#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TENM1	10178	genome.wustl.edu	37	X	124097514	124097514	+	Missense_Mutation	SNP	C	C	G			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:124097514C>G	ENST00000371130.3	-	1	152	c.89G>C	c.(88-90)aGt>aCt	p.S30T	TENM1_ENST00000422452.2_Missense_Mutation_p.S30T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	30	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCCATCTTCACTCTCATCAGA	0.448													ENSG00000009694																																					0													308.0	273.0	285.0					X																	124097514		2203	4300	6503	SO:0001583	missense	0			-	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.89G>C	X.37:g.124097514C>G	ENSP00000360171:p.Ser30Thr		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.S30T	ENST00000371130.3	37	c.89	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	20.4	3.975983	0.74360	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.40225	1.04;1.04	5.78	5.78	0.91487	Teneurin intracellular, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.61527	0.2354	L	0.50333	1.59	0.54753	D	0.999983	D;D;P	0.57257	0.979;0.979;0.625	D;D;B	0.74023	0.982;0.982;0.402	T	0.62895	-0.6757	10	0.87932	D	0	.	18.9267	0.92548	0.0:1.0:0.0:0.0	.	30;30;30	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	30	ENSP00000360171:S30T;ENSP00000403954:S30T	ENSP00000360171:S30T	S	-	2	0	ODZ1	123925195	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.221000	0.78016	2.417000	0.82017	0.600000	0.82982	AGT	-	TENM1	-	pfam_Ten_N		0.448	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	0	0	0	56	56	100	0.00	0.00	C	NM_014253		124097514	-1	30	43	36	72	tier1	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	45.45	37.39	SNP	1.000	G	30	36
MICU2	221154	genome.wustl.edu	37	13	22067469	22067469	+	Silent	SNP	T	T	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr13:22067469T>C	ENST00000382374.4	-	12	1289	c.1224A>G	c.(1222-1224)caA>caG	p.Q408Q	MICU2_ENST00000479790.1_5'UTR	NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	408					mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TCCAGTATTCTTGTATACTCT	0.323													ENSG00000165487																																					0													161.0	153.0	156.0					13																	22067469		2202	4297	6499	SO:0001819	synonymous_variant	0			-	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.1224A>G	13.37:g.22067469T>C			Q8N0T6|Q8NAX8	Silent	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.Q408	ENST00000382374.4	37	c.1224	CCDS9297.1	13																																																																																			-	MICU2	-	NULL		0.323	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICU2	HGNC	protein_coding	OTTHUMT00000144355.1	1	1	0	116	116	146	0.85	0.00	T	NM_152726		22067469	-1	64	74	68	119	tier1	no_errors	ENST00000382374	ensembl	human	known	74_37	silent	48.48	37.56	SNP	0.998	C	64	68
BIRC8	112401	genome.wustl.edu	37	19	53793609	53793609	+	Missense_Mutation	SNP	G	G	A	rs375698355		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr19:53793609G>A	ENST00000426466.1	-	1	1266	c.19C>T	c.(19-21)Cgg>Tgg	p.R7W		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	7					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		GTAATGAGCCGGGCTTCATAA	0.418													ENSG00000163098																																					0								G	TRP/ARG	0,4406		0,0,2203	50.0	54.0	53.0		19	-0.9	0.1	19		53	1,8599	1.2+/-3.3	0,1,4299	no	missense	BIRC8	NM_033341.4	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	7/237	53793609	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.19C>T	19.37:g.53793609G>A	ENSP00000412957:p.Arg7Trp		Q6IPY1|Q96RW5	Missense_Mutation	SNP	pfam_BIR,smart_BIR,smart_Znf_RING,pfscan_BIR,pfscan_Znf_RING	p.R7W	ENST00000426466.1	37	c.19	CCDS12863.1	19	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594703	0.28445	0.0	1.16E-4	ENSG00000163098	ENST00000426466	D	0.96300	-3.97	0.502	-0.919	0.10478	Baculoviral inhibition of apoptosis protein repeat (5);	.	.	.	.	D	0.98024	0.9349	H	0.98802	4.335	0.53005	D	0.999967	D	0.65815	0.995	P	0.56514	0.8	D	0.95337	0.8435	9	0.72032	D	0.01	-18.8463	4.9287	0.13907	0.2609:0.0:0.7391:0.0	.	7	Q96P09	BIRC8_HUMAN	W	7	ENSP00000412957:R7W	ENSP00000412957:R7W	R	-	1	2	BIRC8	58485421	0.695000	0.27747	0.052000	0.19188	0.007000	0.05969	0.999000	0.29757	-0.213000	0.10094	-0.700000	0.03674	CGG	-	BIRC8	-	pfam_BIR,smart_BIR,pfscan_BIR		0.418	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC8	HGNC	protein_coding	OTTHUMT00000464357.1	0	0	0	39	39	125	0.00	0.00	G	NM_033341		53793609	-1	11	54	24	50	tier1	no_errors	ENST00000426466	ensembl	human	known	74_37	missense	31.43	51.92	SNP	0.904	A	11	24
NCK2	8440	genome.wustl.edu	37	2	106471560	106471560	+	Missense_Mutation	SNP	C	C	G			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:106471560C>G	ENST00000233154.4	+	3	483	c.41C>G	c.(40-42)aCc>aGc	p.T14S	AC009505.2_ENST00000596418.1_RNA|AC009505.2_ENST00000598281.1_RNA|AC009505.2_ENST00000427050.2_RNA|NCK2_ENST00000451463.2_Missense_Mutation_p.T14S|NCK2_ENST00000393349.2_Missense_Mutation_p.T14S|NCK2_ENST00000522586.1_Missense_Mutation_p.T14S	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	14	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						TGGGACTACACCGCCCAGCAG	0.542													ENSG00000071051																																					0													92.0	89.0	90.0					2																	106471560		2203	4300	6503	SO:0001583	missense	0			-	AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.41C>G	2.37:g.106471560C>G	ENSP00000233154:p.Thr14Ser		D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.T14S	ENST00000233154.4	37	c.41	CCDS33266.1	2	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049851	0.55218	.	.	ENSG00000071051	ENST00000233154;ENST00000451463;ENST00000393348;ENST00000522586;ENST00000425756;ENST00000393349	T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.77;0.76	5.7	5.7	0.88788	Src homology-3 domain (5);	0.048137	0.85682	D	0.000000	T	0.42426	0.1202	L	0.41356	1.27	0.80722	D	1	B;B	0.21452	0.014;0.056	B;B	0.29077	0.038;0.098	T	0.32824	-0.9892	10	0.07175	T	0.84	.	19.8253	0.96616	0.0:1.0:0.0:0.0	.	14;14	E7ERP6;O43639	.;NCK2_HUMAN	S	14	ENSP00000233154:T14S;ENSP00000410428:T14S;ENSP00000377017:T14S;ENSP00000431109:T14S;ENSP00000408040:T14S;ENSP00000377018:T14S	ENSP00000233154:T14S	T	+	2	0	NCK2	105837992	0.996000	0.38824	0.960000	0.40013	0.992000	0.81027	3.463000	0.53050	2.676000	0.91093	0.650000	0.86243	ACC	-	NCK2	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pirsf_Cytoplasmic_NCK,pfscan_SH3_domain,prints_SH3_domain		0.542	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCK2	HGNC	protein_coding	OTTHUMT00000329634.1	0	0	0	42	42	81	0.00	0.00	C	NM_003581		106471560	+1	26	40	19	51	tier1	no_errors	ENST00000233154	ensembl	human	known	74_37	missense	57.78	43.96	SNP	0.997	G	26	19
