#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ANK3	288	genome.wustl.edu	37	10	61833769	61833769	+	Silent	SNP	C	C	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr10:61833769C>G	ENST00000280772.2	-	37	7061	c.6870G>C	c.(6868-6870)ctG>ctC	p.L2290L	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2290					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ACAGACCTGCCAGTTCTTTGG	0.498													ENSG00000151150																																					0													121.0	119.0	120.0					10																	61833769		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.6870G>C	10.37:g.61833769C>G			B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.L2290	ENST00000280772.2	37	c.6870	CCDS7258.1	10																																																																																			-	ANK3	-	NULL		0.498	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	0	0	0	76	76	46	0.00	0.00	C	NM_020987		61833769	-1	6	9	25	56	tier1	no_errors	ENST00000280772	ensembl	human	known	74_37	silent	19.35	13.85	SNP	1.000	G	6	25
IL17RA	23765	genome.wustl.edu	37	22	17590484	17590484	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr22:17590484C>A	ENST00000319363.6	+	13	2508	c.2375C>A	c.(2374-2376)tCt>tAt	p.S792Y		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	792					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TCAGTGCAGTCTGACCAGGGC	0.662													ENSG00000177663																																					0													21.0	19.0	19.0					22																	17590484		2198	4295	6493	SO:0001583	missense	0			-	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.2375C>A	22.37:g.17590484C>A	ENSP00000320936:p.Ser792Tyr		O43844|Q20WK1	Missense_Mutation	SNP	pfam_SEFIR	p.S792Y	ENST00000319363.6	37	c.2375	CCDS13739.1	22	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524446	0.85600	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.16073	2.37	4.55	4.55	0.56014	.	0.166559	0.41001	D	0.000961	T	0.42086	0.1187	M	0.65498	2.005	0.45205	D	0.99821	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.42155	-0.9468	10	0.87932	D	0	-25.4231	17.6726	0.88222	0.0:1.0:0.0:0.0	.	740;792	D3YTB4;Q96F46	.;I17RA_HUMAN	Y	740;792	ENSP00000320936:S792Y	ENSP00000320936:S792Y	S	+	2	0	IL17RA	15970484	1.000000	0.71417	0.943000	0.38184	0.964000	0.63967	6.591000	0.74090	2.227000	0.72691	0.655000	0.94253	TCT	-	IL17RA	-	NULL		0.662	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RA	HGNC	protein_coding	OTTHUMT00000315820.1	0	0	0	39	39	24	0.00	0.00	C	NM_014339		17590484	+1	22	4	26	19	tier1	no_errors	ENST00000319363	ensembl	human	known	74_37	missense	45.83	17.39	SNP	0.999	A	22	26
CRY1	1407	genome.wustl.edu	37	12	107395061	107395061	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr12:107395061T>A	ENST00000008527.5	-	5	1548	c.681A>T	c.(679-681)agA>agT	p.R227S		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	227					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						ATCATACTTTTCTTTCCAAAT	0.323													ENSG00000008405																																					0													92.0	94.0	94.0					12																	107395061		2203	4300	6503	SO:0001583	missense	0			-	BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.681A>T	12.37:g.107395061T>A	ENSP00000008527:p.Arg227Ser			Missense_Mutation	SNP	pfam_Photolyase_FAD-bd/Cryptochr_C,pfam_D_photolyase_N,superfamily_Photolyase_FAD-bd/Cryptochr_C,superfamily_D_photolyase_N	p.R227S	ENST00000008527.5	37	c.681	CCDS9112.1	12	.	.	.	.	.	.	.	.	.	.	T	16.97	3.268011	0.59540	.	.	ENSG00000008405	ENST00000008527	.	.	.	5.72	5.72	0.89469	DNA photolyase, FAD-binding/Cryptochrome, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.52549	0.1741	L	0.52126	1.63	0.80722	D	1	B	0.31153	0.31	B	0.35114	0.196	T	0.52480	-0.8570	9	0.37606	T	0.19	-21.0442	10.3536	0.43950	0.0:0.0731:0.0:0.9269	.	227	Q16526	CRY1_HUMAN	S	227	.	ENSP00000008527:R227S	R	-	3	2	CRY1	105919191	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.640000	0.46579	2.176000	0.68965	0.455000	0.32223	AGA	-	CRY1	-	pfam_Photolyase_FAD-bd/Cryptochr_C,superfamily_Photolyase_FAD-bd/Cryptochr_C		0.323	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRY1	HGNC	protein_coding	OTTHUMT00000406827.1	0	0	0	12	12	46	0.00	0.00	T	NM_004075		107395061	-1	5	35	10	39	tier1	no_errors	ENST00000008527	ensembl	human	known	74_37	missense	33.33	47.30	SNP	1.000	A	5	10
