#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
STOML2	30968	genome.wustl.edu	37	9	35100719	35100719	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr9:35100719C>T	ENST00000356493.5	-	9	871	c.809G>A	c.(808-810)gGa>gAa	p.G270E	STOML2_ENST00000487490.1_5'Flank|RP11-182N22.8_ENST00000431804.1_RNA|STOML2_ENST00000452248.2_Missense_Mutation_p.G225E	NM_013442.1	NP_038470.1	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2	270					CD4-positive, alpha-beta T cell activation (GO:0035710)|cellular calcium ion homeostasis (GO:0006874)|interleukin-2 production (GO:0032623)|lipid localization (GO:0010876)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|mitochondrial calcium ion transport (GO:0006851)|mitochondrial protein processing (GO:0034982)|mitochondrion organization (GO:0007005)|positive regulation of cardiolipin metabolic process (GO:1900210)|positive regulation of mitochondrial DNA replication (GO:0090297)|positive regulation of mitochondrial membrane potential (GO:0010918)|protein oligomerization (GO:0051259)|stress-induced mitochondrial fusion (GO:1990046)|T cell receptor signaling pathway (GO:0050852)	cytoskeleton (GO:0005856)|extrinsic component of plasma membrane (GO:0019897)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	cardiolipin binding (GO:1901612)|receptor binding (GO:0005102)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|prostate(1)	16			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TGCTGCATCTCCATTCTGTGA	0.512													ENSG00000165283																																					0													145.0	134.0	138.0					9																	35100719		2203	4300	6503	SO:0001583	missense	0			-	AF190167	CCDS6577.1, CCDS69588.1, CCDS75830.1	9p13.1	2008-02-05			ENSG00000165283	ENSG00000165283			14559	protein-coding gene	gene with protein product		608292				10713127, 17121834	Standard	NM_001287031		Approved	SLP-2, HSPC108	uc003zwi.3	Q9UJZ1	OTTHUMG00000019851	ENST00000356493.5:c.809G>A	9.37:g.35100719C>T	ENSP00000348886:p.Gly270Glu		B4E1K7|D3DRN3|O60376|Q53G29|Q96FY2|Q9P042	Missense_Mutation	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.G270E	ENST00000356493.5	37	c.809	CCDS6577.1	9	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686109	0.88639	.	.	ENSG00000165283	ENST00000356493;ENST00000452248	D;D	0.98280	-3.7;-4.84	5.69	5.69	0.88448	.	0.110642	0.64402	D	0.000009	D	0.99180	0.9716	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.85130	0.98;0.997	D	0.99346	1.0913	9	.	.	.	-1.9483	19.8047	0.96525	0.0:1.0:0.0:0.0	.	225;270	B4E1K7;Q9UJZ1	.;STML2_HUMAN	E	270;225	ENSP00000348886:G270E;ENSP00000395743:G225E	.	G	-	2	0	STOML2	35090719	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.692000	0.91855	0.563000	0.77884	GGA	-	STOML2	-	NULL		0.512	STOML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOML2	HGNC	protein_coding	OTTHUMT00000052273.1	0	0		50	50		0.00		C	NM_013442		35100719	-1	13		24		tier1	no_errors	ENST00000356493	ensembl	human	known	74_37	missense	35.14		SNP	1.000	T	13	24
MALAT1	378938	genome.wustl.edu	37	11	65271780	65271780	+	lincRNA	DEL	T	T	-	rs36002528		TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr11:65271780delT	ENST00000534336.1	+	0	6548					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTGTTGTAGCTTTTTTTTTTT	0.433													ENSG00000251562																																					0													25.0	28.0	27.0					11																	65271780		874	1988	2862			0				AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271780delT				R	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																				MALAT1	-	-		0.433	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	0	0		23	23		0.00		T	NR_002819		65271780	+1	5		22		tier1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	18.52		DEL	0.994	-	5	22
HUWE1	10075	genome.wustl.edu	37	X	53573735	53573735	+	Missense_Mutation	SNP	C	C	G			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chrX:53573735C>G	ENST00000342160.3	-	68	11145	c.10688G>C	c.(10687-10689)gGc>gCc	p.G3563A	HUWE1_ENST00000262854.6_Missense_Mutation_p.G3563A|HUWE1_ENST00000474288.1_5'UTR			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3563					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ACTGCTGCTGCCCCCATCACT	0.493													ENSG00000086758																																					0													69.0	55.0	60.0					X																	53573735		2203	4300	6503	SO:0001583	missense	0			-	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.10688G>C	X.37:g.53573735C>G	ENSP00000340648:p.Gly3563Ala		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.G3563A	ENST00000342160.3	37	c.10688	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	9.376	1.071833	0.20147	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.34472	1.36;1.36	5.44	5.44	0.79542	.	1.198190	0.05765	N	0.605731	T	0.22126	0.0533	N	0.08118	0	0.30130	N	0.804909	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.07424	-1.0773	10	0.09590	T	0.72	.	12.1782	0.54198	0.1708:0.8291:0.0:0.0	.	3563;3547	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	A	3563	ENSP00000340648:G3563A;ENSP00000262854:G3563A	ENSP00000262854:G3563A	G	-	2	0	HUWE1	53590460	1.000000	0.71417	0.984000	0.44739	0.512000	0.34134	3.832000	0.55783	2.286000	0.76751	0.538000	0.68166	GGC	-	HUWE1	-	NULL		0.493	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	0	0		34	34		0.00		C	XM_497119		53573735	-1	7		21		tier1	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	25.00		SNP	1.000	G	7	21
KCNV1	27012	genome.wustl.edu	37	8	110980696	110980696	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr8:110980696G>T	ENST00000524391.1	-	4	2156	c.1124C>A	c.(1123-1125)aCc>aAc	p.T375N	KCNV1_ENST00000297404.1_Missense_Mutation_p.T375N			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	375					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			ACTTGTGAAGGTTGTGTCAGG	0.473													ENSG00000164794																																					0													88.0	87.0	87.0					8																	110980696		2203	4300	6503	SO:0001583	missense	0			-	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.1124C>A	8.37:g.110980696G>T	ENSP00000435954:p.Thr375Asn		Q9UHJ4	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.T375N	ENST00000524391.1	37	c.1124	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799812	0.50208	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.98012	-4.66;-4.66	5.35	5.35	0.76521	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.94863	0.8340	N	0.02802	-0.49	0.49687	D	0.999812	D	0.56287	0.975	P	0.54431	0.752	D	0.95023	0.8162	10	0.29301	T	0.29	.	18.0522	0.89353	0.0:0.0:1.0:0.0	.	375	Q6PIU1	KCNV1_HUMAN	N	375;375;251	ENSP00000435954:T375N;ENSP00000297404:T375N	ENSP00000297404:T375N	T	-	2	0	KCNV1	111049872	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.058000	0.89460	2.479000	0.83701	0.655000	0.94253	ACC	-	KCNV1	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom		0.473	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1	0	0		36	36		0.00		G	NM_014379		110980696	-1	10		31		tier1	no_errors	ENST00000297404	ensembl	human	known	74_37	missense	24.39		SNP	1.000	T	10	31
CACNA1S	779	genome.wustl.edu	37	1	201009019	201009019	+	Silent	SNP	G	G	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr1:201009019G>A	ENST00000362061.3	-	44	5788	c.5562C>T	c.(5560-5562)tcC>tcT	p.S1854S	RP11-168O16.2_ENST00000415359.1_RNA|CACNA1S_ENST00000367338.3_Silent_p.S1835S	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1854					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCTGCCCAGGGAGGACCCGA	0.602													ENSG00000081248																																					0													100.0	98.0	99.0					1																	201009019		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.5562C>T	1.37:g.201009019G>A			A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.S1854	ENST00000362061.3	37	c.5562	CCDS1407.1	1																																																																																			-	CAC1S	-	NULL		0.602	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAC1S	HGNC	protein_coding	OTTHUMT00000087049.1	0	0		34	34		0.00		G	NM_000069		201009019	-1	10		31		tier1	no_errors	ENST00000362061	ensembl	human	known	74_37	silent	24.39		SNP	0.906	A	10	31
MAPK8IP3	23162	genome.wustl.edu	37	16	1814328	1814328	+	Silent	SNP	G	G	C			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr16:1814328G>C	ENST00000250894.4	+	19	2302	c.2145G>C	c.(2143-2145)ctG>ctC	p.L715L	MAPK8IP3_ENST00000356010.5_Silent_p.L709L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	715					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GCGTCAACCTGAGCGGGTGGA	0.716													ENSG00000138834																																					0													13.0	19.0	17.0					16																	1814328		2002	4139	6141	SO:0001819	synonymous_variant	0			-	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.2145G>C	16.37:g.1814328G>C			A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.L715	ENST00000250894.4	37	c.2145	CCDS10442.2	16																																																																																			-	MAPK8IP3	-	NULL		0.716	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	0	0		45	45		0.00		G	NM_001040439		1814328	+1	21		24		tier1	no_errors	ENST00000250894	ensembl	human	known	74_37	silent	46.67		SNP	1.000	C	21	24
