	-0.9983	10	0.41790	T	0.15	-15.412	10.7457	0.46179	0.1467:0.7118:0.1416:0.0	.	120	Q9UBU7	DBF4A_HUMAN	D	120	ENSP00000265728:H120D	ENSP00000265728:H120D	H	+	1	0	DBF4	87352368	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.259000	0.51515	2.550000	0.86006	0.591000	0.81541	CAT	-	DBF4	-	superfamily_BRCT_dom		0.408	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBF4	HGNC	protein_coding	OTTHUMT00000253678.1	0	0	0	39	39	28	0.00	0.00	C	NM_006716		87514432	+1	20	11	30	30	tier1	no_errors	ENST00000265728	ensembl	human	known	74_37	missense	40.00	26.19	SNP	1.000	G	20	30
LILRB5	10990	genome.wustl.edu	37	19	54756803	54756803	+	Missense_Mutation	SNP	C	C	T	rs146369950		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr19:54756803C>T	ENST00000316219.5	-	9	1509	c.1402G>A	c.(1402-1404)Gtc>Atc	p.V468I	CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000449561.2_Missense_Mutation_p.V469I|LILRB5_ENST00000450632.1_Missense_Mutation_p.V460I|LILRB5_ENST00000345866.6_Missense_Mutation_p.V369I	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	468					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGCAGCAGGACGAAGGCCACT	0.592													ENSG00000105609																																					0								C	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	183.0	124.0	144.0		1405,1105,1402	-5.2	0.0	19	dbSNP_134	144	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	LILRB5	NM_001081442.1,NM_001081443.1,NM_006840.3	29,29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign	469/592,369/492,468/591	54756803	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1402G>A	19.37:g.54756803C>T	ENSP00000320390:p.Val468Ile		Q8N760	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V460I	ENST00000316219.5	37	c.1378	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.195908	0.00299	0.0	2.33E-4	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00469	7.29;7.21;7.26;7.28	2.59	-5.19	0.02832	.	13.484300	0.00447	N	0.000086	T	0.00178	0.0005	N	0.00980	-1.08	0.09310	N	1	B;B;B;B	0.16396	0.007;0.017;0.013;0.012	B;B;B;B	0.15052	0.001;0.012;0.005;0.002	T	0.45086	-0.9285	10	0.13470	T	0.59	.	8.7076	0.34365	0.1383:0.6979:0.0:0.1639	.	460;369;469;468	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	I	468;460;469;369	ENSP00000320390:V468I;ENSP00000414225:V460I;ENSP00000406478:V469I;ENSP00000263430:V369I	ENSP00000320390:V468I	V	-	1	0	LILRB5	59448615	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-1.681000	0.01937	-2.362000	0.00609	-1.288000	0.01363	GTC	rs146369950	LILRB5	-	NULL		0.592	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	0	0	0	56	56	33	0.00	0.00	C			54756803	-1	15	7	66	49	tier1	no_errors	ENST00000450632	ensembl	human	known	74_37	missense	18.52	12.50	SNP	0.000	T	15	66
GCSAM	257144	genome.wustl.edu	37	3	111849257	111849257	+	Intron	SNP	A	A	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr3:111849257A>G	ENST00000308910.4	-	2	283				GCSAM_ENST00000484193.1_Intron|C3orf52_ENST00000467942.2_3'UTR	NM_001190259.1|NM_001190260.1|NM_152785.4	NP_001177188.1|NP_001177189.1|NP_689998.1	Q8N6F7	GCSAM_HUMAN	germinal center-associated, signaling and motility						negative regulation of lymphocyte migration (GO:2000402)|regulation of B cell receptor signaling pathway (GO:0050855)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|myosin II binding (GO:0045159)|protein kinase binding (GO:0019901)										TCCTTGGGCAAGGTCTGGGGG	0.488													ENSG00000114529																																					0													178.0	181.0	180.0					3																	111849257		2203	4300	6503	SO:0001627	intron_variant	0			-	BC030506	CCDS2964.1, CCDS54621.1, CCDS54622.1	3q13.13	2012-09-03	2012-08-23	2012-08-23	ENSG00000174500	ENSG00000174500			20253	protein-coding gene	gene with protein product	"""human germinal center-associated lymphoma"""	607792	"""germinal center expressed transcript 2"""	GCET2			Standard	NM_152785		Approved	MGC40441, HGAL	uc021xcl.1	Q8N6F7	OTTHUMG00000159231	ENST00000308910.4:c.98+34T>C	3.37:g.111849257A>G			C9JD17|C9JUG6	R	SNP	-	NULL	ENST00000308910.4	37	NULL	CCDS2964.1	3																																																																																			-	C3orf52	-	-		0.488	GCSAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C3orf52	HGNC	protein_coding	OTTHUMT00000353967.2	0	0	0	96	96	103	0.00	0.00	A	NM_152785		111849257	+1	26	24	80	110	tier1	no_errors	ENST00000467942	ensembl	human	known	74_37	rna	24.53	17.91	SNP	0.014	G	26	80
NBEAL1	65065	genome.wustl.edu	37	2	203942512	203942512	+	Silent	SNP	T	T	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:203942512T>G	ENST00000449802.1	+	8	969	c.636T>G	c.(634-636)ctT>ctG	p.L212L		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	212										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AGGAAAGTCTTAAATGTTGCT	0.284													ENSG00000144426																																					0													54.0	50.0	51.0					2																	203942512		692	1591	2283	SO:0001819	synonymous_variant	0			-	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.636T>G	2.37:g.203942512T>G			A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L212	ENST00000449802.1	37	c.636	CCDS46495.1	2																																																																																			-	NBEAL1	-	superfamily_ARM-type_fold		0.284	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	0	0	0	78	78	70	0.00	0.00	T			203942512	+1	12	12	55	76	tier1	no_errors	ENST00000449802	ensembl	human	known	74_37	silent	17.91	13.64	SNP	0.996	G	12	55
NOS1	4842	genome.wustl.edu	37	12	117710226	117710226	+	Silent	SNP	G	G	A	rs371959195		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr12:117710226G>A	ENST00000338101.4	-	9	1807	c.1803C>T	c.(1801-1803)cgC>cgT	p.R601R	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Silent_p.R601R			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CACAGTAGTCGCGGACACCAA	0.592													ENSG00000089250																									Esophageal Squamous(162;1748 2599 51982 52956)												0								G	,,,	1,4391		0,1,2195	72.0	81.0	78.0		1803,795,795,1803	-3.9	1.0	12		78	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NOS1	NM_000620.4,NM_001204213.1,NM_001204214.1,NM_001204218.1	,,,	0,1,6493	AA,AG,GG		0.0,0.0228,0.0077	,,,	601/1435,265/1099,265/1099,601/1469	117710226	1,12987	2196	4298	6494	SO:0001819	synonymous_variant	0			-		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1803C>T	12.37:g.117710226G>A				Silent	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/D-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.R601	ENST00000338101.4	37	c.1803	CCDS55890.1	12																																																																																			-	NOS1	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk		0.592	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	0	0	0	55	55	54	0.00	0.00	G			117710226	-1	16	12	58	20	tier1	no_errors	ENST00000317775	ensembl	human	known	74_37	silent	21.62	37.50	SNP	0.567	A	16	58
MUC16	94025	genome.wustl.edu	37	19	9048510	9048510	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr19:9048510C>A	ENST00000397910.4	-	5	33324	c.33121G>T	c.(33121-33123)Gtg>Ttg	p.V11041L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11043	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGGTCACCACTCCTGGTACC	0.488													ENSG00000181143																																					0													104.0	94.0	97.0					19																	9048510		1935	4153	6088	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33121G>T	19.37:g.9048510C>A	ENSP00000381008:p.Val11041Leu		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.V11041L	ENST00000397910.4	37	c.33121	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	5.685	0.310992	0.10733	.	.	ENSG00000181143	ENST00000397910	T	0.02498	4.27	2.47	-1.29	0.09288	.	.	.	.	.	T	0.02610	0.0079	L	0.41236	1.265	.	.	.	B	0.27594	0.182	B	0.16722	0.016	T	0.31223	-0.9951	8	0.87932	D	0	.	6.0073	0.19553	0.0:0.4738:0.0:0.5262	.	11041	B5ME49	.	L	11041	ENSP00000381008:V11041L	ENSP00000381008:V11041L	V	-	1	0	MUC16	8909510	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-4.702000	0.00196	-0.399000	0.07668	-0.348000	0.07805	GTG	-	MUC16	-	NULL		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	101	101	23	0.00	0.00	C	NM_024690		9048510	-1	20	6	41	20	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	32.79	23.08	SNP	0.000	A	20	41
MROH2B	133558	genome.wustl.edu	37	5	40998776	40998776	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr5:40998776G>T	ENST00000399564.4	-	41	5039	c.4589C>A	c.(4588-4590)gCc>gAc	p.A1530D	MROH2B_ENST00000506092.2_Missense_Mutation_p.A1085D	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1530																	GAGAACAACGGCATCTAAAGT	0.408													ENSG00000171495																																					0													76.0	76.0	76.0					5																	40998776		1867	4092	5959	SO:0001583	missense	0			-		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.4589C>A	5.37:g.40998776G>T	ENSP00000382476:p.Ala1530Asp		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A1530D	ENST00000399564.4	37	c.4589	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117635	0.56505	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.63255	-0.03;-0.03	5.92	5.92	0.95590	Armadillo-like helical (1);Armadillo-type fold (1);	0.263953	0.27433	N	0.019396	T	0.68622	0.3021	L	0.51422	1.61	0.44110	D	0.99688	D	0.59357	0.985	P	0.54664	0.758	T	0.65364	-0.6186	10	0.36615	T	0.2	.	15.8207	0.78638	0.0:0.0:1.0:0.0	.	1530	Q7Z745	HTRB2_HUMAN	D	1085;1235;1530	ENSP00000441504:A1085D;ENSP00000382476:A1530D	ENSP00000296803:A1235D	A	-	2	0	HEATR7B2	41034533	1.000000	0.71417	1.000000	0.80357	0.177000	0.22998	4.489000	0.60309	2.809000	0.96659	0.655000	0.94253	GCC	-	MROH2B	-	superfamily_ARM-type_fold		0.408	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	0	0	0	33	33	83	0.00	0.00	G	NM_173489		40998776	-1	9	24	16	65	tier1	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	36.00	26.97	SNP	1.000	T	9	16
OR11H12	440153	genome.wustl.edu	37	14	19378392	19378392	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr14:19378392T>A	ENST00000550708.1	+	1	871	c.799T>A	c.(799-801)Tat>Aat	p.Y267N		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATCACTGTGCTATAGCTCTCT	0.468													ENSG00000257115																																					0													6.0	1.0	2.0					14																	19378392		83	198	281	SO:0001583	missense	0			-		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.799T>A	14.37:g.19378392T>A	ENSP00000449002:p.Tyr267Asn			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y267N	ENST00000550708.1	37	c.799	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	t	11.32	1.602692	0.28534	.	.	ENSG00000257115	ENST00000550708	T	0.41400	1.0	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38272	N	0.001749	T	0.64962	0.2646	M	0.92122	3.275	0.26425	N	0.976035	D	0.89917	1.0	D	0.91635	0.999	T	0.70208	-0.4935	9	0.87932	D	0	.	5.5303	0.16980	0.0:1.0E-4:0.0:0.9999	.	267	B2RN74	O11HC_HUMAN	N	267	ENSP00000449002:Y267N	ENSP00000449002:Y267N	Y	+	1	0	CR383656.1	18448392	0.000000	0.05858	0.856000	0.33681	0.039000	0.13416	0.637000	0.24659	0.518000	0.28383	0.055000	0.15244	TAT	-	OR11H12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.468	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	HGNC	protein_coding	OTTHUMT00000408402.1	0	0	0	35	35	23	0.00	0.00	T	NM_001013354		19378392	+1	99	107	24	17	tier1	no_errors	ENST00000550708	ensembl	human	known	74_37	missense	80.49	86.29	SNP	0.538	A	99	24