GNPAT	8443	genome.wustl.edu	37	1	231411035	231411035	+	Silent	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:231411035C>T	ENST00000366647.4	+	13	1981	c.1812C>T	c.(1810-1812)gtC>gtT	p.V604V	GNPAT_ENST00000366646.3_Silent_p.V543V|GNPAT_ENST00000469332.1_3'UTR	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	604					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TGGCTGCAGTCAGAAAATTCA	0.423													ENSG00000116906																																					0													113.0	106.0	109.0					1																	231411035		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1812C>T	1.37:g.231411035C>T			B4DNM9|Q5TBH7|Q9BWC2	Silent	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.V604	ENST00000366647.4	37	c.1812	CCDS1592.1	1																																																																																			-	GNPAT	-	NULL		0.423	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNPAT	HGNC	protein_coding	OTTHUMT00000092871.1	0	0	0	70	70	64	0.00	0.00	C			231411035	+1	37	57	46	34	tier1	no_errors	ENST00000366647	ensembl	human	known	74_37	silent	44.58	62.64	SNP	0.782	T	37	46
BCLAF1	9774	genome.wustl.edu	37	6	136599100	136599100	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr6:136599100G>A	ENST00000531224.1	-	4	1171	c.919C>T	c.(919-921)Cca>Tca	p.P307S	BCLAF1_ENST00000530767.1_Missense_Mutation_p.P307S|BCLAF1_ENST00000527536.1_Missense_Mutation_p.P307S|BCLAF1_ENST00000527759.1_Missense_Mutation_p.P305S|BCLAF1_ENST00000392348.2_Missense_Mutation_p.P305S|BCLAF1_ENST00000353331.4_Missense_Mutation_p.P305S	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	307					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GCATTCTGTGGTGCGATTGTC	0.453													ENSG00000029363																									Colon(142;1534 1789 5427 7063 28491)												0													85.0	80.0	81.0					6																	136599100		2203	4300	6503	SO:0001583	missense	0			-	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.919C>T	6.37:g.136599100G>A	ENSP00000435210:p.Pro307Ser		A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	NULL	p.P307S	ENST00000531224.1	37	c.919	CCDS5177.1	6	.	.	.	.	.	.	.	.	.	.	G	9.895	1.205289	0.22205	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9;2.9;2.9	5.82	4.95	0.65309	.	0.216399	0.34628	N	0.003818	T	0.02970	0.0088	L	0.34521	1.04	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.35968	-0.9767	10	0.37606	T	0.19	-9.6741	4.057	0.09821	0.158:0.0:0.6237:0.2183	.	305;305;307;307	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	S	307;305;307;307;305;305;307	ENSP00000435210:P307S;ENSP00000229446:P305S;ENSP00000435441:P307S;ENSP00000436501:P307S;ENSP00000434826:P305S;ENSP00000376159:P305S;ENSP00000431734:P307S	ENSP00000229446:P305S	P	-	1	0	BCLAF1	136640793	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.833000	0.39161	2.754000	0.94517	0.650000	0.86243	CCA	-	BCLAF1	-	NULL		0.453	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	HGNC	protein_coding	OTTHUMT00000042375.2	0	0	0	255	255	93	0.00	0.00	G	NM_014739		136599100	-1	42	39	196	110	tier1	no_errors	ENST00000531224	ensembl	human	known	74_37	missense	17.65	26.17	SNP	1.000	A	42	196
INTS3	65123	genome.wustl.edu	37	1	153734135	153734135	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:153734135C>G	ENST00000318967.2	+	14	2067	c.1499C>G	c.(1498-1500)cCc>cGc	p.P500R	INTS3_ENST00000456435.1_Missense_Mutation_p.P294R|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000435409.2_Missense_Mutation_p.P500R|INTS3_ENST00000512605.1_Missense_Mutation_p.P294R	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	501					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGCAGCTCACCCTCCCCACCT	0.552													ENSG00000143624																																					0													89.0	77.0	81.0					1																	153734135		2203	4300	6503	SO:0001583	missense	0			-	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.1499C>G	1.37:g.153734135C>G	ENSP00000318641:p.Pro500Arg		A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	pfam_Int_cplx_su3	p.P500R	ENST00000318967.2	37	c.1499	CCDS1052.1	1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771037	0.69992	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.0	4.09	0.47781	.	0.060591	0.64402	D	0.000002	T	0.47377	0.1442	L	0.43152	1.355	0.58432	D	0.999999	P;P;P	0.45176	0.852;0.769;0.693	P;B;B	0.50896	0.653;0.248;0.431	T	0.54384	-0.8302	9	0.72032	D	0.01	.	11.1907	0.48683	0.0:0.9106:0.0:0.0894	.	294;501;500	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	R	500;294;500;294	.	ENSP00000318641:P500R	P	+	2	0	INTS3	152000759	1.000000	0.71417	0.838000	0.33150	0.989000	0.77384	5.438000	0.66550	1.347000	0.45714	0.455000	0.32223	CCC	-	INTS3	-	NULL		0.552	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	HGNC	protein_coding	OTTHUMT00000090045.2	0	0	0	35	35	43	0.00	0.00	C	NM_023015		153734135	+1	16	30	32	60	tier1	no_errors	ENST00000318967	ensembl	human	known	74_37	missense	33.33	32.97	SNP	1.000	G	16	32
