#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ABCA10	10349	genome.wustl.edu	37	17	67215820	67215820	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr17:67215820C>T	ENST00000269081.4	-	7	1305	c.396G>A	c.(394-396)atG>atA	p.M132I	ABCA10_ENST00000416101.2_Missense_Mutation_p.M132I|ABCA10_ENST00000432313.2_Missense_Mutation_p.M132I	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	132					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ACCATTCATTCATAATTTCTC	0.303													ENSG00000154263																																					0													70.0	74.0	72.0					17																	67215820		2202	4294	6496	SO:0001583	missense	0			-	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.396G>A	17.37:g.67215820C>T	ENSP00000269081:p.Met132Ile		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.M132I	ENST00000269081.4	37	c.396	CCDS11684.1	17	.	.	.	.	.	.	.	.	.	.	C	4.562	0.104416	0.08731	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	D;D;D	0.86497	-2.13;-2.13;-2.13	3.73	-3.28	0.05033	.	0.765734	0.10367	N	0.683315	T	0.59115	0.2170	N	0.01109	-1.01	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.53472	-0.8434	10	0.21014	T	0.42	.	4.7907	0.13247	0.0:0.308:0.2984:0.3936	.	132;132	E5RFP5;Q8WWZ4	.;ABCAA_HUMAN	I	132	ENSP00000269081:M132I;ENSP00000407772:M132I;ENSP00000387674:M132I	ENSP00000269081:M132I	M	-	3	0	ABCA10	64727415	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.202000	0.09451	-0.589000	0.05874	-1.205000	0.01647	ATG	-	ABCA10	-	NULL		0.303	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	0	0	0	41	41	57	0.00	0.00	C	NM_080282		67215820	-1	13	54	39	79	tier1	no_errors	ENST00000269081	ensembl	human	known	74_37	missense	25.00	40.30	SNP	0.000	T	13	39
HERC6	55008	genome.wustl.edu	37	4	89338623	89338623	+	Silent	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr4:89338623C>T	ENST00000264346.7	+	13	1664	c.1605C>T	c.(1603-1605)atC>atT	p.I535I	HERC6_ENST00000380265.5_Silent_p.I535I	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	535					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		ATCCGCTGATCCAGATGCTTA	0.408													ENSG00000138642																																					0													72.0	66.0	68.0					4																	89338623		1872	4097	5969	SO:0001819	synonymous_variant	0			-	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.1605C>T	4.37:g.89338623C>T			B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Silent	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.I535	ENST00000264346.7	37	c.1605	CCDS47098.1	4																																																																																			-	HERC6	-	NULL		0.408	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERC6	HGNC	protein_coding	OTTHUMT00000363259.2	0	0	0	68	68	53	0.00	0.00	C			89338623	+1	30	20	45	42	tier1	no_errors	ENST00000264346	ensembl	human	known	74_37	silent	40.00	32.26	SNP	1.000	T	30	45
PCLO	27445	genome.wustl.edu	37	7	82583496	82583496	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr7:82583496C>A	ENST00000333891.9	-	5	7110	c.6773G>T	c.(6772-6774)aGt>aTt	p.S2258I	PCLO_ENST00000423517.2_Missense_Mutation_p.S2258I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGATCAGCACTAGCTCTACC	0.388													ENSG00000186472																																					0													79.0	76.0	77.0					7																	82583496		1878	4101	5979	SO:0001583	missense	0			-	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6773G>T	7.37:g.82583496C>A	ENSP00000334319:p.Ser2258Ile			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S2258I	ENST00000333891.9	37	c.6773	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	3.222	-0.159397	0.06544	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.31	5.7	2.54	0.30619	.	.	.	.	.	T	0.12603	0.0306	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.28235	-1.0050	9	0.87932	D	0	.	3.541	0.07811	0.2418:0.5031:0.1078:0.1474	.	2258;2258	Q9Y6V0-5;Q9Y6V0-6	.;.	I	2189;2258;2258	ENSP00000334319:S2258I;ENSP00000388393:S2258I	ENSP00000334319:S2258I	S	-	2	0	PCLO	82421432	0.000000	0.05858	0.020000	0.16555	0.397000	0.30659	-0.036000	0.12185	0.731000	0.32448	-0.235000	0.12190	AGT	-	PCLO	-	NULL		0.388	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	0	0	0	48	48	57	0.00	0.00	C	NM_014510		82583496	-1	21	48	19	48	tier1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	52.50	50.00	SNP	0.000	A	21	19
LAMC3	10319	genome.wustl.edu	37	9	133967191	133967191	+	3'UTR	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr9:133967191C>T	ENST00000361069.4	+	0	4878				LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3						astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCCAGATCCCCGGCACACACT	0.637													ENSG00000050555																																					0													30.0	30.0	30.0					9																	133967191		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.*17C>T	9.37:g.133967191C>T			B1APX9|B1APY0|Q59H72	R	SNP	-	NULL	ENST00000361069.4	37	NULL	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	C	6.557	0.471086	0.12461	.	.	ENSG00000050555	ENST00000320021	.	.	.	4.17	-2.26	0.06867	.	.	.	.	.	T	0.34978	0.0916	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.41034	-0.9531	5	0.62326	D	0.03	.	4.7924	0.13256	0.0:0.3009:0.1664:0.5327	.	.	.	.	W	520	.	ENSP00000325873:R520W	R	+	1	2	LAMC3	132957012	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.926000	0.01562	-0.333000	0.08476	-0.140000	0.14226	CGG	-	LAMC3	-	-		0.637	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	0	0	0	107	107	50	0.00	0.00	C	NM_006059		133967191	+1	33	7	49	22	tier1	no_errors	ENST00000462567	ensembl	human	known	74_37	rna	40.24	24.14	SNP	0.000	T	33	49
