#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ANKK1	255239	genome.wustl.edu	37	11	113270544	113270544	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:113270544A>T	ENST00000303941.3	+	8	1947	c.1853A>T	c.(1852-1854)aAc>aTc	p.N618I		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	618							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		AGCCACGCAAACATGGGTGCT	0.632													ENSG00000170209																																					0													21.0	26.0	25.0					11																	113270544		2126	4249	6375	SO:0001583	missense	0			-	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.1853A>T	11.37:g.113270544A>T	ENSP00000306678:p.Asn618Ile			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.N618I	ENST00000303941.3	37	c.1853	CCDS44734.1	11	.	.	.	.	.	.	.	.	.	.	A	8.197	0.797211	0.16327	.	.	ENSG00000170209	ENST00000303941	T	0.67345	-0.26	4.87	3.72	0.42706	Ankyrin repeat-containing domain (4);	0.577950	0.15940	N	0.237252	T	0.67832	0.2935	M	0.75777	2.31	0.09310	N	1	P	0.35433	0.501	B	0.41764	0.366	T	0.62576	-0.6825	10	0.59425	D	0.04	-14.4435	6.3332	0.21282	0.7783:0.0:0.0794:0.1423	.	618	Q8NFD2	ANKK1_HUMAN	I	618	ENSP00000306678:N618I	ENSP00000306678:N618I	N	+	2	0	ANKK1	112775754	0.007000	0.16637	0.012000	0.15200	0.038000	0.13279	2.339000	0.43965	0.869000	0.35703	0.460000	0.39030	AAC	-	ANKK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.632	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKK1	HGNC	protein_coding	OTTHUMT00000395830.1	0	0	0	24	24	43	0.00	0.00	A	NM_178510		113270544	+1	7	17	20	28	tier1	no_errors	ENST00000303941	ensembl	human	known	74_37	missense	25.93	37.78	SNP	0.000	T	7	20
PCLO	27445	genome.wustl.edu	37	7	82579403	82579403	+	Missense_Mutation	SNP	T	T	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr7:82579403T>G	ENST00000333891.9	-	6	10838	c.10501A>C	c.(10501-10503)Atg>Ctg	p.M3501L	PCLO_ENST00000423517.2_Missense_Mutation_p.M3501L|PCLO_ENST00000437081.1_Missense_Mutation_p.M221L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCCTCTGTCATGCTGTCACCA	0.463													ENSG00000186472																																					0													143.0	130.0	135.0					7																	82579403		1961	4156	6117	SO:0001583	missense	0			-	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10501A>C	7.37:g.82579403T>G	ENSP00000334319:p.Met3501Leu			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.M3501L	ENST00000333891.9	37	c.10501	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	5.890	0.348363	0.11126	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T;T	0.33654	2.45;2.45;1.4	5.39	1.67	0.24075	.	.	.	.	.	T	0.18509	0.0444	N	0.08118	0	0.09310	N	1	B;B;B	0.12013	0.0;0.005;0.005	B;B;B	0.11329	0.001;0.006;0.006	T	0.21724	-1.0237	9	0.87932	D	0	.	6.3833	0.21546	0.0:0.1408:0.1334:0.7258	.	3432;3501;3501	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	L	3432;3501;3501;221	ENSP00000334319:M3501L;ENSP00000388393:M3501L;ENSP00000393760:M221L	ENSP00000334319:M3501L	M	-	1	0	PCLO	82417339	0.004000	0.15560	0.025000	0.17156	0.870000	0.49936	0.802000	0.27069	0.042000	0.15717	0.533000	0.62120	ATG	-	PCLO	-	NULL		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	0	0	0	57	57	91	0.00	0.00	T	NM_014510		82579403	-1	18	10	49	73	tier1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	26.87	12.05	SNP	0.406	G	18	49
DNAH10	196385	genome.wustl.edu	37	12	124341717	124341717	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr12:124341717C>T	ENST00000409039.3	+	36	6224	c.6199C>T	c.(6199-6201)Cgc>Tgc	p.R2067C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2067					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGACTGCCCTCGCGTCCGCTA	0.532													ENSG00000197653																																					0													142.0	145.0	144.0					12																	124341717		2072	4205	6277	SO:0001583	missense	0			-	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6199C>T	12.37:g.124341717C>T	ENSP00000386770:p.Arg2067Cys		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.R2067C	ENST00000409039.3	37	c.6199	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	19.82	3.899127	0.72754	.	.	ENSG00000197653	ENST00000409039	T	0.24538	1.85	5.75	5.75	0.90469	.	0.000000	0.64402	U	0.000001	T	0.69753	0.3146	H	0.98133	4.155	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81538	-0.0887	10	0.87932	D	0	.	19.9522	0.97203	0.0:1.0:0.0:0.0	.	2067	Q8IVF4	DYH10_HUMAN	C	2067	ENSP00000386770:R2067C	ENSP00000386770:R2067C	R	+	1	0	DNAH10	122907670	1.000000	0.71417	0.465000	0.27155	0.113000	0.19764	5.960000	0.70348	2.725000	0.93324	0.655000	0.94253	CGC	-	DH10	-	superfamily_P-loop_NTPase		0.532	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH10	HGNC	protein_coding	OTTHUMT00000335420.3	0	0	0	124	124	79	0.00	0.00	C			124341717	+1	24	15	130	70	tier1	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	15.58	17.65	SNP	1.000	T	24	130
ZBTB44	29068	genome.wustl.edu	37	11	130103271	130103271	+	Missense_Mutation	SNP	A	A	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:130103271A>G	ENST00000357899.4	-	7	1965	c.1693T>C	c.(1693-1695)Tcc>Ccc	p.S565P	ZBTB44_ENST00000397753.1_Missense_Mutation_p.S565P|ZBTB44_ENST00000530205.1_Missense_Mutation_p.L453P|ZBTB44_ENST00000525842.1_3'UTR			Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	565					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		TTGCCTTTGGAGTGGTACTAT	0.403													ENSG00000196323																																					0																																										SO:0001583	missense	0			-	AK024659	CCDS44776.1, CCDS73414.1, CCDS73415.1	11q24.3	2013-01-08	2006-09-19	2006-09-19		ENSG00000196323		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	25001	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 15"""	BTBD15		11042152	Standard	NM_014155		Approved	HSPC063, ZNF851	uc001qgb.4	Q8NCP5		ENST00000357899.4:c.1693T>C	11.37:g.130103271A>G	ENSP00000350574:p.Ser565Pro		Q6IPT8|Q86VJ7|Q86XX5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S565P	ENST00000357899.4	37	c.1693		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	5.864|5.864	0.343583|0.343583	0.11126|0.11126	.|.	.|.	ENSG00000196323|ENSG00000196323	ENST00000530205|ENST00000397753;ENST00000357899;ENST00000529982	T|T;T	0.12465|0.10005	2.68|2.92;2.92	5.0|5.0	3.88|3.88	0.44766|0.44766	.|.	.|0.248903	.|0.42420	.|D	.|0.000715	T|T	0.08626|0.08626	0.0214|0.0214	.|.	.|.	.|.	0.23798|0.23798	N|N	0.996818|0.996818	B|B	0.28880|0.02656	0.226|0.0	B|B	0.42522|0.01281	0.39|0.0	T|T	0.23332|0.23332	-1.0191|-1.0191	7|9	.|0.72032	.|D	.|0.01	.|.	7.6631|7.6631	0.28415|0.28415	0.829:0.0:0.171:0.0|0.829:0.0:0.171:0.0	.|.	453|565	Q8NCP5-2|Q8NCP5	.|ZBT44_HUMAN	P|P	453|565;565;307	ENSP00000434177:L453P|ENSP00000380861:S565P;ENSP00000350574:S565P	.|ENSP00000350574:S565P	L|S	-|-	2|1	0|0	ZBTB44|ZBTB44	129608481|129608481	0.001000|0.001000	0.12720|0.12720	0.211000|0.211000	0.23655|0.23655	0.843000|0.843000	0.47879|0.47879	0.878000|0.878000	0.28126|0.28126	1.052000|1.052000	0.40392|0.40392	0.528000|0.528000	0.53228|0.53228	CTC|TCC	-	ZBTB44	-	NULL		0.403	ZBTB44-003	KNOWN	basic|appris_principal	protein_coding	ZBTB44	HGNC	protein_coding	OTTHUMT00000386126.1	0	0	0	114	114	56	0.00	0.00	A	NM_014155		130103271	-1	15	9	81	30	tier1	no_errors	ENST00000357899	ensembl	human	known	74_37	missense	15.62	23.08	SNP	0.178	G	15	81
DCLK3	85443	genome.wustl.edu	37	3	36779370	36779370	+	Missense_Mutation	SNP	T	T	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr3:36779370T>C	ENST00000416516.2	-	2	1271	c.781A>G	c.(781-783)Aag>Gag	p.K261E		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	261						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						GTGTCCTTCTTCACCTCCCTC	0.592													ENSG00000163673																																					0													95.0	100.0	98.0					3																	36779370		1995	4167	6162	SO:0001583	missense	0			-	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.781A>G	3.37:g.36779370T>C	ENSP00000394484:p.Lys261Glu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K261E	ENST00000416516.2	37	c.781	CCDS43064.1	3	.	.	.	.	.	.	.	.	.	.	T	6.063	0.380017	0.11466	.	.	ENSG00000163673	ENST00000416516	T	0.66995	-0.24	5.03	-0.907	0.10521	.	0.496643	0.15075	N	0.281993	T	0.43722	0.1260	N	0.19112	0.55	0.09310	N	1	B	0.34103	0.437	B	0.27608	0.081	T	0.31779	-0.9931	10	0.62326	D	0.03	.	7.9987	0.30284	0.0:0.0717:0.3909:0.5373	.	261	Q9C098	DCLK3_HUMAN	E	261	ENSP00000394484:K261E	ENSP00000394484:K261E	K	-	1	0	DCLK3	36754374	0.141000	0.22595	0.001000	0.08648	0.013000	0.08279	1.559000	0.36320	0.010000	0.14839	0.533000	0.62120	AAG	-	DCLK3	-	NULL		0.592	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	HGNC	protein_coding	OTTHUMT00000341727.1	0	0	0	47	47	78	0.00	0.00	T	XM_047355		36779370	-1	6	24	38	77	tier1	no_errors	ENST00000416516	ensembl	human	known	74_37	missense	13.64	23.76	SNP	0.193	C	6	38
LINGO1	84894	genome.wustl.edu	37	15	77934287	77934287	+	Intron	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr15:77934287G>A	ENST00000561030.1	-	4	446				RP11-307C19.3_ENST00000558691.1_RNA			Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1						central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						acctgttggcggagtggtctt	0.582													ENSG00000259666																																					0																																										SO:0001627	intron_variant	0			-	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000561030.1:c.12-26045C>T	15.37:g.77934287G>A			D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	R	SNP	-	NULL	ENST00000561030.1	37	NULL		15																																																																																			-	RP11-307C19.3	-	-		0.582	LINGO1-002	KNOWN	basic	protein_coding	LOC253044	Clone_based_vega_gene	protein_coding	OTTHUMT00000419548.2	0	0	1	43	43	93	0.00	1.06	G	NM_032808		77934287	+1	7	8	36	70	tier1	no_errors	ENST00000558691	ensembl	human	known	74_37	rna	16.28	10.26	SNP	0.001	A	7	36
RP11-156P1.2	0	genome.wustl.edu	37	17	45095748	45095748	+	Intron	SNP	C	C	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr17:45095748C>A	ENST00000571841.1	+	8	736				RP11-156P1.3_ENST00000575173.1_RNA|LRRC37A17P_ENST00000570478.1_RNA|GOSR2_ENST00000439730.2_Intron																							GTTTCACCTCCAGGTCACCAT	0.527													ENSG00000262879																																					0																																										SO:0001627	intron_variant	0			-																												ENST00000571841.1:c.677-6298C>A	17.37:g.45095748C>A				R	SNP	-	NULL	ENST00000571841.1	37	NULL		17																																																																																			-	RP11-156P1.3	-	-		0.527	RP11-156P1.2-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	LOC101927060	Clone_based_vega_gene	protein_coding	OTTHUMT00000440447.1	0	0	0	208	208	59	0.00	0.00	C			45095748	-1	21	6	156	51	tier1	no_errors	ENST00000575173	ensembl	human	known	74_37	rna	11.86	10.34	SNP	0.000	A	21	156
CECR2	27443	genome.wustl.edu	37	22	18020346	18020346	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr22:18020346C>T	ENST00000400585.2	+	14	1690	c.1252C>T	c.(1252-1254)Cgc>Tgc	p.R418C	CECR2_ENST00000400573.5_Missense_Mutation_p.R559C|CECR2_ENST00000262608.8_Missense_Mutation_p.R560C			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	601					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GCCCCCCACACGCCGAGCGCC	0.627													ENSG00000099954																																					0													47.0	59.0	55.0					22																	18020346		1983	4139	6122	SO:0001583	missense	0			-	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1252C>T	22.37:g.18020346C>T	ENSP00000383428:p.Arg418Cys		A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R559C	ENST00000400585.2	37	c.1675		22	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855819	0.51376	.	.	ENSG00000099954	ENST00000400585;ENST00000400573;ENST00000262608	T;T;T	0.27104	1.81;1.81;1.69	5.95	5.95	0.96441	.	0.387908	0.22346	N	0.061261	T	0.33527	0.0866	L	0.59436	1.845	0.21782	N	0.999549	D;D;D	0.71674	0.995;0.998;0.998	B;P;P	0.47528	0.446;0.549;0.549	T	0.33343	-0.9872	10	0.56958	D	0.05	-15.8191	13.9729	0.64252	0.0:0.9224:0.0:0.0776	.	601;418;559	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	C	418;559;560	ENSP00000383428:R418C;ENSP00000383417:R559C;ENSP00000262608:R560C	ENSP00000262608:R560C	R	+	1	0	CECR2	16400346	0.685000	0.27652	0.393000	0.26258	0.095000	0.18619	3.163000	0.50763	2.826000	0.97356	0.491000	0.48974	CGC	-	CECR2	-	NULL		0.627	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	0	0	0	38	38	59	0.00	0.00	C	NM_031413		18020346	+1	13	18	21	35	tier1	no_errors	ENST00000400573	ensembl	human	novel	74_37	missense	38.24	33.96	SNP	0.152	T	13	21
FANCB	2187	genome.wustl.edu	37	X	14882869	14882869	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chrX:14882869G>A	ENST00000324138.3	-	2	917	c.764C>T	c.(763-765)tCt>tTt	p.S255F	FANCB_ENST00000398334.1_Missense_Mutation_p.S255F	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	255					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					GGCAATGAGAGATATTCTTAA	0.373								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				ENSG00000181544																																					0													89.0	84.0	86.0					X																	14882869		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.764C>T	X.37:g.14882869G>A	ENSP00000326819:p.Ser255Phe		B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	NULL	p.S255F	ENST00000324138.3	37	c.764	CCDS14161.1	X	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362711	0.61403	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	T;T;T	0.03607	3.87;3.87;3.87	5.43	5.43	0.79202	.	0.309649	0.36101	N	0.002794	T	0.16342	0.0393	M	0.71581	2.175	0.43368	D	0.99545	D	0.89917	1.0	D	0.91635	0.999	T	0.00045	-1.2218	10	0.72032	D	0.01	-19.2712	12.8276	0.57728	0.0803:0.0:0.9197:0.0	.	255	Q8NB91	FANCB_HUMAN	F	255	ENSP00000326819:S255F;ENSP00000381378:S255F;ENSP00000397849:S255F	ENSP00000326819:S255F	S	-	2	0	FANCB	14792790	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	3.891000	0.56227	2.408000	0.81797	0.513000	0.50165	TCT	-	FANCB	-	NULL		0.373	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	0	0	0	40	40	79	0.00	0.00	G	NM_152633		14882869	-1	7	13	37	63	tier1	no_errors	ENST00000324138	ensembl	human	known	74_37	missense	15.56	17.11	SNP	1.000	A	7	37