PLD5	200150	genome.wustl.edu	37	1	242253161	242253161	+	Missense_Mutation	SNP	C	C	G	rs376520582		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:242253161C>G	ENST00000536534.2	-	10	1847	c.1606G>C	c.(1606-1608)Gta>Cta	p.V536L	PLD5_ENST00000427495.1_Missense_Mutation_p.V474L|PLD5_ENST00000442594.2_Missense_Mutation_p.V444L			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	536						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TCATGTTATACGTTCCGGGGA	0.418													ENSG00000180287																																					0													202.0	198.0	200.0					1																	242253161		2203	4300	6503	SO:0001583	missense	0			-	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1606G>C	1.37:g.242253161C>G	ENSP00000440896:p.Val536Leu		A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	smart_PLipase_D/transphosphatidylase	p.V536L	ENST00000536534.2	37	c.1606	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	C	3.421	-0.118222	0.06838	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.42900	0.99;0.98;0.96	5.34	4.41	0.53225	.	0.571972	0.14426	N	0.320341	T	0.29458	0.0734	N	0.16478	0.41	0.09310	N	1	B;B;B	0.15930	0.015;0.002;0.015	B;B;B	0.16289	0.015;0.007;0.015	T	0.22452	-1.0216	10	0.54805	T	0.06	.	12.2641	0.54668	0.0:0.9195:0.0:0.0805	.	444;536;474	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	L	474;444;536	ENSP00000401285:V474L;ENSP00000414188:V444L;ENSP00000440896:V536L	ENSP00000401285:V474L	V	-	1	0	PLD5	240319784	0.001000	0.12720	0.001000	0.08648	0.021000	0.10359	1.377000	0.34317	1.227000	0.43598	0.655000	0.94253	GTA	-	PLD5	-	NULL		0.418	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	0	0	0	141	141	75	0.00	0.00	C	NM_152666		242253161	-1	70	31	65	49	tier1	no_errors	ENST00000536534	ensembl	human	known	74_37	missense	51.85	38.75	SNP	0.013	G	70	65
ZNF300P1	134466	genome.wustl.edu	37	5	150323571	150323571	+	RNA	SNP	T	T	C			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr5:150323571T>C	ENST00000520773.1	-	0	1050									zinc finger protein 300 pseudogene 1 (functional)																		TTGACCCTTATAGCAAACACC	0.443													ENSG00000197083																																					0																																												0			-	AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150323571T>C				R	SNP	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			-	ZNF300P1	-	-		0.443	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	HGNC	pseudogene	OTTHUMT00000374771.1	0	0	0	10	10	28	0.00	0.00	T	NR_026867		150323571	-1	7	15	5	31	tier1	no_errors	ENST00000520773	ensembl	human	known	74_37	rna	58.33	32.61	SNP	0.000	C	7	5
GC	2638	genome.wustl.edu	37	4	72620173	72620173	+	Missense_Mutation	SNP	A	A	C			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr4:72620173A>C	ENST00000273951.8	-	10	1560	c.1217T>G	c.(1216-1218)cTa>cGa	p.L406R	GC_ENST00000503472.1_5'UTR|GC_ENST00000504199.1_Missense_Mutation_p.L425R|GC_ENST00000513476.1_Missense_Mutation_p.L406R	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	406	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	ATCTGCACATAGTTCTTGTCC	0.308													ENSG00000145321																																					0													77.0	76.0	76.0					4																	72620173		2203	4299	6502	SO:0001583	missense	0			-	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.1217T>G	4.37:g.72620173A>C	ENSP00000273951:p.Leu406Arg		B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	pfam_Serum_albumin_N,pfam_VitD-bind_III,superfamily_Serum_albumin-like,smart_Serum_albumin_N,prints_VitD-bd,prints_ALB/AFP/VDB	p.L406R	ENST00000273951.8	37	c.1217	CCDS3550.1	4	.	.	.	.	.	.	.	.	.	.	A	17.26	3.343517	0.61073	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476	T;T;T	0.33438	1.41;1.41;1.41	5.35	5.35	0.76521	.	0.572095	0.17283	N	0.179905	T	0.51839	0.1698	M	0.61703	1.905	0.39867	D	0.97345	D;D	0.89917	1.0;1.0	D;D	0.80764	0.993;0.994	T	0.55159	-0.8184	10	0.87932	D	0	.	12.0044	0.53251	1.0:0.0:0.0:0.0	.	425;406	D6RAK8;D6RF35	.;.	R	406;425;406	ENSP00000273951:L406R;ENSP00000421725:L425R;ENSP00000426683:L406R	ENSP00000273951:L406R	L	-	2	0	GC	72839037	0.832000	0.29368	0.906000	0.35671	0.759000	0.43091	4.517000	0.60503	2.135000	0.66039	0.533000	0.62120	CTA	-	GC	-	pfam_VitD-bind_III,superfamily_Serum_albumin-like,prints_VitD-bd		0.308	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GC	HGNC	protein_coding	OTTHUMT00000252167.2	0	0	0	82	82	65	0.00	0.00	A			72620173	-1	30	52	41	66	tier1	no_errors	ENST00000273951	ensembl	human	known	74_37	missense	42.25	44.07	SNP	0.950	C	30	41