SACS	26278	genome.wustl.edu	37	13	23906926	23906926	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr13:23906926G>C	ENST00000382292.3	-	9	11362	c.11089C>G	c.(11089-11091)Ctc>Gtc	p.L3697V	SACS_ENST00000402364.1_Missense_Mutation_p.L2947V|SACS_ENST00000382298.3_Missense_Mutation_p.L3697V			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3697					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AACAGCTGGAGTACATCACAT	0.398													ENSG00000151835																																					0													132.0	120.0	124.0					13																	23906926		2203	4300	6503	SO:0001583	missense	0			-	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.11089C>G	13.37:g.23906926G>C	ENSP00000371729:p.Leu3697Val		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.L3697V	ENST00000382292.3	37	c.11089	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	11.80	1.746567	0.30955	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87571	-2.12;-2.27;-2.12	5.8	2.64	0.31445	.	0.124501	0.52532	D	0.000079	T	0.64962	0.2646	N	0.08118	0	0.24694	N	0.993294	B	0.06786	0.001	B	0.06405	0.002	T	0.50816	-0.8783	10	0.06494	T	0.89	.	2.5292	0.04698	0.1106:0.1555:0.4173:0.3165	.	3697	Q9NZJ4	SACS_HUMAN	V	3697;2947;3697	ENSP00000371729:L3697V;ENSP00000385844:L2947V;ENSP00000371735:L3697V	ENSP00000371729:L3697V	L	-	1	0	SACS	22804926	1.000000	0.71417	0.459000	0.27081	0.610000	0.37248	3.472000	0.53114	0.759000	0.33084	0.563000	0.77884	CTC	-	SACS	-	NULL		0.398	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	0	0	0	38	38	95	0.00	0.00	G	NM_014363		23906926	-1	14	35	43	140	tier1	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	24.56	19.89	SNP	0.713	C	14	43
CFAP54	144535	genome.wustl.edu	37	12	96897758	96897758	+	Missense_Mutation	SNP	A	A	C			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr12:96897758A>C	ENST00000524981.4	+	3	541	c.518A>C	c.(517-519)aAa>aCa	p.K173T	C12orf55_ENST00000298953.3_Missense_Mutation_p.K173T			Q96N23	CL055_HUMAN		173																	ACTCAATTCAAAGCTACCTTT	0.338													ENSG00000188596																																					0																																										SO:0001583	missense	0			-																												ENST00000524981.4:c.518A>C	12.37:g.96897758A>C	ENSP00000431759:p.Lys173Thr			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.K173T	ENST00000524981.4	37	c.518		12	.	.	.	.	.	.	.	.	.	.	A	14.37	2.515848	0.44763	.	.	ENSG00000188596	ENST00000524981;ENST00000298953	T	0.35048	1.33	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.55162	0.1903	M	0.70275	2.135	0.80722	D	1	.	.	.	.	.	.	T	0.58634	-0.7602	8	0.66056	D	0.02	-27.2342	15.5162	0.75826	1.0:0.0:0.0:0.0	.	.	.	.	T	173	ENSP00000298953:K173T	ENSP00000298953:K173T	K	+	2	0	C12orf63	95421889	0.993000	0.37304	0.917000	0.36280	0.008000	0.06430	3.290000	0.51755	2.206000	0.71126	0.533000	0.62120	AAA	-	C12orf55	-	NULL		0.338	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	0	0	0	75	75	92	0.00	0.00	A			96897758	+1	31	61	44	96	tier1	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	41.33	38.85	SNP	0.988	C	31	44
NAPRT	93100	genome.wustl.edu	37	8	144658831	144658831	+	Missense_Mutation	SNP	G	G	T	rs143378632		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr8:144658831G>T	ENST00000449291.2	-	6	1160	c.866C>A	c.(865-867)aCc>aAc	p.T289N	NAPRT1_ENST00000426292.3_Missense_Mutation_p.T289N|NAPRT1_ENST00000276844.7_Missense_Mutation_p.T289N|RP11-661A12.7_ENST00000529247.1_RNA|NAPRT1_ENST00000460623.1_5'Flank|NAPRT1_ENST00000435154.3_Missense_Mutation_p.T289N|RP11-661A12.9_ENST00000531730.1_RNA																endometrium(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	6	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CACGCTGTAGGTGTCCAGGAG	0.642													ENSG00000147813																																					0													17.0	19.0	18.0					8																	144658831		2199	4291	6490	SO:0001583	missense	0			-																												ENST00000449291.2:c.866C>A	8.37:g.144658831G>T	ENSP00000401508:p.Thr289Asn			Missense_Mutation	SNP	pfam_Nic_PRibTrfase-Fam,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nic_PRibTrfase-Fam,tigrfam_Nic_PRibTrfase_pncB	p.T289N	ENST00000449291.2	37	c.866	CCDS6403.2	8	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916027	0.52546	.	.	ENSG00000147813	ENST00000435154;ENST00000449291;ENST00000340490;ENST00000426292;ENST00000276844	T;T;T;T;T	0.74209	-0.63;-0.65;-0.82;-0.75;-0.66	4.4	3.52	0.40303	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.222984	0.43919	D	0.000516	D	0.87661	0.6233	M	0.93763	3.455	0.24761	N	0.992927	P;D;B;B	0.76494	0.565;0.999;0.29;0.338	B;D;B;B	0.67900	0.239;0.954;0.154;0.239	T	0.80823	-0.1210	10	0.87932	D	0	-17.1985	11.0289	0.47761	0.0909:0.0:0.9091:0.0	.	289;289;289;289	C9J8U2;G5E977;Q6XQN6-3;Q6XQN6	.;.;.;PNCB_HUMAN	N	289	ENSP00000405670:T289N;ENSP00000401508:T289N;ENSP00000341136:T289N;ENSP00000390949:T289N;ENSP00000276844:T289N	ENSP00000276844:T289N	T	-	2	0	NAPRT1	144729974	1.000000	0.71417	0.942000	0.38095	0.564000	0.35744	3.863000	0.56016	1.042000	0.40150	0.643000	0.83706	ACC	-	PRT1	-	pfam_Nic_PRibTrfase-Fam,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nic_PRibTrfase-Fam,tigrfam_Nic_PRibTrfase_pncB		0.642	NAPRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRT1	HGNC	protein_coding	OTTHUMT00000346708.3	0	0	0	19	19	43	0.00	0.00	G			144658831	-1	12	4	17	18	tier1	no_errors	ENST00000276844	ensembl	human	known	74_37	missense	41.38	18.18	SNP	0.999	T	12	17