PPARGC1B	133522	genome.wustl.edu	37	5	149216579	149216579	+	Nonsense_Mutation	SNP	C	C	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr5:149216579C>G	ENST00000309241.5	+	8	2593	c.2561C>G	c.(2560-2562)tCa>tGa	p.S854*	PPARGC1B_ENST00000360453.4_Nonsense_Mutation_p.S815*|PPARGC1B_ENST00000394320.3_Nonsense_Mutation_p.S854*|PPARGC1B_ENST00000403750.1_Nonsense_Mutation_p.S790*	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	854					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CGCAGCCGCTCAAGCTCTGGC	0.627													ENSG00000155846																																					0													63.0	69.0	67.0					5																	149216579		2203	4300	6503	SO:0001587	stop_gained	0			-	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2561C>G	5.37:g.149216579C>G	ENSP00000312649:p.Ser854*		A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S854*	ENST00000309241.5	37	c.2561	CCDS4298.1	5	.	.	.	.	.	.	.	.	.	.	C	40	8.295862	0.98747	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	.	.	.	5.8	5.8	0.92144	.	0.208573	0.34025	N	0.004339	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-27.64	18.2397	0.89963	0.0:1.0:0.0:0.0	.	.	.	.	X	815;854;854;790	.	ENSP00000312649:S854X	S	+	2	0	PPARGC1B	149196772	1.000000	0.71417	0.991000	0.47740	0.956000	0.61745	5.443000	0.66581	2.747000	0.94245	0.462000	0.41574	TCA	-	PPARGC1B	-	NULL		0.627	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1	0	0	0	43	43	24	0.00	0.00	C	NM_133263		149216579	+1	9	9	25	11	tier1	no_errors	ENST00000309241	ensembl	human	known	74_37	nonsense	26.47	45.00	SNP	0.998	G	9	25
PADI3	51702	genome.wustl.edu	37	1	17588628	17588628	+	Splice_Site	SNP	G	G	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr1:17588628G>T	ENST00000375460.3	+	3	314	c.274G>T	c.(274-276)Gtt>Ttt	p.V92F		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	92					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CTCTCCACAGGTTCAGATTTC	0.582													ENSG00000142619																																					0													70.0	59.0	63.0					1																	17588628		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.274-1G>T	1.37:g.17588628G>T			Q58EY7|Q70SX5	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.V92F	ENST00000375460.3	37	c.274	CCDS179.1	1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.915336	0.52546	.	.	ENSG00000142619	ENST00000375460	T	0.16073	2.37	5.08	4.16	0.48862	Cupredoxin (1);Protein-arginine deiminase (PAD) N-terminal (1);	0.238077	0.36374	N	0.002628	T	0.20981	0.0505	M	0.77616	2.38	0.80722	D	1	B	0.10296	0.003	B	0.17098	0.017	T	0.03384	-1.1042	9	.	.	.	-7.2539	9.9531	0.41651	0.0944:0.0:0.9056:0.0	.	92	Q9ULW8	PADI3_HUMAN	F	92	ENSP00000364609:V92F	.	V	+	1	0	PADI3	17461215	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	2.220000	0.42908	2.376000	0.81061	0.563000	0.77884	GTT	-	PADI3	-	pfam_PAD_N,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub		0.582	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI3	HGNC	protein_coding	OTTHUMT00000006805.1	0	0	0	41	41	75	0.00	0.00	G		Missense_Mutation	17588628	+1	12	20	32	41	tier1	no_errors	ENST00000375460	ensembl	human	known	74_37	missense	27.27	32.79	SNP	1.000	T	12	32
TSSK1B	83942	genome.wustl.edu	37	5	112769636	112769636	+	Missense_Mutation	SNP	C	C	T	rs371461523		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr5:112769636C>T	ENST00000390666.3	-	1	1092	c.901G>A	c.(901-903)Gaa>Aaa	p.E301K	CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000416046.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA|MCC_ENST00000408903.3_Intron	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	301					multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		GAGCCAGGTTCGGGGGTCCAC	0.622													ENSG00000212122	C|||	1	0.000199681	0.0	0.0	5008	,	,		17425	0.0		0.0	False		,,,				2504	0.001																0								C	,LYS/GLU	0,4180		0,0,2090	35.0	39.0	38.0		,901	0.9	0.1	5		38	1,8489		0,1,4244	no	intron,missense	MCC,TSSK1B	NM_001085377.1,NM_032028.3	,56	0,1,6334	TT,TC,CC		0.0118,0.0,0.0079	,benign	,301/368	112769636	1,12669	2090	4245	6335	SO:0001583	missense	0			-	AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.901G>A	5.37:g.112769636C>T	ENSP00000375081:p.Glu301Lys		B2R8D9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E301K	ENST00000390666.3	37	c.901	CCDS4112.1	5	.	.	.	.	.	.	.	.	.	.	C	6.540	0.467956	0.12402	0.0	1.18E-4	ENSG00000212122	ENST00000390666	T	0.68025	-0.3	0.9	0.9	0.19278	Protein kinase-like domain (1);	0.222293	0.22012	U	0.065853	T	0.35219	0.0924	N	0.08118	0	0.21697	N	0.999583	B	0.06786	0.001	B	0.01281	0.0	T	0.17018	-1.0383	10	0.08381	T	0.77	.	4.9573	0.14048	0.0:1.0:0.0:0.0	.	301	Q9BXA7	TSSK1_HUMAN	K	301	ENSP00000375081:E301K	ENSP00000375081:E301K	E	-	1	0	TSSK1B	112797535	0.001000	0.12720	0.050000	0.19076	0.051000	0.14879	-0.332000	0.07904	0.308000	0.22923	0.313000	0.20887	GAA	-	TSSK1B	-	superfamily_Kinase-like_dom		0.622	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK1B	HGNC	protein_coding	OTTHUMT00000250774.2	0	0	0	33	33	76	0.00	0.00	C	NM_032028		112769636	-1	6	12	25	33	tier1	no_errors	ENST00000390666	ensembl	human	known	74_37	missense	19.35	26.67	SNP	0.590	T	6	25
KCNK9	51305	genome.wustl.edu	37	8	140631178	140631178	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr8:140631178G>C	ENST00000520439.1	-	2	511	c.448C>G	c.(448-450)Cgc>Ggc	p.R150G	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Missense_Mutation_p.R150G	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	150					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.R150C(1)		NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	TCAGTGTTGCGCATGCCACAG	0.597													ENSG00000169427																																					1	Substitution - Missense(1)	endometrium(1)											125.0	100.0	109.0					8																	140631178		2203	4300	6503	SO:0001583	missense	0			-	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.448C>G	8.37:g.140631178G>C	ENSP00000430676:p.Arg150Gly		Q2M290|Q540F2	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl_TASK,prints_KCNK9,prints_2pore_dom_K_chnl	p.R150G	ENST00000520439.1	37	c.448	CCDS6377.1	8	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055410	0.55325	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.24350	1.86;1.86;1.86	5.85	4.94	0.65067	.	0.061993	0.64402	D	0.000002	T	0.40145	0.1105	M	0.76838	2.35	0.46437	D	0.999046	P	0.42123	0.771	P	0.47430	0.547	T	0.31223	-0.9951	10	0.62326	D	0.03	.	13.2389	0.59985	0.0:0.0:0.6745:0.3255	.	150	Q9NPC2	KCNK9_HUMAN	G	150	ENSP00000429847:R150G;ENSP00000302166:R150G;ENSP00000430676:R150G	ENSP00000302166:R150G	R	-	1	0	KCNK9	140700360	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.798000	0.38814	2.753000	0.94483	0.655000	0.94253	CGC	-	KCNK9	-	pirsf_2pore_dom_K_chnl_TASK		0.597	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK9	HGNC	protein_coding	OTTHUMT00000378473.1	0	0	0	55	55	33	0.00	0.00	G	NM_016601		140631178	-1	6	6	29	29	tier1	no_errors	ENST00000303015	ensembl	human	known	74_37	missense	17.14	17.14	SNP	1.000	C	6	29
LRRC30	339291	genome.wustl.edu	37	18	7231229	7231229	+	Silent	SNP	C	C	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr18:7231229C>T	ENST00000383467.2	+	1	107	c.93C>T	c.(91-93)gaC>gaT	p.D31D		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	31										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CTCCGTGGGACGATGCCCTGC	0.617													ENSG00000206422																																					0													68.0	74.0	72.0					18																	7231229		1985	4155	6140	SO:0001819	synonymous_variant	0			-		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.93C>T	18.37:g.7231229C>T				Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.D31	ENST00000383467.2	37	c.93	CCDS42409.1	18																																																																																			-	LRRC30	-	NULL		0.617	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC30	HGNC	protein_coding	OTTHUMT00000442140.1	0	0	0	33	33	86	0.00	0.00	C	XM_292678		7231229	+1	5	21	13	53	tier1	no_errors	ENST00000383467	ensembl	human	known	74_37	silent	27.78	28.38	SNP	0.033	T	5	13
MPPED1	758	genome.wustl.edu	37	22	43831030	43831030	+	Silent	SNP	A	A	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr22:43831030A>C	ENST00000417669.2	+	3	745	c.301A>C	c.(301-303)Agg>Cgg	p.R101R	MPPED1_ENST00000542779.1_Silent_p.R101R|MPPED1_ENST00000538182.1_Silent_p.R134R|MPPED1_ENST00000414469.2_5'UTR|MPPED1_ENST00000439548.1_Intron|MPPED1_ENST00000443721.1_Silent_p.R101R			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	101							hydrolase activity (GO:0016787)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				TACCCACTCGAGGACGGACCC	0.632													ENSG00000186732																																					0													107.0	123.0	118.0					22																	43831030		2132	4225	6357	SO:0001819	synonymous_variant	0			-	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.301A>C	22.37:g.43831030A>C			A8K159|B7Z2S9|Q8N361	Silent	SNP	pfam_PEstase_dom	p.R134	ENST00000417669.2	37	c.400	CCDS46723.1	22																																																																																			-	MPPED1	-	NULL		0.632	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPPED1	HGNC	protein_coding	OTTHUMT00000318938.2	0	0	0	83	83	55	0.00	0.00	A	NM_001044370		43831030	+1	51	72	31	43	tier1	no_errors	ENST00000538182	ensembl	human	known	74_37	silent	62.20	62.61	SNP	0.921	C	51	31
GLIPR1L2	144321	genome.wustl.edu	37	12	75824639	75824639	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr12:75824639C>T	ENST00000550916.1	+	6	780	c.733C>T	c.(733-735)Cgg>Tgg	p.R245W	GLIPR1L2_ENST00000441218.1_Missense_Mutation_p.R180W|GLIPR1L2_ENST00000435775.1_3'UTR|GLIPR1L2_ENST00000378692.3_Missense_Mutation_p.R138W	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	245						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						GGAAATGCCCCGGCCAGTTGT	0.343													ENSG00000180481																																					0																																										SO:0001583	missense	0			-	BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.733C>T	12.37:g.75824639C>T	ENSP00000448248:p.Arg245Trp		Q6MZS1|Q8N6N0|Q8NA43	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.R245W	ENST00000550916.1	37	c.733	CCDS58258.1	12	.	.	.	.	.	.	.	.	.	.	C	22.1	4.242301	0.79912	.	.	ENSG00000180481	ENST00000550916;ENST00000378692;ENST00000441218	T;T;T	0.14391	3.02;2.51;2.69	5.48	5.48	0.80851	.	0.372474	0.23032	N	0.052739	T	0.38506	0.1043	.	.	.	0.32150	N	0.584337	D	0.89917	1.0	D	0.91635	0.999	T	0.49244	-0.8960	9	0.87932	D	0	.	14.8504	0.70292	0.0:1.0:0.0:0.0	.	245	Q4G1C9	GRPL2_HUMAN	W	245;138;180	ENSP00000448248:R245W;ENSP00000367963:R138W;ENSP00000405273:R180W	ENSP00000367963:R138W	R	+	1	2	GLIPR1L2	74110906	0.993000	0.37304	0.999000	0.59377	0.877000	0.50540	1.299000	0.33424	2.551000	0.86045	0.650000	0.86243	CGG	-	GLIPR1L2	-	NULL		0.343	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR1L2	HGNC	protein_coding	OTTHUMT00000405718.1	0	0	0	140	140	83	0.00	0.00	C	NM_152436		75824639	+1	27	26	87	83	tier1	no_errors	ENST00000550916	ensembl	human	known	74_37	missense	23.68	23.85	SNP	1.000	T	27	87
ACO1	48	genome.wustl.edu	37	9	32418329	32418329	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr9:32418329G>A	ENST00000309951.6	+	6	616	c.478G>A	c.(478-480)Ggt>Agt	p.G160S	ACO1_ENST00000379923.1_Missense_Mutation_p.G160S|ACO1_ENST00000541043.1_Missense_Mutation_p.G61S	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	160					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		ATCCCAGTGGGGTTCCCAGGC	0.478													ENSG00000122729																																					0													59.0	62.0	61.0					9																	32418329		2203	4300	6503	SO:0001583	missense	0			-	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.478G>A	9.37:g.32418329G>A	ENSP00000309477:p.Gly160Ser		D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.G160S	ENST00000309951.6	37	c.478	CCDS6525.1	9	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505548	0.85282	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921;ENST00000541043	T;T;T	0.44482	0.92;0.92;0.92	6.08	5.18	0.71444	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.000000	0.85682	D	0.000000	T	0.63546	0.2520	M	0.70595	2.14	0.80722	D	1	D	0.69078	0.997	D	0.77557	0.99	T	0.67971	-0.5532	10	0.87932	D	0	-20.9153	14.4409	0.67318	0.0715:0.0:0.9285:0.0	.	160	P21399	ACOC_HUMAN	S	196;160;160;160;61	ENSP00000309477:G160S;ENSP00000369255:G160S;ENSP00000438733:G61S	ENSP00000309477:G160S	G	+	1	0	ACO1	32408329	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.760000	0.62235	1.584000	0.49913	0.655000	0.94253	GGT	-	ACO1	-	pfam_Acoase/IPM_deHydtase_lsu_aba,superfamily_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2		0.478	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO1	HGNC	protein_coding	OTTHUMT00000051998.3	0	0	0	143	143	125	0.00	0.00	G	NM_002197		32418329	+1	20	22	78	96	tier1	no_errors	ENST00000309951	ensembl	human	known	74_37	missense	20.20	18.64	SNP	1.000	A	20	78
PRKG1	5592	genome.wustl.edu	37	10	52834636	52834636	+	Intron	SNP	C	C	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr10:52834636C>A	ENST00000401604.2	+	2	460				PRKG1_ENST00000373980.4_Missense_Mutation_p.L96M|PRKG1_ENST00000373985.1_Intron			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CCATGTGACCCTGCCCTTCTA	0.672													ENSG00000185532																																					0													174.0	126.0	142.0					10																	52834636		2203	4300	6503	SO:0001627	intron_variant	0			-		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.267-78288C>A	10.37:g.52834636C>A			A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom	p.L96M	ENST00000401604.2	37	c.286	CCDS44399.1	10	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473844	0.84640	.	.	ENSG00000185532	ENST00000373980	D	0.86627	-2.15	5.47	5.47	0.80525	.	0.090958	0.45867	D	0.000333	D	0.91229	0.7236	M	0.62723	1.935	0.80722	D	1	P	0.43633	0.813	P	0.55455	0.776	D	0.91255	0.5032	10	0.59425	D	0.04	-5.4253	17.1675	0.86820	0.0:1.0:0.0:0.0	.	96	Q13976-2	.	M	96	ENSP00000363092:L96M	ENSP00000363092:L96M	L	+	1	2	PRKG1	52504642	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.129000	0.77225	2.720000	0.93068	0.655000	0.94253	CTG	-	PRKG1	-	pirsf_cGMP-dependent_protein_kinase,superfamily_cNMP-bd-like		0.672	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		0	0	0	107	107	38	0.00	0.00	C			52834636	+1	23	13	53	21	tier1	no_errors	ENST00000373980	ensembl	human	known	74_37	missense	30.26	38.24	SNP	1.000	A	23	53