KIAA2012	100652824	genome.wustl.edu	37	2	202970560	202970560	+	Silent	SNP	G	G	A	rs530562614		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:202970560G>A	ENST00000541917.1	+	9	1774	c.1401G>A	c.(1399-1401)gcG>gcA	p.A467A	AC079354.1_ENST00000295844.3_Silent_p.A523A|AC079354.1_ENST00000409515.3_3'UTR																							TGAAGCATGCGTCCTTAGAAA	0.562													ENSG00000182329	G|||	1	0.000199681	0.0008	0.0	5008	,	,		21925	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001819	synonymous_variant	0			-																												ENST00000541917.1:c.1401G>A	2.37:g.202970560G>A				Silent	SNP	NULL	p.A467	ENST00000541917.1	37	c.1401		2																																																																																			-	AC079354.1	-	NULL		0.562	AC079354.1-201	KNOWN	basic|appris_principal	protein_coding	LOC100652824	Clone_based_vega_gene	protein_coding		0	0	0	48	48	81	0.00	0.00	G			202970560	+1	31	31	26	36	tier1	no_errors	ENST00000541917	ensembl	human	known	74_37	silent	54.39	45.59	SNP	0.000	A	31	26
C14orf39	317761	genome.wustl.edu	37	14	60945096	60945096	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr14:60945096G>A	ENST00000321731.3	-	5	404	c.245C>T	c.(244-246)aCa>aTa	p.T82I		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	82					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		AACATCACATGTTGGCTTCCA	0.259													ENSG00000179008																																					0													61.0	60.0	60.0					14																	60945096		2202	4295	6497	SO:0001583	missense	0			-	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.245C>T	14.37:g.60945096G>A	ENSP00000324920:p.Thr82Ile		Q08AQ4	Missense_Mutation	SNP	NULL	p.T82I	ENST00000321731.3	37	c.245	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686184	0.47991	.	.	ENSG00000179008	ENST00000321731;ENST00000555476;ENST00000556799	T;T	0.58210	0.83;0.35	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	T	0.72391	0.3454	M	0.69823	2.125	0.40882	D	0.984002	D	0.89917	1.0	D	0.87578	0.998	T	0.74153	-0.3757	10	0.59425	D	0.04	-8.3516	17.3748	0.87389	0.0:0.0:1.0:0.0	.	82	Q8N1H7	S6OS1_HUMAN	I	82;53;82	ENSP00000324920:T82I;ENSP00000451665:T53I	ENSP00000324920:T82I	T	-	2	0	C14orf39	60014849	1.000000	0.71417	1.000000	0.80357	0.049000	0.14656	6.011000	0.70760	2.771000	0.95319	0.650000	0.86243	ACA	-	C14orf39	-	NULL		0.259	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	HGNC	protein_coding	OTTHUMT00000276948.1	0	0	0	67	67	73	0.00	0.00	G	NM_174978		60945096	-1	27	39	48	47	tier1	no_errors	ENST00000321731	ensembl	human	known	74_37	missense	36.00	45.35	SNP	1.000	A	27	48
CLCA2	9635	genome.wustl.edu	37	1	86913457	86913457	+	Silent	SNP	A	A	G			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr1:86913457A>G	ENST00000370565.4	+	11	2142	c.1980A>G	c.(1978-1980)ggA>ggG	p.G660G		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	660					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TTGATGATGGAGCAGGTAACA	0.413													ENSG00000137975																									Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)												0													59.0	56.0	57.0					1																	86913457		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1980A>G	1.37:g.86913457A>G			A8K2T3|Q9Y6N2	Silent	SNP	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.G660	ENST00000370565.4	37	c.1980	CCDS708.1	1																																																																																			-	CLCA2	-	pfam_DUF1973,tigrfam_CaCC_prot		0.413	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA2	HGNC	protein_coding	OTTHUMT00000028284.1	0	0	0	67	67	46	0.00	0.00	A	NM_006536		86913457	+1	18	26	38	39	tier1	no_errors	ENST00000370565	ensembl	human	known	74_37	silent	32.14	39.39	SNP	0.998	G	18	38
KIF4A	24137	genome.wustl.edu	37	X	69550144	69550144	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:69550144G>A	ENST00000374403.3	+	9	1115	c.1033G>A	c.(1033-1035)Gat>Aat	p.D345N	KIF4A_ENST00000374388.3_Missense_Mutation_p.D345N	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	345					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TGTTAATATTGATCCCCAGAC	0.378													ENSG00000090889																																					0													107.0	102.0	103.0					X																	69550144		2203	4298	6501	SO:0001583	missense	0			-	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1033G>A	X.37:g.69550144G>A	ENSP00000363524:p.Asp345Asn		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D345N	ENST00000374403.3	37	c.1033	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	30	5.054928	0.93793	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.73363	-0.74;-0.74	5.16	5.16	0.70880	Kinesin, motor domain (1);	0.100034	0.43919	D	0.000507	D	0.84552	0.5497	M	0.80508	2.5	0.80722	D	1	P;P	0.49696	0.927;0.797	P;P	0.56434	0.798;0.584	D	0.87140	0.2202	10	0.87932	D	0	.	16.9009	0.86113	0.0:0.0:1.0:0.0	.	345;345	O95239;O95239-2	KIF4A_HUMAN;.	N	345	ENSP00000363509:D345N;ENSP00000363524:D345N	ENSP00000363509:D345N	D	+	1	0	KIF4A	69466869	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.379000	0.97198	2.285000	0.76669	0.436000	0.28706	GAT	-	KIF4A	-	superfamily_P-loop_NTPase		0.378	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	0	0	0	51	51	33	0.00	0.00	G	NM_012310		69550144	+1	27	12	30	24	tier1	no_errors	ENST00000374403	ensembl	human	known	74_37	missense	47.37	33.33	SNP	1.000	A	27	30
CDC123	8872	genome.wustl.edu	37	10	12288380	12288380	+	Intron	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr10:12288380G>A	ENST00000281141.4	+	11	1126				RP11-186N15.3_ENST00000421657.1_RNA|RP11-186N15.3_ENST00000598961.1_RNA|CDC123_ENST00000455773.3_Intron|CDC123_ENST00000378900.2_Intron	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123						cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						GGACCCTTGGGAAGCGCAGAG	0.463													ENSG00000228302																																					0																																										SO:0001627	intron_variant	0			-	BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.846+104G>A	10.37:g.12288380G>A			A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	R	SNP	-	NULL	ENST00000281141.4	37	NULL	CCDS7090.1	10																																																																																			-	RP11-186N15.3	-	-		0.463	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228302	Clone_based_vega_gene	protein_coding	OTTHUMT00000046801.1	0	0	0	9	9	83	0.00	0.00	G	NM_006023		12288380	-1	7	42	4	64	tier1	no_errors	ENST00000421657	ensembl	human	known	74_37	rna	63.64	39.62	SNP	0.000	A	7	4
