#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
HYDIN	54768	genome.wustl.edu	37	16	70902531	70902531	+	Missense_Mutation	SNP	G	G	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr16:70902531G>C	ENST00000393567.2	-	66	11402	c.11252C>G	c.(11251-11253)aCa>aGa	p.T3751R	SNORD112_ENST00000515891.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3751					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCACTTGACTGTGTGCATGCG	0.522													ENSG00000157423																																					0													62.0	59.0	60.0					16																	70902531		1930	4130	6060	SO:0001583	missense	0			-	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11252C>G	16.37:g.70902531G>C	ENSP00000377197:p.Thr3751Arg		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.T3751R	ENST00000393567.2	37	c.11252	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	19.26	3.792792	0.70452	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00995	5.46	5.03	4.07	0.47477	.	0.000000	0.33792	U	0.004557	T	0.04137	0.0115	M	0.73598	2.24	0.80722	D	1	D	0.71674	0.998	D	0.64877	0.93	T	0.43925	-0.9361	10	0.46703	T	0.11	.	12.4939	0.55916	0.0824:0.0:0.9176:0.0	.	3750	F8WD23	.	R	3751;3750	ENSP00000377197:T3751R	ENSP00000313052:T3750R	T	-	2	0	HYDIN	69460032	1.000000	0.71417	0.997000	0.53966	0.871000	0.50021	5.087000	0.64480	2.327000	0.79052	0.511000	0.50034	ACA	-	HYDIN	-	NULL		0.522	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	0	0	0	98	98	94	0.00	0.00	G			70902531	-1	23	21	73	29	tier1	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	23.96	42.00	SNP	0.998	C	23	73
CSRNP3	80034	genome.wustl.edu	37	2	166535783	166535783	+	Silent	SNP	T	T	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:166535783T>A	ENST00000342316.4	+	5	1550	c.1278T>A	c.(1276-1278)gcT>gcA	p.A426A	CSRNP3_ENST00000314499.7_Silent_p.A426A|CSRNP3_ENST00000409420.1_Silent_p.A458A	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	426					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						CAAAGAATGCTTCTTTTTATG	0.443													ENSG00000178662																																					0													134.0	135.0	135.0					2																	166535783		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.1278T>A	2.37:g.166535783T>A			B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Silent	SNP	prints_Cys/Ser-rich_nuc_prot	p.A426	ENST00000342316.4	37	c.1278	CCDS2225.1	2																																																																																			-	CSRNP3	-	NULL		0.443	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP3	HGNC	protein_coding	OTTHUMT00000255191.2	0	0	0	41	41	99	0.00	0.00	T	NM_024969		166535783	+1	8	17	40	51	tier1	no_errors	ENST00000314499	ensembl	human	known	74_37	silent	16.67	25.00	SNP	0.988	A	8	40
KRBOX1	100506243	genome.wustl.edu	37	3	42929043	42929043	+	Intron	SNP	A	A	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr3:42929043A>G	ENST00000426937.1	+	3	131				RP11-141M3.5_ENST00000471537.1_RNA			C9JBD0	KRBX1_HUMAN	KRAB box domain containing 1						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			lung(2)	2						GTGGagaactactgaggactt	0.478													ENSG00000144648																																					0																																										SO:0001627	intron_variant	0			-		CCDS54572.1	3p22.1	2014-02-12	2010-07-29		ENSG00000240747	ENSG00000240747		"""-"""	38708	protein-coding gene	gene with protein product							Standard	NM_001205272		Approved		uc003cmm.4	C9JBD0	OTTHUMG00000156448	ENST00000426937.1:c.-163-21242A>G	3.37:g.42929043A>G			B4DJE8	R	SNP	-	NULL	ENST00000426937.1	37	NULL	CCDS54572.1	3																																																																																			-	ACKR2	-	-		0.478	KRBOX1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ACKR2	HGNC	protein_coding	OTTHUMT00000344162.1	0	0	0	75	75	119	0.00	0.00	A	NM_001205272		42929043	+1	13	11	60	89	tier1	no_errors	ENST00000460855	ensembl	human	known	74_37	rna	17.81	11.00	SNP	0.004	G	13	60