C2orf44	80304	genome.wustl.edu	37	2	24262326	24262326	+	Silent	SNP	C	C	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr2:24262326C>G	ENST00000295148.4	-	2	96	c.39G>C	c.(37-39)ctG>ctC	p.L13L	C2orf44_ENST00000406895.3_Silent_p.L13L	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	13									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAACGCATTCAGTCCAGTCC	0.453			T	ALK	NSCLC								ENSG00000163026																												Dom	yes		2	2p23.3	80304	chromosome 2 open reading frame 44		E	0													82.0	75.0	77.0					2																	24262326		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.39G>C	2.37:g.24262326C>G			D6W532|Q8IYK0|Q9HBP5	Silent	SNP	NULL	p.L13	ENST00000295148.4	37	c.39	CCDS1705.1	2																																																																																			-	C2orf44	-	NULL		0.453	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C2orf44	HGNC	protein_coding	OTTHUMT00000246825.1	0	0	0	34	34	113	0.00	0.00	C	NM_025203		24262326	-1	8	22	18	64	tier1	no_errors	ENST00000295148	ensembl	human	known	74_37	silent	30.77	25.58	SNP	0.998	G	8	18
EEA1	8411	genome.wustl.edu	37	12	93196420	93196420	+	Missense_Mutation	SNP	T	T	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr12:93196420T>G	ENST00000322349.8	-	19	2694	c.2430A>C	c.(2428-2430)aaA>aaC	p.K810N		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	810			K -> Q (in dbSNP:rs10745623). {ECO:0000269|PubMed:7768953, ECO:0000269|Ref.2}.		early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						GTTTCAGGATTTTTTTTTCTT	0.313													ENSG00000102189																																					0													73.0	69.0	70.0					12																	93196420		2201	4296	6497	SO:0001583	missense	0			-	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.2430A>C	12.37:g.93196420T>G	ENSP00000317955:p.Lys810Asn		Q14221	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.K810N	ENST00000322349.8	37	c.2430	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	T	1.763	-0.486303	0.04352	.	.	ENSG00000102189	ENST00000322349	T	0.77358	-1.09	5.65	-4.89	0.03103	.	1.398190	0.04950	N	0.460191	T	0.48840	0.1522	N	0.03608	-0.345	0.09310	N	1	B	0.17667	0.023	B	0.11329	0.006	T	0.28235	-1.0050	10	0.25106	T	0.35	.	3.1522	0.06492	0.3136:0.0638:0.3714:0.2511	.	810	Q15075	EEA1_HUMAN	N	810	ENSP00000317955:K810N	ENSP00000317955:K810N	K	-	3	2	EEA1	91720551	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.002000	0.12924	-0.620000	0.05641	0.459000	0.35465	AAA	-	EEA1	-	NULL		0.313	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	HGNC	protein_coding	OTTHUMT00000407304.1	0	0	0	25	25	28	0.00	0.00	T	NM_003566		93196420	-1	9	21	22	67	tier1	no_errors	ENST00000322349	ensembl	human	known	74_37	missense	29.03	23.86	SNP	0.000	G	9	22
FOCAD	54914	genome.wustl.edu	37	9	20789525	20789525	+	Missense_Mutation	SNP	A	A	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr9:20789525A>C	ENST00000380249.1	+	13	1737	c.1373A>C	c.(1372-1374)cAc>cCc	p.H458P	FOCAD_ENST00000338382.6_Missense_Mutation_p.H458P|SNORA30_ENST00000365319.1_RNA	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	458						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											CTGCTGGCTCACCTCCTTGTT	0.463													ENSG00000188352																																					0													141.0	130.0	134.0					9																	20789525		2203	4300	6503	SO:0001583	missense	0			-	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.1373A>C	9.37:g.20789525A>C	ENSP00000369599:p.His458Pro		D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.H458P	ENST00000380249.1	37	c.1373	CCDS34993.1	9	.	.	.	.	.	.	.	.	.	.	A	14.83	2.652677	0.47362	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.06933	3.24;3.24	5.71	5.71	0.89125	.	0.399491	0.27586	N	0.018715	T	0.06917	0.0176	N	0.14661	0.345	0.40919	D	0.98429	B	0.33448	0.412	B	0.34722	0.188	T	0.42982	-0.9419	10	0.45353	T	0.12	-24.1523	14.5549	0.68094	1.0:0.0:0.0:0.0	.	458	Q5VW36	K1797_HUMAN	P	458	ENSP00000369599:H458P;ENSP00000344307:H458P	ENSP00000344307:H458P	H	+	2	0	KIAA1797	20779525	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.979000	0.70508	2.178000	0.69098	0.533000	0.62120	CAC	-	FOCAD	-	NULL		0.463	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	0	0	0	48	48	110	0.00	0.00	A	NM_017794		20789525	+1	12	21	30	47	tier1	no_errors	ENST00000338382	ensembl	human	known	74_37	missense	28.57	30.88	SNP	0.999	C	12	30
SEZ6L2	26470	genome.wustl.edu	37	16	29906619	29906619	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr16:29906619G>A	ENST00000308713.5	-	5	1341	c.814C>T	c.(814-816)Cgg>Tgg	p.R272W	SEZ6L2_ENST00000562159.1_5'UTR|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.R202W|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R228W|SEZ6L2_ENST00000346932.5_Intron	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	272	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTTGGGACCCGTGGGCTCTGG	0.607													ENSG00000174938																																					0													78.0	84.0	82.0					16																	29906619		2197	4300	6497	SO:0001583	missense	0			-	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.814C>T	16.37:g.29906619G>A	ENSP00000312550:p.Arg272Trp		B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R272W	ENST00000308713.5	37	c.814	CCDS10659.1	16	.	.	.	.	.	.	.	.	.	.	g	21.6	4.178392	0.78564	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000537485	T;T;T	0.56776	0.44;0.44;0.44	5.36	5.36	0.76844	CUB (5);	0.000000	0.44285	D	0.000473	T	0.65729	0.2719	L	0.43152	1.355	0.39289	D	0.964701	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.70227	0.968;0.949;0.915;0.949;0.915	T	0.66280	-0.5963	10	0.44086	T	0.13	.	17.8708	0.88810	0.0:0.0:1.0:0.0	.	228;272;202;272;202	F5H293;B7Z5L4;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;SE6L2_HUMAN;.	W	202;272;228	ENSP00000310206:R202W;ENSP00000312550:R272W;ENSP00000439412:R228W	ENSP00000312550:R272W	R	-	1	2	SEZ6L2	29814120	0.840000	0.29493	0.405000	0.26409	0.878000	0.50629	3.623000	0.54224	2.521000	0.84997	0.586000	0.80456	CGG	-	SEZ6L2	-	superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.607	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	0	0	0	76	76	56	0.00	0.00	G	NM_012410		29906619	-1	13	14	52	46	tier1	no_errors	ENST00000308713	ensembl	human	known	74_37	missense	20.00	23.33	SNP	0.746	A	13	52
CPAMD8	27151	genome.wustl.edu	37	19	17088328	17088328	+	Silent	SNP	A	A	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr19:17088328A>T	ENST00000443236.1	-	15	1780	c.1749T>A	c.(1747-1749)gcT>gcA	p.A583A	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	536						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CGTCGACCTCAGCTTCTGGGG	0.592													ENSG00000160111																																					0													27.0	32.0	31.0					19																	17088328		1968	4149	6117	SO:0001819	synonymous_variant	0			-	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1749T>A	19.37:g.17088328A>T			Q8NC09|Q9ULD7	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.A583	ENST00000443236.1	37	c.1749	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	a	9.466	1.094314	0.20471	.	.	ENSG00000160111	ENST00000443236	T	0.70631	-0.5	2.62	-5.24	0.02789	.	.	.	.	.	T	0.55561	0.1928	.	.	.	0.33786	D	0.62482	.	.	.	.	.	.	T	0.55373	-0.8151	5	.	.	.	.	4.465	0.11685	0.3154:0.0:0.2819:0.4027	.	.	.	.	Q	594	ENSP00000402505:L594Q	.	L	-	2	0	CPAMD8	16949328	0.001000	0.12720	0.067000	0.19924	0.330000	0.28571	-1.679000	0.01940	-0.676000	0.05238	-0.635000	0.03985	CTG	-	CPAMD8	-	pfam_A2M_N_2		0.592	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	0	0	0	40	40	16	0.00	0.00	A	NM_015692		17088328	-1	5	9	15	14	tier1	no_errors	ENST00000443236	ensembl	human	known	74_37	silent	25.00	39.13	SNP	0.155	T	5	15
MYOCD	93649	genome.wustl.edu	37	17	12666808	12666808	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr17:12666808A>T	ENST00000343344.4	+	13	2664	c.2664A>T	c.(2662-2664)gaA>gaT	p.E888D	RP11-1090M7.1_ENST00000584772.1_RNA|MYOCD_ENST00000425538.1_Missense_Mutation_p.E936D			Q8IZQ8	MYCD_HUMAN	myocardin	888					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CTCCCTGGGAAACCATGGAGT	0.547													ENSG00000141052																																					0													76.0	67.0	70.0					17																	12666808		2203	4300	6503	SO:0001583	missense	0			-	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2664A>T	17.37:g.12666808A>T	ENSP00000341835:p.Glu888Asp		Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.E936D	ENST00000343344.4	37	c.2808	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	A	15.36	2.810454	0.50421	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000443061	T;T	0.34859	1.42;1.34	6.08	-1.34	0.09143	.	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	N	0.16862	0.45	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.96;0.998;0.996	T	0.04551	-1.0943	10	0.19147	T	0.46	-30.7458	12.4873	0.55881	0.4439:0.0:0.5561:0.0	.	612;936;888	E9PEP9;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	D	612;936;888;598	ENSP00000341835:E888D;ENSP00000400148:E598D	ENSP00000341835:E888D	E	+	3	2	MYOCD	12607533	0.998000	0.40836	0.993000	0.49108	0.936000	0.57629	0.689000	0.25437	-0.274000	0.09232	0.533000	0.62120	GAA	-	MYOCD	-	NULL		0.547	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1	0	0	0	43	43	63	0.00	0.00	A	NM_153604		12666808	+1	5	8	34	60	tier1	no_errors	ENST00000425538	ensembl	human	known	74_37	missense	12.82	11.76	SNP	0.998	T	5	34
PTPRT	11122	genome.wustl.edu	37	20	40735528	40735528	+	Silent	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr20:40735528G>A	ENST00000373187.1	-	24	3287	c.3288C>T	c.(3286-3288)gcC>gcT	p.A1096A	PTPRT_ENST00000356100.2_Silent_p.A1105A|PTPRT_ENST00000373201.1_Silent_p.A1086A|PTPRT_ENST00000373184.1_Silent_p.A1106A|PTPRT_ENST00000373190.1_Silent_p.A1095A|PTPRT_ENST00000373198.4_Silent_p.A1115A|PTPRT_ENST00000373193.3_Silent_p.A1099A			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1096	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.		A -> P (in a colorectal cancer). {ECO:0000269|PubMed:15155950}.		cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGGTGTCAATGGCAATGAAGC	0.587													ENSG00000196090																																					0													67.0	78.0	75.0					20																	40735528		2089	4241	6330	SO:0001819	synonymous_variant	0			-	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3288C>T	20.37:g.40735528G>A			A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.A1115	ENST00000373187.1	37	c.3345	CCDS42874.1	20																																																																																			-	PTPRT	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt		0.587	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	0	0	0	67	67	60	0.00	0.00	G			40735528	-1	16	20	41	39	tier1	no_errors	ENST00000373198	ensembl	human	known	74_37	silent	28.07	33.33	SNP	0.998	A	16	41
OR2G2	81470	genome.wustl.edu	37	1	247752530	247752530	+	Missense_Mutation	SNP	C	C	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr1:247752530C>A	ENST00000320065.1	+	1	869	c.869C>A	c.(868-870)cCt>cAt	p.P290H	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATGCTTAACCCTCTTATTTAT	0.403													ENSG00000177489																																					0													111.0	116.0	114.0					1																	247752530		2203	4300	6503	SO:0001583	missense	0			-	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.869C>A	1.37:g.247752530C>A	ENSP00000326349:p.Pro290His		Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P290H	ENST00000320065.1	37	c.869	CCDS31092.1	1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436552	0.43224	.	.	ENSG00000177489	ENST00000320065	T	0.64260	-0.09	4.29	3.38	0.38709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37219	U	0.002195	T	0.77110	0.4082	M	0.82132	2.575	0.30700	N	0.750446	D	0.89917	1.0	D	0.97110	1.0	T	0.76759	-0.2841	10	0.87932	D	0	.	9.7522	0.40483	0.0:0.8973:0.0:0.1027	.	290	Q8NGZ5	OR2G2_HUMAN	H	290	ENSP00000326349:P290H	ENSP00000326349:P290H	P	+	2	0	OR2G2	245819153	0.780000	0.28664	0.188000	0.23233	0.387000	0.30353	2.423000	0.44705	1.008000	0.39264	0.591000	0.81541	CCT	-	OR2G2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.403	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G2	HGNC	protein_coding	OTTHUMT00000097623.1	0	0	0	93	93	102	0.00	0.00	C			247752530	+1	16	29	43	64	tier1	no_errors	ENST00000320065	ensembl	human	known	74_37	missense	27.12	31.18	SNP	0.989	A	16	43
C6orf165	154313	genome.wustl.edu	37	6	88120317	88120317	+	Silent	SNP	C	C	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr6:88120317C>G	ENST00000507897.1	+	3	206	c.123C>G	c.(121-123)gtC>gtG	p.V41V	C6ORF165_ENST00000369562.4_Silent_p.V41V			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	41										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		AAGCTGTTGTCCTGGATCCAA	0.348													ENSG00000272514																																					0													151.0	146.0	148.0					6																	88120317		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.123C>G	6.37:g.88120317C>G			A8K969|E1P507|Q8N9U4	Silent	SNP	pfam_DUF3508	p.V41	ENST00000507897.1	37	c.123	CCDS34498.1	6																																																																																			-	C6ORF165	-	NULL		0.348	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	Uniprot_gn	protein_coding	OTTHUMT00000470406.1	0	0	0	93	93	114	0.00	0.00	C	NM_178823		88120317	+1	23	48	57	119	tier1	no_errors	ENST00000369562	ensembl	human	known	74_37	silent	28.75	28.74	SNP	0.863	G	23	57