NCKAP5	344148	genome.wustl.edu	37	2	133542322	133542322	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr2:133542322C>A	ENST00000409261.1	-	14	2435	c.2062G>T	c.(2062-2064)Gtt>Ttt	p.V688F	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.V688F	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	688										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ACAGTGACAACCCCAGTCTGG	0.438													ENSG00000176771																																					0													136.0	129.0	131.0					2																	133542322		1881	4119	6000	SO:0001583	missense	0			-	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2062G>T	2.37:g.133542322C>A	ENSP00000387128:p.Val688Phe		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.V688F	ENST00000409261.1	37	c.2062	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	c	12.06	1.825776	0.32237	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.44083	0.93;0.93	5.64	-3.01	0.05463	.	0.587199	0.12636	U	0.451715	T	0.23926	0.0579	L	0.29908	0.895	0.23386	N	0.997789	B	0.33212	0.402	B	0.33521	0.165	T	0.16041	-1.0416	10	0.72032	D	0.01	.	2.1889	0.03893	0.1046:0.2571:0.3254:0.3129	.	688	O14513	NCKP5_HUMAN	F	688	ENSP00000387128:V688F;ENSP00000380603:V688F	ENSP00000380603:V688F	V	-	1	0	NCKAP5	133258792	0.640000	0.27243	0.024000	0.17045	0.927000	0.56198	-0.083000	0.11286	-0.877000	0.04012	-0.155000	0.13514	GTT	-	NCKAP5	-	NULL		0.438	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	0	0	0	52	52	107	0.00	0.00	C	NM_207481		133542322	-1	30	45	26	49	tier1	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	53.57	47.37	SNP	0.217	A	30	26
LRRC31	79782	genome.wustl.edu	37	3	169571430	169571430	+	Intron	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr3:169571430C>T	ENST00000316428.5	-	6	1049				LRRC31_ENST00000264676.5_Intron|LRRC31_ENST00000397805.2_5'UTR|LRRC31_ENST00000523069.1_Intron	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31											cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			TAATGCTCCACGCAAAGCTCA	0.388													ENSG00000114248																																					0																																										SO:0001627	intron_variant	0			-	AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.991+1170G>A	3.37:g.169571430C>T			B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	R	SNP	-	NULL	ENST00000316428.5	37	NULL	CCDS43167.1	3																																																																																			-	LRRC31	-	-		0.388	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC31	HGNC	protein_coding	OTTHUMT00000378699.1	0	0	0	47	47	126	0.00	0.00	C	NM_024727		169571430	-1	29	62	38	85	tier1	no_errors	ENST00000397805	ensembl	human	known	74_37	rna	43.28	42.18	SNP	0.000	T	29	38
LAMA1	284217	genome.wustl.edu	37	18	7050762	7050762	+	Silent	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr18:7050762G>T	ENST00000389658.3	-	4	612	c.519C>A	c.(517-519)acC>acA	p.T173T		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	173	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CAGCCCTGTAGGTGGGTGGCC	0.522													ENSG00000101680																																					0													124.0	102.0	110.0					18																	7050762		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.519C>A	18.37:g.7050762G>T				Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.T173	ENST00000389658.3	37	c.519	CCDS32787.1	18																																																																																			-	LAMA1	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N		0.522	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	0	0	0	85	85	82	0.00	0.00	G	NM_005559		7050762	-1	27	29	41	48	tier1	no_errors	ENST00000389658	ensembl	human	known	74_37	silent	39.71	37.18	SNP	0.000	T	27	41
MAP1B	4131	genome.wustl.edu	37	5	71489794	71489794	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr5:71489794C>A	ENST00000296755.7	+	5	910	c.612C>A	c.(610-612)caC>caA	p.H204Q		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	204					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TTGACAGACACAATCTCCAAG	0.448													ENSG00000131711																									Melanoma(17;367 822 11631 31730 47712)												0													102.0	98.0	99.0					5																	71489794		2203	4300	6503	SO:0001583	missense	0			-	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.612C>A	5.37:g.71489794C>A	ENSP00000296755:p.His204Gln		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.H204Q	ENST00000296755.7	37	c.612	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836840	0.32421	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	T;T;T	0.04706	3.57;3.57;3.57	6.08	2.94	0.34122	.	0.000000	0.64402	D	0.000001	T	0.11879	0.0289	L	0.45228	1.405	0.51233	D	0.999915	D;D	0.76494	0.999;0.999	D;D	0.73708	0.981;0.981	T	0.17531	-1.0366	10	0.20046	T	0.44	-16.1611	12.0035	0.53246	0.0:0.7356:0.0:0.2644	.	78;204	A2BDK6;P46821	.;MAP1B_HUMAN	Q	204;221;78	ENSP00000296755:H204Q;ENSP00000423444:H221Q;ENSP00000423416:H78Q	ENSP00000296755:H204Q	H	+	3	2	MAP1B	71525550	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.460000	0.35244	0.908000	0.36671	0.591000	0.81541	CAC	-	MAP1B	-	NULL		0.448	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	0	0	0	63	63	86	0.00	0.00	C	NM_005909		71489794	+1	29	48	42	42	tier1	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	40.85	53.33	SNP	1.000	A	29	42
