#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
NAGPA	51172	genome.wustl.edu	37	16	5078957	5078957	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr16:5078957C>T	ENST00000312251.3	-	5	863	c.844G>A	c.(844-846)Gcc>Acc	p.A282T	NAGPA_ENST00000381955.3_Missense_Mutation_p.A282T|RP11-165E7.1_ENST00000588778.1_RNA|NAGPA_ENST00000564922.1_5'Flank	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	282					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	AGGTTGATGGCGTTGACCACG	0.597													ENSG00000103174																																					0													142.0	123.0	130.0					16																	5078957		2197	4300	6497	SO:0001583	missense	0			-	AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.844G>A	16.37:g.5078957C>T	ENSP00000310998:p.Ala282Thr		B2RAS1|Q96EJ8	Missense_Mutation	SNP	pfam_DUF2233,pfscan_EG-like_dom	p.A282T	ENST00000312251.3	37	c.844	CCDS10527.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.805560	0.96967	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	T;T	0.67171	-0.25;0.0	5.45	5.45	0.79879	.	0.108387	0.64402	D	0.000007	D	0.87525	0.6199	H	0.94582	3.555	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.90622	0.4560	10	0.72032	D	0.01	-33.1673	19.2854	0.94067	0.0:1.0:0.0:0.0	.	282;282;282	Q9UK23-3;Q9UK23;Q9UK23-2	.;NAGPA_HUMAN;.	T	282	ENSP00000310998:A282T;ENSP00000371381:A282T	ENSP00000310998:A282T	A	-	1	0	NAGPA	5018958	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.712000	0.84684	2.556000	0.86216	0.561000	0.74099	GCC	-	GPA	-	pfam_DUF2233		0.597	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPA	HGNC	protein_coding	OTTHUMT00000207003.1	0	0	0	26	26	70	0.00	0.00	C	NM_016256		5078957	-1	17	37	23	48	tier1	no_errors	ENST00000312251	ensembl	human	known	74_37	missense	42.50	43.53	SNP	1.000	T	17	23
MDN1	23195	genome.wustl.edu	37	6	90448081	90448081	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr6:90448081G>A	ENST00000369393.3	-	33	4802	c.4687C>T	c.(4687-4689)Cgt>Tgt	p.R1563C	MDN1_ENST00000428876.1_Missense_Mutation_p.R1563C			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1563					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AATCCTGGACGAAGATTATGA	0.443													ENSG00000112159																																					0													147.0	130.0	136.0					6																	90448081		2203	4300	6503	SO:0001583	missense	0			-	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4687C>T	6.37:g.90448081G>A	ENSP00000358400:p.Arg1563Cys		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.R1563C	ENST00000369393.3	37	c.4687	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956283	0.34565	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.42131	0.98;0.98	5.69	3.9	0.45041	.	0.302743	0.36815	N	0.002381	T	0.20455	0.0492	L	0.47190	1.495	0.52099	D	0.999943	B	0.13145	0.007	B	0.12837	0.008	T	0.06807	-1.0806	10	0.59425	D	0.04	.	10.7103	0.45980	0.0682:0.0:0.7993:0.1325	.	1563	Q9NU22	MDN1_HUMAN	C	1563	ENSP00000358400:R1563C;ENSP00000413970:R1563C	ENSP00000358400:R1563C	R	-	1	0	MDN1	90504802	0.999000	0.42202	0.988000	0.46212	0.943000	0.58893	2.427000	0.44740	0.747000	0.32809	0.557000	0.71058	CGT	-	MDN1	-	superfamily_P-loop_NTPase,pirsf_Midasin		0.443	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	0	0	0	94	94	67	0.00	0.00	G			90448081	-1	25	18	48	31	tier1	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	34.25	36.73	SNP	0.998	A	25	48
CXXC1	30827	genome.wustl.edu	37	18	47811580	47811580	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr18:47811580G>A	ENST00000285106.6	-	7	1418	c.704C>T	c.(703-705)cCc>cTc	p.P235L	CXXC1_ENST00000412036.2_Missense_Mutation_p.P235L|CXXC1_ENST00000589940.1_Missense_Mutation_p.P235L|CXXC1_ENST00000587396.1_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	235				P -> S (in Ref. 4; BAG37400). {ECO:0000305}.	activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						TGGCCGGCGGGGCCTTGGCAG	0.657													ENSG00000154832																																					0													30.0	29.0	29.0					18																	47811580		2203	4300	6503	SO:0001583	missense	0			-	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.704C>T	18.37:g.47811580G>A	ENSP00000285106:p.Pro235Leu		B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	pfam_CpG-bd_C,pfam_Znf_CXXC,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.P235L	ENST00000285106.6	37	c.704	CCDS11945.1	18	.	.	.	.	.	.	.	.	.	.	G	2.088	-0.409079	0.04799	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.22336	1.97;1.96	3.65	3.65	0.41850	.	0.400713	0.21586	N	0.072174	T	0.22399	0.0540	N	0.14661	0.345	0.46901	D	0.999244	P;P;B	0.51449	0.945;0.909;0.0	P;P;B	0.59056	0.851;0.713;0.0	T	0.02736	-1.1117	10	0.27785	T	0.31	-9.3593	11.5216	0.50553	0.0:0.0:1.0:0.0	.	235;235;102	Q9P0U4-2;Q9P0U4;Q59EC8	.;CXXC1_HUMAN;.	L	235	ENSP00000285106:P235L;ENSP00000390475:P235L	ENSP00000285106:P235L	P	-	2	0	CXXC1	46065578	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.021000	0.49651	1.991000	0.58162	0.542000	0.68232	CCC	-	CXXC1	-	NULL		0.657	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXXC1	HGNC	protein_coding	OTTHUMT00000255927.2	0	0	0	98	98	16	0.00	0.00	G	NM_014593		47811580	-1	6	5	32	11	tier1	no_errors	ENST00000412036	ensembl	human	known	74_37	missense	15.79	31.25	SNP	1.000	A	6	32
SENP1	29843	genome.wustl.edu	37	12	48501209	48501209	+	5'Flank	SNP	G	G	A	rs193298317	byFrequency	TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr12:48501209G>A	ENST00000004980.5	-	0	0				SENP1_ENST00000549518.1_5'Flank|SENP1_ENST00000448372.1_5'Flank|PFKM_ENST00000340802.6_Missense_Mutation_p.R18H|SENP1_ENST00000551330.1_5'Flank|SENP1_ENST00000339976.6_5'Flank			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				ATTCAGTCTCGCCAGTTAGTC	0.433													ENSG00000152556																																					0													222.0	193.0	202.0					12																	48501209		1568	3582	5150	SO:0001631	upstream_gene_variant	0			-	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896		12.37:g.48501209G>A	Exception_encountered		A8K7P5|Q86XC8	Missense_Mutation	SNP	NULL	p.R18H	ENST00000004980.5	37	c.53	CCDS44868.2	12	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121313	0.56613	.	.	ENSG00000152556	ENST00000340802;ENST00000546755;ENST00000549366;ENST00000552792;ENST00000548288	T;D;D;D	0.88664	-1.47;-2.38;-2.41;-2.4	3.92	1.96	0.26148	.	0.428948	0.17391	N	0.175934	T	0.70954	0.3283	N	0.08118	0	0.21220	N	0.999751	B	0.25667	0.131	B	0.17722	0.019	T	0.56998	-0.7886	10	0.15952	T	0.53	-1.1249	4.5828	0.12267	0.1347:0.2236:0.6416:0.0	.	18	Q6ZTT1	.	H	18	ENSP00000345771:R18H;ENSP00000449622:R18H;ENSP00000448940:R18H;ENSP00000448018:R18H	ENSP00000345771:R18H	R	+	2	0	PFKM	46787476	0.833000	0.29383	0.260000	0.24451	0.903000	0.53119	1.019000	0.30014	0.546000	0.28920	0.591000	0.81541	CGC	-	PFKM	-	NULL		0.433	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PFKM	HGNC	protein_coding	OTTHUMT00000406471.1	0	0	0	45	45	39	0.00	0.00	G	NM_014554		48501209	+1	19	17	45	78	tier1	no_errors	ENST00000547581	ensembl	human	known	74_37	missense	29.69	17.71	SNP	0.301	A	19	45
DACT1	51339	genome.wustl.edu	37	14	59112535	59112535	+	Silent	SNP	G	G	A	rs111351020		TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr14:59112535G>A	ENST00000335867.4	+	4	1218	c.1194G>A	c.(1192-1194)gcG>gcA	p.A398A	DACT1_ENST00000395153.3_Silent_p.A361A|DACT1_ENST00000541264.2_Silent_p.A117A|DACT1_ENST00000556859.1_Silent_p.A117A			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	398					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CGAAACAGGCGTGTCTGCCCT	0.552													ENSG00000165617																																					0													68.0	72.0	70.0					14																	59112535		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1194G>A	14.37:g.59112535G>A			A8MYJ2|Q86TY0	Silent	SNP	NULL	p.A398	ENST00000335867.4	37	c.1194	CCDS9736.1	14																																																																																			rs111351020	DACT1	-	NULL		0.552	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	HGNC	protein_coding	OTTHUMT00000325515.1	0	0	0	73	73	82	0.00	0.00	G	NM_016651		59112535	+1	16	30	49	116	tier1	no_errors	ENST00000335867	ensembl	human	known	74_37	silent	24.62	20.55	SNP	0.000	A	16	49