SLC13A5	284111	genome.wustl.edu	37	17	6606359	6606359	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:6606359C>T	ENST00000433363.2	-	5	879	c.646G>A	c.(646-648)Gcc>Acc	p.A216T	SLC13A5_ENST00000573648.1_Missense_Mutation_p.A216T|SLC13A5_ENST00000381074.4_Missense_Mutation_p.A173T|SLC13A5_ENST00000293800.6_Missense_Mutation_p.A199T	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	216					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						CCGATGCTGGCCGCGTAGCAG	0.617													ENSG00000141485																																					0													140.0	114.0	123.0					17																	6606359		2203	4300	6503	SO:0001583	missense	0			-	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.646G>A	17.37:g.6606359C>T	ENSP00000406220:p.Ala216Thr		B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.A216T	ENST00000433363.2	37	c.646	CCDS11079.1	17	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332529	0.81801	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T	0.02737	4.18;4.18	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.23532	0.0569	M	0.94101	3.495	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.996;0.998;0.998;0.998	T	0.05131	-1.0904	10	0.87932	D	0	.	17.1977	0.86898	0.0:1.0:0.0:0.0	.	216;173;173;199;216	B7ZLB4;F8W7N2;B7Z4P2;B3KXR0;Q86YT5	.;.;.;.;S13A5_HUMAN	T	216;216;173	ENSP00000406220:A216T;ENSP00000370464:A173T	ENSP00000293800:A216T	A	-	1	0	SLC13A5	6547083	1.000000	0.71417	0.971000	0.41717	0.148000	0.21650	5.588000	0.67517	2.746000	0.94184	0.561000	0.74099	GCC	-	SLC13A5	-	pfam_Na/sul_symport		0.617	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A5	HGNC	protein_coding	OTTHUMT00000219853.2	0	0	0	74	74	25	0.00	0.00	C	NM_177550		6606359	-1	37	7	70	17	tier1	no_errors	ENST00000433363	ensembl	human	known	74_37	missense	34.58	29.17	SNP	1.000	T	37	70
THOC1	9984	genome.wustl.edu	37	18	215471	215471	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:215471C>T	ENST00000261600.6	-	20	1643	c.1636G>A	c.(1636-1638)Gaa>Aaa	p.E546K		NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	546					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TCCTCATCTTCATCCTCACCT	0.343													ENSG00000079134																																					0													139.0	123.0	128.0					18																	215471		1852	4094	5946	SO:0001583	missense	0			-	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.1636G>A	18.37:g.215471C>T	ENSP00000261600:p.Glu546Lys		B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	pfam_THO_THOC1,pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain	p.E546K	ENST00000261600.6	37	c.1636	CCDS45820.1	18	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111215	0.56398	.	.	ENSG00000079134	ENST00000261600	.	.	.	5.44	5.44	0.79542	.	0.049423	0.85682	D	0.000000	T	0.45216	0.1331	N	0.20685	0.6	0.58432	D	0.999999	P	0.35493	0.505	B	0.37015	0.239	T	0.33548	-0.9864	9	0.16420	T	0.52	-17.9489	18.2487	0.89996	0.0:1.0:0.0:0.0	.	546	Q96FV9	THOC1_HUMAN	K	546	.	ENSP00000261600:E546K	E	-	1	0	THOC1	205471	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.317000	0.72862	2.560000	0.86352	0.563000	0.77884	GAA	-	THOC1	-	NULL		0.343	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC1	HGNC	protein_coding	OTTHUMT00000440348.5	0	0	0	31	31	100	0.00	0.00	C	NM_005131		215471	-1	14	15	40	65	tier1	no_errors	ENST00000261600	ensembl	human	known	74_37	missense	25.93	18.75	SNP	1.000	T	14	40
ESX1	80712	genome.wustl.edu	37	X	103498855	103498855	+	Silent	SNP	T	T	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chrX:103498855T>C	ENST00000372588.4	-	2	569	c.486A>G	c.(484-486)caA>caG	p.Q162Q		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	162					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CGTCGGGATATTGAGATTCAT	0.622													ENSG00000123576																									Pancreas(200;1705 2227 25194 28471 45274)												0													53.0	54.0	53.0					X																	103498855		2203	4298	6501	SO:0001819	synonymous_variant	0			-	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.486A>G	X.37:g.103498855T>C			B0QYU3|Q7Z6K7	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.Q162	ENST00000372588.4	37	c.486	CCDS14516.1	X																																																																																			-	ESX1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.622	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	HGNC	protein_coding	OTTHUMT00000057763.2	0	0	0	69	69	25	0.00	0.00	T	NM_153448		103498855	-1	28	7	44	19	tier1	no_errors	ENST00000372588	ensembl	human	known	74_37	silent	38.89	26.92	SNP	0.000	C	28	44