SETD5	55209	genome.wustl.edu	37	3	9476152	9476152	+	Silent	SNP	C	C	T	rs376494447		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:9476152C>T	ENST00000406341.1	+	4	502	c.312C>T	c.(310-312)ctC>ctT	p.L104L	SETD5_ENST00000302463.6_5'UTR|SETD5_ENST00000402466.1_5'UTR|SETD5_ENST00000407969.1_Silent_p.L123L|SETD5_ENST00000402198.1_Silent_p.L104L			Q9C0A6	SETD5_HUMAN	SET domain containing 5	104										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		GCTTCCTTCTCAACTGTGACA	0.473													ENSG00000168137																																					0								C		0,3904		0,0,1952	95.0	98.0	97.0		312	4.9	1.0	3		97	2,8302		0,2,4150	no	coding-synonymous	SETD5	NM_001080517.1		0,2,6102	TT,TC,CC		0.0241,0.0,0.0164		104/1443	9476152	2,12206	1952	4152	6104	SO:0001819	synonymous_variant	0			-	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.312C>T	3.37:g.9476152C>T			Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.L104	ENST00000406341.1	37	c.312	CCDS46741.1	3																																																																																			-	SETD5	-	NULL		0.473	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	HGNC	protein_coding	OTTHUMT00000318425.1	0	0	0	60	60	134	0.00	0.00	C	XM_371614		9476152	+1	55	74	44	70	tier1	no_errors	ENST00000402198	ensembl	human	known	74_37	silent	55.56	51.39	SNP	1.000	T	55	44
C18orf32	497661	genome.wustl.edu	37	18	47013943	47013943	+	5'Flank	SNP	A	A	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr18:47013943A>C	ENST00000318240.3	-	0	0				MIR1539_ENST00000581232.1_RNA|C18orf32_ENST00000582392.1_5'Flank|RPL17-C18orf32_ENST00000584895.1_Intron|MIR1539_ENST00000410758.1_RNA|RPL17_ENST00000581091.1_5'Flank|RPL17-C18orf32_ENST00000332968.6_Intron|C18orf32_ENST00000579820.1_5'Flank|RP11-110H1.4_ENST00000580150.1_RNA|SNORD58C_ENST00000365223.1_RNA	NM_001035005.3	NP_001030177.1	Q8TCD1	CR032_HUMAN	chromosome 18 open reading frame 32						positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)		signal transducer activity (GO:0004871)			large_intestine(2)|lung(1)	3						TGGATAAGCTATTAGTTTTGC	0.468													ENSG00000265496																																					0																																										SO:0001631	upstream_gene_variant	0			-	AK027111	CCDS32831.1	18q21.1	2012-10-24			ENSG00000177576	ENSG00000177576			31690	protein-coding gene	gene with protein product							Standard	NM_001035005		Approved	FLJ23458	uc002ldl.3	Q8TCD1	OTTHUMG00000179688		18.37:g.47013943A>C	Exception_encountered			R	SNP	-	NULL	ENST00000318240.3	37	NULL	CCDS32831.1	18																																																																																			-	MIR1539	-	-		0.468	C18orf32-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MIR1539	HGNC	protein_coding	OTTHUMT00000447656.1	0	0	0	26	26	101	0.00	0.00	A	NM_001035005		47013943	+1	7	23	14	42	tier1	no_errors	ENST00000581232	ensembl	human	known	74_37	rna	33.33	35.38	SNP	0.000	C	7	14
RGAG1	57529	genome.wustl.edu	37	X	109695944	109695944	+	Missense_Mutation	SNP	A	A	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:109695944A>T	ENST00000465301.2	+	3	2345	c.2099A>T	c.(2098-2100)cAa>cTa	p.Q700L	RGAG1_ENST00000540313.1_Missense_Mutation_p.Q700L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	700										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATGAGAGCTCAAGACCCAGGA	0.507													ENSG00000243978																																					0													122.0	101.0	108.0					X																	109695944		2203	4300	6503	SO:0001583	missense	0			-	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2099A>T	X.37:g.109695944A>T	ENSP00000419786:p.Gln700Leu		Q9P2M8	Missense_Mutation	SNP	NULL	p.Q700L	ENST00000465301.2	37	c.2099	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	A	1.081	-0.667046	0.03428	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.44083	0.93;0.93	3.96	2.09	0.27110	.	0.852571	0.09821	N	0.751458	T	0.26738	0.0654	L	0.29908	0.895	0.09310	N	1	B	0.14805	0.011	B	0.09377	0.004	T	0.24548	-1.0157	9	.	.	.	-0.6656	4.1289	0.10139	0.4424:0.4398:0.0:0.1178	.	700	Q8NET4	RGAG1_HUMAN	L	700	ENSP00000419786:Q700L;ENSP00000441452:Q700L	.	Q	+	2	0	RGAG1	109582600	0.229000	0.23729	0.001000	0.08648	0.004000	0.04260	1.712000	0.37940	0.402000	0.25451	-0.269000	0.10298	CAA	-	RGAG1	-	NULL		0.507	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	0	0	0	54	54	96	0.00	0.00	A	NM_020769		109695944	+1	24	40	29	62	tier1	no_errors	ENST00000465301	ensembl	human	known	74_37	missense	45.28	39.22	SNP	0.003	T	24	29
TCEB3B	51224	genome.wustl.edu	37	18	44559800	44559800	+	Silent	SNP	C	C	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr18:44559800C>T	ENST00000332567.4	-	1	2188	c.1836G>A	c.(1834-1836)ccG>ccA	p.P612P	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	612	Activation domain. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CTGGGGCGTCCGGAAGCCGCA	0.498													ENSG00000206181																																					0													73.0	79.0	77.0					18																	44559800		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1836G>A	18.37:g.44559800C>T			Q9P2V9	Silent	SNP	pfam_R_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.P612	ENST00000332567.4	37	c.1836	CCDS11932.1	18																																																																																			-	TCEB3B	-	pfam_R_pol_II_trans_fac_SIII_A		0.498	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	HGNC	protein_coding	OTTHUMT00000255900.1	0	0	0	66	66	75	0.00	0.00	C	NM_016427		44559800	-1	24	41	40	57	tier1	no_errors	ENST00000332567	ensembl	human	known	74_37	silent	37.50	41.84	SNP	0.993	T	24	40
FAM26D	221301	genome.wustl.edu	37	6	116875489	116875489	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr6:116875489C>A	ENST00000368596.3	+	1	577	c.533C>A	c.(532-534)gCt>gAt	p.A178D	FAM26D_ENST00000405399.1_Missense_Mutation_p.A35D|FAM26D_ENST00000368597.2_Intron|FAM26D_ENST00000416171.2_Missense_Mutation_p.A34D			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	178					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		GATGAAATAGCTCTTCTGCAC	0.408													ENSG00000164451																																					0																																										SO:0001583	missense	0			-	AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.533C>A	6.37:g.116875489C>A	ENSP00000357585:p.Ala178Asp		B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Missense_Mutation	SNP	NULL	p.A178D	ENST00000368596.3	37	c.533		6	.	.	.	.	.	.	.	.	.	.	C	11.90	1.777594	0.31502	.	.	ENSG00000164451	ENST00000416171;ENST00000405399;ENST00000368596	T;T;T	0.18960	2.18;2.18;2.18	6.11	2.18	0.27775	.	0.503984	0.20018	N	0.100967	T	0.02807	0.0084	.	.	.	0.27120	N	0.962158	P;P	0.45474	0.859;0.773	B;B	0.37304	0.246;0.246	T	0.33574	-0.9863	9	0.16420	T	0.52	-19.597	4.2659	0.10763	0.0:0.4497:0.1598:0.3905	.	34;178	B4DTQ0;Q5JW98	.;FA26D_HUMAN	D	34;35;178	ENSP00000416976:A34D;ENSP00000385836:A35D;ENSP00000357585:A178D	ENSP00000357585:A178D	A	+	2	0	FAM26D	116982182	0.985000	0.35326	0.427000	0.26684	0.906000	0.53458	0.804000	0.27098	0.389000	0.25086	-0.345000	0.07892	GCT	-	FAM26D	-	NULL		0.408	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	0	0	0	30	30	59	0.00	0.00	C	NM_153036		116875489	+1	16	36	14	39	tier1	no_errors	ENST00000368596	ensembl	human	known	74_37	missense	53.33	48.00	SNP	0.771	A	16	14