ZNF429	353088	genome.wustl.edu	37	19	21719972	21719972	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr19:21719972G>A	ENST00000358491.4	+	4	1325	c.1117G>A	c.(1117-1119)Gaa>Aaa	p.E373K	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						CAAATGTGAAGAATGTGGCAA	0.368													ENSG00000197013																																					0													41.0	46.0	44.0					19																	21719972		2110	4265	6375	SO:0001583	missense	0			-	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1117G>A	19.37:g.21719972G>A	ENSP00000351280:p.Glu373Lys		A6NLV7|Q9BZE6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E373K	ENST00000358491.4	37	c.1117	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	10.03	1.238858	0.22711	.	.	ENSG00000197013	ENST00000358491	T	0.07327	3.2	0.876	-1.63	0.08345	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06005	0.0156	N	0.20845	0.615	0.09310	N	1	P	0.38129	0.619	B	0.40199	0.322	T	0.40887	-0.9539	9	0.59425	D	0.04	.	7.4658	0.27320	0.0:0.27:0.7299:0.0	.	373	Q86V71	ZN429_HUMAN	K	373	ENSP00000351280:E373K	ENSP00000351280:E373K	E	+	1	0	ZNF429	21511812	0.000000	0.05858	0.697000	0.30258	0.699000	0.40488	-0.563000	0.05943	0.293000	0.22520	0.298000	0.19748	GAA	-	ZNF429	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.368	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	HGNC	protein_coding	OTTHUMT00000463981.1	0	0	0	21	21	12	0.00	0.00	G	NM_001001415		21719972	+1	16	9	11	10	tier1	no_errors	ENST00000358491	ensembl	human	novel	74_37	missense	59.26	47.37	SNP	0.040	A	16	11
MYO18B	84700	genome.wustl.edu	37	22	26159314	26159314	+	Silent	SNP	G	G	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr22:26159314G>A	ENST00000407587.2	+	3	325	c.156G>A	c.(154-156)gcG>gcA	p.A52A	MYO18B_ENST00000335473.7_Silent_p.A52A|MYO18B_ENST00000536101.1_Silent_p.A52A			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	52						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CCAAGGAAGCGAGACAGAGGA	0.542													ENSG00000133454																																					0													36.0	39.0	38.0					22																	26159314		1943	4143	6086	SO:0001819	synonymous_variant	0			-	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.156G>A	22.37:g.26159314G>A			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tR-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A52	ENST00000407587.2	37	c.156		22																																																																																			-	MYO18B	-	NULL		0.542	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	0	0	0	40	40	41	0.00	0.00	G	NM_032608		26159314	+1	23	20	20	26	tier1	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	53.49	43.48	SNP	0.000	A	23	20
ARHGEF26	26084	genome.wustl.edu	37	3	153935690	153935690	+	Silent	SNP	G	G	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr3:153935690G>A	ENST00000356448.4	+	10	2162	c.1878G>A	c.(1876-1878)aaG>aaA	p.K626K	ARHGEF26_ENST00000465817.1_Intron|ARHGEF26_ENST00000465093.1_Silent_p.K626K	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	626					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						GCGCCCGGAAGATGGAAAGGA	0.418													ENSG00000114790																									GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)												0													98.0	93.0	94.0					3																	153935690		1858	4105	5963	SO:0001819	synonymous_variant	0			-	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1878G>A	3.37:g.153935690G>A			B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Silent	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.K626	ENST00000356448.4	37	c.1878	CCDS46938.1	3																																																																																			-	ARHGEF26	-	superfamily_DH-domain		0.418	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF26	HGNC	protein_coding	OTTHUMT00000353287.3	0	0	0	102	102	135	0.00	0.00	G	NM_015595		153935690	+1	39	37	66	78	tier1	no_errors	ENST00000356448	ensembl	human	known	74_37	silent	37.14	32.17	SNP	1.000	A	39	66
GK2	2712	genome.wustl.edu	37	4	80328766	80328766	+	Missense_Mutation	SNP	T	T	C			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr4:80328766T>C	ENST00000358842.3	-	1	606	c.589A>G	c.(589-591)Aca>Gca	p.T197A		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						GTTACATCTGTACAATGCACG	0.398													ENSG00000196475																																					0													103.0	99.0	100.0					4																	80328766		2203	4300	6503	SO:0001583	missense	0			-	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.589A>G	4.37:g.80328766T>C	ENSP00000351706:p.Thr197Ala		Q7Z4Q4	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.T197A	ENST00000358842.3	37	c.589	CCDS3585.1	4	.	.	.	.	.	.	.	.	.	.	T	13.23	2.174253	0.38413	.	.	ENSG00000196475	ENST00000358842	T	0.55234	0.53	3.76	3.76	0.43208	Carbohydrate kinase, FGGY, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83131	-0.0113	10	0.87932	D	0	-7.3968	11.0964	0.48147	0.0:0.0:0.0:1.0	.	197	Q14410	GLPK2_HUMAN	A	197	ENSP00000351706:T197A	ENSP00000351706:T197A	T	-	1	0	GK2	80547790	1.000000	0.71417	0.451000	0.26982	0.102000	0.19082	7.465000	0.80898	1.958000	0.56883	0.477000	0.44152	ACA	-	GK2	-	pfam_Carb_kinase_FGGY_N,tigrfam_Glycerol_kin		0.398	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK2	HGNC	protein_coding	OTTHUMT00000252517.2	0	0	0	56	56	77	0.00	0.00	T	NM_033214		80328766	-1	12	19	43	60	tier1	no_errors	ENST00000358842	ensembl	human	known	74_37	missense	21.82	24.05	SNP	0.999	C	12	43
NRXN1	9378	genome.wustl.edu	37	2	50847269	50847269	+	Missense_Mutation	SNP	T	T	C			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr2:50847269T>C	ENST00000406316.2	-	8	2687	c.1211A>G	c.(1210-1212)gAt>gGt	p.D404G	NRXN1_ENST00000405472.3_Missense_Mutation_p.D396G|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Missense_Mutation_p.D404G|NRXN1_ENST00000404971.1_Missense_Mutation_p.D444G|NRXN1_ENST00000402717.3_Missense_Mutation_p.D396G|NRXN1_ENST00000401669.2_Missense_Mutation_p.D404G	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	404	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CATGGTATAATCTTCTTGCGT	0.478													ENSG00000179915																																					0													65.0	66.0	66.0					2																	50847269		2050	4225	6275	SO:0001583	missense	0			-	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1211A>G	2.37:g.50847269T>C	ENSP00000384311:p.Asp404Gly		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.D396G	ENST00000406316.2	37	c.1187	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	T	18.13	3.554603	0.65425	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.78816	-1.21;-1.21;-1.1;-1.21;-1.1;-1.21	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.82157	0.4976	L	0.28115	0.83	0.52501	D	0.99995	D;P;D	0.89917	1.0;0.952;0.99	D;P;D	0.78314	0.991;0.863;0.954	D	0.84286	0.0497	10	0.72032	D	0.01	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	444;404;396	Q9ULB1-3;F8WB18;A7E294	.;.;.	G	444;404;396;404;445;396;404	ENSP00000385142:D444G;ENSP00000384311:D404G;ENSP00000434015:D396G;ENSP00000385017:D404G;ENSP00000385434:D396G;ENSP00000385681:D404G	ENSP00000385017:D404G	D	-	2	0	NRXN1	50700773	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.367000	0.80283	0.528000	0.53228	GAT	-	NRXN1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.478	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	0	0	0	39	39	84	0.00	0.00	T			50847269	-1	11	24	11	52	tier1	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	50.00	31.58	SNP	1.000	C	11	11
