#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TTBK2	146057	genome.wustl.edu	37	15	43045133	43045133	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr15:43045133C>G	ENST00000267890.6	-	14	2419	c.2311G>C	c.(2311-2313)Gaa>Caa	p.E771Q		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	771					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		GGGAGATTTTCAAATTCTCTC	0.393													ENSG00000128881																																					0													189.0	174.0	179.0					15																	43045133		1837	4080	5917	SO:0001583	missense	0			-	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.2311G>C	15.37:g.43045133C>G	ENSP00000267890:p.Glu771Gln		O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E771Q	ENST00000267890.6	37	c.2311	CCDS42029.1	15	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108624	0.37242	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.42131	0.98	5.73	5.73	0.89815	.	0.488040	0.22850	N	0.054864	T	0.47173	0.1431	L	0.56769	1.78	0.80722	D	1	B;B	0.30361	0.277;0.181	B;B	0.34779	0.189;0.092	T	0.45440	-0.9261	10	0.62326	D	0.03	.	18.0859	0.89457	0.0:1.0:0.0:0.0	.	702;771	Q6IQ55-2;Q6IQ55	.;TTBK2_HUMAN	Q	771;701;1176	ENSP00000267890:E771Q	ENSP00000263802:E1176Q	E	-	1	0	TTBK2	40832425	1.000000	0.71417	0.955000	0.39395	0.555000	0.35460	3.435000	0.52849	2.698000	0.92095	0.655000	0.94253	GAA	-	TTBK2	-	NULL		0.393	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK2	HGNC	protein_coding	OTTHUMT00000431106.2	0	0	0	62	62	109	0.00	0.00	C	NM_173500		43045133	-1	31	59	42	49	tier1	no_errors	ENST00000267890	ensembl	human	known	74_37	missense	42.47	54.63	SNP	0.997	G	31	42
DNAH17	8632	genome.wustl.edu	37	17	76446859	76446859	+	Missense_Mutation	SNP	G	G	A	rs568734889		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr17:76446859G>A	ENST00000585328.1	-	67	10913	c.10789C>T	c.(10789-10791)Cgt>Tgt	p.R3597C	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.R3588C	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3588	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GCCGACAGACGGGCCAGGAGC	0.547													ENSG00000187775	G|||	1	0.000199681	0.0	0.0	5008	,	,		20656	0.0		0.001	False		,,,				2504	0.0																0													79.0	80.0	80.0					17																	76446859		2203	4300	6503	SO:0001583	missense	0			-	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10789C>T	17.37:g.76446859G>A	ENSP00000465516:p.Arg3597Cys		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.R3588C	ENST00000585328.1	37	c.10762		17	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366234	0.82463	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.34072	1.38	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000005	T	0.61350	0.2340	M	0.91300	3.195	0.80722	D	1	D	0.58268	0.982	P	0.54889	0.763	T	0.71104	-0.4689	10	0.66056	D	0.02	.	14.7803	0.69760	0.0:0.0:0.8551:0.1449	.	3597	E7EUM8	.	C	3597;3588	ENSP00000374490:R3588C	ENSP00000300671:R3597C	R	-	1	0	DNAH17	73958454	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	4.571000	0.60879	2.494000	0.84150	0.650000	0.86243	CGT	-	DH17	-	superfamily_P-loop_NTPase		0.547	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DH17	HGNC	protein_coding	OTTHUMT00000318962.2	0	0	0	62	62	72	0.00	0.00	G	NM_173628		76446859	-1	24	36	27	43	tier1	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	47.06	45.57	SNP	1.000	A	24	27
TTBK2	146057	genome.wustl.edu	37	15	43044957	43044957	+	Silent	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr15:43044957C>T	ENST00000267890.6	-	14	2595	c.2487G>A	c.(2485-2487)caG>caA	p.Q829Q		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	829					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q829H(1)		NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CACTAAAAGTCTGTGTTTTTG	0.403													ENSG00000128881																																					1	Substitution - Missense(1)	cervix(1)											114.0	102.0	106.0					15																	43044957		1851	4096	5947	SO:0001819	synonymous_variant	0			-	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.2487G>A	15.37:g.43044957C>T			O94932|Q6ZN52|Q8IVV1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q829	ENST00000267890.6	37	c.2487	CCDS42029.1	15																																																																																			-	TTBK2	-	NULL		0.403	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK2	HGNC	protein_coding	OTTHUMT00000431106.2	0	0	0	46	46	115	0.00	0.00	C	NM_173500		43044957	-1	29	35	25	57	tier1	no_errors	ENST00000267890	ensembl	human	known	74_37	silent	53.70	38.04	SNP	1.000	T	29	25
WDFY4	57705	genome.wustl.edu	37	10	49951200	49951200	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951200C>T	ENST00000325239.5	+	11	2093	c.2066C>T	c.(2065-2067)tCc>tTc	p.S689F	WDFY4_ENST00000413659.2_Missense_Mutation_p.S689F	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	689						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TGTGCTGTGTCCGCAGCGCTG	0.607													ENSG00000128815																																					0													45.0	43.0	43.0					10																	49951200		692	1591	2283	SO:0001583	missense	0			-	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2066C>T	10.37:g.49951200C>T	ENSP00000320563:p.Ser689Phe		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S689F	ENST00000325239.5	37	c.2066	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623554	0.46840	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T	0.57907	0.37;1.39	5.13	4.22	0.49857	Armadillo-type fold (1);	.	.	.	.	T	0.51126	0.1656	M	0.63428	1.95	0.29679	N	0.841832	P	0.45283	0.855	B	0.41571	0.36	T	0.54543	-0.8278	8	.	.	.	.	12.127	0.53922	0.0:0.917:0.0:0.083	.	689	Q6ZS81	WDFY4_HUMAN	F	698;689;689;689	ENSP00000320563:S689F;ENSP00000403789:S689F	.	S	+	2	0	WDFY4	49621206	0.890000	0.30428	0.989000	0.46669	0.097000	0.18754	3.440000	0.52886	2.407000	0.81776	0.563000	0.77884	TCC	-	WDFY4	-	superfamily_ARM-type_fold		0.607	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		0	0	0	63	63	72	0.00	0.00	C	XM_033379		49951200	+1	14	24	88	64	tier1	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	13.73	27.27	SNP	0.991	T	14	88
CUX1	1523	genome.wustl.edu	37	7	101801856	101801856	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr7:101801856A>T	ENST00000292535.7	+	9	729	c.691A>T	c.(691-693)Atg>Ttg	p.M231L	CUX1_ENST00000360264.3_Missense_Mutation_p.M242L|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000546411.2_Missense_Mutation_p.M231L|CUX1_ENST00000549414.2_Missense_Mutation_p.M231L|CUX1_ENST00000556210.1_Missense_Mutation_p.M231L|CUX1_ENST00000550008.2_Missense_Mutation_p.M231L|CUX1_ENST00000547394.2_Missense_Mutation_p.M226L|CUX1_ENST00000425244.2_Missense_Mutation_p.M196L|CUX1_ENST00000292538.4_Missense_Mutation_p.M242L|CUX1_ENST00000393824.3_Missense_Mutation_p.M205L|CUX1_ENST00000437600.4_Missense_Mutation_p.M242L	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	231					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CGAGATTGAAATGATCATGAC	0.552													ENSG00000257923																																					0													92.0	83.0	86.0					7																	101801856		2203	4300	6503	SO:0001583	missense	0			-	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.691A>T	7.37:g.101801856A>T	ENSP00000292535:p.Met231Leu		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.M242L	ENST00000292535.7	37	c.724	CCDS5721.1	7	.	.	.	.	.	.	.	.	.	.	A	10.64	1.406481	0.25378	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.76316	1.22;1.22;1.22;2.44;1.06;1.22;-1.01;1.22;1.22;1.22	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.66076	0.2753	N	0.13235	0.315	0.43250	D	0.995177	P;B;B;B;B;B;B	0.40660	0.726;0.167;0.296;0.052;0.095;0.156;0.257	B;B;B;B;B;B;P	0.47786	0.191;0.354;0.046;0.058;0.015;0.041;0.557	T	0.64546	-0.6382	10	0.05620	T	0.96	-40.0631	12.6554	0.56784	1.0:0.0:0.0:0.0	.	205;231;196;226;242;242;242	B4DZZ2;P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;.;CASP_HUMAN;.	L	242;226;242;196;242;231;231;231;231;231	ENSP00000292538:M242L;ENSP00000449371:M226L;ENSP00000353401:M242L;ENSP00000409745:M196L;ENSP00000414091:M242L;ENSP00000292535:M231L;ENSP00000446630:M231L;ENSP00000447373:M231L;ENSP00000450125:M231L;ENSP00000451558:M231L	ENSP00000292535:M231L	M	+	1	0	CUX1	101588576	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.940000	0.70187	2.010000	0.58986	0.460000	0.39030	ATG	-	CUX1	-	NULL		0.552	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347535.1	0	0	0	57	57	68	0.00	0.00	A	NM_001913		101801856	+1	24	31	24	56	tier1	no_errors	ENST00000360264	ensembl	human	known	74_37	missense	50.00	35.63	SNP	1.000	T	24	24
ASTN1	460	genome.wustl.edu	37	1	177001821	177001821	+	Silent	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:177001821G>A	ENST00000367654.3	-	3	847	c.636C>T	c.(634-636)caC>caT	p.H212H	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Silent_p.H212H|ASTN1_ENST00000424564.2_Silent_p.H212H|ASTN1_ENST00000361833.2_Silent_p.H212H	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	212					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCTCCCGTCCGTGCCCGCCGA	0.627													ENSG00000152092																																					0													64.0	53.0	57.0					1																	177001821		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.636C>T	1.37:g.177001821G>A			A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.H212	ENST00000367654.3	37	c.636		1																																																																																			-	ASTN1	-	NULL		0.627	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		0	0	0	52	52	24	0.00	0.00	G	NM_004319		177001821	-1	22	8	45	21	tier1	no_errors	ENST00000367654	ensembl	human	known	74_37	silent	32.84	27.59	SNP	0.099	A	22	45