TMC1	117531	genome.wustl.edu	37	9	75309519	75309519	+	Missense_Mutation	SNP	G	G	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr9:75309519G>C	ENST00000297784.5	+	7	665	c.125G>C	c.(124-126)aGg>aCg	p.R42T	TMC1_ENST00000340019.3_Missense_Mutation_p.R42T|TMC1_ENST00000396237.3_Missense_Mutation_p.R42T	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	42	Arg/Asp/Glu/Lys-rich (highly charged).				auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						AGACCAAAGAGGAAACGGACC	0.448													ENSG00000165091																									Pancreas(75;173 1345 14232 34245 43413)												0													154.0	142.0	146.0					9																	75309519		2202	4300	6502	SO:0001583	missense	0			-	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.125G>C	9.37:g.75309519G>C	ENSP00000297784:p.Arg42Thr		A8MVZ2|B1AM91	Missense_Mutation	SNP	pfam_TMC	p.R42T	ENST00000297784.5	37	c.125	CCDS6643.1	9	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149552	0.78001	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	T;T;T	0.15834	2.39;2.39;2.39	5.33	5.33	0.75918	.	0.123609	0.53938	D	0.000048	T	0.29749	0.0743	L	0.40543	1.245	0.28220	N	0.926545	P;D	0.54601	0.909;0.967	P;P	0.60789	0.879;0.879	T	0.03773	-1.1005	10	0.36615	T	0.2	-21.8422	15.7578	0.78051	0.0:0.0:1.0:0.0	.	51;42	A4FUA6;Q8TDI8	.;TMC1_HUMAN	T	42;42;51;51;51;36;42	ENSP00000297784:R42T;ENSP00000341433:R42T;ENSP00000379538:R42T	ENSP00000297784:R42T	R	+	2	0	TMC1	74499339	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.196000	0.51020	2.484000	0.83849	0.650000	0.86243	AGG	-	TMC1	-	NULL		0.448	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	HGNC	protein_coding	OTTHUMT00000052655.1	0	0	0	28	28	84	0.00	0.00	G			75309519	+1	6	8	47	60	tier1	no_errors	ENST00000297784	ensembl	human	known	74_37	missense	11.32	11.76	SNP	1.000	C	6	47
ZNF345	25850	genome.wustl.edu	37	19	37367976	37367976	+	Nonsense_Mutation	SNP	C	C	T	rs202011849		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr19:37367976C>T	ENST00000529555.1	+	2	1032	c.244C>T	c.(244-246)Cga>Tga	p.R82*	ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000420450.1_Nonsense_Mutation_p.R82*|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000589046.1_Nonsense_Mutation_p.R82*			Q14585	ZN345_HUMAN	zinc finger protein 345	82					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R82*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCGACATCAGCGAATTCATAC	0.403													ENSG00000251247																																					1	Substitution - Nonsense(1)	endometrium(1)											104.0	109.0	108.0					19																	37367976		2203	4300	6503	SO:0001587	stop_gained	0			-	X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.244C>T	19.37:g.37367976C>T	ENSP00000431202:p.Arg82*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R82*	ENST00000529555.1	37	c.244	CCDS12497.1	19	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066976	0.55539	.	.	ENSG00000251247	ENST00000420450;ENST00000529555;ENST00000331800	.	.	.	4.28	1.85	0.25348	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5385	0.45018	0.3427:0.6573:0.0:0.0	.	.	.	.	X	82	.	.	R	+	1	2	ZNF345	42059816	0.000000	0.05858	1.000000	0.80357	0.999000	0.98932	-1.759000	0.01808	1.064000	0.40671	0.655000	0.94253	CGA	rs202011849	ZNF345	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.403	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF345	HGNC	protein_coding	OTTHUMT00000388258.1	0	0	0	25	25	81	0.00	0.00	C			37367976	+1	10	14	33	69	tier1	no_errors	ENST00000420450	ensembl	human	known	74_37	nonsense	23.26	16.87	SNP	1.000	T	10	33
JMJD7	100137047	genome.wustl.edu	37	15	42120356	42120356	+	Missense_Mutation	SNP	G	G	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr15:42120356G>C	ENST00000397299.4	+	1	74	c.34G>C	c.(34-36)Gag>Cag	p.E12Q	JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.E12Q|RP11-23P13.4_ENST00000512295.1_RNA|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.E12Q|RP11-23P13.4_ENST00000510176.1_RNA|JMJD7_ENST00000405106.2_3'UTR|JMJD7_ENST00000408047.1_5'UTR|PLA2G4B_ENST00000542534.2_Missense_Mutation_p.E12Q	NM_001114632.1	NP_001108104.1	P0C870	JMJD7_HUMAN	jumonji domain containing 7	12										NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	8						CGTGCGGAGCGAGTTACGAGA	0.706													ENSG00000168970																																					0													16.0	19.0	18.0					15																	42120356		2199	4298	6497	SO:0001583	missense	0			-		CCDS45240.1	15q15.1	2011-02-10			ENSG00000243789	ENSG00000243789			34397	protein-coding gene	gene with protein product							Standard	NM_001114632		Approved			P0C870	OTTHUMG00000156810	ENST00000397299.4:c.34G>C	15.37:g.42120356G>C	ENSP00000380467:p.Glu12Gln		A5D6V5|O95712|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.E12Q	ENST00000397299.4	37	c.34	CCDS45240.1	15	.	