LYSMD4	145748	genome.wustl.edu	37	15	100256626	100256626	+	Missense_Mutation	SNP	C	C	G			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr15:100256626C>G	ENST00000378904.2	-	1	1403	c.377G>C	c.(376-378)aGc>aCc	p.S126T	MEF2A_ENST00000557942.1_3'UTR|MEF2A_ENST00000453228.2_3'UTR|LYSMD4_ENST00000604213.1_5'UTR|MEF2A_ENST00000338042.6_3'UTR|MEF2A_ENST00000354410.5_3'UTR																							GAAGACAATGCTAAAGGTTGT	0.378													ENSG00000214397																																					0																																										SO:0001583	missense	0			-																												ENST00000378904.2:c.377G>C	15.37:g.100256626C>G	ENSP00000368184:p.Ser126Thr			Missense_Mutation	SNP	NULL	p.S126T	ENST00000378904.2	37	c.377		15	.	.	.	.	.	.	.	.	.	.	C	12.19	1.862654	0.32884	.	.	ENSG00000214397	ENST00000378904	.	.	.	5.93	5.01	0.66863	.	.	.	.	.	T	0.74581	0.3735	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78054	-0.2354	5	0.87932	D	0	.	13.8719	0.63624	0.0:0.9251:0.0:0.0749	.	.	.	.	T	126	.	ENSP00000368184:S126T	S	-	2	0	AC022692.1	98074149	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.644000	0.61397	1.472000	0.48140	0.655000	0.94253	AGC	-	DKFZP779J2370	-	NULL		0.378	DKFZP779J2370-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000214397	Uniprot_gn	protein_coding		0	0	0	32	32	71	0.00	0.00	C			100256626	-1	7	15	23	62	tier1	no_errors	ENST00000378904	ensembl	human	known	74_37	missense	23.33	19.48	SNP	1.000	G	7	23
MDN1	23195	genome.wustl.edu	37	6	90513121	90513121	+	Silent	SNP	T	T	C			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr6:90513121T>C	ENST00000369393.3	-	2	370	c.255A>G	c.(253-255)caA>caG	p.Q85Q	MDN1_ENST00000428876.1_Silent_p.Q85Q			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	85					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CATGGTTGATTTGGCCTCCAG	0.468													ENSG00000112159																																					0													260.0	226.0	237.0					6																	90513121		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.255A>G	6.37:g.90513121T>C			O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.Q85	ENST00000369393.3	37	c.255	CCDS5024.1	6																																																																																			-	MDN1	-	pirsf_Midasin		0.468	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	0	0	0	58	58	78	0.00	0.00	T			90513121	-1	20	39	12	14	tier1	no_errors	ENST00000369393	ensembl	human	known	74_37	silent	62.50	73.58	SNP	0.871	C	20	12
TBXAS1	6916	genome.wustl.edu	37	7	139653173	139653173	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr7:139653173C>A	ENST00000336425.5	+	10	846	c.457C>A	c.(457-459)Ccc>Acc	p.P153T	TBXAS1_ENST00000458722.1_Missense_Mutation_p.P199T|TBXAS1_ENST00000263552.6_Missense_Mutation_p.P154T|TBXAS1_ENST00000462275.1_3'UTR|TBXAS1_ENST00000436047.2_Missense_Mutation_p.P154T|TBXAS1_ENST00000448866.1_Missense_Mutation_p.P153T|TBXAS1_ENST00000416849.2_Missense_Mutation_p.P200T|TBXAS1_ENST00000425687.1_Missense_Mutation_p.P86T|TBXAS1_ENST00000414508.2_Missense_Mutation_p.P154T|TBXAS1_ENST00000411653.1_Missense_Mutation_p.P153T			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	153					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	TCAGATGGTTCCCCTCATCAG	0.478													ENSG00000059377																																					0													127.0	114.0	118.0					7																	139653173		2203	4300	6503	SO:0001583	missense	0			-	L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.457C>A	7.37:g.139653173C>A	ENSP00000338087:p.Pro153Thr		B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.P200T	ENST00000336425.5	37	c.598		7	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054850	0.75960	.	.	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000458722;ENST00000411653	T;T;T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.84991	0.5595	M	0.78916	2.43	0.80722	D	1	D;D;P;D;D;P;P	0.89917	0.999;1.0;0.885;1.0;0.991;0.885;0.885	D;D;P;D;D;P;P	0.97110	0.99;1.0;0.766;1.0;0.973;0.833;0.833	D	0.86122	0.1569	10	0.62326	D	0.03	.	18.8712	0.92315	0.0:1.0:0.0:0.0	.	134;200;105;86;154;154;153	B4DVP1;E7EP08;B4E0M5;E7ESB5;E7EMU9;Q53F23;P24557	.;.;.;.;.;.;THAS_HUMAN	T	86;154;153;200;154;154;153;199;153	ENSP00000388736:P86T;ENSP00000263552:P154T;ENSP00000338087:P153T;ENSP00000389414:P200T;ENSP00000392361:P154T;ENSP00000392702:P154T;ENSP00000402536:P153T;ENSP00000411274:P199T;ENSP00000411326:P153T	ENSP00000263552:P154T	P	+	1	0	TBXAS1	139299642	1.000000	0.71417	0.315000	0.25238	0.418000	0.31294	6.485000	0.73625	2.549000	0.85964	0.655000	0.94253	CCC	-	TBXAS1	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.478	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	TBXAS1	HGNC	protein_coding	OTTHUMT00000348373.1	0	0	0	34	34	91	0.00	0.00	C			139653173	+1	5	30	16	57	tier1	no_errors	ENST00000416849	ensembl	human	known	74_37	missense	23.81	34.48	SNP	0.999	A	5	16
ACOT12	134526	genome.wustl.edu	37	5	80626231	80626231	+	Silent	SNP	C	C	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr5:80626231C>T	ENST00000307624.3	-	15	1678	c.1650G>A	c.(1648-1650)ggG>ggA	p.G550G	ACOT12_ENST00000508234.1_5'UTR	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	550					acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		TGCTTACAAACCCATCATCAG	0.398													ENSG00000172497																																					0													75.0	77.0	76.0					5																	80626231		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.1650G>A	5.37:g.80626231C>T			B3KVK9|Q5FWE9	Silent	SNP	pfam_Thioestr_supf,pfam_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.G550	ENST00000307624.3	37	c.1650	CCDS4055.1	5																																																																																			-	ACOT12	-	NULL		0.398	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT12	HGNC	protein_coding	OTTHUMT00000254074.1	0	0	1	27	27	110	0.00	0.90	C	NM_130767		80626231	-1	4	42	23	118	tier1	no_errors	ENST00000307624	ensembl	human	known	74_37	silent	14.81	26.09	SNP	0.000	T	4	23
SYT3	84258	genome.wustl.edu	37	19	51132748	51132748	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr19:51132748G>T	ENST00000338916.4	-	4	1717	c.1084C>A	c.(1084-1086)Ccc>Acc	p.P362T	SYT3_ENST00000544769.1_Missense_Mutation_p.P362T|SYT3_ENST00000600079.1_Missense_Mutation_p.P362T|SYT3_ENST00000593901.1_Missense_Mutation_p.P362T	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	362	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		TTGAAGACGGGGTTCAGGGTC	0.607													ENSG00000213023																																					0													87.0	94.0	92.0					19																	51132748		2203	4300	6503	SO:0001583	missense	0			-	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1084C>A	19.37:g.51132748G>T	ENSP00000340914:p.Pro362Thr		Q8N5Z1|Q8N640	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.P362T	ENST00000338916.4	37	c.1084	CCDS12798.1	19	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478185	0.84747	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	D;D	0.91295	-2.82;-2.82	4.43	4.43	0.53597	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000010	D	0.97362	0.9137	H	0.98701	4.305	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.99264	1.0891	10	0.87932	D	0	.	16.1835	0.81929	0.0:0.0:1.0:0.0	.	362	Q9BQG1	SYT3_HUMAN	T	362	ENSP00000340914:P362T;ENSP00000438883:P362T	ENSP00000340914:P362T	P	-	1	0	SYT3	55824560	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.666000	0.83877	2.183000	0.69458	0.655000	0.94253	CCC	-	SYT3	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_C2_dom,pfscan_C2_dom		0.607	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	0	0	0	53	53	50	0.00	0.00	G	NM_032298		51132748	-1	8	13	20	22	tier1	no_errors	ENST00000338916	ensembl	human	known	74_37	missense	28.57	37.14	SNP	1.000	T	8	20
ABCA5	23461	genome.wustl.edu	37	17	67266783	67266783	+	Missense_Mutation	SNP	T	T	G			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr17:67266783T>G	ENST00000392676.3	-	22	3065	c.3001A>C	c.(3001-3003)Atc>Ctc	p.I1001L	ABCA5_ENST00000588877.1_Missense_Mutation_p.I1001L|ABCA5_ENST00000392677.2_Missense_Mutation_p.I1002L			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	1001					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	CAGATCTGGATGGTTTCAGTC	0.294													ENSG00000154265																																					0													122.0	138.0	133.0					17																	67266783		2203	4281	6484	SO:0001583	missense	0			-	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.3001A>C	17.37:g.67266783T>G	ENSP00000376443:p.Ile1001Leu		Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I1002L	ENST00000392676.3	37	c.3004	CCDS11685.1	17	.	.	.	.	.	.	.	.	.	.	T	26.6	4.755743	0.89843	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.87729	-2.29;-2.29	5.45	5.45	0.79879	.	0.096119	0.46145	D	0.000311	D	0.93478	0.7919	M	0.82823	2.61	0.58432	D	0.999999	D	0.71674	0.998	D	0.83275	0.996	D	0.93838	0.7134	9	.	.	.	.	14.4987	0.67707	0.0:0.0:0.0:1.0	.	1001	Q8WWZ7	ABCA5_HUMAN	L	1002;1001	ENSP00000376444:I1002L;ENSP00000376443:I1001L	.	I	-	1	0	ABCA5	64778378	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.716000	0.68437	2.062000	0.61559	0.482000	0.46254	ATC	-	ABCA5	-	NULL		0.294	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCA5	HGNC	protein_coding	OTTHUMT00000450654.1	0	0	0	47	47	69	0.00	0.00	T	NM_018672		67266783	-1	8	9	19	41	tier1	no_errors	ENST00000392677	ensembl	human	known	74_37	missense	29.63	18.00	SNP	0.998	G	8	19