ITPKA	3706	genome.wustl.edu	37	15	41793952	41793952	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr15:41793952G>A	ENST00000260386.5	+	3	759	c.706G>A	c.(706-708)Ggc>Agc	p.G236S		NM_002220.2	NP_002211.1	P23677	IP3KA_HUMAN	inositol-trisphosphate 3-kinase A	236					actin cytoskeleton organization (GO:0030036)|dendritic spine maintenance (GO:0097062)|inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|positive regulation of dendritic spine morphogenesis (GO:0061003)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendritic spine (GO:0043197)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			kidney(1)|lung(3)|skin(1)	5		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;7.63e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TGCCTTCCACGGCGTGGTGGA	0.672													ENSG00000137825																																					0													32.0	31.0	31.0					15																	41793952		2203	4300	6503	SO:0001583	missense	0			-	X54938	CCDS10076.1	15q15.1	2011-04-28	2011-04-28		ENSG00000137825	ENSG00000137825	2.7.1.127		6178	protein-coding gene	gene with protein product		147521	"""inositol 1,4,5-trisphosphate 3-kinase A"""			1330886, 2175886	Standard	NM_002220		Approved	IP3KA, IP3-3KA	uc001znz.3	P23677	OTTHUMG00000130343	ENST00000260386.5:c.706G>A	15.37:g.41793952G>A	ENSP00000260386:p.Gly236Ser		Q8TAN3	Missense_Mutation	SNP	pfam_IPK	p.G236S	ENST00000260386.5	37	c.706	CCDS10076.1	15	.	.	.	.	.	.	.	.	.	.	G	36	5.649259	0.96714	.	.	ENSG00000137825	ENST00000425927;ENST00000260386	T;T	0.19532	2.14;2.14	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.51363	0.1670	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57648	-0.7775	10	0.87932	D	0	-2.303	18.6028	0.91255	0.0:0.0:1.0:0.0	.	236	P23677	IP3KA_HUMAN	S	131;236	ENSP00000396560:G131S;ENSP00000260386:G236S	ENSP00000260386:G236S	G	+	1	0	ITPKA	39581244	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.848000	0.99507	2.398000	0.81561	0.462000	0.41574	GGC	-	ITPKA	-	NULL		0.672	ITPKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKA	HGNC	protein_coding	OTTHUMT00000252695.3	0	0		31	31		0.00		G	NM_002220		41793952	+1	16		55		tier1	no_errors	ENST00000260386	ensembl	human	known	74_37	missense	22.54		SNP	1.000	A	16	55
ABHD4	63874	genome.wustl.edu	37	14	23078791	23078791	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr14:23078791G>A	ENST00000428304.2	+	6	984	c.914G>A	c.(913-915)cGg>cAg	p.R305Q		NM_022060.2	NP_071343.2	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4	305					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(3)|prostate(1)	14	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		AAGATGCAGCGGCCGGATTCC	0.493													ENSG00000100439																																					0													83.0	74.0	77.0					14																	23078791		2203	4300	6503	SO:0001583	missense	0			-	AK022878	CCDS9572.1	14q11.1	2006-10-06			ENSG00000100439	ENSG00000100439		"""Abhydrolase domain containing"""	20154	protein-coding gene	gene with protein product							Standard	NM_022060		Approved	FLJ12816	uc001wgm.3	Q8TB40	OTTHUMG00000028686	ENST00000428304.2:c.914G>A	14.37:g.23078791G>A	ENSP00000414558:p.Arg305Gln		B4DDH7|Q9H9E0	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1	p.R305Q	ENST00000428304.2	37	c.914	CCDS9572.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.606410	0.96626	.	.	ENSG00000100439	ENST00000428304	D	0.84370	-1.84	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.92264	0.7546	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.91561	0.5264	10	0.39692	T	0.17	-21.6042	16.8703	0.86039	0.0:0.0:1.0:0.0	.	305	Q8TB40	ABHD4_HUMAN	Q	305	ENSP00000414558:R305Q	ENSP00000414558:R305Q	R	+	2	0	ABHD4	22148631	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	6.763000	0.74955	2.570000	0.86706	0.643000	0.83706	CGG	-	ABHD4	-	pfam_AB_hydrolase_1		0.493	ABHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD4	HGNC	protein_coding	OTTHUMT00000071623.3	0	0		54	54		0.00		G			23078791	+1	31		17		tier1	no_errors	ENST00000428304	ensembl	human	known	74_37	missense	64.58		SNP	1.000	A	31	17
NRP1	8829	genome.wustl.edu	37	10	33510663	33510663	+	Silent	SNP	G	G	A	rs2229935	byFrequency	TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr10:33510663G>A	ENST00000265371.4	-	9	1791	c.1266C>T	c.(1264-1266)taC>taT	p.Y422Y	NRP1_ENST00000395995.1_Silent_p.Y422Y|NRP1_ENST00000374875.1_Silent_p.Y241Y|NRP1_ENST00000374821.5_Silent_p.Y422Y|NRP1_ENST00000374867.2_Silent_p.Y422Y|NRP1_ENST00000374816.3_Silent_p.Y422Y|NRP1_ENST00000374822.4_Silent_p.Y422Y|NRP1_ENST00000432372.2_Silent_p.Y422Y|NRP1_ENST00000374823.5_Silent_p.Y422Y			O14786	NRP1_HUMAN	neuropilin 1	422	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	TCTTGCAACCGTATACTTCAA	0.393													ENSG00000099250	A|||	1798	0.359026	0.1793	0.4337	5008	,	,		18709	0.623		0.2485	False		,,,				2504	0.3906				Melanoma(104;886 1489 44640 45944 51153)												0								A	,,	917,3489	738.2+/-411.0	99,719,1385	150.0	145.0	146.0		1266,1266,1266	-0.6	0.8	10	dbSNP_111	146	2285,6315	706.9+/-405.6	302,1681,2317	no	coding-synonymous,coding-synonymous,coding-synonymous	NRP1	NM_001024628.2,NM_001024629.2,NM_003873.5	,,	401,2400,3702	AA,AG,GG		26.5698,20.8125,24.6194	,,	422/645,422/610,422/924	33510663	3202,9804	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1266C>T	10.37:g.33510663G>A			B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Silent	SNP	pirsf_Neuropilin,pfam_CUB_dom,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,smart_CUB_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.Y422	ENST00000265371.4	37	c.1266	CCDS7177.1	10																																																																																			rs2229935	NRP1	-	pirsf_Neuropilin,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.393	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NRP1	HGNC	protein_coding	OTTHUMT00000051203.2	0	0		96	96		0.00		G			33510663	-1	5		22		tier1	no_errors	ENST00000265371	ensembl	human	known	74_37	silent	18.52		SNP	0.998	A	5	22
RBP3	5949	genome.wustl.edu	37	10	48388773	48388773	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr10:48388773delA	ENST00000224600.4	-	1	2218	c.2105delT	c.(2104-2106)ttcfs	p.F702fs	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	702	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	AGGGCTGTGGAACACTAGCAA	0.632													ENSG00000107618																																					0													35.0	39.0	38.0					10																	48388773		2202	4296	6498	SO:0001589	frameshift_variant	0				M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.2105delT	10.37:g.48388773delA	ENSP00000224600:p.Phe702fs		Q0QD34|Q5VSR0|Q8IXN0	Frame_Shift_Del	DEL	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.F702fs	ENST00000224600.4	37	c.2105	CCDS7218.1	10																																																																																				RBP3	-	NULL		0.632	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	HGNC	protein_coding	OTTHUMT00000047888.1	0	0		47	47		0.00		A	NM_002900		48388773	-1	2		13		tier1	no_errors	ENST00000224600	ensembl	human	known	74_37	frame_shift_del	13.33		DEL	1.000	-	2	13
HERC2	8924	genome.wustl.edu	37	15	28501459	28501459	+	Missense_Mutation	SNP	T	T	G			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr15:28501459T>G	ENST00000261609.7	-	18	2630	c.2522A>C	c.(2521-2523)cAt>cCt	p.H841P		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AATGGCAGCATGCAACTGAAA	0.428													ENSG00000128731																																					0													12.0	12.0	12.0					15																	28501459		2111	4027	6138	SO:0001583	missense	0			-	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.2522A>C	15.37:g.28501459T>G	ENSP00000261609:p.His841Pro			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.H841P	ENST00000261609.7	37	c.2522	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	T	17.64	3.439942	0.63067	.	.	ENSG00000128731	ENST00000261609	T	0.42513	0.97	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.61502	0.2352	M	0.71581	2.175	0.80722	D	1	D	0.57571	0.98	D	0.64321	0.924	T	0.62923	-0.6751	10	0.45353	T	0.12	.	15.2929	0.73879	0.0:0.0:0.0:1.0	.	841	O95714	HERC2_HUMAN	P	841	ENSP00000261609:H841P	ENSP00000261609:H841P	H	-	2	0	HERC2	26175054	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.648000	0.83479	2.022000	0.59522	0.441000	0.28932	CAT	-	HERC2	-	NULL		0.428	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	0	0		116	116		0.00		T	NM_004667		28501459	-1	28		105		tier1	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	20.90		SNP	1.000	G	28	105
