#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
DNAH5	1767	genome.wustl.edu	37	5	13769642	13769642	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr5:13769642C>A	ENST00000265104.4	-	57	9792	c.9688G>T	c.(9688-9690)Gag>Tag	p.E3230*	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3230	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ACTTGTAGCTCCTTTTCTTTC	0.418									Kartagener syndrome				ENSG00000039139																																					0													277.0	238.0	251.0					5																	13769642		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9688G>T	5.37:g.13769642C>A	ENSP00000265104:p.Glu3230*		Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E3230*	ENST00000265104.4	37	c.9688	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	52	20.006629	0.99926	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.77	5.77	0.91146	.	0.048483	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	20.3472	0.98799	0.0:1.0:0.0:0.0	.	.	.	.	X	3230	.	ENSP00000265104:E3230X	E	-	1	0	DNAH5	13822642	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.657000	0.83745	2.890000	0.99128	0.650000	0.86243	GAG	-	DH5	-	NULL		0.418	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0	0	83	83	100	0.00	0.00	C	NM_001369		13769642	-1	49	33	101	114	tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	nonsense	32.67	22.45	SNP	1.000	A	49	101
KIF6	221458	genome.wustl.edu	37	6	39353432	39353432	+	Missense_Mutation	SNP	T	T	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr6:39353432T>A	ENST00000287152.7	-	16	1921	c.1827A>T	c.(1825-1827)gaA>gaT	p.E609D	KIF6_ENST00000394362.1_Missense_Mutation_p.E60D|KIF6_ENST00000373213.4_Missense_Mutation_p.E448D|KIF6_ENST00000373216.3_Missense_Mutation_p.E609D|KIF6_ENST00000229913.5_Missense_Mutation_p.E60D|KIF6_ENST00000541946.1_Missense_Mutation_p.E60D|KIF6_ENST00000538893.1_Missense_Mutation_p.E553D|KIF6_ENST00000373215.3_Intron	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	609					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GCTGGGTGATTTCTTCCTTCA	0.463													ENSG00000164627																																					0													116.0	109.0	111.0					6																	39353432		2203	4300	6503	SO:0001583	missense	0			-	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1827A>T	6.37:g.39353432T>A	ENSP00000287152:p.Glu609Asp		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E609D	ENST00000287152.7	37	c.1827	CCDS4844.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	13.76|13.76	2.332428|2.332428	0.41297|0.41297	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000394362;ENST00000373216;ENST00000373213;ENST00000229913;ENST00000538893;ENST00000541946;ENST00000540362|ENST00000458470	T;T;T;T;T;T;T|.	0.42131|.	0.98;0.98;0.98;0.98;0.98;0.98;0.98|.	5.53|5.53	-5.62|-5.62	0.02481|0.02481	.|.	.|.	.|.	.|.	.|.	T|T	0.15176|0.15176	0.0366|0.0366	L|L	0.42245|0.42245	1.32|1.32	0.23559|0.23559	N|N	0.997416|0.997416	B;B;P|.	0.34522|.	0.003;0.002;0.455|.	B;B;B|.	0.29353|.	0.002;0.005;0.101|.	T|T	0.33650|0.33650	-0.9860|-0.9860	9|5	0.23891|.	T|.	0.37|.	.|.	7.6908|7.6908	0.28567|0.28567	0.0:0.3857:0.3535:0.2608|0.0:0.3857:0.3535:0.2608	.|.	553;609;609|.	F6VGH2;Q6ZMV9-3;Q6ZMV9|.	.;.;KIF6_HUMAN|.	D|I	609;60;609;448;60;553;60;60|501	ENSP00000287152:E609D;ENSP00000377889:E60D;ENSP00000362312:E609D;ENSP00000362309:E448D;ENSP00000229913:E60D;ENSP00000441435:E553D;ENSP00000439064:E60D|.	ENSP00000229913:E60D|.	E|K	-|-	3|2	2|0	KIF6|KIF6	39461410|39461410	0.967000|0.967000	0.33354|0.33354	0.076000|0.076000	0.20297|0.20297	0.957000|0.957000	0.61999|0.61999	-0.043000|-0.043000	0.12043|0.12043	-1.179000|-1.179000	0.02737|0.02737	-0.424000|-0.424000	0.05967|0.05967	GAA|AAA	-	KIF6	-	NULL		0.463	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	0	0	0	73	73	106	0.00	0.00	T	NM_145027		39353432	-1	28	27	40	17	tier1	no_errors	ENST00000287152	ensembl	human	known	74_37	missense	41.18	61.36	SNP	0.602	A	28	40
ZNF236	7776	genome.wustl.edu	37	18	74592142	74592142	+	Missense_Mutation	SNP	C	C	G			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr18:74592142C>G	ENST00000253159.8	+	8	1250	c.1052C>G	c.(1051-1053)tCc>tGc	p.S351C	ZNF236_ENST00000320610.9_Missense_Mutation_p.S353C	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	351					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CAGCCGAGCTCCCAGGCGGTG	0.602													ENSG00000130856																																					0													46.0	51.0	49.0					18																	74592142		1998	4154	6152	SO:0001583	missense	0			-	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.1052C>G	18.37:g.74592142C>G	ENSP00000253159:p.Ser351Cys		B2RTX9|Q9UL37	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S351C	ENST00000253159.8	37	c.1052	CCDS42447.1	18	.	.	.	.	.	.	.	.	.	.	C	11.58	1.681591	0.29872	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.11712	2.75;2.91	4.99	4.99	0.66335	.	0.614209	0.16619	N	0.206594	T	0.12178	0.0296	L	0.44542	1.39	0.09310	N	0.999999	P;P	0.52463	0.953;0.938	P;B	0.46975	0.533;0.436	T	0.10064	-1.0646	10	0.07813	T	0.8	.	13.2261	0.59914	0.2004:0.7996:0.0:0.0	.	351;351	Q9NWI2;Q9UL36	.;ZN236_HUMAN	C	351	ENSP00000253159:S351C;ENSP00000444524:S351C	ENSP00000253159:S351C	S	+	2	0	ZNF236	72721130	0.321000	0.24625	0.005000	0.12908	0.007000	0.05969	3.946000	0.56644	2.316000	0.78162	0.557000	0.71058	TCC	-	ZNF236	-	NULL		0.602	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	0	0	0	68	68	24	0.00	0.00	C			74592142	+1	39	7	183	30	tier1	no_errors	ENST00000253159	ensembl	human	known	74_37	missense	17.57	18.92	SNP	0.002	G	39	183
RAD21	5885	genome.wustl.edu	37	8	117887056	117887056	+	5'UTR	SNP	T	T	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr8:117887056T>C	ENST00000297338.2	-	0	49				RAD21_ENST00000523547.1_5'Flank|MIR3610_ENST00000582903.1_RNA|RAD21-AS1_ENST00000521487.2_RNA	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)						apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					GCCCAAATCCTCGGTTCAAAT	0.652													ENSG00000253327																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.-239A>G	8.37:g.117887056T>C			A8K0E0|Q15001|Q99568	R	SNP	-	NULL	ENST00000297338.2	37	NULL	CCDS6321.1	8	.	.	.	.	.	.	.	.	.	.	T	12.77	2.037701	0.35989	.	.	ENSG00000253327	ENST00000521487	.	.	.	4.31	3.1	0.35709	.	.	.	.	.	T	0.54367	0.1854	.	.	.	0.23221	N	0.998097	D	0.69078	0.997	P	0.62184	0.899	T	0.42816	-0.9429	7	0.87932	D	0	.	5.3638	0.16103	0.1574:0.0:0.2481:0.5945	.	15	E5RI81	.	P	15	.	ENSP00000429518:S15P	S	+	1	0	NCRNA00255	117956237	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.791000	0.47829	0.590000	0.29694	0.459000	0.35465	TCG	-	RAD21-AS1	-	-		0.652	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21-AS1	HGNC	protein_coding	OTTHUMT00000381184.1	0	0	0	28	28	40	0.00	0.00	T	NM_006265		117887056	+1	18	24	68	27	tier1	no_errors	ENST00000521487	ensembl	human	known	74_37	rna	20.93	47.06	SNP	1.000	C	18	68
SSTR3	6753	genome.wustl.edu	37	22	37603800	37603800	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr22:37603800G>T	ENST00000328544.3	-	2	576	c.43C>A	c.(43-45)Cct>Act	p.P15T	SSTR3_ENST00000402501.1_Missense_Mutation_p.P15T	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	15					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	GCATTCTCAGGTTCTGAGGTC	0.632													ENSG00000183473																																					0													58.0	55.0	56.0					22																	37603800		2203	4300	6503	SO:0001583	missense	0			-		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.43C>A	22.37:g.37603800G>T	ENSP00000330138:p.Pro15Thr		A8K550|Q53ZR7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Somatstn_rcpt_3,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Somatstn_rcpt_5,prints_Neuropept_B/W_rcpt	p.P15T	ENST00000328544.3	37	c.43	CCDS13944.1	22	.	.	.	.	.	.	.	.	.	.	G	0.709	-0.787734	0.02884	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.71698	-0.59;-0.59	5.61	2.31	0.28768	.	0.000000	0.85682	D	0.000000	T	0.54143	0.1840	L	0.47716	1.5	0.09310	N	0.999999	P	0.43094	0.799	B	0.33339	0.162	T	0.43360	-0.9396	10	0.22109	T	0.4	.	9.2642	0.37630	0.0802:0.4572:0.4626:0.0	.	15	P32745	SSR3_HUMAN	T	15	ENSP00000330138:P15T;ENSP00000384904:P15T	ENSP00000330138:P15T	P	-	1	0	SSTR3	35933746	0.522000	0.26266	0.016000	0.15963	0.018000	0.09664	1.743000	0.38258	0.292000	0.22492	0.557000	0.71058	CCT	-	SSTR3	-	prints_Somatstn_rcpt_3		0.632	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR3	HGNC	protein_coding	OTTHUMT00000318802.1	0	0	0	88	88	78	0.00	0.00	G			37603800	-1	28	10	62	40	tier1	no_errors	ENST00000328544	ensembl	human	known	74_37	missense	31.11	20.00	SNP	0.182	T	28	62
PLEKHO2	80301	genome.wustl.edu	37	15	65157999	65157999	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr15:65157999G>A	ENST00000323544.4	+	6	1513	c.1385G>A	c.(1384-1386)aGa>aAa	p.R462K	AC069368.3_ENST00000437723.1_Intron	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	462										NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						CAGGAAATGAGAGATTTGGGA	0.612													ENSG00000241839																																					0													33.0	35.0	34.0					15																	65157999		2202	4299	6501	SO:0001583	missense	0			-	AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.1385G>A	15.37:g.65157999G>A	ENSP00000326706:p.Arg462Lys		Q7L4H4|Q8WYS8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R462K	ENST00000323544.4	37	c.1385	CCDS10196.1	15	.	.	.	.	.	.	.	.	.	.	G	11.20	1.569790	0.28003	.	.	ENSG00000241839	ENST00000323544	T	0.27890	1.64	5.13	1.81	0.25067	.	0.276436	0.39407	N	0.001373	T	0.13372	0.0324	N	0.12746	0.255	0.25635	N	0.986269	B;B	0.20052	0.041;0.029	B;B	0.21151	0.033;0.004	T	0.19976	-1.0289	10	0.20519	T	0.43	.	4.974	0.14131	0.4932:0.0:0.5068:0.0	.	412;462	Q8TD55-2;Q8TD55	.;PKHO2_HUMAN	K	462	ENSP00000326706:R462K	ENSP00000326706:R462K	R	+	2	0	PLEKHO2	62945052	0.990000	0.36364	0.952000	0.39060	0.884000	0.51177	2.969000	0.49232	0.560000	0.29169	0.549000	0.68633	AGA	-	PLEKHO2	-	NULL		0.612	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHO2	HGNC	protein_coding	OTTHUMT00000256659.1	0	0	0	42	42	86	0.00	0.00	G	NM_025201		65157999	+1	12	10	43	56	tier1	no_errors	ENST00000323544	ensembl	human	known	74_37	missense	21.82	15.15	SNP	0.967	A	12	43
SARS	6301	genome.wustl.edu	37	1	109766653	109766653	+	Missense_Mutation	SNP	A	A	G			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr1:109766653A>G	ENST00000234677.2	+	2	265	c.190A>G	c.(190-192)Atc>Gtc	p.I64V	SARS_ENST00000369923.4_Missense_Mutation_p.I64V	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase	64					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	CAGCAAGACAATCGGAGAGAA	0.388													ENSG00000031698																																					0													159.0	163.0	162.0					1																	109766653		2203	4300	6503	SO:0001583	missense	0			-	BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.190A>G	1.37:g.109766653A>G	ENSP00000234677:p.Ile64Val		B2R6Y9|Q5T5C8|Q9NSE3	Missense_Mutation	SNP	pfam_aa-tR-synt_IIb_cons-dom,pfam_Ser-tR-synth_1_N,superfamily_tR-bd_arm,pirsf_Ser-tR-ligase_type_1,pfscan_aa-tR-synth_II,prints_Ser-tR-ligase_type_1,tigrfam_Ser-tR-ligase_type_1	p.I64V	ENST00000234677.2	37	c.190	CCDS795.1	1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.879867	0.72294	.	.	ENSG00000031698	ENST00000234677;ENST00000369923	T;T	0.51574	0.7;0.7	5.93	5.93	0.95920	tRNA-binding arm (1);Seryl-tRNA synthetase, class IIa, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.29882	0.0747	N	0.25890	0.77	0.80722	D	1	B;B;P;B	0.35107	0.283;0.334;0.484;0.283	B;B;B;B	0.42245	0.268;0.381;0.268;0.268	T	0.15896	-1.0421	10	0.31617	T	0.26	-14.3221	16.0678	0.80897	1.0:0.0:0.0:0.0	.	64;64;64;64	Q0VGA5;Q53HA4;Q5T5C7;P49591	.;.;.;SYSC_HUMAN	V	64	ENSP00000234677:I64V;ENSP00000358939:I64V	ENSP00000234677:I64V	I	+	1	0	SARS	109568176	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	8.919000	0.92770	2.281000	0.76405	0.533000	0.62120	ATC	-	SARS	-	pfam_Ser-tR-synth_1_N,superfamily_tR-bd_arm,pirsf_Ser-tR-ligase_type_1,tigrfam_Ser-tR-ligase_type_1		0.388	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARS	HGNC	protein_coding	OTTHUMT00000032394.2	0	0	0	54	54	126	0.00	0.00	A	NM_006513		109766653	+1	47	66	67	95	tier1	no_errors	ENST00000369923	ensembl	human	known	74_37	missense	40.87	40.99	SNP	1.000	G	47	67
DNAH6	1768	genome.wustl.edu	37	2	84822877	84822877	+	Silent	SNP	C	C	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr2:84822877C>A	ENST00000237449.6	+	17	2840	c.2832C>A	c.(2830-2832)ccC>ccA	p.P944P	DNAH6_ENST00000389394.3_Silent_p.P944P|DNAH6_ENST00000398278.2_Silent_p.P944P			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	944	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GTGTAGTGCCCCAGCTCAAAT	0.388													ENSG00000115423																																					0													105.0	99.0	101.0					2																	84822877		692	1591	2283	SO:0001819	synonymous_variant	0			-	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2832C>A	2.37:g.84822877C>A			A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P944	ENST00000237449.6	37	c.2832	CCDS46348.1	2																																																																																			-	DH6	-	pfam_Dynein_heavy_dom-2		0.388	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH6	HGNC	protein_coding	OTTHUMT00000328537.2	0	0	0	15	15	60	0.00	0.00	C	NM_001370		84822877	+1	23	92	47	190	tier1	no_errors	ENST00000237449	ensembl	human	known	74_37	silent	32.86	32.62	SNP	0.998	A	23	47