HNF1B	6928	genome.wustl.edu	37	17	36091772	36091772	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr17:36091772C>G	ENST00000225893.4	-	4	1220	c.859G>C	c.(859-861)Ggc>Cgc	p.G287R	HNF1B_ENST00000560016.1_Missense_Mutation_p.G287R|HNF1B_ENST00000427275.2_Missense_Mutation_p.G261R|HNF1B_ENST00000561193.1_Missense_Mutation_p.G261R	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	287					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			AAGTTGGAGCCCAGGCCGTGG	0.612													ENSG00000108753																									Colon(71;102 1179 9001 27917 43397)												0													109.0	99.0	102.0					17																	36091772		2203	4300	6503	SO:0001583	missense	0			-	BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.859G>C	17.37:g.36091772C>G	ENSP00000225893:p.Gly287Arg		B4DKM3|E0YMJ9	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G287R	ENST00000225893.4	37	c.859	CCDS11324.1	17	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609582	0.87258	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.95690	-3.78;-3.78	5.56	4.59	0.56863	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.090718	0.85682	D	0.000000	D	0.97247	0.9100	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	D	0.97750	1.0214	10	0.72032	D	0.01	-23.5242	13.6975	0.62589	0.0:0.9266:0.0:0.0734	.	261;287;287	E0YMJ6;P35680-3;P35680	.;.;HNF1B_HUMAN	R	287;261;287;175	ENSP00000225893:G287R;ENSP00000412212:G261R	ENSP00000225893:G287R	G	-	1	0	HNF1B	33165885	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.320000	0.79064	1.591000	0.50007	0.655000	0.94253	GGC	-	HNF1B	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.612	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1B	HGNC	protein_coding	OTTHUMT00000256807.3	0	0	0	34	34	81	0.00	0.00	C	NM_000458		36091772	-1	20	30	15	23	tier1	no_errors	ENST00000225893	ensembl	human	known	74_37	missense	57.14	56.60	SNP	1.000	G	20	15
ADAM28	10863	genome.wustl.edu	37	8	24168921	24168921	+	Silent	SNP	C	C	T	rs144018592		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr8:24168921C>T	ENST00000265769.4	+	5	464	c.354C>T	c.(352-354)gaC>gaT	p.D118D	ADAM28_ENST00000540823.1_5'UTR|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000397649.3_5'UTR|RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000437154.2_Silent_p.D118D	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	118					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		AGGTTTCTGACGCTAGCATCA	0.373													ENSG00000042980																									NSCLC(193;488 2149 22258 34798 40734)												0								C	,	1,4405	2.1+/-5.4	0,1,2202	123.0	121.0	122.0		354,354	-4.2	0.7	8	dbSNP_134	122	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ADAM28	NM_014265.4,NM_021777.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	118/776,118/541	24168921	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.354C>T	8.37:g.24168921C>T			B2RMV5|Q9Y339|Q9Y3S0	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D118	ENST00000265769.4	37	c.354	CCDS34865.1	8																																																																																			rs144018592	ADAM28	-	pfam_Peptidase_M12B_N		0.373	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	HGNC	protein_coding	OTTHUMT00000375441.2	0	0	0	64	64	98	0.00	0.00	C	NM_021778		24168921	+1	22	14	61	56	tier1	no_errors	ENST00000265769	ensembl	human	known	74_37	silent	26.51	20.00	SNP	0.730	T	22	61
TSPAN6	7105	genome.wustl.edu	37	X	99890554	99890554	+	Splice_Site	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chrX:99890554C>A	ENST00000373020.4	-	2	388		c.e2+1		TSPAN6_ENST00000496771.1_Splice_Site	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6						negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						CAAGGACTCACCAGTTTTAGC	0.403													ENSG00000000003																																					0													34.0	30.0	31.0					X																	99890554		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.276+1G>T	X.37:g.99890554C>A			Q54A42|Q6IAN9	Splice_Site	SNP	-	e2+1	ENST00000373020.4	37	c.276+1	CCDS14470.1	X	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142104	0.77775	.	.	ENSG00000000003	ENST00000373020;ENST00000431386	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8251	0.85929	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TSPAN6	99777210	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.487000	0.81328	2.234000	0.73211	0.523000	0.50628	.	-	TSPAN6	-	-		0.403	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN6	HGNC	protein_coding	OTTHUMT00000057483.1	0	0	1	41	41	112	0.00	0.88	C		Intron	99890554	-1	4	5	18	34	tier1	no_errors	ENST00000373020	ensembl	human	known	74_37	splice_site	18.18	12.82	SNP	1.000	A	4	18
WDFY4	57705	genome.wustl.edu	37	10	49951225	49951225	+	Silent	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951225C>T	ENST00000325239.5	+	11	2118	c.2091C>T	c.(2089-2091)gtC>gtT	p.V697V	WDFY4_ENST00000413659.2_Silent_p.V697V	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	697						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GGGACCCTGTCAATGGCTACT	0.607													ENSG00000128815																																					0													37.0	34.0	35.0					10																	49951225		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2091C>T	10.37:g.49951225C>T			B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V697	ENST00000325239.5	37	c.2091	CCDS44385.1	10																																																																																			-	WDFY4	-	superfamily_ARM-type_fold		0.607	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		0	0	0	53	53	71	0.00	0.00	C	XM_033379		49951225	+1	15	28	87	70	tier1	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	14.71	28.57	SNP	1.000	T	15	87
WDFY4	57705	genome.wustl.edu	37	10	49951403	49951403	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951403C>T	ENST00000325239.5	+	11	2296	c.2269C>T	c.(2269-2271)Cca>Tca	p.P757S	WDFY4_ENST00000413659.2_Missense_Mutation_p.P757S	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	757						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CGGCTCACTCCCACCCCGGAT	0.617													ENSG00000128815																																					0													30.0	32.0	31.0					10																	49951403		692	1591	2283	SO:0001583	missense	0			-	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2269C>T	10.37:g.49951403C>T	ENSP00000320563:p.Pro757Ser		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P757S	ENST00000325239.5	37	c.2269	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	10.66	1.411927	0.25465	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T	0.57907	0.37;1.27	5.02	5.02	0.67125	Armadillo-type fold (1);	.	.	.	.	T	0.66056	0.2751	L	0.59436	1.845	0.41667	D	0.989217	D	0.89917	1.0	D	0.91635	0.999	T	0.66011	-0.6029	8	.	.	.	.	10.8933	0.47008	0.0:0.9135:0.0:0.0865	.	757	Q6ZS81	WDFY4_HUMAN	S	766;757;757;757	ENSP00000320563:P757S;ENSP00000403789:P757S	.	P	+	1	0	WDFY4	49621409	1.000000	0.71417	0.378000	0.26068	0.008000	0.06430	4.462000	0.60121	2.338000	0.79540	0.563000	0.77884	CCA	-	WDFY4	-	superfamily_ARM-type_fold		0.617	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		0	0	0	42	42	85	0.00	0.00	C	XM_033379		49951403	+1	16	19	74	85	tier1	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	17.78	18.27	SNP	1.000	T	16	74
WDFY4	57705	genome.wustl.edu	37	10	49951426	49951426	+	Silent	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951426C>T	ENST00000325239.5	+	11	2319	c.2292C>T	c.(2290-2292)ctC>ctT	p.L764L	WDFY4_ENST00000413659.2_Silent_p.L764L	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	764						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGAGCTGCCTCCAGATCCTTG	0.617													ENSG00000128815																																					0													28.0	30.0	29.0					10																	49951426		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2292C>T	10.37:g.49951426C>T			B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L764	ENST00000325239.5	37	c.2292	CCDS44385.1	10																																																																																			-	WDFY4	-	superfamily_ARM-type_fold		0.617	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		0	0	0	42	42	94	0.00	0.00	C	XM_033379		49951426	+1	20	23	87	93	tier1	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	18.69	19.66	SNP	0.014	T	20	87
TCTN1	79600	genome.wustl.edu	37	12	111065921	111065921	+	Intron	SNP	A	A	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:111065921A>G	ENST00000551590.1	+	4	628				TCTN1_ENST00000397659.4_Intron|RN7SL387P_ENST00000581015.1_RNA|TCTN1_ENST00000397655.3_Intron|TCTN1_ENST00000550703.2_Intron|TCTN1_ENST00000377654.3_Intron|TCTN1_ENST00000471804.2_3'UTR|HVCN1_ENST00000548312.1_3'UTR|TCTN1_ENST00000551555.2_Intron			Q2MV58	TECT1_HUMAN	tectonic family member 1						central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						TTTCATTCCCATAGCCATCCG	0.473													ENSG00000204852																																					0																																										SO:0001627	intron_variant	0			-	AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.473-651A>G	12.37:g.111065921A>G			A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Silent	SNP	pfam_DUF1619	p.P179	ENST00000551590.1	37	c.537	CCDS41835.1	12																																																																																			-	TCTN1	-	NULL		0.473	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	TCTN1	HGNC	protein_coding	OTTHUMT00000316016.2	0	0	0	53	53	53	0.00	0.00	A	NM_024549		111065921	+1	25	17	19	34	tier1	no_errors	ENST00000397656	ensembl	human	known	74_37	silent	56.82	33.33	SNP	0.000	G	25	19