SRPX2	27286	genome.wustl.edu	37	X	99905993	99905993	+	Intron	SNP	A	A	G			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chrX:99905993A>G	ENST00000373004.3	+	3	591				SRPX2_ENST00000481988.1_3'UTR	NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2						angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						aggggctgtgatttctcatca	0.458													ENSG00000102359																																					0																																										SO:0001627	intron_variant	0			-	AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.163+131A>G	X.37:g.99905993A>G			B3KQT3|Q8WW85	R	SNP	-	NULL	ENST00000373004.3	37	NULL	CCDS14471.1	X																																																																																			-	SRPX2	-	-		0.458	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX2	HGNC	protein_coding	OTTHUMT00000057486.1	0	0		13	13		0.00		A	NM_014467		99905993	+1	4		7		tier1	no_errors	ENST00000481988	ensembl	human	known	74_37	rna	36.36		SNP	0.031	G	4	7
STAT5A	6776	genome.wustl.edu	37	17	40441970	40441970	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr17:40441970C>T	ENST00000345506.4	+	4	857	c.215C>T	c.(214-216)gCg>gTg	p.A72V	STAT5A_ENST00000452307.2_Missense_Mutation_p.A72V|STAT5A_ENST00000546010.2_Missense_Mutation_p.A72V|STAT5A_ENST00000588868.1_Missense_Mutation_p.A72V|STAT5A_ENST00000590949.1_Missense_Mutation_p.A72V	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	72					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		CAGAAGAAGGCGGAGCACCAG	0.627													ENSG00000126561																																					0													58.0	49.0	52.0					17																	40441970		2203	4300	6503	SO:0001583	missense	0			-	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.215C>T	17.37:g.40441970C>T	ENSP00000341208:p.Ala72Val		Q1KLZ6	Missense_Mutation	SNP	pfam_STAT_TF_D-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_D-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.A72V	ENST00000345506.4	37	c.215	CCDS11424.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.400263	0.97537	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307;ENST00000444283	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.5	5.5	0.81552	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.71685	0.3369	M	0.72353	2.195	0.80722	D	1	D;P;P	0.65815	0.995;0.911;0.66	D;P;P	0.65323	0.934;0.608;0.49	T	0.72456	-0.4288	10	0.52906	T	0.07	-1.882	19.3961	0.94607	0.0:1.0:0.0:0.0	.	72;74;72	Q1KLZ6;Q59GY7;P42229	.;.;STA5A_HUMAN	V	72;72;74;72;72	ENSP00000341208:A72V;ENSP00000443107:A72V;ENSP00000400320:A72V;ENSP00000407327:A72V	ENSP00000341208:A72V	A	+	2	0	STAT5A	37695496	1.000000	0.71417	0.960000	0.40013	0.994000	0.84299	7.481000	0.81124	2.584000	0.87258	0.557000	0.71058	GCG	-	STAT5A	-	pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction		0.627	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5A	HGNC	protein_coding	OTTHUMT00000319804.1	0	0		34	34		0.00		C	NM_003152		40441970	+1	10		18		tier1	no_errors	ENST00000345506	ensembl	human	known	74_37	missense	35.71		SNP	1.000	T	10	18
MYH14	79784	genome.wustl.edu	37	19	50813026	50813026	+	Silent	SNP	C	C	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr19:50813026C>A	ENST00000596571.1	+	40	5967	c.5967C>A	c.(5965-5967)tcC>tcA	p.S1989S	MYH14_ENST00000440075.2_Silent_p.S2030S|MYH14_ENST00000262269.8_Silent_p.S2030S|MYH14_ENST00000425460.1_Silent_p.S1997S|MYH14_ENST00000376970.2_Silent_p.S2022S|MYH14_ENST00000601313.1_Silent_p.S2030S|MYH14_ENST00000598205.1_Silent_p.S1997S|CTB-191K22.5_ENST00000595563.1_RNA			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1989					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CTGAGGGGTCCCCACCAGCCC	0.697													ENSG00000105357																																					0													16.0	22.0	20.0					19																	50813026		1978	4137	6115	SO:0001819	synonymous_variant	0			-	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5967C>A	19.37:g.50813026C>A			B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S2030	ENST00000596571.1	37	c.6090	CCDS59411.1	19																																																																																			-	MYH14	-	NULL		0.697	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	0	0		35	35		0.00		C	NM_024729		50813026	+1	14		30		tier1	no_errors	ENST00000262269	ensembl	human	known	74_37	silent	31.82		SNP	0.001	A	14	30
BOD1L1	259282	genome.wustl.edu	37	4	13604281	13604281	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr4:13604281C>T	ENST00000040738.5	-	10	4378	c.4243G>A	c.(4243-4245)Gac>Aac	p.D1415N		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1415						nucleus (GO:0005634)	DNA binding (GO:0003677)										GCATTTAAGTCATTTTCTTTC	0.408													ENSG00000038219																																					0													109.0	110.0	110.0					4																	13604281		2203	4300	6503	SO:0001583	missense	0			-	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.4243G>A	4.37:g.13604281C>T	ENSP00000040738:p.Asp1415Asn		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.D1415N	ENST00000040738.5	37	c.4243	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	11.91	1.778428	0.31502	.	.	ENSG00000038219	ENST00000040738	T	0.08370	3.1	5.37	3.56	0.40772	.	0.753271	0.12064	N	0.502829	T	0.06371	0.0164	L	0.29908	0.895	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.43097	-0.9412	10	0.22109	T	0.4	-0.9056	7.2128	0.25943	0.1671:0.7441:0.0:0.0888	.	1415	Q8NFC6	BOD1L_HUMAN	N	1415	ENSP00000040738:D1415N	ENSP00000040738:D1415N	D	-	1	0	BOD1L	13213379	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	0.451000	0.21779	0.580000	0.29522	0.650000	0.86243	GAC	-	BOD1L1	-	NULL		0.408	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	0	0		116	116		0.00		C	NM_148894		13604281	-1	32		55		tier1	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	36.78		SNP	0.004	T	32	55
GATA2	2624	genome.wustl.edu	37	3	128202738	128202738	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr3:128202738G>T	ENST00000341105.2	-	4	1313	c.982C>A	c.(982-984)Cag>Aag	p.Q328K	GATA2_ENST00000489987.1_5'Flank|GATA2_ENST00000430265.2_Missense_Mutation_p.Q328K|GATA2_ENST00000487848.1_Missense_Mutation_p.Q328K	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	328					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Q328*(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		GGTCGGTTCTGCCCATTCATC	0.637			Mis		AML(CML blast transformation)								ENSG00000179348																												Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	1	Substitution - Nonsense(1)	large_intestine(1)											91.0	76.0	81.0					3																	128202738		2203	4300	6503	SO:0001583	missense	0			-	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.982C>A	3.37:g.128202738G>T	ENSP00000345681:p.Gln328Lys		D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.Q328K	ENST00000341105.2	37	c.982	CCDS3049.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.519785	0.96416	.	.	ENSG00000179348	ENST00000341105;ENST00000430265;ENST00000487848	D;D;D	0.99466	-5.95;-5.95;-5.95	5.15	5.15	0.70609	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (3);	0.000000	0.85682	D	0.000000	D	0.98298	0.9436	N	0.02539	-0.55	0.80722	D	1	D;D	0.62365	0.979;0.991	P;D	0.64877	0.801;0.93	D	0.99950	1.1529	10	0.87932	D	0	-17.9832	18.6153	0.91300	0.0:0.0:1.0:0.0	.	328;328	P23769-2;P23769	.;GATA2_HUMAN	K	328	ENSP00000345681:Q328K;ENSP00000400259:Q328K;ENSP00000417074:Q328K	ENSP00000345681:Q328K	Q	-	1	0	GATA2	129685428	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.854000	0.99522	2.388000	0.81334	0.491000	0.48974	CAG	-	GATA2	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA		0.637	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA2	HGNC	protein_coding	OTTHUMT00000356925.1	0	0		61	61		0.00		G	NM_032638		128202738	-1	14		45		tier1	no_errors	ENST00000341105	ensembl	human	known	74_37	missense	23.73		SNP	1.000	T	14	45