CYP2C18	1562	genome.wustl.edu	37	10	96495187	96495187	+	Missense_Mutation	SNP	T	T	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr10:96495187T>G	ENST00000285979.6	+	9	1658	c.1459T>G	c.(1459-1461)Ttc>Gtc	p.F487V	CYP2C19_ENST00000464755.1_Intron|CYP2C18_ENST00000339022.5_Missense_Mutation_p.F428V	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	487					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	CCAGCTCTGCTTCATTCCTGT	0.502													ENSG00000108242																																					0													190.0	174.0	180.0					10																	96495187		2203	4300	6503	SO:0001583	missense	0			-	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.1459T>G	10.37:g.96495187T>G	ENSP00000285979:p.Phe487Val		B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.F487V	ENST00000285979.6	37	c.1459	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	t	13.13	2.146560	0.37923	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	T;T	0.68331	-0.32;-0.32	4.05	4.05	0.47172	.	0.166042	0.39341	U	0.001395	T	0.70168	0.3193	L	0.33624	1.015	0.80722	D	1	D;B	0.89917	1.0;0.26	D;B	0.91635	0.999;0.255	T	0.66976	-0.5787	10	0.29301	T	0.29	.	11.0524	0.47898	0.0:0.0:0.0:1.0	.	428;487	Q4VAT5;P33260	.;CP2CI_HUMAN	V	428;487	ENSP00000341293:F428V;ENSP00000285979:F487V	ENSP00000285979:F487V	F	+	1	0	CYP2C18	96485177	0.137000	0.22531	0.235000	0.24058	0.302000	0.27658	1.502000	0.35704	1.686000	0.51046	0.369000	0.22263	TTC	-	CYP2C18	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.502	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	HGNC	protein_coding	OTTHUMT00000049486.1	0	0	0	85	85	98	0.00	0.00	T	NM_000772		96495187	+1	28	32	64	59	tier1	no_errors	ENST00000285979	ensembl	human	known	74_37	missense	30.43	35.16	SNP	0.793	G	28	64
TTN	7273	genome.wustl.edu	37	2	179438310	179438310	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:179438310C>A	ENST00000591111.1	-	276	67850	c.67626G>T	c.(67624-67626)aaG>aaT	p.K22542N	TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K15118N|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K15243N|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K15310N|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K24183N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K21615N|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22542	Fibronectin type-III 63. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K15310N(1)|p.K15243N(1)|p.K21615N(1)|p.K15118N(1)|p.K21613N(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTAGTGACCTTTAGCTTTG	0.423													ENSG00000155657																																					5	Substitution - Missense(5)	lung(5)											266.0	261.0	263.0					2																	179438310		1920	4131	6051	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.67626G>T	2.37:g.179438310C>A	ENSP00000465570:p.Lys22542Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K21615N	ENST00000591111.1	37	c.64845		2	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348070	0.24426	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	6.08	4.23	0.50019	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64011	0.2560	L	0.48935	1.535	0.53005	D	0.99996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.64879	-0.6303	9	0.87932	D	0	.	10.793	0.46445	0.0:0.7835:0.0:0.2165	.	15118;15243;15310;22542	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	21615;15118;15310;15243;15116	ENSP00000343764:K21615N;ENSP00000434586:K15118N;ENSP00000340554:K15310N;ENSP00000352154:K15243N	ENSP00000340554:K15310N	K	-	3	2	TTN	179146556	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.693000	0.37742	0.846000	0.35142	0.655000	0.94253	AAG	-	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	1	41	41	82	0.00	1.20	C	NM_133378		179438310	-1	18	20	31	54	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	36.73	26.67	SNP	1.000	A	18	31
DIS3L	115752	genome.wustl.edu	37	15	66599178	66599178	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr15:66599178C>T	ENST00000319212.4	+	3	360	c.310C>T	c.(310-312)Cga>Tga	p.R104*	DIS3L_ENST00000441424.2_Intron|DIS3L_ENST00000319194.5_Nonsense_Mutation_p.R21*	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	104					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TAACAAACTGCGAAACCTGCT	0.448													ENSG00000166938																																					0													142.0	116.0	124.0					15																	66599178		2201	4299	6500	SO:0001587	stop_gained	0			-		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.310C>T	15.37:g.66599178C>T	ENSP00000321711:p.Arg104*		Q8N1N8|Q8WTU9|Q96CM7	Nonsense_Mutation	SNP	NULL	p.R104*	ENST00000319212.4	37	c.310	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	C	41	8.728938	0.98931	.	.	ENSG00000166938	ENST00000319194;ENST00000525134;ENST00000319212;ENST00000532580;ENST00000530615	.	.	.	5.76	5.76	0.90799	.	0.795993	0.11819	N	0.526413	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6829	12.3003	0.54870	0.0:0.9234:0.0:0.0766	.	.	.	.	X	21;21;104;21;21	.	ENSP00000321583:R21X	R	+	1	2	DIS3L	64386232	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	2.149000	0.42244	2.726000	0.93360	0.655000	0.94253	CGA	-	DIS3L	-	NULL		0.448	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	HGNC	protein_coding	OTTHUMT00000382792.2	0	0	0	54	54	69	0.00	0.00	C	NM_133375		66599178	+1	20	15	38	38	tier1	no_errors	ENST00000319212	ensembl	human	known	74_37	nonsense	34.48	28.30	SNP	1.000	T	20	38
IL6R	3570	genome.wustl.edu	37	1	154401712	154401712	+	Missense_Mutation	SNP	C	C	G	rs34099703	byFrequency	TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:154401712C>G	ENST00000368485.3	+	2	563	c.126C>G	c.(124-126)agC>agG	p.S42R	IL6R_ENST00000344086.4_Missense_Mutation_p.S42R	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor	42	Ig-like C2-type.				acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)		IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	CAGGAGACAGCGTGACTCTGA	0.632													ENSG00000160712																																					0													81.0	79.0	80.0					1																	154401712		2203	4300	6503	SO:0001583	missense	0			-	X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.126C>G	1.37:g.154401712C>G	ENSP00000357470:p.Ser42Arg		A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S42R	ENST00000368485.3	37	c.126	CCDS1067.1	1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.611081	0.28712	.	.	ENSG00000160712	ENST00000368485;ENST00000344086;ENST00000512471	T;T;T	0.15718	2.4;2.66;2.66	4.85	-7.11	0.01542	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.196460	0.05465	N	0.552057	T	0.05456	0.0144	L	0.27053	0.805	0.09310	N	1	D;P	0.58620	0.983;0.949	P;B	0.46917	0.531;0.331	T	0.04165	-1.0972	10	0.30078	T	0.28	-4.3456	14.8624	0.70392	0.0:0.2435:0.0:0.7565	.	42;42	P08887-2;P08887	.;IL6RA_HUMAN	R	42	ENSP00000357470:S42R;ENSP00000340589:S42R;ENSP00000423184:S42R	ENSP00000340589:S42R	S	+	3	2	IL6R	152668336	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.470000	0.00229	-2.154000	0.00792	-1.036000	0.02392	AGC	-	IL6R	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.632	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL6R	HGNC	protein_coding	OTTHUMT00000087911.1	0	0	0	59	59	36	0.00	0.00	C	NM_000565		154401712	+1	14	15	100	73	tier1	no_errors	ENST00000368485	ensembl	human	known	74_37	missense	12.28	16.85	SNP	0.000	G	14	100
KIAA1217	56243	genome.wustl.edu	37	10	24810764	24810764	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr10:24810764G>C	ENST00000376454.3	+	12	2392	c.2362G>C	c.(2362-2364)Gag>Cag	p.E788Q	KIAA1217_ENST00000376452.3_Missense_Mutation_p.E753Q|KIAA1217_ENST00000376462.1_Missense_Mutation_p.E708Q|KIAA1217_ENST00000396445.1_Missense_Mutation_p.E471Q|KIAA1217_ENST00000307544.6_Missense_Mutation_p.E471Q|KIAA1217_ENST00000430453.2_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.E471Q|KIAA1217_ENST00000458595.1_Missense_Mutation_p.E753Q|KIAA1217_ENST00000396446.1_Missense_Mutation_p.E471Q	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	788					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CATAGAAGTGGAGGCCGTGCG	0.552													ENSG00000120549																																					0													85.0	84.0	84.0					10																	24810764		2203	4300	6503	SO:0001583	missense	0			-	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.2362G>C	10.37:g.24810764G>C	ENSP00000365637:p.Glu788Gln		A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	pfam_AIP3_C	p.E788Q	ENST00000376454.3	37	c.2362	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.376574	0.95945	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.79246	0.4413	M	0.80616	2.505	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.998;0.998;0.999;0.999;0.998;0.995;0.998	T	0.79157	-0.1919	10	0.56958	D	0.05	.	20.3802	0.98930	0.0:0.0:1.0:0.0	.	753;753;471;471;471;471;788;788	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	Q	708;753;753;471;788;753;603;471;471;471;471;471	ENSP00000365645:E708Q;ENSP00000365639:E753Q;ENSP00000392625:E753Q;ENSP00000365637:E788Q;ENSP00000365635:E753Q;ENSP00000404798:E603Q;ENSP00000302343:E471Q;ENSP00000379722:E471Q;ENSP00000365634:E471Q;ENSP00000379723:E471Q	ENSP00000302343:E471Q	E	+	1	0	KIAA1217	24850770	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.869000	0.99810	2.822000	0.97130	0.563000	0.77884	GAG	-	KIAA1217	-	NULL		0.552	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	0	0	0	32	32	49	0.00	0.00	G	NM_019590		24810764	+1	19	7	20	19	tier1	no_errors	ENST00000376454	ensembl	human	known	74_37	missense	48.72	26.92	SNP	1.000	C	19	20
ARPC3	10094	genome.wustl.edu	37	12	110888066	110888066	+	5'UTR	SNP	C	C	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr12:110888066C>A	ENST00000228825.7	-	0	146				ARPC3_ENST00000471641.1_5'UTR	NM_001278556.1|NM_005719.2	NP_001265485.1|NP_005710.1	O15145	ARPC3_HUMAN	actin related protein 2/3 complex, subunit 3, 21kDa						Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			lung(1)|ovary(1)	2						TCACCGGCATCTTGGCGGCGC	0.652											OREG0022114	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000111229																																					0													24.0	25.0	25.0					12																	110888066		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			-	AF006086	CCDS9146.1	12q24	2011-07-06	2002-08-29		ENSG00000111229	ENSG00000111229		"""Actin related protein 2/3 complex subunits"""	706	protein-coding gene	gene with protein product		604225	"""actin related protein 2/3 complex, subunit 3 (21 kD)"""			9230079, 9359840	Standard	NM_001278556		Approved	p21-Arc, ARC21	uc001tqq.3	O15145	OTTHUMG00000134333	ENST00000228825.7:c.-1G>T	12.37:g.110888066C>A		1431	O00554	R	SNP	-	NULL	ENST00000228825.7	37	NULL	CCDS9146.1	12																																																																																			-	ARPC3	-	-		0.652	ARPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC3	HGNC	protein_coding	OTTHUMT00000259487.2	0	0	0	44	44	37	0.00	0.00	C			110888066	-1	16	6	43	20	tier1	no_errors	ENST00000471641	ensembl	human	known	74_37	rna	27.12	23.08	SNP	0.990	A	16	43
CTSL3P	392360	genome.wustl.edu	37	9	90388540	90388540	+	RNA	SNP	C	C	G	rs139706141		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr9:90388540C>G	ENST00000354530.2	+	0	406					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)										TCTGAGGAATCCTTTTCATAT	0.443													ENSG00000188029																																					0								C		2,4404	4.2+/-10.8	0,2,2201	118.0	110.0	113.0			1.8	0.3	9	dbSNP_134	113	0,8600		0,0,4300	no	intergenic				0,2,6501	GG,GC,CC		0.0,0.0454,0.0154			90388540	2,13004	2203	4300	6503			0			-	AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90388540C>G				R	SNP	-	NULL	ENST00000354530.2	37	NULL		9																																																																																			rs139706141	CTSL3P	-	-		0.443	CTSL3P-002	KNOWN	basic	processed_transcript	CTSL3P	HGNC	pseudogene	OTTHUMT00000356542.1	0	0	0	78	78	64	0.00	0.00	C	NR_027917		90388540	+1	25	24	75	71	tier1	no_errors	ENST00000354530	ensembl	human	known	74_37	rna	25.00	25.26	SNP	1.000	G	25	75