LCT	3938	genome.wustl.edu	37	2	136579728	136579728	+	Intron	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr2:136579728G>A	ENST00000264162.2	-	5	918				AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	ATGCAAGTCTGAAATCAACAG	0.393													ENSG00000226806																																					0													99.0	86.0	90.0					2																	136579728		692	1591	2283	SO:0001627	intron_variant	0			-	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.908-60C>T	2.37:g.136579728G>A			Q4ZG58	R	SNP	-	NULL	ENST00000264162.2	37	NULL	CCDS2178.1	2																																																																																			-	AC011893.3	-	-		0.393	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100507600	Clone_based_vega_gene	protein_coding	OTTHUMT00000254657.1	0	0	1	28	28	101	0.00	0.98	G	NM_002299		136579728	+1	7	22	19	76	tier1	no_errors	ENST00000437007	ensembl	human	known	74_37	rna	26.92	22.45	SNP	0.002	A	7	19
DLGAP4	22839	genome.wustl.edu	37	20	35075162	35075162	+	Silent	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr20:35075162G>A	ENST00000373907.2	+	6	1669	c.1470G>A	c.(1468-1470)gcG>gcA	p.A490A	DLGAP4_ENST00000339266.5_Silent_p.A490A|DLGAP4_ENST00000373913.3_Silent_p.A490A|DLGAP4_ENST00000401952.2_Silent_p.A490A			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	490					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GCAGTGAAGCGGAGTCCACAG	0.642													ENSG00000080845																																					0													48.0	34.0	39.0					20																	35075162		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.1470G>A	20.37:g.35075162G>A			E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Silent	SNP	pfam_GKAP	p.A490	ENST00000373907.2	37	c.1470		20																																																																																			-	DLGAP4	-	NULL		0.642	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2	0	0	0	86	86	21	0.00	0.00	G	NM_014902		35075162	+1	23	3	28	11	tier1	no_errors	ENST00000339266	ensembl	human	known	74_37	silent	45.10	21.43	SNP	0.001	A	23	28
TRPM3	80036	genome.wustl.edu	37	9	73391377	73391377	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr9:73391377C>G	ENST00000396283.1	-	9	1110	c.791G>C	c.(790-792)aGa>aCa	p.R264T	TRPM3_ENST00000357533.2_Intron|TRPM3_ENST00000377101.1_Intron|TRPM3_ENST00000396285.1_Intron|TRPM3_ENST00000423814.3_Intron|TRPM3_ENST00000360823.2_Intron|TRPM3_ENST00000396292.4_Intron|TRPM3_ENST00000358082.3_Intron|TRPM3_ENST00000396280.5_Intron|TRPM3_ENST00000377105.1_Intron|TRPM3_ENST00000377106.1_Intron|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000408909.2_Intron|TRPM3_ENST00000377110.3_Intron			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	0					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TTTTCTTTCTCTTTTTAGATT	0.363													ENSG00000083067																																					0																																										SO:0001583	missense	0			-	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000396283.1:c.791G>C	9.37:g.73391377C>G	ENSP00000379579:p.Arg264Thr		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	NULL	p.R264T	ENST00000396283.1	37	c.791		9	.	.	.	.	.	.	.	.	.	.	C	8.416	0.845220	0.16963	.	.	ENSG00000083067	ENST00000396283	T	0.69306	-0.39	3.02	0.982	0.19762	.	.	.	.	.	T	0.58921	0.2156	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.52388	-0.8582	6	0.51188	T	0.08	.	5.1132	0.14821	0.0:0.6869:0.0:0.3131	.	.	.	.	T	264	ENSP00000379579:R264T	ENSP00000379579:R264T	R	-	2	0	TRPM3	72581197	0.087000	0.21565	0.003000	0.11579	0.033000	0.12548	-0.049000	0.11924	0.259000	0.21709	0.655000	0.94253	AGA	-	TRPM3	-	NULL		0.363	TRPM3-002	PUTATIVE	basic	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000052611.3	0	0	0	57	57	49	0.00	0.00	C	NM_206945		73391377	-1	23	25	25	20	tier1	no_errors	ENST00000396283	ensembl	human	putative	74_37	missense	47.92	55.56	SNP	0.004	G	23	25
KIAA1429	25962	genome.wustl.edu	37	8	95547168	95547168	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr8:95547168A>T	ENST00000297591.5	-	5	458	c.383T>A	c.(382-384)gTg>gAg	p.V128E	RP11-267M23.3_ENST00000521010.1_RNA|KIAA1429_ENST00000437199.1_Missense_Mutation_p.V128E|KIAA1429_ENST00000421249.2_Missense_Mutation_p.V128E	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	128					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CACTCTATCCACTGATCCATA	0.463													ENSG00000164944																																					0													129.0	113.0	119.0					8																	95547168		2203	4300	6503	SO:0001583	missense	0			-	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.383T>A	8.37:g.95547168A>T	ENSP00000297591:p.Val128Glu		Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V128E	ENST00000297591.5	37	c.383	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472696	0.84640	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.44482	0.93;0.92;0.92	5.35	5.35	0.76521	.	0.124113	0.53938	D	0.000048	T	0.48241	0.1489	N	0.14661	0.345	0.52099	D	0.999942	D;D	0.64830	0.994;0.994	D;D	0.73380	0.98;0.98	T	0.56774	-0.7923	10	0.87932	D	0	-12.9387	15.6297	0.76893	1.0:0.0:0.0:0.0	.	128;128	Q69YN4-4;Q69YN4	.;VIR_HUMAN	E	128	ENSP00000297591:V128E;ENSP00000395600:V128E;ENSP00000398390:V128E	ENSP00000297591:V128E	V	-	2	0	KIAA1429	95616344	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.124000	0.77185	2.144000	0.66660	0.482000	0.46254	GTG	-	KIAA1429	-	NULL		0.463	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2	0	0	0	32	32	76	0.00	0.00	A	NM_015496		95547168	-1	15	34	30	41	tier1	no_errors	ENST00000297591	ensembl	human	known	74_37	missense	33.33	45.33	SNP	1.000	T	15	30
FBXO38	81545	genome.wustl.edu	37	5	147806999	147806999	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr5:147806999C>G	ENST00000340253.5	+	15	2310	c.2142C>G	c.(2140-2142)aaC>aaG	p.N714K	FBXO38_ENST00000394370.3_Missense_Mutation_p.N714K|FBXO38_ENST00000296701.6_Intron|FBXO38_ENST00000513826.1_Intron|CTD-2283N19.1_ENST00000520980.2_RNA			Q6PIJ6	FBX38_HUMAN	F-box protein 38	714					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGTGGGAAACTCCAGCTCAC	0.512													ENSG00000145868																																					0													55.0	47.0	50.0					5																	147806999		2203	4300	6503	SO:0001583	missense	0			-	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2142C>G	5.37:g.147806999C>G	ENSP00000342023:p.Asn714Lys		Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	superfamily_F-box_dom	p.N714K	ENST00000340253.5	37	c.2142		5	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801683	0.31869	.	.	ENSG00000145868	ENST00000340253;ENST00000394370	T;T	0.29917	1.55;1.57	5.63	4.75	0.60458	.	0.785760	0.12822	N	0.436343	T	0.17365	0.0417	N	0.24115	0.695	0.80722	D	1	B;B	0.27732	0.11;0.187	B;B	0.22601	0.025;0.04	T	0.10291	-1.0636	10	0.18276	T	0.48	-2.6714	6.0471	0.19766	0.1547:0.6902:0.0:0.1551	.	714;714	Q6PIJ6-2;Q6PIJ6	.;FBX38_HUMAN	K	714	ENSP00000342023:N714K;ENSP00000377895:N714K	ENSP00000342023:N714K	N	+	3	2	FBXO38	147787192	0.979000	0.34478	1.000000	0.80357	0.998000	0.95712	0.969000	0.29370	2.644000	0.89710	0.655000	0.94253	AAC	-	FBXO38	-	NULL		0.512	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	FBXO38	HGNC	protein_coding	OTTHUMT00000252185.2	0	0	1	10	10	51	0.00	1.92	C	NM_030793		147806999	+1	6	20	10	23	tier1	no_errors	ENST00000340253	ensembl	human	known	74_37	missense	37.50	46.51	SNP	0.980	G	6	10
HMGCLL1	54511	genome.wustl.edu	37	6	55406543	55406543	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr6:55406543G>C	ENST00000398661.2	-	4	502	c.371C>G	c.(370-372)tCc>tGc	p.S124C	HMGCLL1_ENST00000308161.4_Missense_Mutation_p.S94C|HMGCLL1_ENST00000508459.1_Missense_Mutation_p.S94C|HMGCLL1_ENST00000274901.4_Missense_Mutation_p.S94C|HMGCLL1_ENST00000428842.1_Missense_Mutation_p.S94C|HMGCLL1_ENST00000370850.2_Missense_Mutation_p.S94C	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	124					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			TACCCATCTGGAAGACACAAA	0.318													ENSG00000146151																									Ovarian(35;840 893 7837 15538 42887)												0													85.0	83.0	83.0					6																	55406543		1808	4073	5881	SO:0001583	missense	0			-	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.371C>G	6.37:g.55406543G>C	ENSP00000381654:p.Ser124Cys		B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	pfam_PYR_CT,pfscan_PYR_CT	p.S124C	ENST00000398661.2	37	c.371	CCDS43475.1	6	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315658	0.81469	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000370850;ENST00000508459;ENST00000308161;ENST00000428842	D;D;D;D;D;D	0.98329	-4.73;-4.73;-4.48;-4.73;-4.87;-4.73	5.97	5.97	0.96955	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.98670	0.9554	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.996;0.998;0.996;0.997	D;D;D;D;D;D	0.80764	0.98;0.994;0.951;0.973;0.951;0.971	D	0.99851	1.1071	10	0.87932	D	0	-18.5351	20.4387	0.99107	0.0:0.0:1.0:0.0	.	94;94;94;94;94;124	B7Z4D4;B7Z212;F8W793;G5E9S9;Q8TB92-2;Q8TB92	.;.;.;.;.;HMGC2_HUMAN	C	94;124;94;94;94;94	ENSP00000274901:S94C;ENSP00000381654:S124C;ENSP00000359887:S94C;ENSP00000424309:S94C;ENSP00000309737:S94C;ENSP00000412924:S94C	ENSP00000274901:S94C	S	-	2	0	HMGCLL1	55514502	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	8.795000	0.91872	2.836000	0.97738	0.655000	0.94253	TCC	-	HMGCLL1	-	pfam_PYR_CT,pfscan_PYR_CT		0.318	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	HMGCLL1	HGNC	protein_coding	OTTHUMT00000360290.1	0	0	0	69	69	74	0.00	0.00	G	XM_166383		55406543	-1	49	49	41	67	tier1	no_errors	ENST00000398661	ensembl	human	known	74_37	missense	54.44	42.24	SNP	1.000	C	49	41