BAIAP3	8938	genome.wustl.edu	37	16	1391868	1391868	+	Splice_Site	SNP	G	G	C			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr16:1391868G>C	ENST00000324385.5	+	9	1039		c.e9+1		BAIAP3_ENST00000397488.2_Splice_Site|BAIAP3_ENST00000426824.3_Splice_Site|BAIAP3_ENST00000562208.1_Splice_Site|BAIAP3_ENST00000421665.2_Splice_Site|BAIAP3_ENST00000397489.1_Splice_Site|BAIAP3_ENST00000568887.1_Splice_Site	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				TGGACATCTGGTACAGGCCCC	0.667													ENSG00000007516																																					0													54.0	63.0	60.0					16																	1391868		2198	4299	6497	SO:0001630	splice_region_variant	0			-	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.881+1G>C	16.37:g.1391868G>C			A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Splice_Site	SNP	-	e9+1	ENST00000324385.5	37	c.881+1	CCDS10434.1	16	.	.	.	.	.	.	.	.	.	.	G	12.20	1.866487	0.32977	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7002	0.77536	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BAIAP3	1331869	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	7.993000	0.88291	2.381000	0.81170	0.305000	0.20034	.	-	BAIAP3	-	-		0.667	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	HGNC	protein_coding	OTTHUMT00000109056.3	0	0	0	72	72	27	0.00	0.00	G		Intron	1391868	+1	14	8	87	44	tier1	no_errors	ENST00000324385	ensembl	human	known	74_37	splice_site	13.86	15.38	SNP	1.000	C	14	87
ZNF790	388536	genome.wustl.edu	37	19	37309350	37309350	+	Silent	SNP	G	G	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr19:37309350G>A	ENST00000356725.4	-	5	2016	c.1896C>T	c.(1894-1896)ttC>ttT	p.F632F	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	632					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AGAGTGAAATGAAGTGAGAGC	0.308													ENSG00000197863																																					0													35.0	39.0	37.0					19																	37309350		2201	4294	6495	SO:0001819	synonymous_variant	0			-	BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.1896C>T	19.37:g.37309350G>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F632	ENST00000356725.4	37	c.1896	CCDS12496.1	19																																																																																			-	ZNF790	-	NULL		0.308	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790	HGNC	protein_coding	OTTHUMT00000385341.2	0	0	0	52	52	77	0.00	0.00	G	NM_206894		37309350	-1	9	17	41	62	tier1	no_errors	ENST00000356725	ensembl	human	known	74_37	silent	18.00	21.52	SNP	0.036	A	9	41
ACACB	32	genome.wustl.edu	37	12	109604769	109604769	+	Missense_Mutation	SNP	C	C	T	rs149394526		TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr12:109604769C>T	ENST00000338432.7	+	3	876	c.757C>T	c.(757-759)Cgc>Tgc	p.R253C	ACACB_ENST00000377854.5_Missense_Mutation_p.R253C|ACACB_ENST00000377848.3_Missense_Mutation_p.R253C			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	253					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GTTTGTCACACGCTTTGGGGG	0.612													ENSG00000076555																																					0								C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	80.0	75.0	77.0		757	5.6	1.0	12	dbSNP_134	77	0,8600		0,0,4300	no	missense	ACACB	NM_001093.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	253/2459	109604769	1,13005	2203	4300	6503	SO:0001583	missense	0			-	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.757C>T	12.37:g.109604769C>T	ENSP00000341044:p.Arg253Cys		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.R253C	ENST00000338432.7	37	c.757	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395717	0.83011	2.27E-4	0.0	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	T;T;T	0.75367	-0.93;-0.93;-0.93	5.55	5.55	0.83447	PreATP-grasp-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85579	0.5729	M	0.83012	2.62	0.80722	D	1	D	0.69078	0.997	P	0.57244	0.816	D	0.87329	0.2323	10	0.66056	D	0.02	.	19.1106	0.93315	0.0:1.0:0.0:0.0	.	253	O00763	ACACB_HUMAN	C	253	ENSP00000341044:R253C;ENSP00000367079:R253C;ENSP00000367085:R253C	ENSP00000341044:R253C	R	+	1	0	ACACB	108089152	1.000000	0.71417	0.979000	0.43373	0.986000	0.74619	5.975000	0.70475	2.596000	0.87737	0.591000	0.81541	CGC	rs149394526	ACACB	-	superfamily_PreATP-grasp_dom		0.612	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	0	0	0	47	47	64	0.00	0.00	C	NM_001093		109604769	+1	10	16	23	52	tier1	no_errors	ENST00000338432	ensembl	human	known	74_37	missense	30.30	23.53	SNP	1.000	T	10	23
MDGA2	161357	genome.wustl.edu	37	14	47613285	47613285	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr14:47613285G>A	ENST00000399232.2	-	4	945	c.581C>T	c.(580-582)aCc>aTc	p.T194I	MDGA2_ENST00000439988.3_Missense_Mutation_p.T263I|MDGA2_ENST00000357362.3_5'UTR|MDGA2_ENST00000426342.1_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	194	Ig-like 2.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TCATACCTGGGTAAAGAATGG	0.418													ENSG00000272781																																					0													125.0	108.0	113.0					14																	47613285		692	1591	2283	SO:0001583	missense	0			-	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.581C>T	14.37:g.47613285G>A	ENSP00000382178:p.Thr194Ile		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.T263I	ENST00000399232.2	37	c.788		14	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624987	0.87560	.	.	ENSG00000139915	ENST00000439988;ENST00000399232	T;T	0.03124	4.04;4.04	5.73	5.73	0.89815	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	U	0.000065	T	0.16428	0.0395	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00561	-1.1670	10	0.31617	T	0.26	.	18.4708	0.90774	0.0:0.0:1.0:0.0	.	194	Q7Z553	MDGA2_HUMAN	I	194;263	ENSP00000400011:T194I;ENSP00000382178:T263I	ENSP00000382178:T263I	T	-	2	0	MDGA2	46683035	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.378000	0.97191	2.718000	0.92993	0.585000	0.79938	ACC	-	MDGA2	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.418	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	0	0	0	58	58	139	0.00	0.00	G	NM_182830		47613285	-1	7	28	46	126	tier1	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	13.21	18.06	SNP	1.000	A	7	46
SACS	26278	genome.wustl.edu	37	13	23910564	23910564	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr13:23910564C>A	ENST00000382292.3	-	9	7724	c.7451G>T	c.(7450-7452)tGt>tTt	p.C2484F	SACS_ENST00000382298.3_Missense_Mutation_p.C2484F|SACS_ENST00000402364.1_Missense_Mutation_p.C1734F			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2484					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GTCAGCATGACAATATTTTAC	0.383													ENSG00000151835																																					0													132.0	127.0	129.0					13																	23910564		2203	4299	6502	SO:0001583	missense	0			-	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.7451G>T	13.37:g.23910564C>A	ENSP00000371729:p.Cys2484Phe		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.C2484F	ENST00000382292.3	37	c.7451	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	C	19.18	3.778306	0.70107	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.93547	-3.24;-3.24;-3.24	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.95040	0.8394	L	0.38175	1.15	0.58432	D	0.999999	D	0.67145	0.996	D	0.74023	0.982	D	0.95601	0.8663	10	0.87932	D	0	.	19.3511	0.94387	0.0:1.0:0.0:0.0	.	2484	Q9NZJ4	SACS_HUMAN	F	2484;1734;2484	ENSP00000371729:C2484F;ENSP00000385844:C1734F;ENSP00000371735:C2484F	ENSP00000371729:C2484F	C	-	2	0	SACS	22808564	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.484000	0.81180	2.582000	0.87167	0.561000	0.74099	TGT	-	SACS	-	NULL		0.383	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	0	0	0	80	80	103	0.00	0.00	C	NM_014363		23910564	-1	21	16	50	41	tier1	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	29.58	28.07	SNP	1.000	A	21	50