TENM1	10178	genome.wustl.edu	37	X	124097497	124097497	+	Missense_Mutation	SNP	G	G	C	rs370597690		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:124097497G>C	ENST00000371130.3	-	1	169	c.106C>G	c.(106-108)Cca>Gca	p.P36A	TENM1_ENST00000422452.2_Missense_Mutation_p.P36A	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	36	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GACTGTCTTGGTTTTCTTCCA	0.438													ENSG00000009694																																					0													316.0	283.0	294.0					X																	124097497		2203	4300	6503	SO:0001583	missense	0			-	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.106C>G	X.37:g.124097497G>C	ENSP00000360171:p.Pro36Ala		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.P36A	ENST00000371130.3	37	c.106	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342883	0.41498	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.30981	1.51;1.51	5.78	5.78	0.91487	Teneurin intracellular, N-terminal (2);	0.154026	0.44285	D	0.000480	T	0.26955	0.0660	L	0.34521	1.04	0.35125	D	0.767452	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.001	T	0.22208	-1.0223	10	0.62326	D	0.03	.	15.1558	0.72739	0.0:0.1375:0.8625:0.0	.	36;36;36	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	A	36	ENSP00000360171:P36A;ENSP00000403954:P36A	ENSP00000360171:P36A	P	-	1	0	ODZ1	123925178	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.028000	0.64115	2.417000	0.82017	0.600000	0.82982	CCA	-	TENM1	-	pfam_Ten_N		0.438	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	0	0	0	53	53	101	0.00	0.00	G	NM_014253		124097497	-1	30	43	35	73	tier1	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	45.45	37.07	SNP	1.000	C	30	35
ZNF726	730087	genome.wustl.edu	37	19	24102852	24102852	+	Missense_Mutation	SNP	T	T	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr19:24102852T>C	ENST00000334589.5	+	3	312	c.194T>C	c.(193-195)aTg>aCg	p.M65T	ZNF726_ENST00000594466.1_Missense_Mutation_p.M65T|ZNF726_ENST00000575986.1_Missense_Mutation_p.M65T|CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000322487.7_Missense_Mutation_p.M65T|ZNF726_ENST00000531821.2_Missense_Mutation_p.M65T|ZNF726_ENST00000525354.2_Missense_Mutation_p.M65T			A6NNF4	ZN726_HUMAN	zinc finger protein 726	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCCTGGAATATGAAGCGAGAT	0.423													ENSG00000213967																																					0																																										SO:0001583	missense	0			-	DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000334589.5:c.194T>C	19.37:g.24102852T>C	ENSP00000334762:p.Met65Thr		M0R0X8|Q86Y87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M65T	ENST00000334589.5	37	c.194		19	.	.	.	.	.	.	.	.	.	.	t	2.781	-0.253460	0.05829	.	.	ENSG00000213967	ENST00000525354;ENST00000334589;ENST00000531821;ENST00000322487	T;T;T;T	0.06142	5.71;5.64;5.67;3.34	1.14	-2.28	0.06826	.	.	.	.	.	T	0.04815	0.0130	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40194	-0.9576	6	0.42905	T	0.14	.	1.3689	0.02207	0.3385:0.2819:0.0:0.3795	.	.	.	.	T	65	ENSP00000433319:M65T;ENSP00000334762:M65T;ENSP00000432583:M65T;ENSP00000317125:M65T	ENSP00000317125:M65T	M	+	2	0	ZNF726	23894692	0.012000	0.17670	0.000000	0.03702	0.006000	0.05464	-0.140000	0.10342	-0.504000	0.06577	0.352000	0.21897	ATG	-	ZNF726	-	pfscan_Krueppel-associated_box		0.423	ZNF726-003	PUTATIVE	basic|exp_conf	protein_coding	ZNF726	HGNC	protein_coding	OTTHUMT00000395815.2	0	0	0	86	86	30	0.00	0.00	T	XM_001715134		24102852	+1	29	22	58	25	tier1	no_errors	ENST00000322487	ensembl	human	known	74_37	missense	33.33	46.81	SNP	0.000	C	29	58
PODXL	5420	genome.wustl.edu	37	7	131190689	131190689	+	Silent	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr7:131190689G>A	ENST00000378555.3	-	8	1664	c.1417C>T	c.(1417-1419)Ctg>Ttg	p.L473L	PODXL_ENST00000537928.1_Silent_p.L441L|PODXL_ENST00000541194.1_Silent_p.L475L|PODXL_ENST00000322985.9_Silent_p.L441L			O00592	PODXL_HUMAN	podocalyxin-like	473					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ACGAGGAGCAGGAATGATGCC	0.632													ENSG00000128567																																					0													40.0	34.0	36.0					7																	131190689		2203	4299	6502	SO:0001819	synonymous_variant	0			-		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.1417C>T	7.37:g.131190689G>A			A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	pfam_CD34/Podocalyxin,pirsf_Podocalyxin-like_p1	p.L475	ENST00000378555.3	37	c.1423	CCDS34755.1	7																																																																																			-	PODXL	-	pfam_CD34/Podocalyxin,pirsf_Podocalyxin-like_p1		0.632	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PODXL	HGNC	protein_coding	OTTHUMT00000337627.2	0	0	0	74	74	26	0.00	0.00	G	NM_001018111		131190689	-1	6	3	51	18	tier1	no_errors	ENST00000541194	ensembl	human	known	74_37	silent	10.53	13.64	SNP	1.000	A	6	51
WDR87	83889	genome.wustl.edu	37	19	38378740	38378740	+	Silent	SNP	T	T	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr19:38378740T>C	ENST00000303868.5	-	6	5678	c.5454A>G	c.(5452-5454)agA>agG	p.R1818R	WDR87_ENST00000447313.2_Silent_p.R1857R	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1818	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TGTTGATCCATCTTTCCCTTT	0.443													ENSG00000171804																																					0													222.0	155.0	175.0					19																	38378740		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.5454A>G	19.37:g.38378740T>C			Q9BWV9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1857	ENST00000303868.5	37	c.5571	CCDS46063.1	19																																																																																			-	WDR87	-	superfamily_ARM-type_fold		0.443	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	0	0	1	116	116	149	0.00	0.67	T	XM_940478		38378740	-1	45	67	13	12	tier1	no_errors	ENST00000447313	ensembl	human	known	74_37	silent	77.59	84.81	SNP	0.000	C	45	13