KNTC1	9735	genome.wustl.edu	37	12	123070191	123070191	+	Silent	SNP	T	T	C	rs546067080	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:123070191T>C	ENST00000333479.7	+	37	3720	c.3543T>C	c.(3541-3543)ttT>ttC	p.F1181F	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1181					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AGGCTTCTTTTGGGACACATA	0.383													ENSG00000184445	T|||	3	0.000599042	0.0	0.0	5008	,	,		20512	0.0		0.0	False		,,,				2504	0.0031																0													147.0	135.0	138.0					12																	123070191		1864	4105	5969	SO:0001819	synonymous_variant	0			-		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3543T>C	12.37:g.123070191T>C			A7E2C4|B3KSG2	Silent	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.F1181	ENST00000333479.7	37	c.3543	CCDS45002.1	12																																																																																			-	KNTC1	-	NULL		0.383	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	0	0	0	92	92	83	0.00	0.00	T			123070191	+1	35	33	56	31	tier1	no_errors	ENST00000333479	ensembl	human	known	74_37	silent	38.46	51.56	SNP	0.989	C	35	56
KLC4	89953	genome.wustl.edu	37	6	43041689	43041689	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr6:43041689G>A	ENST00000394056.2	+	16	2290	c.1795G>A	c.(1795-1797)Gca>Aca	p.A599T	KLC4_ENST00000394058.1_Missense_Mutation_p.A599T|PTK7_ENST00000471863.1_5'Flank|PTK7_ENST00000352931.2_5'Flank|PTK7_ENST00000481273.1_5'Flank|PTK7_ENST00000345201.2_5'Flank|KLC4_ENST00000453940.2_Missense_Mutation_p.A522T|KLC4_ENST00000479388.1_Missense_Mutation_p.A599T|PTK7_ENST00000349241.2_5'Flank|PTK7_ENST00000230419.4_5'Flank|RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000347162.5_Missense_Mutation_p.A599T|PTK7_ENST00000476760.1_5'Flank|KLC4_ENST00000259708.3_Missense_Mutation_p.A617T			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	599						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			CCAACCTAGTGCAGCACCCCT	0.527													ENSG00000137171																																					0													131.0	113.0	119.0					6																	43041689		2203	4300	6503	SO:0001583	missense	0			-	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1795G>A	6.37:g.43041689G>A	ENSP00000377620:p.Ala599Thr		B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.A617T	ENST00000394056.2	37	c.1849	CCDS4883.1	6	.	.	.	.	.	.	.	.	.	.	G	9.486	1.099428	0.20552	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T	0.77750	-1.11;-1.12;-1.12;-1.11;-1.11;-1.11	5.44	3.65	0.41850	.	0.696719	0.13520	N	0.381766	T	0.35711	0.0941	N	0.14661	0.345	0.25762	N	0.984934	B;B;B	0.29716	0.255;0.0;0.0	B;B;B	0.24394	0.053;0.001;0.0	T	0.12372	-1.0550	10	0.23302	T	0.38	-24.0412	6.9889	0.24743	0.0884:0.0:0.7402:0.1714	.	522;617;599	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	T	599;522;617;599;599;599	ENSP00000340221:A599T;ENSP00000395806:A522T;ENSP00000259708:A617T;ENSP00000418031:A599T;ENSP00000377620:A599T;ENSP00000377622:A599T	ENSP00000259708:A617T	A	+	1	0	KLC4	43149667	1.000000	0.71417	0.737000	0.30932	0.599000	0.36880	2.895000	0.48648	0.656000	0.30886	-0.258000	0.10820	GCA	-	KLC4	-	NULL		0.527	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLC4	HGNC	protein_coding	OTTHUMT00000040579.2	0	0	0	127	127	109	0.00	0.00	G	NM_138343		43041689	+1	41	22	76	60	tier1	no_errors	ENST00000259708	ensembl	human	known	74_37	missense	34.75	26.83	SNP	0.909	A	41	76
GPRIN3	285513	genome.wustl.edu	37	4	90168982	90168982	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr4:90168982G>C	ENST00000609438.1	-	2	2798	c.2280C>G	c.(2278-2280)ttC>ttG	p.F760L	GPRIN3_ENST00000333209.4_Missense_Mutation_p.F760L	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	760										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TGGGGCGTCGGAAGTTCTGCA	0.468													ENSG00000185477																																					0													114.0	117.0	116.0					4																	90168982		2203	4300	6503	SO:0001583	missense	0			-	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.2280C>G	4.37:g.90168982G>C	ENSP00000476603:p.Phe760Leu		Q8IVE4	Missense_Mutation	SNP	NULL	p.F760L	ENST00000609438.1	37	c.2280	CCDS34030.1	4	.	.	.	.	.	.	.	.	.	.	G	17.58	3.423958	0.62733	.	.	ENSG00000185477	ENST00000333209	T	0.18338	2.22	5.26	-10.5	0.00291	.	0.000000	0.35151	N	0.003417	T	0.05868	0.0153	N	0.04090	-0.28	0.23150	N	0.998215	B	0.24043	0.096	B	0.25614	0.062	T	0.22347	-1.0219	10	0.52906	T	0.07	-6.5429	12.9534	0.58413	0.6275:0.2128:0.1597:0.0	.	760	Q6ZVF9	GRIN3_HUMAN	L	760	ENSP00000328672:F760L	ENSP00000328672:F760L	F	-	3	2	GPRIN3	90388005	0.016000	0.18221	0.003000	0.11579	0.985000	0.73830	-0.763000	0.04740	-3.183000	0.00221	0.655000	0.94253	TTC	-	GPRIN3	-	NULL		0.468	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN3	HGNC	protein_coding	OTTHUMT00000363540.2	0	0	0	46	46	60	0.00	0.00	G	NM_198281		90168982	-1	28	13	26	29	tier1	no_errors	ENST00000333209	ensembl	human	known	74_37	missense	51.85	30.95	SNP	0.015	C	28	26
HSD17B12	51144	genome.wustl.edu	37	11	43819959	43819959	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:43819959C>T	ENST00000278353.4	+	4	492	c.373C>T	c.(373-375)Ctt>Ttt	p.L125F	HSD17B12_ENST00000529261.1_3'UTR	NM_016142.2	NP_057226.1	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	125					cellular lipid metabolic process (GO:0044255)|estrogen biosynthetic process (GO:0006703)|extracellular matrix organization (GO:0030198)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cell-substrate adhesion (GO:0010811)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|heparin binding (GO:0008201)			endometrium(2)|large_intestine(4)|lung(4)	10						CTTGGCTGGTCTTGAAATCGG	0.318													ENSG00000149084																									Ovarian(58;548 1143 13948 16572 34258)												0													95.0	99.0	98.0					11																	43819959		2203	4300	6503	SO:0001583	missense	0			-	AF078850	CCDS7905.1	11q11	2011-09-20				ENSG00000149084	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18646	protein-coding gene	gene with protein product	"""3-ketoacyl-CoA reductase"", ""short chain dehydrogenase/reductase family 12C, member 1"""	609574				12482854, 19027726	Standard	NM_016142		Approved	KAR, SDR12C1	uc001mxq.4	Q53GQ0		ENST00000278353.4:c.373C>T	11.37:g.43819959C>T	ENSP00000278353:p.Leu125Phe		A8K9B0|D3DR23|Q96EA9|Q96JU2|Q9Y6G8	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.L125F	ENST00000278353.4	37	c.373	CCDS7905.1	11	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848206	0.71603	.	.	ENSG00000149084	ENST00000531185;ENST00000278353	D;D	0.93019	-3.15;-2.27	5.09	5.09	0.68999	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95862	0.8653	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96210	0.9152	10	0.72032	D	0.01	-13.1904	15.4364	0.75149	0.0:1.0:0.0:0.0	.	125	Q53GQ0	DHB12_HUMAN	F	84;125	ENSP00000436582:L84F;ENSP00000278353:L125F	ENSP00000278353:L125F	L	+	1	0	HSD17B12	43776535	1.000000	0.71417	0.933000	0.37362	0.824000	0.46624	3.433000	0.52834	2.360000	0.80028	0.655000	0.94253	CTT	-	HSD17B12	-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR		0.318	HSD17B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B12	HGNC	protein_coding	OTTHUMT00000389594.1	0	0	0	47	47	66	0.00	0.00	C			43819959	+1	13	29	18	53	tier1	no_errors	ENST00000278353	ensembl	human	known	74_37	missense	41.94	35.37	SNP	0.999	T	13	18
WDFY4	57705	genome.wustl.edu	37	10	49951504	49951504	+	Silent	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951504C>T	ENST00000325239.5	+	11	2397	c.2370C>T	c.(2368-2370)acC>acT	p.T790T	WDFY4_ENST00000413659.2_Silent_p.T790T	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	790						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCCTGAGGACCAAGCAGGGGC	0.602													ENSG00000128815																																					0													16.0	19.0	18.0					10																	49951504		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2370C>T	10.37:g.49951504C>T			B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T790	ENST00000325239.5	37	c.2370	CCDS44385.1	10																																																																																			-	WDFY4	-	superfamily_ARM-type_fold		0.602	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		0	0	0	39	39	93	0.00	0.00	C	XM_033379		49951504	+1	18	30	60	118	tier1	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	23.08	20.27	SNP	0.000	T	18	60
GLI1	2735	genome.wustl.edu	37	12	57864284	57864284	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:57864284C>A	ENST00000228682.2	+	12	1852	c.1761C>A	c.(1759-1761)taC>taA	p.Y587*	GLI1_ENST00000546141.1_Nonsense_Mutation_p.Y546*|GLI1_ENST00000543426.1_Nonsense_Mutation_p.Y459*	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	587					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCCAGCACTACCTGCTTCGGG	0.627													ENSG00000111087																									Pancreas(157;841 1936 10503 41495 50368)												0													64.0	55.0	58.0					12																	57864284		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1761C>A	12.37:g.57864284C>A	ENSP00000228682:p.Tyr587*		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y587*	ENST00000228682.2	37	c.1761	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	C	28.8	4.947592	0.92593	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	.	.	.	3.86	2.97	0.34412	.	0.000000	0.41823	D	0.000805	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7525	0.28904	0.0:0.7988:0.0:0.2011	.	.	.	.	X	459;587;546;546	.	ENSP00000228682:Y587X	Y	+	3	2	GLI1	56150551	0.995000	0.38212	1.000000	0.80357	0.912000	0.54170	1.834000	0.39171	1.198000	0.43158	0.491000	0.48974	TAC	-	GLI1	-	NULL		0.627	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1	0	0	0	60	60	50	0.00	0.00	C	NM_005269		57864284	+1	16	14	34	13	tier1	no_errors	ENST00000228682	ensembl	human	known	74_37	nonsense	32.00	51.85	SNP	1.000	A	16	34