PSMG4	389362	genome.wustl.edu	37	6	3263936	3263936	+	Missense_Mutation	SNP	A	A	G	rs374935109	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr6:3263936A>G	ENST00000438998.2	+	2	322	c.193A>G	c.(193-195)Acc>Gcc	p.T65A	PSMG4_ENST00000473000.2_Missense_Mutation_p.T65A|PSMG4_ENST00000451246.2_Intron|PSMG4_ENST00000380306.4_Intron|PSMG4_ENST00000419065.2_Missense_Mutation_p.T65A|PSMG4_ENST00000380305.4_Intron	NM_001128591.1	NP_001122063.1	Q5JS54	PSMG4_HUMAN	proteasome (prosome, macropain) assembly chaperone 4	65										endometrium(1)	1						CCCCGTGTCTACCTCCCTCCT	0.612													ENSG00000180822	A|||	7	0.00139776	0.0045	0.0014	5008	,	,		17813	0.0		0.0	False		,,,				2504	0.0																0								A	ALA/THR,ALA/THR,ALA/THR	4,1380		0,4,688	96.0	103.0	101.0		193,193,193	4.6	1.0	6		101	0,3182		0,0,1591	no	missense,missense,missense	PSMG4	NM_001128591.1,NM_001128592.1,NM_001135750.1	58,58,58	0,4,2279	GG,GA,AA		0.0,0.289,0.0876	probably-damaging,probably-damaging,probably-damaging	65/124,65/163,65/105	3263936	4,4562	692	1591	2283	SO:0001583	missense	0			-		CCDS47360.1, CCDS47361.1, CCDS47362.1	6p25.2	2010-06-23	2008-02-25	2008-02-25	ENSG00000180822	ENSG00000180822			21108	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 86"""	C6orf86		17707236	Standard	NM_001128591		Approved	PAC4	uc010jnl.1	Q5JS54	OTTHUMG00000014142	ENST00000438998.2:c.193A>G	6.37:g.3263936A>G	ENSP00000413353:p.Thr65Ala		C9J2F8|F8WBZ2|Q5JS53|Q5JS56	Missense_Mutation	SNP	NULL	p.T65A	ENST00000438998.2	37	c.193	CCDS47361.1	6	.	.	.	.	.	.	.	.	.	.	A	19.14	3.769877	0.69992	0.00289	0.0	ENSG00000180822	ENST00000438998;ENST00000419065;ENST00000473000	.	.	.	5.78	4.59	0.56863	.	0.326694	0.27159	N	0.020654	T	0.62575	0.2439	M	0.62266	1.93	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.999	D;D;D	0.83275	0.99;0.996;0.996	T	0.65207	-0.6224	9	0.48119	T	0.1	-30.5964	11.2308	0.48912	0.8464:0.1536:0.0:0.0	.	65;65;65	Q5JS54;C9J2F8;F8WBZ2	PSMG4_HUMAN;.;.	A	65	.	ENSP00000424330:T65A	T	+	1	0	PSMG4	3208935	1.000000	0.71417	0.979000	0.43373	0.757000	0.42996	6.635000	0.74295	0.975000	0.38392	0.460000	0.39030	ACC	-	PSMG4	-	NULL		0.612	PSMG4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMG4	HGNC	protein_coding	OTTHUMT00000039678.2	0	0	0	87	87	65	0.00	0.00	A			3263936	+1	26	30	37	41	tier1	no_errors	ENST00000419065	ensembl	human	known	74_37	missense	40.62	42.25	SNP	0.998	G	26	37
OR5G5P	81191	genome.wustl.edu	37	11	56569579	56569579	+	RNA	SNP	G	G	A	rs137945535		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr11:56569579G>A	ENST00000378368.2	-	0	691									olfactory receptor, family 5, subfamily G, member 5 pseudogene																		TTTGCGTCTCGCGTCAGCAGA	0.478													ENSG00000205025	G|||	1	0.000199681	0.0	0.0	5008	,	,		20731	0.001		0.0	False		,,,				2504	0.0																0																																												0			GMAF=0.0005			11q12.1	2014-03-20			ENSG00000205025	ENSG00000205025		"""GPCR / Class A : Olfactory receptors"""	15289	pseudogene	pseudogene							Standard	NG_004191		Approved				OTTHUMG00000154297		11.37:g.56569579G>A				R	SNP	-	NULL	ENST00000378368.2	37	NULL		11																																																																																			rs137945535	OR5G5P	-	-		0.478	OR5G5P-003	KNOWN	basic	processed_transcript	OR5G5P	HGNC	pseudogene	OTTHUMT00000392444.1	0	0	0	25	25	23	0.00	0.00	G			56569579	-1	4	15	20	27	tier1	no_errors	ENST00000378368	ensembl	human	known	74_37	rna	16.67	35.71	SNP	0.004	A	4	20
C22orf29	79680	genome.wustl.edu	37	22	19839506	19839506	+	Silent	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr22:19839506C>T	ENST00000405640.1	-	2	947	c.279G>A	c.(277-279)agG>agA	p.R93R	GNB1L_ENST00000329517.6_Intron|C22orf29_ENST00000328554.4_Silent_p.R93R|C22orf29_ENST00000407472.1_Silent_p.R93R|GNB1L_ENST00000460402.1_Intron|GNB1L_ENST00000403325.1_Intron|C22orf29_ENST00000484072.1_Intron|GNB1L_ENST00000405009.1_Intron			Q7L3V2	BOP_HUMAN	chromosome 22 open reading frame 29	93					mitochondrial outer membrane permeabilization (GO:0097345)|regulation of mitochondrial membrane potential (GO:0051881)	mitochondrion (GO:0005739)				NS(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	7	Colorectal(54;0.0993)					AGAAGTCCACCCTGTGGGGTC	0.617													ENSG00000215012																																					0													50.0	56.0	54.0					22																	19839506		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BX640998	