LBH	81606	genome.wustl.edu	37	2	30454435	30454435	+	5'UTR	SNP	A	A	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:30454435A>G	ENST00000395323.3	+	0	39				LBH_ENST00000404397.1_5'UTR|LBH_ENST00000406087.1_5'UTR|LBH_ENST00000407930.2_5'Flank|LBH_ENST00000401506.1_5'Flank	NM_030915.3	NP_112177.2	Q53QV2	LBH_HUMAN	limb bud and heart development						multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(172;0.155)					AGTTGTGTCCACCTTGCCGAC	0.716													ENSG00000213626																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF110224	CCDS33173.1	2p23.1	2012-12-07	2012-12-07		ENSG00000213626	ENSG00000213626			29532	protein-coding gene	gene with protein product		611763	"""limb bud and heart development homolog (mouse)"""			11230166, 11336496	Standard	NM_030915		Approved		uc002rne.2	Q53QV2	OTTHUMG00000152051	ENST00000395323.3:c.-170A>G	2.37:g.30454435A>G			B2RBC2|Q9H0Q1	R	SNP	-	NULL	ENST00000395323.3	37	NULL	CCDS33173.1	2																																																																																			-	LBH	-	-		0.716	LBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LBH	HGNC	protein_coding	OTTHUMT00000325091.1	0	0	0	8	8	19	0.00	0.00	A	NM_030915		30454435	+1	7	5	16	31	tier1	no_errors	ENST00000464412	ensembl	human	known	74_37	rna	30.43	13.89	SNP	0.001	G	7	16
MYO7B	4648	genome.wustl.edu	37	2	128350513	128350513	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:128350513C>T	ENST00000409816.2	+	16	2169	c.2137C>T	c.(2137-2139)Cgg>Tgg	p.R713W	MYO7B_ENST00000428314.1_Missense_Mutation_p.R713W|MYO7B_ENST00000389524.4_Missense_Mutation_p.R713W			Q6PIF6	MYO7B_HUMAN	myosin VIIB	713	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CAACGCCATGCGGATGCAGGT	0.672													ENSG00000169994																																					0													28.0	34.0	32.0					2																	128350513		2070	4181	6251	SO:0001583	missense	0			-		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2137C>T	2.37:g.128350513C>T	ENSP00000386461:p.Arg713Trp		Q14786|Q8TEE1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.R713W	ENST00000409816.2	37	c.2137	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064250	0.55432	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	T;T;T	0.71934	-0.61;-0.61;-0.61	4.4	-0.0933	0.13650	Myosin head, motor domain (2);	0.545338	0.17415	N	0.175060	T	0.66137	0.2759	N	0.17594	0.5	0.09310	N	1	D	0.89917	1.0	D	0.66847	0.947	T	0.57636	-0.7777	10	0.72032	D	0.01	.	6.7589	0.23530	0.5194:0.3937:0.0:0.0869	.	713	Q6PIF6	MYO7B_HUMAN	W	713	ENSP00000374175:R713W;ENSP00000415090:R713W;ENSP00000386461:R713W	ENSP00000374175:R713W	R	+	1	2	MYO7B	128066983	0.017000	0.18338	0.001000	0.08648	0.019000	0.09904	0.332000	0.19751	-0.141000	0.11374	0.655000	0.94253	CGG	-	MYO7B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.672	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	0	0	0	55	55	26	0.00	0.00	C	XM_291001		128350513	+1	28	7	53	21	tier1	no_errors	ENST00000389524	ensembl	human	known	74_37	missense	34.57	25.00	SNP	0.005	T	28	53
OSBPL6	114880	genome.wustl.edu	37	2	179188982	179188982	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:179188982G>A	ENST00000190611.4	+	4	557	c.181G>A	c.(181-183)Gtc>Atc	p.V61I	OSBPL6_ENST00000409631.1_Missense_Mutation_p.V61I|OSBPL6_ENST00000392505.2_Missense_Mutation_p.V61I|OSBPL6_ENST00000359685.3_Missense_Mutation_p.V61I|OSBPL6_ENST00000315022.2_Missense_Mutation_p.V40I|OSBPL6_ENST00000409045.3_Missense_Mutation_p.V61I|OSBPL6_ENST00000357080.4_Missense_Mutation_p.V61I|OSBPL6_ENST00000477097.1_3'UTR	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	61					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			ACCGGAGCCAGTCCCCCTCTC	0.488													ENSG00000079156																																					0													71.0	60.0	64.0					2																	179188982		2203	4295	6498	SO:0001583	missense	0			-	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.181G>A	2.37:g.179188982G>A	ENSP00000190611:p.Val61Ile		B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	pfam_Oxysterol-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V40I	ENST00000190611.4	37	c.118	CCDS2277.1	2	.	.	.	.	.	.	.	.	.	.	G	4.556	0.103310	0.08731	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.11821	2.78;2.74;2.75;2.77;2.76;2.74;2.77	5.96	3.2	0.36748	.	0.546828	0.21365	N	0.075728	T	0.08447	0.0210	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.001;0.002;0.0;0.002;0.0;0.002	T	0.29579	-1.0007	10	0.39692	T	0.17	-0.0012	6.1575	0.20346	0.2733:0.1265:0.6002:0.0	.	61;40;61;61;61;61	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	I	61;61;61;61;61;61;40	ENSP00000376293:V61I;ENSP00000352713:V61I;ENSP00000349591:V61I;ENSP00000387248:V61I;ENSP00000190611:V61I;ENSP00000386885:V61I;ENSP00000318723:V40I	ENSP00000190611:V61I	V	+	1	0	OSBPL6	178897228	0.118000	0.22208	0.006000	0.13384	0.807000	0.45602	1.582000	0.36568	0.417000	0.25871	0.655000	0.94253	GTC	-	OSBPL6	-	NULL		0.488	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSBPL6	HGNC	protein_coding	OTTHUMT00000334393.2	0	0	0	29	29	59	0.00	0.00	G	NM_032523		179188982	+1	8	27	39	32	tier1	no_errors	ENST00000315022	ensembl	human	known	74_37	missense	17.02	45.76	SNP	0.007	A	8	39
UMODL1	89766	genome.wustl.edu	37	21	43557666	43557666	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr21:43557666T>A	ENST00000408910.2	+	22	3893	c.3893T>A	c.(3892-3894)aTg>aAg	p.M1298K	UMODL1_ENST00000400424.2_Missense_Mutation_p.M1226K|UMODL1_ENST00000400427.1_Missense_Mutation_p.M1354K|UMODL1_ENST00000408989.2_Missense_Mutation_p.M1426K|UMODL1_ENST00000400423.2_3'UTR	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1298					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TACCAGAGAATGAATGGGAGA	0.547													ENSG00000177398																									Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												0													141.0	144.0	143.0					21																	43557666		2051	4184	6235	SO:0001583	missense	0			-		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3893T>A	21.37:g.43557666T>A	ENSP00000386147:p.Met1298Lys		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_ZP_dom,pfam_SEA_dom,pfam_EGF-like_Ca-bd_dom,pfam_EMI_domain,pfam_WAP-type_4-diS_core,superfamily_Fibronectin_type3,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_EGF-like_Ca-bd_dom,smart_Fibronectin_type3,smart_ZP_dom,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_ZP_dom,prints_ZP_dom	p.M1426K	ENST00000408910.2	37	c.4277	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.798167	0.00617	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.70282	-0.47;-0.46;-0.47;-0.47	3.03	-0.791	0.10929	.	0.531653	0.15827	N	0.242708	T	0.48892	0.1525	L	0.29908	0.895	0.09310	N	1	B;B	0.12013	0.005;0.001	B;B	0.12156	0.007;0.001	T	0.20438	-1.0275	9	.	.	.	-10.4711	3.2762	0.06899	0.231:0.3466:0.0:0.4224	.	1426;1298	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	K	1354;1226;1426;1298	ENSP00000383279:M1354K;ENSP00000383276:M1226K;ENSP00000386126:M1426K;ENSP00000386147:M1298K	.	M	+	2	0	UMODL1	42430735	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.052000	0.11865	-0.150000	0.11195	-0.411000	0.06167	ATG	-	UMODL1	-	NULL		0.547	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	0	0	0	75	75	61	0.00	0.00	T			43557666	+1	19	12	21	18	tier1	no_errors	ENST00000408989	ensembl	human	known	74_37	missense	47.50	40.00	SNP	0.000	A	19	21
PIK3C2G	5288	genome.wustl.edu	37	12	18477970	18477970	+	Splice_Site	SNP	C	C	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr12:18477970C>A	ENST00000266497.5	+	7	1248	c.1210C>A	c.(1210-1212)Caa>Aaa	p.Q404K	PIK3C2G_ENST00000535651.1_Splice_Site_p.Q404K|PIK3C2G_ENST00000433979.1_Splice_Site_p.Q404K|PIK3C2G_ENST00000538779.1_Splice_Site_p.Q404K			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	404					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				ATTTTCCAGACAATGTCTCTT	0.308													ENSG00000139144																																					0													66.0	63.0	64.0					12																	18477970		1797	4061	5858	SO:0001630	splice_region_variant	0			-	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1209-1C>A	12.37:g.18477970C>A			A1L3U0	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.Q404K	ENST00000266497.5	37	c.1210	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	C	9.573	1.121438	0.20877	.	.	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	T;T;T;T	0.61859	1.38;0.07;0.07;0.13	4.11	4.11	0.48088	.	0.147376	0.31210	N	0.008046	T	0.48786	0.1519	M	0.63843	1.955	0.33892	D	0.637466	P;P;P	0.43352	0.704;0.804;0.704	B;B;B	0.33254	0.077;0.16;0.077	T	0.66748	-0.5845	10	0.42905	T	0.14	-5.8532	12.1492	0.54040	0.0:1.0:0.0:0.0	.	403;404;404	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	K	404	ENSP00000443850:Q404K;ENSP00000404845:Q404K;ENSP00000266497:Q404K;ENSP00000445381:Q404K	ENSP00000266497:Q404K	Q	+	1	0	PIK3C2G	18369237	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	0.624000	0.24462	2.573000	0.86826	0.655000	0.94253	CAA	-	PIK3C2G	-	NULL		0.308	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	0	0	0	44	44	48	0.00	0.00	C	NM_004570	Missense_Mutation	18477970	+1	3	24	9	46	tier1	no_errors	ENST00000538779	ensembl	human	known	74_37	missense	25.00	33.33	SNP	1.000	A	3	9
SLC44A2	57153	genome.wustl.edu	37	19	10747106	10747106	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr19:10747106C>G	ENST00000335757.5	+	15	1717	c.1341C>G	c.(1339-1341)atC>atG	p.I447M	SLC44A2_ENST00000407327.4_Missense_Mutation_p.I445M|SLC44A2_ENST00000586078.1_Missense_Mutation_p.I447M			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	447					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	GCCTGCAGATCTTCAATGCCT	0.637													ENSG00000129353																																					0													88.0	89.0	89.0					19																	10747106		2203	4300	6503	SO:0001583	missense	0			-	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.1341C>G	19.37:g.10747106C>G	ENSP00000336888:p.Ile447Met		B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.I447M	ENST00000335757.5	37	c.1341	CCDS12245.1	19	.	.	.	.	.	.	.	.	.	.	C	16.70	3.197097	0.58126	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.24908	1.83;1.83	5.8	3.57	0.40892	.	0.143626	0.64402	D	0.000007	T	0.26846	0.0657	L	0.46947	1.48	0.45747	D	0.998641	B;B;B	0.30211	0.128;0.273;0.128	B;B;B	0.37943	0.197;0.261;0.197	T	0.10753	-1.0616	10	0.54805	T	0.06	-32.0212	10.4668	0.44614	0.0:0.7914:0.1343:0.0743	.	447;447;445	Q8IWA5-2;Q8IWA5;Q8IWA5-3	.;CTL2_HUMAN;.	M	445;447;447	ENSP00000385135:I445M;ENSP00000336888:I447M	ENSP00000336888:I447M	I	+	3	3	SLC44A2	10608106	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.257000	0.51500	1.466000	0.48025	0.655000	0.94253	ATC	-	SLC44A2	-	pfam_Choline_transptr-like		0.637	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A2	HGNC	protein_coding	OTTHUMT00000452045.1	0	0	0	76	76	31	0.00	0.00	C			10747106	+1	18	14	169	61	tier1	no_errors	ENST00000335757	ensembl	human	known	74_37	missense	9.63	18.67	SNP	1.000	G	18	169
PRDM2	7799	genome.wustl.edu	37	1	14107396	14107396	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:14107396C>T	ENST00000235372.7	+	8	3962	c.3106C>T	c.(3106-3108)Ccc>Tcc	p.P1036S	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.P1036S|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.P835S|PRDM2_ENST00000343137.4_Missense_Mutation_p.P835S	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1036	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TCCCATTCCTCCCGTGGAGCC	0.567													ENSG00000116731																																					0													93.0	80.0	85.0					1																	14107396		2203	4300	6503	SO:0001583	missense	0			-	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.3106C>T	1.37:g.14107396C>T	ENSP00000235372:p.Pro1036Ser		B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_RIZ_retinblastoma-bd_prot,pfscan_SET_dom,pfscan_Znf_C2H2	p.P1036S	ENST00000235372.7	37	c.3106	CCDS150.1	1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.886958	0.00527	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01613	4.84;4.73;4.75;4.75	5.97	1.44	0.22558	.	0.243951	0.43260	N	0.000582	T	0.00552	0.0018	N	0.01168	-0.975	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.44559	-0.9320	10	0.05721	T	0.95	.	1.3445	0.02161	0.171:0.3785:0.174:0.2765	.	894;1036;1036	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	S	1036;1036;1036;835;835	ENSP00000235372:P1036S;ENSP00000312352:P1036S;ENSP00000411103:P835S;ENSP00000341621:P835S	ENSP00000235372:P1036S	P	+	1	0	PRDM2	13979983	1.000000	0.71417	0.099000	0.21106	0.144000	0.21451	1.273000	0.33121	0.023000	0.15187	0.655000	0.94253	CCC	-	PRDM2	-	pirsf_RIZ_retinblastoma-bd_prot		0.567	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM2	HGNC	protein_coding	OTTHUMT00000021792.2	0	0	0	50	50	35	0.00	0.00	C	NM_012231		14107396	+1	20	19	54	62	tier1	no_errors	ENST00000235372	ensembl	human	known	74_37	missense	27.03	23.46	SNP	0.283	T	20	54