RAD54L2	23132	genome.wustl.edu	37	3	51669630	51669630	+	Missense_Mutation	SNP	A	A	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:51669630A>C	ENST00000409535.2	+	9	1289	c.1164A>C	c.(1162-1164)aaA>aaC	p.K388N	RAD54L2_ENST00000296477.3_Missense_Mutation_p.K82N	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	388	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CTCGTGCTAAAGTGATGGCTG	0.463													ENSG00000164080																																					0													125.0	112.0	116.0					3																	51669630		2203	4300	6503	SO:0001583	missense	0			-	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.1164A>C	3.37:g.51669630A>C	ENSP00000386520:p.Lys388Asn		Q8TB57|Q9BV54	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K388N	ENST00000409535.2	37	c.1164	CCDS33765.2	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.95|15.95	2.983535|2.983535	0.53827|0.53827	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000409535;ENST00000296477|ENST00000432863	D;D|.	0.93659|.	-3.26;-3.26|.	5.43|5.43	3.11|3.11	0.35812|0.35812	DEAD-like helicase (2);SNF2-related (1);|.	0.042343|.	0.85682|.	D|.	0.000000|.	T|T	0.43433|0.43433	0.1247|0.1247	L|L	0.28776|0.28776	0.89|0.89	0.52501|0.52501	D|D	0.999956|0.999956	B|.	0.30021|.	0.265|.	B|.	0.39706|.	0.307|.	T|T	0.20907|0.20907	-1.0261|-1.0261	10|5	0.36615|.	T|.	0.2|.	-2.7906|-2.7906	7.5205|7.5205	0.27624|0.27624	0.8232:0.0:0.1767:0.0|0.8232:0.0:0.1767:0.0	.|.	388|.	Q9Y4B4|.	ARIP4_HUMAN|.	N|R	388;82|217	ENSP00000386520:K388N;ENSP00000296477:K82N|.	ENSP00000296477:K82N|.	K|S	+|+	3|1	2|0	RAD54L2|RAD54L2	51644670|51644670	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.708000|1.708000	0.37899|0.37899	2.069000|2.069000	0.61940|0.61940	0.533000|0.533000	0.62120|0.62120	AAA|AGT	-	RAD54L2	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.463	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	0	0	1	36	36	91	0.00	1.09	A	NM_015106		51669630	+1	22	22	28	27	tier1	no_errors	ENST00000409535	ensembl	human	known	74_37	missense	44.00	44.90	SNP	1.000	C	22	28
LRP2	4036	genome.wustl.edu	37	2	169999283	169999283	+	Missense_Mutation	SNP	T	T	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:169999283T>C	ENST00000263816.3	-	71	13294	c.13009A>G	c.(13009-13011)Atc>Gtc	p.I4337V		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4337	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGGCTGCAGATCTGTTTGCAA	0.542													ENSG00000081479																																					0													118.0	113.0	115.0					2																	169999283		2203	4300	6503	SO:0001583	missense	0			-		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13009A>G	2.37:g.169999283T>C	ENSP00000263816:p.Ile4337Val		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.I4337V	ENST00000263816.3	37	c.13009	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	T	1.467	-0.560837	0.03939	.	.	ENSG00000081479	ENST00000263816	D	0.89196	-2.48	5.86	2.09	0.27110	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.318407	0.33127	N	0.005252	T	0.58524	0.2128	N	0.00146	-1.995	0.58432	D	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.49485	-0.8935	10	0.12430	T	0.62	.	9.3347	0.38043	0.0:0.7346:0.0:0.2654	.	4337	P98164	LRP2_HUMAN	V	4337	ENSP00000263816:I4337V	ENSP00000263816:I4337V	I	-	1	0	LRP2	169707529	0.212000	0.23540	0.156000	0.22583	0.109000	0.19521	0.753000	0.26376	0.175000	0.19841	-0.924000	0.02725	ATC	-	LRP2	-	superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom		0.542	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	0	0	0	66	66	74	0.00	0.00	T	NM_004525		169999283	-1	25	41	45	43	tier1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	35.71	48.81	SNP	0.636	C	25	45
KIF9	64147	genome.wustl.edu	37	3	47287688	47287688	+	Splice_Site	SNP	T	T	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:47287688T>A	ENST00000265529.3	-	14	1968	c.1288A>T	c.(1288-1290)Agc>Tgc	p.S430C	KIF9_ENST00000487440.1_5'UTR|KIF9_ENST00000452770.2_Splice_Site_p.S430C|KIF9-AS1_ENST00000429315.3_RNA|KIF9_ENST00000352910.4_Splice_Site_p.S337C|KIF9_ENST00000335044.2_Splice_Site_p.S430C|KIF9_ENST00000444589.2_Splice_Site_p.S430C			Q9HAQ2	KIF9_HUMAN	kinesin family member 9	430					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GTCTCTCACCTCAGAACCACC	0.537													ENSG00000088727																									Colon(44;962 1147 15977 24541)												0													68.0	54.0	59.0					3																	47287688		2202	4300	6502	SO:0001630	splice_region_variant	0			-	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.1289+1A>T	3.37:g.47287688T>A			Q86Z28|Q9H8A4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S430C	ENST00000265529.3	37	c.1288	CCDS2752.1	3	.	.	.	.	.	.	.	.	.	.	T	14.84	2.654078	0.47362	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.16	5.16	0.70880	.	0.332353	0.36444	N	0.002597	T	0.54759	0.1878	L	0.44542	1.39	0.28649	N	0.90677	D;P	0.60575	0.988;0.943	P;B	0.57244	0.816;0.428	T	0.54774	-0.8243	10	0.66056	D	0.02	.	12.9933	0.58632	0.0:0.0:0.0:1.0	.	430;430	Q9HAQ2-2;Q9HAQ2	.;KIF9_HUMAN	C	430;430;430;430;337	ENSP00000333942:S430C;ENSP00000265529:S430C;ENSP00000414987:S430C;ENSP00000391100:S430C;ENSP00000292334:S337C	ENSP00000265529:S430C	S	-	1	0	KIF9	47262692	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	3.691000	0.54720	2.174000	0.68829	0.528000	0.53228	AGC	-	KIF9	-	NULL		0.537	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF9	HGNC	protein_coding	OTTHUMT00000257475.2	0	0	0	74	74	96	0.00	0.00	T		Missense_Mutation	47287688	-1	36	46	31	50	tier1	no_errors	ENST00000265529	ensembl	human	known	74_37	missense	53.73	47.92	SNP	1.000	A	36	31
ANAPC1	64682	genome.wustl.edu	37	2	112536331	112536331	+	Missense_Mutation	SNP	T	T	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:112536331T>A	ENST00000341068.3	-	45	6078	c.5306A>T	c.(5305-5307)gAt>gTt	p.D1769V		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1769					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						AGAAAAGAGATCCAGAATTTC	0.383													ENSG00000153107																																					0													57.0	53.0	55.0					2																	112536331		2200	4294	6494	SO:0001583	missense	0			-	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.5306A>T	2.37:g.112536331T>A	ENSP00000339109:p.Asp1769Val		Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	NULL	p.D1769V	ENST00000341068.3	37	c.5306	CCDS2093.1	2	.	.	.	.	.	.	.	.	.	.	T	7.986	0.752153	0.15778	.	.	ENSG00000153107	ENST00000341068	.	.	.	4.05	4.05	0.47172	.	0.109079	0.36167	N	0.002749	T	0.44623	0.1302	L	0.40543	1.245	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33879	-0.9851	9	0.28530	T	0.3	-8.3828	8.8988	0.35481	0.0:0.0904:0.0:0.9096	.	1769	Q9H1A4	APC1_HUMAN	V	1769	.	ENSP00000339109:D1769V	D	-	2	0	ANAPC1	112252802	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.710000	0.47169	1.585000	0.49928	0.454000	0.30748	GAT	-	APC1	-	NULL		0.383	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APC1	HGNC	protein_coding	OTTHUMT00000254045.2	0	0	0	159	159	34	0.00	0.00	T	NM_022662		112536331	-1	60	22	78	29	tier1	no_errors	ENST00000341068	ensembl	human	known	74_37	missense	43.48	43.14	SNP	1.000	A	60	78