CCDS13769.1	22q11.21	2006-07-05			ENSG00000215012	ENSG00000215012			26112	protein-coding gene	gene with protein product						12477932	Standard	NM_024627		Approved	FLJ21125	uc002zqh.3	Q7L3V2	OTTHUMG00000030314	ENST00000405640.1:c.279G>A	22.37:g.19839506C>T			A8K5E7|D3DX21|Q6MZM8|Q6N000|Q9H7A0	Silent	SNP	NULL	p.R93	ENST00000405640.1	37	c.279	CCDS13769.1	22																																																																																			-	C22orf29	-	NULL		0.617	C22orf29-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C22orf29	HGNC	protein_coding	OTTHUMT00000317290.2	0	0	0	33	33	45	0.00	0.00	C	NM_024627		19839506	-1	15	15	10	34	tier1	no_errors	ENST00000328554	ensembl	human	known	74_37	silent	60.00	30.61	SNP	0.031	T	15	10
PGM5P2	595135	genome.wustl.edu	37	9	69113643	69113643	+	RNA	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr9:69113643C>T	ENST00000591037.1	-	0	1002					NR_002836.2				phosphoglucomutase 5 pseudogene 2																		TCATTGCTTCCAGAAGAGTCA	0.483													ENSG00000227558																																					0																																												0			-	BC007887, BC025351		9q12	2014-01-23			ENSG00000227558	ENSG00000277778			18965	pseudogene	pseudogene						12421752, 15233989	Standard	NR_002836		Approved		uc004aff.4		OTTHUMG00000013322		9.37:g.69113643C>T				R	SNP	-	NULL	ENST00000591037.1	37	NULL		9																																																																																			-	PGM5P2	-	-		0.483	PGM5P2-002	KNOWN	basic	processed_transcript	PGM5P2	HGNC	pseudogene	OTTHUMT00000460890.1	0	0	0	118	118	34	0.00	0.00	C	NR_002836		69113643	-1	65	24	60	23	tier1	no_errors	ENST00000591037	ensembl	human	known	74_37	rna	52.00	51.06	SNP	1.000	T	65	60
MUC4	4585	genome.wustl.edu	37	3	195516546	195516546	+	Silent	SNP	G	G	A			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr3:195516546G>A	ENST00000463781.3	-	2	2364	c.1905C>T	c.(1903-1905)tcC>tcT	p.S635S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.S635S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	640					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACCCCTTTGGGAAACAGCTG	0.502													ENSG00000145113																																					0													320.0	322.0	321.0					3																	195516546		2057	4211	6268	SO:0001819	synonymous_variant	0			-	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.1905C>T	3.37:g.195516546G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S635	ENST00000463781.3	37	c.1905	CCDS54700.1	3																																																																																			-	MUC4	-	NULL		0.502	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	91	91	68	0.00	0.00	G	NM_018406		195516546	-1	45	42	43	38	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	51.14	52.50	SNP	0.000	A	45	43
TAF6L	10629	genome.wustl.edu	37	11	62543260	62543260	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr11:62543260C>T	ENST00000294168.3	+	2	206	c.5C>T	c.(4-6)tCa>tTa	p.S2L	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	2					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						GGGGCCATGTCAGAGCGAGAA	0.642													ENSG00000162227																																					0													55.0	60.0	58.0					11																	62543260		2201	4299	6500	SO:0001583	missense	0			-	BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.5C>T	11.37:g.62543260C>T	ENSP00000294168:p.Ser2Leu		B2RAT0|Q96HA6	Missense_Mutation	SNP	pfam_TAF_TATA-bd,pfam_DUF1546,superfamily_Histone-fold,smart_TAF_TATA-bd	p.S2L	ENST00000294168.3	37	c.5	CCDS8035.1	11	.	.	.	.	.	.	.	.	.	.	C	16.27	3.074962	0.55646	.	.	ENSG00000162227	ENST00000294168;ENST00000526261;ENST00000529509	T;T	0.50813	0.73;0.82	4.53	4.53	0.55603	.	0.268410	0.30285	N	0.009971	T	0.32852	0.0843	N	0.14661	0.345	0.80722	D	1	B;B	0.24186	0.035;0.099	B;B	0.19391	0.012;0.025	T	0.24657	-1.0154	10	0.72032	D	0.01	-31.1238	15.1558	0.72739	0.0:1.0:0.0:0.0	.	2;2	B4DVM4;Q9Y6J9	.;TAF6L_HUMAN	L	2	ENSP00000294168:S2L;ENSP00000434662:S2L	ENSP00000294168:S2L	S	+	2	0	TAF6L	62299836	1.000000	0.71417	0.948000	0.38648	0.722000	0.41435	4.711000	0.61881	2.517000	0.84864	0.561000	0.74099	TCA	-	TAF6L	-	NULL		0.642	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF6L	HGNC	protein_coding	OTTHUMT00000395352.1	0	0	0	44	44	35	0.00	0.00	C	NM_006473		62543260	+1	12	17	22	11	tier1	no_errors	ENST00000294168	ensembl	human	known	74_37	missense	35.29	60.71	SNP	0.970	T	12	22