LOC494141	494141	genome.wustl.edu	37	11	18231484	18231484	+	Silent	SNP	G	G	A	rs544147593		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr11:18231484G>A	ENST00000527059.1	+	1	730	c.270G>A	c.(268-270)cgG>cgA	p.R90R	RP11-113D6.10_ENST00000534640.1_Silent_p.R90R|RP11-113D6.10_ENST00000340135.3_Silent_p.R90R																							ACTTGTATCGGGGAATCTTTC	0.453													ENSG00000189332																																					0																																										SO:0001819	synonymous_variant	0			-																												ENST00000527059.1:c.270G>A	11.37:g.18231484G>A				Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.R90	ENST00000527059.1	37	c.270		11																																																																																			-	RP11-113D6.10	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.453	RP11-113D6.10-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000189332	Clone_based_vega_gene	protein_coding	OTTHUMT00000389801.2	0	0	0	69	69	58	0.00	0.00	G			18231484	+1	21	22	60	34	tier1	no_errors	ENST00000340135	ensembl	human	novel	74_37	silent	25.93	39.29	SNP	0.998	A	21	60
HLA-V	352962	genome.wustl.edu	37	6	29764977	29764977	+	RNA	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr6:29764977G>A	ENST00000457107.1	+	0	4203									major histocompatibility complex, class I, V (pseudogene)																		cagaagtgcagcttcattccc	0.353													ENSG00000181126																																					0																																												0			-	M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29764977G>A				R	SNP	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			-	HLA-V	-	-		0.353	HLA-V-003	KNOWN	basic	processed_transcript	HLA-V	HGNC	pseudogene	OTTHUMT00000105231.1	0	0	0	65	65	100	0.00	0.00	G	NG_002729		29764977	+1	26	35	50	84	tier1	no_errors	ENST00000457107	ensembl	human	known	74_37	rna	34.21	29.41	SNP	0.001	A	26	50
PRDM2	7799	genome.wustl.edu	37	1	14107394	14107394	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:14107394C>T	ENST00000235372.7	+	8	3960	c.3104C>T	c.(3103-3105)cCt>cTt	p.P1035L	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.P1035L|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.P834L|PRDM2_ENST00000343137.4_Missense_Mutation_p.P834L	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1035	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TCTCCCATTCCTCCCGTGGAG	0.572													ENSG00000116731																																					0													95.0	82.0	86.0					1																	14107394		2203	4300	6503	SO:0001583	missense	0			-	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.3104C>T	1.37:g.14107394C>T	ENSP00000235372:p.Pro1035Leu		B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_RIZ_retinblastoma-bd_prot,pfscan_SET_dom,pfscan_Znf_C2H2	p.P1035L	ENST00000235372.7	37	c.3104	CCDS150.1	1	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432084	0.25813	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01871	4.7;4.59;4.61;4.61	5.84	5.84	0.93424	.	0.053753	0.85682	D	0.000000	T	0.09818	0.0241	M	0.67953	2.075	0.80722	D	1	D;D;D	0.63046	0.964;0.987;0.992	P;P;P	0.60541	0.637;0.755;0.876	T	0.32561	-0.9902	10	0.21540	T	0.41	.	18.7072	0.91643	0.0:1.0:0.0:0.0	.	893;1035;1035	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	L	1035;1035;1035;834;834	ENSP00000235372:P1035L;ENSP00000312352:P1035L;ENSP00000411103:P834L;ENSP00000341621:P834L	ENSP00000235372:P1035L	P	+	2	0	PRDM2	13979981	1.000000	0.71417	0.733000	0.30861	0.236000	0.25371	3.777000	0.55364	2.769000	0.95229	0.563000	0.77884	CCT	-	PRDM2	-	pirsf_RIZ_retinblastoma-bd_prot		0.572	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM2	HGNC	protein_coding	OTTHUMT00000021792.2	0	0	0	54	54	34	0.00	0.00	C	NM_012231		14107394	+1	20	19	53	62	tier1	no_errors	ENST00000235372	ensembl	human	known	74_37	missense	27.40	23.46	SNP	0.877	T	20	53
MYO5B	4645	genome.wustl.edu	37	18	47500968	47500968	+	Silent	SNP	T	T	C	rs548182150		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr18:47500968T>C	ENST00000285039.7	-	10	1373	c.1074A>G	c.(1072-1074)ctA>ctG	p.L358L		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	358	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AGAAGTTGCTTAGGTATACAT	0.592													ENSG00000167306																																					0													118.0	116.0	116.0					18																	47500968		2074	4218	6292	SO:0001819	synonymous_variant	0			-	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1074A>G	18.37:g.47500968T>C			B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L358	ENST00000285039.7	37	c.1074	CCDS42436.1	18																																																																																			-	MYO5B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.592	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	0	0	0	31	31	50	0.00	0.00	T			47500968	-1	16	16	42	48	tier1	no_errors	ENST00000285039	ensembl	human	known	74_37	silent	27.59	25.00	SNP	0.011	C	16	42
GNS	2799	genome.wustl.edu	37	12	65130858	65130858	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr12:65130858G>A	ENST00000258145.3	-	9	1194	c.1024C>T	c.(1024-1026)Cag>Tag	p.Q342*	GNS_ENST00000542058.1_Nonsense_Mutation_p.Q322*|GNS_ENST00000418919.2_Nonsense_Mutation_p.Q286*|GNS_ENST00000543646.1_Nonsense_Mutation_p.Q374*	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	342					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		TCATACAGCTGTCTCTTGTCT	0.438													ENSG00000135677																																					0													120.0	115.0	117.0					12																	65130858		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.1024C>T	12.37:g.65130858G>A	ENSP00000258145:p.Gln342*		B4DYH8|Q53F05	Nonsense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_Glcc_6-SO4ase	p.Q342*	ENST00000258145.3	37	c.1024	CCDS8970.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	7.096589|7.096589	0.98059|0.98059	.|.	.|.	ENSG00000135677|ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825;ENST00000545471|ENST00000540196	.|.	.|.	.|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.79730	.|0.4496	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77691	.|-0.2493	.|3	.|.	.|.	.|.	-16.8627|-16.8627	19.7699|19.7699	0.96359|0.96359	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	286;342;374;322;259;279|161	.|.	.|.	Q|T	-|-	1|2	0|0	GNS|GNS	63417125|63417125	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.956000|0.956000	0.61745|0.61745	9.645000|9.645000	0.98471|0.98471	2.759000|2.759000	0.94783|0.94783	0.555000|0.555000	0.69702|0.69702	CAG|ACA	-	GNS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_Glcc_6-SO4ase		0.438	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GNS	HGNC	protein_coding	OTTHUMT00000401195.2	0	0	1	27	27	89	0.00	1.11	G			65130858	-1	299	629	43	85	tier1	no_errors	ENST00000258145	ensembl	human	known	74_37	nonsense	87.17	88.10	SNP	1.000	A	299	43
DSCAM	1826	genome.wustl.edu	37	21	41719729	41719729	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr21:41719729C>T	ENST00000400454.1	-	6	1555	c.1078G>A	c.(1078-1080)Gtg>Atg	p.V360M		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	360	Ig-like C2-type 4.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTGATCCTCACATTTTTTCCA	0.512													ENSG00000171587																									Melanoma(134;970 1778 1785 21664 32388)												0													299.0	267.0	277.0					21																	41719729		1934	4150	6084	SO:0001583	missense	0			-	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1078G>A	21.37:g.41719729C>T	ENSP00000383303:p.Val360Met		O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V360M	ENST00000400454.1	37	c.1078	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505306	0.85282	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.69175	-0.38;-0.38	5.1	5.1	0.69264	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.067040	0.64402	D	0.000012	T	0.80732	0.4679	M	0.79693	2.465	0.58432	D	0.999994	D	0.58268	0.982	P	0.60012	0.867	T	0.80402	-0.1397	10	0.34782	T	0.22	.	18.4949	0.90861	0.0:1.0:0.0:0.0	.	360	O60469	DSCAM_HUMAN	M	360;112	ENSP00000383303:V360M;ENSP00000385342:V112M	ENSP00000383303:V360M	V	-	1	0	DSCAM	40641599	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.718000	0.84743	2.344000	0.79699	0.655000	0.94253	GTG	-	DSCAM	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.512	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	0	0	0	96	96	89	0.00	0.00	C	NM_001389		41719729	-1	19	12	26	27	tier1	no_errors	ENST00000400454	ensembl	human	known	74_37	missense	42.22	30.77	SNP	1.000	T	19	26
KRT79	338785	genome.wustl.edu	37	12	53228026	53228026	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr12:53228026G>A	ENST00000330553.5	-	1	53	c.19C>T	c.(19-21)Cgg>Tgg	p.R7W		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	7	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TATGTTTGCCGAGAGACGGAG	0.622													ENSG00000185640																																					0													29.0	28.0	28.0					12																	53228026		2203	4299	6502	SO:0001583	missense	0			-	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.19C>T	12.37:g.53228026G>A	ENSP00000328358:p.Arg7Trp		Q6P465|Q7Z793	Missense_Mutation	SNP	pfam_IF,superfamily_STAT_TF_coiled-coil,prints_Keratin_II	p.R7W	ENST00000330553.5	37	c.19	CCDS8839.1	12	.	.	.	.	.	.	.	.	.	.	G	7.935	0.741576	0.15642	.	.	ENSG00000185640	ENST00000330553	T	0.21932	1.98	4.01	3.08	0.35506	.	0.151308	0.30473	N	0.009554	T	0.15955	0.0384	L	0.36672	1.1	0.23537	N	0.997464	D	0.56287	0.975	B	0.40565	0.333	T	0.10989	-1.0606	10	0.37606	T	0.19	.	12.3181	0.54969	0.0:0.0:0.8287:0.1713	.	7	Q5XKE5	K2C79_HUMAN	W	7	ENSP00000328358:R7W	ENSP00000328358:R7W	R	-	1	2	KRT79	51514293	0.810000	0.29049	0.689000	0.30133	0.201000	0.24016	1.478000	0.35442	1.230000	0.43646	0.650000	0.86243	CGG	-	KRT79	-	NULL		0.622	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT79	HGNC	protein_coding	OTTHUMT00000406376.1	0	0	0	67	67	47	0.00	0.00	G	NM_175834		53228026	-1	35	12	70	31	tier1	no_errors	ENST00000330553	ensembl	human	known	74_37	missense	33.33	27.91	SNP	0.397	A	35	70
FCHO1	23149	genome.wustl.edu	37	19	17881328	17881328	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr19:17881328G>A	ENST00000596536.1	+	8	714	c.431G>A	c.(430-432)cGt>cAt	p.R144H	FCHO1_ENST00000596951.1_Missense_Mutation_p.R144H|FCHO1_ENST00000595033.1_Missense_Mutation_p.R94H|FCHO1_ENST00000252771.7_Missense_Mutation_p.R144H|FCHO1_ENST00000597512.1_Missense_Mutation_p.R151H|FCHO1_ENST00000539407.1_Missense_Mutation_p.R144H|FCHO1_ENST00000594202.1_Missense_Mutation_p.R144H|FCHO1_ENST00000600676.1_Missense_Mutation_p.R144H|FCHO1_ENST00000389133.4_Missense_Mutation_p.R144H	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	144	Mediates membrane-binding.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						TACCTGAACCGTTGCATGGAC	0.627													ENSG00000130475																																					0													52.0	51.0	51.0					19																	17881328		2203	4300	6503	SO:0001583	missense	0			-	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.431G>A	19.37:g.17881328G>A	ENSP00000470731:p.Arg144His		A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,superfamily_Clathrin_mu_C,smart_FCH_dom,pfscan_FCH_dom	p.R144H	ENST00000596536.1	37	c.431	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863663	0.71949	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.45668	0.89;0.89;0.89	4.56	2.45	0.29901	.	0.253934	0.32473	N	0.006056	T	0.51991	0.1707	L	0.52905	1.665	0.35670	D	0.813269	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.70935	0.971;0.91;0.97	T	0.59166	-0.7505	10	0.59425	D	0.04	-9.6494	6.2523	0.20852	0.2243:0.0:0.7757:0.0	.	94;144;144	B4E120;O14526;O14526-2	.;FCHO1_HUMAN;.	H	144	ENSP00000252771:R144H;ENSP00000373785:R144H;ENSP00000437978:R144H	ENSP00000252771:R144H	R	+	2	0	FCHO1	17742328	0.991000	0.36638	0.927000	0.36925	0.996000	0.88848	3.154000	0.50693	0.556000	0.29098	0.491000	0.48974	CGT	-	FCHO1	-	NULL		0.627	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	0	0	0	35	35	38	0.00	0.00	G	NM_015122		17881328	+1	14	6	34	16	tier1	no_errors	ENST00000252771	ensembl	human	known	74_37	missense	29.17	27.27	SNP	0.913	A	14	34