ZFPM2	23414	genome.wustl.edu	37	8	106814477	106814477	+	Missense_Mutation	SNP	T	T	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr8:106814477T>C	ENST00000407775.2	+	8	2417	c.2167T>C	c.(2167-2169)Tcc>Ccc	p.S723P	RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S454P|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S591P|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.S591P|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000522296.1_3'UTR	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	723					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GAGGTCTGCTTCCAACAAAGT	0.517													ENSG00000169946																																					0													54.0	52.0	53.0					8																	106814477		2096	4221	6317	SO:0001583	missense	0			-	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2167T>C	8.37:g.106814477T>C	ENSP00000384179:p.Ser723Pro		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S723P	ENST00000407775.2	37	c.2167	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	T	12.75	2.030739	0.35797	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20332	2.08;2.56;2.56;3.77	5.72	5.72	0.89469	.	0.263389	0.44902	D	0.000411	T	0.11836	0.0288	N	0.14661	0.345	0.44302	D	0.997178	P	0.44195	0.828	B	0.37650	0.255	T	0.17198	-1.0377	10	0.23891	T	0.37	.	11.9288	0.52835	0.0:0.0:0.1451:0.8549	.	723	Q8WW38	FOG2_HUMAN	P	723;591;591;454	ENSP00000384179:S723P;ENSP00000430757:S591P;ENSP00000428720:S591P;ENSP00000367733:S454P	ENSP00000367733:S454P	S	+	1	0	ZFPM2	106883653	0.978000	0.34361	1.000000	0.80357	0.994000	0.84299	1.080000	0.30779	2.186000	0.69663	0.459000	0.35465	TCC	-	ZFPM2	-	NULL		0.517	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	0	0	0	13	13	45	0.00	0.00	T			106814477	+1	11	27	39	46	tier1	no_errors	ENST00000407775	ensembl	human	known	74_37	missense	22.00	36.99	SNP	1.000	C	11	39
KNTC1	9735	genome.wustl.edu	37	12	123060135	123060135	+	Missense_Mutation	SNP	C	C	T	rs151068294		TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr12:123060135C>T	ENST00000333479.7	+	28	2605	c.2428C>T	c.(2428-2430)Cct>Tct	p.P810S	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	810					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GGCAGTGGTTCCTTGGAGTGC	0.483													ENSG00000184445	C|||	1	0.000199681	0.0008	0.0	5008	,	,		20416	0.0		0.0	False		,,,				2504	0.0																0													113.0	114.0	114.0					12																	123060135		2117	4226	6343	SO:0001583	missense	0			GMAF=0.0005		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.2428C>T	12.37:g.123060135C>T	ENSP00000328236:p.Pro810Ser		A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.P810S	ENST00000333479.7	37	c.2428	CCDS45002.1	12	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	33	5.215155	0.95104	.	.	ENSG00000184445	ENST00000333479	T	0.66460	-0.21	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.80253	0.4589	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.81470	-0.0918	10	0.72032	D	0.01	-17.4721	17.7222	0.88355	0.0:1.0:0.0:0.0	.	810	P50748	KNTC1_HUMAN	S	810	ENSP00000328236:P810S	ENSP00000328236:P810S	P	+	1	0	KNTC1	121626088	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.818000	0.86416	2.614000	0.88457	0.655000	0.94253	CCT	rs151068294	KNTC1	-	NULL		0.483	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	0	0	0	106	106	86	0.00	0.00	C			123060135	+1	37	23	131	95	tier1	no_errors	ENST00000333479	ensembl	human	known	74_37	missense	22.02	19.49	SNP	1.000	T	37	131
TRPM2	7226	genome.wustl.edu	37	21	45842168	45842168	+	Intron	SNP	T	T	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr21:45842168T>C	ENST00000397928.1	+	23	3906				AP001065.2_ENST00000423310.1_RNA|TRPM2_ENST00000300481.9_Intron|TRPM2_ENST00000397932.2_Silent_p.L1159L|TRPM2_ENST00000498430.1_Intron|TRPM2_ENST00000300482.5_Intron	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2						calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GGCTGGAGCTTTGGGGGTCAA	0.597													ENSG00000142185																																					0																																										SO:0001627	intron_variant	0			-	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.3462-1360T>C	21.37:g.45842168T>C			D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.L1159	ENST00000397928.1	37	c.3477	CCDS13710.1	21																																																																																			-	TRPM2	-	NULL		0.597	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	0	0	0	86	86	43	0.00	0.00	T	NM_003307		45842168	+1	10	5	58	37	tier1	no_errors	ENST00000397932	ensembl	human	novel	74_37	silent	14.71	11.90	SNP	0.003	C	10	58
FAM129B	64855	genome.wustl.edu	37	9	130279234	130279234	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr9:130279234G>C	ENST00000373312.3	-	8	1088	c.875C>G	c.(874-876)tCc>tGc	p.S292C	FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Missense_Mutation_p.S279C	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	292					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CTGCACCTTGGACAGCACCTC	0.602													ENSG00000136830																																					0													179.0	163.0	168.0					9																	130279234		2203	4300	6503	SO:0001583	missense	0			-	AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.875C>G	9.37:g.130279234G>C	ENSP00000362409:p.Ser292Cys		Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.S292C	ENST00000373312.3	37	c.875	CCDS35145.1	9	.	.	.	.	.	.	.	.	.	.	G	6.719	0.501339	0.12822	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.23950	1.88;1.88	4.87	2.98	0.34508	.	1.243180	0.05188	N	0.502531	T	0.21227	0.0511	L	0.36672	1.1	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.006	T	0.28808	-1.0032	10	0.49607	T	0.09	-11.1535	3.4763	0.07586	0.0949:0.1761:0.5605:0.1685	.	279;292	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	C	279;292	ENSP00000362411:S279C;ENSP00000362409:S292C	ENSP00000362409:S292C	S	-	2	0	FAM129B	129319055	0.859000	0.29813	0.662000	0.29724	0.004000	0.04260	4.264000	0.58859	0.444000	0.26612	-0.140000	0.14226	TCC	-	FAM129B	-	NULL		0.602	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129B	HGNC	protein_coding	OTTHUMT00000054196.1	0	0	0	105	105	41	0.00	0.00	G	NM_022833		130279234	-1	16	7	58	25	tier1	no_errors	ENST00000373312	ensembl	human	known	74_37	missense	21.62	21.88	SNP	0.114	C	16	58
CACNA1B	774	genome.wustl.edu	37	9	140943767	140943767	+	Splice_Site	SNP	C	C	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr9:140943767C>T	ENST00000371372.1	+	24	3855	c.3710C>T	c.(3709-3711)tCa>tTa	p.S1237L	CACNA1B_ENST00000371357.1_Splice_Site_p.S1238L|CACNA1B_ENST00000277549.5_Splice_Site_p.S429L|CACNA1B_ENST00000371363.1_Splice_Site_p.S1237L|CACNA1B_ENST00000277551.2_Splice_Site_p.S1237L|CACNA1B_ENST00000371355.4_Splice_Site_p.S1238L	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1237					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TTTGCTTTCTCGTAAGTAACG	0.567													ENSG00000148408																																					0													125.0	121.0	122.0					9																	140943767		2070	4206	6276	SO:0001630	splice_region_variant	0			-	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.3710+1C>T	9.37:g.140943767C>T			B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.S1238L	ENST00000371372.1	37	c.3713	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.927202	0.97110	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.98617	-5.03;-5.03;-5.03;-5.03;-5.03;-5.03	5.13	5.13	0.70059	.	1.141480	0.06318	N	0.703971	D	0.98764	0.9584	L	0.42245	1.32	0.80722	D	1	B;D;D	0.71674	0.174;0.998;0.998	B;D;D	0.63283	0.049;0.913;0.913	D	0.95258	0.8366	10	0.87932	D	0	.	18.1658	0.89724	0.0:1.0:0.0:0.0	.	1237;1238;1237	B1AQK4;B1AQK7;B1AQK6	.;.;.	L	1237;1237;429;1237;1238;1238	ENSP00000360423:S1237L;ENSP00000277551:S1237L;ENSP00000277549:S429L;ENSP00000360414:S1237L;ENSP00000360408:S1238L;ENSP00000360406:S1238L	ENSP00000277549:S429L	S	+	2	0	CACNA1B	140063588	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.698000	0.84413	2.386000	0.81285	0.491000	0.48974	TCA;TCA;TCG;TCA;TCA;TCA	-	CAC1B	-	pfam_Ion_trans_dom		0.567	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CAC1B	HGNC	protein_coding	OTTHUMT00000055380.1	0	0	0	223	223	134	0.00	0.00	C	NM_000718	Missense_Mutation	140943767	+1	32	22	128	69	tier1	no_errors	ENST00000371355	ensembl	human	known	74_37	missense	19.88	24.18	SNP	1.000	T	32	128
ANXA10	11199	genome.wustl.edu	37	4	169060727	169060727	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr4:169060727G>A	ENST00000359299.3	+	3	377	c.191G>A	c.(190-192)gGc>gAc	p.G64D		NM_007193.4	NP_009124.2	Q9UJ72	ANX10_HUMAN	annexin A10	64						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(2)	16		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		AGCATGTATGGCCGGGTAAGG	0.423													ENSG00000109511																																					0													92.0	89.0	90.0					4																	169060727		2203	4300	6503	SO:0001583	missense	0			-	AJ238979	CCDS34096.1	4q32.3	2008-02-05			ENSG00000109511	ENSG00000109511		"""Annexins"""	534	protein-coding gene	gene with protein product		608008				10458909	Standard	NM_007193		Approved	ANX14	uc003irm.3	Q9UJ72	OTTHUMG00000161275	ENST00000359299.3:c.191G>A	4.37:g.169060727G>A	ENSP00000352248:p.Gly64Asp		Q96IQ5|Q9UJV4	Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinX	p.G64D	ENST00000359299.3	37	c.191	CCDS34096.1	4	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103486	0.56291	.	.	ENSG00000109511	ENST00000359299;ENST00000393751	T	0.05319	3.46	5.8	5.8	0.92144	.	0.234460	0.38005	N	0.001842	T	0.21227	0.0511	M	0.74467	2.265	0.53688	D	0.999973	D	0.56968	0.978	P	0.54372	0.75	T	0.00051	-1.2193	10	0.87932	D	0	.	18.8252	0.92115	0.0:0.0:1.0:0.0	.	64	Q9UJ72	ANX10_HUMAN	D	64	ENSP00000352248:G64D	ENSP00000352248:G64D	G	+	2	0	ANXA10	169297302	1.000000	0.71417	0.983000	0.44433	0.011000	0.07611	6.576000	0.74023	2.758000	0.94735	0.561000	0.74099	GGC	-	ANXA10	-	pfam_Annexin_repeat,smart_Annexin_repeat		0.423	ANXA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA10	HGNC	protein_coding	OTTHUMT00000364348.2	0	0	0	18	18	59	0.00	0.00	G	NM_007193		169060727	+1	22	35	20	32	tier1	no_errors	ENST00000359299	ensembl	human	known	74_37	missense	52.38	52.24	SNP	0.998	A	22	20
ZNF236	7776	genome.wustl.edu	37	18	74589978	74589978	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr18:74589978C>T	ENST00000253159.8	+	7	1046	c.848C>T	c.(847-849)cCt>cTt	p.P283L	ZNF236_ENST00000320610.9_Missense_Mutation_p.P285L	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	283					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		AAGAATGGTCCTACCTATAAC	0.303													ENSG00000130856																																					0													62.0	58.0	59.0					18																	74589978		1825	4079	5904	SO:0001583	missense	0			-	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.848C>T	18.37:g.74589978C>T	ENSP00000253159:p.Pro283Leu		B2RTX9|Q9UL37	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P283L	ENST00000253159.8	37	c.848	CCDS42447.1	18	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486992	0.84854	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.06933	3.24;3.24	5.14	5.14	0.70334	.	0.128260	0.53938	D	0.000058	T	0.09335	0.0230	N	0.12527	0.23	0.58432	D	0.99999	P;D	0.59767	0.843;0.986	B;P	0.48304	0.295;0.573	T	0.22591	-1.0212	10	0.66056	D	0.02	.	18.7034	0.91629	0.0:1.0:0.0:0.0	.	283;283	Q9NWI2;Q9UL36	.;ZN236_HUMAN	L	283	ENSP00000253159:P283L;ENSP00000444524:P283L	ENSP00000253159:P283L	P	+	2	0	ZNF236	72718966	1.000000	0.71417	0.990000	0.47175	0.946000	0.59487	6.905000	0.75714	2.407000	0.81776	0.456000	0.33151	CCT	-	ZNF236	-	NULL		0.303	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	0	0	0	28	28	73	0.00	0.00	C			74589978	+1	17	25	86	123	tier1	no_errors	ENST00000253159	ensembl	human	known	74_37	missense	16.50	16.89	SNP	0.961	T	17	86
TMC7	79905	genome.wustl.edu	37	16	19049220	19049220	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr16:19049220C>T	ENST00000304381.5	+	8	1160	c.1030C>T	c.(1030-1032)Cgg>Tgg	p.R344W	TMC7_ENST00000421369.3_Missense_Mutation_p.R234W|TMC7_ENST00000569532.1_Missense_Mutation_p.R344W|TMC7_ENST00000561963.1_3'UTR	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	344					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						AGAAAGAATGCGGCAGAAAAT	0.398													ENSG00000170537																																					0													144.0	129.0	134.0					16																	19049220		2197	4300	6497	SO:0001583	missense	0			-	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1030C>T	16.37:g.19049220C>T	ENSP00000304710:p.Arg344Trp		E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	pfam_TMC	p.R344W	ENST00000304381.5	37	c.1030	CCDS10573.1	16	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482525	0.84747	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.58652	0.32;0.32	5.5	4.5	0.54988	.	0.064293	0.64402	D	0.000006	T	0.64789	0.2630	M	0.72894	2.215	0.36737	D	0.882042	D;D	0.61697	0.99;0.99	P;P	0.52343	0.696;0.696	T	0.74179	-0.3749	10	0.87932	D	0	.	10.5494	0.45079	0.3291:0.6709:0.0:0.0	.	344;344	Q7Z402;B3KSZ3	TMC7_HUMAN;.	W	344;234	ENSP00000304710:R344W;ENSP00000397081:R234W	ENSP00000304710:R344W	R	+	1	2	TMC7	18956721	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.746000	0.55127	2.588000	0.87417	0.650000	0.86243	CGG	-	TMC7	-	NULL		0.398	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC7	HGNC	protein_coding	OTTHUMT00000254276.3	0	0	0	75	75	167	0.00	0.00	C	NM_024847		19049220	+1	36	49	27	50	tier1	no_errors	ENST00000304381	ensembl	human	known	74_37	missense	57.14	49.49	SNP	1.000	T	36	27
ABCA8	10351	genome.wustl.edu	37	17	66883174	66883174	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr17:66883174G>A	ENST00000269080.2	-	24	3430	c.3293C>T	c.(3292-3294)tCa>tTa	p.S1098L	ABCA8_ENST00000430352.2_Missense_Mutation_p.S1138L|ABCA8_ENST00000586539.1_Missense_Mutation_p.S1138L	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1098					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GAAACAAAATGACCAAATGCC	0.348													ENSG00000141338																																					0													75.0	73.0	73.0					17																	66883174		2203	4300	6503	SO:0001583	missense	0			-	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3293C>T	17.37:g.66883174G>A	ENSP00000269080:p.Ser1098Leu		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S1138L	ENST00000269080.2	37	c.3413	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057838	0.76074	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	D;D	0.85258	-1.96;-1.96	4.17	4.17	0.49024	.	0.191417	0.25445	N	0.030629	D	0.90508	0.7026	M	0.86028	2.79	0.41409	D	0.987722	D;D;P;D	0.61697	0.99;0.985;0.742;0.985	P;D;P;D	0.63113	0.897;0.911;0.628;0.911	D	0.88605	0.3152	10	0.10111	T	0.7	.	13.6778	0.62465	0.0:0.0:1.0:0.0	.	1077;1138;1138;1098	F5H6Z4;A1L3U3;C9JQE6;O94911	.;.;.;ABCA8_HUMAN	L	1098;1138;1077	ENSP00000269080:S1098L;ENSP00000402814:S1138L	ENSP00000269080:S1098L	S	-	2	0	ABCA8	64394769	0.996000	0.38824	1.000000	0.80357	0.952000	0.60782	2.956000	0.49129	2.321000	0.78463	0.655000	0.94253	TCA	-	ABCA8	-	NULL		0.348	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	0	0	0	15	15	59	0.00	0.00	G	NM_007168		66883174	-1	16	33	45	123	tier1	no_errors	ENST00000430352	ensembl	human	known	74_37	missense	26.23	21.02	SNP	0.998	A	16	45