SERPINA10	51156	genome.wustl.edu	37	14	94756550	94756567	+	In_Frame_Del	DEL	CCCTCTCTTGATCTGGGT	CCCTCTCTTGATCTGGGT	-			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	CCCTCTCTTGATCTGGGT	CCCTCTCTTGATCTGGGT	CCCTCTCTTGATCTGGGT	-	CCCTCTCTTGATCTGGGT	CCCTCTCTTGATCTGGGT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr14:94756550_94756567delCCCTCTCTTGATCTGGGT	ENST00000393096.1	-	2	829_846	c.364_381delACCCAGATCAAGAGAGGG	c.(364-381)acccagatcaagagagggdel	p.TQIKRG122del	SERPINA10_ENST00000554173.1_In_Frame_Del_p.TQIKRG122del|SERPINA10_ENST00000261994.4_In_Frame_Del_p.TQIKRG122del|SERPINA10_ENST00000554723.1_In_Frame_Del_p.TQIKRG162del	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	122					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GCAAGTGGAGCCCTCTCTTGATCTGGGTTTCAGTCGGC	0.587													ENSG00000140093																																					0																																										SO:0001651	inframe_deletion	0				AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.364_381delACCCAGATCAAGAGAGGG	14.37:g.94756550_94756567delCCCTCTCTTGATCTGGGT	ENSP00000376809:p.Thr122_Gly127del		A5Z2A5|Q6UWX9|Q86U20	In_Frame_Del	DEL	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.TQIKRG122in_frame_del	ENST00000393096.1	37	c.381_364	CCDS9923.1	14																																																																																				SERPI10	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.587	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPI10	HGNC	protein_coding	OTTHUMT00000413061.1	0	0	0	28	28	28	0.00	0.00	CCCTCTCTTGATCTGGGT	NM_016186		94756567	-1	4	4	30	30	tier1	no_errors	ENST00000261994	ensembl	human	known	74_37	in_frame_del	11.76	11.76	DEL	0.000:0.001:0.005:0.000:0.000:0.000:0.000:0.006:0.004:0.020:0.889:0.896:0.983:0.984:0.952:0.432:0.014:0.001	-	4	30
ACADSB	36	genome.wustl.edu	37	10	124800090	124800090	+	Missense_Mutation	SNP	T	T	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr10:124800090T>G	ENST00000358776.4	+	4	426	c.412T>G	c.(412-414)Ttt>Gtt	p.F138V	ACADSB_ENST00000368869.4_Missense_Mutation_p.F36V|ACADSB_ENST00000496730.2_3'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	138					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	TGTGGCTGTCTTTTGTGAGAT	0.403													ENSG00000196177																																					0													134.0	133.0	133.0					10																	124800090		2203	4300	6503	SO:0001583	missense	0			-	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.412T>G	10.37:g.124800090T>G	ENSP00000357873:p.Phe138Val		B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.F138V	ENST00000358776.4	37	c.412	CCDS7634.1	10	.	.	.	.	.	.	.	.	.	.	T	0.048	-1.259425	0.01445	.	.	ENSG00000196177	ENST00000368869;ENST00000358776	D;D	0.99671	-6.35;-6.35	5.68	-11.4	0.00090	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	1.090830	0.07085	N	0.837655	D	0.95130	0.8422	N	0.04655	-0.195	0.09310	N	0.999999	B	0.02656	0.0	B	0.10450	0.005	T	0.80162	-0.1497	10	0.24483	T	0.36	.	1.0526	0.01583	0.2999:0.3111:0.2153:0.1736	.	138	P45954	ACDSB_HUMAN	V	36;138	ENSP00000357862:F36V;ENSP00000357873:F138V	ENSP00000357873:F138V	F	+	1	0	ACADSB	124790080	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.203000	0.01234	-6.524000	0.00003	-2.025000	0.00428	TTT	-	ACADSB	-	pfam_AcylCoA_DH/ox_N,superfamily_AcylCoA_DH/oxidase_NM_dom		0.403	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADSB	HGNC	protein_coding	OTTHUMT00000050843.1	0	0	0	102	102	69	0.00	0.00	T	NM_001609		124800090	+1	42	32	12	7	tier1	no_errors	ENST00000358776	ensembl	human	known	74_37	missense	77.78	82.05	SNP	0.000	G	42	12
RP5-1158E12.1	0	genome.wustl.edu	37	X	45772969	45772969	+	lincRNA	SNP	A	A	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chrX:45772969A>T	ENST00000420585.1	-	0	499																											TTGCGGAGCAAAGGTCGATCA	0.468													ENSG00000234613																																					0																																												0			-																													X.37:g.45772969A>T				R	SNP	-	NULL	ENST00000420585.1	37	NULL		X																																																																																			-	RP5-1158E12.1	-	-		0.468	RP5-1158E12.1-001	KNOWN	basic	lincRNA	ENSG00000234613	Clone_based_vega_gene	lincRNA	OTTHUMT00000056345.1	0	0	0	9	9	17	0.00	0.00	A			45772969	-1	8	21	0	1	tier1	no_errors	ENST00000420585	ensembl	human	known	74_37	rna	100.00	95.45	SNP	0.988	T	8	0