SCML2	10389	genome.wustl.edu	37	X	18257646	18257646	+	3'UTR	SNP	T	T	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:18257646T>A	ENST00000251900.4	-	0	3987				SCML2_ENST00000491988.1_5'UTR	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)						anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CTAAAGTACATTTGGTTTTCT	0.289													ENSG00000102098																									Esophageal Squamous(100;1252 1965 19021 35517)												0																																										SO:0001624	3_prime_UTR_variant	0			-	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.*1725A>T	X.37:g.18257646T>A			Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	R	SNP	-	NULL	ENST00000251900.4	37	NULL	CCDS14185.1	X																																																																																			-	SCML2	-	-		0.289	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	HGNC	protein_coding	OTTHUMT00000055941.1	0	0	0	106	106	86	0.00	0.00	T	NM_006089		18257646	-1	52	62	66	65	tier1	no_errors	ENST00000491988	ensembl	human	known	74_37	rna	44.07	48.82	SNP	1.000	A	52	66
COL6A6	131873	genome.wustl.edu	37	3	130293060	130293060	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:130293060G>A	ENST00000358511.6	+	7	3269	c.3238G>A	c.(3238-3240)Ggt>Agt	p.G1080S	COL6A6_ENST00000453409.2_Missense_Mutation_p.G1080S	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1080	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G1080S(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CACACACATCGGTGCTGCACT	0.473													ENSG00000206384																																					1	Substitution - Missense(1)	endometrium(1)											98.0	98.0	98.0					3																	130293060		1998	4172	6170	SO:0001583	missense	0			-	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3238G>A	3.37:g.130293060G>A	ENSP00000351310:p.Gly1080Ser		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G1080S	ENST00000358511.6	37	c.3238	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481386	0.63849	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.85629	-2.01;-2.01	5.0	5.0	0.66597	von Willebrand factor, type A (3);	0.000000	0.56097	D	0.000021	D	0.94079	0.8102	M	0.91510	3.215	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.95184	0.8302	10	0.72032	D	0.01	.	18.2589	0.90028	0.0:0.0:1.0:0.0	.	1080	A6NMZ7	CO6A6_HUMAN	S	1080	ENSP00000351310:G1080S;ENSP00000399236:G1080S	ENSP00000351310:G1080S	G	+	1	0	COL6A6	131775750	1.000000	0.71417	0.687000	0.30102	0.021000	0.10359	9.383000	0.97214	2.480000	0.83734	0.561000	0.74099	GGT	-	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.473	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	0	0	0	16	16	90	0.00	0.00	G	NM_001102608		130293060	+1	8	51	8	70	tier1	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	50.00	42.15	SNP	1.000	A	8	8
DRD1	1812	genome.wustl.edu	37	5	174869993	174869993	+	Missense_Mutation	SNP	G	G	A	rs5327	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr5:174869993G>A	ENST00000393752.2	-	2	1102	c.110C>T	c.(109-111)aCg>aTg	p.T37M		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	37			T -> P (in dbSNP:rs5327).|T -> R (in dbSNP:rs5328).		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CCCCAGGAGCGTGGACAGGAT	0.572													ENSG00000184845																																					0			GRCh37	CM086309	DRD1	M	rs5328						102.0	94.0	97.0					5																	174869993		2203	4300	6503	SO:0001583	missense	0			-	X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.110C>T	5.37:g.174869993G>A	ENSP00000377353:p.Thr37Met		B2RA44|Q4QRJ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Dopamine_D1_rcpt,prints_GPCR_Rhodpsn,prints_Dopamine_rcpt,prints_ADR_fam	p.T37M	ENST00000393752.2	37	c.110	CCDS4393.1	5	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309924	0.81247	.	.	ENSG00000184845	ENST00000393752;ENST00000329144	T	0.40756	1.02	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.69895	0.3162	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74414	-0.3673	10	0.72032	D	0.01	.	18.5126	0.90923	0.0:0.0:1.0:0.0	.	37	P21728	DRD1_HUMAN	M	37	ENSP00000377353:T37M	ENSP00000327652:T37M	T	-	2	0	DRD1	174802599	1.000000	0.71417	0.969000	0.41365	0.994000	0.84299	9.675000	0.98638	2.679000	0.91253	0.650000	0.86243	ACG	-	DRD1	-	pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_GPCR_Rhodpsn		0.572	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD1	HGNC	protein_coding	OTTHUMT00000252982.2	0	0	0	36	36	53	0.00	0.00	G	NM_000794		174869993	-1	19	41	0	5	tier1	no_errors	ENST00000393752	ensembl	human	known	74_37	missense	100.00	89.13	SNP	1.000	A	19	0
EPN2	22905	genome.wustl.edu	37	17	19189049	19189049	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr17:19189049C>T	ENST00000314728.5	+	4	1196	c.712C>T	c.(712-714)Cgc>Tgc	p.R238C	EPN2_ENST00000395626.1_Missense_Mutation_p.R238C|EPN2_ENST00000347697.2_Intron|EPN2_ENST00000571254.1_Intron|EPN2_ENST00000395620.2_Intron|EPN2_ENST00000575595.1_Intron|EPN2_ENST00000395618.3_Intron	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	238					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					gctggcctcccgcccaaatgg	0.677													ENSG00000072134																																					0													14.0	15.0	14.0					17																	19189049		2197	4284	6481	SO:0001583	missense	0			-	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.712C>T	17.37:g.19189049C>T	ENSP00000320543:p.Arg238Cys		A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.R238C	ENST00000314728.5	37	c.712	CCDS11203.1	17	.	.	.	.	.	.	.	.	.	.	C	13.53	2.266022	0.40095	.	.	ENSG00000072134	ENST00000314728;ENST00000395626	T;T	0.33654	2.41;1.4	5.22	3.17	0.36434	.	0.940458	0.08999	N	0.863343	T	0.20007	0.0481	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07790	-1.0754	10	0.48119	T	0.1	-2.5782	7.5628	0.27862	0.0:0.7969:0.0:0.2031	.	238;238	E9PBC1;O95208	.;EPN2_HUMAN	C	238	ENSP00000320543:R238C;ENSP00000378988:R238C	ENSP00000320543:R238C	R	+	1	0	EPN2	19129642	0.976000	0.34144	1.000000	0.80357	0.996000	0.88848	0.123000	0.15708	1.398000	0.46701	0.655000	0.94253	CGC	-	EPN2	-	NULL		0.677	EPN2-001	KNOWN	basic|CCDS	protein_coding	EPN2	HGNC	protein_coding	OTTHUMT00000132283.3	0	0	0	42	42	5	0.00	0.00	C	NM_014964		19189049	+1	20	3	62	3	tier1	no_errors	ENST00000314728	ensembl	human	known	74_37	missense	24.39	50.00	SNP	0.999	T	20	62
ZNRF2P2	100271874	genome.wustl.edu	37	7	29720400	29720400	+	RNA	SNP	C	C	G			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr7:29720400C>G	ENST00000426767.1	-	0	366				MIR550A3_ENST00000390735.2_RNA	NR_024278.1				zinc and ring finger 2 pseudogene 2																		CTTACAACAACAGGACTCTTA	0.483													ENSG00000212024																																					0																																												0			-			7p14.3	2011-08-22			ENSG00000239968	ENSG00000225264			42793	pseudogene	pseudogene							Standard	NR_027347		Approved				OTTHUMG00000152750		7.37:g.29720400C>G				R	SNP	-	NULL	ENST00000426767.1	37	NULL		7																																																																																			-	MIR550A3	-	-		0.483	ZNRF2P2-003	KNOWN	basic	processed_transcript	MIR550A3	HGNC	pseudogene	OTTHUMT00000327679.1	0	0	0	66	66	7	0.00	0.00	C	NR_027347		29720400	-1	48	2	25	2	tier1	no_errors	ENST00000390735	ensembl	human	known	74_37	rna	65.75	50.00	SNP	0.225	G	48	25