FAF2	23197	genome.wustl.edu	37	5	175919335	175919335	+	Splice_Site	SNP	T	T	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr5:175919335T>A	ENST00000261942.6	+	5	536		c.e5+2			NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2						lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						TACAGCCAGGTCAGTGCCATA	0.463													ENSG00000113194																																					0													57.0	52.0	53.0					5																	175919335		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.483+2T>A	5.37:g.175919335T>A			O94963|Q8IUF2|Q9BRP2|Q9BVM7	Splice_Site	SNP	-	e5+2	ENST00000261942.6	37	c.483+2	CCDS34296.1	5	.	.	.	.	.	.	.	.	.	.	T	22.5	4.300318	0.81136	.	.	ENSG00000113194	ENST00000261942;ENST00000540174	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1055	0.81216	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAF2	175851941	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.619000	0.83057	2.252000	0.74401	0.533000	0.62120	.	-	FAF2	-	-		0.463	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF2	HGNC	protein_coding	OTTHUMT00000372194.1	0	0	0	46	46	124	0.00	0.00	T	NM_014613	Intron	175919335	+1	40	57	22	37	tier1	no_errors	ENST00000261942	ensembl	human	known	74_37	splice_site	64.52	60.00	SNP	1.000	A	40	22
PPP1R14C	81706	genome.wustl.edu	37	6	150464569	150464569	+	Missense_Mutation	SNP	C	C	G			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr6:150464569C>G	ENST00000361131.4	+	1	358	c.241C>G	c.(241-243)Ctt>Gtt	p.L81V		NM_030949.2	NP_112211.1	Q8TAE6	PP14C_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14C	81					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)|membrane (GO:0016020)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			endometrium(1)|large_intestine(1)|prostate(1)	3		Ovarian(120;0.0284)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;9.14e-12)		TCGTAAGGAGCTTCGGAAGCG	0.662													ENSG00000198729																									Melanoma(165;1879 1941 2052 16588 48349)												0													40.0	41.0	41.0					6																	150464569		2203	4300	6503	SO:0001583	missense	0			-	AF308297	CCDS5226.1	6q24.3-q25.3	2012-04-17			ENSG00000198729	ENSG00000198729		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14952	protein-coding gene	gene with protein product	"""kinase C-enhanced PP1 inhibitor"""	613242				11948623	Standard	NM_030949		Approved	CPI17-like, NY-BR-81, KEPI	uc003qnt.3	Q8TAE6	OTTHUMG00000015818	ENST00000361131.4:c.241C>G	6.37:g.150464569C>G	ENSP00000355260:p.Leu81Val		Q5VY83|Q96BB1|Q9H277	Missense_Mutation	SNP	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	p.L81V	ENST00000361131.4	37	c.241	CCDS5226.1	6	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744101	0.89663	.	.	ENSG00000198729	ENST00000361131	T	0.57436	0.4	3.99	3.99	0.46301	.	0.381527	0.27495	N	0.019120	T	0.67097	0.2857	M	0.78223	2.4	0.54753	D	0.999985	D	0.89917	1.0	D	0.91635	0.999	T	0.73892	-0.3839	10	0.87932	D	0	-30.0588	15.5247	0.75894	0.0:1.0:0.0:0.0	.	81	Q8TAE6	PP14C_HUMAN	V	81	ENSP00000355260:L81V	ENSP00000355260:L81V	L	+	1	0	PPP1R14C	150506262	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.988000	0.76212	1.922000	0.55676	0.632000	0.83419	CTT	-	PPP1R14C	-	pfam_PP1_inhibitor,superfamily_PP1_inhibitor		0.662	PPP1R14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R14C	HGNC	protein_coding	OTTHUMT00000042685.1	0	0	0	78	78	113	0.00	0.00	C	NM_030949		150464569	+1	19	36	100	117	tier1	no_errors	ENST00000361131	ensembl	human	known	74_37	missense	15.97	23.53	SNP	1.000	G	19	100
EFTUD2	9343	genome.wustl.edu	37	17	42929917	42929917	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr17:42929917G>A	ENST00000426333.2	-	26	2872	c.2575C>T	c.(2575-2577)Cag>Tag	p.Q859*	EFTUD2_ENST00000592576.1_Nonsense_Mutation_p.Q849*|EFTUD2_ENST00000402521.3_Nonsense_Mutation_p.Q824*|EFTUD2_ENST00000591382.1_Nonsense_Mutation_p.Q859*	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	859					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.Q859*(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				GGTGCATCCTGAGTCACGTGC	0.522													ENSG00000108883																									Ovarian(10;65 485 10258 29980 30707)												1	Substitution - Nonsense(1)	prostate(1)											86.0	74.0	78.0					17																	42929917		2203	4300	6503	SO:0001587	stop_gained	0			-	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.2575C>T	17.37:g.42929917G>A	ENSP00000392094:p.Gln859*		B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Nonsense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.Q859*	ENST00000426333.2	37	c.2575	CCDS11489.1	17	.	.	.	.	.	.	.	.	.	.	G	42	9.327469	0.99138	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-22.6567	20.2194	0.98323	0.0:0.0:1.0:0.0	.	.	.	.	X	859;849;824	.	ENSP00000262414:Q849X	Q	-	1	0	EFTUD2	40285443	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.837000	0.99465	2.879000	0.98667	0.650000	0.86243	CAG	-	EFTUD2	-	pfam_EFG_V,superfamily_EFG_III-V,smart_EFG_V		0.522	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD2	HGNC	protein_coding	OTTHUMT00000448672.1	0	0	0	31	31	151	0.00	0.00	G	NM_004247		42929917	-1	17	34	23	66	tier1	no_errors	ENST00000426333	ensembl	human	known	74_37	nonsense	42.50	34.00	SNP	1.000	A	17	23
ZFHX3	463	genome.wustl.edu	37	16	72832405	72832405	+	Silent	SNP	C	C	T	rs200609704		TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr16:72832405C>T	ENST00000268489.5	-	9	4848	c.4176G>A	c.(4174-4176)ccG>ccA	p.P1392P	ZFHX3_ENST00000397992.5_Silent_p.P478P	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1392					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GATCTGACACCGGCAGCTGAG	0.493													ENSG00000140836																																					0													148.0	130.0	136.0					16																	72832405		2198	4300	6498	SO:0001819	synonymous_variant	0			-	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.4176G>A	16.37:g.72832405C>T			D3DWS8|O15101|Q13719	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.P1392	ENST00000268489.5	37	c.4176	CCDS10908.1	16																																																																																			rs200609704	ZFHX3	-	NULL		0.493	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	0	0	0	55	55	85	0.00	0.00	C	NM_006885		72832405	-1	20	18	17	23	tier1	no_errors	ENST00000268489	ensembl	human	known	74_37	silent	54.05	43.90	SNP	0.000	T	20	17
GNAZ	2781	genome.wustl.edu	37	22	23438606	23438606	+	Splice_Site	SNP	G	G	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr22:23438606G>C	ENST00000248996.4	+	2	1389		c.e2+1		RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		TAACCAGACAGTAAGTGGGGC	0.567													ENSG00000128266																																					0													146.0	168.0	161.0					22																	23438606		2198	4298	6496	SO:0001630	splice_region_variant	0			-		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.723+1G>C	22.37:g.23438606G>C			B2R6C1|Q4QRJ6	Splice_Site	SNP	-	e1+1	ENST00000248996.4	37	c.723+1	CCDS13804.1	22	.	.	.	.	.	.	.	.	.	.	G	14.27	2.484225	0.44147	.	.	ENSG00000128266	ENST00000248996;ENST00000456059	.	.	.	4.51	3.5	0.40072	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8391	0.52344	0.086:0.0:0.914:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GNAZ	21768606	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	9.597000	0.98273	1.049000	0.40321	-0.136000	0.14681	.	-	GZ	-	-		0.567	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZ	HGNC	protein_coding	OTTHUMT00000319073.1	0	0	0	108	108	204	0.00	0.00	G	NM_002073	Intron	23438606	+1	24	29	75	123	tier1	no_errors	ENST00000248996	ensembl	human	known	74_37	splice_site	24.24	19.08	SNP	1.000	C	24	75
AUH	549	genome.wustl.edu	37	9	94058337	94058337	+	Silent	SNP	C	C	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr9:94058337C>T	ENST00000375731.4	-	6	644	c.621G>A	c.(619-621)ctG>ctA	p.L207L	AUH_ENST00000303617.5_Silent_p.L178L|AUH_ENST00000478465.1_5'Flank|AUH_ENST00000422391.2_Silent_p.L207L	NM_001698.2	NP_001689.1	Q13825	AUHM_HUMAN	AU RNA binding protein/enoyl-CoA hydratase	207					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enoyl-CoA hydratase activity (GO:0004300)|methylglutaconyl-CoA hydratase activity (GO:0004490)|mRNA 3'-UTR binding (GO:0003730)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11						TTGTTTCAACCAGGCCCATTT	0.373													ENSG00000148090																																					0													108.0	92.0	97.0					9																	94058337		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X79888	CCDS6689.1	9q22	2014-09-17	2010-04-30		ENSG00000148090	ENSG00000148090			890	protein-coding gene	gene with protein product		600529	"""AU RNA-binding protein/enoyl-Coenzyme A hydratase"", ""AU RNA binding protein/enoyl-Coenzyme A hydratase"""			7892223	Standard	NM_001698		Approved		uc004arf.4	Q13825	OTTHUMG00000020207	ENST00000375731.4:c.621G>A	9.37:g.94058337C>T			B1ALV7|B1ALV8|Q8WUE4	Silent	SNP	pfam_Crotonase_core_superfam	p.L207	ENST00000375731.4	37	c.621	CCDS6689.1	9																																																																																			-	AUH	-	pfam_Crotonase_core_superfam		0.373	AUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUH	HGNC	protein_coding	OTTHUMT00000053032.1	0	0	0	21	21	79	0.00	0.00	C			94058337	-1	15	40	18	124	tier1	no_errors	ENST00000375731	ensembl	human	known	74_37	silent	45.45	24.39	SNP	1.000	T	15	18
MACF1	23499	genome.wustl.edu	37	1	39951193	39951193	+	Intron	SNP	T	T	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr1:39951193T>C	ENST00000372915.3	+	97	21997				MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTCTGCTGTTTTATTCTTGAA	0.527													ENSG00000127603																																					0													23.0	23.0	23.0					1																	39951193		2199	4295	6494	SO:0001627	intron_variant	0			-	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.21911-17T>C	1.37:g.39951193T>C			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	R	SNP	-	NULL	ENST00000372915.3	37	NULL		1																																																																																			-	MACF1	-	-		0.527	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	0	0	0	44	44	120	0.00	0.00	T	NM_033044		39951193	+1	10	31	36	81	tier1	no_errors	ENST00000496360	ensembl	human	known	74_37	rna	21.74	27.68	SNP	0.111	C	10	36
WHSC1L1	54904	genome.wustl.edu	37	8	38133419	38133419	+	Intron	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr8:38133419G>A	ENST00000317025.8	-	24	4590				WHSC1L1_ENST00000527502.1_Intron|WHSC1L1_ENST00000433384.2_Intron|RP11-513D5.5_ENST00000529325.1_RNA	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1						histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			gggagatggggaggaagaagg	0.468			T	NUP98	AML								ENSG00000255487																												Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	0													20.0	20.0	20.0					8																	38133419		2048	4195	6243	SO:0001627	intron_variant	0			-	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.4073-19C>T	8.37:g.38133419G>A			B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	R	SNP	-	NULL	ENST00000317025.8	37	NULL	CCDS43729.1	8																																																																																			-	RP11-513D5.5	-	-		0.468	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255487	Clone_based_vega_gene	protein_coding	OTTHUMT00000381924.3	0	0	1	19	19	132	0.00	0.75	G	NM_023034		38133419	+1	9	45	11	62	tier1	no_errors	ENST00000529325	ensembl	human	known	74_37	rna	45.00	42.06	SNP	0.042	A	9	11
ZFPM2	23414	genome.wustl.edu	37	8	106814478	106814478	+	Missense_Mutation	SNP	C	C	T	rs267601701		TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr8:106814478C>T	ENST00000407775.2	+	8	2418	c.2168C>T	c.(2167-2169)tCc>tTc	p.S723F	RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S454F|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S591F|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.S591F|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000522296.1_3'UTR	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	723					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AGGTCTGCTTCCAACAAAGTG	0.517													ENSG00000169946																																					0													54.0	52.0	52.0					8																	106814478		2096	4219	6315	SO:0001583	missense	0			-	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2168C>T	8.37:g.106814478C>T	ENSP00000384179:p.Ser723Phe		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S723F	ENST00000407775.2	37	c.2168	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354493	0.61293	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20598	2.06;2.54;2.54;3.75	5.72	5.72	0.89469	.	0.263389	0.44902	D	0.000411	T	0.21631	0.0521	L	0.29908	0.895	0.51012	D	0.999904	D	0.57899	0.981	P	0.44597	0.454	T	0.00697	-1.1605	10	0.33940	T	0.23	.	19.88	0.96892	0.0:1.0:0.0:0.0	.	723	Q8WW38	FOG2_HUMAN	F	723;591;591;454	ENSP00000384179:S723F;ENSP00000430757:S591F;ENSP00000428720:S591F;ENSP00000367733:S454F	ENSP00000367733:S454F	S	+	2	0	ZFPM2	106883654	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.860000	0.62961	2.708000	0.92522	0.561000	0.74099	TCC	-	ZFPM2	-	NULL		0.517	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	0	0	0	14	14	44	0.00	0.00	C			106814478	+1	12	28	40	45	tier1	no_errors	ENST00000407775	ensembl	human	known	74_37	missense	23.08	38.36	SNP	1.000	T	12	40