TBC1D8B	54885	genome.wustl.edu	37	X	106061981	106061981	+	Missense_Mutation	SNP	A	A	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chrX:106061981A>T	ENST00000357242.5	+	2	393	c.219A>T	c.(217-219)caA>caT	p.Q73H	TBC1D8B_ENST00000481617.2_Missense_Mutation_p.Q73H|TBC1D8B_ENST00000276175.3_Missense_Mutation_p.Q73H|TBC1D8B_ENST00000310452.2_Missense_Mutation_p.Q73H	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	73							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAGATTCTCAAGTTTACTTGT	0.358													ENSG00000133138																																					0													152.0	126.0	135.0					X																	106061981		2203	4299	6502	SO:0001583	missense	0			-	AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.219A>T	X.37:g.106061981A>T	ENSP00000349781:p.Gln73His		B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.Q73H	ENST00000357242.5	37	c.219	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	A	18.97	3.735513	0.69189	.	.	ENSG00000133138	ENST00000357242;ENST00000310452;ENST00000481617;ENST00000276175	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.83	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.42154	0.1190	M	0.73962	2.25	0.46654	D	0.999148	D;D;D	0.89917	0.998;1.0;0.998	D;D;D	0.79784	0.993;0.99;0.993	T	0.35176	-0.9799	10	0.66056	D	0.02	-15.923	8.021	0.30408	0.8486:0.0:0.1514:0.0	.	73;73;73	Q0IIM8;B9A6K6;D6RFZ2	TBC8B_HUMAN;.;.	H	73	ENSP00000349781:Q73H;ENSP00000310675:Q73H;ENSP00000421375:Q73H;ENSP00000276175:Q73H	ENSP00000276175:Q73H	Q	+	3	2	TBC1D8B	105948637	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.005000	0.29834	1.956000	0.56807	0.486000	0.48141	CAA	-	TBC1D8B	-	NULL		0.358	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	HGNC	protein_coding	OTTHUMT00000057807.2	0	0		73	73		0.00		A	NM_017752		106061981	+1	25		65		tier1	no_errors	ENST00000357242	ensembl	human	known	74_37	missense	27.78		SNP	1.000	T	25	65
EFCAB7	84455	genome.wustl.edu	37	1	64036710	64036710	+	Missense_Mutation	SNP	A	A	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr1:64036710A>T	ENST00000371088.4	+	13	1972	c.1726A>T	c.(1726-1728)Att>Ttt	p.I576F	EFCAB7_ENST00000461039.1_3'UTR	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	576							calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						GAAAGTGATTATTCACATCAG	0.318													ENSG00000203965																																					0													83.0	82.0	83.0					1																	64036710		2203	4299	6502	SO:0001583	missense	0			-	BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.1726A>T	1.37:g.64036710A>T	ENSP00000360129:p.Ile576Phe		Q658P0|Q96B95|Q96JM6	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.I576F	ENST00000371088.4	37	c.1726	CCDS30737.1	1	.	.	.	.	.	.	.	.	.	.	A	18.07	3.542766	0.65198	.	.	ENSG00000203965	ENST00000371088	T	0.62639	0.01	5.95	5.95	0.96441	.	0.108661	0.64402	D	0.000005	T	0.44787	0.1310	L	0.51422	1.61	0.80722	D	1	P	0.51933	0.949	B	0.44163	0.443	T	0.58752	-0.7581	10	0.72032	D	0.01	-19.9593	7.369	0.26790	0.8026:0.0:0.069:0.1284	.	576	A8K855	EFCB7_HUMAN	F	576	ENSP00000360129:I576F	ENSP00000360129:I576F	I	+	1	0	EFCAB7	63809298	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.136000	0.50554	2.280000	0.76307	0.460000	0.39030	ATT	-	EFCAB7	-	NULL		0.318	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB7	HGNC	protein_coding	OTTHUMT00000024910.1	0	0		62	62		0.00		A	NM_032437		64036710	+1	37		7		tier1	no_errors	ENST00000371088	ensembl	human	known	74_37	missense	84.09		SNP	1.000	T	37	7
NBPF12	149013	genome.wustl.edu	37	1	146408160	146408160	+	Silent	SNP	C	C	T	rs587751026	byFrequency	TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr1:146408160C>T	ENST00000442909.2	+	15	2630	c.1794C>T	c.(1792-1794)aaC>aaT	p.N598N	NBPF12_ENST00000439206.2_Intron|NBPF12_ENST00000309471.8_Silent_p.N252N|NBPF12_ENST00000446760.2_Silent_p.N327N			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	0						cytoplasm (GO:0005737)				ovary(2)	2						AGCAGCAGAACAAATACAGTA	0.443													ENSG00000186275																																					0																																										SO:0001819	synonymous_variant	0			-	BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.1794C>T	1.37:g.146408160C>T			O95877	Silent	SNP	pfam_NBPF_dom	p.N327	ENST00000442909.2	37	c.981		1																																																																																			-	NBPF12	-	NULL		0.443	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	NBPF12	HGNC	protein_coding	OTTHUMT00000102086.3	0	0		180	180		0.00		C	XM_003119146		146408160	+1	63		131		tier1	no_errors	ENST00000446760	ensembl	human	known	74_37	silent	32.31		SNP	0.001	T	63	131
SLC2A2	6514	genome.wustl.edu	37	3	170723133	170723133	+	Missense_Mutation	SNP	G	G	C			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr3:170723133G>C	ENST00000314251.3	-	7	983	c.904C>G	c.(904-906)Cag>Gag	p.Q302E	SLC2A2_ENST00000382808.4_Missense_Mutation_p.Q183E	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	302					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	AGAATAGGCTGTCGGTAGCTG	0.418													ENSG00000163581																																					0													195.0	177.0	183.0					3																	170723133		2203	4300	6503	SO:0001583	missense	0			-	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.904C>G	3.37:g.170723133G>C	ENSP00000323568:p.Gln302Glu		A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_2,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.Q302E	ENST00000314251.3	37	c.904	CCDS3215.1	3	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303224	0.40795	.	.	ENSG00000163581	ENST00000314251;ENST00000382808	T;T	0.80566	-1.39;-1.39	5.53	2.61	0.31194	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.255323	0.47093	D	0.000251	D	0.83211	0.5205	M	0.88241	2.94	0.50632	D	0.999886	B	0.26195	0.144	B	0.35899	0.213	T	0.76005	-0.3117	10	0.09590	T	0.72	.	14.6816	0.69020	0.0:0.0:0.6005:0.3995	.	302	P11168	GTR2_HUMAN	E	302;183	ENSP00000323568:Q302E;ENSP00000372258:Q183E	ENSP00000323568:Q302E	Q	-	1	0	SLC2A2	172205827	1.000000	0.71417	0.204000	0.23530	0.070000	0.16714	3.154000	0.50693	0.318000	0.23185	-0.293000	0.09583	CAG	-	SLC2A2	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.418	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A2	HGNC	protein_coding	OTTHUMT00000352834.1	0	0		52	52		0.00		G	NM_000340		170723133	-1	10		50		tier1	no_errors	ENST00000314251	ensembl	human	known	74_37	missense	16.67		SNP	0.986	C	10	50
HS1BP3	64342	genome.wustl.edu	37	2	20840695	20840695	+	Intron	SNP	G	G	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr2:20840695G>A	ENST00000304031.3	-	3	432				HS1BP3_ENST00000402541.1_Intron|HS1BP3_ENST00000406618.3_Silent_p.P148P	NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3								phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTCTGGGCCGGGGAGACCTG	0.652													ENSG00000118960																																					0													62.0	70.0	67.0					2																	20840695		2203	4300	6503	SO:0001627	intron_variant	0			-		CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.406+37C>T	2.37:g.20840695G>A			B2RAW2|D6W529|Q86VC2|Q8N367	Silent	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.P148	ENST00000304031.3	37	c.444	CCDS1700.1	2																																																																																			-	HS1BP3	-	NULL		0.652	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS1BP3	HGNC	protein_coding	OTTHUMT00000242863.1	0	0		68	68		0.00		G	NM_022460		20840695	-1	35		41		tier1	no_errors	ENST00000406618	ensembl	human	putative	74_37	silent	46.05		SNP	0.000	A	35	41
RP1L1	94137	genome.wustl.edu	37	8	10480360	10480360	+	Missense_Mutation	SNP	G	G	A	rs200121539		TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr8:10480360G>A	ENST00000382483.3	-	2	575	c.352C>T	c.(352-354)Cgg>Tgg	p.R118W	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	118	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCCTGTGGCCGGCCTGGTCCA	0.637													ENSG00000183638																																					0																																										SO:0001583	missense	0			-	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.352C>T	8.37:g.10480360G>A	ENSP00000371923:p.Arg118Trp		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.R118W	ENST00000382483.3	37	c.352	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	g	12.31	1.899891	0.33535	.	.	ENSG00000183638	ENST00000382483	T	0.04809	3.55	4.32	-5.73	0.02398	.	.	.	.	.	T	0.02533	0.0077	N	0.22421	0.69	0.09310	N	1	B	0.20671	0.047	B	0.09377	0.004	T	0.44937	-0.9295	9	0.54805	T	0.06	-0.6815	1.102	0.01686	0.2966:0.2077:0.3539:0.1418	.	118	A6NKC6	.	W	118	ENSP00000371923:R118W	ENSP00000371923:R118W	R	-	1	2	RP1L1	10517770	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	0.738000	0.26158	-1.015000	0.03375	-1.023000	0.02433	CGG	rs200121539	RP1L1	-	NULL		0.637	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	0	0		84	84		0.00		G			10480360	-1	23		53		tier1	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	30.26		SNP	0.000	A	23	53
PLET1	349633	genome.wustl.edu	37	11	112118610	112118619	+	IGR	DEL	ACACACACAC	ACACACACAC	-	rs201398125|rs79699298|rs202146857|rs146953253		TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	ACACACACAC	ACACACACAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr11:112118610_112118619delACACACACAC	ENST00000338832.2	-	0	1541				AP002884.1_ENST00000401135.1_RNA	NM_001145024.1	NP_001138496.1	Q6UQ28	PLET1_HUMAN							cell differentiation (GO:0030154)|negative regulation of cell-matrix adhesion (GO:0001953)|positive regulation of cell migration (GO:0030335)|wound healing, spreading of epidermal cells (GO:0035313)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)				endometrium(2)	2						atgtatatATacacacacacacacacacac	0.352													ENSG00000215954																																					0																																										SO:0001628	intergenic_variant	0																																11.37:g.112118620_112118629delACACACACAC			Q6UQ24|Q6UQ25|Q6UQ27	R	DEL	-	NULL	ENST00000338832.2	37	NULL		11																																																																																				AP002884.1	-	-		0.352	C11orf34-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000215954	Clone_based_ensembl_gene	protein_coding										ACACACACAC			112118619	+1					tier1	no_errors	ENST00000401135	ensembl	human	novel	74_37	rna			DEL	0.028:0.021:0.024:0.025:0.042:0.052:0.057:0.059:0.067:0.070	-		