TP53	7157	genome.wustl.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	T	C	rs587780073		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr17:7577580T>C	ENST00000269305.4	-	7	890	c.701A>G	c.(700-702)tAc>tGc	p.Y234C	TP53_ENST00000420246.2_Missense_Mutation_p.Y234C|TP53_ENST00000455263.2_Missense_Mutation_p.Y234C|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.Y234C|TP53_ENST00000359597.4_Missense_Mutation_p.Y234C|TP53_ENST00000445888.2_Missense_Mutation_p.Y234C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	234	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y234C(94)|p.Y234S(9)|p.Y141C(8)|p.0?(8)|p.?(5)|p.Y234del(3)|p.Y141S(2)|p.I232_Y236delIHYNY(1)|p.Y234fs*2(1)|p.Y234F(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234R(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.I232fs*5(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGTAGTTGTAGTGGATGGT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	141	Substitution - Missense(115)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(5)	lung(32)|haematopoietic_and_lymphoid_tissue(17)|breast(17)|ovary(15)|central_nervous_system(10)|urinary_tract(9)|upper_aerodigestive_tract(8)|oesophagus(7)|biliary_tract(6)|large_intestine(5)|kidney(4)|bone(4)|cervix(2)|stomach(2)|adrenal_gland(1)|skin(1)|liver(1)	GRCh37	CM035576	TP53	M							119.0	95.0	103.0					17																	7577580		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.701A>G	17.37:g.7577580T>C	ENSP00000269305:p.Tyr234Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y234C	ENST00000269305.4	37	c.701	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	16.52	3.146603	0.57044	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99826	-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98	4.62	3.49	0.39957	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.211900	0.41823	D	0.000804	D	0.99778	0.9908	M	0.88105	2.93	0.51012	D	0.999909	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.982;0.998;0.997;0.985;0.994;0.999	D	0.98045	1.0384	10	0.87932	D	0	-10.1131	9.0203	0.36195	0.1783:0.0:0.0:0.8216	.	234;234;141;234;234;234	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	234;234;234;234;234;234;223;141;102;141	ENSP00000410739:Y234C;ENSP00000352610:Y234C;ENSP00000269305:Y234C;ENSP00000398846:Y234C;ENSP00000391127:Y234C;ENSP00000391478:Y234C;ENSP00000425104:Y102C;ENSP00000423862:Y141C	ENSP00000269305:Y234C	Y	-	2	0	TP53	7518305	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.037000	0.41174	0.835000	0.34877	0.379000	0.24179	TAC	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	70	70	59	0.00	0.00	T	NM_000546		7577580	-1	54	27	3	3	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	94.74	90.00	SNP	1.000	C	54	3
PSMB11	122706	genome.wustl.edu	37	14	23512330	23512330	+	Missense_Mutation	SNP	C	C	T	rs533259463		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr14:23512330C>T	ENST00000408907.2	+	1	955	c.896C>T	c.(895-897)aCg>aTg	p.T299M		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	299					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		GGGACTGAGACGGTGTGAGAA	0.647													ENSG00000222028	C|||	1	0.000199681	0.0008	0.0	5008	,	,		19280	0.0		0.0	False		,,,				2504	0.0																0													18.0	20.0	20.0					14																	23512330		2079	4195	6274	SO:0001583	missense	0			-		CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.896C>T	14.37:g.23512330C>T	ENSP00000386212:p.Thr299Met			Missense_Mutation	SNP	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.T299M	ENST00000408907.2	37	c.896	CCDS41923.1	14	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869741	0.33069	.	.	ENSG00000222028	ENST00000408907	T	0.29655	1.56	3.6	-7.21	0.01490	.	.	.	.	.	T	0.13713	0.0332	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.33803	-0.9854	9	0.52906	T	0.07	.	10.4345	0.44428	0.0:0.1427:0.6451:0.2122	.	299	A5LHX3	PSB11_HUMAN	M	299	ENSP00000386212:T299M	ENSP00000386212:T299M	T	+	2	0	PSMB11	22582170	0.000000	0.05858	0.004000	0.12327	0.460000	0.32559	-2.566000	0.00917	-1.587000	0.01630	-0.367000	0.07326	ACG	-	PSMB11	-	NULL		0.647	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB11	HGNC	protein_coding	OTTHUMT00000408294.1	0	0	0	45	45	69	0.00	0.00	C	NM_001099780		23512330	+1	8	4	40	59	tier1	no_errors	ENST00000408907	ensembl	human	known	74_37	missense	16.67	6.35	SNP	0.001	T	8	40
NRXN1	9378	genome.wustl.edu	37	2	50923314	50923321	+	Intron	DEL	GTGTGTGT	GTGTGTGT	-	rs202071380|rs201534178|rs200473527		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	GTGTGTGT	GTGTGTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:50923314_50923321delGTGTGTGT	ENST00000406316.2	-	6	2309				NRXN1_ENST00000405472.3_Intron|AC009234.2_ENST00000401372.1_RNA|NRXN1_ENST00000401669.2_Intron|NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000404971.1_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			Gtacatatacgtgtgtgtgtgtgtgtgt	0.438													ENSG00000216191																																					0																																										SO:0001627	intron_variant	0				AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.833-72561ACACACAC>-	2.37:g.50923322_50923329delGTGTGTGT			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	R	DEL	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																				AC009234.2	-	-		0.438	NRXN1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000216191	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000325291.2	0	0	0	0	0	0	0.00	0.00	GTGTGTGT			50923321	-1	0	0	0	0	tier1	no_errors	ENST00000401372	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.006:0.004:0.003:0.002:0.002:0.000:0.000:0.000	-	0	0
MT-CO1	4512	genome.wustl.edu	37	M	7218	7218	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrM:7218C>A	ENST00000361624.2	+	1	1315	c.1315C>A	c.(1315-1317)Cgt>Agt	p.R439S	MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	439					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GAATGCCCCGACGTTACTCGG	0.413													ENSG00000198804																																					0																																										SO:0001583	missense	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1315C>A	M.37:g.7218C>A	ENSP00000354499:p.Arg439Ser		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.R439S	ENST00000361624.2	37	c.1315		MT																																																																																			-	MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1		0.413	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		0	0	0	36	36	3	0.00	0.00	C	YP_003024028		7218	+1	2	0	9	0	tier1	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	18.18	0.00	SNP	NULL	A	2	9