FMOD	2331	genome.wustl.edu	37	1	203311601	203311601	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:203311601C>T	ENST00000354955.4	-	3	1464	c.1001G>A	c.(1000-1002)tGc>tAc	p.C334Y	FMOD_ENST00000493296.1_5'UTR	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	334					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			CACCACGGTGCAGAAGCTGCT	0.602											OREG0014119	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000122176																																					0													38.0	35.0	36.0					1																	203311601		2203	4300	6503	SO:0001583	missense	0			-	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.1001G>A	1.37:g.203311601C>T	ENSP00000347041:p.Cys334Tyr	2136	Q15331|Q8IV47	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.C334Y	ENST00000354955.4	37	c.1001	CCDS30976.1	1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020963	0.93462	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.04119	3.7	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.18923	0.0454	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00069	-1.2136	10	0.87932	D	0	-11.2657	17.7886	0.88546	0.0:1.0:0.0:0.0	.	334	Q06828	FMOD_HUMAN	Y	321;334	ENSP00000347041:C334Y	ENSP00000347041:C334Y	C	-	2	0	FMOD	201578224	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.459000	0.80802	2.532000	0.85374	0.655000	0.94253	TGC	-	FMOD	-	pfam_Leu-rich_rpt		0.602	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMOD	HGNC	protein_coding	OTTHUMT00000087472.1	0	0	0	19	19	53	0.00	0.00	C	NM_002023		203311601	-1	8	28	7	23	tier1	no_errors	ENST00000354955	ensembl	human	known	74_37	missense	53.33	54.90	SNP	1.000	T	8	7
SOX5	6660	genome.wustl.edu	37	12	23998945	23998945	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr12:23998945C>A	ENST00000451604.2	-	3	554	c.453G>T	c.(451-453)atG>atT	p.M151I	SOX5_ENST00000545921.1_Missense_Mutation_p.M141I|SOX5_ENST00000309359.1_Missense_Mutation_p.M138I|SOX5_ENST00000441133.2_Missense_Mutation_p.M116I|SOX5_ENST00000541847.1_Missense_Mutation_p.M141I|SOX5_ENST00000541536.1_Missense_Mutation_p.M138I|SOX5_ENST00000537393.1_Missense_Mutation_p.M116I|SOX5_ENST00000546136.1_Missense_Mutation_p.M138I|SOX5_ENST00000381381.2_Missense_Mutation_p.M138I			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	151					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.M151I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TGAGCTCTTCCATTTTCCTCT	0.443													ENSG00000134532																																					1	Substitution - Missense(1)	lung(1)											116.0	106.0	109.0					12																	23998945		2203	4300	6503	SO:0001583	missense	0			-	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.453G>T	12.37:g.23998945C>A	ENSP00000398273:p.Met151Ile		B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.M151I	ENST00000451604.2	37	c.453	CCDS8699.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.095561	0.94197	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921;ENST00000541847;ENST00000441133;ENST00000538083	D;D;D;D;D;D;D	0.96992	-4.17;-4.17;-4.2;-4.17;-4.16;-4.2;-4.17	5.79	5.79	0.91817	.	0.040904	0.85682	D	0.000000	D	0.96297	0.8792	M	0.67953	2.075	0.80722	D	1	P;B;B;B	0.46859	0.885;0.371;0.048;0.255	P;B;B;B	0.45577	0.486;0.157;0.024;0.155	D	0.95912	0.8924	10	0.49607	T	0.09	.	20.0349	0.97554	0.0:1.0:0.0:0.0	.	116;116;138;151	G3V0H1;F5H0I3;P35711-4;P35711	.;.;.;SOX5_HUMAN	I	138;138;138;151;103;116;138;141;141;116;138	ENSP00000437487:M138I;ENSP00000308927:M138I;ENSP00000370788:M138I;ENSP00000398273:M151I;ENSP00000439832:M116I;ENSP00000441973:M138I;ENSP00000443520:M141I	ENSP00000308927:M138I	M	-	3	0	SOX5	23890212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.474000	0.81024	2.744000	0.94065	0.650000	0.86243	ATG	-	SOX5	-	NULL		0.443	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	HGNC	protein_coding	OTTHUMT00000402006.2	0	0	0	45	45	58	0.00	0.00	C	NM_006940		23998945	-1	5	13	25	44	tier1	no_errors	ENST00000451604	ensembl	human	known	74_37	missense	16.67	22.81	SNP	1.000	A	5	25
ARAP2	116984	genome.wustl.edu	37	4	36069535	36069535	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr4:36069535C>A	ENST00000303965.4	-	33	5598	c.5109G>T	c.(5107-5109)ttG>ttT	p.L1703F		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1703					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTTCCTACTTCAAAATCTGCT	0.318													ENSG00000047365																																					0													53.0	56.0	55.0					4																	36069535		2203	4300	6503	SO:0001583	missense	0			-	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.5109G>T	4.37:g.36069535C>A	ENSP00000302895:p.Leu1703Phe		Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.L1703F	ENST00000303965.4	37	c.5109	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	C	3.500	-0.101955	0.06967	.	.	ENSG00000047365	ENST00000303965	T	0.10960	2.82	4.93	1.2	0.21068	.	0.990092	0.08211	N	0.980772	T	0.07683	0.0193	N	0.24115	0.695	0.09310	N	1	B	0.29085	0.232	B	0.24701	0.055	T	0.38308	-0.9667	10	0.66056	D	0.02	.	6.7242	0.23346	0.0:0.6004:0.0:0.3996	.	1703	Q8WZ64	ARAP2_HUMAN	F	1703	ENSP00000302895:L1703F	ENSP00000302895:L1703F	L	-	3	2	ARAP2	35745930	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.187000	0.09656	0.078000	0.16900	0.650000	0.86243	TTG	-	ARAP2	-	NULL		0.318	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	HGNC	protein_coding	OTTHUMT00000215074.2	0	0	0	46	46	48	0.00	0.00	C	NM_015230		36069535	-1	25	45	17	53	tier1	no_errors	ENST00000303965	ensembl	human	known	74_37	missense	59.52	45.92	SNP	0.000	A	25	17