OR10S1	219873	genome.wustl.edu	37	11	123847411	123847411	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:123847411G>T	ENST00000531945.1	-	1	1077	c.988C>A	c.(988-990)Ccc>Acc	p.P330T		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	330						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GACTATGGGGGTGGGCTGCCT	0.468													ENSG00000196248																																					0													47.0	45.0	45.0					11																	123847411		2202	4299	6501	SO:0001583	missense	0			-	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.988C>A	11.37:g.123847411G>T	ENSP00000431914:p.Pro330Thr		B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P330T	ENST00000531945.1	37	c.988	CCDS31701.1	11	.	.	.	.	.	.	.	.	.	.	G	10.35	1.325578	0.24080	.	.	ENSG00000196248	ENST00000531945	T	0.00036	8.86	4.82	0.233	0.15386	.	.	.	.	.	T	0.00109	0.0003	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.14578	0.011	T	0.14755	-1.0461	9	0.72032	D	0.01	-5.7104	7.9196	0.29837	0.1736:0.5637:0.2626:0.0	.	330	Q8NGN2	O10S1_HUMAN	T	330	ENSP00000431914:P330T	ENSP00000431914:P330T	P	-	1	0	OR10S1	123352621	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-1.551000	0.02178	-0.137000	0.11455	-0.222000	0.12452	CCC	-	OR10S1	-	NULL		0.468	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10S1	HGNC	protein_coding	OTTHUMT00000387265.2	0	0	0	16	16	41	0.00	0.00	G	NM_001004474		123847411	-1	7	27	17	39	tier1	no_errors	ENST00000531945	ensembl	human	known	74_37	missense	29.17	40.91	SNP	0.014	T	7	17
SLC24A4	123041	genome.wustl.edu	37	14	92923649	92923650	+	Intron	INS	-	-	ACACCAGG	rs60368323|rs386780028|rs386780027|rs150261689|rs146511335	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-	-	ACACCAGG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr14:92923649_92923650insACACCAGG	ENST00000532405.1	+	12	1481				SLC24A4_ENST00000556739.1_3'UTR|SLC24A4_ENST00000393265.2_Intron|SLC24A4_ENST00000531433.1_Intron|SLC24A4_ENST00000298877.1_Intron|SLC24A4_ENST00000351924.5_Intron			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4						amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		attcctagaactgcgcacctgc	0.559													ENSG00000140090		3402	0.679313	0.8374	0.5504	5008	,	,		14560	0.5933		0.6879	False		,,,				2504	0.637				NSCLC(10;315 435 10383 28450 38798)												0																																										SO:0001627	intron_variant	0				AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1255+697->ACACCAGG	14.37:g.92923649_92923650insACACCAGG			B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	R	INS	-	NULL	ENST00000532405.1	37	NULL	CCDS9903.2	14																																																																																				SLC24A4	-	-		0.559	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	SLC24A4	HGNC	protein_coding	OTTHUMT00000395240.1	0	0	0	44	44	44	0.00	0.00	-	NM_153646		92923650	+1	2	2	17	17	tier1	no_errors	ENST00000556739	ensembl	human	known	74_37	rna	10.53	10.53	INS	0.000:0.000	ACACCAGG	2	17
ACTA2	59	genome.wustl.edu	37	10	90701022	90701025	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TCTT	TCTT	TCTT	-	TCTT	TCTT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:90701022_90701025delTCTT	ENST00000458208.1	-	6	1051_1054	c.577_580delAAGA	c.(577-582)aagatcfs	p.KI193fs	ACTA2-AS1_ENST00000437930.4_RNA|STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000224784.6_Frame_Shift_Del_p.KI193fs|ACTA2_ENST00000480297.1_5'UTR|ACTA2-AS1_ENST00000596007.1_RNA	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta	193					glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		TCAGTCAGGATCTTCATGAGGTAG	0.549													ENSG00000107796																																					0																																										SO:0001589	frameshift_variant	0				X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.577_580delAAGA	10.37:g.90701022_90701025delTCTT	ENSP00000402373:p.Lys193fs		B2R8A4|P03996|P04108|Q6FI19	Frame_Shift_Del	DEL	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.K193fs	ENST00000458208.1	37	c.580_577	CCDS7392.1	10																																																																																				ACTA2	-	pfam_Actin-related,smart_Actin-related		0.549	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2	HGNC	protein_coding	OTTHUMT00000049264.1	0	0	0	75	75	36	0.00	0.00	TCTT	NM_001613		90701025	-1	26	18	10	6	tier1	no_errors	ENST00000224784	ensembl	human	known	74_37	frame_shift_del	72.22	75.00	DEL	1.000:1.000:1.000:1.000	-	26	10
ACTA2	59	genome.wustl.edu	37	10	90701026	90701026	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:90701026C>A	ENST00000458208.1	-	6	1050	c.576G>T	c.(574-576)atG>atT	p.M192I	ACTA2-AS1_ENST00000437930.4_RNA|STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000224784.6_Missense_Mutation_p.M192I|ACTA2_ENST00000480297.1_5'UTR|ACTA2-AS1_ENST00000596007.1_RNA	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta	192					glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		TCAGGATCTTCATGAGGTAGT	0.547													ENSG00000107796																																					0													138.0	107.0	118.0					10																	90701026		2203	4300	6503	SO:0001583	missense	0			-	X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.576G>T	10.37:g.90701026C>A	ENSP00000402373:p.Met192Ile		B2R8A4|P03996|P04108|Q6FI19	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.M192I	ENST00000458208.1	37	c.576	CCDS7392.1	10	.	.	.	.	.	.	.	.	.	.	C	17.69	3.453070	0.63290	.	.	ENSG00000107796	ENST00000224784;ENST00000458208;ENST00000544901	D;D	0.97352	-4.35;-4.35	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.95956	0.8683	L	0.49699	1.58	0.80722	D	1	B	0.12630	0.006	B	0.26770	0.073	D	0.92733	0.6201	10	0.87932	D	0	.	18.7419	0.91777	0.0:1.0:0.0:0.0	.	192	P62736	ACTA_HUMAN	I	192;192;147	ENSP00000224784:M192I;ENSP00000402373:M192I	ENSP00000224784:M192I	M	-	3	0	ACTA2	90691006	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.769000	0.85360	2.762000	0.94881	0.655000	0.94253	ATG	-	ACTA2	-	pfam_Actin-related,smart_Actin-related		0.547	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2	HGNC	protein_coding	OTTHUMT00000049264.1	0	0	0	73	73	36	0.00	0.00	C	NM_001613		90701026	-1	30	18	9	6	tier1	no_errors	ENST00000224784	ensembl	human	known	74_37	missense	76.92	75.00	SNP	1.000	A	30	9
ADAMTS18	170692	genome.wustl.edu	37	16	77325184	77325184	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:77325184C>A	ENST00000282849.5	-	21	3799	c.3381G>T	c.(3379-3381)tgG>tgT	p.W1127C	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1127	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GCAATGAATACCATCCAGCTA	0.493													ENSG00000140873																																					0													104.0	96.0	99.0					16																	77325184		2198	4300	6498	SO:0001583	missense	0			-	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3381G>T	16.37:g.77325184C>A	ENSP00000282849:p.Trp1127Cys		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.W1127C	ENST00000282849.5	37	c.3381	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869767	0.72065	.	.	ENSG00000140873	ENST00000282849	T	0.69435	-0.4	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.90683	0.7077	H	0.99726	4.73	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.94729	0.7908	10	0.87932	D	0	.	18.5635	0.91110	0.0:1.0:0.0:0.0	.	1127	Q8TE60	ATS18_HUMAN	C	1127	ENSP00000282849:W1127C	ENSP00000282849:W1127C	W	-	3	0	ADAMTS18	75882685	1.000000	0.71417	0.997000	0.53966	0.525000	0.34531	6.797000	0.75150	2.641000	0.89580	0.563000	0.77884	TGG	-	ADAMTS18	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.493	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1	0	0	0	72	72	86	0.00	0.00	C			77325184	-1	21	36	11	6	tier1	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	65.62	85.71	SNP	1.000	A	21	11
ANGPTL3	27329	genome.wustl.edu	37	1	63070097	63070097	+	Intron	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:63070097C>T	ENST00000371129.3	+	6	1278				DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000340370.5_Intron|ANGPTL3_ENST00000493994.1_3'UTR	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3						acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						CTCTAATCTTCCTCAGATTTT	0.294													ENSG00000132855																																					0																																										SO:0001627	intron_variant	0			-	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1198+191C>T	1.37:g.63070097C>T			A0JLS0|B1ALJ0|B2RCW1	R	SNP	-	NULL	ENST00000371129.3	37	NULL	CCDS622.1	1																																																																																			-	ANGPTL3	-	-		0.294	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL3	HGNC	protein_coding	OTTHUMT00000025344.1	0	0	0	14	14	59	0.00	0.00	C	NM_014495		63070097	+1	4	44	5	3	tier1	no_errors	ENST00000493994	ensembl	human	putative	74_37	rna	44.44	93.62	SNP	0.000	T	4	5