KIAA1045	23349	genome.wustl.edu	37	9	34971556	34971556	+	Silent	SNP	C	C	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr9:34971556C>T	ENST00000242315.3	+	2	343	c.261C>T	c.(259-261)ggC>ggT	p.G87G	KIAA1045_ENST00000476115.2_Intron|KIAA1045_ENST00000544237.1_Silent_p.G87G	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	87							metal ion binding (GO:0046872)	p.G87G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			ATGGGCGCGGCGTGGAGCCTG	0.617													ENSG00000122733																																					1	Substitution - coding silent(1)	large_intestine(1)											79.0	94.0	89.0					9																	34971556		2009	4164	6173	SO:0001819	synonymous_variant	0			-	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.261C>T	9.37:g.34971556C>T			B7Z253|Q58FE9|Q5T662	Silent	SNP	superfamily_Znf_FYVE_PHD	p.G87	ENST00000242315.3	37	c.261	CCDS43796.1	9																																																																																			-	KIAA1045	-	NULL		0.617	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1045	HGNC	protein_coding	OTTHUMT00000052256.2	0	0	0	41	41	68	0.00	0.00	C	XM_048592		34971556	+1	11	20	23	30	tier1	no_errors	ENST00000242315	ensembl	human	known	74_37	silent	32.35	40.00	SNP	0.080	T	11	23
CSMD1	64478	genome.wustl.edu	37	8	3565992	3565992	+	Missense_Mutation	SNP	T	T	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr8:3565992T>A	ENST00000520002.1	-	7	1508	c.953A>T	c.(952-954)aAg>aTg	p.K318M	CSMD1_ENST00000537824.1_Missense_Mutation_p.K318M|CSMD1_ENST00000539096.1_Missense_Mutation_p.K318M|CSMD1_ENST00000602723.1_Missense_Mutation_p.K318M|CSMD1_ENST00000400186.3_Missense_Mutation_p.K318M|CSMD1_ENST00000602557.1_Missense_Mutation_p.K318M|CSMD1_ENST00000542608.1_Missense_Mutation_p.K318M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	318						integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCCTCTTGACTTCAACTCAAT	0.438													ENSG00000183117																																					0													95.0	94.0	94.0					8																	3565992		1980	4170	6150	SO:0001583	missense	0			-			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.953A>T	8.37:g.3565992T>A	ENSP00000430733:p.Lys318Met		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.K318M	ENST00000520002.1	37	c.953		8	.	.	.	.	.	.	.	.	.	.	T	24.1	4.493271	0.84962	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29	5.54	5.54	0.83059	.	.	.	.	.	D	0.91379	0.7280	L	0.55990	1.75	0.39837	D	0.973053	D	0.63046	0.992	D	0.72075	0.976	D	0.92472	0.5986	9	0.62326	D	0.03	.	14.2483	0.66001	0.0:0.0:0.0:1.0	.	318	E5RIG2	.	M	318;318;180;318;318;318	ENSP00000383047:K318M;ENSP00000430733:K318M;ENSP00000441462:K318M;ENSP00000446243:K318M;ENSP00000441675:K318M	ENSP00000320445:K180M	K	-	2	0	CSMD1	3553400	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.290000	0.72712	2.087000	0.62958	0.528000	0.53228	AAG	-	CSMD1	-	NULL		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	0	0	0	30	30	115	0.00	0.00	T	NM_033225		3565992	-1	12	24	23	103	tier1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	34.29	18.90	SNP	1.000	A	12	23
HOXC10	3226	genome.wustl.edu	37	12	54383454	54383454	+	3'UTR	SNP	G	G	C			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr12:54383454G>C	ENST00000303460.4	+	0	1327				RP11-834C11.12_ENST00000513209.1_Intron|MIR196A2_ENST00000385189.1_RNA|HOXC10_ENST00000511575.1_3'UTR	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10						anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						GGTGTGGTGTGTGCCCTCATA	0.547											OREG0021882	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000180818																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.*224G>C	12.37:g.54383454G>C		999	O15219|O15220|Q9BVD5	R	SNP	-	NULL	ENST00000303460.4	37	NULL	CCDS8868.1	12																																																																																			-	HOXC10	-	-		0.547	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC10	HGNC	protein_coding	OTTHUMT00000358952.2	0	0	0	23	23	100	0.00	0.00	G			54383454	+1	3	25	12	71	tier1	no_errors	ENST00000511575	ensembl	human	known	74_37	rna	20.00	26.04	SNP	0.523	C	3	12
CRELD1	78987	genome.wustl.edu	37	3	9984866	9984866	+	Intron	SNP	C	C	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr3:9984866C>T	ENST00000383811.3	+	8	1512				CRELD1_ENST00000489674.1_3'UTR|CRELD1_ENST00000452070.1_Intron|CRELD1_ENST00000397170.3_Intron|CRELD1_ENST00000326434.5_Intron	NM_015513.4	NP_056328	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1						cardiac septum development (GO:0003279)|endocardial cushion development (GO:0003197)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|urinary_tract(1)	14						GGTGAGTCTCCTGCTGATGGG	0.607													ENSG00000163703																																					0													41.0	43.0	42.0					3																	9984866		2203	4300	6503	SO:0001627	intron_variant	0			-	AF452623	CCDS2593.1, CCDS33693.1	3p25.3	2005-12-08	2004-02-13		ENSG00000163703	ENSG00000163703			14630	protein-coding gene	gene with protein product		607170	"""atrioventricular septal defect 2"""	AVSD2		10922384, 12137942	Standard	NM_015513		Approved		uc003buf.3	Q96HD1	OTTHUMG00000128653	ENST00000383811.3:c.913+10C>T	3.37:g.9984866C>T			A8MX90|B2RAA9|Q6I9X5|Q8NFT4|Q9Y409	R	SNP	-	NULL	ENST00000383811.3	37	NULL	CCDS2593.1	3																																																																																			-	CRELD1	-	-		0.607	CRELD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRELD1	HGNC	protein_coding	OTTHUMT00000250533.1	0	0	0	36	36	16	0.00	0.00	C	NM_015513		9984866	+1	8	9	29	20	tier1	no_errors	ENST00000489674	ensembl	human	known	74_37	rna	21.62	31.03	SNP	0.002	T	8	29
GPRC5B	51704	genome.wustl.edu	37	16	19883143	19883143	+	Missense_Mutation	SNP	T	T	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr16:19883143T>A	ENST00000300571.2	-	2	1216	c.1025A>T	c.(1024-1026)aAt>aTt	p.N342I	GPRC5B_ENST00000537135.1_Missense_Mutation_p.N368I|GPRC5B_ENST00000569479.1_Missense_Mutation_p.N342I|GPRC5B_ENST00000569847.1_Missense_Mutation_p.N342I|GPRC5B_ENST00000535671.1_Missense_Mutation_p.N342I	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	342					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						TTTACCTGCATTGTGTTCATC	0.597													ENSG00000167191																																					0													91.0	88.0	89.0					16																	19883143		2197	4300	6497	SO:0001583	missense	0			-	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.1025A>T	16.37:g.19883143T>A	ENSP00000300571:p.Asn342Ile		D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.N368I	ENST00000300571.2	37	c.1103	CCDS10581.1	16	.	.	.	.	.	.	.	.	.	.	T	13.61	2.289452	0.40494	.	.	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000538074;ENST00000537135	T;T;T	0.27402	1.68;1.67;1.67	4.99	-1.63	0.08345	.	0.306075	0.33875	N	0.004463	T	0.29588	0.0738	L	0.46157	1.445	0.35574	D	0.805721	D;P	0.54047	0.964;0.883	P;P	0.49752	0.621;0.499	T	0.28038	-1.0056	9	.	.	.	.	9.9184	0.41448	0.0:0.4417:0.0:0.5583	.	368;342	B7Z831;Q9NZH0	.;GPC5B_HUMAN	I	342;342;191;368	ENSP00000300571:N342I;ENSP00000442858:N342I;ENSP00000441775:N368I	.	N	-	2	0	GPRC5B	19790644	0.453000	0.25721	0.018000	0.16275	0.829000	0.46940	0.770000	0.26618	-0.501000	0.06605	0.533000	0.62120	AAT	-	GPRC5B	-	NULL		0.597	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5B	HGNC	protein_coding	OTTHUMT00000254285.1	0	0	0	48	48	48	0.00	0.00	T			19883143	-1	12	19	57	93	tier1	no_errors	ENST00000537135	ensembl	human	known	74_37	missense	17.39	16.96	SNP	0.409	A	12	57