FAM120A	23196	genome.wustl.edu	37	9	96318801	96318801	+	Silent	SNP	G	G	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr9:96318801G>A	ENST00000277165.6	+	13	2606	c.2412G>A	c.(2410-2412)ggG>ggA	p.G804G	FAM120A_ENST00000340893.4_Silent_p.G804G|FAM120A_ENST00000333936.5_Silent_p.G832G	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	804						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						ATTTTGATGGGAAGCTCTTCC	0.527													ENSG00000048828																																					0													174.0	174.0	174.0					9																	96318801		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.2412G>A	9.37:g.96318801G>A			A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Silent	SNP	NULL	p.G832	ENST00000277165.6	37	c.2496	CCDS6706.1	9																																																																																			-	FAM120A	-	NULL		0.527	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	0	0		57	57		0.00		G	NM_014612		96318801	+1	24		53		tier1	no_errors	ENST00000333936	ensembl	human	known	74_37	silent	31.17		SNP	0.996	A	24	53
FLCN	201163	genome.wustl.edu	37	17	17129630	17129630	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr17:17129630G>A	ENST00000285071.4	-	5	710	c.256C>T	c.(256-258)Cgg>Tgg	p.R86W	FLCN_ENST00000389169.5_Missense_Mutation_p.R86W|RP11-45M22.4_ENST00000427497.3_Intron	NM_144997.5	NP_659434.2	Q8NFG4	FLCN_HUMAN	folliculin	86					cell-cell junction assembly (GO:0007043)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in kidney development (GO:1901723)|negative regulation of energy homeostasis (GO:2000506)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of gene expression (GO:0010629)|negative regulation of mitochondrion organization (GO:0010823)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of gene expression (GO:0010628)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cytokinesis (GO:0032465)|regulation of histone acetylation (GO:0035065)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|regulation of TOR signaling (GO:0032006)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|stomach(1)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCAAGTGACCGGCAGCCCTGT	0.507									Familial Non-VHL Clear Cell Renal Cancer;Birt-Hogg-Dub syndrome				ENSG00000154803																																					0													71.0	76.0	74.0					17																	17129630		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Clear Cell Renal Cell Cancer, FcRCC, Familial Non-VHL Non-Papillary Clear Cell Renal Cancer;BHD, Fibrofolliculomas with Trichodiscomas and Acrochordons, incl.: Hornstein-Knickenberg syndrome, Perifollicular Fibromatosis	-	AF517523	CCDS32579.1, CCDS32580.1	17p11.2	2014-09-17			ENSG00000154803	ENSG00000154803			27310	protein-coding gene	gene with protein product		607273					Standard	NM_144997		Approved	BHD, MGC17998, MGC23445	uc002gra.4	Q8NFG4	OTTHUMG00000059275	ENST00000285071.4:c.256C>T	17.37:g.17129630G>A	ENSP00000285071:p.Arg86Trp		A6NJJ8|Q6ZRX1|Q96BD2|Q96BE4	Missense_Mutation	SNP	pfam_Folliculin	p.R86W	ENST00000285071.4	37	c.256	CCDS32579.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046092	0.75846	.	.	ENSG00000154803	ENST00000285071;ENST00000389169;ENST00000417064;ENST00000389168;ENST00000389171	D;D;D	0.93488	-3.23;-3.04;-1.77	5.45	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.95050	0.8397	L	0.50333	1.59	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.993;0.999;0.984	D	0.95140	0.8263	10	0.87932	D	0	-11.4826	12.4895	0.55891	0.0:0.0:0.6961:0.3039	.	86;86;86	Q8NFG4-3;Q8NFG4-2;Q8NFG4	.;.;FLCN_HUMAN	W	86;86;33;86;86	ENSP00000285071:R86W;ENSP00000373821:R86W;ENSP00000410410:R33W	ENSP00000285071:R86W	R	-	1	2	FLCN	17070355	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.215000	0.58534	1.266000	0.44231	0.563000	0.77884	CGG	-	FLCN	-	NULL		0.507	FLCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLCN	HGNC	protein_coding	OTTHUMT00000131577.1	0	0		68	68		0.00		G	NM_144606		17129630	-1	28		29		tier1	no_errors	ENST00000285071	ensembl	human	known	74_37	missense	49.12		SNP	1.000	A	28	29
HNF1B	6928	genome.wustl.edu	37	17	36091616	36091616	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr17:36091616G>T	ENST00000225893.4	-	4	1376	c.1015C>A	c.(1015-1017)Ccc>Acc	p.P339T	HNF1B_ENST00000561193.1_Missense_Mutation_p.P313T|HNF1B_ENST00000427275.2_Missense_Mutation_p.P313T|HNF1B_ENST00000560016.1_Missense_Mutation_p.P339T	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	339					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GAGGAGCTGGGCTGGTGGTGG	0.597													ENSG00000108753																									Colon(71;102 1179 9001 27917 43397)												0													78.0	60.0	66.0					17																	36091616		2203	4300	6503	SO:0001583	missense	0			-	BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.1015C>A	17.37:g.36091616G>T	ENSP00000225893:p.Pro339Thr		B4DKM3|E0YMJ9	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.P339T	ENST00000225893.4	37	c.1015	CCDS11324.1	17	.	.	.	.	.	.	.	.	.	.	G	12.59	1.982521	0.34942	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.97505	-4.41;-4.41	5.2	4.21	0.49690	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.095904	0.64402	D	0.000001	D	0.93006	0.7774	N	0.25426	0.745	0.45366	D	0.998353	B;B;B	0.15473	0.001;0.013;0.003	B;B;B	0.17979	0.02;0.011;0.005	D	0.89538	0.3790	10	0.33940	T	0.23	-34.684	11.6407	0.51230	0.09:0.0:0.91:0.0	.	313;339;339	E0YMJ6;P35680-3;P35680	.;.;HNF1B_HUMAN	T	339;313;339;227	ENSP00000225893:P339T;ENSP00000412212:P313T	ENSP00000225893:P339T	P	-	1	0	HNF1B	33165729	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	1.710000	0.37920	1.376000	0.46267	0.650000	0.86243	CCC	-	HNF1B	-	pfam_HNF1b_C		0.597	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1B	HGNC	protein_coding	OTTHUMT00000256807.3	0	0		65	65		0.00		G	NM_000458		36091616	-1	19		32		tier1	no_errors	ENST00000225893	ensembl	human	known	74_37	missense	37.25		SNP	1.000	T	19	32
DDX26B	203522	genome.wustl.edu	37	X	134713794	134713794	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chrX:134713794C>T	ENST00000370752.4	+	15	2424	c.2090C>T	c.(2089-2091)gCt>gTt	p.A697V	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	697										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					TCAAAATCTGCTCCATCAGAG	0.443													ENSG00000165359																																					0													75.0	69.0	71.0					X																	134713794		2203	4300	6503	SO:0001583	missense	0			-	AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.2090C>T	X.37:g.134713794C>T	ENSP00000359788:p.Ala697Val		Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	pfscan_VWF_A	p.A697V	ENST00000370752.4	37	c.2090	CCDS35401.1	X	.	.	.	.	.	.	.	.	.	.	C	0.958	-0.704301	0.03255	.	.	ENSG00000165359	ENST00000370752	T	0.31247	1.5	5.67	0.148	0.14843	.	1.165760	0.05987	N	0.645436	T	0.25158	0.0611	L	0.41236	1.265	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.002	T	0.31475	-0.9942	10	0.19147	T	0.46	4.7988	10.0589	0.42261	0.0:0.5404:0.0:0.4596	.	697;697	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	V	697	ENSP00000359788:A697V	ENSP00000359788:A697V	A	+	2	0	DDX26B	134541460	0.737000	0.28175	0.002000	0.10522	0.187000	0.23431	1.143000	0.31553	-0.072000	0.12864	-0.191000	0.12829	GCT	-	DDX26B	-	NULL		0.443	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX26B	HGNC	protein_coding	OTTHUMT00000058420.1	0	0		38	38		0.00		C	NM_182540		134713794	+1	17		43		tier1	no_errors	ENST00000370752	ensembl	human	known	74_37	missense	28.33		SNP	0.001	T	17	43