ELFN2	114794	genome.wustl.edu	37	22	37770666	37770666	+	Silent	SNP	G	G	A	rs201226596		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr22:37770666G>A	ENST00000402918.2	-	3	1694	c.909C>T	c.(907-909)caC>caT	p.H303H	RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	303	Fibronectin type-III.				negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					TGAACGTGACGTGGTGCAGCT	0.607													ENSG00000166897	G|||	1	0.000199681	0.0	0.0	5008	,	,		18628	0.0		0.0	False		,,,				2504	0.001																0								G		1,4405	2.1+/-5.4	0,1,2202	248.0	213.0	225.0		909	-3.4	1.0	22		225	0,8600		0,0,4300	no	coding-synonymous	ELFN2	NM_052906.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		303/821	37770666	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.909C>T	22.37:g.37770666G>A			Q96PY3	Silent	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG_anchor	p.H303	ENST00000402918.2	37	c.909	CCDS33642.1	22																																																																																			rs201226596	ELFN2	-	superfamily_Fibronectin_type3		0.607	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	0	0	0	94	94	31	0.00	0.00	G	NM_052906		37770666	-1	45	13	14	3	tier1	no_errors	ENST00000402918	ensembl	human	known	74_37	silent	76.27	81.25	SNP	0.337	A	45	14
EMP2	2013	genome.wustl.edu	37	16	10625606	10625613	+	3'UTR	DEL	ATGAATGA	ATGAATGA	-	rs151287012|rs111364972|rs149380057		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	ATGAATGA	ATGAATGA	ATGAATGA	-	ATGAATGA	ATGAATGA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:10625606_10625613delATGAATGA	ENST00000359543.3	-	0	1862_1869				EMP2_ENST00000566033.1_5'UTR|RP11-27M24.1_ENST00000535363.1_RNA	NM_001424.4	NP_001415.1	P54851	EMP2_HUMAN	epithelial membrane protein 2						cell proliferation (GO:0008283)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|regulation of glomerular filtration (GO:0003093)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	integrin binding (GO:0005178)			NS(1)|endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6						ATTTATGTTGatgaatgaatgaatgaat	0.471													ENSG00000213853																									GBM(158;2021 2691 14714 39478)												0																																										SO:0001624	3_prime_UTR_variant	0				U52100	CCDS10541.1	16p13.2	2008-08-01			ENSG00000213853	ENSG00000213853			3334	protein-coding gene	gene with protein product		602334				8996089, 10331954, 16216233	Standard	NM_001424		Approved	XMP	uc002czx.3	P54851	OTTHUMG00000129752	ENST00000359543.3:c.*1156TCATTCAT>-	16.37:g.10625614_10625621delATGAATGA			B2R7V6|D3DUF8	R	DEL	-	NULL	ENST00000359543.3	37	NULL	CCDS10541.1	16																																																																																				EMP2	-	-		0.471	EMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP2	HGNC	protein_coding	OTTHUMT00000251965.1	0	0	0	6	6	6	0.00	0.00	ATGAATGA	NM_001424		10625613	-1	2	2	6	6	tier1	no_errors	ENST00000566033	ensembl	human	putative	74_37	rna	25.00	25.00	DEL	0.092:0.092:0.091:0.090:0.088:0.085:0.082:0.078	-	2	6
TRIAP1	51499	genome.wustl.edu	37	12	120884319	120884319	+	5'Flank	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:120884319C>G	ENST00000546954.1	-	0	0				TRIAP1_ENST00000302432.3_5'Flank|AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_Silent_p.A12A	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCCTTCGGGCCCCTCTGGGCG	0.687													ENSG00000257218																																					0													50.0	56.0	54.0					12																	120884319		2203	4298	6501	SO:0001631	upstream_gene_variant	0			-		CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		12.37:g.120884319C>G	Exception_encountered		B2R4Z7|Q5RKS5|Q6LCA7	Silent	SNP	pfam_Asp/Glu-ADT_csu,tigrfam_Asp/Glu-ADT_csu	p.A12	ENST00000546954.1	37	c.36	CCDS9198.1	12																																																																																			-	GATC	-	NULL		0.687	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATC	HGNC	protein_coding	OTTHUMT00000108980.3	0	0	0	110	110	18	0.00	0.00	C	NM_016399		120884319	+1	20	4	62	4	tier1	no_errors	ENST00000551765	ensembl	human	known	74_37	silent	24.39	50.00	SNP	0.000	G	20	62
TRIAP1	51499	genome.wustl.edu	37	12	120884322	120884331	+	5'Flank	DEL	TCTGGGCGGG	TCTGGGCGGG	-	rs2235217|rs199833922|rs368556877	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TCTGGGCGGG	TCTGGGCGGG	TCTGGGCGGG	-	TCTGGGCGGG	TCTGGGCGGG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:120884322_120884331delTCTGGGCGGG	ENST00000546954.1	-	0	0				TRIAP1_ENST00000302432.3_5'Flank|AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_Frame_Shift_Del_p.PLGG13fs	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTCGGGCCCCTCTGGGCGGGCGCCAGGGCT	0.7													ENSG00000257218																																					0																																										SO:0001631	upstream_gene_variant	0					CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		12.37:g.120884322_120884331delTCTGGGCGGG	Exception_encountered		B2R4Z7|Q5RKS5|Q6LCA7	Frame_Shift_Del	DEL	pfam_Asp/Glu-ADT_csu,tigrfam_Asp/Glu-ADT_csu	p.L14fs	ENST00000546954.1	37	c.39_48	CCDS9198.1	12																																																																																				GATC	-	NULL		0.700	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATC	HGNC	protein_coding	OTTHUMT00000108980.3	0	0	0	15	15	15	0.00	0.00	TCTGGGCGGG	NM_016399		120884331	+1	4	4	4	4	tier1	no_errors	ENST00000551765	ensembl	human	known	74_37	frame_shift_del	50.00	50.00	DEL	0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000	-	4	4
MUC2	4583	genome.wustl.edu	37	11	1098687	1098687	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:1098687G>A	ENST00000441003.2	+	37	7084	c.7057G>A	c.(7057-7059)Gat>Aat	p.D2353N	MUC2_ENST00000361558.6_3'UTR	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4715					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCACTACTACGATGCCTGCGT	0.647													ENSG00000198788																																					0													23.0	28.0	27.0					11																	1098687		2117	4234	6351	SO:0001583	missense	0			-	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7057G>A	11.37:g.1098687G>A	ENSP00000415183:p.Asp2353Asn		Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.D2353N	ENST00000441003.2	37	c.7057		11	.	.	.	.	.	.	.	.	.	.	G	6.821	0.520618	0.13005	.	.	ENSG00000198788	ENST00000441003	T	0.77098	-1.07	4.09	4.09	0.47781	.	.	.	.	.	T	0.71451	0.3341	L	0.56124	1.755	0.09310	N	1	P	0.48407	0.91	B	0.40477	0.33	T	0.61496	-0.7051	9	0.23302	T	0.38	.	12.2354	0.54512	0.0:0.1719:0.8281:0.0	.	2353	E7EUV1	.	N	2353	ENSP00000415183:D2353N	ENSP00000415183:D2353N	D	+	1	0	MUC2	1088687	0.001000	0.12720	0.855000	0.33649	0.347000	0.29111	0.632000	0.24583	1.821000	0.53095	0.561000	0.74099	GAT	-	MUC2	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	0	0	0	112	112	15	0.00	0.00	G	NM_002457		1098687	+1	54	3	10	3	tier1	no_errors	ENST00000441003	ensembl	human	known	74_37	missense	84.38	50.00	SNP	0.118	A	54	10
MRGPRX3	117195	genome.wustl.edu	37	11	18159001	18159001	+	Silent	SNP	G	G	A	rs148328055	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:18159001G>A	ENST00000396275.2	+	3	613	c.252G>A	c.(250-252)ccG>ccA	p.P84P		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TATGTTCGCCGTTACGCCTCA	0.542													ENSG00000179826																																					0								G		0,4400		0,0,2200	103.0	98.0	100.0		252	0.5	0.0	11	dbSNP_134	100	4,8582	3.0+/-9.4	0,4,4289	no	coding-synonymous	MRGPRX3	NM_054031.3		0,4,6489	AA,AG,GG		0.0466,0.0,0.0308		84/323	18159001	4,12982	2200	4293	6493	SO:0001819	synonymous_variant	0			-		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.252G>A	11.37:g.18159001G>A			B0M0L1|Q8TDE0|Q8TDE1	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.P84	ENST00000396275.2	37	c.252	CCDS7830.1	11																																																																																			rs148328055	MRGPRX3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX3	HGNC	protein_coding	OTTHUMT00000389767.1	0	0	0	57	57	45	0.00	0.00	G	NM_054031		18159001	+1	25	16	12	6	tier1	no_errors	ENST00000396275	ensembl	human	known	74_37	silent	67.57	72.73	SNP	0.000	A	25	12
SLC17A4	10050	genome.wustl.edu	37	6	25771211	25771211	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr6:25771211T>A	ENST00000377905.4	+	6	796	c.677T>A	c.(676-678)aTa>aAa	p.I226K	SLC17A4_ENST00000439485.2_Intron|SLC17A4_ENST00000397076.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	226					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TGCCAGACCATAGGATGGCCT	0.458													ENSG00000146039																																					0													310.0	291.0	297.0					6																	25771211		2203	4300	6503	SO:0001583	missense	0			-	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.677T>A	6.37:g.25771211T>A	ENSP00000367137:p.Ile226Lys		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I226K	ENST00000377905.4	37	c.677	CCDS4564.1	6	.	.	.	.	.	.	.	.	.	.	T	18.38	3.610253	0.66558	.	.	ENSG00000146039	ENST00000377905	T	0.59364	0.27	5.69	1.9	0.25705	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.283730	0.05320	N	0.526459	T	0.26882	0.0658	L	0.42744	1.35	0.09310	N	1	B	0.15473	0.013	B	0.19148	0.024	T	0.23048	-1.0199	10	0.44086	T	0.13	.	4.2972	0.10908	0.1508:0.1684:0.0:0.6807	.	226	Q9Y2C5	S17A4_HUMAN	K	226	ENSP00000367137:I226K	ENSP00000367137:I226K	I	+	2	0	SLC17A4	25879190	0.160000	0.22878	0.003000	0.11579	0.956000	0.61745	2.253000	0.43205	0.500000	0.27991	0.533000	0.62120	ATA	-	SLC17A4	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.458	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	HGNC	protein_coding	OTTHUMT00000040068.1	0	0	0	128	128	83	0.00	0.00	T			25771211	+1	43	26	6	4	tier1	no_errors	ENST00000377905	ensembl	human	known	74_37	missense	87.76	86.67	SNP	0.004	A	43	6