.	.	.	.	.	.	.	.	.	.	17.68	3.448325	0.63178	.	.	ENSG00000243789;ENSG00000168970;ENSG00000168970;ENSG00000168970	ENST00000397299;ENST00000542534;ENST00000382448;ENST00000342159	T;T;T;T	0.30448	1.53;1.53;5.12;4.81	4.98	0.272	0.15645	.	0.641843	0.13573	N	0.377923	T	0.18341	0.0440	L	0.40543	1.245	0.20821	N	0.999841	B;P;B	0.41393	0.006;0.748;0.29	B;B;B	0.38985	0.007;0.287;0.073	T	0.11616	-1.0580	10	0.19147	T	0.46	-7.5476	2.715	0.05185	0.1764:0.2697:0.4293:0.1246	.	12;12;12	P0C869-7;P0C869-6;P0C870	.;.;JMJD7_HUMAN	Q	12	ENSP00000380467:E12Q;ENSP00000441905:E12Q;ENSP00000371886:E12Q;ENSP00000342785:E12Q	ENSP00000380467:E12Q	E	+	1	0	JMJD7-PLA2G4B;JMJD7	39907648	0.423000	0.25482	0.522000	0.27862	0.476000	0.33039	0.549000	0.23329	0.129000	0.18514	0.561000	0.74099	GAG	-	JMJD7-PLA2G4B	-	NULL		0.706	JMJD7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000326082.1	0	0	0	38	38	15	0.00	0.00	G	NM_001114632		42120356	+1	6	3	38	10	tier1	no_errors	ENST00000382448	ensembl	human	known	74_37	missense	13.64	23.08	SNP	0.000	C	6	38
PRICKLE4	29964	genome.wustl.edu	37	6	41752638	41752638	+	Intron	SNP	G	G	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr6:41752638G>C	ENST00000394260.1	+	2	120				PRICKLE4_ENST00000463606.1_3'UTR|PRICKLE4_ENST00000359201.5_Intron|PRICKLE4_ENST00000458694.1_Intron|PRICKLE4_ENST00000394259.1_Intron|TOMM6_ENST00000398884.3_5'Flank|TOMM6_ENST00000398881.3_5'Flank|PRICKLE4_ENST00000394263.1_Intron			Q2TBC4	PRIC4_HUMAN	prickle homolog 4 (Drosophila)							nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	13	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTCTGCTGGAGCTCTCCCAGT	0.562													ENSG00000124593																																					0													53.0	60.0	58.0					6																	41752638		2203	4300	6503	SO:0001627	intron_variant	0			-	AF216754	CCDS34449.1	6p21.1	2010-08-05	2007-09-18	2007-09-18	ENSG00000124593	ENSG00000124593			16805	protein-coding gene	gene with protein product		611389	"""chromosome 6 open reading frame 49"""	C6orf49		15702247	Standard	NM_013397		Approved	OEBT, DKFZp761H221	uc011duf.1	Q2TBC4	OTTHUMG00000014685	ENST00000394260.1:c.121-35G>C	6.37:g.41752638G>C			A2A3M0|A6PVU1|B3KQ15|Q5T3D4|Q9NSV1	R	SNP	-	NULL	ENST00000394260.1	37	NULL		6																																																																																			-	PRICKLE4	-	-		0.562	PRICKLE4-007	KNOWN	basic	protein_coding	PRICKLE4	HGNC	protein_coding	OTTHUMT00000303948.1	0	0	0	82	82	66	0.00	0.00	G	NM_013397		41752638	+1	27	12	87	58	tier1	no_errors	ENST00000463606	ensembl	human	putative	74_37	rna	23.68	17.14	SNP	0.000	C	27	87
SOAT1	6646	genome.wustl.edu	37	1	179322767	179322767	+	Nonsense_Mutation	SNP	C	C	A	rs149858295		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:179322767C>A	ENST00000367619.3	+	16	1787	c.1644C>A	c.(1642-1644)taC>taA	p.Y548*	SOAT1_ENST00000539888.1_Nonsense_Mutation_p.Y483*|SOAT1_ENST00000535686.1_Nonsense_Mutation_p.Y284*|SOAT1_ENST00000540564.1_Nonsense_Mutation_p.Y490*	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	548					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	CTTGTCGTTACGTGTTTTAGA	0.433													ENSG00000057252																																					0													247.0	223.0	231.0					1																	179322767		2203	4300	6503	SO:0001587	stop_gained	0			-	L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.1644C>A	1.37:g.179322767C>A	ENSP00000356591:p.Tyr548*		A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Nonsense_Mutation	SNP	pfam_MBOAT_fam	p.Y548*	ENST00000367619.3	37	c.1644	CCDS1330.1	1	.	.	.	.	.	.	.	.	.	.	C	41	8.899765	0.98996	.	.	ENSG00000057252	ENST00000539888;ENST00000540564;ENST00000535686;ENST00000367619	.	.	.	5.65	-3.18	0.05186	.	0.496841	0.20464	N	0.091833	.	.	.	.	.	.	0.27977	N	0.936188	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.335	12.7012	0.57034	0.0:0.2988:0.0:0.7012	.	.	.	.	X	483;490;284;548	.	ENSP00000356591:Y548X	Y	+	3	2	SOAT1	177589390	0.646000	0.27295	0.100000	0.21137	0.992000	0.81027	-0.478000	0.06575	-0.708000	0.05015	0.563000	0.77884	TAC	-	SOAT1	-	NULL		0.433	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOAT1	HGNC	protein_coding	OTTHUMT00000085286.2	0	0	0	57	57	127	0.00	0.00	C	NM_003101		179322767	+1	32	78	49	75	tier1	no_errors	ENST00000367619	ensembl	human	known	74_37	nonsense	39.51	50.98	SNP	0.036	A	32	49