PLOD3	8985	genome.wustl.edu	37	7	100854936	100854936	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr7:100854936delG	ENST00000223127.3	-	12	1692	c.1294delC	c.(1294-1296)ctgfs	p.L432fs		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	432					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	TCGGGGCTCAGGGCGCCCCAG	0.697													ENSG00000106397																																					0													28.0	26.0	27.0					7																	100854936		2202	4300	6502	SO:0001589	frameshift_variant	0				AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1294delC	7.37:g.100854936delG	ENSP00000223127:p.Leu432fs		B2R6W6|Q540C3	Frame_Shift_Del	DEL	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.L432fs	ENST00000223127.3	37	c.1294	CCDS5715.1	7																																																																																				PLOD3	-	NULL		0.697	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1	0	0	0	118	118	12	0.00	0.00	G			100854936	-1	36	9	55	7	tier1	no_errors	ENST00000223127	ensembl	human	known	74_37	frame_shift_del	39.56	56.25	DEL	1.000	-	36	55
AMZ1	155185	genome.wustl.edu	37	7	2741852	2741906	+	Intron	DEL	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	-	rs798471|rs540419422|rs191436847|rs10624226|rs33915832|rs35358739|rs10694020|rs397762646	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr7:2741852_2741906delTGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	ENST00000312371.4	+	3	672				AMZ1_ENST00000407112.1_Intron	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CCTGCACCCTTGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTCTGTGTCCTGC	0.624													ENSG00000174945																																					0																																										SO:0001627	intron_variant	0				AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.305-450TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC>-	7.37:g.2741852_2741906delTGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC			B3KRS0|Q8TF51	R	DEL	-	NULL	ENST00000312371.4	37	NULL	CCDS34589.1	7																																																																																				AMZ1	-	-		0.624	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ1	HGNC	protein_coding	OTTHUMT00000325244.1	0	0	0	1	1	1	0.00	0.00	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	NM_133463		2741906	+1	0	0	2	2	tier1	no_errors	ENST00000485540	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.001:0.002:0.002:0.003:0.004:0.003:0.001:0.000:0.000:0.004:0.003:0.003:0.002:0.002:0.002:0.003:0.003:0.001:0.005:0.071:0.077:0.080:0.076:0.071:0.067:0.056:0.014:0.004:0.001:0.002:0.002:0.000:0.001:0.002:0.003:0.004:0.005:0.002:0.002:0.002:0.002:0.002:0.002:0.003:0.000:0.001:0.001:0.000:0.000:0.000:0.001:0.000:0.000	-	0	2
DNM1P46	196968	genome.wustl.edu	37	15	100347042	100347042	+	5'Flank	SNP	A	A	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr15:100347042A>G	ENST00000560059.1	+	0	0				CTD-2054N24.2_ENST00000559714.1_5'Flank|CTD-2054N24.2_ENST00000558188.1_5'Flank|DNM1P46_ENST00000341853.1_RNA																							CTCACGCTCCACTGCAACAGA	0.672													ENSG00000182397																																					0																																										SO:0001631	upstream_gene_variant	0			-																													15.37:g.100347042A>G	Exception_encountered			R	SNP	-	NULL	ENST00000560059.1	37	NULL		15																																																																																			-	DNM1P46	-	-		0.672	CTD-2054N24.2-002	PUTATIVE	basic|appris_principal	protein_coding	DNM1P46	HGNC	protein_coding	OTTHUMT00000416905.2	0	0	0	16	16	1	0.00	0.00	A			100347042	-1	7	0	20	1	tier1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	25.93	0.00	SNP	0.637	G	7	20
SIX5	147912	genome.wustl.edu	37	19	46265047	46265048	+	IGR	INS	-	-	TCCAGC	rs139434566|rs59054027		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr19:46265047_46265048insTCCAGC	ENST00000317578.6	-	0	3318				AC074212.5_ENST00000559756.1_RNA|AC074212.3_ENST00000457052.2_In_Frame_Ins_p.453_453S>SSS	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5						lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		GCAAGGCGCCAtccagctccag	0.658													ENSG00000237452																																					0																																										SO:0001628	intergenic_variant	0				L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196			19.37:g.46265048_46265053dupTCCAGC				In_Frame_Ins	INS	pfam_HMG_box_dom,pfam_bHLH_dom,superfamily_HMG_box_dom,superfamily_bHLH_dom,smart_HMG_box_dom,pfscan_bHLH_dom,pfscan_HMG_box_dom	p.456in_frame_insSS	ENST00000317578.6	37	c.1356_1357	CCDS12673.1	19																																																																																				AC074212.3	-	NULL		0.658	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237452	Clone_based_vega_gene	protein_coding	OTTHUMT00000417341.3	0	0	0	3	3	3	0.00	0.00	-	NM_175875		46265048	+1	2	2	5	5	tier1	no_errors	ENST00000457052	ensembl	human	putative	74_37	in_frame_ins	28.57	28.57	INS	0.000:0.004	TCCAGC	2	5