ABCA13	154664	genome.wustl.edu	37	7	48467363	48467363	+	Splice_Site	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr7:48467363G>A	ENST00000435803.1	+	42	12484	c.12460G>A	c.(12460-12462)Gtg>Atg	p.V4154M		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4154					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCTCCGAAAGGTGTTTTTGAT	0.418													ENSG00000179869																																					0													46.0	43.0	44.0					7																	48467363		1835	4097	5932	SO:0001630	splice_region_variant	0			-	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12460-1G>A	7.37:g.48467363G>A			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V4154M	ENST00000435803.1	37	c.12460	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922112	0.52653	.	.	ENSG00000179869	ENST00000435803	D	0.89485	-2.52	4.74	3.86	0.44501	.	0.161807	0.29040	N	0.013326	D	0.94778	0.8314	H	0.94385	3.53	0.80722	D	1	D;D	0.63880	0.982;0.993	D;P	0.63192	0.912;0.851	D	0.94804	0.7973	9	.	.	.	.	9.2917	0.37791	0.0993:0.0:0.9007:0.0	.	1856;4154	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	M	4154	ENSP00000411096:V4154M	.	V	+	1	0	ABCA13	48437909	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	2.437000	0.44828	1.351000	0.45789	-0.123000	0.14984	GTG	-	ABCA13	-	NULL		0.418	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	0	0	0	29	29	53	0.00	0.00	G	NM_152701	Missense_Mutation	48467363	+1	13	18	24	57	tier1	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	35.14	24.00	SNP	1.000	A	13	24
PRB3	5544	genome.wustl.edu	37	12	11422603	11422603	+	Start_Codon_SNP	SNP	T	T	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr12:11422603T>A	ENST00000279573.7	-	1	136	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	PRB3_ENST00000440870.3_5'UTR|PRB3_ENST00000381842.3_Start_Codon_SNP_p.M1L|PRB3_ENST00000538488.1_Start_Codon_SNP_p.M1L			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	0					defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			ATCAGTAGCATCTTGCTGGAG	0.537													ENSG00000197870																																					0													81.0	79.0	80.0					12																	11422603		2203	4300	6503	SO:0001582	initiator_codon_variant	0			-			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.1A>T	12.37:g.11422603T>A	ENSP00000279573:p.Met1Leu		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	NULL	p.M1L	ENST00000279573.7	37	c.1		12	.	.	.	.	.	.	.	.	.	.	.	1.845	-0.466554	0.04476	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.11821	2.74;2.74	2.29	2.29	0.28610	.	.	.	.	.	T	0.09992	0.0245	.	.	.	0.80722	D	1	P	0.40909	0.732	B	0.34242	0.178	T	0.11421	-1.0588	8	0.87932	D	0	.	6.4444	0.21867	0.0:0.0:0.0:1.0	.	1	Q04118	PRB3_HUMAN	L	1	ENSP00000371264:M1L;ENSP00000442626:M1L	ENSP00000279573:M1L	M	-	1	0	PRB3	11313870	0.734000	0.28142	0.451000	0.26982	0.026000	0.11368	0.308000	0.19314	1.055000	0.40461	0.248000	0.18094	ATG	-	PRB3	-	NULL		0.537	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	PRB3	HGNC	protein_coding	OTTHUMT00000402119.5	0	0	0	26	26	5	0.00	0.00	T	NM_006249	Missense_Mutation	11422603	-1	26	4	60	11	tier1	no_errors	ENST00000381842	ensembl	human	known	74_37	missense	30.23	26.67	SNP	0.811	A	26	60
LOC101927533	101927533	genome.wustl.edu	37	2	65919069	65919069	+	lincRNA	SNP	T	T	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr2:65919069T>C	ENST00000377977.3	+	0	1016																											TTCTATTGTCTCTTCTCTGTG	0.463													ENSG00000204929																																					0																																												0			-																													2.37:g.65919069T>C				R	SNP	-	NULL	ENST00000377977.3	37	NULL		2																																																																																			-	AC074391.1	-	-		0.463	AC074391.1-010	KNOWN	basic	lincRNA	LOC101927533	Clone_based_vega_gene	lincRNA	OTTHUMT00000470883.1	0	0	0	39	39	90	0.00	0.00	T			65919069	+1	52	78	91	113	tier1	no_errors	ENST00000377977	ensembl	human	known	74_37	rna	36.36	40.84	SNP	0.034	C	52	91
NKD2	85409	genome.wustl.edu	37	5	1036455	1036455	+	Missense_Mutation	SNP	T	T	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr5:1036455T>A	ENST00000296849.5	+	9	972	c.743T>A	c.(742-744)cTg>cAg	p.L248Q	NKD2_ENST00000274150.4_Missense_Mutation_p.L248Q|NKD2_ENST00000382730.2_5'Flank|NKD2_ENST00000537972.1_Missense_Mutation_p.L248Q	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	248					exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			AACCACTACCTGGACCTCGCC	0.657													ENSG00000145506																																					0													118.0	90.0	99.0					5																	1036455		2203	4300	6503	SO:0001583	missense	0			-	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.743T>A	5.37:g.1036455T>A	ENSP00000296849:p.Leu248Gln		Q96EK8|Q9BSN0	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.L248Q	ENST00000296849.5	37	c.743	CCDS3859.1	5	.	.	.	.	.	.	.	.	.	.	T	22.8	4.335383	0.81801	.	.	ENSG00000145506	ENST00000296849;ENST00000274150;ENST00000537972	T;T;T	0.79141	-0.08;-1.24;-1.24	4.5	4.5	0.54988	.	0.000000	0.64402	D	0.000018	D	0.86883	0.6040	M	0.79693	2.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87989	0.2748	10	0.87932	D	0	-15.5143	10.2059	0.43112	0.0:0.0:0.0:1.0	.	248;248	Q969F2-2;Q969F2	.;NKD2_HUMAN	Q	248	ENSP00000296849:L248Q;ENSP00000274150:L248Q;ENSP00000440925:L248Q	ENSP00000274150:L248Q	L	+	2	0	NKD2	1089455	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	3.428000	0.52792	1.668000	0.50843	0.402000	0.26972	CTG	-	NKD2	-	NULL		0.657	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NKD2	HGNC	protein_coding	OTTHUMT00000206720.2	0	0	0	126	126	124	0.00	0.00	T	NM_033120		1036455	+1	27	27	74	46	tier1	no_errors	ENST00000296849	ensembl	human	known	74_37	missense	26.73	36.99	SNP	1.000	A	27	74
CARD14	79092	genome.wustl.edu	37	17	78166396	78166396	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr17:78166396G>T	ENST00000573882.1	+	11	1870	c.1334G>T	c.(1333-1335)tGc>tTc	p.C445F	CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000344227.2_Missense_Mutation_p.C445F|CARD14_ENST00000392434.2_Missense_Mutation_p.C208F|CARD14_ENST00000570421.1_Missense_Mutation_p.C445F			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	445					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GACAGCGACTGCAGCCTCGTC	0.662													ENSG00000141527																																					0													50.0	51.0	51.0					17																	78166396		2203	4300	6503	SO:0001583	missense	0			-	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1334G>T	17.37:g.78166396G>T	ENSP00000458715:p.Cys445Phe		B8QQJ3|Q9BVB5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,superfamily_PDZ,pfscan_CARD,pfscan_PDZ,pfscan_Guanylate_kin-like	p.C445F	ENST00000573882.1	37	c.1334	CCDS11768.1	17	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.337326	0.00224	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.32988	1.43;1.43	3.64	-0.0973	0.13633	.	2.414290	0.01689	N	0.026591	T	0.20251	0.0487	L	0.34521	1.04	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.09314	-1.0680	10	0.08381	T	0.77	0.0277	3.8001	0.08754	0.13:0.0:0.4138:0.4562	.	445;208;445	B8QQJ3;E7ETJ2;Q9BXL6	.;.;CAR14_HUMAN	F	445;208;208	ENSP00000344549:C445F;ENSP00000376229:C208F	ENSP00000308507:C208F	C	+	2	0	CARD14	75780991	0.006000	0.16342	0.037000	0.18230	0.033000	0.12548	0.190000	0.17057	0.201000	0.20466	0.561000	0.74099	TGC	-	CARD14	-	NULL		0.662	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD14	HGNC	protein_coding	OTTHUMT00000437507.1	0	0	0	89	89	19	0.00	0.00	G			78166396	+1	22	7	66	13	tier1	no_errors	ENST00000344227	ensembl	human	known	74_37	missense	24.72	35.00	SNP	0.058	T	22	66
DZIP1	22873	genome.wustl.edu	37	13	96242638	96242638	+	Missense_Mutation	SNP	C	C	G	rs267603869		TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr13:96242638C>G	ENST00000376829.2	-	17	2589	c.1738G>C	c.(1738-1740)Gaa>Caa	p.E580Q	DZIP1_ENST00000361156.3_Missense_Mutation_p.E561Q|DZIP1_ENST00000347108.3_Missense_Mutation_p.E580Q|DZIP1_ENST00000361396.2_Missense_Mutation_p.E561Q	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	580					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TTATGTCTTTCTGATTCCACA	0.373													ENSG00000134874																																					0													197.0	177.0	184.0					13																	96242638		2203	4300	6503	SO:0001583	missense	0			-	AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.1738G>C	13.37:g.96242638C>G	ENSP00000366025:p.Glu580Gln		Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E580Q	ENST00000376829.2	37	c.1738	CCDS9478.1	13	.	.	.	.	.	.	.	.	.	.	C	0.283	-0.985271	0.02180	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.06933	3.31;3.24;3.24;3.31	5.66	0.0252	0.14144	.	0.679800	0.15783	N	0.244849	T	0.04048	0.0113	N	0.22421	0.69	0.09310	N	1	P;B	0.35348	0.496;0.363	B;B	0.26969	0.075;0.034	T	0.46219	-0.9207	10	0.12430	T	0.62	0.8641	9.1845	0.37163	0.0:0.5619:0.0:0.4381	.	561;580	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	Q	580;561;561;580	ENSP00000257312:E580Q;ENSP00000355018:E561Q;ENSP00000355175:E561Q;ENSP00000366025:E580Q	ENSP00000257312:E580Q	E	-	1	0	DZIP1	95040639	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.004000	0.13106	-0.352000	0.08237	0.561000	0.74099	GAA	-	DZIP1	-	NULL		0.373	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DZIP1	HGNC	protein_coding	OTTHUMT00000045496.3	0	0	0	67	67	77	0.00	0.00	C	NM_014934		96242638	-1	25	29	129	118	tier1	no_errors	ENST00000347108	ensembl	human	known	74_37	missense	16.23	19.73	SNP	0.001	G	25	129
DYSF	8291	genome.wustl.edu	37	2	71825861	71825861	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr2:71825861G>A	ENST00000258104.3	+	33	3965	c.3688G>A	c.(3688-3690)Gac>Aac	p.D1230N	DYSF_ENST00000409651.1_Missense_Mutation_p.D1262N|DYSF_ENST00000394120.2_Missense_Mutation_p.D1231N|DYSF_ENST00000413539.2_Missense_Mutation_p.D1261N|DYSF_ENST00000409366.1_Missense_Mutation_p.D1231N|DYSF_ENST00000409744.1_Missense_Mutation_p.D1217N|DYSF_ENST00000410041.1_Missense_Mutation_p.D1248N|DYSF_ENST00000409582.3_Missense_Mutation_p.D1247N|DYSF_ENST00000409762.1_Missense_Mutation_p.D1247N|DYSF_ENST00000410020.3_Missense_Mutation_p.D1248N|DYSF_ENST00000429174.2_Missense_Mutation_p.D1230N|DYSF_ENST00000479049.2_3'UTR	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1230	C2 4. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GGAGCTGTACGACCATGACAC	0.612													ENSG00000135636																																					0													70.0	69.0	69.0					2																	71825861		2203	4300	6503	SO:0001583	missense	0			-	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3688G>A	2.37:g.71825861G>A	ENSP00000258104:p.Asp1230Asn		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,superfamily_MFS_dom_general_subst_transpt,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.D1261N	ENST00000258104.3	37	c.3781	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.460748	0.96240	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	5.65	5.65	0.86999	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.93861	0.8036	M	0.91038	3.17	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0;0.999;0.971;0.999;0.999;1.0	D;D;D;D;D;D;D;D;D;D;P;D;D;D	0.81914	0.972;0.972;0.972;0.972;0.989;0.989;0.989;0.983;0.972;0.995;0.711;0.944;0.972;0.983	D	0.94081	0.7344	10	0.49607	T	0.09	-20.6742	17.2125	0.86935	0.0:0.0:1.0:0.0	.	1262;1248;1231;1217;1248;1217;1247;1216;1261;1247;1230;1216;1231;1230	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	N	1261;1247;1247;1230;1230;1262;1231;1217;1231;1248;1248	ENSP00000407046:D1261N;ENSP00000387137:D1247N;ENSP00000386547:D1247N;ENSP00000398305:D1230N;ENSP00000258104:D1230N;ENSP00000386683:D1262N;ENSP00000377678:D1231N;ENSP00000386285:D1217N;ENSP00000386512:D1231N;ENSP00000386881:D1248N;ENSP00000386617:D1248N	ENSP00000258104:D1230N	D	+	1	0	DYSF	71679369	1.000000	0.71417	0.990000	0.47175	0.936000	0.57629	9.598000	0.98277	2.670000	0.90874	0.650000	0.86243	GAC	-	DYSF	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.612	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	0	0	0	37	37	53	0.00	0.00	G	NM_003494		71825861	+1	17	11	61	36	tier1	no_errors	ENST00000413539	ensembl	human	known	74_37	missense	21.79	23.40	SNP	1.000	A	17	61
OR2G6	391211	genome.wustl.edu	37	1	248685272	248685272	+	Missense_Mutation	SNP	T	T	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr1:248685272T>C	ENST00000343414.4	+	1	357	c.325T>C	c.(325-327)Tcg>Ccg	p.S109P		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGGTTGGGCTCGTCTGAGTG	0.547													ENSG00000188558																																					0													103.0	102.0	102.0					1																	248685272		2203	4300	6503	SO:0001583	missense	0			-		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.325T>C	1.37:g.248685272T>C	ENSP00000341291:p.Ser109Pro		B2RP33	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S109P	ENST00000343414.4	37	c.325	CCDS31119.1	1	.	.	.	.	.	.	.	.	.	.	N	8.163	0.789909	0.16258	.	.	ENSG00000188558	ENST00000343414	T	0.03124	4.04	3.68	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42964	U	0.000624	T	0.15869	0.0382	M	0.85462	2.755	0.09310	N	1	D	0.76494	0.999	D	0.69654	0.965	T	0.02581	-1.1138	10	0.59425	D	0.04	.	7.6759	0.28486	0.1892:0.0:0.0:0.8108	.	109	Q5TZ20	OR2G6_HUMAN	P	109	ENSP00000341291:S109P	ENSP00000341291:S109P	S	+	1	0	OR2G6	246751895	0.000000	0.05858	0.012000	0.15200	0.012000	0.07955	-1.319000	0.02702	1.523000	0.49018	0.329000	0.21502	TCG	-	OR2G6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.547	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	HGNC	protein_coding	OTTHUMT00000097358.1	0	0	0	13	13	33	0.00	0.00	T	XM_372842		248685272	+1	9	30	27	62	tier1	no_errors	ENST00000343414	ensembl	human	known	74_37	missense	25.00	32.61	SNP	0.000	C	9	27
LRP1B	53353	genome.wustl.edu	37	2	141201918	141201918	+	Silent	SNP	C	C	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr2:141201918C>T	ENST00000389484.3	-	65	11246	c.10275G>A	c.(10273-10275)gaG>gaA	p.E3425E		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3425	LDL-receptor class A 23. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTCATCTTCCTCATCACCAC	0.363										TSP Lung(27;0.18)			ENSG00000168702																									Colon(99;50 2074 2507 20106)												0													220.0	206.0	210.0					2																	141201918		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10275G>A	2.37:g.141201918C>T			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.E3425	ENST00000389484.3	37	c.10275	CCDS2182.1	2																																																																																			-	LRP1B	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	0	0	0	17	17	48	0.00	0.00	C	NM_018557		141201918	-1	19	29	21	47	tier1	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	47.50	38.16	SNP	0.985	T	19	21