RIC1	57589	genome.wustl.edu	37	9	5720614	5720614	+	Splice_Site	DEL	T	T	-			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr9:5720614delT	ENST00000414202.2	+	6	775	c.584delT	c.(583-585)gta>ga	p.V195fs	KIAA1432_ENST00000381532.2_Splice_Site_p.V116fs|KIAA1432_ENST00000418622.3_Splice_Site_p.V116fs|RP11-207C16.4_ENST00000426764.1_RNA|KIAA1432_ENST00000449720.2_Splice_Site_p.V116fs|KIAA1432_ENST00000251879.6_Splice_Site_p.V195fs	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TTTTCATCAGTAGGTTCATTC	0.343													ENSG00000107036																																					0													140.0	134.0	136.0					9																	5720614		2203	4300	6503	SO:0001630	splice_region_variant	0																															ENST00000414202.2:c.584-1T>-	9.37:g.5720614delT				Frame_Shift_Del	DEL	pfam_Ribosome_control_1,superfamily_WD40_repeat_dom	p.V116fs	ENST00000414202.2	37	c.347	CCDS34982.2	9																																																																																				KIAA1432	-	superfamily_WD40_repeat_dom		0.343	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1432	HGNC	protein_coding	OTTHUMT00000051636.3	0	0		53	53		0.00		T		Frame_Shift_Del	5720614	+1	13		6		tier1	no_errors	ENST00000418622	ensembl	human	known	74_37	frame_shift_del	68.42		DEL	1.000	-	13	6
STOM	2040	genome.wustl.edu	37	9	124110391	124110391	+	Missense_Mutation	SNP	T	T	C	rs528790770	byFrequency	TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr9:124110391T>C	ENST00000286713.2	-	6	579	c.562A>G	c.(562-564)Aag>Gag	p.K188E	AL161784.1_ENST00000594963.1_Missense_Mutation_p.F54S|STOM_ENST00000538954.1_Missense_Mutation_p.K137E|STOM_ENST00000347359.2_Intron	NM_001270526.1|NM_004099.5	NP_001257455.1|NP_004090.4	P27105	STOM_HUMAN	stomatin	188					protein homooligomerization (GO:0051260)|regulation of acid-sensing ion channel activity (GO:1901585)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|vesicle (GO:0031982)				endometrium(1)|large_intestine(1)|lung(3)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(323;0.00107)|GBM - Glioblastoma multiforme(294;0.0137)		CGCTCCACCTTTATTCCCCAG	0.547													ENSG00000148175																																					0													130.0	128.0	129.0					9																	124110391		2203	4300	6503	SO:0001583	missense	0			-		CCDS6830.1, CCDS6831.1, CCDS75892.1	9q34.1	2008-07-21	2002-11-11	2002-11-15	ENSG00000148175	ENSG00000148175			3383	protein-coding gene	gene with protein product		133090	"""erythrocyte membrane protein band 7.2 (stomatin)"""	EPB7, EPB72		1883838	Standard	NM_198194		Approved	BND7	uc004blh.4	P27105	OTTHUMG00000020590	ENST00000286713.2:c.562A>G	9.37:g.124110391T>C	ENSP00000286713:p.Lys188Glu		B1AM77|Q14087|Q15609|Q5VX96|Q96FK4	Missense_Mutation	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.K188E	ENST00000286713.2	37	c.562	CCDS6830.1	9	.	.	.	.	.	.	.	.	.	.	T	19.18	3.777128	0.70107	.	.	ENSG00000148175	ENST00000286713;ENST00000538954	D;D	0.92149	-2.98;-2.98	5.45	4.24	0.50183	Band 7/stomatin-like, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93048	0.7787	M	0.87682	2.9	0.58432	D	0.999999	B	0.20550	0.046	B	0.32928	0.155	D	0.92561	0.6058	10	0.87932	D	0	.	11.4335	0.50054	0.0:0.0:0.1507:0.8493	.	188	P27105	STOM_HUMAN	E	188;137	ENSP00000286713:K188E;ENSP00000445764:K137E	ENSP00000286713:K188E	K	-	1	0	STOM	123150212	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.048000	0.57390	2.059000	0.61396	0.533000	0.62120	AAG	-	STOM	-	pfam_Band_7,smart_Band_7,prints_Stomatin		0.547	STOM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOM	HGNC	protein_coding	OTTHUMT00000053889.1	0	0		55	55		0.00		T	NM_004099		124110391	-1	24		50		tier1	no_errors	ENST00000286713	ensembl	human	known	74_37	missense	32.43		SNP	1.000	C	24	50
RABGGTB	5876	genome.wustl.edu	37	1	76259678	76259714	+	Intron	DEL	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	-	rs372421559|rs377221880|rs75986168|rs141490560|rs377745023	byFrequency	TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr1:76259678_76259714delCCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	ENST00000319942.3	+	8	776				RABGGTB_ENST00000496055.1_Intron|MSH4_ENST00000263187.3_5'Flank|RABGGTB_ENST00000535300.1_Intron	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						CATCAGATTACCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCTCAAAATTAGG	0.376													ENSG00000137955		911	0.181909	0.1604	0.2781	5008	,	,		24903	0.0169		0.2843	False		,,,				2504	0.2076																0																																										SO:0001627	intron_variant	0				U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.706-55CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT>-	1.37:g.76259678_76259714delCCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT			Q92697	R	DEL	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																				RABGGTB	-	-		0.376	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1									CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	NM_004582		76259714	+1					tier1	no_errors	ENST00000459697	ensembl	human	known	74_37	rna			DEL	0.002:0.001:0.001:0.000:0.002:0.005:0.008:0.009:0.007:0.005:0.003:0.003:0.001:0.001:0.002:0.001:0.001:0.001:0.000:0.000:0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000	-		
SKIV2L	6499	genome.wustl.edu	37	6	31937190	31937190	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr6:31937190G>T	ENST00000375394.2	+	27	3646	c.3533G>T	c.(3532-3534)cGg>cTg	p.R1178L	DXO_ENST00000478221.1_5'Flank|STK19_ENST00000375333.2_5'Flank|STK19_ENST00000375331.2_5'Flank|SKIV2L_ENST00000544581.1_Missense_Mutation_p.R985L	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	1178					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						GAGTGGGCCCGGGGCATGGTG	0.572													ENSG00000204351																																					0													99.0	98.0	98.0					6																	31937190		2203	4300	6503	SO:0001583	missense	0			-		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.3533G>T	6.37:g.31937190G>T	ENSP00000364543:p.Arg1178Leu		O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	pfam_DSH_C,pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_R_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R1178L	ENST00000375394.2	37	c.3533	CCDS4731.1	6	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793530	0.90453	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.23754	1.89;1.89	5.29	5.29	0.74685	DSH, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.21145	0.0509	L	0.58101	1.795	0.80722	D	1	B	0.30937	0.301	B	0.34779	0.189	T	0.04930	-1.0917	10	0.66056	D	0.02	-28.4233	17.7168	0.88340	0.0:0.0:1.0:0.0	.	1178	Q15477	SKIV2_HUMAN	L	1178;1020;985	ENSP00000364543:R1178L;ENSP00000442645:R985L	ENSP00000364543:R1178L	R	+	2	0	SKIV2L	32045169	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.528000	0.90598	2.460000	0.83146	0.655000	0.94253	CGG	-	SKIV2L	-	pfam_DSH_C,pirsf_R_helicase_ATP-dep_SK12/DOB1		0.572	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L	HGNC	protein_coding	OTTHUMT00000076264.3	0	0		85	85		0.00		G			31937190	+1	16		23		tier1	no_errors	ENST00000375394	ensembl	human	known	74_37	missense	41.03		SNP	1.000	T	16	23
MAGEC3	139081	genome.wustl.edu	37	X	140953333	140953333	+	Missense_Mutation	SNP	G	G	T	rs149404251		TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chrX:140953333G>T	ENST00000298296.1	+	2	200	c.200G>T	c.(199-201)aGg>aTg	p.R67M		NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	67								p.R67M(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTTTCTGAGGGGTGGAACT	0.512													ENSG00000165509																																					1	Substitution - Missense(1)	lung(1)											206.0	170.0	182.0					X																	140953333		2203	4300	6503	SO:0001583	missense	0			-	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.200G>T	X.37:g.140953333G>T	ENSP00000298296:p.Arg67Met		Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.R67M	ENST00000298296.1	37	c.200	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	G	9.969	1.224918	0.22457	.	.	ENSG00000165509	ENST00000298296	T	0.08546	3.08	1.96	-3.92	0.04155	.	.	.	.	.	T	0.03178	0.0093	N	0.08118	0	0.09310	N	1	P	0.50156	0.932	B	0.38106	0.265	T	0.30794	-0.9966	9	0.87932	D	0	.	4.5692	0.12202	0.5434:0.1764:0.2802:0.0	.	67	Q8TD91	MAGC3_HUMAN	M	67	ENSP00000298296:R67M	ENSP00000298296:R67M	R	+	2	0	MAGEC3	140780999	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.066000	0.03454	-1.761000	0.01310	-0.269000	0.10298	AGG	-	MAGEC3	-	NULL		0.512	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	0	0		98	98		0.00		G	NM_138702		140953333	+1	35		74		tier1	no_errors	ENST00000298296	ensembl	human	known	74_37	missense	32.11		SNP	0.000	T	35	74
CDH26	60437	genome.wustl.edu	37	20	58544078	58544078	+	Splice_Site	SNP	G	G	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr20:58544078G>T	ENST00000244047.5	+	2	437	c.126G>T	c.(124-126)aaG>aaT	p.K42N	CDH26_ENST00000348616.4_Splice_Site_p.K42N			Q8IXH8	CAD26_HUMAN	cadherin 26	42	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			AGCAAACAAAGGTGAGGTTTG	0.328													ENSG00000124215																																					0													65.0	77.0	73.0					20																	58544078		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.126+1G>T	20.37:g.58544078G>T			A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K42N	ENST00000244047.5	37	c.126		20	.	.	.	.	.	.	.	.	.	.	G	9.672	1.147002	0.21288	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.60171	0.21;0.33	3.15	2.18	0.27775	.	0.417144	0.18060	N	0.152998	T	0.41442	0.1159	L	0.27053	0.805	0.80722	D	1	P	0.49090	0.919	B	0.42625	0.393	T	0.27468	-1.0073	10	0.59425	D	0.04	.	6.5363	0.22355	0.141:0.0:0.859:0.0	.	42	Q8IXH8-4	.	N	42	ENSP00000244047:K42N;ENSP00000339390:K42N	ENSP00000244047:K42N	K	+	3	2	CDH26	57977473	0.003000	0.15002	0.002000	0.10522	0.257000	0.26127	0.187000	0.16998	0.660000	0.30964	-0.467000	0.05162	AAG	-	CDH26	-	NULL		0.328	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		0	0		79	79		0.00		G	NM_177980	Missense_Mutation	58544078	+1	4		45		tier1	no_errors	ENST00000244047	ensembl	human	known	74_37	missense	8.16		SNP	0.003	T	4	45