TRIM44	54765	genome.wustl.edu	37	11	35706846	35706846	+	Silent	SNP	T	T	C			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr11:35706846T>C	ENST00000299413.5	+	2	1016	c.709T>C	c.(709-711)Ttg>Ctg	p.L237L		NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	237						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				TATGATCGAATTGGTGGAAAG	0.433													ENSG00000166326																																					0													156.0	149.0	151.0					11																	35706846		2202	4298	6500	SO:0001819	synonymous_variant	0			-	BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	ENST00000299413.5:c.709T>C	11.37:g.35706846T>C			D3DR14|Q96QY2|Q9UGK0	Silent	SNP	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	p.L237	ENST00000299413.5	37	c.709	CCDS31461.1	11																																																																																			-	TRIM44	-	NULL		0.433	TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM44	HGNC	protein_coding	OTTHUMT00000389081.1	0	0	0	55	55	92	0.00	0.00	T	NM_017583		35706846	+1	11	47	30	82	tier1	no_errors	ENST00000299413	ensembl	human	known	74_37	silent	26.83	36.43	SNP	1.000	C	11	30
GALNT7	51809	genome.wustl.edu	37	4	174090036	174090036	+	Missense_Mutation	SNP	G	G	A	rs373166043		TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr4:174090036G>A	ENST00000265000.4	+	1	133	c.50G>A	c.(49-51)aGc>aAc	p.S17N	RP11-10K16.1_ENST00000499322.2_RNA|RP11-10K16.1_ENST00000510523.1_RNA|RP11-10K16.1_ENST00000500914.2_RNA|GALNT7_ENST00000512285.1_Missense_Mutation_p.S17N	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	17					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		GTGGTGGGAAGCTTCCTGGGG	0.672													ENSG00000109586																																					0													138.0	123.0	128.0					4																	174090036		2203	4300	6503	SO:0001583	missense	0			-	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.50G>A	4.37:g.174090036G>A	ENSP00000265000:p.Ser17Asn		B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.S17N	ENST00000265000.4	37	c.50	CCDS3815.1	4	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790996	0.50102	.	.	ENSG00000109586	ENST00000265000;ENST00000512285	T;T	0.56103	0.48;1.52	2.77	1.91	0.25777	.	1.513420	0.03414	N	0.205207	T	0.33847	0.0877	N	0.08118	0	0.23254	N	0.998031	B	0.20261	0.043	B	0.10450	0.005	T	0.25502	-1.0130	10	0.49607	T	0.09	.	5.942	0.19198	0.1623:0.0:0.8377:0.0	.	17	Q86SF2	GALT7_HUMAN	N	17	ENSP00000265000:S17N;ENSP00000427050:S17N	ENSP00000265000:S17N	S	+	2	0	GALNT7	174326611	1.000000	0.71417	0.994000	0.49952	0.974000	0.67602	3.533000	0.53561	0.307000	0.22880	0.298000	0.19748	AGC	-	GALNT7	-	NULL		0.672	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT7	HGNC	protein_coding	OTTHUMT00000362456.2	0	0	0	104	104	70	0.00	0.00	G	NM_017423		174090036	+1	22	17	59	33	tier1	no_errors	ENST00000265000	ensembl	human	known	74_37	missense	27.16	33.33	SNP	0.997	A	22	59
TIAF1	9220	genome.wustl.edu	37	17	27401360	27401360	+	De_novo_Start_OutOfFrame	SNP	C	C	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr17:27401360C>T	ENST00000359450.6	-	0	4515				TIAF1_ENST00000408971.2_De_novo_Start_OutOfFrame|MYO18A_ENST00000531253.1_3'UTR|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000354329.4_3'UTR|MYO18A_ENST00000527372.1_3'UTR|MYO18A_ENST00000533112.1_3'UTR	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1						apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)				kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCACCCCACACGAGAGGGAAG	0.562													ENSG00000196535																																					0																																												0			-	AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411		ENST00000359450.6:c.-143G>A	17.37:g.27401360C>T			A2RRE2|Q6PEG2	R	SNP	-	NULL	ENST00000359450.6	37	NULL	CCDS32599.1	17																																																																																			-	MYO18A	-	-		0.562	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000372394.2	0	0	0	27	27	88	0.00	0.00	C	NM_004740		27401360	-1	10	36	20	60	tier1	no_errors	ENST00000529578	ensembl	human	known	74_37	rna	33.33	37.50	SNP	0.001	T	10	20
PCDHA13	56136	genome.wustl.edu	37	5	140262706	140262706	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr5:140262706G>T	ENST00000289272.2	+	1	853	c.853G>T	c.(853-855)Gta>Tta	p.V285L	PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.V285L|PCDHA4_ENST00000530339.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	285	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGAAGGCCTGTATGGCCTGC	0.363													ENSG00000239389																									Melanoma(147;1739 1852 5500 27947 37288)												0													76.0	76.0	76.0					5																	140262706		2203	4300	6503	SO:0001583	missense	0			-	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.853G>T	5.37:g.140262706G>T	ENSP00000289272:p.Val285Leu		O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V285L	ENST00000289272.2	37	c.853	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	G	8.935	0.964292	0.18583	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.51071	0.72;0.72	5.58	-0.61	0.11604	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35711	0.0941	L	0.39245	1.2	0.09310	N	1	B;B;B	0.18610	0.029;0.013;0.019	B;B;B	0.32928	0.155;0.039;0.056	T	0.40572	-0.9556	9	0.40728	T	0.16	.	2.1469	0.03790	0.3487:0.117:0.4142:0.12	.	285;285;285	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	L	285	ENSP00000386821:V285L;ENSP00000289272:V285L	ENSP00000289272:V285L	V	+	1	0	PCDHA13	140242890	0.000000	0.05858	0.000000	0.03702	0.939000	0.58152	0.379000	0.20585	-0.463000	0.06973	0.561000	0.74099	GTA	-	PCDHA13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.363	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	0	0	0	32	32	86	0.00	0.00	G	NM_018904		140262706	+1	8	18	30	73	tier1	no_errors	ENST00000289272	ensembl	human	known	74_37	missense	21.05	19.78	SNP	0.000	T	8	30
TRIM31	11074	genome.wustl.edu	37	6	30078449	30078449	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr6:30078449C>T	ENST00000376734.3	-	4	645	c.520G>A	c.(520-522)Gta>Ata	p.V174I	TRIM31_ENST00000485864.1_5'UTR|TRIM31-AS1_ENST00000440874.1_RNA|TRIM31_ENST00000540829.1_Missense_Mutation_p.V174I	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	174					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						TCATGTTCTACCTGGTCCTAA	0.463													ENSG00000204616																																					0													67.0	65.0	66.0					6																	30078449		2203	4300	6503	SO:0001583	missense	0			-	AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.520G>A	6.37:g.30078449C>T	ENSP00000365924:p.Val174Ile		A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,prints_Znf_B-box_chordata,pfscan_Znf_B-box,pfscan_Znf_RING	p.V174I	ENST00000376734.3	37	c.520	CCDS34374.1	6	.	.	.	.	.	.	.	.	.	.	C	9.675	1.147863	0.21288	.	.	ENSG00000204616	ENST00000376734;ENST00000376728;ENST00000540829	T;T	0.67345	-0.26;-0.26	3.49	2.61	0.31194	.	.	.	.	.	T	0.30039	0.0752	L	0.29908	0.895	0.19300	N	0.99997	B	0.19817	0.039	B	0.21360	0.034	T	0.19778	-1.0295	9	0.42905	T	0.14	.	5.009	0.14302	0.0:0.6608:0.2197:0.1195	.	174	Q9BZY9	TRI31_HUMAN	I	174	ENSP00000365924:V174I;ENSP00000444311:V174I	ENSP00000365918:V174I	V	-	1	0	TRIM31	30186428	0.000000	0.05858	0.265000	0.24526	0.035000	0.12851	0.103000	0.15292	0.778000	0.33520	0.453000	0.30009	GTA	-	TRIM31	-	NULL		0.463	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM31	HGNC	protein_coding	OTTHUMT00000076081.2	0	0	0	39	39	121	0.00	0.00	C			30078449	-1	13	30	27	57	tier1	no_errors	ENST00000376734	ensembl	human	known	74_37	missense	32.50	34.48	SNP	0.445	T	13	27