TM2D1	83941	genome.wustl.edu	37	1	62190776	62190776	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:62190776G>A	ENST00000606498.1	-	1	37	c.17C>T	c.(16-18)cCg>cTg	p.P6L	TM2D1_ENST00000294613.5_Missense_Mutation_p.P6L|TM2D1_ENST00000371180.2_Missense_Mutation_p.P68L|TM2D1_ENST00000371177.2_Missense_Mutation_p.P6L			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1	6					apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)			large_intestine(2)|lung(3)|ovary(1)	6						CGGACCAGACGGCCAGGCGGC	0.662													ENSG00000162604																																					0													35.0	42.0	40.0					1																	62190776		1913	4090	6003	SO:0001583	missense	0			-	AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.17C>T	1.37:g.62190776G>A	ENSP00000475700:p.Pro6Leu		A6NDA8	Missense_Mutation	SNP	pfam_TM2	p.P68L	ENST00000606498.1	37	c.203		1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686813	0.48097	.	.	ENSG00000162604	ENST00000371180;ENST00000294613;ENST00000371178;ENST00000371177	.	.	.	4.69	3.7	0.42460	.	1.025170	0.07796	N	0.955791	T	0.35393	0.0930	L	0.44542	1.39	0.09310	N	1	B	0.27971	0.196	B	0.14578	0.011	T	0.16719	-1.0393	9	0.72032	D	0.01	-1.8948	9.5646	0.39391	0.0:0.0:0.7907:0.2093	.	6	Q9BX74	TM2D1_HUMAN	L	68;6;6;6	.	ENSP00000294613:P6L	P	-	2	0	TM2D1	61963364	0.015000	0.18098	0.016000	0.15963	0.024000	0.10985	2.006000	0.40874	2.581000	0.87130	0.462000	0.41574	CCG	-	TM2D1	-	NULL		0.662	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	TM2D1	HGNC	protein_coding	OTTHUMT00000470779.2	0	0	0	56	56	18	0.00	0.00	G	NM_032027		62190776	-1	24	5	5	1	tier1	no_errors	ENST00000371180	ensembl	human	known	74_37	missense	82.76	83.33	SNP	0.004	A	24	5
UBAC2	337867	genome.wustl.edu	37	13	100038221	100038221	+	IGR	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr13:100038221C>G	ENST00000403766.3	+	0	1375				UBAC2_ENST00000460562.1_3'UTR|UBAC2_ENST00000376440.2_3'UTR	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2						protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GTTAATTTTGCTCAGAGTATC	0.483													ENSG00000134882																																					0																																										SO:0001628	intergenic_variant	0			-	AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267		13.37:g.100038221C>G			B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	R	SNP	-	NULL	ENST00000403766.3	37	NULL	CCDS45064.1	13																																																																																			-	UBAC2	-	-		0.483	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	UBAC2	HGNC	protein_coding	OTTHUMT00000045588.1	0	0	0	12	12	36	0.00	0.00	C	NM_177967		100038221	+1	8	24	3	0	tier1	no_errors	ENST00000460562	ensembl	human	known	74_37	rna	72.73	100.00	SNP	0.685	G	8	3
WDR11	55717	genome.wustl.edu	37	10	122648750	122648751	+	3'UTR	INS	-	-	TTTTGTTTTG	rs71019800|rs369445236|rs141904743	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-	-	TTTTGTTTTG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:122648750_122648751insTTTTGTTTTG	ENST00000604509.1	+	0	2177_2178				WDR11_ENST00000263461.6_Intron			Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						AAATGAAATCtttttgttttgt	0.411													ENSG00000120008		1378	0.27516	0.3154	0.3271	5008	,	,		15252	0.3899		0.1581	False		,,,				2504	0.1861																0																																										SO:0001624	3_prime_UTR_variant	0				AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000604509.1:c.*2175->TTTTGTTTTG	10.37:g.122648751_122648760dupTTTTGTTTTG			A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	R	INS	-	NULL	ENST00000604509.1	37	NULL		10																																																																																				WDR11	-	-		0.411	WDR11-006	KNOWN	non_canonical_U12|basic	processed_transcript	WDR11	HGNC	protein_coding	OTTHUMT00000468479.1	0	0	0	12	12	12	0.00	0.00	-			122648751	+1	2	2	8	8	tier1	no_errors	ENST00000604509	ensembl	human	known	74_37	rna	20.00	20.00	INS	0.024:0.006	TTTTGTTTTG	2	8
ARFGEF1	10565	genome.wustl.edu	37	8	68188215	68188215	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr8:68188215G>A	ENST00000262215.3	-	9	1722	c.1333C>T	c.(1333-1335)Cca>Tca	p.P445S		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	445					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			ACTTACTTTGGATCTGGTGGT	0.358													ENSG00000066777																																					0													86.0	78.0	81.0					8																	68188215		2203	4300	6503	SO:0001583	missense	0			-	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.1333C>T	8.37:g.68188215G>A	ENSP00000262215:p.Pro445Ser		Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.P445S	ENST00000262215.3	37	c.1333	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869703	0.72065	.	.	ENSG00000066777	ENST00000262215	T	0.39997	1.05	5.53	5.53	0.82687	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59404	0.2191	M	0.85945	2.785	0.80722	D	1	B	0.32324	0.364	B	0.41646	0.362	T	0.60296	-0.7291	10	0.44086	T	0.13	.	19.8389	0.96675	0.0:0.0:1.0:0.0	.	445	Q9Y6D6	BIG1_HUMAN	S	445	ENSP00000262215:P445S	ENSP00000262215:P445S	P	-	1	0	ARFGEF1	68350769	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.715000	0.98748	2.755000	0.94549	0.650000	0.86243	CCA	-	ARFGEF1	-	superfamily_ARM-type_fold		0.358	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	HGNC	protein_coding	OTTHUMT00000379441.4	0	0	0	58	58	105	0.00	0.00	G	NM_006421		68188215	-1	8	9	54	97	tier1	no_errors	ENST00000262215	ensembl	human	known	74_37	missense	12.90	8.49	SNP	1.000	A	8	54
TRIAP1	51499	genome.wustl.edu	37	12	120884315	120884324	+	5'Flank	DEL	GGGCCCCTCT	GGGCCCCTCT	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	GGGCCCCTCT	GGGCCCCTCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:120884315_120884324delGGGCCCCTCT	ENST00000546954.1	-	0	0				TRIAP1_ENST00000302432.3_5'Flank|AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_Frame_Shift_Del_p.RAPL11fs	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGGGCCTTCGGGCCCCTCTGGGCGGGCGC	0.69													ENSG00000257218																																					0																																										SO:0001631	upstream_gene_variant	0					CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		12.37:g.120884315_120884324delGGGCCCCTCT	Exception_encountered		B2R4Z7|Q5RKS5|Q6LCA7	Frame_Shift_Del	DEL	pfam_Asp/Glu-ADT_csu,tigrfam_Asp/Glu-ADT_csu	p.P13fs	ENST00000546954.1	37	c.32_41	CCDS9198.1	12																																																																																				GATC	-	NULL		0.690	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATC	HGNC	protein_coding	OTTHUMT00000108980.3	0	0	0	17	17	17	0.00	0.00	GGGCCCCTCT	NM_016399		120884324	+1	0	0	8	8	tier1	no_errors	ENST00000551765	ensembl	human	known	74_37	frame_shift_del	0.00	0.00	DEL	0.002:0.002:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-	0	8
MAPK8IP3	23162	genome.wustl.edu	37	16	1785034	1785034	+	Intron	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:1785034C>T	ENST00000250894.4	+	4	759				MAPK8IP3_ENST00000356010.5_Intron|MIR3177_ENST00000578255.1_RNA	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3						activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GAGACATTCGCGCAGTGCACG	0.612													ENSG00000265820																																					0																																										SO:0001627	intron_variant	0			-	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.602+5455C>T	16.37:g.1785034C>T			A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	R	SNP	-	NULL	ENST00000250894.4	37	NULL	CCDS10442.2	16																																																																																			-	MIR3177	-	-		0.612	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3177	HGNC	protein_coding	OTTHUMT00000250508.2	0	0	0	24	24	11	0.00	0.00	C	NM_001040439		1785034	+1	17	0	25	5	tier1	no_errors	ENST00000578255	ensembl	human	known	74_37	rna	40.48	0.00	SNP	0.000	T	17	25
DENND2A	27147	genome.wustl.edu	37	7	140280130	140280130	+	Intron	SNP	T	T	C	rs62485838		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr7:140280130T>C	ENST00000275884.6	-	4	1663				DENND2A_ENST00000496613.1_Intron|DENND2A_ENST00000537639.1_Intron|AC006452.1_ENST00000408805.1_RNA|DENND2A_ENST00000492720.1_Intron			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A						positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					tgcatgtatgtatgtatttat	0.368													ENSG00000221732																																					0																																										SO:0001627	intron_variant	0			-	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1245+5258A>G	7.37:g.140280130T>C			C9JUI3|Q1RMD5|Q86XY0	R	SNP	-	NULL	ENST00000275884.6	37	NULL	CCDS43659.1	7																																																																																			rs62485838	AC006452.1	-	-		0.368	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221732	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000348742.1	0	0	0	16	16	0	0.00	0.00	T	NM_015689		140280130	+1	5	0	15	0	tier1	no_errors	ENST00000408805	ensembl	human	novel	74_37	rna	25.00	0.00	SNP	0.057	C	5	15