IQGAP1	8826	genome.wustl.edu	37	15	90934098	90934098	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr15:90934098G>T	ENST00000268182.5	+	2	272	c.148G>T	c.(148-150)Gcg>Tcg	p.A50S	IQGAP1_ENST00000560738.1_Intron|RP11-154B12.3_ENST00000560578.1_RNA	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	50	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TTTGGAAGAAGCGAAGAGGTA	0.423													ENSG00000140575																																					0													166.0	150.0	155.0					15																	90934098		2198	4298	6496	SO:0001583	missense	0			-	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.148G>T	15.37:g.90934098G>T	ENSP00000268182:p.Ala50Ser		A7MBM3	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,pfam_WW_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_WW_dom,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_dom,pfscan_RasGAP	p.A50S	ENST00000268182.5	37	c.148	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922774	0.92319	.	.	ENSG00000140575	ENST00000268182	D	0.95238	-3.65	4.73	4.73	0.59995	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97297	0.9116	M	0.87547	2.89	0.80722	D	1	D	0.61697	0.99	D	0.71870	0.975	D	0.97859	1.0279	10	0.72032	D	0.01	-11.271	15.2382	0.73447	0.0:0.0:1.0:0.0	.	50	P46940	IQGA1_HUMAN	S	50	ENSP00000268182:A50S	ENSP00000268182:A50S	A	+	1	0	IQGAP1	88735102	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.110000	0.94302	2.460000	0.83146	0.462000	0.41574	GCG	-	IQGAP1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.423	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1	0	0	0	64	64	161	0.00	0.00	G	NM_003870		90934098	+1	22	26	79	99	tier1	no_errors	ENST00000268182	ensembl	human	known	74_37	missense	21.78	20.80	SNP	1.000	T	22	79
ARPC2	10109	genome.wustl.edu	37	2	219099578	219099578	+	Intron	SNP	A	A	G			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr2:219099578A>G	ENST00000295685.10	+	4	529				ARPC2_ENST00000315717.5_Intron	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa						Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCAGTCTTCTAATAGGTTGTC	0.358													ENSG00000163466																																					0																																										SO:0001627	intron_variant	0			-	AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.268+458A>G	2.37:g.219099578A>G			Q92801|Q9P1D4	Silent	SNP	NULL	p.*92	ENST00000295685.10	37	c.275	CCDS2410.1	2																																																																																			-	ARPC2	-	NULL		0.358	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC2	HGNC	protein_coding	OTTHUMT00000256777.2	0	0	0	18	18	120	0.00	0.00	A	NM_005731		219099578	+1	6	9	24	71	tier1	no_errors	ENST00000420201	ensembl	human	known	74_37	silent	20.00	11.25	SNP	0.012	G	6	24
DPYD	1806	genome.wustl.edu	37	1	98157281	98157281	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr1:98157281C>T	ENST00000370192.3	-	7	854	c.754G>A	c.(754-756)Ggt>Agt	p.G252S	DPYD_ENST00000423006.2_3'UTR|DPYD_ENST00000474241.1_5'UTR	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	252					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	ACCTTTACACCAAGGTCCTTC	0.368													ENSG00000188641																																					0													102.0	103.0	103.0					1																	98157281		2203	4300	6503	SO:0001583	missense	0			-	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.754G>A	1.37:g.98157281C>T	ENSP00000359211:p.Gly252Ser		A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	pfam_Dihydroorotate_DH_1_2,pfam_Pyr_nucl-diS_OxRdtase_FAD/D,pfam_tR_hU_synthase,superfamily_Helical_ferredxn,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Dihydroorotate_DH	p.G252S	ENST00000370192.3	37	c.754	CCDS30777.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.378349	0.95945	.	.	ENSG00000188641	ENST00000370192	D	0.96073	-3.9	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.98726	0.9572	H	0.99238	4.48	0.80722	D	1	D	0.61697	0.99	P	0.60789	0.879	D	0.99705	1.1005	10	0.87932	D	0	-16.9303	18.7184	0.91685	0.0:1.0:0.0:0.0	.	252	Q12882	DPYD_HUMAN	S	252	ENSP00000359211:G252S	ENSP00000359211:G252S	G	-	1	0	DPYD	97929869	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.412000	0.80091	2.497000	0.84241	0.460000	0.39030	GGT	-	DPYD	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/D		0.368	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	HGNC	protein_coding	OTTHUMT00000095698.3	0	0	0	8	8	19	0.00	0.00	C	NM_000110		98157281	-1	47	61	42	67	tier1	no_errors	ENST00000370192	ensembl	human	known	74_37	missense	52.81	47.66	SNP	1.000	T	47	42
TRIB2	28951	genome.wustl.edu	37	2	12880858	12880858	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr2:12880858G>A	ENST00000155926.4	+	3	2389	c.970G>A	c.(970-972)Gtg>Atg	p.V324M	TRIB2_ENST00000381465.2_Missense_Mutation_p.V188M	NM_021643.3	NP_067675.1			tribbles pseudokinase 2											breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(5)|prostate(1)|skin(1)|stomach(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TGCTAAGGAAGTGTCTGACCA	0.522													ENSG00000071575																																					0													82.0	77.0	79.0					2																	12880858		2203	4300	6503	SO:0001583	missense	0			-	AY245544	CCDS1683.1	2p25.1	2013-10-03	2013-10-03		ENSG00000071575	ENSG00000071575			30809	protein-coding gene	gene with protein product		609462	"""tribbles homolog 2 (Drosophila)"""			12736262, 17097562, 16715410	Standard	NM_021643		Approved	TRB2, GS3955	uc002rbv.4	Q92519	OTTHUMG00000090575	ENST00000155926.4:c.970G>A	2.37:g.12880858G>A	ENSP00000155926:p.Val324Met			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V324M	ENST00000155926.4	37	c.970	CCDS1683.1	2	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714935	0.48622	.	.	ENSG00000071575	ENST00000155926;ENST00000381465	T;T	0.49720	0.8;0.77	5.94	5.94	0.96194	Protein kinase-like domain (1);	0.184155	0.38217	N	0.001761	T	0.36303	0.0962	N	0.14661	0.345	0.80722	D	1	B	0.18610	0.029	B	0.18263	0.021	T	0.09335	-1.0679	10	0.45353	T	0.12	-8.4631	19.354	0.94404	0.0:0.0:1.0:0.0	.	324	Q92519	TRIB2_HUMAN	M	324;188	ENSP00000155926:V324M;ENSP00000370874:V188M	ENSP00000155926:V324M	V	+	1	0	TRIB2	12798309	1.000000	0.71417	0.943000	0.38184	0.998000	0.95712	9.831000	0.99420	2.820000	0.97059	0.650000	0.86243	GTG	-	TRIB2	-	superfamily_Kinase-like_dom		0.522	TRIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIB2	HGNC	protein_coding	OTTHUMT00000207114.2	0	0	0	42	42	142	0.00	0.00	G	NM_021643		12880858	+1	25	25	26	49	tier1	no_errors	ENST00000155926	ensembl	human	known	74_37	missense	49.02	33.78	SNP	1.000	A	25	26
TRRAP	8295	genome.wustl.edu	37	7	98601869	98601869	+	Missense_Mutation	SNP	A	A	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr7:98601869A>C	ENST00000359863.4	+	67	10533	c.10324A>C	c.(10324-10326)Aaa>Caa	p.K3442Q	TRRAP_ENST00000355540.3_Missense_Mutation_p.K3413Q|TRRAP_ENST00000446306.3_Missense_Mutation_p.K3431Q	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3442					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTCTAAGTTGAAAAAGTGGAT	0.388													ENSG00000196367																																					0													86.0	98.0	94.0					7																	98601869		2203	4299	6502	SO:0001583	missense	0			-	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10324A>C	7.37:g.98601869A>C	ENSP00000352925:p.Lys3442Gln		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.K3442Q	ENST00000359863.4	37	c.10324	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.1|25.1	4.603763|4.603763	0.87157|0.87157	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.80738|.	-1.41;-1.41|.	5.08|5.08	5.08|5.08	0.68730|0.68730	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.74129|.	0.3676|.	M|M	0.73430|0.73430	2.235|2.235	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.983;0.983|.	T|.	0.75207|.	-0.3399|.	10|.	0.49607|.	T|.	0.09|.	.|.	14.8596|14.8596	0.70369|0.70369	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	3413;3170;3442|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	Q|C	3442;3413;3430|3170	ENSP00000352925:K3442Q;ENSP00000347733:K3413Q|.	ENSP00000347733:K3413Q|.	K|X	+|+	1|3	0|0	TRRAP|TRRAP	98439805|98439805	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	9.339000|9.339000	0.96797|0.96797	1.916000|1.916000	0.55485|0.55485	0.528000|0.528000	0.53228|0.53228	AAA|TGA	-	TRRAP	-	superfamily_Kinase-like_dom		0.388	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	0	0	0	67	67	147	0.00	0.00	A	NM_003496		98601869	+1	14	25	30	66	tier1	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	31.82	27.47	SNP	1.000	C	14	30
PDGFD	80310	genome.wustl.edu	37	11	103870794	103870794	+	Missense_Mutation	SNP	T	T	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr11:103870794T>A	ENST00000393158.2	-	2	493	c.314A>T	c.(313-315)gAa>gTa	p.E105V	PDGFD_ENST00000302251.5_Missense_Mutation_p.E99V			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	105	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		GATATCATTTTCTGCTTCCTC	0.388													ENSG00000170962																																					0													91.0	95.0	93.0					11																	103870794		2202	4299	6501	SO:0001583	missense	0			-	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.314A>T	11.37:g.103870794T>A	ENSP00000376865:p.Glu105Val		A8K9T6|Q9BWV5	Missense_Mutation	SNP	pfam_CUB_dom,pfam_PDGF/VEGF_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_PDGF/VEGF_dom	p.E105V	ENST00000393158.2	37	c.314	CCDS41703.1	11	.	.	.	.	.	.	.	.	.	.	T	19.66	3.869027	0.72065	.	.	ENSG00000170962	ENST00000393158;ENST00000302251;ENST00000529268	T;T;T	0.19669	2.13;2.13;2.13	5.55	5.55	0.83447	CUB (5);	0.099520	0.64402	N	0.000002	T	0.46151	0.1378	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.986;0.998	T	0.42982	-0.9419	10	0.66056	D	0.02	-21.8971	15.9696	0.80004	0.0:0.0:0.0:1.0	.	105;99	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	V	105;99;128	ENSP00000376865:E105V;ENSP00000302193:E99V;ENSP00000432909:E128V	ENSP00000302193:E99V	E	-	2	0	PDGFD	103376004	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	5.803000	0.69129	2.231000	0.72958	0.459000	0.35465	GAA	-	PDGFD	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.388	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDGFD	HGNC	protein_coding	OTTHUMT00000387231.2	0	0	0	34	34	47	0.00	0.00	T	NM_025208		103870794	-1	20	28	61	102	tier1	no_errors	ENST00000393158	ensembl	human	known	74_37	missense	24.69	21.54	SNP	1.000	A	20	61
MST1R	4486	genome.wustl.edu	37	3	49936073	49936073	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr3:49936073A>T	ENST00000296474.3	-	4	1624	c.1597T>A	c.(1597-1599)Tgt>Agt	p.C533S	CTD-2330K9.2_ENST00000435478.1_RNA|MST1R_ENST00000344206.4_Missense_Mutation_p.C533S	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	533					cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CAACGCCCACAGGTCAGGAAG	0.607													ENSG00000164078																																					0													61.0	67.0	65.0					3																	49936073		2203	4300	6503	SO:0001583	missense	0			-	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.1597T>A	3.37:g.49936073A>T	ENSP00000296474:p.Cys533Ser		B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.C533S	ENST00000296474.3	37	c.1597	CCDS2807.1	3	.	.	.	.	.	.	.	.	.	.	A	28.0	4.886226	0.91814	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.60171	0.21;0.21	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.81408	0.4816	M	0.92026	3.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.996	D	0.85767	0.1353	10	0.87932	D	0	-13.3639	16.2118	0.82165	1.0:0.0:0.0:0.0	.	427;533;533;533	Q04912-4;Q04912-6;Q04912-5;Q04912	.;.;.;RON_HUMAN	S	533	ENSP00000296474:C533S;ENSP00000341325:C533S	ENSP00000296474:C533S	C	-	1	0	MST1R	49911077	1.000000	0.71417	0.997000	0.53966	0.931000	0.56810	8.290000	0.89925	2.234000	0.73211	0.402000	0.26972	TGT	-	MST1R	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,superfamily_Plexin-like_fold,smart_Plexin-like_fold		0.607	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MST1R	HGNC	protein_coding	OTTHUMT00000345403.1	0	0	1	62	62	67	0.00	1.47	A			49936073	-1	7	8	54	50	tier1	no_errors	ENST00000296474	ensembl	human	known	74_37	missense	11.29	13.79	SNP	1.000	T	7	54
GGT1	2678	genome.wustl.edu	37	22	24988289	24988289	+	Intron	SNP	T	T	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr22:24988289T>A	ENST00000248923.4	+	1	59				FAM211B_ENST00000495297.1_5'Flank|FAM211B_ENST00000318753.8_Intron	NM_013430.2	NP_038347.2	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1						arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	GAACTGGTGATGCATGGATGG	0.597													ENSG00000178026																																					0																																										SO:0001627	intron_variant	0			-	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000248923.4:c.-429+8513T>A	22.37:g.24988289T>A			Q08247|Q14404|Q8TBS1|Q9UMK1	R	SNP	-	NULL	ENST00000248923.4	37	NULL	CCDS42992.1	22																																																																																			-	FAM211B	-	-		0.597	GGT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM211B	HGNC	protein_coding	OTTHUMT00000319110.1	0	0	0	98	98	95	0.00	0.00	T	NM_013430		24988289	-1	19	15	46	47	tier1	no_errors	ENST00000464490	ensembl	human	known	74_37	rna	29.23	24.19	SNP	0.000	A	19	46
TTN	7273	genome.wustl.edu	37	2	179632770	179632770	+	Missense_Mutation	SNP	T	T	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr2:179632770T>A	ENST00000591111.1	-	39	9500	c.9276A>T	c.(9274-9276)aaA>aaT	p.K3092N	TTN_ENST00000360870.5_Missense_Mutation_p.K3092N|TTN_ENST00000342175.6_Missense_Mutation_p.K3046N|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K3046N|TTN_ENST00000342992.6_Missense_Mutation_p.K3092N|TTN_ENST00000589042.1_Missense_Mutation_p.K3092N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K3046N			Q8WZ42	TITIN_HUMAN	titin	13424	Ig-like 18.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTGGTCATCTTTCATCCACT	0.413													ENSG00000155657																																					0													163.0	142.0	149.0					2																	179632770		2203	4300	6503	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9276A>T	2.37:g.179632770T>A	ENSP00000465570:p.Lys3092Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K3092N	ENST00000591111.1	37	c.9276		2	.	.	.	.	.	.	.	.	.	.	T	9.063	0.995017	0.19043	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.08102	3.13;3.13;3.13;3.13;3.13	5.73	3.37	0.38596	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38453	0.1041	H	0.96518	3.835	0.27189	N	0.960476	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.998;0.998;0.999	T	0.36529	-0.9744	9	0.87932	D	0	.	8.3771	0.32449	0.0:0.302:0.0:0.698	.	3046;3046;3046;3092;3092	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	N	3092;3046;3046;3046;3046;3092	ENSP00000343764:K3092N;ENSP00000434586:K3046N;ENSP00000340554:K3046N;ENSP00000352154:K3046N;ENSP00000354117:K3092N	ENSP00000340554:K3046N	K	-	3	2	TTN	179341015	1.000000	0.71417	1.000000	0.80357	0.263000	0.26337	0.871000	0.28023	0.532000	0.28657	0.533000	0.62120	AAA	-	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	22	22	76	0.00	0.00	T	NM_133378		179632770	-1	34	38	27	45	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	55.74	45.78	SNP	1.000	A	34	27