COX16	51241	genome.wustl.edu	37	14	70795938	70795938	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr14:70795938C>T	ENST00000389912.6	-	3	300	c.157G>A	c.(157-159)Gaa>Aaa	p.E53K	SYNJ2BP-COX16_ENST00000555276.1_RNA|COX16_ENST00000557612.1_5'UTR	NM_016468.6	NP_057552.1	Q9P0S2	COX16_HUMAN	COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)	53						integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)				large_intestine(1)|lung(2)	3						AGTTTTTTTTCAAGCTCAGGA	0.294													ENSG00000133983																																					0													58.0	62.0	61.0					14																	70795938		2198	4285	6483	SO:0001583	missense	0			-	AF151037	CCDS9802.1	14q24.2	2013-05-10	2008-08-14	2008-06-23	ENSG00000133983	ENSG00000133983			20213	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 112"""	C14orf112		11042152, 15596615	Standard	NM_016468		Approved	HSPC203		Q9P0S2	OTTHUMG00000171238	ENST00000389912.6:c.157G>A	14.37:g.70795938C>T	ENSP00000374562:p.Glu53Lys		A6NDT5|A8K3X8	Missense_Mutation	SNP	NULL	p.E53K	ENST00000389912.6	37	c.157	CCDS9802.1	14	.	.	.	.	.	.	.	.	.	.	C	13.41	2.228296	0.39399	.	.	ENSG00000133983	ENST00000389912	.	.	.	3.65	3.65	0.41850	.	0.089265	0.42172	U	0.000760	T	0.66992	0.2846	L	0.55990	1.75	0.43448	D	0.995631	D	0.76494	0.999	D	0.74348	0.983	T	0.63265	-0.6676	9	0.30854	T	0.27	.	11.1727	0.48582	0.0:1.0:0.0:0.0	.	53	Q9P0S2	COX16_HUMAN	K	53	.	ENSP00000374562:E53K	E	-	1	0	COX16	69865691	1.000000	0.71417	0.997000	0.53966	0.078000	0.17371	3.475000	0.53136	2.355000	0.79922	0.467000	0.42956	GAA	-	COX16	-	NULL		0.294	COX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX16	HGNC	protein_coding	OTTHUMT00000412470.2	0	0	0	37	37	42	0.00	0.00	C	NM_016468		70795938	-1	8	12	28	62	tier1	no_errors	ENST00000389912	ensembl	human	known	74_37	missense	22.22	16.22	SNP	0.998	T	8	28
CFAP54	144535	genome.wustl.edu	37	12	97045392	97045392	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr12:97045392G>T	ENST00000524981.4	+	36	4922	c.4899G>T	c.(4897-4899)tgG>tgT	p.W1633C				Q96N23	CL055_HUMAN		0																	GTGGCTATTGGACTCTGCTTC	0.378													ENSG00000188596																																					0													141.0	127.0	132.0					12																	97045392		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000524981.4:c.4899G>T	12.37:g.97045392G>T	ENSP00000431759:p.Trp1633Cys			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.W1633C	ENST00000524981.4	37	c.4899		12	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355291	0.61293	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	4.92	4.92	0.64577	.	0.000000	0.53938	D	0.000057	T	0.78566	0.4303	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81123	-0.1076	9	0.87932	D	0	-6.0237	18.4959	0.90865	0.0:0.0:1.0:0.0	.	58	Q6ZTY8	CL063_HUMAN	C	1633;58	.	ENSP00000345466:W58C	W	+	3	0	C12orf63	95569523	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	6.568000	0.73987	2.450000	0.82876	0.655000	0.94253	TGG	-	C12orf55	-	NULL		0.378	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	0	0	0	225	225	146	0.00	0.00	G			97045392	+1	34	29	159	188	tier1	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	17.62	13.36	SNP	1.000	T	34	159
ATRX	546	genome.wustl.edu	37	X	76939959	76939959	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chrX:76939959C>T	ENST00000373344.5	-	9	1003	c.789G>A	c.(787-789)tgG>tgA	p.W263*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.W225*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	263	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.W263*(1)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TGTAGCAATACCATTGGTTGT	0.393			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	2	Substitution - Nonsense(1)|Unknown(1)	central_nervous_system(1)|bone(1)											160.0	148.0	152.0					X																	76939959		2203	4296	6499	SO:0001587	stop_gained	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.789G>A	X.37:g.76939959C>T	ENSP00000362441:p.Trp263*		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.W263*	ENST00000373344.5	37	c.789	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	38	6.856805	0.97889	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0559	18.4456	0.90682	0.0:1.0:0.0:0.0	.	.	.	.	X	263;225;219	.	ENSP00000362441:W263X	W	-	3	0	ATRX	76826615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.298000	0.77334	0.513000	0.50165	TGG	-	ATRX	-	superfamily_Znf_FYVE_PHD		0.393	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	119	119	118	0.00	0.00	C	NM_000489		76939959	-1	26	37	38	83	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	40.62	30.83	SNP	1.000	T	26	38
MYT1L	23040	genome.wustl.edu	37	2	1947094	1947094	+	Nonsense_Mutation	SNP	A	A	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr2:1947094A>T	ENST00000399161.2	-	9	912	c.165T>A	c.(163-165)tgT>tgA	p.C55*	MYT1L_ENST00000428368.2_Nonsense_Mutation_p.C55*	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	55					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCGCCAAGGGACAACCATATA	0.418													ENSG00000186487																																					0													38.0	32.0	34.0					2																	1947094		1855	4102	5957	SO:0001587	stop_gained	0			-	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.165T>A	2.37:g.1947094A>T	ENSP00000382114:p.Cys55*		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Nonsense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.C55*	ENST00000399161.2	37	c.165		2	.	.	.	.	.	.	.	.	.	.	A	43	10.011614	0.99317	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	.	.	.	5.4	-0.966	0.10320	.	0.055566	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.3157	11.1011	0.48174	0.7725:0.0:0.2275:0.0	.	.	.	.	X	55	.	ENSP00000295067:C55X	C	-	3	2	MYT1L	1926101	0.994000	0.37717	0.996000	0.52242	0.997000	0.91878	0.370000	0.20433	-0.117000	0.11872	0.455000	0.32223	TGT	-	MYT1L	-	pfam_Znf_C2HC		0.418	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	0	0	0	71	71	57	0.00	0.00	A	NM_015025		1947094	-1	22	18	36	23	tier1	no_errors	ENST00000399161	ensembl	human	known	74_37	nonsense	37.93	43.90	SNP	0.997	T	22	36
MLIP	90523	genome.wustl.edu	37	6	54002429	54002429	+	Intron	SNP	T	T	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr6:54002429T>G	ENST00000274897.5	+	4	725				MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000358276.5_Intron|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000502396.1_Missense_Mutation_p.M521R|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000514921.1_Missense_Mutation_p.M510R|MLIP_ENST00000370876.2_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein							nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						CTTGCTTCCATGAATGTAGAG	0.493													ENSG00000146147																																					0																																										SO:0001627	intron_variant	0			-	AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.613-11425T>G	6.37:g.54002429T>G			B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	NULL	p.M521R	ENST00000274897.5	37	c.1562	CCDS4954.1	6	.	.	.	.	.	.	.	.	.	.	T	0.055	-1.238248	0.01493	.	.	ENSG00000146147	ENST00000514921;ENST00000503951;ENST00000502396	T;T;T	0.42513	1.98;0.97;1.99	4.95	2.64	0.31445	.	.	.	.	.	T	0.12902	0.0313	.	.	.	0.09310	N	1	B;B;B	0.13145	0.002;0.007;0.007	B;B;B	0.17433	0.018;0.018;0.018	T	0.29701	-1.0003	8	0.56958	D	0.05	.	5.5583	0.17129	0.0:0.5891:0.0:0.4109	.	521;521;510	Q5VWP3-3;B7ZA42;D6RE05	.;.;.	R	510;469;521	ENSP00000425142:M510R;ENSP00000426830:M469R;ENSP00000426290:M521R	ENSP00000426290:M521R	M	+	2	0	MLIP	54110388	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.848000	0.27710	0.228000	0.21019	0.482000	0.46254	ATG	-	MLIP	-	NULL		0.493	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3	0	0	0	20	20	43	0.00	0.00	T	NM_138569		54002429	+1	4	8	15	55	tier1	no_errors	ENST00000502396	ensembl	human	putative	74_37	missense	21.05	12.70	SNP	0.001	G	4	15
OR51S1	119692	genome.wustl.edu	37	11	4869965	4869965	+	Silent	SNP	A	A	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:4869965A>G	ENST00000322101.2	-	1	549	c.474T>C	c.(472-474)ttT>ttC	p.F158F	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCAGGCATCGAAAAGAAATGG	0.547													ENSG00000176922																																					0													99.0	99.0	99.0					11																	4869965		2201	4298	6499	SO:0001819	synonymous_variant	0			-	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.474T>C	11.37:g.4869965A>G			B9EGZ1|Q6IFI2	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F158	ENST00000322101.2	37	c.474	CCDS31362.1	11																																																																																			-	OR51S1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.547	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51S1	HGNC	protein_coding	OTTHUMT00000142179.1	0	0	0	33	33	94	0.00	0.00	A	NM_001004758		4869965	-1	7	18	27	45	tier1	no_errors	ENST00000322101	ensembl	human	known	74_37	silent	20.00	27.69	SNP	0.000	G	7	27
UNC93B1	81622	genome.wustl.edu	37	11	67764078	67764078	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:67764078C>T	ENST00000227471.2	-	9	1160	c.1081G>A	c.(1081-1083)Gcc>Acc	p.A361T	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	362					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											CTTACCAAGGCGATACCAGTG	0.468													ENSG00000110057																																					0													42.0	46.0	44.0					11																	67764078		1608	3246	4854	SO:0001583	missense	0			-	AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1081G>A	11.37:g.67764078C>T	ENSP00000227471:p.Ala361Thr		O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.A361T	ENST00000227471.2	37	c.1081		11	.	.	.	.	.	.	.	.	.	.	.	6.734	0.504249	0.12822	.	.	ENSG00000110057	ENST00000227471	T	0.17528	2.27	5.09	0.839	0.18907	.	0.485095	0.24937	N	0.034415	T	0.04724	0.0128	N	0.03608	-0.345	0.29881	N	0.826041	B	0.09022	0.002	B	0.06405	0.002	T	0.41662	-0.9496	10	0.02654	T	1	-11.2904	5.3645	0.16105	0.1353:0.5329:0.0:0.3317	.	362	Q9H1C4	UN93B_HUMAN	T	361	ENSP00000227471:A361T	ENSP00000227471:A361T	A	-	1	0	UNC93B1	67520654	0.424000	0.25490	0.508000	0.27688	0.907000	0.53573	0.423000	0.21313	0.319000	0.23209	-0.224000	0.12420	GCC	-	UNC93B1	-	NULL		0.468	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding		0	0	0	20	20	102	0.00	0.00	C	NM_030930		67764078	-1	6	15	12	72	tier1	no_errors	ENST00000227471	ensembl	human	known	74_37	missense	33.33	17.24	SNP	0.773	T	6	12
GBP4	115361	genome.wustl.edu	37	1	89660991	89660991	+	Missense_Mutation	SNP	C	C	T	rs75750014		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr1:89660991C>T	ENST00000355754.6	-	3	449	c.352G>A	c.(352-354)Gat>Aat	p.D118N		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	118	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.D118N(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		TTTTCTACATCGCCCAGGCCC	0.493													ENSG00000162654																																					1	Substitution - Missense(1)	central_nervous_system(1)											113.0	107.0	109.0					1																	89660991		2203	4300	6503	SO:0001583	missense	0			-	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.352G>A	1.37:g.89660991C>T	ENSP00000359490:p.Asp118Asn		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.D118N	ENST00000355754.6	37	c.352	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434450	0.62955	.	.	ENSG00000162654	ENST00000355754	D	0.84944	-1.92	5.29	5.29	0.74685	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81259	0.4785	M	0.82056	2.57	0.41316	D	0.987147	B	0.28880	0.226	B	0.21546	0.035	T	0.82147	-0.0601	10	0.56958	D	0.05	.	16.4548	0.84008	0.0:1.0:0.0:0.0	.	118	Q96PP9	GBP4_HUMAN	N	118	ENSP00000359490:D118N	ENSP00000359490:D118N	D	-	1	0	GBP4	89433579	0.998000	0.40836	0.959000	0.39883	0.565000	0.35776	4.183000	0.58317	2.754000	0.94517	0.591000	0.81541	GAT	-	GBP4	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase		0.493	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	0	0	0	70	70	127	0.00	0.00	C	NM_052941		89660991	-1	28	13	42	81	tier1	no_errors	ENST00000355754	ensembl	human	known	74_37	missense	40.00	13.83	SNP	0.997	T	28	42
LPL	4023	genome.wustl.edu	37	8	19819651	19819651	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr8:19819651G>C	ENST00000311322.8	+	9	1818	c.1348G>C	c.(1348-1350)Gtg>Ctg	p.V450L		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	450	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	TAGGGAGAAAGTGTCTCATTT	0.433													ENSG00000175445																																					0													169.0	156.0	161.0					8																	19819651		2203	4300	6503	SO:0001583	missense	0			-		CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.1348G>C	8.37:g.19819651G>C	ENSP00000309757:p.Val450Leu		B2R5T9|Q16282|Q16283|Q96FC4	Missense_Mutation	SNP	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_Lipo_Lipase,prints_Lipase,pfscan_PLAT/LH2_dom,tigrfam_Lipo_Lipase	p.V450L	ENST00000311322.8	37	c.1348	CCDS6012.1	8	.	.	.	.	.	.	.	.	.	.	G	7.351	0.622850	0.14193	.	.	ENSG00000175445	ENST00000311322;ENST00000535763	T	0.65732	-0.17	5.89	3.75	0.43078	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.554019	0.20679	N	0.087682	T	0.46983	0.1421	L	0.36672	1.1	0.24403	N	0.994692	B	0.14438	0.01	B	0.13407	0.009	T	0.51092	-0.8749	8	.	.	.	-12.1342	7.5089	0.27562	0.294:0.0:0.706:0.0	.	450	P06858	LIPL_HUMAN	L	450;436	ENSP00000309757:V450L	.	V	+	1	0	LPL	19863931	0.481000	0.25941	0.195000	0.23364	0.840000	0.47671	1.813000	0.38962	1.458000	0.47871	0.655000	0.94253	GTG	-	LPL	-	pirsf_Lipoprotein_lipase_LIPH,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_Lipo_Lipase,pfscan_PLAT/LH2_dom,tigrfam_Lipo_Lipase		0.433	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPL	HGNC	protein_coding	OTTHUMT00000089113.3	0	0	0	33	33	106	0.00	0.00	G			19819651	+1	10	29	16	68	tier1	no_errors	ENST00000311322	ensembl	human	known	74_37	missense	38.46	29.90	SNP	0.140	C	10	16