TCEB3	6924	genome.wustl.edu	37	1	24080854	24080854	+	Splice_Site	SNP	A	A	G			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:24080854A>G	ENST00000418390.2	+	7	2044	c.1773A>G	c.(1771-1773)tcA>tcG	p.S591S	TCEB3_ENST00000609199.1_Splice_Site_p.S565S	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	591	Activation domain. {ECO:0000250}.				gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TCTCTGCAGCAATCTTTGAAG	0.478													ENSG00000011007																																					0													161.0	145.0	150.0					1																	24080854		2203	4300	6503	SO:0001630	splice_region_variant	0			-	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1772-1A>G	1.37:g.24080854A>G			B2R7Q8|Q8IXH1	Silent	SNP	pfam_R_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pfscan_F-box_dom	p.S591	ENST00000418390.2	37	c.1773	CCDS239.2	1																																																																																			-	TCEB3	-	NULL		0.478	TCEB3-001	KNOWN	basic|CCDS	protein_coding	TCEB3	HGNC	protein_coding	OTTHUMT00000008230.2	0	0	0	39	39	116	0.00	0.00	A	NM_003198	Silent	24080854	+1	18	28	34	68	tier1	no_errors	ENST00000418390	ensembl	human	known	74_37	silent	34.62	29.17	SNP	0.831	G	18	34
PRODH	5625	genome.wustl.edu	37	22	18904407	18904407	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr22:18904407G>A	ENST00000357068.6	-	12	1787	c.1522C>T	c.(1522-1524)Cgc>Tgc	p.R508C	PRODH_ENST00000420436.1_Missense_Mutation_p.R400C|PRODH_ENST00000334029.2_Missense_Mutation_p.R400C	NM_016335.4	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase (oxidase) 1	508					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)	FAD binding (GO:0071949)|proline dehydrogenase activity (GO:0004657)			breast(1)|endometrium(3)|lung(4)|upper_aerodigestive_tract(1)	9					L-Proline(DB00172)	ACCTACCTGCGCAGTGCAAAG	0.637													ENSG00000100033																																					0													102.0	57.0	72.0					22																	18904407		2203	4297	6500	SO:0001583	missense	0			-	AF010310	CCDS13754.1, CCDS56223.1	22q11.2	2014-07-10	2001-12-05		ENSG00000100033	ENSG00000100033	1.5.5.2		9453	protein-coding gene	gene with protein product		606810	"""proline dehydrogenase (proline oxidase )"""			9385373, 10192398	Standard	NM_001195226		Approved	HSPOX2, PRODH1, PIG6, PRODH2, TP53I6	uc002zok.4	O43272	OTTHUMG00000150163	ENST00000357068.6:c.1522C>T	22.37:g.18904407G>A	ENSP00000349577:p.Arg508Cys		A6NF53|O14680|Q0P507|Q147W8|Q504W1|Q59FI8|Q6NV86|Q9UF13	Missense_Mutation	SNP	pfam_Proline_DH	p.R508C	ENST00000357068.6	37	c.1522	CCDS13754.1	22	.	.	.	.	.	.	.	.	.	.	g	7.471	0.646598	0.14516	.	.	ENSG00000100033	ENST00000357068;ENST00000313755	T	0.35236	1.32	4.43	-5.63	0.02474	Proline dehydrogenase (1);	0.824595	0.11311	N	0.577137	T	0.25005	0.0607	L	0.61036	1.89	0.09310	N	0.999998	B;B;B	0.21905	0.062;0.058;0.031	B;B;B	0.17098	0.006;0.017;0.01	T	0.31223	-0.9951	10	0.45353	T	0.12	.	1.332	0.02137	0.1848:0.1418:0.2172:0.4563	.	424;508;400	O43272-1;O43272;E7EQL6	.;PROD_HUMAN;.	C	508;153	ENSP00000349577:R508C	ENSP00000318329:R153C	R	-	1	0	PRODH	17284407	0.000000	0.05858	0.013000	0.15412	0.039000	0.13416	0.238000	0.18004	-1.000000	0.03438	-0.465000	0.05216	CGC	-	PRODH	-	pfam_Proline_DH		0.637	PRODH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRODH	HGNC	protein_coding	OTTHUMT00000316637.2	0	0	0	49	49	24	0.00	0.00	G	NM_016335		18904407	-1	13	15	18	11	tier1	no_errors	ENST00000357068	ensembl	human	known	74_37	missense	41.94	57.69	SNP	0.031	A	13	18
RNF149	284996	genome.wustl.edu	37	2	101893740	101893740	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr2:101893740G>T	ENST00000295317.3	-	7	1270	c.1163C>A	c.(1162-1164)gCc>gAc	p.A388D		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	388					cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						ACTCCTGCCGGCTTCTGCAAG	0.478													ENSG00000163162																									Colon(25;331 612 6521 7355 31028)												0													44.0	44.0	44.0					2																	101893740		2203	4300	6503	SO:0001583	missense	0			-	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.1163C>A	2.37:g.101893740G>T	ENSP00000295317:p.Ala388Asp		Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.A388D	ENST00000295317.3	37	c.1163	CCDS2051.1	2	.	.	.	.	.	.	.	.	.	.	G	0.128	-1.116724	0.01799	.	.	ENSG00000163162	ENST00000295317	T	0.08370	3.1	4.89	0.781	0.18561	.	1.233990	0.06245	N	0.691050	T	0.05044	0.0135	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45527	-0.9255	10	0.12103	T	0.63	.	4.8651	0.13604	0.2854:0.1587:0.5559:0.0	.	388	Q8NC42	RN149_HUMAN	D	388	ENSP00000295317:A388D	ENSP00000295317:A388D	A	-	2	0	RNF149	101260172	0.000000	0.05858	0.002000	0.10522	0.132000	0.20833	0.228000	0.17814	0.216000	0.20781	0.563000	0.77884	GCC	-	RNF149	-	NULL		0.478	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF149	HGNC	protein_coding	OTTHUMT00000253180.2	0	0	1	73	73	53	0.00	1.85	G	NM_173647		101893740	-1	9	9	43	44	tier1	no_errors	ENST00000295317	ensembl	human	known	74_37	missense	17.31	16.98	SNP	0.002	T	9	43
RBM15	64783	genome.wustl.edu	37	1	110883188	110883188	+	Missense_Mutation	SNP	G	G	C	rs556732179		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:110883188G>C	ENST00000369784.3	+	1	2061	c.1161G>C	c.(1159-1161)gaG>gaC	p.E387D	RBM15_ENST00000487146.2_Missense_Mutation_p.E387D|RBM15_ENST00000602849.1_Missense_Mutation_p.E387D|RP5-1074L1.1_ENST00000449169.1_RNA	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	387	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGTAACGGAGAGTGATTTAA	0.488			T	MKL1	acute megakaryocytic leukemia								ENSG00000162775																												Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0													51.0	51.0	51.0					1																	110883188		2203	4300	6503	SO:0001583	missense	0			-	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1161G>C	1.37:g.110883188G>C	ENSP00000358799:p.Glu387Asp		A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	pfam_SPOC_C,pfam_RRM_dom,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.E387D	ENST00000369784.3	37	c.1161	CCDS822.1	1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423466	0.25639	.	