PAPPA	5069	genome.wustl.edu	37	9	119065139	119065139	+	Silent	SNP	C	C	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr9:119065139C>T	ENST00000328252.3	+	10	3426	c.3057C>T	c.(3055-3057)ttC>ttT	p.F1019F	PAPPA_ENST00000534838.1_Silent_p.F57F|RP11-45A16.4_ENST00000451100.1_RNA	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1019					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CCCAGGGATTCCTGGATCAGT	0.517													ENSG00000182752																																					0													125.0	109.0	114.0					9																	119065139		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3057C>T	9.37:g.119065139C>T			B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.F1019	ENST00000328252.3	37	c.3057	CCDS6813.1	9																																																																																			-	PAPPA	-	NULL		0.517	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	0	0	0	50	50	89	0.00	0.00	C	NM_002581		119065139	+1	14	32	55	80	tier1	no_errors	ENST00000328252	ensembl	human	known	74_37	silent	20.29	28.57	SNP	1.000	T	14	55
ZNF236	7776	genome.wustl.edu	37	18	74589967	74589967	+	Silent	SNP	C	C	G			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr18:74589967C>G	ENST00000253159.8	+	7	1035	c.837C>G	c.(835-837)gtC>gtG	p.V279V	ZNF236_ENST00000320610.9_Silent_p.V281V	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	279					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TCTTTAAGGTCAAGAATGGTC	0.303													ENSG00000130856																																					0													53.0	49.0	50.0					18																	74589967		1815	4075	5890	SO:0001819	synonymous_variant	0			-	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.837C>G	18.37:g.74589967C>G			B2RTX9|Q9UL37	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V279	ENST00000253159.8	37	c.837	CCDS42447.1	18																																																																																			-	ZNF236	-	pfscan_Znf_C2H2		0.303	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	0	0	0	26	26	72	0.00	0.00	C			74589967	+1	18	23	84	116	tier1	no_errors	ENST00000253159	ensembl	human	known	74_37	silent	17.65	16.55	SNP	1.000	G	18	84
ZNF552	79818	genome.wustl.edu	37	19	58319790	58319790	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr19:58319790G>A	ENST00000391701.1	-	3	1011	c.842C>T	c.(841-843)tCc>tTc	p.S281F	ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	281					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		AAGGAGGTGGGACTTACTGTT	0.408													ENSG00000178935																																					0													70.0	64.0	66.0					19																	58319790		2203	4300	6503	SO:0001583	missense	0			-	AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.842C>T	19.37:g.58319790G>A	ENSP00000375582:p.Ser281Phe		B3KUE9|Q6P5A6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S281F	ENST00000391701.1	37	c.842	CCDS12963.1	19	.	.	.	.	.	.	.	.	.	.	G	8.972	0.973268	0.18736	.	.	ENSG00000178935	ENST00000391701	T	0.07567	3.18	1.74	-3.49	0.04724	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11836	0.0288	M	0.84585	2.705	0.09310	N	1	P;B	0.35982	0.531;0.204	B;B	0.36885	0.154;0.235	T	0.17837	-1.0356	9	0.87932	D	0	.	4.6579	0.12628	0.0:0.1938:0.42:0.3862	.	277;281	B7Z1H1;Q9H707	.;ZN552_HUMAN	F	281	ENSP00000375582:S281F	ENSP00000375582:S281F	S	-	2	0	ZNF552	63011602	0.000000	0.05858	0.000000	0.03702	0.268000	0.26511	-3.841000	0.00353	-0.518000	0.06452	0.205000	0.17691	TCC	-	ZNF552	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.408	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF552	HGNC	protein_coding	OTTHUMT00000466829.1	0	0	0	96	96	160	0.00	0.00	G	NM_024762		58319790	-1	28	25	95	80	tier1	no_errors	ENST00000391701	ensembl	human	known	74_37	missense	22.76	23.81	SNP	0.000	A	28	95
PHYKPL	85007	genome.wustl.edu	37	5	177651522	177651522	+	Missense_Mutation	SNP	T	T	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr5:177651522T>A	ENST00000308158.5	-	6	779	c.545A>T	c.(544-546)cAc>cTc	p.H182L	PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	182						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	TGGGTTGGGGTGGTCCTCCCG	0.632													ENSG00000175309																																					0													102.0	89.0	93.0					5																	177651522		2203	4300	6503	SO:0001583	missense	0			-	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.545A>T	5.37:g.177651522T>A	ENSP00000310978:p.His182Leu		A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase	p.H182L	ENST00000308158.5	37	c.545	CCDS4434.1	5	.	.	.	.	.	.	.	.	.	.	T	13.19	2.164669	0.38217	.	.	ENSG00000175309	ENST00000308158;ENST00000323594	T;T	0.38887	2.15;1.11	6.06	4.88	0.63580	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.36110	0.0955	L	0.43152	1.355	0.80722	D	1	B;B	0.28208	0.05;0.203	B;B	0.34722	0.093;0.188	T	0.09487	-1.0672	10	0.18276	T	0.48	-14.3095	10.3566	0.43967	0.0:0.0:0.1649:0.8351	.	182;182	A8K7P6;Q8IUZ5	.;AT2L2_HUMAN	L	182;196	ENSP00000310978:H182L;ENSP00000321290:H196L	ENSP00000310978:H182L	H	-	2	0	AGXT2L2	177584128	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.875000	0.69660	1.094000	0.41399	0.533000	0.62120	CAC	-	PHYKPL	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase		0.632	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYKPL	HGNC	protein_coding	OTTHUMT00000253477.1	0	0	0	79	79	90	0.00	0.00	T	NM_032921		177651522	-1	59	35	31	20	tier1	no_errors	ENST00000308158	ensembl	human	known	74_37	missense	65.56	63.64	SNP	1.000	A	59	31
ZNF587B	100293516	genome.wustl.edu	37	19	58352520	58352520	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr19:58352520A>T	ENST00000442832.4	+	3	712	c.478A>T	c.(478-480)Agg>Tgg	p.R160W	ZNF587B_ENST00000316462.4_Missense_Mutation_p.R159W|ZNF587B_ENST00000594901.1_Missense_Mutation_p.R160W|CTD-2583A14.10_ENST00000598031.1_Intron	NM_001204818.1	NP_001191747.1	E7ETH6	Z587B_HUMAN	zinc finger protein 587B	160					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										GTTTGTGAAGAGGTGTAAGTT	0.483													ENSG00000269343																																					0																																										SO:0001583	missense	0			-	AK299091	CCDS56109.1	19q13.43	2013-01-08				ENSG00000269343		"""Zinc fingers, C2H2-type"", ""-"""	37142	protein-coding gene	gene with protein product							Standard	NM_001204818		Approved		uc021vcp.1	E7ETH6		ENST00000442832.4:c.478A>T	19.37:g.58352520A>T	ENSP00000392410:p.Arg160Trp		B4DR41	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R160W	ENST00000442832.4	37	c.478	CCDS56109.1	19	.	.	.	.	.	.	.	.	.	.	.	15.10	2.733508	0.48939	.	.	ENSG00000198466	ENST00000316462;ENST00000442832	T;T	0.05319	5.64;3.46	2.17	1.11	0.20524	.	.	.	.	.	T	0.09113	0.0225	L	0.27053	0.805	.	.	.	D;D	0.69078	0.997;0.968	P;P	0.62435	0.902;0.69	T	0.25745	-1.0123	8	0.87932	D	0	.	2.5079	0.04649	0.4044:0.2831:0.3125:0.0	.	160;110	E7ETH6;Q92967	.;.	W	159;160	ENSP00000350696:R159W;ENSP00000392410:R160W	ENSP00000350696:R159W	R	+	1	2	ZNF587	63044332	0.000000	0.05858	0.109000	0.21407	0.233000	0.25261	0.160000	0.16462	0.990000	0.38787	0.254000	0.18369	AGG	-	ZNF587B	-	NULL		0.483	ZNF587B-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	ZNF587B	HGNC	protein_coding	OTTHUMT00000466834.2	0	0	0	169	169	67	0.00	0.00	A	NM_001204818		58352520	+1	42	23	142	31	tier1	no_errors	ENST00000442832	ensembl	human	known	74_37	missense	22.83	42.59	SNP	0.026	T	42	142
SLC28A3	64078	genome.wustl.edu	37	9	86909133	86909133	+	Silent	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr9:86909133G>A	ENST00000376238.4	-	9	968	c.919C>T	c.(919-921)Ctg>Ttg	p.L307L	SLC28A3_ENST00000537648.1_Silent_p.L238L	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	307					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	CACTGCATCAGTCCCAGGTAG	0.493													ENSG00000197506																									Ovarian(106;425 1539 34835 42413 43572)												0													177.0	159.0	165.0					9																	86909133		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.919C>T	9.37:g.86909133G>A			A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Silent	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.L307	ENST00000376238.4	37	c.919	CCDS6670.1	9																																																																																			-	SLC28A3	-	pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac		0.493	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC28A3	HGNC	protein_coding	OTTHUMT00000052874.1	0	0	0	95	95	105	0.00	0.00	G	NM_022127		86909133	-1	26	26	64	54	tier1	no_errors	ENST00000376238	ensembl	human	known	74_37	silent	28.57	32.50	SNP	0.000	A	26	64
TMEM134	80194	genome.wustl.edu	37	11	67234816	67234816	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr11:67234816G>C	ENST00000308022.2	-	4	414	c.373C>G	c.(373-375)Ctg>Gtg	p.L125V	TMEM134_ENST00000541059.1_5'UTR|TMEM134_ENST00000452789.2_Missense_Mutation_p.L116V|TMEM134_ENST00000393877.3_Missense_Mutation_p.L125V	NM_001078651.1|NM_025124.2	NP_001072119.1|NP_079400.1	Q9H6X4	TM134_HUMAN	transmembrane protein 134	125						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						AAGGAGGCCAGCACCACTCGG	0.647													ENSG00000172663																																					0													50.0	54.0	52.0					11																	67234816		2200	4295	6495	SO:0001583	missense	0			-	AK025402	CCDS8167.1, CCDS41678.1	11q13.2	2006-03-09			ENSG00000172663	ENSG00000172663			26142	protein-coding gene	gene with protein product							Standard	NM_025124		Approved	FLJ21749	uc001olq.2	Q9H6X4	OTTHUMG00000168034	ENST00000308022.2:c.373C>G	11.37:g.67234816G>C	ENSP00000312615:p.Leu125Val		Q08AK4|Q6PJN3	Missense_Mutation	SNP	pfam_DUF872_TM	p.L125V	ENST00000308022.2	37	c.373	CCDS8167.1	11	.	.	.	.	.	.	.	.	.	.	G	14.94	2.684407	0.47991	.	.	ENSG00000172663	ENST00000393877;ENST00000308022;ENST00000452789;ENST00000544903	.	.	.	4.37	4.37	0.52481	.	0.093398	0.44483	D	0.000456	T	0.70107	0.3186	L	0.59436	1.845	0.36666	D	0.878218	D;D;D;D	0.63046	0.99;0.987;0.974;0.992	P;P;D;D	0.76071	0.829;0.738;0.953;0.987	T	0.75451	-0.3313	9	0.46703	T	0.11	.	12.4003	0.55410	0.0:0.0:1.0:0.0	.	116;125;125;125	B4DLG6;Q9H6X4-3;Q9H6X4-2;Q9H6X4	.;.;.;TM134_HUMAN	V	125;125;116;166	.	ENSP00000312615:L125V	L	-	1	2	TMEM134	66991392	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	1.437000	0.34991	1.992000	0.58205	0.289000	0.19496	CTG	-	TMEM134	-	pfam_DUF872_TM		0.647	TMEM134-020	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TMEM134	HGNC	protein_coding	OTTHUMT00000398994.1	0	0	0	145	145	91	0.00	0.00	G	NM_025124		67234816	-1	29	19	48	21	tier1	no_errors	ENST00000545682	ensembl	human	known	74_37	missense	37.66	47.50	SNP	1.000	C	29	48
LOC101928517	101928517	genome.wustl.edu	37	19	51670884	51670884	+	RNA	SNP	C	C	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr19:51670884C>A	ENST00000600074.1	-	0	493				SIGLEC17P_ENST00000598286.1_RNA																							AAGATTCTACCCCTGCTTATG	0.552													ENSG00000171101																																					0																																												0			-																													19.37:g.51670884C>A				R	SNP	-	NULL	ENST00000600074.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	.	0.842	-0.741470	0.03088	.	.	ENSG00000171101	ENST00000305812	.	.	.	2.81	-1.24	0.09435	.	.	.	.	.	T	0.27697	0.0681	.	.	.	.	.	.	.	.	.	.	.	.	T	0.29671	-1.0004	4	0.38643	T	0.18	.	1.4168	0.02303	0.2165:0.4341:0.2121:0.1372	.	.	.	.	T	57	.	ENSP00000303760:P57T	P	+	1	0	AC063977.1	56362696	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.317000	0.00254	-0.414000	0.07495	-0.570000	0.04155	CCC	-	SIGLEC17P	-	-		0.552	CTD-3187F8.14-001	KNOWN	basic	antisense	SIGLEC17P	HGNC	antisense	OTTHUMT00000465635.1	0	0	0	58	58	115	0.00	0.00	C			51670884	+1	12	24	58	50	tier1	no_errors	ENST00000341811	ensembl	human	known	74_37	rna	17.14	32.43	SNP	0.000	A	12	58
TBC1D2B	23102	genome.wustl.edu	37	15	78316558	78316558	+	Silent	SNP	C	C	T	rs201179221		TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr15:78316558C>T	ENST00000300584.3	-	6	1409	c.1410G>A	c.(1408-1410)gcG>gcA	p.A470A	TBC1D2B_ENST00000409931.3_Silent_p.A470A	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	470							Rab GTPase activator activity (GO:0005097)			breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						GGGAGCTGGGCGCCACGGTGG	0.617													ENSG00000167202	C|||	1	0.000199681	0.0	0.0014	5008	,	,		19628	0.0		0.0	False		,,,				2504	0.0																0								C	,	0,4392		0,0,2196	55.0	46.0	49.0		1410,1410	-8.8	0.0	15		49	1,8585	1.2+/-3.3	0,1,4292	no	coding-synonymous,coding-synonymous	TBC1D2B	NM_015079.5,NM_144572.1	,	0,1,6488	TT,TC,CC		0.0116,0.0,0.0077	,	470/915,470/964	78316558	1,12977	2196	4293	6489	SO:0001819	synonymous_variant	0			GMAF=0.0005	AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.1410G>A	15.37:g.78316558C>T			A7MD42|Q8N1F9|Q9NXM0	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Prefoldin,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.A470	ENST00000300584.3	37	c.1410	CCDS45314.1	15	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	5.972	0.363217	0.11296	0.0	1.16E-4	ENSG00000167202	ENST00000418039	.	.	.	4.65	-8.8	0.00817	.	.	.	.	.	T	0.22437	0.0541	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.24368	-1.0162	4	.	.	.	.	6.041	0.19734	0.0911:0.1267:0.1672:0.615	.	.	.	.	H	352	.	.	R	-	2	0	TBC1D2B	76103613	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.536000	0.02208	-1.580000	0.01644	-1.430000	0.01095	CGC	rs201179221	TBC1D2B	-	superfamily_Prefoldin		0.617	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D2B	HGNC	protein_coding	OTTHUMT00000328369.3	0	0	0	91	91	18	0.00	0.00	C	NM_015079		78316558	-1	31	9	111	20	tier1	no_errors	ENST00000300584	ensembl	human	known	74_37	silent	21.83	30.00	SNP	0.000	T	31	111