ZDHHC4	55146	genome.wustl.edu	37	7	6621842	6621842	+	Silent	SNP	A	A	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr7:6621842A>G	ENST00000396706.2	+	5	773	c.330A>G	c.(328-330)gtA>gtG	p.V110V	ZDHHC4_ENST00000335965.6_Silent_p.V110V|AC079742.4_ENST00000434951.1_RNA|ZDHHC4_ENST00000396713.2_Silent_p.V110V|ZDHHC4_ENST00000396709.1_Silent_p.V110V|ZDHHC4_ENST00000396707.2_Silent_p.V110V|ZDHHC4_ENST00000405731.3_Silent_p.V110V			Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	110						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		TGCTAGGTGTAAACCTGTTTT	0.458													ENSG00000136247																																					0													271.0	242.0	252.0					7																	6621842		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF201931	CCDS5352.1	7p22.1	2011-01-11			ENSG00000136247	ENSG00000136247		"""Zinc fingers, DHHC-type"""	18471	protein-coding gene	gene with protein product							Standard	NM_018106		Approved	FLJ10479, ZNF374	uc003sqj.3	Q9NPG8	OTTHUMG00000023579	ENST00000396706.2:c.330A>G	7.37:g.6621842A>G			A4D2N9|Q53EV7|Q6FIB5|Q9H0R9	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Znf_DHHC_palmitoyltrfase	p.V110	ENST00000396706.2	37	c.330	CCDS5352.1	7																																																																																			-	ZDHHC4	-	NULL		0.458	ZDHHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC4	HGNC	protein_coding	OTTHUMT00000207477.3	0	0	0	96	96	117	0.00	0.00	A	NM_018106		6621842	+1	24	22	57	81	tier1	no_errors	ENST00000335965	ensembl	human	known	74_37	silent	29.63	21.36	SNP	0.630	G	24	57
DLX4	1748	genome.wustl.edu	37	17	48050587	48050587	+	Missense_Mutation	SNP	C	C	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr17:48050587C>A	ENST00000240306.3	+	2	729	c.434C>A	c.(433-435)cCc>cAc	p.P145H	DLX4_ENST00000411890.2_Missense_Mutation_p.P73H	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4	145					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						CTGGCGCTGCCCGAGAGGGCC	0.652													ENSG00000108813																																					0													30.0	31.0	31.0					17																	48050587		2203	4299	6502	SO:0001583	missense	0			-		CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.434C>A	17.37:g.48050587C>A	ENSP00000240306:p.Pro145His		D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.P145H	ENST00000240306.3	37	c.434	CCDS11555.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.095900	0.94197	.	.	ENSG00000108813	ENST00000240306;ENST00000411890	D;D	0.96104	-3.91;-3.91	4.88	4.88	0.63580	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.	.	.	.	D	0.96568	0.8880	L	0.48362	1.52	0.53688	D	0.99997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96893	0.9654	9	0.87932	D	0	-27.6266	15.9048	0.79419	0.0:1.0:0.0:0.0	.	73;145	Q92988-2;Q92988	.;DLX4_HUMAN	H	145;73	ENSP00000240306:P145H;ENSP00000410622:P73H	ENSP00000240306:P145H	P	+	2	0	DLX4	45405586	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.689000	0.68234	2.679000	0.91253	0.655000	0.94253	CCC	-	DLX4	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom		0.652	DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX4	HGNC	protein_coding	OTTHUMT00000366214.1	0	0	0	32	32	19	0.00	0.00	C			48050587	+1	13	3	26	13	tier1	no_errors	ENST00000240306	ensembl	human	known	74_37	missense	33.33	18.75	SNP	1.000	A	13	26
CYP4F11	57834	genome.wustl.edu	37	19	16034891	16034891	+	Splice_Site	SNP	T	T	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr19:16034891T>C	ENST00000402119.4	-	6	1075	c.649A>G	c.(649-651)Aag>Gag	p.K217E	CYP4F11_ENST00000326742.8_Splice_Site_p.K217E|CYP4F11_ENST00000591841.1_5'UTR|CYP4F11_ENST00000248041.8_Splice_Site_p.K217E	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						TCACTGGGCTTCCTGCATGAA	0.468													ENSG00000171903																																					0													79.0	78.0	78.0					19																	16034891		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.648-1A>G	19.37:g.16034891T>C				Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.K217E	ENST00000402119.4	37	c.649	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	t	14.78	2.636550	0.47049	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	T;T;T	0.78126	-1.15;-1.15;-0.17	2.52	1.4	0.22301	.	0.196102	0.30920	U	0.008606	T	0.69260	0.3091	N	0.16307	0.4	0.40355	D	0.979176	B;P	0.39250	0.088;0.665	B;P	0.51516	0.086;0.672	T	0.64041	-0.6500	10	0.42905	T	0.14	.	6.6353	0.22879	0.0:0.0:0.2443:0.7557	.	217;217	F8W978;Q9HBI6	.;CP4FB_HUMAN	E	217	ENSP00000384588:K217E;ENSP00000248041:K217E;ENSP00000319859:K217E	ENSP00000248041:K217E	K	-	1	0	CYP4F11	15895891	0.119000	0.22226	0.648000	0.29521	0.186000	0.23388	0.331000	0.19733	0.165000	0.19558	0.254000	0.18369	AAG	-	CYP4F11	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.468	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460385.2	0	0	0	63	63	75	0.00	0.00	T	NM_021187	Missense_Mutation	16034891	-1	9	7	43	45	tier1	no_errors	ENST00000248041	ensembl	human	known	74_37	missense	17.31	13.46	SNP	0.999	C	9	43
HK2	3099	genome.wustl.edu	37	2	75115175	75115175	+	Missense_Mutation	SNP	C	C	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr2:75115175C>G	ENST00000290573.2	+	16	2965	c.2365C>G	c.(2365-2367)Cag>Gag	p.Q789E	HK2_ENST00000409174.1_Missense_Mutation_p.Q761E	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	789	Catalytic.|Hexokinase type-2 2.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						GTTCTTGTCTCAGATTGAGAG	0.502													ENSG00000159399																																					0													101.0	97.0	99.0					2																	75115175		2203	4300	6503	SO:0001583	missense	0			-		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2365C>G	2.37:g.75115175C>G	ENSP00000290573:p.Gln789Glu		D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.Q789E	ENST00000290573.2	37	c.2365	CCDS1956.1	2	.	.	.	.	.	.	.	.	.	.	C	9.494	1.101376	0.20632	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.96104	-3.91;-3.91	4.72	4.72	0.59763	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90072	0.6899	N	0.13272	0.32	0.80722	D	1	P	0.51791	0.948	P	0.44897	0.463	D	0.88299	0.2948	10	0.10902	T	0.67	-28.6905	15.5668	0.76300	0.0:1.0:0.0:0.0	.	789	P52789	HXK2_HUMAN	E	789;789;761	ENSP00000290573:Q789E;ENSP00000387140:Q761E	ENSP00000290573:Q789E	Q	+	1	0	HK2	74968683	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.602000	0.82796	2.623000	0.88846	0.555000	0.69702	CAG	-	HK2	-	pfam_Hexokinase_C		0.502	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK2	HGNC	protein_coding	OTTHUMT00000252238.2	0	0	0	34	34	60	0.00	0.00	C	NM_000189		75115175	+1	6	18	17	44	tier1	no_errors	ENST00000290573	ensembl	human	known	74_37	missense	26.09	29.03	SNP	1.000	G	6	17
BEND2	139105	genome.wustl.edu	37	X	18189140	18189140	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chrX:18189140A>T	ENST00000380033.4	-	13	2298	c.2166T>A	c.(2164-2166)aaT>aaA	p.N722K	BEND2_ENST00000380030.3_Missense_Mutation_p.N631K	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	722	BEN 2. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						CACTAATCTTATTGGGGTCAA	0.413													ENSG00000177324																																					0													188.0	168.0	175.0					X																	18189140		2203	4300	6503	SO:0001583	missense	0			-	AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2166T>A	X.37:g.18189140A>T	ENSP00000369372:p.Asn722Lys		E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	pfam_BEN_domain	p.N722K	ENST00000380033.4	37	c.2166	CCDS14184.1	X	.	.	.	.	.	.	.	.	.	.	A	15.93	2.977693	0.53720	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	T;T	0.42513	0.97;0.97	5.49	0.0305	0.14167	BEN domain (2);	0.071372	0.52532	D	0.000070	T	0.58235	0.2108	M	0.76574	2.34	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.51576	-0.8688	10	0.87932	D	0	-24.7411	9.5493	0.39299	0.4202:0.0:0.5798:0.0	.	631;722	E9PFY2;Q8NDZ0	.;BEND2_HUMAN	K	722;631	ENSP00000369372:N722K;ENSP00000369369:N631K	ENSP00000369369:N631K	N	-	3	2	BEND2	18099061	0.002000	0.14202	0.001000	0.08648	0.004000	0.04260	-0.721000	0.04963	-0.039000	0.13602	-0.375000	0.07067	AAT	-	BEND2	-	pfam_BEN_domain		0.413	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND2	HGNC	protein_coding	OTTHUMT00000055940.1	0	0	0	63	63	140	0.00	0.00	A	NM_153346		18189140	-1	9	20	39	89	tier1	no_errors	ENST00000380033	ensembl	human	known	74_37	missense	18.75	18.35	SNP	0.030	T	9	39
PIK3CA	5290	genome.wustl.edu	37	3	178947220	178947220	+	Missense_Mutation	SNP	A	A	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr3:178947220A>G	ENST00000263967.3	+	18	2813	c.2656A>G	c.(2656-2658)Aaa>Gaa	p.K886E		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	886	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGACAAGAACAAAGGAGAAAT	0.388		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)			ENSG00000121879																									Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													86.0	80.0	82.0					3																	178947220		1899	4119	6018	SO:0001583	missense	0			-		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2656A>G	3.37:g.178947220A>G	ENSP00000263967:p.Lys886Glu		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.K886E	ENST00000263967.3	37	c.2656	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898034	0.72639	.	.	ENSG00000121879	ENST00000263967	T	0.75367	-0.93	5.52	4.35	0.52113	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	T	0.67031	0.2850	N	0.21142	0.635	0.58432	D	0.999999	P	0.41366	0.747	P	0.45913	0.497	T	0.66344	-0.5947	10	0.44086	T	0.13	-20.8969	12.6379	0.56692	0.8615:0.1385:0.0:0.0	.	886	P42336	PK3CA_HUMAN	E	886	ENSP00000263967:K886E	ENSP00000263967:K886E	K	+	1	0	PIK3CA	180429914	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.916000	0.75776	0.909000	0.36697	0.366000	0.22137	AAA	-	PIK3CA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.388	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	0	0	1	92	92	88	0.00	1.12	A			178947220	+1	18	25	93	104	tier1	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	16.22	19.38	SNP	1.000	G	18	93
TEAD4	7004	genome.wustl.edu	37	12	3121377	3121377	+	Silent	SNP	C	C	T	rs112112805		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr12:3121377C>T	ENST00000359864.2	+	5	523	c.333C>T	c.(331-333)cgC>cgT	p.R111R	TEAD4_ENST00000358409.2_Silent_p.R111R|TEAD4_ENST00000397122.2_5'UTR	NM_003213.3	NP_003204	Q15561	TEAD4_HUMAN	TEA domain family member 4	111					gene expression (GO:0010467)|hippo signaling (GO:0035329)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			GCAAAGCTCGCGAGATCCAGG	0.597													ENSG00000197905																																					0								C	,,	1,4405	2.1+/-5.4	0,1,2202	74.0	62.0	66.0		333,333,	-10.0	0.5	12	dbSNP_132	66	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,utr-5	TEAD4	NM_003213.3,NM_201441.2,NM_201443.2	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	111/435,111/392,	3121377	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	X94438	CCDS31729.1, CCDS31730.1, CCDS41737.1	12p13.3-p13.2	2008-05-14				ENSG00000197905			11717	protein-coding gene	gene with protein product		601714		TCF13L1		9889009, 8921372	Standard	NM_003213		Approved	TEF-3, TEFR-1, EFTR-2, RTEF-1	uc010sej.2	Q15561		ENST00000359864.2:c.333C>T	12.37:g.3121377C>T			H0Y308|Q6MZR9|Q8NEV5|Q92883|Q96BK2	Nonsense_Mutation	SNP	pfam_TEA/ATTS,smart_TEA/ATTS	p.R90*	ENST00000359864.2	37	c.268	CCDS31729.1	12	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151835	0.38021	2.27E-4	0.0	ENSG00000197905	ENST00000544666	.	.	.	4.98	-9.96	0.00443	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.994	2.5578	0.04764	0.1451:0.0981:0.25:0.5068	.	.	.	.	X	23	.	ENSP00000411475:R90X	R	+	1	2	TEAD4	2991638	0.001000	0.12720	0.461000	0.27105	0.083000	0.17756	-1.960000	0.01517	-2.421000	0.00563	-0.150000	0.13652	CGA	rs112112805	TEAD4	-	smart_TEA/ATTS		0.597	TEAD4-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	TEAD4	HGNC	protein_coding	OTTHUMT00000398475.1	0	0	0	33	33	75	0.00	0.00	C	NM_003213		3121377	+1	6	9	12	31	tier1	no_errors	ENST00000443986	ensembl	human	known	74_37	nonsense	33.33	22.50	SNP	0.094	T	6	12
CELP	1057	genome.wustl.edu	37	9	135961673	135961673	+	RNA	SNP	T	T	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr9:135961673T>C	ENST00000411440.2	+	0	508					NR_001275.2				carboxyl ester lipase pseudogene																		CTACCTGTTTTCCCATCCCTC	0.607													ENSG00000170827																																					0																																												0			-	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135961673T>C				R	SNP	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	CELP	-	-		0.607	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	0	0	0	21	21	53	0.00	0.00	T	NM_001808		135961673	+1	6	9	27	40	tier1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	18.18	18.37	SNP	1.000	C	6	27
MUC16	94025	genome.wustl.edu	37	19	9070223	9070223	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr19:9070223G>T	ENST00000397910.4	-	3	17426	c.17223C>A	c.(17221-17223)caC>caA	p.H5741Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5743	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTTGGATGTGTGTGAATCAG	0.478													ENSG00000181143																																					0													149.0	144.0	146.0					19																	9070223		2077	4210	6287	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17223C>A	19.37:g.9070223G>T	ENSP00000381008:p.His5741Gln		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.H5741Q	ENST00000397910.4	37	c.17223	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.770	-0.766094	0.02974	.	.	ENSG00000181143	ENST00000397910	T	0.20069	2.1	1.72	-3.45	0.04781	.	.	.	.	.	T	0.06554	0.0168	N	0.02011	-0.69	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.30297	-0.9983	8	0.87932	D	0	.	3.7408	0.08528	0.0:0.2951:0.4049:0.3	.	5741	B5ME49	.	Q	5741	ENSP00000381008:H5741Q	ENSP00000381008:H5741Q	H	-	3	2	MUC16	8931223	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.593000	0.05740	-0.936000	0.03723	-2.291000	0.00267	CAC	-	MUC16	-	NULL		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	183	183	93	0.00	0.00	G	NM_024690		9070223	-1	22	9	122	66	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	15.28	12.00	SNP	0.000	T	22	122