TYR	7299	genome.wustl.edu	37	11	88911582	88911582	+	Missense_Mutation	SNP	G	G	A	rs200471520		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:88911582G>A	ENST00000263321.5	+	1	963	c.461G>A	c.(460-462)gGg>gAg	p.G154E	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	154					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	ATCCCCATAGGGACCTATGGC	0.403													ENSG00000077498	G|||	1	0.000199681	0.0	0.0	5008	,	,		21568	0.001		0.0	False		,,,				2504	0.0																0													155.0	147.0	150.0					11																	88911582		2201	4299	6500	SO:0001583	missense	0			GMAF=0.0005	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.461G>A	11.37:g.88911582G>A	ENSP00000263321:p.Gly154Glu		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.G154E	ENST00000263321.5	37	c.461	CCDS8284.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.44	3.125230	0.56721	.	.	ENSG00000077498	ENST00000263321	D	0.83673	-1.75	5.97	5.97	0.96955	Uncharacterised domain, di-copper centre (2);	0.042698	0.85682	D	0.000000	D	0.86289	0.5897	M	0.76328	2.33	0.58432	D	0.999999	P	0.49358	0.923	P	0.45794	0.493	D	0.85729	0.1330	9	.	.	.	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	154	P14679	TYRO_HUMAN	E	154	ENSP00000263321:G154E	.	G	+	2	0	TYR	88551230	1.000000	0.71417	0.979000	0.43373	0.541000	0.35023	7.396000	0.79891	2.828000	0.97474	0.655000	0.94253	GGG	rs200471520	TYR	-	superfamily_Unchr_di-copper_centre		0.403	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	0	0	0	34	34	147	0.00	0.00	G	NM_000372		88911582	+1	11	23	34	105	tier1	no_errors	ENST00000263321	ensembl	human	known	74_37	missense	24.44	17.97	SNP	1.000	A	11	34
AKAP6	9472	genome.wustl.edu	37	14	33015886	33015886	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr14:33015886C>G	ENST00000280979.4	+	4	2197	c.2027C>G	c.(2026-2028)tCa>tGa	p.S676*	AKAP6_ENST00000557272.1_Nonsense_Mutation_p.S676*|AKAP6_ENST00000557354.1_Nonsense_Mutation_p.S676*	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	676					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GAAATGAATTCAGATTCTGAA	0.428													ENSG00000151320																									Melanoma(49;821 1200 7288 13647 42351)												0													98.0	97.0	97.0					14																	33015886		2203	4300	6503	SO:0001587	stop_gained	0			-	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2027C>G	14.37:g.33015886C>G	ENSP00000280979:p.Ser676*		A7E242|A7E2D4|O15028	Nonsense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.S676*	ENST00000280979.4	37	c.2027	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	39	7.551497	0.98352	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	.	.	.	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-9.2338	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	676	.	ENSP00000280979:S676X	S	+	2	0	AKAP6	32085637	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.149000	0.58091	2.941000	0.99782	0.655000	0.94253	TCA	-	AKAP6	-	NULL		0.428	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	0	0	0	15	15	71	0.00	0.00	C	NM_004274		33015886	+1	6	27	13	45	tier1	no_errors	ENST00000280979	ensembl	human	known	74_37	nonsense	31.58	37.50	SNP	1.000	G	6	13
PCDHGB3	56102	genome.wustl.edu	37	5	140750156	140750156	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:140750156C>A	ENST00000576222.1	+	1	326	c.195C>A	c.(193-195)aaC>aaA	p.N65K	PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTACTAGGAACCTGCGGGTTA	0.547													ENSG00000262209																																					0													116.0	123.0	121.0					5																	140750156		1847	4101	5948	SO:0001583	missense	0			-	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.195C>A	5.37:g.140750156C>A	ENSP00000461862:p.Asn65Lys		A7E229|Q9Y5C7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N65K	ENST00000576222.1	37	c.195	CCDS58980.1	5																																																																																			-	PCDHGB3	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.547	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	0	0	0	22	22	100	0.00	0.00	C	NM_018924		140750156	+1	9	23	29	33	tier1	no_errors	ENST00000576222	ensembl	human	known	74_37	missense	23.68	41.07	SNP	0.691	A	9	29