.	ENSG00000162775	ENST00000369784	T	0.21191	2.02	4.69	2.82	0.32997	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.44483	D	0.000443	T	0.09905	0.0243	L	0.39514	1.22	0.51482	D	0.999924	B;P	0.45348	0.066;0.856	B;P	0.44597	0.056;0.454	T	0.05386	-1.0888	10	0.39692	T	0.17	-14.3952	10.498	0.44789	0.1576:0.0:0.8424:0.0	.	387;387	Q96T37-3;Q96T37	.;RBM15_HUMAN	D	387	ENSP00000358799:E387D	ENSP00000358799:E387D	E	+	3	2	RBM15	110684711	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.082000	0.57635	0.598000	0.29829	0.655000	0.94253	GAG	-	RBM15	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.488	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	HGNC	protein_coding	OTTHUMT00000031114.2	0	0	0	47	47	78	0.00	0.00	G	NM_022768		110883188	+1	16	34	29	44	tier1	no_errors	ENST00000369784	ensembl	human	known	74_37	missense	35.56	43.04	SNP	0.989	C	16	29
DNAH10	196385	genome.wustl.edu	37	12	124298365	124298365	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr12:124298365C>A	ENST00000409039.3	+	20	3357	c.3332C>A	c.(3331-3333)aCa>aAa	p.T1111K		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1111	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTCCTTGCAACAATTGCAGAA	0.408													ENSG00000197653																																					0													76.0	75.0	75.0					12																	124298365		2102	4263	6365	SO:0001583	missense	0			-	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3332C>A	12.37:g.124298365C>A	ENSP00000386770:p.Thr1111Lys		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.T1111K	ENST00000409039.3	37	c.3332	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887538	0.91814	.	.	ENSG00000197653	ENST00000409039	T	0.22945	1.93	5.72	5.72	0.89469	.	.	.	.	.	T	0.48259	0.1490	M	0.80183	2.485	0.54753	D	0.999987	P	0.45011	0.848	P	0.52823	0.71	T	0.31613	-0.9937	9	0.29301	T	0.29	.	19.8751	0.96867	0.0:1.0:0.0:0.0	.	1111	Q8IVF4	DYH10_HUMAN	K	1111	ENSP00000386770:T1111K	ENSP00000386770:T1111K	T	+	2	0	DNAH10	122864318	1.000000	0.71417	0.113000	0.21522	0.987000	0.75469	5.720000	0.68470	2.695000	0.91970	0.655000	0.94253	ACA	-	DH10	-	NULL		0.408	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH10	HGNC	protein_coding	OTTHUMT00000335420.3	0	0	0	93	93	109	0.00	0.00	C			124298365	+1	18	51	54	79	tier1	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	25.00	39.23	SNP	0.945	A	18	54
PHACTR1	221692	genome.wustl.edu	37	6	13182854	13182854	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr6:13182854delC	ENST00000379350.1	+	6	729	c.600delC	c.(598-600)gtcfs	p.V200fs	PHACTR1_ENST00000457702.2_Frame_Shift_Del_p.V55fs|PHACTR1_ENST00000379345.2_Frame_Shift_Del_p.V55fs|PHACTR1_ENST00000332995.7_Frame_Shift_Del_p.V200fs			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	200					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TGGAGCCAGTCCCAATGCCCA	0.567													ENSG00000112137																																					0													83.0	87.0	86.0					6																	13182854		1978	4171	6149	SO:0001589	frameshift_variant	0				AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.600delC	6.37:g.13182854delC	ENSP00000368655:p.Val200fs		A8K1V2|Q3MJ93|Q5JSJ2	Frame_Shift_Del	DEL	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.P201fs	ENST00000379350.1	37	c.600		6																																																																																				PHACTR1	-	NULL		0.567	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHACTR1	HGNC	protein_coding	OTTHUMT00000039876.1	0	0	0	33	33	66	0.00	0.00	C	XM_166420		13182854	+1	15	16	34	26	tier1	no_errors	ENST00000379350	ensembl	human	known	74_37	frame_shift_del	30.61	38.10	DEL	0.996	-	15	34
FRMD6	122786	genome.wustl.edu	37	14	52156445	52156445	+	5'UTR	SNP	T	T	G			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr14:52156445T>G	ENST00000344768.5	+	0	87				FRMD6_ENST00000395718.2_5'UTR|FRMD6_ENST00000356218.4_5'UTR			Q96NE9	FRMD6_HUMAN	FERM domain containing 6						apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GTGATGCTTCTCCTGCAGGGC	0.577													ENSG00000139926																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.-110T>G	14.37:g.52156445T>G			D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	R	SNP	-	NULL	ENST00000344768.5	37	NULL	CCDS58318.1	14																																																																																			-	FRMD6	-	-		0.577	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	HGNC	protein_coding	OTTHUMT00000276881.1	0	0	0	78	78	9	0.00	0.00	T	NM_152330		52156445	+1	37	4	33	6	tier1	no_errors	ENST00000556137	ensembl	human	known	74_37	rna	52.86	40.00	SNP	0.000	G	37	33
HTR5A	3361	genome.wustl.edu	37	7	154863029	154863029	+	Silent	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr7:154863029C>T	ENST00000287907.2	+	1	996	c.420C>T	c.(418-420)taC>taT	p.Y140Y	HTR5A-AS1_ENST00000395731.2_5'UTR|HTR5A-AS1_ENST00000543018.1_5'UTR|HTR5A-AS1_ENST00000493904.1_5'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	140					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	TGGACCGCTACTGGTCCATCA	0.627													ENSG00000157219																																					0													86.0	64.0	71.0					7																	154863029		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.420C>T	7.37:g.154863029C>T			Q2M2D2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT5A_rcpt,prints_5HT_rcpt	p.Y140	ENST00000287907.2	37	c.420	CCDS5936.1	7																																																																																			-	HTR5A	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.627	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	HGNC	protein_coding	OTTHUMT00000322240.1	0	0	0	36	36	26	0.00	0.00	C	NM_024012		154863029	+1	20	6	12	9	tier1	no_errors	ENST00000287907	ensembl	human	known	74_37	silent	62.50	40.00	SNP	1.000	T	20	12