KIAA1731	85459	genome.wustl.edu	37	11	93456287	93456287	+	Missense_Mutation	SNP	A	A	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:93456287A>G	ENST00000325212.6	+	21	6190	c.6028A>G	c.(6028-6030)Ata>Gta	p.I2010V	SCARNA9_ENST00000364329.1_RNA|SCARNA9_ENST00000530422.1_RNA|SCARNA9_ENST00000362805.1_RNA|KIAA1731_ENST00000344196.4_Missense_Mutation_p.I190V|KIAA1731_ENST00000411936.1_Missense_Mutation_p.I2010V|KIAA1731_ENST00000531700.1_Missense_Mutation_p.I190V			Q9C0D2	K1731_HUMAN	KIAA1731	2010						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TATAAGTTCCATAGTTCCTTC	0.378													ENSG00000166004																																					0													87.0	73.0	77.0					11																	93456287		692	1591	2283	SO:0001583	missense	0			-	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.6028A>G	11.37:g.93456287A>G	ENSP00000316681:p.Ile2010Val		C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.I2010V	ENST00000325212.6	37	c.6028	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.505060	0.00155	.	.	ENSG00000166004	ENST00000325212;ENST00000411936;ENST00000344196;ENST00000531700;ENST00000531404	T;T	0.08634	3.08;3.07	4.14	-8.28	0.01013	.	1.430830	0.04284	N	0.344339	T	0.04952	0.0133	N	0.17082	0.46	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.36792	-0.9733	10	0.12103	T	0.63	0.2874	13.5395	0.61666	0.156:0.0:0.7266:0.1173	.	2010;2010;190	Q9C0D2;Q9C0D2-3;Q9C0D2-2	K1731_HUMAN;.;.	V	2010;2010;190;190;22	ENSP00000316681:I2010V;ENSP00000406505:I2010V	ENSP00000316681:I2010V	I	+	1	0	KIAA1731	93095935	0.000000	0.05858	0.000000	0.03702	0.212000	0.24457	-2.404000	0.01045	-2.032000	0.00926	-1.155000	0.01812	ATA	-	KIAA1731	-	NULL		0.378	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	0	0	0	23	23	71	0.00	0.00	A	NM_033395		93456287	+1	5	29	14	60	tier1	no_errors	ENST00000411936	ensembl	human	known	74_37	missense	26.32	32.58	SNP	0.000	G	5	14
MRC1	4360	genome.wustl.edu	37	10	17875749	17875749	+	Missense_Mutation	SNP	T	T	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr10:17875749T>C	ENST00000331429.2	+	4	816	c.713T>C	c.(712-714)tTa>tCa	p.L238S	MRC1L1_ENST00000457317.1_Missense_Mutation_p.L238S																breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AAATCCGCTTTAACGTGGCAC	0.468													ENSG00000183748																																					0													89.0	81.0	84.0					10																	17875749		1964	3896	5860	SO:0001583	missense	0			-																												ENST00000331429.2:c.713T>C	10.37:g.17875749T>C	ENSP00000332124:p.Leu238Ser			Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_Ricin_B_lectin,superfamily_C-type_lectin_fold,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.L238S	ENST00000331429.2	37	c.713		10	.	.	.	.	.	.	.	.	.	.	T	15.89	2.967148	0.53507	.	.	ENSG00000183748	ENST00000331429;ENST00000457317	T;T	0.19806	2.12;2.12	4.25	4.25	0.50352	.	0.000000	0.42682	U	0.000662	T	0.47021	0.1423	.	.	.	0.40803	D	0.983358	D	0.89917	1.0	D	0.97110	1.0	T	0.62835	-0.6770	8	0.87932	D	0	-7.6466	13.7063	0.62641	0.0:0.0:0.0:1.0	.	238	B9EJA8	.	S	238	ENSP00000332124:L238S;ENSP00000391843:L238S	ENSP00000332124:L238S	L	+	2	0	AL928580.1	17915755	1.000000	0.71417	0.952000	0.39060	0.172000	0.22775	7.968000	0.87980	1.707000	0.51288	0.451000	0.29950	TTA	-	MRC1L1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.468	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	101928757	Clone_based_vega_gene	protein_coding	OTTHUMT00000047054.1	0	0	1	99	99	109	0.00	0.91	T			17875749	+1	14	18	51	53	tier1	no_errors	ENST00000457317	ensembl	human	known	74_37	missense	21.54	25.35	SNP	1.000	C	14	51
SIRT3	23410	genome.wustl.edu	37	11	218993	218993	+	Nonsense_Mutation	SNP	G	G	A	rs199874973		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:218993G>A	ENST00000382743.4	-	6	1120	c.1018C>T	c.(1018-1020)Cga>Tga	p.R340*	SIRT3_ENST00000524564.1_Nonsense_Mutation_p.R276*|SIRT3_ENST00000532956.1_Nonsense_Mutation_p.R286*|SIRT3_ENST00000529382.1_Nonsense_Mutation_p.R198*|SIRT3_ENST00000525319.1_Nonsense_Mutation_p.R259*	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	340	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		ATGAGCAGTCGGGGAACTGAG	0.622													ENSG00000142082																																					0													53.0	50.0	51.0					11																	218993		2203	4300	6503	SO:0001587	stop_gained	0			-	AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.1018C>T	11.37:g.218993G>A	ENSP00000372191:p.Arg340*		B7Z5U6|Q9Y6E8	Nonsense_Mutation	SNP	pfam_Sirtuin,pirsf_D-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom	p.R340*	ENST00000382743.4	37	c.1018	CCDS7691.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.959209	0.97145	.	.	ENSG00000142082	ENST00000382743;ENST00000525319;ENST00000524564;ENST00000532956;ENST00000529382	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.0679	17.833	0.88688	0.0:0.0:1.0:0.0	.	.	.	.	X	340;259;276;286;198	.	ENSP00000372191:R340X	R	-	1	2	SIRT3	208993	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.805000	0.99149	2.543000	0.85770	0.555000	0.69702	CGA	rs199874973	SIRT3	-	pirsf_D-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom		0.622	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	HGNC	protein_coding	OTTHUMT00000239288.3	0	0	0	72	72	34	0.00	0.00	G			218993	-1	8	8	38	31	tier1	no_errors	ENST00000382743	ensembl	human	known	74_37	nonsense	17.39	20.51	SNP	1.000	A	8	38
GABRA5	2558	genome.wustl.edu	37	15	27188460	27188460	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr15:27188460G>A	ENST00000335625.5	+	10	1864	c.976G>A	c.(976-978)Gtg>Atg	p.V326M	GABRA5_ENST00000400081.3_Missense_Mutation_p.V326M|GABRA5_ENST00000355395.5_Missense_Mutation_p.V326M	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	326					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	GTTCATAGCCGTGTGCTATGC	0.572													ENSG00000186297																																					0													29.0	33.0	32.0					15																	27188460		2119	4267	6386	SO:0001583	missense	0			-		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.976G>A	15.37:g.27188460G>A	ENSP00000335592:p.Val326Met		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa5_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.V326M	ENST00000335625.5	37	c.976	CCDS45194.1	15	.	.	.	.	.	.	.	.	.	.	-	24.1	4.488170	0.84854	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	D;D;D	0.86562	-2.14;-2.14;-2.14	5.27	4.36	0.52297	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90930	0.7149	L	0.52126	1.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91619	0.5309	10	0.87932	D	0	.	13.2941	0.60286	0.0765:0.0:0.9235:0.0	.	326	P31644	GBRA5_HUMAN	M	326	ENSP00000335592:V326M;ENSP00000347557:V326M;ENSP00000382953:V326M	ENSP00000335592:V326M	V	+	1	0	GABRA5	24771206	1.000000	0.71417	0.924000	0.36721	0.994000	0.84299	9.592000	0.98245	1.359000	0.45940	0.651000	0.88453	GTG	-	GABRA5	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,tigrfam_Neur_channel		0.572	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA5	HGNC	protein_coding	OTTHUMT00000415234.1	0	0	0	46	46	40	0.00	0.00	G			27188460	+1	7	14	27	38	tier1	no_errors	ENST00000335625	ensembl	human	known	74_37	missense	20.59	26.92	SNP	0.999	A	7	27
FREM2	341640	genome.wustl.edu	37	13	39450410	39450410	+	Missense_Mutation	SNP	C	C	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr13:39450410C>A	ENST00000280481.7	+	20	8651	c.8435C>A	c.(8434-8436)aCt>aAt	p.T2812N		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2812					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GGGACCTATACTGTGAAGCTG	0.463													ENSG00000150893																																					0													127.0	114.0	118.0					13																	39450410		2203	4300	6503	SO:0001583	missense	0			-	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8435C>A	13.37:g.39450410C>A	ENSP00000280481:p.Thr2812Asn		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.T2812N	ENST00000280481.7	37	c.8435	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530961	0.27387	.	.	ENSG00000150893	ENST00000280481	T	0.23348	1.91	5.69	2.96	0.34315	.	0.112016	0.64402	N	0.000012	T	0.31358	0.0794	M	0.87180	2.865	0.48511	D	0.999669	B	0.15141	0.012	B	0.17979	0.02	T	0.14254	-1.0479	10	0.87932	D	0	.	5.3217	0.15885	0.1196:0.635:0.1156:0.1297	.	2812	Q5SZK8	FREM2_HUMAN	N	2812	ENSP00000280481:T2812N	ENSP00000280481:T2812N	T	+	2	0	FREM2	38348410	0.998000	0.40836	0.017000	0.16124	0.269000	0.26545	3.970000	0.56824	0.316000	0.23135	0.563000	0.77884	ACT	-	FREM2	-	NULL		0.463	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	0	0	0	47	47	43	0.00	0.00	C	NM_207361		39450410	+1	9	24	57	88	tier1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	13.64	21.43	SNP	0.958	A	9	57
TOP2A	7153	genome.wustl.edu	37	17	38551786	38551786	+	Missense_Mutation	SNP	T	T	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr17:38551786T>A	ENST00000423485.1	-	29	3884	c.3726A>T	c.(3724-3726)gaA>gaT	p.E1242D		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1242					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	CTTCAGTATTTTCATTCTAAA	0.363													ENSG00000131747																																					0													121.0	104.0	109.0					17																	38551786		1806	4072	5878	SO:0001583	missense	0			-		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.3726A>T	17.37:g.38551786T>A	ENSP00000411532:p.Glu1242Asp		B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.E1242D	ENST00000423485.1	37	c.3726	CCDS45672.1	17	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294514	0.40594	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.25250	1.81	5.4	4.3	0.51218	.	0.165886	0.56097	D	0.000036	T	0.18718	0.0449	L	0.44542	1.39	0.35129	D	0.767804	P	0.40794	0.729	B	0.36766	0.232	T	0.23797	-1.0178	10	0.34782	T	0.22	.	7.1154	0.25414	0.0:0.1726:0.0:0.8274	.	1242	P11388	TOP2A_HUMAN	D	1242;1322;1265;1278	ENSP00000411532:E1242D	ENSP00000269577:E1322D	E	-	3	2	TOP2A	35805312	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.365000	0.34182	1.033000	0.39918	0.529000	0.55759	GAA	-	TOP2A	-	NULL		0.363	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	HGNC	protein_coding	OTTHUMT00000338035.1	0	0	0	44	44	93	0.00	0.00	T			38551786	-1	10	15	38	82	tier1	no_errors	ENST00000423485	ensembl	human	known	74_37	missense	20.83	15.46	SNP	1.000	A	10	38
PRSS1	5644	genome.wustl.edu	37	7	142459736	142459736	+	Silent	SNP	G	G	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr7:142459736G>T	ENST00000311737.7	+	3	318	c.312G>T	c.(310-312)ctG>ctT	p.L104L	PRSS1_ENST00000486171.1_Silent_p.L118L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	104	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		L -> P (in PCTT). {ECO:0000269|PubMed:11866271}.		cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GGAAGACTCTGAACAATGACA	0.547													ENSG00000204983																																					0													235.0	218.0	223.0					7																	142459736		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.312G>T	7.37:g.142459736G>T			A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L104	ENST00000311737.7	37	c.312	CCDS5872.1	7																																																																																			-	PRSS1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A		0.547	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	HGNC	protein_coding	OTTHUMT00000352538.2	1	1	0	104	104	83	0.95	0.00	G			142459736	+1	14	10	94	61	tier1	no_errors	ENST00000311737	ensembl	human	known	74_37	silent	12.84	14.08	SNP	1.000	T	14	94
NEB	4703	genome.wustl.edu	37	2	152521904	152521904	+	Silent	SNP	G	G	A	rs35016946		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr2:152521904G>A	ENST00000172853.10	-	42	5328	c.5181C>T	c.(5179-5181)taC>taT	p.Y1727Y	NEB_ENST00000603639.1_Silent_p.Y1727Y|NEB_ENST00000409198.1_Silent_p.Y1727Y|NEB_ENST00000604864.1_Silent_p.Y1727Y|NEB_ENST00000427231.2_Silent_p.Y1727Y|NEB_ENST00000397345.3_Silent_p.Y1727Y			P20929	NEBU_HUMAN	nebulin	1727					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGTCCATGGCGTAAGTGAACT	0.512													ENSG00000183091																																					0								G	,,	0,4136		0,0,2068	256.0	251.0	253.0		5181,5181,5181	-7.0	0.0	2	dbSNP_126	253	6,8384		0,6,4189	no	coding-synonymous,coding-synonymous,coding-synonymous	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	,,	0,6,6257	AA,AG,GG		0.0715,0.0,0.0479	,,	1727/8526,1727/8526,1727/6670	152521904	6,12520	2068	4195	6263	SO:0001819	synonymous_variant	0			-	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.5181C>T	2.37:g.152521904G>A			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.Y1727	ENST00000172853.10	37	c.5181		2																																																																																			rs35016946	NEB	-	smart_Nebulin_35r-motif		0.512	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		0	0	0	257	257	86	0.00	0.00	G	NM_004543		152521904	-1	64	25	137	35	tier1	no_errors	ENST00000397345	ensembl	human	known	74_37	silent	31.53	41.67	SNP	0.000	A	64	137
MOBP	4336	genome.wustl.edu	37	3	39555017	39555017	+	IGR	DEL	G	G	-			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr3:39555017delG	ENST00000420739.1	+	0	940				MOBP_ENST00000479860.1_3'UTR|MOBP_ENST00000415443.1_3'UTR|MOBP_ENST00000311042.6_3'UTR|MOBP_ENST00000383754.3_3'UTR|MOBP_ENST00000447324.1_3'UTR|MOBP_ENST00000396228.1_3'UTR			Q13875	MOBP_HUMAN	myelin-associated oligodendrocyte basic protein						intracellular protein transport (GO:0006886)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.082)|Kidney(284;0.0998)		ATATTATGCAGGGGCAAACAC	0.532													ENSG00000168314																																					0																																										SO:0001628	intergenic_variant	0				D28113	CCDS2687.1, CCDS63598.1, CCDS2688.1	3p21.33	2004-03-02			ENSG00000168314	ENSG00000168314			7189	protein-coding gene	gene with protein product		600948				7989345	Standard	NM_001278322		Approved		uc031ryw.1	Q13875	OTTHUMG00000131347		3.37:g.39555017delG			A8K2C2|G5E945|Q13874|Q6DHZ6|Q8TBJ1	R	DEL	-	NULL	ENST00000420739.1	37	NULL		3																																																																																				MOBP	-	-		0.532	MOBP-001	KNOWN	basic	protein_coding	MOBP	HGNC	protein_coding	OTTHUMT00000343711.1	0	0	0	42	42	61	0.00	0.00	G	NM_006501, NM_182934, NM_182935		39555017	+1	6	19	44	54	tier1	no_errors	ENST00000479860	ensembl	human	known	74_37	rna	12.00	26.03	DEL	0.091	-	6	44