CPNE6	9362	genome.wustl.edu	37	14	24543259	24543259	+	Splice_Site	SNP	G	G	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr14:24543259G>T	ENST00000397016.2	+	5	659		c.e5-1		CPNE6_ENST00000560092.1_Splice_Site|CPNE6_ENST00000216775.2_Splice_Site|CPNE6_ENST00000537691.1_Splice_Site	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)						lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		TCCATCCCCAGATTGTGTCAC	0.517													ENSG00000100884																																					0													126.0	102.0	110.0					14																	24543259		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.349-1G>T	14.37:g.24543259G>T			B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Splice_Site	SNP	-	e5-1	ENST00000397016.2	37	c.514-1	CCDS9607.1	14	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323840	0.41096	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9361	0.70957	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CPNE6	23613099	1.000000	0.71417	0.989000	0.46669	0.400000	0.30750	8.086000	0.89520	2.394000	0.81467	0.467000	0.42956	.	-	CPNE6	-	-		0.517	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE6	HGNC	protein_coding	OTTHUMT00000071869.5	0	0	0	36	36	105	0.00	0.00	G		Intron	24543259	+1	9	19	92	159	tier1	no_errors	ENST00000537691	ensembl	human	known	74_37	splice_site	8.91	10.67	SNP	1.000	T	9	92
PHLDB2	90102	genome.wustl.edu	37	3	111651219	111651219	+	Missense_Mutation	SNP	A	A	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr3:111651219A>C	ENST00000431670.2	+	6	2516	c.2105A>C	c.(2104-2106)gAa>gCa	p.E702A	PHLDB2_ENST00000495180.1_Missense_Mutation_p.E288A|PHLDB2_ENST00000393925.3_Missense_Mutation_p.E702A|PHLDB2_ENST00000412622.1_Intron|PHLDB2_ENST00000393923.3_Intron|PHLDB2_ENST00000481953.1_Intron	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	702						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TCCATGAGGGAACAGTTACAA	0.438													ENSG00000144824																																					0													97.0	86.0	89.0					3																	111651219		692	1591	2283	SO:0001583	missense	0			-		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2105A>C	3.37:g.111651219A>C	ENSP00000405405:p.Glu702Ala		A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E702A	ENST00000431670.2	37	c.2105	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	A	24.4	4.523297	0.85600	.	.	ENSG00000144824	ENST00000431670;ENST00000393925;ENST00000495180	T;T;T	0.38887	1.11;1.11;1.46	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.64875	0.2638	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.72982	0.979;0.958	T	0.65768	-0.6088	9	0.49607	T	0.09	.	15.8048	0.78491	1.0:0.0:0.0:0.0	.	288;702	E9PGF6;Q86SQ0	.;PHLB2_HUMAN	A	702;702;288	ENSP00000405405:E702A;ENSP00000377502:E702A;ENSP00000420303:E288A	ENSP00000377502:E702A	E	+	2	0	PHLDB2	113133909	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.809000	0.91944	2.371000	0.80710	0.533000	0.62120	GAA	-	PHLDB2	-	NULL		0.438	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1	0	0	0	24	24	113	0.00	0.00	A	NM_145753		111651219	+1	27	48	22	61	tier1	no_errors	ENST00000393925	ensembl	human	known	74_37	missense	55.10	44.04	SNP	1.000	C	27	22
NMRK1	54981	genome.wustl.edu	37	9	77676433	77676433	+	3'UTR	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr9:77676433C>T	ENST00000361092.4	-	0	867				NMRK1_ENST00000376811.1_3'UTR|NMRK1_ENST00000376808.4_3'UTR|NMRK1_ENST00000482537.1_5'UTR	NM_017881.2	NP_060351.1	Q9NWW6	NRK1_HUMAN	nicotinamide riboside kinase 1						NAD biosynthetic process (GO:0009435)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)										TTTCCTAATTCACTTCAGGAA	0.333													ENSG00000106733																																					0													132.0	124.0	127.0					9																	77676433		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	AK097144	CCDS6650.1, CCDS47981.1	9q21.31	2012-03-30	2012-03-30	2012-03-30	ENSG00000106733	ENSG00000106733			26057	protein-coding gene	gene with protein product		608704	"""chromosome 9 open reading frame 95"""	C9orf95		15137942	Standard	NM_017881		Approved	FLJ20559, NRK1, bA235O14.2	uc004ajr.4	Q9NWW6	OTTHUMG00000020034	ENST00000361092.4:c.*31G>A	9.37:g.77676433C>T			Q5W124|Q8N430	R	SNP	-	NULL	ENST00000361092.4	37	NULL	CCDS6650.1	9																																																																																			-	NMRK1	-	-		0.333	NMRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMRK1	HGNC	protein_coding	OTTHUMT00000052705.1	0	0	0	40	40	108	0.00	0.00	C	NM_017881		77676433	-1	11	55	37	145	tier1	no_errors	ENST00000482537	ensembl	human	known	74_37	rna	22.92	27.50	SNP	0.060	T	11	37
GBP5	115362	genome.wustl.edu	37	1	89732799	89732799	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:89732799T>A	ENST00000370459.3	-	5	593	c.466A>T	c.(466-468)Aac>Tac	p.N156Y	GBP5_ENST00000343435.5_Missense_Mutation_p.N156Y|RP4-620F22.2_ENST00000437128.1_RNA			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	156	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		TCGGGTGAGTTTCTTGCCTTG	0.453													ENSG00000154451																																					0													120.0	108.0	112.0					1																	89732799		2203	4300	6503	SO:0001583	missense	0			-	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.466A>T	1.37:g.89732799T>A	ENSP00000359488:p.Asn156Tyr		B2RCE1|Q86TM5	Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.N156Y	ENST00000370459.3	37	c.466	CCDS722.1	1	.	.	.	.	.	.	.	.	.	.	T	18.90	3.720680	0.68959	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.61859	0.07;0.07;0.07	4.61	0.822	0.18806	Guanylate-binding protein, N-terminal (1);	1.275210	0.05416	N	0.543390	T	0.34716	0.0907	L	0.39898	1.24	0.09310	N	1	P	0.42556	0.783	P	0.46419	0.516	T	0.33675	-0.9859	10	0.87932	D	0	0.1823	4.209	0.10502	0.2663:0.2333:0.0:0.5004	.	156	Q96PP8	GBP5_HUMAN	Y	156	ENSP00000340396:N156Y;ENSP00000359488:N156Y;ENSP00000403010:N156Y	ENSP00000340396:N156Y	N	-	1	0	GBP5	89505387	0.000000	0.05858	0.000000	0.03702	0.635000	0.38103	-0.039000	0.12124	0.047000	0.15862	0.369000	0.22263	AAC	-	GBP5	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase		0.453	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP5	HGNC	protein_coding	OTTHUMT00000027700.1	0	0	0	39	39	54	0.00	0.00	T	NM_052942		89732799	-1	12	20	24	60	tier1	no_errors	ENST00000343435	ensembl	human	known	74_37	missense	33.33	25.00	SNP	0.000	A	12	24
RAPGEF4	11069	genome.wustl.edu	37	2	173679322	173679322	+	Intron	SNP	T	T	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:173679322T>A	ENST00000397081.3	+	4	587				RAPGEF4_ENST00000264111.6_Intron|RAPGEF4_ENST00000409036.1_Intron	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			AAAGCCATTTTGACACAAGAC	0.313													ENSG00000091428																																					0																																										SO:0001627	intron_variant	0			-	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.444+169T>A	2.37:g.173679322T>A			B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	R	SNP	-	NULL	ENST00000397081.3	37	NULL	CCDS42775.1	2																																																																																			-	RAPGEF4	-	-		0.313	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	HGNC	protein_coding	OTTHUMT00000257864.2	0	0	0	84	84	60	0.00	0.00	T	NM_007023		173679322	+1	22	24	52	47	tier1	no_errors	ENST00000464976	ensembl	human	known	74_37	rna	29.73	33.80	SNP	1.000	A	22	52
WIPI2	26100	genome.wustl.edu	37	7	5254196	5254196	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr7:5254196G>C	ENST00000288828.4	+	4	474	c.242G>C	c.(241-243)aGa>aCa	p.R81T	WIPI2_ENST00000401525.3_Missense_Mutation_p.R63T|WIPI2_ENST00000404704.3_Missense_Mutation_p.R81T|WIPI2_ENST00000382384.2_Missense_Mutation_p.R63T|WIPI2_ENST00000485854.1_3'UTR|WIPI2_ENST00000484262.1_Missense_Mutation_p.R22T	NM_001033518.1|NM_001278299.1|NM_015610.3	NP_001028690.1|NP_001265228.1|NP_056425.1	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	81					autophagic vacuole assembly (GO:0000045)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|protein complex (GO:0043234)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)	16		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		ATTGTAGAGAGATTGTTCTCC	0.488													ENSG00000157954																																					0													229.0	193.0	205.0					7																	5254196		2203	4300	6503	SO:0001583	missense	0			-		CCDS5339.1, CCDS34593.1, CCDS47531.1, CCDS47532.1, CCDS47533.1	7p22.1	2014-02-12			ENSG00000157954	ENSG00000157954		"""WD repeat domain containing"""	32225	protein-coding gene	gene with protein product		609225				15602573	Standard	NM_001278299		Approved	Atg21, CGI-50, FLJ12979, FLJ14217, FLJ42984, DKFZP434J154, DKFZp686P02188, ATG18B	uc003snv.3	Q9Y4P8	OTTHUMG00000121179	ENST00000288828.4:c.242G>C	7.37:g.5254196G>C	ENSP00000288828:p.Arg81Thr		B3KNC2|Q5MNZ8|Q6FI96|Q75L50|Q96IE4|Q9Y364	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.R81T	ENST00000288828.4	37	c.242	CCDS5339.1	7	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194641	0.78902	.	.	ENSG00000157954	ENST00000288828;ENST00000401525;ENST00000404704;ENST00000382384;ENST00000484262;ENST00000315176	T;T;T;T;T	0.64991	0.76;0.76;0.76;0.76;-0.13	5.16	5.16	0.70880	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84383	0.5460	M	0.92507	3.315	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.996;0.974;0.999;0.997;0.997;0.99	D	0.87174	0.2223	10	0.52906	T	0.07	-27.7917	19.013	0.92881	0.0:0.0:1.0:0.0	.	75;22;63;63;81;81	E7EVF6;Q9Y4P8-3;Q9Y4P8-2;Q9Y4P8-4;Q9Y4P8-6;Q9Y4P8	.;.;.;.;.;WIPI2_HUMAN	T	81;63;81;63;22;75	ENSP00000288828:R81T;ENSP00000384945:R63T;ENSP00000385297:R81T;ENSP00000371821:R63T;ENSP00000429654:R22T	ENSP00000288828:R81T	R	+	2	0	WIPI2	5220722	1.000000	0.71417	0.507000	0.27676	0.552000	0.35366	9.363000	0.97131	2.571000	0.86741	0.655000	0.94253	AGA	-	WIPI2	-	superfamily_WD40_repeat_dom		0.488	WIPI2-001	KNOWN	basic|CCDS	protein_coding	WIPI2	HGNC	protein_coding	OTTHUMT00000241669.2	0	0	0	112	112	45	0.00	0.00	G	NM_015610		5254196	+1	20	17	106	45	tier1	no_errors	ENST00000288828	ensembl	human	known	74_37	missense	15.87	27.42	SNP	1.000	C	20	106
SPEG	10290	genome.wustl.edu	37	2	220353597	220353597	+	Silent	SNP	G	G	A	rs374304716		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:220353597G>A	ENST00000312358.7	+	34	8256	c.8124G>A	c.(8122-8124)acG>acA	p.T2708T	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2708	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CACCTTGCACGTATACGCTGG	0.657													ENSG00000072195																																					0								G		1,4091		0,1,2045	23.0	26.0	25.0		8124	-8.5	0.6	2		25	0,8366		0,0,4183	no	coding-synonymous	SPEG	NM_005876.4		0,1,6228	AA,AG,GG		0.0,0.0244,0.0080		2708/3268	220353597	1,12457	2046	4183	6229	SO:0001819	synonymous_variant	0			-	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.8124G>A	2.37:g.220353597G>A			A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T2708	ENST00000312358.7	37	c.8124	CCDS42824.1	2																																																																																			-	SPEG	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.657	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	0	0	0	56	56	14	0.00	0.00	G	NM_005876		220353597	+1	20	5	51	13	tier1	no_errors	ENST00000312358	ensembl	human	novel	74_37	silent	28.17	27.78	SNP	0.086	A	20	51