FOXA2	3170	genome.wustl.edu	37	20	22562842	22562842	+	Silent	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr20:22562842C>G	ENST00000377115.4	-	3	1201	c.1020G>C	c.(1018-1020)ggG>ggC	p.G340G	FOXA2_ENST00000419308.2_Silent_p.G346G	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	340					adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					GCTGCTGCTGCCCGGGAGAGG	0.761													ENSG00000125798																																					0													12.0	10.0	11.0					20																	22562842		1968	3749	5717	SO:0001819	synonymous_variant	0			-	AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.1020G>C	20.37:g.22562842C>G			Q8WUW4|Q96DF7	Silent	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G346	ENST00000377115.4	37	c.1038	CCDS13147.1	20																																																																																			-	FOXA2	-	NULL		0.761	FOXA2-001	KNOWN	basic|CCDS	protein_coding	FOXA2	HGNC	protein_coding	OTTHUMT00000078289.1	0	0	0	8	8	0	0.00	0.00	C			22562842	-1	4	0	5	0	tier1	no_errors	ENST00000419308	ensembl	human	known	74_37	silent	44.44	0.00	SNP	0.997	G	4	5
IL21R	50615	genome.wustl.edu	37	16	27459684	27459684	+	Intron	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:27459684G>T	ENST00000337929.3	+	9	1340				IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000564089.1_Intron|IL21R_ENST00000564583.1_Intron|IL21R_ENST00000395754.4_Intron|IL21R_ENST00000395755.1_Intron	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor						interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						gctgaggcaggagaatcactt	0.522			T	BCL6	NHL								ENSG00000259954																												Dom	yes		16	16p11	50615	interleukin 21 receptor		L	0																																										SO:0001627	intron_variant	0			-	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.868-171G>T	16.37:g.27459684G>T			A8K9E8|D3DWF7|Q96HZ1|Q9HB91	R	SNP	-	NULL	ENST00000337929.3	37	NULL	CCDS10630.1	16																																																																																			-	IL21R-AS1	-	-		0.522	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21R-AS1	HGNC	protein_coding	OTTHUMT00000254578.2	0	0	0	13	13	0	0.00	0.00	G	NM_181078		27459684	-1	8	0	5	0	tier1	no_errors	ENST00000563191	ensembl	human	known	74_37	rna	61.54	0.00	SNP	0.004	T	8	5
LOR	4014	genome.wustl.edu	37	1	153233991	153233992	+	In_Frame_Ins	INS	-	-	CTCTGGCGGCGG	rs11272549|rs547333583|rs561634896	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:153233991_153233992insCTCTGGCGGCGG	ENST00000368742.3	+	2	623_624	c.566_567insCTCTGGCGGCGG	c.(565-570)tactct>taCTCTGGCGGCGGctct	p.194_195insGGGS		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	194					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggcg	0.743													ENSG00000203782		3247	0.648363	0.6664	0.7954	5008	,	,		5032	0.4563		0.7147	False		,,,				2504	0.6493																0										178,190		86,6,92						-7.1	0.0		dbSNP_120	1	749,435		350,49,193	no	coding	LOR	NM_000427.2		436,55,285	A1A1,A1R,RR		36.7399,48.3696,40.2706				927,625				SO:0001652	inframe_insertion	0				M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.567_578dupCTCTGGCGGCGG	1.37:g.153233991_153233992insCTCTGGCGGCGG	ENSP00000357731:p.Gly191_Ser194dup		Q5T869|Q5XKF8	In_Frame_Ins	INS	NULL	p.193in_frame_insGSGG	ENST00000368742.3	37	c.566_567	CCDS30870.1	1																																																																																				LOR	-	NULL		0.743	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	HGNC	protein_coding	OTTHUMT00000039107.1	0	0	0	1	1	1	0.00	0.00	-	NM_000427		153233992	+1	0	0	0	0	tier1	no_errors	ENST00000368742	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.014:0.200	CTCTGGCGGCGG	0	0
MSH3	4437	genome.wustl.edu	37	5	79950712	79950738	+	In_Frame_Del	DEL	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA	-	rs2431220|rs2001675|rs2405876|rs2405877|rs201874762|rs144776112|rs1574197|rs148550291|rs201906899|rs535056167|rs60484572|rs70991168|rs201149584	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr5:79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENST00000265081.6	+	1	246_272	c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	c.(166-192)gcggccgcagcggccgcagcgcccccadel	p.AAAAAAAPP56del	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	56	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		agcggctgcagcggccgcagcggccgcagcgCCCCCAGCGCCCCCAG	0.705								Mismatch excision repair (MMR)					ENSG00000113318																									Melanoma(88;1010 1399 13793 26548 36275)												0																																										SO:0001651	inframe_deletion	0				U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	5.37:g.79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENSP00000265081:p.Ala56_Pro64del		A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	pfam_D_mismatch_repair_MutS_C,pfam_D_mismatch_repair_MutS_core,pfam_D_mmatch_repair_MutS_con_dom,pfam_D_mismatch_repair_MutS-lik_N,pfam_D_mismatch_repair_MutS_clamp,superfamily_D_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_D_mismatch_repair_MutS_N,superfamily_D_mmatch_repair_MutS_con_dom,smart_D_mismatch_repair_MutS_core,smart_D_mismatch_repair_MutS_C	p.AAAAAAPPA57in_frame_del	ENST00000265081.6	37	c.166_192	CCDS34195.1	5																																																																																				MSH3	-	NULL		0.705	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	HGNC	protein_coding	OTTHUMT00000369471.1	0	0	0	0	0	0	0.00	0.00	GCGGCCGCAGCGGCCGCAGCGCCCCCA	NM_002439		79950738	+1	0	0	2	2	tier1	no_errors	ENST00000265081	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.238:0.205:0.172:0.140:0.107:0.075:0.032:0.035:0.048:0.057:0.087:0.730:0.747:0.894:0.911:0.915:0.941:0.965:0.997:1.000:1.000:1.000:1.000:0.988:0.984:0.963:0.965	-	0	2
NUMBL	9253	genome.wustl.edu	37	19	41173893	41173898	+	In_Frame_Del	DEL	TGCTGT	TGCTGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TGCTGT	TGCTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr19:41173893_41173898delTGCTGT	ENST00000252891.4	-	10	1472_1477	c.1305_1310delACAGCA	c.(1303-1311)caacagcag>cag	p.435_437QQQ>Q	NUMBL_ENST00000540131.1_In_Frame_Del_p.394_396QQQ>Q|NUMBL_ENST00000598779.1_In_Frame_Del_p.394_396QQQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgctgttgctgttgct	0.66													ENSG00000105245		2856	0.570288	0.7821	0.428	5008	,	,		15157	0.4653		0.5149	False		,,,				2504	0.5501																0																																										SO:0001651	inframe_deletion	0				AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1310delACAGCA	19.37:g.41173899_41173904delTGCTGT	ENSP00000252891:p.Gln445_Gln446del		Q7Z4J9	In_Frame_Del	DEL	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.QQ439in_frame_del	ENST00000252891.4	37	c.1310_1305	CCDS12561.1	19																																																																																				NUMBL	-	pirsf_Numb/numb-like		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2	0	0	0	0	0	0	0.00	0.00	TGCTGT	NM_004756		41173898	-1	0	0	0	0	tier1	no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	1.000:1.000:1.000:1.000:1.000:0.998	-	0	0
GPR125	166647	genome.wustl.edu	37	4	22404357	22404357	+	Silent	SNP	G	G	T	rs61736467	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr4:22404357G>T	ENST00000334304.5	-	15	2567	c.2298C>A	c.(2296-2298)acC>acA	p.T766T	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	766					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				GAATGATAGCGGTAGTATAAA	0.443													ENSG00000152990																																					0													112.0	113.0	113.0					4																	22404357		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2298C>A	4.37:g.22404357G>T			Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.T766	ENST00000334304.5	37	c.2298	CCDS33964.1	4																																																																																			-	GPR125	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.443	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3	0	0	0	51	51	123	0.00	0.00	G			22404357	-1	4	2	32	124	tier1	no_errors	ENST00000334304	ensembl	human	known	74_37	silent	11.11	1.59	SNP	0.819	T	4	32
ASCC1	51008	genome.wustl.edu	37	10	73940732	73940733	+	Intron	INS	-	-	T	rs534461070	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:73940732_73940733insT	ENST00000342444.4	-	6	675				ASCC1_ENST00000317126.4_Intron|ASCC1_ENST00000317168.6_Intron|ASCC1_ENST00000394915.3_Intron|ASCC1_ENST00000394919.1_Intron|SNORA36_ENST00000363424.1_RNA|ASCC1_ENST00000545550.1_Intron	NM_001198799.2	NP_001185728.1	Q8N9N2	ASCC1_HUMAN	activating signal cointegrator 1 complex subunit 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|transcription factor complex (GO:0005667)	catalytic activity (GO:0003824)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	7						ATTCATTTGCCtttttttttgg	0.465													ENSG00000200294																																					0																																										SO:0001627	intron_variant	0				AY013290	CCDS31219.1, CCDS55713.1	10q22.1	2012-09-20			ENSG00000138303	ENSG00000138303			24268	protein-coding gene	gene with protein product		614215				10810093, 12077347	Standard	NM_001198799		Approved	CGI-18, ASC1p50, Em:AC022392.3	uc001jst.2	Q8N9N2	OTTHUMG00000018434	ENST00000342444.4:c.573+15835->A	10.37:g.73940741_73940741dupT			Q5SW06|Q5SW07|Q96EI8|Q9Y307	R	INS	-	NULL	ENST00000342444.4	37	NULL	CCDS55713.1	10																																																																																				SNORA36	-	-		0.465	ASCC1-004	KNOWN	basic|CCDS	protein_coding	ENSG00000200294	RFAM	protein_coding	OTTHUMT00000048573.2	0	0	0	13	13	49	0.00	0.00	-	NM_015947		73940733	+1	3	2	7	25	tier1	no_errors	ENST00000363424	ensembl	human	novel	74_37	rna	30.00	7.41	INS	0.371:0.371	T	3	7