KIAA1109	84162	genome.wustl.edu	37	4	123188042	123188042	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr4:123188042delT	ENST00000264501.4	+	46	7795	c.7422delT	c.(7420-7422)actfs	p.T2474fs	KIAA1109_ENST00000455637.1_Frame_Shift_Del_p.T2474fs|KIAA1109_ENST00000388738.3_Frame_Shift_Del_p.T2474fs			Q2LD37	K1109_HUMAN	KIAA1109	2474					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TTTCAGGGACTTTGGACTGCC	0.413													ENSG00000138688																																					0													169.0	155.0	160.0					4																	123188042		1905	4118	6023	SO:0001589	frameshift_variant	0				AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.7422delT	4.37:g.123188042delT	ENSP00000264501:p.Thr2474fs		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Frame_Shift_Del	DEL	pfam_Fragile_site-assoc_C	p.L2475fs	ENST00000264501.4	37	c.7422	CCDS43267.1	4																																																																																				KIAA1109	-	NULL		0.413	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	0	0	0	51	51	95	0.00	0.00	T	NM_020797		123188042	+1	16	24	24	57	tier1	no_errors	ENST00000264501	ensembl	human	known	74_37	frame_shift_del	40.00	29.63	DEL	0.803	-	16	24
PROSER1	80209	genome.wustl.edu	37	13	39587561	39587562	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	CA	CA	CA	-	CA	CA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr13:39587561_39587562delCA	ENST00000352251.3	-	11	2660_2661	c.1827_1828delTG	c.(1825-1830)actgagfs	p.E610fs	PROSER1_ENST00000350125.3_Frame_Shift_Del_p.E588fs|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	610	Ser-rich.																CTTGTGGGCTCAGTTTTGATCA	0.525													ENSG00000120685																																					0																																										SO:0001589	frameshift_variant	0				AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1827_1828delTG	13.37:g.39587561_39587562delCA	ENSP00000332034:p.Glu610fs		A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Frame_Shift_Del	DEL	NULL	p.E610fs	ENST00000352251.3	37	c.1828_1827	CCDS9368.2	13																																																																																				PROSER1	-	NULL		0.525	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	0	0	0	97	97	107	0.00	0.00	CA	NM_025138		39587562	-1	23	39	100	167	tier1	no_errors	ENST00000352251	ensembl	human	known	74_37	frame_shift_del	18.70	18.93	DEL	1.000:0.992	-	23	100
EBF1	1879	genome.wustl.edu	37	5	158126125	158126126	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	AG	AG	AG	-	AG	AG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr5:158126125_158126126delAG	ENST00000313708.6	-	16	2051_2052	c.1769_1770delCT	c.(1768-1770)cctfs	p.P590fs	EBF1_ENST00000380654.4_Frame_Shift_Del_p.P559fs|EBF1_ENST00000517373.1_Frame_Shift_Del_p.P522fs|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	590					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTTTCACATAGGAGGAACAAT	0.361			T	HMGA2	lipoma								ENSG00000164330																												Dom	yes		5	5q34	1879	early B-cell factor 1		M	0																																										SO:0001589	frameshift_variant	0				AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1769_1770delCT	5.37:g.158126125_158126126delAG	ENSP00000322898:p.Pro590fs		Q8IW11	Frame_Shift_Del	DEL	pfam_IPT,superfamily_Ig_E-set,superfamily_bHLH_dom,smart_IPT	p.P590fs	ENST00000313708.6	37	c.1770_1769	CCDS4343.1	5																																																																																				EBF1	-	NULL		0.361	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1	0	0	0	45	45	67	0.00	0.00	AG	NM_024007		158126126	-1	12	16	55	63	tier1	no_errors	ENST00000313708	ensembl	human	known	74_37	frame_shift_del	17.91	20.25	DEL	1.000:1.000	-	12	55
MRVI1	10335	genome.wustl.edu	37	11	10653562	10653562	+	Frame_Shift_Del	DEL	A	A	-	rs202082096		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:10653562delA	ENST00000436272.1	-	3	427	c.349delT	c.(349-351)tccfs	p.S117fs	MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000424001.1_5'UTR|MRVI1_ENST00000423302.2_Frame_Shift_Del_p.S126fs|MRVI1_ENST00000527509.2_Frame_Shift_Del_p.S35fs|MRVI1_ENST00000421747.1_Frame_Shift_Del_p.S117fs|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000547195.1_Frame_Shift_Del_p.S35fs|MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000531107.1_Frame_Shift_Del_p.S117fs|MRVI1_ENST00000541483.1_Frame_Shift_Del_p.S126fs|MRVI1_ENST00000532037.1_5'UTR|MRVI1_ENST00000552103.1_Frame_Shift_Del_p.S35fs			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	117					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GAGGCAGTGGACACCTTCAAG	0.488													ENSG00000072952																																					0													87.0	92.0	90.0					11																	10653562		2085	4203	6288	SO:0001589	frameshift_variant	0				AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.349delT	11.37:g.10653562delA	ENSP00000412229:p.Ser117fs		B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Frame_Shift_Del	DEL	pfam_MRVI1	p.S117fs	ENST00000436272.1	37	c.349		11																																																																																				MRVI1	-	NULL		0.488	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	HGNC	protein_coding		0	0	0	58	58	106	0.00	0.00	A	NM_001098579		10653562	-1	7	23	32	85	tier1	no_errors	ENST00000421747	ensembl	human	known	74_37	frame_shift_del	17.95	21.30	DEL	0.990	-	7	32
ADAMTS8	11095	genome.wustl.edu	37	11	130275593	130275593	+	Missense_Mutation	SNP	A	A	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:130275593A>G	ENST00000257359.6	-	9	3236	c.2530T>C	c.(2530-2532)Tgc>Cgc	p.C844R		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	844	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GTGCTAGAGCACTCAGACCAG	0.622													ENSG00000134917																																					0													79.0	93.0	88.0					11																	130275593		2073	4226	6299	SO:0001583	missense	0			-	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.2530T>C	11.37:g.130275593A>G	ENSP00000257359:p.Cys844Arg		Q9NZS0	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS8,prints_Peptidase_M12B_ADAM-TS	p.C844R	ENST00000257359.6	37	c.2530	CCDS41732.1	11	.	.	.	.	.	.	.	.	.	.	A	18.32	3.597709	0.66332	.	.	ENSG00000134917	ENST00000531752;ENST00000257359;ENST00000414575	D	0.98585	-5.01	5.35	4.23	0.50019	.	0.044050	0.85682	D	0.000000	D	0.99453	0.9806	H	0.99830	4.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97679	1.0171	10	0.87932	D	0	.	10.8699	0.46877	0.926:0.0:0.074:0.0	.	844;325	Q9UP79;B3KVX9	ATS8_HUMAN;.	R	242;844;873	ENSP00000257359:C844R	ENSP00000257359:C844R	C	-	1	0	ADAMTS8	129780803	1.000000	0.71417	0.557000	0.28306	0.790000	0.44656	7.174000	0.77620	0.881000	0.35993	0.482000	0.46254	TGC	-	ADAMTS8	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.622	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS8	HGNC	protein_coding	OTTHUMT00000385636.1	0	0	0	41	41	8	0.00	0.00	A	NM_007037		130275593	-1	5	4	18	3	tier1	no_errors	ENST00000257359	ensembl	human	known	74_37	missense	21.74	57.14	SNP	1.000	G	5	18
CDKN1A	1026	genome.wustl.edu	37	6	36652002	36652002	+	Missense_Mutation	SNP	A	A	C			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr6:36652002A>C	ENST00000405375.1	+	2	359	c.124A>C	c.(124-126)Atc>Ctc	p.I42L	CDKN1A_ENST00000448526.2_Missense_Mutation_p.I76L|CDKN1A_ENST00000373711.2_Missense_Mutation_p.I42L|CDKN1A_ENST00000244741.5_Missense_Mutation_p.I42L|CDKN1A_ENST00000478800.1_3'UTR	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	42					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						GGCGGGCTGCATCCAGGAGGC	0.662													ENSG00000124762																																					0													44.0	40.0	41.0					6																	36652002		2203	4300	6503	SO:0001583	missense	0			-	U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.124A>C	6.37:g.36652002A>C	ENSP00000384849:p.Ile42Leu		Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	pfam_CDI	p.I76L	ENST00000405375.1	37	c.226	CCDS4824.1	6	.	.	.	.	.	.	.	.	.	.	A	0.064	-1.218247	0.01542	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.06	-1.69	0.08186	.	1.599070	0.03741	N	0.255046	T	0.26231	0.0640	N	0.01168	-0.975	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.15178	-1.0446	10	0.11182	T	0.66	-2.7388	0.9324	0.01338	0.2002:0.4013:0.1548:0.2438	.	76;42;42	B4DQP9;P38936;Q96LE1	.;CDN1A_HUMAN;.	L	76;42;42;42	ENSP00000409259:I76L;ENSP00000244741:I42L;ENSP00000384849:I42L;ENSP00000362815:I42L	ENSP00000244741:I42L	I	+	1	0	CDKN1A	36759980	0.001000	0.12720	0.002000	0.10522	0.042000	0.13812	-0.212000	0.09319	-0.356000	0.08187	-0.516000	0.04426	ATC	-	CDKN1A	-	pfam_CDI		0.662	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1A	HGNC	protein_coding	OTTHUMT00000040354.1	0	0	0	55	55	20	0.00	0.00	A	NM_078467		36652002	+1	9	3	37	7	tier1	no_errors	ENST00000448526	ensembl	human	known	74_37	missense	19.57	30.00	SNP	0.000	C	9	37
SPANXC	64663	genome.wustl.edu	37	X	140335820	140335820	+	Missense_Mutation	SNP	T	T	A	rs57835830	byFrequency	TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chrX:140335820T>A	ENST00000358993.2	-	2	162	c.124A>T	c.(124-126)Atg>Ttg	p.M42L		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	42						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.M42L(1)		large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					GATGTTTTCATTTTTTTAGGA	0.498													ENSG00000198573																																					1	Substitution - Missense(1)	large_intestine(1)																																								SO:0001583	missense	0			-	AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.124A>T	X.37:g.140335820T>A	ENSP00000351884:p.Met42Leu		Q32WL9|Q5JX88	Missense_Mutation	SNP	pfam_SPANX_prot	p.M42L	ENST00000358993.2	37	c.124	CCDS14673.1	X	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.452949	0.00175	.	.	ENSG00000198573	ENST00000358993	T	0.05717	3.4	.	.	.	.	.	.	.	.	T	0.02418	0.0074	N	0.02802	-0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48468	-0.9033	7	0.19147	T	0.46	.	.	.	.	.	42	Q9NY87	SPNXC_HUMAN	L	42	ENSP00000351884:M42L	ENSP00000351884:M42L	M	-	1	0	SPANXC	140163486	0.012000	0.17670	0.003000	0.11579	0.004000	0.04260	0.065000	0.14466	0.424000	0.26061	0.270000	0.19313	ATG	-	SPANXC	-	pfam_SPANX_prot		0.498	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXC	HGNC	protein_coding	OTTHUMT00000058590.1	1	1	0	294	294	67	0.34	0.00	T	NM_022661		140335820	-1	48	4	197	61	tier1	no_errors	ENST00000358993	ensembl	human	known	74_37	missense	19.59	6.15	SNP	0.004	A	48	197
LILRB5	10990	genome.wustl.edu	37	19	54758275	54758275	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr19:54758275G>T	ENST00000316219.5	-	7	1366	c.1259C>A	c.(1258-1260)cCc>cAc	p.P420H	LILRB5_ENST00000345866.6_Missense_Mutation_p.P320H|LILRB5_ENST00000449561.2_Missense_Mutation_p.P420H|LILRB5_ENST00000450632.1_Missense_Mutation_p.P411H	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	420					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ATCCCCAGAGGGTCCTGGGAA	0.627													ENSG00000105609																																					0													29.0	32.0	31.0					19																	54758275		2196	4298	6494	SO:0001583	missense	0			-	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1259C>A	19.37:g.54758275G>T	ENSP00000320390:p.Pro420His		Q8N760	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P411H	ENST00000316219.5	37	c.1232	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	G	5.117	0.207188	0.09704	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00486	7.1;7.06;7.09;7.08	2.08	-0.152	0.13407	.	4.984720	0.00628	N	0.000469	T	0.00524	0.0017	L	0.53249	1.67	0.09310	N	1	B;B;P;B	0.35807	0.009;0.196;0.522;0.027	B;B;B;B	0.39152	0.01;0.112;0.292;0.022	T	0.45556	-0.9253	10	0.33141	T	0.24	.	4.3338	0.11076	0.3667:0.0:0.6333:0.0	.	411;320;420;420	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	H	420;411;420;320	ENSP00000320390:P420H;ENSP00000414225:P411H;ENSP00000406478:P420H;ENSP00000263430:P320H	ENSP00000320390:P420H	P	-	2	0	LILRB5	59450087	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.012000	0.13287	0.038000	0.15604	0.471000	0.43371	CCC	-	LILRB5	-	NULL		0.627	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	0	0	0	46	46	91	0.00	0.00	G			54758275	-1	5	6	32	55	tier1	no_errors	ENST00000450632	ensembl	human	known	74_37	missense	13.51	9.84	SNP	0.000	T	5	32
DYNC2H1	79659	genome.wustl.edu	37	11	103191767	103191767	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr11:103191767A>T	ENST00000375735.2	+	81	11879	c.11735A>T	c.(11734-11736)gAt>gTt	p.D3912V	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.D3919V|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3912					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GGTGCCAAAGATGTACAATGG	0.299													ENSG00000187240																																					0													64.0	59.0	60.0					11																	103191767		1800	4067	5867	SO:0001583	missense	0			-	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.11735A>T	11.37:g.103191767A>T	ENSP00000364887:p.Asp3912Val		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D3919V	ENST00000375735.2	37	c.11756	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	A	13.90	2.376107	0.42105	.	.	ENSG00000187240	ENST00000375735;ENST00000398093;ENST00000540621	T;T	0.08458	3.09;3.09	5.81	5.81	0.92471	Dynein heavy chain (1);	0.298098	0.27673	N	0.018328	T	0.10637	0.0260	L	0.45137	1.4	0.80722	D	1	B;B	0.20887	0.034;0.049	B;B	0.22152	0.038;0.017	T	0.06972	-1.0797	10	0.40728	T	0.16	.	16.1566	0.81673	1.0:0.0:0.0:0.0	.	3912;3919	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	V	3912;3919;158	ENSP00000364887:D3912V;ENSP00000381167:D3919V	ENSP00000364887:D3912V	D	+	2	0	DYNC2H1	102696977	1.000000	0.71417	0.996000	0.52242	0.873000	0.50193	3.373000	0.52394	2.225000	0.72522	0.528000	0.53228	GAT	-	DYNC2H1	-	pfam_Dynein_heavy_dom		0.299	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	0	0	0	68	68	48	0.00	0.00	A	XM_370652		103191767	+1	10	4	54	60	tier1	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	15.62	6.15	SNP	1.000	T	10	54