HERC4	26091	genome.wustl.edu	37	10	69832687	69832687	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr10:69832687C>T	ENST00000395198.3	-	3	426	c.179G>A	c.(178-180)tGt>tAt	p.C60Y	HERC4_ENST00000492996.2_Missense_Mutation_p.C60Y|HERC4_ENST00000373700.4_Missense_Mutation_p.C60Y|HERC4_ENST00000395187.2_Missense_Mutation_p.C60Y|HERC4_ENST00000412272.2_Missense_Mutation_p.C60Y	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	60					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						TAGATCATTACATCCACATGT	0.323													ENSG00000148634																																					0													118.0	114.0	116.0					10																	69832687		2203	4300	6503	SO:0001583	missense	0			-	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.179G>A	10.37:g.69832687C>T	ENSP00000378624:p.Cys60Tyr		Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.C60Y	ENST00000395198.3	37	c.179	CCDS41533.1	10	.	.	.	.	.	.	.	.	.	.	C	15.24	2.774693	0.49786	.	.	ENSG00000148634	ENST00000412272;ENST00000395198;ENST00000373700;ENST00000395187;ENST00000513996;ENST00000492996	D;D;D;T;D;T	0.85556	-2.0;-2.0;-2.0;-1.32;-2.0;-1.32	4.78	4.78	0.61160	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.106872	0.64402	D	0.000003	D	0.88347	0.6412	L	0.39085	1.19	0.80722	D	1	D;D;B;B;B	0.69078	0.997;0.997;0.012;0.023;0.273	D;D;B;B;B	0.83275	0.931;0.996;0.011;0.052;0.374	D	0.87460	0.2407	9	.	.	.	.	16.0089	0.80383	0.0:1.0:0.0:0.0	.	60;60;60;60;60	Q5GLZ8-3;Q5GLZ8-4;A8K9U4;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	Y	60	ENSP00000416504:C60Y;ENSP00000378624:C60Y;ENSP00000362804:C60Y;ENSP00000378614:C60Y;ENSP00000427191:C60Y;ENSP00000422383:C60Y	.	C	-	2	0	HERC4	69502693	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.745000	0.68672	2.191000	0.70037	0.655000	0.94253	TGT	-	HERC4	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens		0.323	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	HGNC	protein_coding	OTTHUMT00000359262.1	0	0		93	93		0.00		C	NM_015601		69832687	-1	4		42		tier1	no_errors	ENST00000395198	ensembl	human	known	74_37	missense	8.70		SNP	1.000	T	4	42
VCPKMT	79609	genome.wustl.edu	37	14	50579351	50579351	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr14:50579351G>T	ENST00000395860.2	-	5	661	c.657C>A	c.(655-657)taC>taA	p.Y219*	VCPKMT_ENST00000395859.2_Intron	NM_024558.2	NP_078834.2	Q9H867	MT21D_HUMAN	valosin containing protein lysine (K) methyltransferase	219					peptidyl-lysine trimethylation (GO:0018023)	cytoplasm (GO:0005737)	protein-lysine N-methyltransferase activity (GO:0016279)										TCTTTCTGATGTATATAATAT	0.333													ENSG00000100483																																					0													58.0	52.0	54.0					14																	50579351		1804	4043	5847	SO:0001587	stop_gained	0			-	AK023982	CCDS9696.2, CCDS41951.1	14q21.3	2013-09-30	2013-09-30	2013-09-30	ENSG00000100483	ENSG00000100483			20352	protein-coding gene	gene with protein product		615260	"""chromosome 14 open reading frame 138"", ""methyltransferase like 21D"""	C14orf138, METTL21D		22948820	Standard	NR_049738		Approved	VCP-KMT	uc001wxo.1	Q9H867	OTTHUMG00000029531	ENST00000395860.2:c.657C>A	14.37:g.50579351G>T	ENSP00000379201:p.Tyr219*		B7ZLA3|B7ZLA4|Q2M2X3|Q86T12	Nonsense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.Y219*	ENST00000395860.2	37	c.657	CCDS9696.2	14	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525369	0.85600	.	.	ENSG00000100483	ENST00000358490;ENST00000395860	.	.	.	5.45	3.6	0.41247	.	1.220290	0.06044	U	0.655457	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-2.8293	7.7882	0.29103	0.1421:0.0:0.7252:0.1327	.	.	.	.	X	152;219	.	ENSP00000351279:Y152X	Y	-	3	2	METTL21D	49649101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.080000	0.30779	1.426000	0.47256	0.655000	0.94253	TAC	-	VCPKMT	-	NULL		0.333	VCPKMT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPKMT	HGNC	protein_coding	OTTHUMT00000276877.1	0	0		32	32		0.00		G	NM_024558		50579351	-1	4		23		tier1	no_errors	ENST00000395860	ensembl	human	known	74_37	nonsense	14.81		SNP	1.000	T	4	23
GBX2	2637	genome.wustl.edu	37	2	237074887	237074887	+	Silent	SNP	G	G	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr2:237074887G>A	ENST00000306318.4	-	2	1114	c.717C>T	c.(715-717)ggC>ggT	p.G239G	GBX2_ENST00000551105.1_3'UTR|AC079135.1_ENST00000483218.1_RNA|GBX2_ENST00000465889.1_5'UTR|AC079135.1_ENST00000415226.1_RNA	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2	239					autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		ACGTGGTGCTGCCCGCGGCGC	0.647													ENSG00000168505																																					0													30.0	35.0	33.0					2																	237074887		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.717C>T	2.37:g.237074887G>A			B2RPH7|O43833|Q53RX5|Q9Y5Y1	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.G239	ENST00000306318.4	37	c.717	CCDS2515.1	2																																																																																			-	GBX2	-	superfamily_Homeodomain-like		0.647	GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBX2	HGNC	protein_coding	OTTHUMT00000257078.3	0	0		36	36		0.00		G	NM_001485		237074887	-1	16		21		tier1	no_errors	ENST00000306318	ensembl	human	known	74_37	silent	43.24		SNP	1.000	A	16	21
STARD9	57519	genome.wustl.edu	37	15	42979512	42979512	+	Missense_Mutation	SNP	A	A	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr15:42979512A>T	ENST00000290607.7	+	23	5793	c.5736A>T	c.(5734-5736)gaA>gaT	p.E1912D		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1912					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TCTTTCGTGAATCTGAGGCAC	0.512													ENSG00000159433																																					0													15.0	15.0	15.0					15																	42979512		692	1589	2281	SO:0001583	missense	0			-	AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.5736A>T	15.37:g.42979512A>T	ENSP00000290607:p.Glu1912Asp		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1912D	ENST00000290607.7	37	c.5736	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	A	9.795	1.179097	0.21787	.	.	ENSG00000159433	ENST00000290607	T	0.60920	0.15	5.87	-5.25	0.02781	.	.	.	.	.	T	0.32436	0.0829	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.21245	-1.0251	7	0.28530	T	0.3	.	1.94	0.03345	0.2936:0.2831:0.3052:0.1181	.	.	.	.	D	1912	ENSP00000290607:E1912D	ENSP00000290607:E1912D	E	+	3	2	STARD9	40766804	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	-1.363000	0.02592	-1.309000	0.02315	-0.250000	0.11733	GAA	-	STARD9	-	NULL		0.512	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	0	0		28	28		0.00		A			42979512	+1	16		61		tier1	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	20.78		SNP	0.001	T	16	61
OR2B3	442184	genome.wustl.edu	37	6	29054540	29054540	+	Silent	SNP	C	C	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr6:29054540C>T	ENST00000377173.2	-	1	550	c.486G>A	c.(484-486)ttG>ttA	p.L162L		NM_001005226.2	NP_001005226.1	O76000	OR2B3_HUMAN	olfactory receptor, family 2, subfamily B, member 3	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|lung(17)|prostate(1)|skin(2)	24						TGTTAAGAGTCAAGGAAGACT	0.488													ENSG00000204703																																					0													59.0	53.0	55.0					6																	29054540		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS34358.1	6p22.2-p21.31	2012-08-09	2008-10-22	2008-10-22	ENSG00000204703	ENSG00000204703		"""GPCR / Class A : Olfactory receptors"""	8238	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 3 pseudogene"""	OR2B3P			Standard	NM_001005226		Approved	OR6-4	uc003nlx.3	O76000	OTTHUMG00000031226	ENST00000377173.2:c.486G>A	6.37:g.29054540C>T			B0UYQ1|Q5ST41|Q96R13	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L162	ENST00000377173.2	37	c.486	CCDS34358.1	6																																																																																			-	OR2B3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.488	OR2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B3	HGNC	protein_coding	OTTHUMT00000076469.2	0	0		21	21		0.00		C			29054540	-1	3		10		tier1	no_errors	ENST00000377173	ensembl	human	known	74_37	silent	23.08		SNP	0.010	T	3	10