NBPF1	55672	genome.wustl.edu	37	1	16913618	16913618	+	Missense_Mutation	SNP	T	T	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:16913618T>G	ENST00000430580.2	-	11	1592	c.705A>C	c.(703-705)aaA>aaC	p.K235N		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	235	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TTGAGTTGACTTTGTCTTCCT	0.448													ENSG00000219481																																					0													498.0	430.0	453.0					1																	16913618		2198	4295	6493	SO:0001583	missense	0			-	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.705A>C	1.37:g.16913618T>G	ENSP00000474456:p.Lys235Asn		Q8N4E8|Q9C0H0	Missense_Mutation	SNP	pfam_NBPF_dom	p.K235N	ENST00000430580.2	37	c.705		1																																																																																			-	NBPF1	-	pfam_NBPF_dom		0.448	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	0	0	0	177	177	21	0.00	0.00	T	NM_017940		16913618	-1	55	5	180	14	tier1	no_errors	ENST00000430580	ensembl	human	novel	74_37	missense	23.40	26.32	SNP	0.004	G	55	180
RCAN2	10231	genome.wustl.edu	37	6	46216533	46216533	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr6:46216533G>A	ENST00000330430.6	-	2	376	c.188C>T	c.(187-189)tCt>tTt	p.S63F	RCAN2_ENST00000306764.7_Missense_Mutation_p.S109F|RCAN2_ENST00000371374.1_Missense_Mutation_p.S109F|RCAN2_ENST00000405162.1_Missense_Mutation_p.S109F	NM_005822.3	NP_005813.2	Q14206	RCAN2_HUMAN	regulator of calcineurin 2	63					calcineurin-NFAT signaling cascade (GO:0033173)|locomotion involved in locomotory behavior (GO:0031987)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)		nucleotide binding (GO:0000166)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						TCGGGCTGCAGATTTAGGATT	0.393													ENSG00000172348																																					0													101.0	90.0	93.0					6																	46216533		1837	4105	5942	SO:0001583	missense	0			-	D83407	CCDS43469.1, CCDS59023.1	6p12.3	2008-10-31	2007-06-26	2007-06-26	ENSG00000172348	ENSG00000172348			3041	protein-coding gene	gene with protein product		604876	"""Down syndrome critical region gene 1-like 1"""	DSCR1L1		8662924	Standard	NM_001251973		Approved	ZAKI-4	uc003oyc.2	Q14206	OTTHUMG00000014782	ENST00000330430.6:c.188C>T	6.37:g.46216533G>A	ENSP00000329454:p.Ser63Phe		A6ND07|B3KR46|Q5VWF7|Q5VWF8|Q8N116	Missense_Mutation	SNP	pfam_Calcipressin	p.S109F	ENST00000330430.6	37	c.326	CCDS43469.1	6	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403432	0.62288	.	.	ENSG00000172348	ENST00000330430;ENST00000371374;ENST00000306764;ENST00000405162	.	.	.	5.82	4.95	0.65309	Nucleotide-binding, alpha-beta plait (1);	0.215254	0.40640	N	0.001047	T	0.66416	0.2787	M	0.61703	1.905	0.44359	D	0.997259	P;D	0.54047	0.468;0.964	P;P	0.59546	0.664;0.859	T	0.72327	-0.4327	9	0.87932	D	0	-21.9795	14.1686	0.65493	0.0716:0.0:0.9284:0.0	.	109;63	Q14206-2;Q14206	.;RCAN2_HUMAN	F	63;109;109;109	.	ENSP00000305223:S109F	S	-	2	0	RCAN2	46324492	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	7.568000	0.82369	1.466000	0.48025	-0.150000	0.13652	TCT	-	RCAN2	-	pfam_Calcipressin		0.393	RCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCAN2	HGNC	protein_coding	OTTHUMT00000040782.1	0	0	0	42	42	97	0.00	0.00	G			46216533	-1	42	54	23	12	tier1	no_errors	ENST00000306764	ensembl	human	known	74_37	missense	64.62	81.82	SNP	1.000	A	42	23