PCDHA3	56145	genome.wustl.edu	37	5	140181783	140181783	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr5:140181783G>A	ENST00000522353.2	+	1	1001	c.1001G>A	c.(1000-1002)tGc>tAc	p.C334Y	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.C334Y|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	334	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGATCACTGCACAGTTCTA	0.383													ENSG00000255408																																					0													177.0	175.0	176.0					5																	140181783		2203	4300	6503	SO:0001583	missense	0			-	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1001G>A	5.37:g.140181783G>A	ENSP00000429808:p.Cys334Tyr		O75286	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.C334Y	ENST00000522353.2	37	c.1001	CCDS54915.1	5	.	.	.	.	.	.	.	.	.	.	g	13.27	2.186303	0.38609	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.51817	0.69;0.69	4.79	4.79	0.61399	Cadherin (4);Cadherin-like (1);	0.000000	0.45867	U	0.000327	D	0.82577	0.5067	H	0.99130	4.44	0.32605	N	0.525399	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.91347	0.5101	10	0.87932	D	0	.	18.1862	0.89793	0.0:0.0:1.0:0.0	.	334;334	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	Y	334	ENSP00000429808:C334Y;ENSP00000434086:C334Y	ENSP00000429808:C334Y	C	+	2	0	PCDHA3	140161967	0.992000	0.36948	1.000000	0.80357	0.528000	0.34623	3.404000	0.52623	2.378000	0.81104	0.467000	0.42956	TGC	-	PCDHA3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.383	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	HGNC	protein_coding	OTTHUMT00000372848.2	0	0	1	43	43	127	0.00	0.78	G	NM_018906		140181783	+1	16	32	41	105	tier1	no_errors	ENST00000522353	ensembl	human	known	74_37	missense	28.07	23.36	SNP	1.000	A	16	41
AQP4	361	genome.wustl.edu	37	18	24436238	24436238	+	Silent	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr18:24436238G>A	ENST00000383168.4	-	5	1037	c.909C>T	c.(907-909)gaC>gaT	p.D303D	AQP4_ENST00000581374.1_Silent_p.D281D|AQP4-AS1_ENST00000579964.1_RNA|AQP4_ENST00000583022.1_5'Flank|AQP4-AS1_ENST00000582605.1_RNA|AQP4_ENST00000440832.3_Silent_p.D281D	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	P55087	AQP4_HUMAN	aquaporin 4	303					carbon dioxide transport (GO:0015670)|cellular response to estradiol stimulus (GO:0071392)|cellular response to interferon-gamma (GO:0071346)|female pregnancy (GO:0007565)|hyperosmotic salinity response (GO:0042538)|multicellular organismal water homeostasis (GO:0050891)|protein homooligomerization (GO:0051260)|renal water absorption (GO:0070295)|response to glucocorticoid (GO:0051384)|response to radiation (GO:0009314)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)	porin activity (GO:0015288)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(2)|large_intestine(3)|lung(5)|skin(1)	11	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					CCCGGTCAACGTCAATCACAT	0.488													ENSG00000171885																																					0													346.0	294.0	312.0					18																	24436238		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U63622	CCDS11889.1, CCDS58617.1	18q11.2-q12.1	2005-09-20			ENSG00000171885	ENSG00000171885		"""Ion channels / Aquaporins"""	637	protein-coding gene	gene with protein product		600308				7528931	Standard	NM_001650		Approved	MIWC	uc002kwa.3	P55087	OTTHUMG00000131955	ENST00000383168.4:c.909C>T	18.37:g.24436238G>A			P78564	Silent	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	p.D303	ENST00000383168.4	37	c.909	CCDS11889.1	18																																																																																			-	AQP4	-	NULL		0.488	AQP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP4	HGNC	protein_coding	OTTHUMT00000254914.2	0	0	0	80	80	99	0.00	0.00	G	NM_001650, NM_004028		24436238	-1	23	43	110	116	tier1	no_errors	ENST00000383168	ensembl	human	known	74_37	silent	17.29	27.04	SNP	0.998	A	23	110
CHD8	57680	genome.wustl.edu	37	14	21861844	21861844	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr14:21861844G>T	ENST00000557364.1	-	32	6373	c.6110C>A	c.(6109-6111)aCc>aAc	p.T2037N	SNORD9_ENST00000362566.1_RNA|CHD8_ENST00000555962.1_5'Flank|CHD8_ENST00000430710.3_Missense_Mutation_p.T1758N|CHD8_ENST00000399982.2_Missense_Mutation_p.T2037N			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2037					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTCTTGTGGGGTTGGTCGGCT	0.552													ENSG00000100888																																					0													58.0	60.0	59.0					14																	21861844		2001	4170	6171	SO:0001583	missense	0			-	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.6110C>A	14.37:g.21861844G>T	ENSP00000451601:p.Thr2037Asn		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.T2037N	ENST00000557364.1	37	c.6110	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262713	0.23051	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	T;T;T	0.70749	-0.51;-0.51;-0.51	5.26	3.46	0.39613	.	0.482752	0.23191	N	0.050916	T	0.41650	0.1168	N	0.08118	0	0.26397	N	0.976483	B	0.32620	0.378	B	0.26969	0.075	T	0.20874	-1.0262	10	0.18710	T	0.47	-4.0883	5.6322	0.17516	0.1719:0.1608:0.6673:0.0	.	1758	Q9HCK8-2	.	N	1758;2037;1757;2037	ENSP00000406288:T1758N;ENSP00000382863:T2037N;ENSP00000451601:T2037N	ENSP00000262707:T1757N	T	-	2	0	CHD8	20931684	0.951000	0.32395	1.000000	0.80357	0.987000	0.75469	0.374000	0.20501	0.811000	0.34303	-0.244000	0.11960	ACC	-	CHD8	-	NULL		0.552	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	0	0	0	63	63	80	0.00	0.00	G	NM_020920		21861844	-1	24	18	96	114	tier1	no_errors	ENST00000399982	ensembl	human	known	74_37	missense	20.00	13.64	SNP	0.980	T	24	96
FGR	2268	genome.wustl.edu	37	1	27943478	27943478	+	Missense_Mutation	SNP	C	C	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr1:27943478C>A	ENST00000374005.3	-	7	860	c.572G>T	c.(571-573)aGa>aTa	p.R191I	FGR_ENST00000545953.1_Missense_Mutation_p.R125I|FGR_ENST00000374004.1_Missense_Mutation_p.R191I|FGR_ENST00000399173.1_Missense_Mutation_p.R191I	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	191	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		ATGATCGCCTCTGGTCTGATC	0.557													ENSG00000000938																																					0													135.0	121.0	126.0					1																	27943478		2203	4300	6503	SO:0001583	missense	0			-	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.572G>T	1.37:g.27943478C>A	ENSP00000363117:p.Arg191Ile		D3DPL7|Q9UIQ3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.R191I	ENST00000374005.3	37	c.572	CCDS305.1	1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713989	0.68730	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	T;T;T;T;T;T	0.79247	-0.84;-0.8;-0.84;-0.84;-0.84;-1.25	4.38	1.79	0.24919	SH2 motif (4);	0.302624	0.26518	N	0.023935	T	0.75280	0.3828	L	0.58583	1.82	0.35142	D	0.768943	B	0.33694	0.421	B	0.42593	0.392	T	0.77534	-0.2552	10	0.72032	D	0.01	.	7.1712	0.25719	0.0:0.6305:0.0:0.3695	.	191	P09769	FGR_HUMAN	I	191;125;191;191;191;191	ENSP00000363117:R191I;ENSP00000445302:R125I;ENSP00000382126:R191I;ENSP00000363116:R191I;ENSP00000363115:R191I;ENSP00000407670:R191I	ENSP00000363115:R191I	R	-	2	0	FGR	27816065	1.000000	0.71417	0.882000	0.34594	0.981000	0.71138	4.210000	0.58500	0.475000	0.27415	0.491000	0.48974	AGA	-	FGR	-	pfam_SH2,smart_SH2,pfscan_SH2		0.557	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGR	HGNC	protein_coding	OTTHUMT00000009772.1	0	0	0	117	117	128	0.00	0.00	C	NM_005248		27943478	-1	23	26	26	37	tier1	no_errors	ENST00000374003	ensembl	human	known	74_37	missense	46.94	41.27	SNP	0.997	A	23	26
FCRL5	83416	genome.wustl.edu	37	1	157497702	157497702	+	Intron	SNP	G	G	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr1:157497702G>T	ENST00000361835.3	-	9	1839				FCRL5_ENST00000368191.3_Intron|FCRL5_ENST00000368190.3_Intron|FCRL5_ENST00000356953.4_Intron	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5						negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GAGAAAATGAGTTAGGGACAC	0.478													ENSG00000143297																																					0													37.0	42.0	40.0					1																	157497702		2202	4298	6500	SO:0001627	intron_variant	0			-	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1682-17C>A	1.37:g.157497702G>T			A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	R	SNP	-	NULL	ENST00000361835.3	37	NULL	CCDS1165.1	1																																																																																			-	FCRL5	-	-		0.478	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	0	0	0	15	15	25	0.00	0.00	G	NM_031281		157497702	-1	20	11	30	26	tier1	no_errors	ENST00000497286	ensembl	human	known	74_37	rna	40.00	29.73	SNP	0.008	T	20	30
ATF4P4	100127952	genome.wustl.edu	37	11	113660197	113660197	+	RNA	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr11:113660197G>A	ENST00000393544.2	+	0	245									activating transcription factor 4 pseudogene 4																		TGCTGAACGCGGTGTGCAAGA	0.627													ENSG00000256167																																					0																																												0			-			11q23.2	2011-09-02	2010-12-16	2010-12-16	ENSG00000256167	ENSG00000256167			787	pseudogene	pseudogene			"""activating transcription factor 4B"""	ATF4B		10610718	Standard	NG_021835		Approved				OTTHUMG00000168194		11.37:g.113660197G>A				R	SNP	-	NULL	ENST00000393544.2	37	NULL		11																																																																																			-	ATF4P4	-	-		0.627	ATF4P4-002	KNOWN	basic	processed_transcript	ATF4P4	HGNC	pseudogene	OTTHUMT00000398707.1	0	0	0	79	79	9	0.00	0.00	G	NG_021835		113660197	+1	55	6	64	4	tier1	no_errors	ENST00000393544	ensembl	human	known	74_37	rna	46.22	60.00	SNP	0.998	A	55	64
CLEC4G	339390	genome.wustl.edu	37	19	7796175	7796175	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr19:7796175C>T	ENST00000328853.5	-	3	265	c.197G>A	c.(196-198)gGc>gAc	p.G66D	CLEC4G_ENST00000598081.1_5'UTR	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G	66						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(1)	6						CAGGTCGTGGCCGTCAAGCAG	0.721													ENSG00000182566																									Esophageal Squamous(146;540 1807 3349 19438 30853)												0													6.0	7.0	7.0					19																	7796175		2152	4226	6378	SO:0001583	missense	0			-	AY358431	CCDS12185.1	19p13.2	2010-04-27	2008-11-04			ENSG00000182566		"""C-type lectin domain containing"""	24591	protein-coding gene	gene with protein product			"""C-type lectin superfamily 4, member G"""			12975309	Standard	NM_198492		Approved	UNQ431, LSECtin	uc002mhp.4	Q6UXB4		ENST00000328853.5:c.197G>A	19.37:g.7796175C>T	ENSP00000327599:p.Gly66Asp			Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.G66D	ENST00000328853.5	37	c.197	CCDS12185.1	19	.	.	.	.	.	.	.	.	.	.	C	9.997	1.232289	0.22626	.	.	ENSG00000182566	ENST00000328853	T	0.00922	5.54	3.35	-3.18	0.05186	.	1.406470	0.05485	N	0.555454	T	0.00695	0.0023	N	0.22421	0.69	0.09310	N	1	B	0.33073	0.396	B	0.29785	0.107	T	0.47849	-0.9085	10	0.12430	T	0.62	.	5.1991	0.15254	0.1805:0.5309:0.0:0.2885	.	66	Q6UXB4	CLC4G_HUMAN	D	66	ENSP00000327599:G66D	ENSP00000327599:G66D	G	-	2	0	CLEC4G	7702175	0.002000	0.14202	0.000000	0.03702	0.006000	0.05464	-0.388000	0.07352	-0.854000	0.04131	0.455000	0.32223	GGC	-	CLEC4G	-	NULL		0.721	CLEC4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4G	HGNC	protein_coding	OTTHUMT00000461989.1	0	0	0	14	14	10	0.00	0.00	C	NM_198492		7796175	-1	9	2	9	4	tier1	no_errors	ENST00000328853	ensembl	human	known	74_37	missense	50.00	33.33	SNP	0.000	T	9	9
KRT27	342574	genome.wustl.edu	37	17	38936017	38936017	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr17:38936017G>A	ENST00000301656.3	-	4	821	c.781C>T	c.(781-783)Cga>Tga	p.R261*	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TACTCAGCTCGCATATTGTTC	0.607													ENSG00000171446																																					0													50.0	50.0	50.0					17																	38936017		2203	4300	6503	SO:0001587	stop_gained	0			-	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.781C>T	17.37:g.38936017G>A	ENSP00000301656:p.Arg261*			Nonsense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.R261*	ENST00000301656.3	37	c.781	CCDS11375.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.279319	0.95489	.	.	ENSG00000171446	ENST00000301656	.	.	.	5.47	1.82	0.25136	.	0.000000	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0488	0.58942	0.0:0.0:0.3576:0.6424	.	.	.	.	X	261	.	ENSP00000301656:R261X	R	-	1	2	KRT27	36189543	0.699000	0.27786	0.991000	0.47740	0.814000	0.46013	-0.216000	0.09266	0.767000	0.33267	0.580000	0.79431	CGA	-	KRT27	-	pfam_IF,superfamily_Prefoldin,prints_Keratin_I		0.607	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT27	HGNC	protein_coding	OTTHUMT00000257216.1	0	0	0	41	41	16	0.00	0.00	G	NM_181537		38936017	-1	22	4	15	2	tier1	no_errors	ENST00000301656	ensembl	human	known	74_37	nonsense	59.46	66.67	SNP	1.000	A	22	15
NKTR	4820	genome.wustl.edu	37	3	42661510	42661510	+	Intron	SNP	A	A	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr3:42661510A>T	ENST00000232978.8	+	5	474				RP4-613B23.1_ENST00000438017.1_RNA|NKTR_ENST00000442970.1_Missense_Mutation_p.N97Y|RP4-613B23.1_ENST00000445452.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor						protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		GTTTATAGAGAATGTGGTCTT	0.363													ENSG00000114857																																					0																																										SO:0001627	intron_variant	0			-		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.286+310A>T	3.37:g.42661510A>T				Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.N97Y	ENST00000232978.8	37	c.289	CCDS2702.1	3	.	.	.	.	.	.	.	.	.	.	A	14.14	2.446520	0.43429	.	.	ENSG00000114857	ENST00000442970;ENST00000445842	T;T	0.42513	0.97;0.97	5.31	5.31	0.75309	.	.	.	.	.	T	0.39091	0.1065	.	.	.	0.80722	D	1	B	0.15719	0.014	B	0.12156	0.007	T	0.25847	-1.0120	8	0.87932	D	0	.	15.547	0.76112	1.0:0.0:0.0:0.0	.	97	A8K7K2	.	Y	97	ENSP00000390259:N97Y;ENSP00000408660:N97Y	ENSP00000404802:N97Y	N	+	1	0	NKTR	42636514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.361000	0.73070	2.127000	0.65507	0.528000	0.53228	AAT	-	NKTR	-	pfscan_Cyclophilin-like_PPIase_dom		0.363	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	HGNC	protein_coding	OTTHUMT00000256642.2	0	0	0	15	15	48	0.00	0.00	A	NM_005385		42661510	+1	43	98	6	9	tier1	no_errors	ENST00000429888	ensembl	human	known	74_37	missense	87.76	91.59	SNP	1.000	T	43	6