SH3BP5	9467	genome.wustl.edu	37	3	15311315	15311315	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr3:15311315C>T	ENST00000383791.3	-	4	620	c.400G>A	c.(400-402)Gag>Aag	p.E134K	SH3BP5_ENST00000253688.5_5'UTR|SH3BP5_ENST00000465894.2_5'Flank|SH3BP5_ENST00000426925.1_5'UTR|SH3BP5_ENST00000408919.3_5'UTR	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	134					intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						GAGATGGTCTCCTTGGCGGCA	0.607													ENSG00000131370																																					0													111.0	114.0	113.0					3																	15311315		2203	4300	6503	SO:0001583	missense	0			-	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.400G>A	3.37:g.15311315C>T	ENSP00000373301:p.Glu134Lys		B3KQW6|Q5JWV9	Missense_Mutation	SNP	pfam_SH3-bd_5	p.E134K	ENST00000383791.3	37	c.400	CCDS2625.2	3	.	.	.	.	.	.	.	.	.	.	C	34	5.318577	0.95682	.	.	ENSG00000131370	ENST00000383791	.	.	.	5.62	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.79701	0.4491	M	0.87900	2.915	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.81304	-0.0993	9	0.87932	D	0	-22.5735	10.9615	0.47387	0.0:0.7989:0.1305:0.0706	.	134	O60239	3BP5_HUMAN	K	134	.	ENSP00000373301:E134K	E	-	1	0	SH3BP5	15286319	1.000000	0.71417	0.997000	0.53966	0.923000	0.55619	7.710000	0.84655	0.731000	0.32448	0.555000	0.69702	GAG	-	SH3BP5	-	pfam_SH3-bd_5		0.607	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5	HGNC	protein_coding	OTTHUMT00000340740.2	0	0	0	25	25	8	0.00	0.00	C	NM_004844		15311315	-1	6	3	26	23	tier1	no_errors	ENST00000383791	ensembl	human	known	74_37	missense	18.75	11.54	SNP	1.000	T	6	26
HR	55806	genome.wustl.edu	37	8	21983187	21983187	+	Silent	SNP	C	C	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr8:21983187C>A	ENST00000381418.4	-	4	2944	c.1464G>T	c.(1462-1464)ctG>ctT	p.L488L	HR_ENST00000312841.8_Silent_p.L488L	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	488					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CAGGGAGAGCCAGGCATGGTA	0.607													ENSG00000168453																																					0													68.0	59.0	62.0					8																	21983187		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.1464G>T	8.37:g.21983187C>A			Q6GS30|Q96H33|Q9NPE1	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.L488	ENST00000381418.4	37	c.1464	CCDS6022.1	8																																																																																			-	HR	-	NULL		0.607	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HR	HGNC	protein_coding	OTTHUMT00000214213.1	0	0	0	105	105	66	0.00	0.00	C			21983187	-1	22	24	62	62	tier1	no_errors	ENST00000381418	ensembl	human	known	74_37	silent	26.19	27.91	SNP	0.000	A	22	62
ZNF655	79027	genome.wustl.edu	37	7	99171504	99171504	+	3'UTR	SNP	C	C	T			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr7:99171504C>T	ENST00000394163.2	+	0	1956				ZNF655_ENST00000425063.1_3'UTR|GS1-259H13.10_ENST00000455905.1_Intron|ZNF655_ENST00000424881.1_3'UTR|ZNF655_ENST00000252713.4_3'UTR|ZNF655_ENST00000419215.2_3'UTR|GS1-259H13.10_ENST00000486324.1_Intron	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655						negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					ATACCTTAGTCACATTTGGAG	0.333													ENSG00000197343																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.*297C>T	7.37:g.99171504C>T			A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	R	SNP	-	NULL	ENST00000394163.2	37	NULL	CCDS5669.1	7																																																																																			-	ZNF655	-	-		0.333	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ZNF655	HGNC	protein_coding	OTTHUMT00000344929.1	0	0	0	26	26	33	0.00	0.00	C	NM_138494		99171504	+1	7	12	15	28	tier1	no_errors	ENST00000419215	ensembl	human	known	74_37	rna	31.82	30.00	SNP	0.307	T	7	15
DMBT1P1	375940	genome.wustl.edu	37	10	124558622	124558622	+	RNA	SNP	C	C	T	rs567988906		TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr10:124558622C>T	ENST00000439464.2	+	0	3743					NR_003570.1																						AAGATGCTGGCGTCATCTGCT	0.582													ENSG00000176584	C|||	1	0.000199681	0.0008	0.0	5008	,	,		19922	0.0		0.0	False		,,,				2504	0.0																0																																												0			-																													10.37:g.124558622C>T				R	SNP	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			-	RP11-318C4.2	-	-		0.582	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1	0	0	0	28	28	53	0.00	0.00	C			124558622	+1	10	5	11	25	tier1	no_errors	ENST00000605982	ensembl	human	known	74_37	rna	47.62	16.67	SNP	0.456	T	10	11
SERPINB3	6317	genome.wustl.edu	37	18	61324115	61324115	+	Missense_Mutation	SNP	C	C	A	rs61733410	byFrequency	TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr18:61324115C>A	ENST00000283752.5	-	7	861	c.718G>T	c.(718-720)Gat>Tat	p.D240Y	SERPINB11_ENST00000489748.1_RNA|SERPINB3_ENST00000332821.8_Intron	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	240					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						ATGCTTAGATCTTTGCCTTTG	0.423													ENSG00000057149																																					0													229.0	200.0	210.0					18																	61324115		2203	4300	6503	SO:0001583	missense	0			-	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.718G>T	18.37:g.61324115C>A	ENSP00000283752:p.Asp240Tyr		A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.D240Y	ENST00000283752.5	37	c.718	CCDS11987.1	18	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719847	0.30503	.	.	ENSG00000057149	ENST00000283752	D	0.85088	-1.94	2.64	2.64	0.31445	Serpin domain (3);	0.527334	0.15765	N	0.245740	D	0.93086	0.7799	M	0.92367	3.3	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.66602	0.945;0.945	D	0.94300	0.7536	10	0.87932	D	0	.	13.4002	0.60879	0.0:1.0:0.0:0.0	.	240;240	P29508;Q5K684	SPB3_HUMAN;.	Y	240	ENSP00000283752:D240Y	ENSP00000283752:D240Y	D	-	1	0	SERPINB3	59475095	0.002000	0.14202	0.009000	0.14445	0.254000	0.26022	0.933000	0.28897	1.800000	0.52685	0.455000	0.32223	GAT	-	SERPINB3	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.423	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB3	HGNC	protein_coding	OTTHUMT00000133791.1	0	0	0	75	75	34	0.00	0.00	C	NM_006919		61324115	-1	19	2	55	18	tier1	no_errors	ENST00000283752	ensembl	human	known	74_37	missense	25.68	10.00	SNP	0.055	A	19	55
GLOD4	51031	genome.wustl.edu	37	17	673297	673297	+	Missense_Mutation	SNP	A	A	C			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr17:673297A>C	ENST00000301328.5	-	8	799	c.776T>G	c.(775-777)aTt>aGt	p.I259S	GLOD4_ENST00000301329.6_Missense_Mutation_p.I244S|GLOD4_ENST00000536578.1_Missense_Mutation_p.I235S			Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4	259						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|prostate(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GTCGGCCAGAATGACCACCTG	0.507													ENSG00000167699																																					0													68.0	62.0	64.0					17																	673297		2203	4300	6503	SO:0001583	missense	0			-	AF177342	CCDS32520.1	17p13.3	2008-02-05	2007-03-14	2007-03-14		ENSG00000167699			14111	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 25"""	C17orf25		11642406, 12528892	Standard	NM_016080		Approved	CGI-150, HC71	uc002fru.3	Q9HC38		ENST00000301328.5:c.776T>G	17.37:g.673297A>C	ENSP00000301328:p.Ile259Ser		D3DTG9|D3DTH1|Q96B89|Q9H3J8|Q9HC37|Q9NVN1	Missense_Mutation	SNP	NULL	p.I259S	ENST00000301328.5	37	c.776		17	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019451	0.75275	.	.	ENSG00000167699	ENST00000301329;ENST00000397393;ENST00000301328;ENST00000536578	T;T;T	0.38240	1.15;1.15;1.15	5.79	5.79	0.91817	.	0.092466	0.64402	D	0.000001	T	0.68476	0.3005	M	0.92459	3.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.997;0.997;0.989	T	0.74538	-0.3632	10	0.42905	T	0.14	-6.2426	15.3033	0.73972	1.0:0.0:0.0:0.0	.	235;259;244	B7Z403;Q9HC38;Q9HC38-2	.;GLOD4_HUMAN;.	S	244;447;259;235	ENSP00000301329:I244S;ENSP00000301328:I259S;ENSP00000444315:I235S	ENSP00000301328:I259S	I	-	2	0	GLOD4	620047	1.000000	0.71417	0.997000	0.53966	0.535000	0.34838	8.963000	0.93385	2.198000	0.70561	0.533000	0.62120	ATT	-	GLOD4	-	NULL		0.507	GLOD4-005	KNOWN	basic	protein_coding	GLOD4	HGNC	protein_coding	OTTHUMT00000437190.1	0	0	0	72	72	92	0.00	0.00	A	NM_016080		673297	-1	14	13	32	37	tier1	no_errors	ENST00000301328	ensembl	human	known	74_37	missense	30.43	26.00	SNP	1.000	C	14	32