SETBP1	26040	genome.wustl.edu	37	18	42530827	42530827	+	Missense_Mutation	SNP	A	A	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:42530827A>G	ENST00000282030.5	+	4	1818	c.1522A>G	c.(1522-1524)Acg>Gcg	p.T508A		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	508						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GACACCTCCAACGTGCACAGA	0.512									Schinzel-Giedion syndrome				ENSG00000152217																																					0													77.0	76.0	76.0					18																	42530827		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	-	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1522A>G	18.37:g.42530827A>G	ENSP00000282030:p.Thr508Ala		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_D-bd_motif	p.T508A	ENST00000282030.5	37	c.1522	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	A	1.283	-0.609690	0.03690	.	.	ENSG00000152217	ENST00000282030	T	0.68181	-0.31	6.08	-2.61	0.06171	.	0.931883	0.09236	N	0.829920	T	0.36276	0.0961	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22661	-1.0210	10	0.09084	T	0.74	.	0.926	0.01324	0.4453:0.1549:0.2194:0.1804	.	508	Q9Y6X0	SETBP_HUMAN	A	508	ENSP00000282030:T508A	ENSP00000282030:T508A	T	+	1	0	SETBP1	40784825	0.000000	0.05858	0.000000	0.03702	0.973000	0.67179	-0.086000	0.11233	-0.080000	0.12685	0.533000	0.62120	ACG	-	SETBP1	-	NULL		0.512	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	0	0	0	38	38	70	0.00	0.00	A	NM_001130110		42530827	+1	10	13	24	45	tier1	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	29.41	22.03	SNP	0.000	G	10	24
MUC4	4585	genome.wustl.edu	37	3	195515857	195515857	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr3:195515857G>A	ENST00000463781.3	-	2	3053	c.2594C>T	c.(2593-2595)tCt>tTt	p.S865F	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S865F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	870	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S865F(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACGATCGAAGACGCCATTCC	0.587													ENSG00000145113																																					1	Substitution - Missense(1)	lung(1)											66.0	70.0	69.0					3																	195515857		2095	4198	6293	SO:0001583	missense	0			-	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2594C>T	3.37:g.195515857G>A	ENSP00000417498:p.Ser865Phe		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S865F	ENST00000463781.3	37	c.2594	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	7.545	0.661571	0.14645	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.48836	0.8;0.82	2.78	2.78	0.32641	.	1.183160	0.06260	N	0.693658	T	0.52125	0.1715	N	0.19112	0.55	0.09310	N	1	D;D	0.89917	0.997;1.0	D;D	0.65987	0.936;0.94	T	0.49790	-0.8902	10	0.56958	D	0.05	-8.1738	9.3672	0.38232	0.0:0.0:1.0:0.0	.	865;870	E7ESK3;Q99102	.;MUC4_HUMAN	F	865;865;839	ENSP00000417498:S865F;ENSP00000420243:S865F	ENSP00000376209:S839F	S	-	2	0	MUC4	197000252	0.000000	0.05858	0.002000	0.10522	0.018000	0.09664	0.188000	0.17018	1.875000	0.54330	0.579000	0.79373	TCT	-	MUC4	-	NULL		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	29	29	88	0.00	0.00	G	NM_018406		195515857	-1	18	24	45	64	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	28.57	27.27	SNP	0.004	A	18	45
ITGAD	3681	genome.wustl.edu	37	16	31409218	31409218	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr16:31409218G>A	ENST00000389202.2	+	5	464	c.415G>A	c.(415-417)Gac>Aac	p.D139N		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	139					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GACAGTCCCCGACGCCACGCC	0.647													ENSG00000156886																																					0													30.0	26.0	27.0					16																	31409218		2197	4300	6497	SO:0001583	missense	0			-	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.415G>A	16.37:g.31409218G>A	ENSP00000373854:p.Asp139Asn		Q15575|Q15576	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.D139N	ENST00000389202.2	37	c.415	CCDS32438.1	16	.	.	.	.	.	.	.	.	.	.	G	7.713	0.695643	0.15106	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.58506	0.33	3.73	2.78	0.32641	.	.	.	.	.	T	0.30103	0.0754	N	0.08118	0	0.09310	N	1	P;P;B	0.44578	0.838;0.458;0.312	B;B;B	0.35353	0.201;0.067;0.067	T	0.08186	-1.0734	9	0.51188	T	0.08	.	5.414	0.16363	0.1145:0.2059:0.6796:0.0	.	139;155;139	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	N	155;139	ENSP00000373854:D139N	ENSP00000373854:D139N	D	+	1	0	ITGAD	31316719	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.139000	0.10358	0.893000	0.36288	0.563000	0.77884	GAC	-	ITGAD	-	NULL		0.647	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	HGNC	protein_coding	OTTHUMT00000432836.1	0	0	0	51	51	33	0.00	0.00	G	NM_005353		31409218	+1	12	8	76	24	tier1	no_errors	ENST00000389202	ensembl	human	known	74_37	missense	13.64	25.00	SNP	0.002	A	12	76