FERMT1	55612	genome.wustl.edu	37	20	6096550	6096550	+	Missense_Mutation	SNP	C	C	T	rs137862671	byFrequency	TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr20:6096550C>T	ENST00000217289.4	-	3	1081	c.293G>A	c.(292-294)cGc>cAc	p.R98H	FERMT1_ENST00000536936.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	98	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						CAGACGAAGGCGCAGCATTTT	0.483													ENSG00000101311	C|||	3	0.000599042	0.0	0.0	5008	,	,		19742	0.001		0.001	False		,,,				2504	0.001																0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	87.0	88.0	88.0		293	5.5	1.0	20	dbSNP_134	88	2,8598	2.2+/-6.3	0,2,4298	yes	missense	FERMT1	NM_017671.4	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	98/678	6096550	3,13003	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.293G>A	20.37:g.6096550C>T	ENSP00000217289:p.Arg98His		D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R98H	ENST00000217289.4	37	c.293	CCDS13098.1	20	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	28.7	4.939444	0.92526	2.27E-4	2.33E-4	ENSG00000101311	ENST00000217289;ENST00000339538;ENST00000378844	T;T	0.11277	2.79;2.79	5.52	5.52	0.82312	Band 4.1 domain (1);	0.104565	0.64402	D	0.000003	T	0.38348	0.1037	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.64321	0.924;0.88	T	0.24728	-1.0152	10	0.66056	D	0.02	-11.0514	19.8176	0.96576	0.0:1.0:0.0:0.0	.	98;98	Q9BQL6-4;Q9BQL6	.;FERM1_HUMAN	H	98	ENSP00000217289:R98H;ENSP00000368121:R98H	ENSP00000217289:R98H	R	-	2	0	FERMT1	6044550	1.000000	0.71417	0.998000	0.56505	0.840000	0.47671	3.972000	0.56838	2.765000	0.95021	0.650000	0.86243	CGC	rs137862671	FERMT1	-	smart_Band_41_domain		0.483	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERMT1	HGNC	protein_coding	OTTHUMT00000077908.2	0	0	0	39	39	85	0.00	0.00	C	NM_017671		6096550	-1	8	5	23	65	tier1	no_errors	ENST00000217289	ensembl	human	known	74_37	missense	25.81	7.14	SNP	1.000	T	8	23
LINC01410	103352539	genome.wustl.edu	37	9	66468909	66468909	+	lincRNA	SNP	G	G	A	rs78672302		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr9:66468909G>A	ENST00000424345.1	+	0	2476																											attgtgaccagcacagattca	0.453													ENSG00000238113																																					0																																												0			-																													9.37:g.66468909G>A				R	SNP	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			rs78672302	RP11-262H14.1	-	-		0.453	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	Clone_based_vega_gene	lincRNA	OTTHUMT00000128851.1	0	0	1	11	11	46	0.00	2.13	G			66468909	+1	5	8	10	33	tier1	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	33.33	19.51	SNP	0.065	A	5	10
JPH3	57338	genome.wustl.edu	37	16	87678395	87678395	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr16:87678395G>A	ENST00000284262.2	+	2	1156	c.914G>A	c.(913-915)cGc>cAc	p.R305H		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	305					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		GTGAGCCAGCGCTCGGACGGG	0.662													ENSG00000154118																																					0													70.0	74.0	72.0					16																	87678395		2198	4300	6498	SO:0001583	missense	0			-	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.914G>A	16.37:g.87678395G>A	ENSP00000284262:p.Arg305His		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	pirsf_Junctophilin,pfam_MORN,smart_MORN	p.R305H	ENST00000284262.2	37	c.914	CCDS10962.1	16	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526601	0.85706	.	.	ENSG00000154118	ENST00000537256;ENST00000284262	T	0.54866	0.55	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.57417	0.2052	N	0.12920	0.275	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62544	-0.6832	10	0.45353	T	0.12	.	17.1059	0.86663	0.0:0.0:1.0:0.0	.	305	Q8WXH2	JPH3_HUMAN	H	168;305	ENSP00000284262:R305H	ENSP00000284262:R305H	R	+	2	0	JPH3	86235896	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	9.580000	0.98207	2.286000	0.76751	0.561000	0.74099	CGC	-	JPH3	-	pirsf_Junctophilin,pfam_MORN,smart_MORN		0.662	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH3	HGNC	protein_coding	OTTHUMT00000269108.2	0	0	0	79	79	7	0.00	0.00	G			87678395	+1	8	0	27	4	tier1	no_errors	ENST00000284262	ensembl	human	known	74_37	missense	22.86	0.00	SNP	1.000	A	8	27
SPOCK3	50859	genome.wustl.edu	37	4	168155291	168155292	+	Frame_Shift_Del	DEL	CA	CA	-	rs557659762		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr4:168155291_168155292delCA	ENST00000357154.3	-	2	170_171	c.33_34delTG	c.(31-36)tgtgcafs	p.A14fs	SPOCK3_ENST00000541354.1_5'UTR|SPOCK3_ENST00000510741.1_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000511531.1_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000541637.1_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000504953.1_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000421836.2_5'UTR|SPOCK3_ENST00000357545.4_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000534949.1_5'Flank|SPOCK3_ENST00000512648.1_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000512681.1_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000506886.1_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000535728.1_5'Flank|SPOCK3_ENST00000502330.1_Frame_Shift_Del_p.A14fs|SPOCK3_ENST00000511269.1_Frame_Shift_Del_p.A14fs	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	14					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		CAAGCGGCTGCACACACACACA	0.609													ENSG00000196104																																					0																																										SO:0001589	frameshift_variant	0				AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.33_34delTG	4.37:g.168155301_168155302delCA	ENSP00000349677:p.Ala14fs		B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Frame_Shift_Del	DEL	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.A12fs	ENST00000357154.3	37	c.34_33	CCDS54817.1	4																																																																																				SPOCK3	-	NULL		0.609	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCK3	HGNC	protein_coding	OTTHUMT00000364091.1	0	0	0	59	59	8	0.00	0.00	CA			168155292	-1	3	0	23	5	tier1	no_errors	ENST00000357154	ensembl	human	known	74_37	frame_shift_del	11.54	0.00	DEL	1.000:1.000	-	3	23
MAML3	55534	genome.wustl.edu	37	4	140811066	140811066	+	Splice_Site	SNP	C	C	T	rs58015886|rs370122702		TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr4:140811066C>T	ENST00000398940.1	-	2	108		c.e2-1		MAML3_ENST00000327122.5_Silent_p.Q352Q|MAML3_ENST00000509479.2_Silent_p.Q508Q					mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					AGtgctgttgctgctgctgct	0.512													ENSG00000196782																																					0													45.0	53.0	50.0					4																	140811066		2180	4289	6469	SO:0001630	splice_region_variant	0			-	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000398940.1:c.109-1G>A	4.37:g.140811066C>T				Splice_Site	SNP	-	e2-1	ENST00000398940.1	37	c.109-1		4																																																																																			-	MAML3	-	-		0.512	MAML3-202	KNOWN	basic	protein_coding	MAML3	HGNC	protein_coding		0	0	0	62	62	1	0.00	0.00	C		Intron	140811066	-1	6	0	60	1	tier1	no_errors	ENST00000398940	ensembl	human	known	74_37	splice_site	9.09	0.00	SNP	1.000	T	6	60
VIM	7431	genome.wustl.edu	37	10	17271377	17271377	+	5'UTR	SNP	T	T	G			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr10:17271377T>G	ENST00000224237.5	+	0	101				VIM-AS1_ENST00000437232.1_RNA|VIM-AS1_ENST00000605833.1_RNA|VIM_ENST00000544301.1_5'UTR|VIM_ENST00000485947.1_3'UTR			P08670	VIME_HUMAN	vimentin						apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CGGGAGCCAGTCCGCGCCACC	0.736													ENSG00000026025																																					0													6.0	5.0	5.0					10																	17271377		1986	3951	5937	SO:0001623	5_prime_UTR_variant	0			-	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.-45T>G	10.37:g.17271377T>G			B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	R	SNP	-	NULL	ENST00000224237.5	37	NULL	CCDS7120.1	10																																																																																			-	VIM	-	-		0.736	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIM	HGNC	protein_coding	OTTHUMT00000047015.1	0	0	0	22	22	3	0.00	0.00	T	NM_003380		17271377	+1	7	2	5	0	tier1	no_errors	ENST00000478317	ensembl	human	known	74_37	rna	58.33	100.00	SNP	0.000	G	7	5
PRSS16	10279	genome.wustl.edu	37	6	27219026	27219026	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr6:27219026A>T	ENST00000230582.3	+	7	715	c.700A>T	c.(700-702)Atc>Ttc	p.I234F	PRSS16_ENST00000421826.2_Intron	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	234					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						GAGCACCGCGATCGGCGGGTC	0.667													ENSG00000112812																									NSCLC(178;1118 2105 17078 23587 44429)												0													37.0	40.0	39.0					6																	27219026		2203	4299	6502	SO:0001583	missense	0			-	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.700A>T	6.37:g.27219026A>T	ENSP00000230582:p.Ile234Phe		O75416	Missense_Mutation	SNP	pfam_Peptidase_S28	p.I234F	ENST00000230582.3	37	c.700	CCDS4623.1	6	.	.	.	.	.	.	.	.	.	.	A	14.84	2.655612	0.47467	.	.	ENSG00000112812	ENST00000230582	T	0.20881	2.04	4.38	1.75	0.24633	.	0.723579	0.12937	N	0.426928	T	0.04048	0.0113	L	0.34521	1.04	0.09310	N	1	P	0.35684	0.515	B	0.37304	0.246	T	0.39663	-0.9603	10	0.10111	T	0.7	-0.2492	4.882	0.13685	0.7083:0.1876:0.1042:0.0	.	234	Q9NQE7	TSSP_HUMAN	F	234	ENSP00000230582:I234F	ENSP00000230582:I234F	I	+	1	0	PRSS16	27327005	0.007000	0.16637	0.008000	0.14137	0.102000	0.19082	0.334000	0.19787	0.231000	0.21079	0.460000	0.39030	ATC	-	PRSS16	-	pfam_Peptidase_S28		0.667	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS16	HGNC	protein_coding	OTTHUMT00000043418.2	0	0	0	69	69	59	0.00	0.00	A			27219026	+1	8	2	47	33	tier1	no_errors	ENST00000230582	ensembl	human	known	74_37	missense	14.55	5.56	SNP	0.007	T	8	47
ZNF608	57507	genome.wustl.edu	37	5	124079849	124079849	+	Silent	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr5:124079849G>A	ENST00000306315.5	-	1	1269	c.834C>T	c.(832-834)aaC>aaT	p.N278N	ZNF608_ENST00000504926.1_Intron	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	278							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CCAACATAGAGTTTCCCATGA	0.562													ENSG00000168916																																					0													134.0	141.0	139.0					5																	124079849		2123	4179	6302	SO:0001819	synonymous_variant	0			-	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.834C>T	5.37:g.124079849G>A			A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Silent	SNP	NULL	p.N278	ENST00000306315.5	37	c.834	CCDS34219.1	5																																																																																			-	ZNF608	-	NULL		0.562	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	0	0	0	30	30	60	0.00	0.00	G	XM_114432		124079849	-1	4	3	20	30	tier1	no_errors	ENST00000306315	ensembl	human	known	74_37	silent	16.67	8.82	SNP	1.000	A	4	20
ACO1	48	genome.wustl.edu	37	9	32419050	32419050	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr9:32419050G>A	ENST00000309951.6	+	7	811	c.673G>A	c.(673-675)Gaa>Aaa	p.E225K	ACO1_ENST00000379923.1_Missense_Mutation_p.E225K|ACO1_ENST00000541043.1_Missense_Mutation_p.E126K	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	225					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.E225K(1)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		CGGTGGTATTGAAGCAGAAGC	0.488													ENSG00000122729																																					1	Substitution - Missense(1)	large_intestine(1)											177.0	127.0	144.0					9																	32419050		2203	4300	6503	SO:0001583	missense	0			-	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.673G>A	9.37:g.32419050G>A	ENSP00000309477:p.Glu225Lys		D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.E225K	ENST00000309951.6	37	c.673	CCDS6525.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.516233	0.96402	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921;ENST00000541043	T;T;T	0.26373	1.74;1.74;1.74	5.64	5.64	0.86602	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (3);	0.000000	0.85682	D	0.000000	T	0.70579	0.3240	H	0.98918	4.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.83475	0.0061	10	0.87932	D	0	-19.8444	18.4726	0.90779	0.0:0.0:1.0:0.0	.	261;225	Q59FI0;P21399	.;ACOC_HUMAN	K	261;225;225;225;126	ENSP00000309477:E225K;ENSP00000369255:E225K;ENSP00000438733:E126K	ENSP00000309477:E225K	E	+	1	0	ACO1	32409050	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	9.869000	0.99810	2.637000	0.89404	0.563000	0.77884	GAA	-	ACO1	-	pfam_Acoase/IPM_deHydtase_lsu_aba,superfamily_Acoase/IPM_deHydtase_lsu_aba,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2		0.488	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO1	HGNC	protein_coding	OTTHUMT00000051998.3	0	0	0	61	61	57	0.00	0.00	G	NM_002197		32419050	+1	6	2	19	21	tier1	no_errors	ENST00000309951	ensembl	human	known	74_37	missense	24.00	8.70	SNP	1.000	A	6	19
ADRA2B	151	genome.wustl.edu	37	2	96781300	96781300	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A2OT-01A-11D-A21Q-09	TCGA-HB-A2OT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9b94fd39-a2ed-4f84-a977-ee5190378c1f	fda78838-677d-481c-9ac5-e17e40a974aa	g.chr2:96781300G>T	ENST00000409345.3	-	1	684	c.589C>A	c.(589-591)Ctg>Atg	p.L197M		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	197					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)			endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TTGGCGATCAGGTAGATGCGC	0.617													ENSG00000222040																																					0													42.0	48.0	46.0					2																	96781300		2129	4253	6382	SO:0001583	missense	0			-	M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.589C>A	2.37:g.96781300G>T	ENSP00000387281:p.Leu197Met		Q4TUH9|Q53RF2|Q9BZK0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA2B_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.L197M	ENST00000409345.3	37	c.589	CCDS56129.1	2	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533231	0.45073	.	.	ENSG00000222040	ENST00000409345	T	0.39056	1.1	5.07	1.12	0.20585	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.41994	0.1183	M	0.81239	2.535	0.28536	N	0.912333	B	0.32365	0.367	B	0.32762	0.152	T	0.36163	-0.9759	9	0.42905	T	0.14	.	6.5103	0.22218	0.1643:0.2903:0.5454:0.0	.	197	P18089	ADA2B_HUMAN	M	197	ENSP00000387281:L197M	ENSP00000387281:L197M	L	-	1	2	ADRA2B	96145027	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.303000	0.43646	0.029000	0.15352	0.456000	0.33151	CTG	-	ADRA2B	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADR_fam		0.617	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRA2B	HGNC	protein_coding	OTTHUMT00000334990.1	0	0	0	23	23	71	0.00	0.00	G			96781300	-1	7	3	14	56	tier1	no_errors	ENST00000409345	ensembl	human	known	74_37	missense	33.33	5.08	SNP	1.000	T	7	14