RLTPR	146206	genome.wustl.edu	37	16	67683005	67683005	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr16:67683005G>A	ENST00000334583.6	+	18	1946	c.1618G>A	c.(1618-1620)Gtg>Atg	p.V540M	RLTPR_ENST00000545661.1_Missense_Mutation_p.V504M	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	540					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GGTGACTCTGGTGCTGGCCAT	0.622													ENSG00000159753																																					0													39.0	48.0	45.0					16																	67683005		2077	4209	6286	SO:0001583	missense	0			-	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1618G>A	16.37:g.67683005G>A	ENSP00000334958:p.Val540Met		B8X2Z3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.V540M	ENST00000334583.6	37	c.1618	CCDS45513.1	16	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887489	0.52014	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.53857	0.6;0.6	5.07	5.07	0.68467	.	0.157590	0.43260	D	0.000595	T	0.68403	0.2997	L	0.58810	1.83	0.38564	D	0.949786	D;D	0.76494	0.999;0.999	D;D	0.68765	0.956;0.96	T	0.73720	-0.3894	10	0.72032	D	0.01	-16.1018	16.2341	0.82361	0.0:0.0:1.0:0.0	.	504;540	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	M	540;504	ENSP00000334958:V540M;ENSP00000441481:V504M	ENSP00000334958:V540M	V	+	1	0	RLTPR	66240506	1.000000	0.71417	1.000000	0.80357	0.058000	0.15608	2.413000	0.44618	2.367000	0.80283	0.655000	0.94253	GTG	-	RLTPR	-	NULL		0.622	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1	0	0	0	62	62	64	0.00	0.00	G	NM_001013838		67683005	+1	30	29	6	0	tier1	no_errors	ENST00000334583	ensembl	human	known	74_37	missense	83.33	100.00	SNP	1.000	A	30	6
ZNF267	10308	genome.wustl.edu	37	16	31927666	31927666	+	Missense_Mutation	SNP	A	A	G			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr16:31927666A>G	ENST00000300870.10	+	4	2305	c.2096A>G	c.(2095-2097)tAt>tGt	p.Y699C		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	699					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						GCCTTCAGCTATAGGTCATAC	0.443													ENSG00000185947																																					0													110.0	96.0	101.0					16																	31927666		2197	4300	6497	SO:0001583	missense	0			-	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.2096A>G	16.37:g.31927666A>G	ENSP00000300870:p.Tyr699Cys		A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y699C	ENST00000300870.10	37	c.2096	CCDS32440.1	16	.	.	.	.	.	.	.	.	.	.	.	6.801	0.516886	0.13005	.	.	ENSG00000185947	ENST00000300870	T	0.19250	2.16	0.468	0.468	0.16732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13114	0.0318	N	0.25094	0.71	0.09310	N	0.999999	D	0.54601	0.967	B	0.44085	0.44	T	0.17077	-1.0381	9	0.37606	T	0.19	.	5.2175	0.15350	0.9999:0.0:1.0E-4:0.0	.	699	Q14586	ZN267_HUMAN	C	699	ENSP00000300870:Y699C	ENSP00000300870:Y699C	Y	+	2	0	ZNF267	31835167	0.000000	0.05858	0.037000	0.18230	0.034000	0.12701	-0.386000	0.07370	0.413000	0.25759	0.402000	0.26972	TAT	-	ZNF267	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	0	0	0	10	10	38	0.00	0.00	A	NM_003414		31927666	+1	39	54	9	6	tier1	no_errors	ENST00000300870	ensembl	human	known	74_37	missense	81.25	90.00	SNP	0.000	G	39	9
VPS9D1	9605	genome.wustl.edu	37	16	89784447	89784447	+	Intron	SNP	T	T	G			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr16:89784447T>G	ENST00000389386.3	-	2	300				VPS9D1-AS1_ENST00000562866.1_RNA|VPS9D1-AS1_ENST00000562298.1_RNA|ZNF276_ENST00000446326.2_5'Flank|ZNF276_ENST00000568064.1_5'Flank|VPS9D1_ENST00000561976.1_Intron|ZNF276_ENST00000289816.5_5'Flank	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1						ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										CTGACCTCTGTGATCCCACGT	0.647													ENSG00000261373																																					0																																										SO:0001627	intron_variant	0			-	AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.175+987A>C	16.37:g.89784447T>G				R	SNP	-	NULL	ENST00000389386.3	37	NULL	CCDS42220.1	16																																																																																			-	VPS9D1-AS1	-	-		0.647	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	VPS9D1-AS1	HGNC	protein_coding	OTTHUMT00000422508.1	0	0	0	294	294	27	0.00	0.00	T	NM_004913		89784447	+1	279	7	25	1	tier1	no_errors	ENST00000562298	ensembl	human	known	74_37	rna	91.78	87.50	SNP	0.003	G	279	25
CCDC146	57639	genome.wustl.edu	37	7	76916777	76916777	+	Silent	SNP	G	G	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr7:76916777G>A	ENST00000285871.4	+	17	2425	c.2298G>A	c.(2296-2298)aaG>aaA	p.K766K	CCDC146_ENST00000431197.1_Silent_p.K480K|CCDC146_ENST00000415740.2_3'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	766										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AACTGGCCAAGAAGGAGGAGA	0.433													ENSG00000135205																																					0													86.0	86.0	86.0					7																	76916777		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.2298G>A	7.37:g.76916777G>A			A8K8X6|Q9P223	Silent	SNP	NULL	p.K766	ENST00000285871.4	37	c.2298	CCDS34671.1	7																																																																																			-	CCDC146	-	NULL		0.433	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	HGNC	protein_coding	OTTHUMT00000341449.1	0	0	0	22	22	59	0.00	0.00	G	NM_020879		76916777	+1	7	4	17	58	tier1	no_errors	ENST00000285871	ensembl	human	known	74_37	silent	29.17	6.45	SNP	1.000	A	7	17
ZNF578	147660	genome.wustl.edu	37	19	53014787	53014787	+	Missense_Mutation	SNP	A	A	T	rs35356792	byFrequency	TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr19:53014787A>T	ENST00000421239.2	+	6	1397	c.1153A>T	c.(1153-1155)Acc>Tcc	p.T385S	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		TCAAAATTCAACCCTTGTAAT	0.378													ENSG00000258405																																					0													96.0	101.0	99.0					19																	53014787		2203	4299	6502	SO:0001583	missense	0			-	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.1153A>T	19.37:g.53014787A>T	ENSP00000459216:p.Thr385Ser		B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T385S	ENST00000421239.2	37	c.1153	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	-	0.004	-2.282060	0.00251	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.48	-2.97	0.05530	.	.	.	.	.	T	0.09069	0.0224	N	0.02357	-0.585	0.09310	N	1	B	0.24426	0.103	B	0.28011	0.085	T	0.21655	-1.0239	7	.	.	.	.	0.5818	0.00713	0.4441:0.1578:0.131:0.2671	.	385	G3V4F6	.	S	385	.	.	T	+	1	0	ZNF578	57706599	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-13.157000	0.00001	-1.870000	0.01139	0.246000	0.17985	ACC	-	ZNF578	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	HGNC	protein_coding	OTTHUMT00000344298.3	0	0	0	117	117	91	0.00	0.00	A	NM_152472		53014787	+1	32	7	121	69	tier1	no_errors	ENST00000421239	ensembl	human	known	74_37	missense	20.92	9.21	SNP	0.000	T	32	121
MSX2	4488	genome.wustl.edu	37	5	174156457	174156457	+	Silent	SNP	C	C	A			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr5:174156457C>A	ENST00000239243.6	+	2	802	c.675C>A	c.(673-675)ccC>ccA	p.P225P		NM_002449.4	NP_002440.2	P35548	MSX2_HUMAN	msh homeobox 2	225					activation of meiosis (GO:0090427)|anagen (GO:0042640)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone trabecula formation (GO:0060346)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte development (GO:0002063)|cranial suture morphogenesis (GO:0060363)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|enamel mineralization (GO:0070166)|endochondral bone growth (GO:0003416)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|frontal suture morphogenesis (GO:0060364)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of catagen (GO:0051795)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of osteoblast differentiation (GO:0045669)|signal transduction involved in regulation of gene expression (GO:0023019)|wound healing, spreading of epidermal cells (GO:0035313)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TCCCTTTCCCCATCAGCTCGC	0.572													ENSG00000120149																																					0													64.0	63.0	63.0					5																	174156457		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D26145	CCDS4392.1	5q35.2	2011-06-20	2006-11-21		ENSG00000120149	ENSG00000120149		"""Homeoboxes / ANTP class : NKL subclass"""	7392	protein-coding gene	gene with protein product	"""craniosynostosis, type 2"""	123101	"""msh (Drosophila) homeo box homolog 2"", ""parietal foramina 1"", ""msh homeobox homolog 2 (Drosophila)"""	PFM1		8668339, 8786091	Standard	XM_006714868		Approved	CRS2, FPP, HOX8, MSH, PFM	uc003mcy.3	P35548	OTTHUMG00000130556	ENST00000239243.6:c.675C>A	5.37:g.174156457C>A			D3DQN1|Q53XM4|Q9UD60	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.P225	ENST00000239243.6	37	c.675	CCDS4392.1	5																																																																																			-	MSX2	-	NULL		0.572	MSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSX2	HGNC	protein_coding	OTTHUMT00000252981.3	0	0	0	87	87	96	0.00	0.00	C			174156457	+1	11	4	85	60	tier1	no_errors	ENST00000239243	ensembl	human	known	74_37	silent	11.46	6.25	SNP	1.000	A	11	85
KIAA1456	57604	genome.wustl.edu	37	8	12848476	12848476	+	De_novo_Start_InFrame	SNP	A	A	T			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr8:12848476A>T	ENST00000524591.2	+	0	424				KIAA1456_ENST00000528753.2_De_novo_Start_InFrame|KIAA1456_ENST00000528335.1_3'UTR|KIAA1456_ENST00000447063.2_De_novo_Start_InFrame|KIAA1456_ENST00000400069.3_De_novo_Start_OutOfFrame	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456								methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						CACTCTCTGGAGGTGGAGACT	0.418													ENSG00000250305																																					0																																												0			-	BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477		8.37:g.12848476A>T			Q96AW6	R	SNP	-	NULL	ENST00000524591.2	37	NULL	CCDS47808.1	8																																																																																			-	KIAA1456	-	-		0.418	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1456	HGNC	protein_coding	OTTHUMT00000383262.2	0	0	2	49	49	107	0.00	1.83	A	NM_001099677		12848476	+1	40	48	7	6	tier1	no_errors	ENST00000528335	ensembl	human	known	74_37	rna	85.11	88.89	SNP	0.000	T	40	7
KRTAP5-3	387266	genome.wustl.edu	37	11	1629046	1629046	+	Silent	SNP	G	G	A	rs12808755		TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr11:1629046G>A	ENST00000399685.1	-	1	647	c.570C>T	c.(568-570)tgC>tgT	p.C190C		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	190	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		agcagggtttgcagcagctgg	0.622													ENSG00000196224																																					0													161.0	162.0	162.0					11																	1629046		2202	4290	6492	SO:0001819	synonymous_variant	0			-	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.570C>T	11.37:g.1629046G>A			Q6PL44|Q701N3	Silent	SNP	NULL	p.C190	ENST00000399685.1	37	c.570	CCDS41591.1	11																																																																																			rs12808755	KRTAP5-3	-	NULL		0.622	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-3	HGNC	protein_coding	OTTHUMT00000127924.1	1	1	0	185	185	4	0.54	0.00	G			1629046	-1	5	1	25	0	tier1	no_errors	ENST00000399685	ensembl	human	known	74_37	silent	16.67	100.00	SNP	0.064	A	5	25
SERPINH1	871	genome.wustl.edu	37	11	75277570	75277570	+	Missense_Mutation	SNP	C	C	G			TCGA-HB-A43Z-01A-11D-A24N-09	TCGA-HB-A43Z-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	16d33e09-2e21-4da2-8e57-e78ce28c4408	33ac805d-038d-4238-8f33-54634f71015e	g.chr11:75277570C>G	ENST00000524558.1	+	2	1611	c.176C>G	c.(175-177)gCc>gGc	p.A59G	SERPINH1_ENST00000533603.1_Missense_Mutation_p.A59G|SERPINH1_ENST00000525876.1_5'Flank|SERPINH1_ENST00000358171.3_Missense_Mutation_p.A59G|SERPINH1_ENST00000530284.1_Missense_Mutation_p.A59G			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	59					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					CAGGCCATGGCCAAGGACCAG	0.692													ENSG00000149257																																					0													48.0	34.0	38.0					11																	75277570		2200	4292	6492	SO:0001583	missense	0			-	X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.176C>G	11.37:g.75277570C>G	ENSP00000434412:p.Ala59Gly		B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.A59G	ENST00000524558.1	37	c.176	CCDS8239.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166501	0.78339	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000526242;ENST00000526397;ENST00000421448;ENST00000529643;ENST00000530284;ENST00000532356;ENST00000524558;ENST00000528990;ENST00000533449;ENST00000525611;ENST00000528760	D;D;D;D;D;D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	4.76	4.76	0.60689	Serpin domain (3);	0.055117	0.64402	D	0.000001	D	0.86669	0.5988	L	0.41415	1.275	0.80722	D	1	D;D	0.67145	0.993;0.996	P;P	0.62560	0.841;0.904	T	0.82995	-0.0180	10	0.17832	T	0.49	.	15.3136	0.74056	0.0:1.0:0.0:0.0	.	59;59	E9PPV6;P50454	.;SERPH_HUMAN	G	59;59;34;59;59;59;59;59;59;59;59;59;59	ENSP00000434657:A59G;ENSP00000350894:A59G;ENSP00000431384:A34G;ENSP00000434964:A59G;ENSP00000435936:A59G;ENSP00000436305:A59G;ENSP00000436040:A59G;ENSP00000434412:A59G;ENSP00000431827:A59G;ENSP00000435452:A59G;ENSP00000437108:A59G	ENSP00000350894:A59G	A	+	2	0	SERPINH1	74955218	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.569000	0.82380	2.470000	0.83445	0.563000	0.77884	GCC	-	SERPINH1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.692	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINH1	HGNC	protein_coding	OTTHUMT00000383610.1	0	0	0	60	60	3	0.00	0.00	C	NM_004353		75277570	+1	19	0	42	1	tier1	no_errors	ENST00000358171	ensembl	human	known	74_37	missense	31.15	0.00	SNP	1.000	G	19	42