CAMKV	79012	genome.wustl.edu	37	3	49898704	49898704	+	Silent	SNP	C	C	T	rs569820460	byFrequency	TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr3:49898704C>T	ENST00000477224.1	-	6	949	c.471G>A	c.(469-471)ctG>ctA	p.L157L	CAMKV_ENST00000463537.1_Silent_p.L157L|CAMKV_ENST00000467248.1_Silent_p.L82L|CAMKV_ENST00000488336.1_Silent_p.L157L|CAMKV_ENST00000466940.1_Silent_p.L114L|CAMKV_ENST00000296471.7_Silent_p.L157L|CAMKV_ENST00000498324.1_5'Flank|RN7SL217P_ENST00000584520.1_RNA			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TCGAGTTCTTCAGCCGGTTGT	0.532													ENSG00000164076	C|||	2	0.000399361	0.0	0.0029	5008	,	,		15769	0.0		0.0	False		,,,				2504	0.0																0													87.0	81.0	83.0					3																	49898704		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.471G>A	3.37:g.49898704C>T			A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L157	ENST00000477224.1	37	c.471	CCDS33762.1	3																																																																																			-	CAMKV	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.532	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKV	HGNC	protein_coding	OTTHUMT00000350584.4	0	0	0	37	37	70	0.00	0.00	C	NM_024046		49898704	-1	11	23	25	93	tier1	no_errors	ENST00000477224	ensembl	human	known	74_37	silent	30.56	19.83	SNP	1.000	T	11	25
MYO18B	84700	genome.wustl.edu	37	22	26164163	26164163	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr22:26164163delG	ENST00000407587.2	+	4	449	c.280delG	c.(280-282)gacfs	p.D94fs	MYO18B_ENST00000335473.7_Frame_Shift_Del_p.D94fs|MYO18B_ENST00000536101.1_Frame_Shift_Del_p.D94fs			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	94	Ser-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTCTCAGGACGACCAGTCAAG	0.557													ENSG00000133454																																					0													112.0	118.0	116.0					22																	26164163		1999	4172	6171	SO:0001589	frameshift_variant	0				AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.280delG	22.37:g.26164163delG	ENSP00000386096:p.Asp94fs		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tR-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D94fs	ENST00000407587.2	37	c.280		22																																																																																				MYO18B	-	NULL		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	0	0	0	50	50	47	0.00	0.00	G	NM_032608		26164163	+1	8	14	29	32	tier1	no_errors	ENST00000335473	ensembl	human	known	74_37	frame_shift_del	21.62	30.43	DEL	0.001	-	8	29
TLR5	7100	genome.wustl.edu	37	1	223285856	223285856	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr1:223285856delT	ENST00000540964.1	-	4	979	c.518delA	c.(517-519)aagfs	p.K173fs	TLR5_ENST00000342210.6_Frame_Shift_Del_p.K173fs			O60602	TLR5_HUMAN	toll-like receptor 5	173					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		ATCTATGGACTTTAAGGAATT	0.388													ENSG00000187554																																					0													59.0	63.0	62.0					1																	223285856		2203	4300	6503	SO:0001589	frameshift_variant	0					CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.518delA	1.37:g.223285856delT	ENSP00000440643:p.Lys173fs		B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Frame_Shift_Del	DEL	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.K173fs	ENST00000540964.1	37	c.518	CCDS31033.1	1																																																																																				TLR5	-	smart_Leu-rich_rpt_typical-subtyp		0.388	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR5	HGNC	protein_coding		0	0	0	27	27	121	0.00	0.00	T	NM_003268		223285856	-1	11	68	17	119	tier1	no_errors	ENST00000342210	ensembl	human	known	74_37	frame_shift_del	39.29	36.36	DEL	0.001	-	11	17
TSSK2	23617	genome.wustl.edu	37	22	19119283	19119283	+	Missense_Mutation	SNP	T	T	G			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr22:19119283T>G	ENST00000399635.2	+	1	963	c.371T>G	c.(370-372)gTc>gGc	p.V124G	DGCR14_ENST00000252137.6_3'UTR	NM_053006.4	NP_443732.3	Q96PF2	TSSK2_HUMAN	testis-specific serine kinase 2	124	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(2)|lung(2)|prostate(4)|stomach(1)	11	Colorectal(54;0.0993)					TCCTCCGCCGTCAAGTACTGC	0.587													ENSG00000206203																																					0													120.0	97.0	105.0					22																	19119283		2203	4300	6503	SO:0001583	missense	0			-	AF362953	CCDS13755.1	22q11.21	2007-01-30	2005-03-10	2005-03-12	ENSG00000206203	ENSG00000206203			11401	protein-coding gene	gene with protein product		610710	"""serine/threonine kinase 22B (spermiogenesis associated)"""	STK22B		10591208	Standard	NM_053006		Approved	SPOGA2, FLJ38613	uc002zow.2	Q96PF2	OTTHUMG00000150118	ENST00000399635.2:c.371T>G	22.37:g.19119283T>G	ENSP00000382544:p.Val124Gly		Q8IY55	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V124G	ENST00000399635.2	37	c.371	CCDS13755.1	22	.	.	.	.	.	.	.	.	.	.	T	13.47	2.245648	0.39697	.	.	ENSG00000206203	ENST00000399635	D	0.84370	-1.84	5.48	5.48	0.80851	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.143157	0.32134	N	0.006537	D	0.90487	0.7020	M	0.89968	3.075	0.58432	D	0.999992	B	0.33448	0.412	B	0.42798	0.398	D	0.91427	0.5163	10	0.87932	D	0	.	14.5657	0.68173	0.0:0.0:0.0:1.0	.	124	Q96PF2	TSSK2_HUMAN	G	124	ENSP00000382544:V124G	ENSP00000382544:V124G	V	+	2	0	TSSK2	17499283	1.000000	0.71417	0.998000	0.56505	0.419000	0.31324	4.188000	0.58351	2.082000	0.62665	0.533000	0.62120	GTC	-	TSSK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.587	TSSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK2	HGNC	protein_coding	OTTHUMT00000316431.1	0	0	0	13	13	42	0.00	0.00	T			19119283	+1	8	8	25	97	tier1	no_errors	ENST00000399635	ensembl	human	known	74_37	missense	24.24	7.62	SNP	1.000	G	8	25
BEST1	7439	genome.wustl.edu	37	11	61725857	61725857	+	Intron	SNP	G	G	A			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr11:61725857G>A	ENST00000378043.4	+	7	1510				BEST1_ENST00000435278.2_Intron|BEST1_ENST00000526988.1_Silent_p.Q212Q|BEST1_ENST00000378042.3_Intron|BEST1_ENST00000301774.9_Intron|BEST1_ENST00000534553.1_Intron|BEST1_ENST00000449131.2_Intron	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						TGCAGTGTCAGGAAAGGAAGG	0.632													ENSG00000167995																																					0																																										SO:0001627	intron_variant	0			-	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.867+87G>A	11.37:g.61725857G>A			A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Silent	SNP	pfam_Bestrophin/UPF0187	p.Q318	ENST00000378043.4	37	c.954	CCDS31580.1	11																																																																																			-	BEST1	-	NULL		0.632	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST1	HGNC	protein_coding	OTTHUMT00000394715.1	0	0	0	48	48	19	0.00	0.00	G	NM_004183		61725857	+1	7	1	18	4	tier1	no_errors	ENST00000524926	ensembl	human	known	74_37	silent	28.00	20.00	SNP	0.000	A	7	18
FAM90A1	55138	genome.wustl.edu	37	12	8375178	8375178	+	Missense_Mutation	SNP	T	T	G			TCGA-IE-A3OV-01A-11D-A228-09	TCGA-IE-A3OV-11A-22D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4c52a1b8-fc8a-4df4-b1c2-c5154ef2c8c0	482bbe0c-c0a1-46f8-a7d9-6e98423cf2d8	g.chr12:8375178T>G	ENST00000538603.1	-	7	1193	c.635A>C	c.(634-636)cAg>cCg	p.Q212P	FAM90A1_ENST00000307435.6_Missense_Mutation_p.Q212P	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	212							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		GACTGCAGTCTGAGGGATGTC	0.617													ENSG00000171847																																					0													39.0	60.0	53.0					12																	8375178		2096	4204	6300	SO:0001583	missense	0			-	AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.635A>C	12.37:g.8375178T>G	ENSP00000445418:p.Gln212Pro		D3DUU9|Q9NVZ6	Missense_Mutation	SNP	NULL	p.Q212P	ENST00000538603.1	37	c.635	CCDS31738.1	12	.	.	.	.	.	.	.	.	.	.	.	2.088	-0.409035	0.04799	.	.	ENSG00000171847	ENST00000307435;ENST00000538603	T;T	0.13778	2.56;2.56	0.722	0.722	0.18225	.	.	.	.	.	T	0.09423	0.0232	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.30592	-0.9973	8	0.40728	T	0.16	-0.0568	.	.	.	.	212	Q86YD7	F90A1_HUMAN	P	212	ENSP00000307798:Q212P;ENSP00000445418:Q212P	ENSP00000307798:Q212P	Q	-	2	0	FAM90A1	8266445	0.016000	0.18221	0.005000	0.12908	0.019000	0.09904	0.264000	0.18497	0.568000	0.29311	0.163000	0.16589	CAG	-	FAM90A1	-	NULL		0.617	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM90A1	HGNC	protein_coding	OTTHUMT00000400468.1	0	0	0	280	280	0	0.00	0.00	T	NM_018088		8375178	-1	49	0	206	0	tier1	no_errors	ENST00000307435	ensembl	human	known	74_37	missense	19.22	0.00	SNP	0.005	G	49	206