SLC6A12	6539	genome.wustl.edu	37	12	306031	306031	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr12:306031T>C	ENST00000428720.1	-	11	1836	c.1093A>G	c.(1093-1095)Atc>Gtc	p.I365V	SLC6A12_ENST00000359674.4_Missense_Mutation_p.I365V|SLC6A12_ENST00000538272.1_5'Flank|SLC6A12_ENST00000397296.2_Missense_Mutation_p.I365V|RP11-283I3.1_ENST00000544067.1_RNA|SLC6A12_ENST00000536824.1_Missense_Mutation_p.I365V|SLC6A12_ENST00000424061.2_Missense_Mutation_p.I365V	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	365					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GGGAAGGCGATGAAGGCCAGC	0.582													ENSG00000111181																																					0													95.0	86.0	89.0					12																	306031		2203	4300	6503	SO:0001583	missense	0			-	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.1093A>G	12.37:g.306031T>C	ENSP00000388184:p.Ile365Val		A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_betaine	p.I365V	ENST00000428720.1	37	c.1093	CCDS8501.1	12	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936360	0.52972	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	4.26	4.26	0.50523	.	0.061973	0.64402	D	0.000011	D	0.83101	0.5181	M	0.66506	2.035	0.47905	D	0.999546	D	0.76494	0.999	D	0.77557	0.99	T	0.82224	-0.0563	10	0.33940	T	0.23	.	13.5481	0.61715	0.0:0.0:0.0:1.0	.	365	P48065	S6A12_HUMAN	V	365	ENSP00000352702:I365V;ENSP00000380464:I365V;ENSP00000388184:I365V;ENSP00000399136:I365V;ENSP00000444268:I365V	ENSP00000352702:I365V	I	-	1	0	SLC6A12	176292	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.511000	0.35801	1.782000	0.52362	0.391000	0.25812	ATC	-	SLC6A12	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.582	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A12	HGNC	protein_coding	OTTHUMT00000206671.2	0	0	0	48	48	40	0.00	0.00	T	NM_003044		306031	-1	5	2	26	39	tier1	no_errors	ENST00000359674	ensembl	human	known	74_37	missense	16.13	4.88	SNP	1.000	C	5	26
RGS2	5997	genome.wustl.edu	37	1	192778205	192778205	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:192778205C>T	ENST00000235382.5	+	1	35	c.4C>T	c.(4-6)Caa>Taa	p.Q2*	RGS2_ENST00000483295.1_3'UTR	NM_002923.3	NP_002914.1	P41220	RGS2_HUMAN	regulator of G-protein signaling 2	2					brown fat cell differentiation (GO:0050873)|cell cycle (GO:0007049)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phospholipase activity (GO:0010519)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of microtubule polymerization (GO:0031116)|regulation of adrenergic receptor signaling pathway (GO:0071877)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of translation (GO:0006417)|relaxation of cardiac muscle (GO:0055119)|relaxation of vascular smooth muscle (GO:0060087)|spermatogenesis (GO:0007283)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.Q2*(1)		large_intestine(3)|lung(1)|urinary_tract(1)	5						AACGATAATGCAAAGTGCTAT	0.612													ENSG00000116741																									Pancreas(71;51 2183 4981)												1	Substitution - Nonsense(1)	large_intestine(1)											133.0	121.0	125.0					1																	192778205		2203	4300	6503	SO:0001587	stop_gained	0			-	L13463	CCDS1377.1	1q31	2014-06-19	2014-06-19		ENSG00000116741	ENSG00000116741		"""Regulators of G-protein signaling"", ""Endogenous ligands"""	9998	protein-coding gene	gene with protein product		600861	"""regulator of G-protein signalling 2, 24kD"", ""regulator of G-protein signalling 2, 24kDa"", ""regulator of G-protein signaling 2, 24kDa"""	G0S8		8179820	Standard	NM_002923		Approved		uc001gsl.3	P41220	OTTHUMG00000035600	ENST00000235382.5:c.4C>T	1.37:g.192778205C>T	ENSP00000235382:p.Gln2*		Q6I9U5	Nonsense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.Q2*	ENST00000235382.5	37	c.4	CCDS1377.1	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350249	0.82132	.	.	ENSG00000116741	ENST00000235382	.	.	.	4.62	3.71	0.42584	.	0.110419	0.40222	N	0.001143	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	10.632	0.45543	0.0:0.9057:0.0:0.0943	.	.	.	.	X	2	.	ENSP00000235382:Q2X	Q	+	1	0	RGS2	191044828	1.000000	0.71417	0.995000	0.50966	0.321000	0.28281	3.207000	0.51106	1.305000	0.44909	0.591000	0.81541	CAA	-	RGS2	-	NULL		0.612	RGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS2	HGNC	protein_coding	OTTHUMT00000086396.1	0	0	0	60	60	40	0.00	0.00	C	NM_002923		192778205	+1	12	3	42	50	tier1	no_errors	ENST00000235382	ensembl	human	known	74_37	nonsense	22.22	5.66	SNP	1.000	T	12	42