ANO3	63982	genome.wustl.edu	37	11	26681890	26681890	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr11:26681890G>C	ENST00000256737.3	+	27	3697	c.2845G>C	c.(2845-2847)Gag>Cag	p.E949Q	ANO3_ENST00000525139.1_Missense_Mutation_p.E933Q|ANO3_ENST00000537978.1_Missense_Mutation_p.E933Q|ANO3_ENST00000531568.1_Missense_Mutation_p.E803Q	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	949					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						AATACGACGAGAGAAGTACTT	0.413													ENSG00000134343																																					0													150.0	138.0	142.0					11																	26681890		2203	4299	6502	SO:0001583	missense	0			-	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2845G>C	11.37:g.26681890G>C	ENSP00000256737:p.Glu949Gln		B7Z3F5	Missense_Mutation	SNP	pfam_Anoctamin	p.E949Q	ENST00000256737.3	37	c.2845	CCDS31447.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.491984	0.96339	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000538001;ENST00000531568	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.80939	0.4720	M	0.77712	2.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81656	-0.0834	10	0.59425	D	0.04	.	19.717	0.96124	0.0:0.0:1.0:0.0	.	851;949	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	Q	933;933;949;851;803	ENSP00000440737:E933Q;ENSP00000432576:E933Q;ENSP00000256737:E949Q;ENSP00000432394:E803Q	ENSP00000256737:E949Q	E	+	1	0	ANO3	26638466	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.667000	0.90743	0.650000	0.86243	GAG	-	ANO3	-	pfam_Anoctamin		0.413	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO3	HGNC	protein_coding	OTTHUMT00000387806.1	0	0	0	55	55	83	0.00	0.00	G	NM_031418		26681890	+1	22	16	56	77	tier1	no_errors	ENST00000256737	ensembl	human	known	74_37	missense	28.21	17.20	SNP	1.000	C	22	56
DNAH6	1768	genome.wustl.edu	37	2	84861702	84861702	+	Silent	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:84861702C>T	ENST00000237449.6	+	29	4598	c.4590C>T	c.(4588-4590)gaC>gaT	p.D1530D	DNAH6_ENST00000389394.3_Silent_p.D1530D|DNAH6_ENST00000398278.2_Silent_p.D1530D			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1530	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						ATCGAATTGACATAGAAGTTC	0.473													ENSG00000115423																																					0													97.0	82.0	86.0					2																	84861702		692	1591	2283	SO:0001819	synonymous_variant	0			-	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.4590C>T	2.37:g.84861702C>T			A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D1530	ENST00000237449.6	37	c.4590	CCDS46348.1	2																																																																																			-	DH6	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.473	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH6	HGNC	protein_coding	OTTHUMT00000328537.2	0	0	0	63	63	74	0.00	0.00	C	NM_001370		84861702	+1	11	17	43	71	tier1	no_errors	ENST00000237449	ensembl	human	known	74_37	silent	20.37	19.32	SNP	0.974	T	11	43
VPS4B	9525	genome.wustl.edu	37	18	61070983	61070983	+	Silent	SNP	T	T	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr18:61070983T>C	ENST00000238497.5	-	5	644	c.441A>G	c.(439-441)aaA>aaG	p.K147K	VPS4B_ENST00000591383.1_5'UTR	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	147					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						TCACAGCCTCTTTCAGTGCTT	0.343													ENSG00000119541																																					0													80.0	75.0	77.0					18																	61070983		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.441A>G	18.37:g.61070983T>C			Q69HW4|Q9GZS7	Silent	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_D_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.K147	ENST00000238497.5	37	c.441	CCDS11983.1	18																																																																																			-	VPS4B	-	superfamily_P-loop_NTPase		0.343	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4B	HGNC	protein_coding	OTTHUMT00000256198.2	0	0	0	58	58	92	0.00	0.00	T	NM_004869		61070983	-1	10	18	29	81	tier1	no_errors	ENST00000238497	ensembl	human	known	74_37	silent	25.64	18.18	SNP	1.000	C	10	29
TTN	7273	genome.wustl.edu	37	2	179596646	179596646	+	Nonsense_Mutation	SNP	G	G	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr2:179596646G>C	ENST00000591111.1	-	56	16229	c.16005C>G	c.(16003-16005)taC>taG	p.Y5335*	TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y5652*|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y4408*			Q8WZ42	TITIN_HUMAN	titin	12155	Ig-like 34.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACATGACATCGTACTCCTTTA	0.423													ENSG00000155657																																					0													89.0	91.0	91.0					2																	179596646		2014	4192	6206	SO:0001587	stop_gained	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16005C>G	2.37:g.179596646G>C	ENSP00000465570:p.Tyr5335*		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Y4408*	ENST00000591111.1	37	c.13224		2	.	.	.	.	.	.	.	.	.	.	G	54	22.988832	0.99952	.	.	ENSG00000155657	ENST00000342992	.	.	.	6.17	-0.54	0.11861	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.7519	0.13064	0.4783:0.0:0.3109:0.2108	.	.	.	.	X	4408	.	ENSP00000343764:Y4408X	Y	-	3	2	TTN	179304891	0.025000	0.19082	0.991000	0.47740	0.990000	0.78478	-0.555000	0.05999	-0.245000	0.09625	-0.290000	0.09829	TAC	-	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	33	33	113	0.00	0.00	G	NM_133378		179596646	-1	11	48	19	66	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	nonsense	36.67	42.11	SNP	0.944	C	11	19
UNC13C	440279	genome.wustl.edu	37	15	54306133	54306133	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr15:54306133A>G	ENST00000260323.11	+	1	1033	c.1033A>G	c.(1033-1035)Aaa>Gaa	p.K345E	UNC13C_ENST00000545554.1_Missense_Mutation_p.K345E|UNC13C_ENST00000537900.1_Missense_Mutation_p.K345E	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	345					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCTAATAGATAAAATGGGTTT	0.388													ENSG00000137766																																					0													68.0	68.0	68.0					15																	54306133		1838	4083	5921	SO:0001583	missense	0			-	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1033A>G	15.37:g.54306133A>G	ENSP00000260323:p.Lys345Glu		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.K345E	ENST00000260323.11	37	c.1033	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	A	17.57	3.422298	0.62622	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.81996	-1.56;-1.56;-1.56	4.93	4.93	0.64822	.	.	.	.	.	D	0.83608	0.5291	N	0.17082	0.46	0.49687	D	0.999811	D	0.69078	0.997	D	0.75020	0.985	D	0.86332	0.1699	9	0.72032	D	0.01	.	13.7769	0.63059	1.0:0.0:0.0:0.0	.	345	Q8NB66	UN13C_HUMAN	E	345	ENSP00000260323:K345E;ENSP00000438156:K345E;ENSP00000442569:K345E	ENSP00000260323:K345E	K	+	1	0	UNC13C	52093425	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.261000	0.95576	1.838000	0.53458	0.533000	0.62120	AAA	-	UNC13C	-	NULL		0.388	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	0	0	0	75	75	65	0.00	0.00	A	NM_173166		54306133	+1	14	27	27	50	tier1	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	34.15	35.06	SNP	1.000	G	14	27
CLDN6	9074	genome.wustl.edu	37	16	3065590	3065590	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr16:3065590G>A	ENST00000396925.1	-	3	861	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W	CLDN6_ENST00000572154.1_Intron|CLDN6_ENST00000328796.4_Missense_Mutation_p.R145W|TNFRSF12A_ENST00000573001.1_5'Flank			P56747	CLD6_HUMAN	claudin 6	145					calcium-independent cell-cell adhesion (GO:0016338)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	10						TAGAAGTCCCGGATGATGGCA	0.627													ENSG00000184697																																					0													22.0	24.0	23.0					16																	3065590		2196	4297	6493	SO:0001583	missense	0			-	AJ249735	CCDS10488.1	16p13.3	2008-08-01			ENSG00000184697	ENSG00000184697		"""Claudins"""	2048	protein-coding gene	gene with protein product		615798				9892664, 18234789	Standard	NM_021195		Approved		uc002csu.4	P56747	OTTHUMG00000128999	ENST00000396925.1:c.433C>T	16.37:g.3065590G>A	ENSP00000380131:p.Arg145Trp		B3KQP9|D3DUA5	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin6	p.R145W	ENST00000396925.1	37	c.433	CCDS10488.1	16	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622358	0.28889	.	.	ENSG00000184697	ENST00000396925;ENST00000328796	D;D	0.89270	-2.49;-2.49	4.76	3.73	0.42828	.	0.602915	0.15819	N	0.243097	D	0.89588	0.6758	M	0.89968	3.075	0.34931	D	0.749378	B	0.32071	0.355	B	0.25506	0.061	D	0.93213	0.6602	10	0.72032	D	0.01	.	12.1796	0.54204	0.0:0.0:0.8289:0.1711	.	145	P56747	CLD6_HUMAN	W	145	ENSP00000380131:R145W;ENSP00000328674:R145W	ENSP00000328674:R145W	R	-	1	2	CLDN6	3005591	1.000000	0.71417	0.996000	0.52242	0.139000	0.21198	4.874000	0.63064	2.638000	0.89438	0.655000	0.94253	CGG	-	CLDN6	-	pfam_PMP22/EMP/MP20/Claudin		0.627	CLDN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN6	HGNC	protein_coding	OTTHUMT00000250988.1	0	0	0	29	29	6	0.00	0.00	G	NM_021195		3065590	-1	12	2	30	16	tier1	no_errors	ENST00000328796	ensembl	human	known	74_37	missense	28.57	11.11	SNP	0.988	A	12	30
RABGGTB	5876	genome.wustl.edu	37	1	76259678	76259714	+	Intron	DEL	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	-	rs372421559|rs377221880|rs75986168|rs141490560|rs377745023	byFrequency	TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	-	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:76259678_76259714delCCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	ENST00000319942.3	+	8	776				RABGGTB_ENST00000496055.1_Intron|RABGGTB_ENST00000535300.1_Intron|MSH4_ENST00000263187.3_5'Flank	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						CATCAGATTACCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCTCAAAATTAGG	0.376													ENSG00000137955		911	0.181909	0.1604	0.2781	5008	,	,		24903	0.0169		0.2843	False		,,,				2504	0.2076																0																																										SO:0001627	intron_variant	0				U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.706-55CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT>-	1.37:g.76259678_76259714delCCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT			Q92697	R	DEL	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																				RABGGTB	-	-		0.376	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1	0	0	0	47	47	47	0.00	0.00	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	NM_004582		76259714	+1	4	4	30	30	tier1	no_errors	ENST00000459697	ensembl	human	known	74_37	rna	11.76	11.76	DEL	0.002:0.001:0.001:0.000:0.002:0.005:0.008:0.009:0.007:0.005:0.003:0.003:0.001:0.001:0.002:0.001:0.001:0.001:0.000:0.000:0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000	-	4	30
AKNAD1	254268	genome.wustl.edu	37	1	109400924	109400924	+	5'Flank	DEL	T	T	-			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:109400924delT	ENST00000370001.3	-	0	0				AKNAD1_ENST00000357393.4_Intron|SPATA42_ENST00000417241.1_RNA|AKNAD1_ENST00000369995.3_5'Flank|SPATA42_ENST00000369989.2_RNA	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1							cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						AACTTTTGTCTTTTTTTTTTT	0.363													ENSG00000203897																																					0																																										SO:0001631	upstream_gene_variant	0				AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231		1.37:g.109400924delT	Exception_encountered		B9EK62|Q5T1N0|Q8N990|Q8NCN9	R	DEL	-	NULL	ENST00000370001.3	37	NULL	CCDS791.2	1																																																																																				SPATA42	-	-		0.363	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA42	HGNC	protein_coding	OTTHUMT00000030923.2	0	0	0	8	8	19	0.00	0.00	T	NM_152763		109400924	+1	6	6	15	13	tier1	no_errors	ENST00000417241	ensembl	human	known	74_37	rna	28.57	31.58	DEL	0.000	-	6	15