RBMXL3	139804	genome.wustl.edu	37	X	114426788	114426788	+	Silent	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chrX:114426788C>T	ENST00000424776.3	+	1	2826	c.2784C>T	c.(2782-2784)cgC>cgT	p.R928R	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	928	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GCGGGGGCCGCGGCCTCAACA	0.637													ENSG00000175718																																					0													13.0	15.0	15.0					X																	114426788		691	1591	2282	SO:0001819	synonymous_variant	0			-	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2784C>T	X.37:g.114426788C>T			B4DXC0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R928	ENST00000424776.3	37	c.2784	CCDS55478.1	X																																																																																			-	RBMXL3	-	NULL		0.637	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	0	0	0	84	84	13	0.00	0.00	C	NM_001145346		114426788	+1	28	6	43	9	tier1	no_errors	ENST00000424776	ensembl	human	known	74_37	silent	38.89	40.00	SNP	0.374	T	28	43
PRKACA	5566	genome.wustl.edu	37	19	14211650	14211650	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr19:14211650A>T	ENST00000308677.4	-	5	603	c.407T>A	c.(406-408)aTc>aAc	p.I136N	PRKACA_ENST00000350356.3_5'UTR|PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000589994.1_Missense_Mutation_p.I128N	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	136	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						GAACCTTCCGATCCGCCGTAG	0.602													ENSG00000072062																																					0													109.0	82.0	91.0					19																	14211650		2203	4300	6503	SO:0001583	missense	0			-		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.407T>A	19.37:g.14211650A>T	ENSP00000309591:p.Ile136Asn		Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I136N	ENST00000308677.4	37	c.407	CCDS12304.1	19	.	.	.	.	.	.	.	.	.	.	A	7.001	0.554839	0.13436	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695;ENST00000536649	T	0.63096	-0.02	4.93	4.93	0.64822	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47093	D	0.000248	T	0.37265	0.0997	N	0.03154	-0.405	0.52501	D	0.99995	B;B;B;B	0.10296	0.002;0.003;0.0;0.002	B;B;B;B	0.17433	0.008;0.008;0.01;0.018	T	0.23762	-1.0179	10	0.18276	T	0.48	.	12.5745	0.56355	1.0:0.0:0.0:0.0	.	78;119;136;128	B7Z708;Q15136;P17612;P17612-2	.;.;KAPCA_HUMAN;.	N	136;128;136;78	ENSP00000309591:I136N	ENSP00000309591:I136N	I	-	2	0	PRKACA	14072650	1.000000	0.71417	0.974000	0.42286	0.139000	0.21198	9.217000	0.95160	1.878000	0.54408	0.378000	0.23410	ATC	-	PRKACA	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.602	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	HGNC	protein_coding	OTTHUMT00000459004.1	0	0	0	69	69	60	0.00	0.00	A	NM_002730		14211650	-1	7	4	58	51	tier1	no_errors	ENST00000308677	ensembl	human	known	74_37	missense	10.77	7.27	SNP	1.000	T	7	58
USP38	84640	genome.wustl.edu	37	4	144107117	144107117	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr4:144107117G>C	ENST00000307017.4	+	1	1020	c.514G>C	c.(514-516)Gtt>Ctt	p.V172L	RP11-284M14.1_ENST00000507486.1_RNA|USP38_ENST00000510377.1_Missense_Mutation_p.V172L|RP11-284M14.1_ENST00000507826.1_RNA	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	172					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					TCAACAGCTGGTTCGAACGAT	0.542													ENSG00000170185																																					0													102.0	99.0	100.0					4																	144107117		2203	4300	6503	SO:0001583	missense	0			-	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.514G>C	4.37:g.144107117G>C	ENSP00000303434:p.Val172Leu		B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.V172L	ENST00000307017.4	37	c.514	CCDS3758.1	4	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737698	0.89573	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.62105	0.05;0.11	5.12	4.28	0.50868	.	0.000000	0.64402	D	0.000001	T	0.64571	0.2610	L	0.34521	1.04	0.80722	D	1	D;D	0.55800	0.973;0.973	P;P	0.55871	0.729;0.786	T	0.68685	-0.5343	10	0.72032	D	0.01	-5.2924	13.9186	0.63916	0.073:0.0:0.9269:0.0	.	172;172	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	L	172	ENSP00000427647:V172L;ENSP00000303434:V172L	ENSP00000303434:V172L	V	+	1	0	USP38	144326567	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.040000	0.57333	1.401000	0.46761	0.561000	0.74099	GTT	-	USP38	-	NULL		0.542	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP38	HGNC	protein_coding	OTTHUMT00000364869.1	0	0	0	26	26	122	0.00	0.00	G	NM_032557		144107117	+1	4	5	31	99	tier1	no_errors	ENST00000307017	ensembl	human	known	74_37	missense	11.43	4.81	SNP	1.000	C	4	31
ING1	3621	genome.wustl.edu	37	13	111371715	111371715	+	Silent	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr13:111371715G>T	ENST00000375774.3	+	2	1167	c.705G>T	c.(703-705)gtG>gtT	p.V235V	ING1_ENST00000333219.7_Silent_p.V92V|ING1_ENST00000464141.1_3'UTR|ING1_ENST00000338450.7_Silent_p.V48V|ING1_ENST00000375775.3_Silent_p.V23V	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	235					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TCCAGATCGTGAGCCAGATGG	0.672													ENSG00000153487																																					0													48.0	59.0	55.0					13																	111371715		2203	4299	6502	SO:0001819	synonymous_variant	0			-		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.705G>T	13.37:g.111371715G>T			O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.V235	ENST00000375774.3	37	c.705	CCDS9517.1	13																																																																																			-	ING1	-	NULL		0.672	ING1-004	KNOWN	basic|CCDS	protein_coding	ING1	HGNC	protein_coding	OTTHUMT00000045770.2	0	0	0	73	73	19	0.00	0.00	G	NM_005537		111371715	+1	4	0	43	2	tier1	no_errors	ENST00000375774	ensembl	human	known	74_37	silent	8.51	0.00	SNP	0.688	T	4	43