MT-ND5	4540	genome.wustl.edu	37	M	12213	12213	+	5'Flank	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrM:12213G>T	ENST00000361567.2	+	0	0				MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TTACCGAGAAAGCTCACAAGA	0.403													ENSG00000210184																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915			M.37:g.12213G>T	Exception_encountered		Q34773|Q8WCY3	R	SNP	-	NULL	ENST00000361567.2	37	NULL		MT																																																																																			-	MT-TS2	-	-		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-TS2	HGNC	protein_coding		0	0	0	19	19	1	0.00	0.00	G	YP_003024036		12213	+1	2	0	6	0	tier1	no_errors	ENST00000387449	ensembl	human	known	74_37	rna	25.00	0.00	SNP	NULL	T	2	6
LATS2	26524	genome.wustl.edu	37	13	21563188	21563188	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr13:21563188G>A	ENST00000382592.4	-	4	1136	c.731C>T	c.(730-732)gCa>gTa	p.A244V	LATS2_ENST00000542899.1_Missense_Mutation_p.A244V|LATS2_ENST00000472754.1_5'UTR	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CGGGAAGTGTGCCCCTGCTGC	0.711													ENSG00000150457																																					0													7.0	9.0	8.0					13																	21563188		2173	4241	6414	SO:0001583	missense	0			-	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.731C>T	13.37:g.21563188G>A	ENSP00000372035:p.Ala244Val			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.A244V	ENST00000382592.4	37	c.731	CCDS9294.1	13	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367249	0.24771	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.58506	0.33;0.33	4.88	3.82	0.43975	.	2.277970	0.01491	N	0.017079	T	0.38427	0.1040	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.27673	-1.0067	10	0.25751	T	0.34	.	4.9341	0.13932	0.808:0.0:0.192:0.0	.	244	Q9NRM7	LATS2_HUMAN	V	244	ENSP00000372035:A244V;ENSP00000441817:A244V	ENSP00000372035:A244V	A	-	2	0	LATS2	20461188	0.002000	0.14202	0.001000	0.08648	0.660000	0.38997	1.507000	0.35758	0.852000	0.35287	0.306000	0.20318	GCA	-	LATS2	-	NULL		0.711	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	HGNC	protein_coding	OTTHUMT00000044102.1	0	0	0	18	18	2	0.00	0.00	G			21563188	-1	15	4	31	2	tier1	no_errors	ENST00000382592	ensembl	human	known	74_37	missense	31.91	66.67	SNP	0.008	A	15	31
FANCG	2189	genome.wustl.edu	37	9	35078228	35078228	+	Silent	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr9:35078228G>A	ENST00000378643.3	-	4	911	c.420C>T	c.(418-420)caC>caT	p.H140H	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	140					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CAACCAGGCGGTGCAGGGCAG	0.627			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks					ENSG00000221829																											yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	0													69.0	69.0	69.0					9																	35078228		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.420C>T	9.37:g.35078228G>A				Silent	SNP	superfamily_Sig_transdc_His_kin_Hpt_dom,smart_TPR_repeat	p.H140	ENST00000378643.3	37	c.420	CCDS6574.1	9																																																																																			-	FANCG	-	superfamily_Sig_transdc_His_kin_Hpt_dom		0.627	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCG	HGNC	protein_coding	OTTHUMT00000052269.1	0	0	0	28	28	29	0.00	0.00	G	NM_004629		35078228	-1	5	2	17	26	tier1	no_errors	ENST00000378643	ensembl	human	known	74_37	silent	22.73	7.14	SNP	0.952	A	5	17
SGIP1	84251	genome.wustl.edu	37	1	67142719	67142719	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr1:67142719G>T	ENST00000371037.4	+	13	756	c.679G>T	c.(679-681)Ggc>Tgc	p.G227C	SGIP1_ENST00000237247.6_Missense_Mutation_p.G231C|SGIP1_ENST00000371039.1_Missense_Mutation_p.G195C|SGIP1_ENST00000371035.3_Missense_Mutation_p.G184C|AL139147.1_ENST00000502413.2_5'Flank|SGIP1_ENST00000371036.3_Missense_Mutation_p.G194C|SGIP1_ENST00000468286.1_3'UTR	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	227	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						ATGGGGTTCAGGCCAACCAAT	0.388													ENSG00000118473																																					0													120.0	120.0	120.0					1																	67142719		2203	4300	6503	SO:0001583	missense	0			-	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.679G>T	1.37:g.67142719G>T	ENSP00000360076:p.Gly227Cys		A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	p.G231C	ENST00000371037.4	37	c.691	CCDS30744.1	1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377353	0.61735	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000424320;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037	T;T;T;T;T;T	0.03358	3.96;3.96;3.96;3.96;3.96;3.96	5.35	4.44	0.53790	.	0.354548	0.33515	N	0.004825	T	0.01287	0.0042	N	0.14661	0.345	0.38778	D	0.954704	P	0.40000	0.698	B	0.40329	0.326	T	0.60816	-0.7188	10	0.54805	T	0.06	-7.3616	10.1944	0.43045	0.072:0.0:0.792:0.136	.	227	Q9BQI5	SGIP1_HUMAN	C	231;195;219;184;230;230;194;227	ENSP00000237247:G231C;ENSP00000360078:G195C;ENSP00000410439:G219C;ENSP00000360074:G184C;ENSP00000360075:G194C;ENSP00000360076:G227C	ENSP00000237247:G231C	G	+	1	0	SGIP1	66915307	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	3.135000	0.50546	1.256000	0.44068	0.655000	0.94253	GGC	-	SGIP1	-	NULL		0.388	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	0	0	0	28	28	100	0.00	0.00	G	NM_032291		67142719	+1	4	2	42	103	tier1	no_errors	ENST00000237247	ensembl	human	known	74_37	missense	8.70	1.90	SNP	1.000	T	4	42
FBXO30	84085	genome.wustl.edu	37	6	146126375	146126375	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr6:146126375G>T	ENST00000237281.4	-	2	1333	c.1167C>A	c.(1165-1167)ttC>ttA	p.F389L		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	389	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		AAAGAAAATTGAATGAAGGAG	0.393													ENSG00000118496																																					0													157.0	156.0	156.0					6																	146126375		2203	4300	6503	SO:0001583	missense	0			-	AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.1167C>A	6.37:g.146126375G>T	ENSP00000237281:p.Phe389Leu		Q9BXZ7	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,superfamily_TRAF-like,pfscan_F-box_dom,pfscan_Znf_TRAF	p.F389L	ENST00000237281.4	37	c.1167	CCDS5208.1	6	.	.	.	.	.	.	.	.	.	.	G	1.924	-0.447550	0.04572	.	.	ENSG00000118496	ENST00000237281	T	0.18502	2.21	5.46	3.64	0.41730	.	0.211973	0.50627	N	0.000117	T	0.03739	0.0106	L	0.47716	1.5	0.31949	N	0.609955	B	0.06786	0.001	B	0.04013	0.001	T	0.40515	-0.9559	10	0.02654	T	1	-1.4169	9.2805	0.37725	0.0733:0.2765:0.6502:0.0	.	389	Q8TB52	FBX30_HUMAN	L	389	ENSP00000237281:F389L	ENSP00000237281:F389L	F	-	3	2	FBXO30	146168068	1.000000	0.71417	0.996000	0.52242	0.950000	0.60333	2.178000	0.42519	0.759000	0.33084	-0.165000	0.13383	TTC	-	FBXO30	-	NULL		0.393	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO30	HGNC	protein_coding	OTTHUMT00000042570.2	0	0	0	67	67	83	0.00	0.00	G			146126375	-1	4	2	44	117	tier1	no_errors	ENST00000237281	ensembl	human	known	74_37	missense	8.33	1.68	SNP	0.999	T	4	44