LGALS3BP	3959	genome.wustl.edu	37	17	76968782	76968783	+	Frame_Shift_Ins	INS	-	-	GTAC			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	-	-	-	GTAC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr17:76968782_76968783insGTAC	ENST00000262776.3	-	6	941_942	c.633_634insGTAC	c.(631-636)tacttcfs	p.F212fs	LGALS3BP_ENST00000591778.1_Frame_Shift_Ins_p.-127fs	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	212	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			CGGGAGTAGAAGTACCTGGGGA	0.604													ENSG00000108679																									GBM(89;1105 1755 18102 21513)												0																																										SO:0001589	frameshift_variant	0				L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.630_633dupGTAC	17.37:g.76968783_76968786dupGTAC	ENSP00000262776:p.Phe212fs		Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Frame_Shift_Ins	INS	pfam_SRCR,pfam_BACK,superfamily_Srcr_rcpt-rel,superfamily_BTB/POZ_fold,smart_Srcr_rcpt-rel,smart_BACK,pfscan_BTB/POZ-like,pfscan_SRCR,prints_SRCR	p.F211fs	ENST00000262776.3	37	c.634_633	CCDS11759.1	17																																																																																				LGALS3BP	-	superfamily_BTB/POZ_fold,pfscan_BTB/POZ-like		0.604	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS3BP	HGNC	protein_coding	OTTHUMT00000437785.3	0	0	0	21	21	60	0.00	0.00	-	NM_005567		76968783	-1	8	12	17	12	tier1	no_errors	ENST00000262776	ensembl	human	known	74_37	frame_shift_ins	32.00	50.00	INS	0.997:1.000	GTAC	8	17
TJP2	9414	genome.wustl.edu	37	9	71869131	71869132	+	Frame_Shift_Ins	INS	-	-	C	rs371868714		TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr9:71869131_71869132insC	ENST00000377245.4	+	23	3622_3623	c.3414_3415insC	c.(3415-3417)cccfs	p.P1139fs	TJP2_ENST00000453658.2_Frame_Shift_Ins_p.P969fs|TJP2_ENST00000535702.1_Frame_Shift_Ins_p.P1106fs|TJP2_ENST00000539225.1_Frame_Shift_Ins_p.P1170fs|TJP2_ENST00000348208.4_Frame_Shift_Ins_p.P992fs	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	1139					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						TTAGTTCCAGACCCCCTGAGCC	0.545													ENSG00000119139																																					0																																										SO:0001589	frameshift_variant	0				L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.3419dupC	9.37:g.71869136_71869136dupC	ENSP00000366453:p.Pro1139fs		A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Frame_Shift_Ins	INS	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_SH3_2,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS2,prints_ZonOcculdens	p.E1171fs	ENST00000377245.4	37	c.3507_3508	CCDS6627.1	9																																																																																				TJP2	-	NULL		0.545	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	HGNC	protein_coding	OTTHUMT00000052572.2	0	0	0	39	39	80	0.00	0.00	-	NM_201629		71869132	+1	10	15	46	93	tier1	no_errors	ENST00000539225	ensembl	human	known	74_37	frame_shift_ins	17.86	13.89	INS	0.167:0.194	C	10	46
TRIM52	84851	genome.wustl.edu	37	5	180686884	180686888	+	Intron	DEL	AAGAG	AAGAG	-			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	AAGAG	AAGAG	AAGAG	-	AAGAG	AAGAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr5:180686884_180686888delAAGAG	ENST00000327767.4	-	1	1118				CTC-338M12.4_ENST00000511331.1_RNA|CTC-338M12.4_ENST00000417281.2_RNA|TRIM52_ENST00000514805.1_5'UTR|CTC-338M12.4_ENST00000505151.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA|TRIM52-AS1_ENST00000507434.1_RNA|CTC-338M12.4_ENST00000506340.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52						positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		TCATCAAATAAAGAGAAGTTTAGCA	0.478													ENSG00000183718																																					0																																										SO:0001627	intron_variant	0					CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.813+113CTCTT>-	5.37:g.180686884_180686888delAAGAG				R	DEL	-	NULL	ENST00000327767.4	37	NULL	CCDS4467.1	5																																																																																				TRIM52	-	-		0.478	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM52	HGNC	protein_coding	OTTHUMT00000253572.3	0	0	0	81	81	81	0.00	0.00	AAGAG	NM_032765		180686888	-1	21	21	38	38	tier1	no_errors	ENST00000514805	ensembl	human	known	74_37	rna	35.59	35.59	DEL	0.000:0.000:0.000:0.001:0.002	-	21	38
MRC1	4360	genome.wustl.edu	37	10	17891663	17891663	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr10:17891663A>G	ENST00000331429.2	+	7	1247	c.1144A>G	c.(1144-1146)Aaa>Gaa	p.K382E	MRC1L1_ENST00000457317.1_Missense_Mutation_p.K382E																breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AGATGAGAAAAAAATCCAGAG	0.488													ENSG00000183748																																					0													83.0	104.0	97.0					10																	17891663		2168	4170	6338	SO:0001583	missense	0			-																												ENST00000331429.2:c.1144A>G	10.37:g.17891663A>G	ENSP00000332124:p.Lys382Glu			Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_Ricin_B_lectin,superfamily_C-type_lectin_fold,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.K382E	ENST00000331429.2	37	c.1144		10	.	.	.	.	.	.	.	.	.	.	A	14.66	2.600753	0.46423	.	.	ENSG00000183748	ENST00000331429;ENST00000457317	T;T	0.11604	3.45;2.76	3.74	3.74	0.42951	.	0.000000	0.64402	U	0.000016	T	0.16128	0.0388	.	.	.	0.32328	N	0.561445	D	0.76494	0.999	D	0.68621	0.959	T	0.11941	-1.0567	8	0.08837	T	0.75	-27.6767	7.2915	0.26368	0.8971:0.0:0.1029:0.0	.	382	B9EJA8	.	E	382	ENSP00000332124:K382E;ENSP00000391843:K382E	ENSP00000332124:K382E	K	+	1	0	AL928580.1	17931669	1.000000	0.71417	0.986000	0.45419	0.631000	0.37964	3.420000	0.52735	1.691000	0.51100	0.378000	0.23410	AAA	-	MRC1L1	-	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.488	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	101928757	Clone_based_vega_gene	protein_coding	OTTHUMT00000047054.1	0	0	0	24	24	16	0.00	0.00	A			17891663	+1	9	8	0	0	tier1	no_errors	ENST00000457317	ensembl	human	known	74_37	missense	100.00	100.00	SNP	0.970	G	9	0
METRN	79006	genome.wustl.edu	37	16	766992	766992	+	Splice_Site	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr16:766992G>A	ENST00000568223.2	+	3	740	c.565G>A	c.(565-567)Gta>Ata	p.V189I	METRN_ENST00000568415.1_Splice_Site_p.V56I	NM_024042.2	NP_076947.1	Q9UJH8	METRN_HUMAN	meteorin, glial cell differentiation regulator	189					glial cell differentiation (GO:0010001)|positive regulation of axonogenesis (GO:0050772)	extracellular space (GO:0005615)				skin(1)	1		Hepatocellular(780;0.00335)				CAGCGACTTCGGTGAGTGTCC	0.662													ENSG00000103260																																					0													32.0	36.0	35.0					16																	766992		2192	4298	6490	SO:0001630	splice_region_variant	0			-	BC000662	CCDS10422.1	16p13.3	2008-02-05	2004-11-26	2004-12-01	ENSG00000103260	ENSG00000103260			14151	protein-coding gene	gene with protein product		610998	"""chromosome 16 open reading frame 23"""	C16orf23		15085178	Standard	NM_024042		Approved	MGC2601	uc002cjd.3	Q9UJH8	OTTHUMG00000047851	ENST00000568223.2:c.565+1G>A	16.37:g.766992G>A			Q9UJH9	Missense_Mutation	SNP	NULL	p.V189I	ENST00000568223.2	37	c.565	CCDS10422.1	16	.	.	.	.	.	.	.	.	.	.	G	12.14	1.847303	0.32606	.	.	ENSG00000103260	ENST00000219542	.	.	.	4.15	2.12	0.27331	.	0.000000	0.64402	D	0.000001	T	0.47322	0.1439	M	0.81802	2.56	0.51482	D	0.999921	D	0.56287	0.975	B	0.40009	0.316	T	0.47861	-0.9084	9	0.66056	D	0.02	-12.1545	4.1242	0.10119	0.2129:0.1957:0.5915:0.0	.	189	Q9UJH8	METRN_HUMAN	I	189	.	ENSP00000219542:V189I	V	+	1	0	METRN	706993	1.000000	0.71417	0.999000	0.59377	0.655000	0.38815	4.817000	0.62650	0.383000	0.24910	0.558000	0.71614	GTA	-	METRN	-	NULL		0.662	METRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METRN	HGNC	protein_coding	OTTHUMT00000109074.4	0	0	0	66	66	7	0.00	0.00	G	NM_024042	Missense_Mutation	766992	+1	42	3	111	5	tier1	no_errors	ENST00000568223	ensembl	human	known	74_37	missense	27.45	37.50	SNP	1.000	A	42	111
CEP350	9857	genome.wustl.edu	37	1	179961245	179961245	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:179961245C>G	ENST00000367607.3	+	5	702	c.284C>G	c.(283-285)tCc>tGc	p.S95C		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	95					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ATCTCCAAATCCACTAAATCA	0.398													ENSG00000135837																																					0													49.0	48.0	48.0					1																	179961245		2203	4295	6498	SO:0001583	missense	0			-	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.284C>G	1.37:g.179961245C>G	ENSP00000356579:p.Ser95Cys		O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.S95C	ENST00000367607.3	37	c.284	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544069	0.27563	.	.	ENSG00000135837	ENST00000367607;ENST00000491495;ENST00000357434	T	0.59083	0.29	4.68	0.64	0.17752	.	0.937624	0.08743	N	0.900222	T	0.46541	0.1398	N	0.19112	0.55	0.23681	N	0.997124	P;B;D	0.53619	0.947;0.022;0.961	B;B;P	0.50378	0.319;0.007;0.639	T	0.33879	-0.9851	9	.	.	.	.	5.4714	0.16672	0.1384:0.5516:0.0:0.31	.	95;95;69	E7EU22;Q5VT06;E9PIK0	.;CE350_HUMAN;.	C	95;69;94	ENSP00000356579:S95C	.	S	+	2	0	CEP350	178227868	0.970000	0.33590	0.969000	0.41365	0.831000	0.47069	1.103000	0.31062	0.275000	0.22094	-0.196000	0.12772	TCC	-	CEP350	-	NULL		0.398	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	0	0	1	48	48	95	0.00	1.04	C	NM_014810		179961245	+1	14	29	119	344	tier1	no_errors	ENST00000367607	ensembl	human	known	74_37	missense	10.53	7.77	SNP	0.824	G	14	119
MPO	4353	genome.wustl.edu	37	17	56355490	56355490	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr17:56355490G>A	ENST00000225275.3	-	7	1078	c.902C>T	c.(901-903)cCc>cTc	p.P301L	MPO_ENST00000340482.3_Missense_Mutation_p.P333L|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	301					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	CTTGATGCGGGGGTCATTGGG	0.627													ENSG00000005381																																					0													75.0	72.0	73.0					17																	56355490		2203	4300	6503	SO:0001583	missense	0			-		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.902C>T	17.37:g.56355490G>A	ENSP00000225275:p.Pro301Leu		A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.P333L	ENST00000225275.3	37	c.998	CCDS11604.1	17	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455361	0.84209	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.71817	-0.6;-0.6	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.86977	0.6063	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89336	0.3650	10	0.87932	D	0	-30.5659	18.0012	0.89198	0.0:0.0:1.0:0.0	.	301	P05164	PERM_HUMAN	L	333;301	ENSP00000344419:P333L;ENSP00000225275:P301L	ENSP00000225275:P301L	P	-	2	0	MPO	53710489	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.362000	0.66098	2.518000	0.84900	0.561000	0.74099	CCC	-	MPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.627	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	0	0	0	21	21	49	0.00	0.00	G			56355490	-1	8	7	44	85	tier1	no_errors	ENST00000340482	ensembl	human	known	74_37	missense	15.38	7.61	SNP	1.000	A	8	44
PRMT5	10419	genome.wustl.edu	37	14	23389819	23389819	+	3'UTR	SNP	G	G	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr14:23389819G>A	ENST00000324366.8	-	0	2431				RBM23_ENST00000555209.1_5'Flank|PRMT5-AS1_ENST00000424245.2_RNA|RBM23_ENST00000556984.1_5'Flank|RBM23_ENST00000359890.3_5'Flank|PRMT5_ENST00000397441.2_3'UTR|PRMT5-AS1_ENST00000590290.1_RNA|PRMT5-AS1_ENST00000595662.1_RNA|RBM23_ENST00000346528.5_5'Flank|PRMT5-AS1_ENST00000609885.1_RNA|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5_ENST00000397440.4_3'UTR|PRMT5-AS1_ENST00000457443.2_RNA|RBM23_ENST00000399922.2_5'Flank|RBM23_ENST00000542016.2_5'Flank|PRMT5_ENST00000216350.8_3'UTR|PRMT5-AS1_ENST00000587245.2_RNA	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5						cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		CTGAAAATCCGTTCAAACCCC	0.463													ENSG00000237054																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.*294C>T	14.37:g.23389819G>A			A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	R	SNP	-	NULL	ENST00000324366.8	37	NULL	CCDS9579.1	14																																																																																			-	PRMT5-AS1	-	-		0.463	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT5-AS1	HGNC	protein_coding	OTTHUMT00000071674.3	0	0	0	28	28	84	0.00	0.00	G			23389819	+1	7	10	36	117	tier1	no_errors	ENST00000424245	ensembl	human	known	74_37	rna	16.28	7.87	SNP	0.000	A	7	36