RIMBP3	85376	genome.wustl.edu	37	22	20458608	20458608	+	Silent	SNP	C	C	A			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr22:20458608C>A	ENST00000426804.1	-	1	3178	c.2694G>T	c.(2692-2694)ccG>ccT	p.P898P	RN7SKP131_ENST00000363006.1_RNA	NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	898	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.									breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			TGTAGCTGTCCGGAATCTGCT	0.587													ENSG00000196622																																					0													11.0	19.0	17.0					22																	20458608		1888	4059	5947	SO:0001819	synonymous_variant	0			-	AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.2694G>T	22.37:g.20458608C>A			Q8IYP7|Q9BY94|Q9UFQ5	Silent	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,pfscan_SH3_domain	p.P898	ENST00000426804.1	37	c.2694	CCDS46665.1	22																																																																																			-	RIMBP3	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.587	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP3	HGNC	protein_coding	OTTHUMT00000318945.2	0	0		171	171		0.00		C	NM_015672		20458608	-1	31		180		tier1	no_errors	ENST00000426804	ensembl	human	known	74_37	silent	14.69		SNP	0.841	A	31	180
TP53	7157	genome.wustl.edu	37	17	7574019	7574020	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr17:7574019_7574020delCT	ENST00000269305.4	-	10	1196_1197	c.1007_1008delAG	c.(1006-1008)gagfs	p.E336fs	TP53_ENST00000359597.4_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Frame_Shift_Del_p.E336fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	336	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTCGAAGCGCTCACGCCCACG	0.52		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	10	Whole gene deletion(8)|Unknown(1)|Deletion - Frameshift(1)	bone(4)|haematopoietic_and_lymphoid_tissue(2)|central_nervous_system(2)|large_intestine(1)|stomach(1)	GRCh37	CI084335	TP53	I																																				SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1007_1008delAG	17.37:g.7574019_7574020delCT	ENSP00000269305:p.Glu336fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E336fs	ENST00000269305.4	37	c.1008_1007	CCDS11118.1	17																																																																																				TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor		0.520	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0		26	26		0.00		CT	NM_000546		7574020	-1	11		3		tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	78.57		DEL	0.004:0.009	-	11	3
SRGAP1	57522	genome.wustl.edu	37	12	64491140	64491140	+	Missense_Mutation	SNP	C	C	G			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr12:64491140C>G	ENST00000355086.3	+	15	2322	c.1798C>G	c.(1798-1800)Ctg>Gtg	p.L600V	SRGAP1_ENST00000357825.3_Missense_Mutation_p.L577V|RP11-196H14.2_ENST00000535594.1_RNA|SRGAP1_ENST00000543397.1_Missense_Mutation_p.L537V	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	600	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		ATTTAACGATCTGATTTCTTG	0.423													ENSG00000196935																																					0													88.0	85.0	86.0					12																	64491140		2203	4300	6503	SO:0001583	missense	0			-	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.1798C>G	12.37:g.64491140C>G	ENSP00000347198:p.Leu600Val		Q9H8A3|Q9P2P2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L600V	ENST00000355086.3	37	c.1798	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880779	0.72294	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.21191	2.02;2.02;2.02	5.48	4.59	0.56863	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.29314	U	0.012505	T	0.39545	0.1082	M	0.67953	2.075	0.58432	D	0.999999	P;B	0.46395	0.877;0.369	P;B	0.56916	0.809;0.26	T	0.14227	-1.0480	9	.	.	.	.	14.347	0.66672	0.0:0.9288:0.0:0.0712	.	600;537	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	V	600;577;537	ENSP00000347198:L600V;ENSP00000350480:L577V;ENSP00000437948:L537V	.	L	+	1	2	SRGAP1	62777407	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.136000	0.42121	1.452000	0.47756	0.655000	0.94253	CTG	-	SRGAP1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.423	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	0	0		42	42		0.00		C			64491140	+1	20		33		tier1	no_errors	ENST00000355086	ensembl	human	known	74_37	missense	37.74		SNP	1.000	G	20	33
ZZEF1	23140	genome.wustl.edu	37	17	4007959	4007959	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr17:4007959G>T	ENST00000381638.2	-	8	1665	c.1541C>A	c.(1540-1542)gCg>gAg	p.A514E	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	514							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TCTGACTGACGCCATGGACAA	0.463													ENSG00000074755																																					0													152.0	130.0	138.0					17																	4007959		2203	4300	6503	SO:0001583	missense	0			-	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.1541C>A	17.37:g.4007959G>T	ENSP00000371051:p.Ala514Glu		A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_CUB_dom,smart_EF_hand_dom,smart_Znf_ZZ,pfscan_EF_hand_dom,pfscan_Znf_ZZ	p.A514E	ENST00000381638.2	37	c.1541	CCDS11043.1	17	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551104	0.45383	.	.	ENSG00000074755	ENST00000381638	T	0.42513	0.97	5.65	5.65	0.86999	.	0.101605	0.64402	D	0.000002	T	0.26629	0.0651	N	0.17082	0.46	0.51767	D	0.999934	P;P	0.39216	0.664;0.533	B;B	0.34242	0.178;0.086	T	0.05209	-1.0899	10	0.27082	T	0.32	-6.7341	14.8846	0.70557	0.0:0.0:0.8566:0.1434	.	514;514	O43149-3;O43149	.;ZZEF1_HUMAN	E	514	ENSP00000371051:A514E	ENSP00000371051:A514E	A	-	2	0	ZZEF1	3954708	1.000000	0.71417	0.995000	0.50966	0.641000	0.38312	7.365000	0.79537	2.824000	0.97209	0.655000	0.94253	GCG	-	ZZEF1	-	NULL		0.463	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	0	0		55	55		0.00		G	NM_015113		4007959	-1	5		51		tier1	no_errors	ENST00000381638	ensembl	human	known	74_37	missense	8.93		SNP	0.999	T	5	51
SLC27A4	10999	genome.wustl.edu	37	9	131107639	131107639	+	Silent	SNP	C	C	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr9:131107639C>T	ENST00000300456.4	+	3	484	c.367C>T	c.(367-369)Ctg>Ttg	p.L123L	SLC27A4_ENST00000372870.1_Intron	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	123					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						GGCCCGGGGCCTGGCCTCGGG	0.617													ENSG00000167114																									Pancreas(107;1554 2241 10946 12953)												0													55.0	51.0	52.0					9																	131107639		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.367C>T	9.37:g.131107639C>T			A8K2F7|O95186|Q96G53	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.L123	ENST00000300456.4	37	c.367	CCDS6899.1	9																																																																																			-	SLC27A4	-	pfam_AMP-dep_Synth/Lig		0.617	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A4	HGNC	protein_coding	OTTHUMT00000054432.2	0	0		78	78		0.00		C			131107639	+1	29		57		tier1	no_errors	ENST00000300456	ensembl	human	known	74_37	silent	33.72		SNP	1.000	T	29	57
ITGA9	3680	genome.wustl.edu	37	3	37574815	37574815	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EI-01A-11D-A24N-09	TCGA-IE-A4EI-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	522dc834-8367-4f49-b93b-fcba91a2de7e	9f3e9eb7-1873-4f33-a9c8-671eae8cc921	g.chr3:37574815G>T	ENST00000264741.5	+	14	1640	c.1384G>T	c.(1384-1386)Gtc>Ttc	p.V462F	ITGA9_ENST00000422441.1_Missense_Mutation_p.V462F	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	462					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		AGCAAGGCCTGTCATTACGGT	0.537													ENSG00000144668																																					0													114.0	89.0	97.0					3																	37574815		2203	4300	6503	SO:0001583	missense	0			-	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1384G>T	3.37:g.37574815G>T	ENSP00000264741:p.Val462Phe		Q14638	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.V462F	ENST00000264741.5	37	c.1384	CCDS2669.1	3	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618118	0.66787	.	.	ENSG00000144668	ENST00000422441;ENST00000264741	D;D	0.82984	-1.67;-1.67	6.07	5.2	0.72013	Integrin alpha-2 (1);	0.061082	0.64402	D	0.000004	D	0.90937	0.7151	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.97110	1.0;0.976	D	0.92131	0.5712	10	0.87932	D	0	.	15.5329	0.75977	0.066:0.0:0.934:0.0	.	462;462	Q13797;E9PDS3	ITA9_HUMAN;.	F	462	ENSP00000397258:V462F;ENSP00000264741:V462F	ENSP00000264741:V462F	V	+	1	0	ITGA9	37549819	1.000000	0.71417	0.966000	0.40874	0.184000	0.23303	7.905000	0.87416	1.577000	0.49804	0.655000	0.94253	GTC	-	ITGA9	-	pfam_Integrin_alpha-2,smart_Int_alpha_beta-p,prints_Integrin_alpha		0.537	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA9	HGNC	protein_coding	OTTHUMT00000253361.1	0	0		94	94		0.00		G	NM_002207		37574815	+1	5		56		tier1	no_errors	ENST00000264741	ensembl	human	known	74_37	missense	8.20		SNP	1.000	T	5	56