AC079610.1	0	genome.wustl.edu	37	2	213628318	213628325	+	RNA	DEL	TGTGTGTG	TGTGTGTG	-	rs57305053|rs34611679|rs76851700		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	TGTGTGTG	TGTGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr2:213628318_213628325delTGTGTGTG	ENST00000415387.1	-	0	381				AC093865.1_ENST00000408461.1_RNA																							tatatatatatgtgtgtgtatatatata	0.197													ENSG00000221388																																					0																																												0																																2.37:g.213628318_213628325delTGTGTGTG				R	DEL	-	NULL	ENST00000415387.1	37	NULL		2																																																																																				AC093865.1	-	-		0.197	AC079610.1-001	KNOWN	basic	sense_overlapping	ENSG00000221388	Clone_based_ensembl_gene	sense_overlapping	OTTHUMT00000337265.1	0	0	0	0	0	0	0.00	0.00	TGTGTGTG			213628325	-1	0	0	0	0	tier1	no_errors	ENST00000408461	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-	0	0
GOLGA2P7	388152	genome.wustl.edu	37	15	84868716	84868729	+	RNA	DEL	GGGGGGGGAGGGGT	GGGGGGGGAGGGGT	-	rs372945855|rs111618525|rs200105620		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	GGGGGGGGAGGGGT	GGGGGGGGAGGGGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr15:84868716_84868729delGGGGGGGGAGGGGT	ENST00000559668.1	-	0	3586_3599					NR_049748.1																						TGCGGGGGGGGGGGGGGGAGGGGTGGGATGTTCT	0.701													ENSG00000225151																																					0																																												0																																15.37:g.84868716_84868729delGGGGGGGGAGGGGT				R	DEL	-	NULL	ENST00000559668.1	37	NULL		15																																																																																				AC103965.1	-	-		0.701	AC103965.1-008	KNOWN	basic	processed_transcript	LOC101929847	Clone_based_vega_gene	pseudogene	OTTHUMT00000418802.1	0	0	0	1	1	1	0.00	0.00	GGGGGGGGAGGGGT			84868729	-1	0	0	1	1	tier1	no_errors	ENST00000316967	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.370:0.357:0.300:0.305:0.291:0.276:0.262:0.247:0.207:0.187:0.139:0.134:0.116:0.121	-	0	1
PPIAL4G	644591	genome.wustl.edu	37	1	143767744	143767744	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:143767744G>T	ENST00000419275.1	-	1	137	c.105C>A	c.(103-105)aaC>aaA	p.N35K		NM_001123068.1	NP_001116540.1	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like 4G	35	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	cytoplasm (GO:0005737)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(2)|kidney(1)|lung(8)|ovary(1)|skin(1)	14						GAGCACGAAAGTTTTCTGCTG	0.468													ENSG00000236334																																					0													112.0	105.0	107.0					1																	143767744		1568	3578	5146	SO:0001583	missense	0			-		CCDS41375.1, CCDS41375.2	1q21.1	2010-06-03			ENSG00000236334	ENSG00000236334			33996	protein-coding gene	gene with protein product							Standard	NM_001123068		Approved		uc001ejt.3	A2BFH1	OTTHUMG00000013629	ENST00000419275.1:c.105C>A	1.37:g.143767744G>T	ENSP00000393845:p.Asn35Lys		A1L431	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.N35K	ENST00000419275.1	37	c.105	CCDS41375.1	1	.	.	.	.	.	.	.	.	.	.	.	19.15	3.771747	0.69992	.	.	ENSG00000236334	ENST00000419275	T	0.32753	1.44	0.523	0.523	0.17060	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.055346	0.64402	N	0.000002	T	0.50922	0.1644	H	0.98068	4.14	0.25060	N	0.99107	D	0.57899	0.981	D	0.67900	0.954	T	0.36553	-0.9743	10	0.59425	D	0.04	.	6.9309	0.24442	1.0E-4:0.0:0.9999:0.0	.	35	A2BFH1	PAL4G_HUMAN	K	35	ENSP00000393845:N35K	ENSP00000393845:N35K	N	-	3	2	PPIAL4G	142559267	1.000000	0.71417	0.966000	0.40874	0.890000	0.51754	0.920000	0.28705	0.587000	0.29643	0.403000	0.27427	AAC	-	PPIAL4G	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom		0.468	PPIAL4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIAL4G	HGNC	protein_coding	OTTHUMT00000037969.1	0	0	0	327	327	2	0.00	0.00	G	NM_001123068		143767744	-1	85	0	258	0	tier1	no_errors	ENST00000419275	ensembl	human	known	74_37	missense	24.78	0.00	SNP	1.000	T	85	258
PRKACA	5566	genome.wustl.edu	37	19	14202661	14202661	+	3'UTR	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr19:14202661G>T	ENST00000308677.4	-	0	2515				SAMD1_ENST00000541938.1_5'Flank|PRKACA_ENST00000350356.3_5'UTR|SAMD1_ENST00000533683.2_5'Flank	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha						activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						GGGATGGGGAGAAGTTATGAG	0.577													ENSG00000072062																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.*1263C>A	19.37:g.14202661G>T			Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	R	SNP	-	NULL	ENST00000308677.4	37	NULL	CCDS12304.1	19																																																																																			-	PRKACA	-	-		0.577	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	HGNC	protein_coding	OTTHUMT00000459004.1	0	0	0	73	73	4	0.00	0.00	G	NM_002730		14202661	-1	33	2	48	4	tier1	no_errors	ENST00000350356	ensembl	human	known	74_37	rna	40.74	33.33	SNP	0.979	T	33	48