ARHGEF25	115557	genome.wustl.edu	37	12	58008522	58008522	+	Silent	SNP	C	C	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr12:58008522C>T	ENST00000286494.4	+	9	1327	c.867C>T	c.(865-867)atC>atT	p.I289I	AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA|ARHGEF25_ENST00000333972.7_Silent_p.I328I|AC025165.8_ENST00000610219.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	289	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.|Important for binding to Rho GTPases.					cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						ACCTCCTCATCAAACCTGTGC	0.597													ENSG00000240771																																					0													29.0	30.0	29.0					12																	58008522		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.867C>T	12.37:g.58008522C>T			A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.I328	ENST00000286494.4	37	c.984	CCDS8947.1	12																																																																																			-	ARHGEF25	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.597	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	ARHGEF25	HGNC	protein_coding	OTTHUMT00000326561.1	0	0	0	29	29	38	0.00	0.00	C	NM_133483		58008522	+1	24	20	258	308	tier1	no_errors	ENST00000333972	ensembl	human	known	74_37	silent	8.51	6.10	SNP	1.000	T	24	258
POTEM	641455	genome.wustl.edu	37	14	20010458	20010458	+	Intron	SNP	T	T	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr14:20010458T>C	ENST00000551509.1	-	5	969				RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						CTCAGTGGGGTATTGCATAGC	0.348													ENSG00000258276																																					0																																										SO:0001627	intron_variant	0			-		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-218A>G	14.37:g.20010458T>C				R	SNP	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			-	RP11-244H18.1	-	-		0.348	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LOC100508046	Clone_based_vega_gene	protein_coding	OTTHUMT00000409490.3	0	0	1	21	21	24	0.00	3.85	T	NM_001145442		20010458	+1	4	28	14	35	tier1	no_errors	ENST00000547584	ensembl	human	known	74_37	rna	22.22	43.08	SNP	0.000	C	4	14
AC002485.1	0	genome.wustl.edu	37	6	67069360	67069361	+	RNA	INS	-	-	ACACACACAC	rs60357112|rs112345412	byFrequency	TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr6:67069360_67069361insACACACACAC	ENST00000408354.1	+	0	43_44																											AGTATGCAAATacacacacaca	0.406													ENSG00000221281																																					0																																												0																																6.37:g.67069361_67069370dupACACACACAC				R	INS	-	NULL	ENST00000408354.1	37	NULL		6																																																																																				AC002485.1	-	-		0.406	AC002485.1-201	NOVEL	basic	miRNA	ENSG00000221281	Clone_based_ensembl_gene	miRNA		0	0	0	0	0	0	0.00	0.00	-			67069361	+1	0	0	0	0	tier1	no_errors	ENST00000408354	ensembl	human	novel	74_37	rna	0.00	0.00	INS	0.000:0.000	ACACACACAC	0	0
HERC2P4	100289574	genome.wustl.edu	37	16	32163957	32163957	+	IGR	SNP	G	G	C			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr16:32163957G>C								RP11-1166P10.6 (67851 upstream) : HERC2P4 (17347 downstream)																							GCGCCACCTCGGCATGGACTC	0.627													ENSG00000230267																																					0																																										SO:0001628	intergenic_variant	0			-																													16.37:g.32163957G>C				R	SNP	-	NULL		37	NULL		16																																																																																			-	HERC2P4	-	-	0	0.627					HERC2P4	HGNC			0	0	0	83	83	3	0.00	0.00	G			32163957	-1	20	0	76	5	tier1	no_errors	ENST00000563904	ensembl	human	known	74_37	rna	20.83	0.00	SNP	0.818	C	20	76
MSH3	4437	genome.wustl.edu	37	5	79950712	79950738	+	In_Frame_Del	DEL	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA	-	rs2431220|rs2001675|rs2405876|rs2405877|rs201874762|rs144776112|rs1574197|rs148550291|rs201906899|rs535056167|rs60484572|rs70991168|rs201149584	byFrequency	TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr5:79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENST00000265081.6	+	1	246_272	c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	c.(166-192)gcggccgcagcggccgcagcgcccccadel	p.AAAAAAAPP56del	DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	56	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		agcggctgcagcggccgcagcggccgcagcgCCCCCAGCGCCCCCAG	0.705								Mismatch excision repair (MMR)					ENSG00000113318																									Melanoma(88;1010 1399 13793 26548 36275)												0																																										SO:0001651	inframe_deletion	0				U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	5.37:g.79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENSP00000265081:p.Ala56_Pro64del		A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	pfam_D_mismatch_repair_MutS_C,pfam_D_mismatch_repair_MutS_core,pfam_D_mmatch_repair_MutS_con_dom,pfam_D_mismatch_repair_MutS-lik_N,pfam_D_mismatch_repair_MutS_clamp,superfamily_D_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_D_mismatch_repair_MutS_N,superfamily_D_mmatch_repair_MutS_con_dom,smart_D_mismatch_repair_MutS_core,smart_D_mismatch_repair_MutS_C	p.AAAAAAPPA57in_frame_del	ENST00000265081.6	37	c.166_192	CCDS34195.1	5																																																																																				MSH3	-	NULL		0.705	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	HGNC	protein_coding	OTTHUMT00000369471.1	0	0	0	0	0	0	0.00	0.00	GCGGCCGCAGCGGCCGCAGCGCCCCCA	NM_002439		79950738	+1	0	0	0	0	tier1	no_errors	ENST00000265081	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.238:0.205:0.172:0.140:0.107:0.075:0.032:0.035:0.048:0.057:0.087:0.730:0.747:0.894:0.911:0.915:0.941:0.965:0.997:1.000:1.000:1.000:1.000:0.988:0.984:0.963:0.965	-	0	0
NBPF10	100132406	genome.wustl.edu	37	1	145366987	145366987	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr1:145366987C>G	ENST00000342960.5	+	82	10332	c.10297C>G	c.(10297-10299)Ctt>Gtt	p.L3433V	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	747						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGGCTTGGCTCTTGACGTGGA	0.493													ENSG00000163386																																					0																																										SO:0001583	missense	0			-	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10297C>G	1.37:g.145366987C>G	ENSP00000345684:p.Leu3433Val		Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.L3433V	ENST00000342960.5	37	c.10297	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	1.387	-0.581928	0.03827	.	.	ENSG00000163386	ENST00000342960	T	0.13307	2.6	1.43	-1.69	0.08186	.	.	.	.	.	T	0.04679	0.0127	L	0.52126	1.63	0.09310	N	1	.	.	.	.	.	.	T	0.41305	-0.9516	7	0.42905	T	0.14	.	1.7902	0.03049	0.3214:0.4347:0.0:0.2438	.	.	.	.	V	3433	ENSP00000345684:L3433V	ENSP00000345684:L3433V	L	+	1	0	NBPF10	144078344	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.353000	0.07691	-0.040000	0.13580	-0.561000	0.04177	CTT	-	NBPF10	-	pfam_NBPF_dom		0.493	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		0	0	0	29	29	0	0.00	0.00	C	NM_001039703		145366987	+1	7	0	10	0	tier1	no_errors	ENST00000342960	ensembl	human	known	74_37	missense	41.18	0.00	SNP	0.000	G	7	10
WASH3P	374666	genome.wustl.edu	37	15	102516467	102516467	+	RNA	SNP	T	T	A			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr15:102516467T>A	ENST00000557932.1	+	0	1415				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						CTGGGAATCCTAGGGGGCTCC	0.647													ENSG00000185596																																					0																																												0			-			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516467T>A				R	SNP	-	NULL	ENST00000557932.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	t	11.88	1.769215	0.31320	.	.	ENSG00000185596	ENST00000398121;ENST00000378819	.	.	.	0.906	0.906	0.19314	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.0975	0.09998	0.0:0.0:0.0:1.0	.	.	.	.	K	464;359	.	.	X	+	1	0	WASH3P	100333990	1.000000	0.71417	0.926000	0.36857	0.594000	0.36715	4.390000	0.59646	0.662000	0.31006	0.155000	0.16302	TAG	-	WASH3P	-	-		0.647	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1	1	1	0	274	274	0	0.36	0.00	T	NM_199163		102516467	+1	25	0	282	0	tier1	no_errors	ENST00000557932	ensembl	human	known	74_37	rna	8.14	0.00	SNP	0.984	A	25	282
PRKCSH	5589	genome.wustl.edu	37	19	11558341	11558346	+	In_Frame_Del	DEL	GAGGAG	GAGGAG	-	rs543211095|rs397840350|rs71166603|rs3217229	byFrequency	TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	GAGGAG	GAGGAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr19:11558341_11558346delGAGGAG	ENST00000589838.1	+	10	937_942	c.937_942delGAGGAG	c.(937-942)gaggagdel	p.EE323del	PRKCSH_ENST00000592741.1_In_Frame_Del_p.EE323del|PRKCSH_ENST00000591462.1_In_Frame_Del_p.EE323del|PRKCSH_ENST00000587327.1_In_Frame_Del_p.EE323del|PRKCSH_ENST00000252455.2_In_Frame_Del_p.EE323del|PRKCSH_ENST00000412601.1_In_Frame_Del_p.EE323del			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	323	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						GTCGCCCACAgaggaggaggaggagg	0.655													ENSG00000130175																																					0																																										SO:0001651	inframe_deletion	0					CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.937_942delGAGGAG	19.37:g.11558347_11558352delGAGGAG	ENSP00000465461:p.Glu323_Glu324del		A8K318|Q96BU9|Q96D06|Q9P0W9	In_Frame_Del	DEL	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_LDrepeatLR_classA_rpt,pfscan_EF_hand_dom	p.EE316in_frame_del	ENST00000589838.1	37	c.937_942	CCDS32911.1	19																																																																																				PRKCSH	-	NULL		0.655	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKCSH	HGNC	protein_coding	OTTHUMT00000458817.1	0	0	0	2	2	2	0.00	0.00	GAGGAG			11558346	+1	5	5	6	6	tier1	no_errors	ENST00000252455	ensembl	human	known	74_37	in_frame_del	45.45	45.45	DEL	0.997:0.999:0.994:1.000:1.000:0.720	-	5	6
PSD	5662	genome.wustl.edu	37	10	104174766	104174766	+	Silent	SNP	G	G	T			TCGA-FX-A2QS-01A-11D-A21Q-09	TCGA-FX-A2QS-11A-11D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d332cb1-ba25-47e4-8bf8-d25e14f40d59	5b25b7db-9b62-46da-bb84-314e9186da96	g.chr10:104174766G>T	ENST00000020673.5	-	4	1504	c.978C>A	c.(976-978)ggC>ggA	p.G326G	PSD_ENST00000406432.1_Silent_p.G326G|PSD_ENST00000492902.2_5'Flank	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	326					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GGTAGGCAGTGCCTGGTGGGC	0.672													ENSG00000059915																																					0													69.0	58.0	61.0					10																	104174766		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.978C>A	10.37:g.104174766G>T			B1AKX7|D3DR87|Q15673|Q8IVG0	Silent	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.G326	ENST00000020673.5	37	c.978	CCDS31272.1	10																																																																																			-	PSD	-	NULL		0.672	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	HGNC	protein_coding	OTTHUMT00000050041.2	0	0	0	71	71	4	0.00	0.00	G			104174766	-1	26	4	61	4	tier1	no_errors	ENST00000020673	ensembl	human	known	74_37	silent	29.89	50.00	SNP	0.988	T	26	61