AZGP1	563	genome.wustl.edu	37	7	99569380	99569380	+	Missense_Mutation	SNP	T	T	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr7:99569380T>C	ENST00000292401.4	-	2	462	c.326A>G	c.(325-327)aAc>aGc	p.N109S	AZGP1_ENST00000411734.1_Missense_Mutation_p.N106S	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	109					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GTTACTGTCGTTGTAATACTC	0.527													ENSG00000160862																																					0													156.0	126.0	136.0					7																	99569380		2203	4300	6503	SO:0001583	missense	0			-	BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.326A>G	7.37:g.99569380T>C	ENSP00000292401:p.Asn109Ser		D6W5T8|O60386|Q5XKQ4|Q8N4N0	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.N109S	ENST00000292401.4	37	c.326	CCDS5680.1	7	.	.	.	.	.	.	.	.	.	.	T	10.64	1.406331	0.25378	.	.	ENSG00000160862	ENST00000292401;ENST00000411734	T;T	0.01455	4.87;4.87	1.51	1.51	0.23008	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.820344	0.09870	U	0.745080	T	0.04861	0.0131	M	0.93062	3.375	0.29261	N	0.871304	B	0.23891	0.093	B	0.19666	0.026	T	0.11717	-1.0576	10	0.87932	D	0	.	5.1124	0.14815	0.0:0.0:0.0:1.0	.	109	P25311	ZA2G_HUMAN	S	109;106	ENSP00000292401:N109S;ENSP00000396093:N106S	ENSP00000292401:N109S	N	-	2	0	AZGP1	99407316	0.949000	0.32298	0.733000	0.30861	0.035000	0.12851	1.269000	0.33074	0.933000	0.37291	0.260000	0.18958	AAC	-	AZGP1	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a		0.527	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZGP1	HGNC	protein_coding	OTTHUMT00000059387.4	0	0	0	113	113	62	0.00	0.00	T	NM_001185		99569380	-1	37	7	71	19	tier1	no_errors	ENST00000292401	ensembl	human	known	74_37	missense	33.94	26.92	SNP	0.932	C	37	71
FLNA	2316	genome.wustl.edu	37	X	153588251	153588251	+	Silent	SNP	A	A	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chrX:153588251A>T	ENST00000369850.3	-	23	4064	c.3828T>A	c.(3826-3828)acT>acA	p.T1276T	FLNA_ENST00000360319.4_Silent_p.T1276T|FLNA_ENST00000422373.1_Silent_p.T1276T|FLNA_ENST00000344736.4_Silent_p.T1276T|FLNA_ENST00000369856.3_5'Flank	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1276					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CACTGAACTCAGTGGTGGCCT	0.657													ENSG00000196924																																					0													43.0	45.0	44.0					X																	153588251		2000	4130	6130	SO:0001819	synonymous_variant	0			-	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3828T>A	X.37:g.153588251A>T			E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T1276	ENST00000369850.3	37	c.3828	CCDS48194.1	X																																																																																			-	FL	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.657	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FL	HGNC	protein_coding	OTTHUMT00000058942.3	0	0	0	50	50	12	0.00	0.00	A			153588251	-1	21	7	45	16	tier1	no_errors	ENST00000369850	ensembl	human	known	74_37	silent	31.82	30.43	SNP	0.136	T	21	45
ZSCAN29	146050	genome.wustl.edu	37	15	43656522	43656522	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr15:43656522C>T	ENST00000396976.2	-	4	1415	c.1281G>A	c.(1279-1281)caG>caA	p.Q427Q	ZSCAN29_ENST00000396972.1_Intron|ZSCAN29_ENST00000562072.1_Silent_p.Q426Q|ZSCAN29_ENST00000568898.1_Intron	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	427					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		CTTCATAAAACTGGGTCTCAC	0.493													ENSG00000140265																																					0													89.0	85.0	86.0					15																	43656522		2201	4299	6500	SO:0001819	synonymous_variant	0			-	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.1281G>A	15.37:g.43656522C>T			B3KVB9|Q32M75|Q32M76|Q8NA40	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q427	ENST00000396976.2	37	c.1281	CCDS10095.2	15																																																																																			-	ZSCAN29	-	NULL		0.493	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN29	HGNC	protein_coding	OTTHUMT00000253278.1	0	0	0	78	78	113	0.00	0.00	C	NM_152455		43656522	-1	14	33	79	116	tier1	no_errors	ENST00000396976	ensembl	human	known	74_37	silent	14.89	22.15	SNP	1.000	T	14	79
PFAS	5198	genome.wustl.edu	37	17	8167128	8167128	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:8167128G>A	ENST00000314666.6	+	15	1798	c.1665G>A	c.(1663-1665)tgG>tgA	p.W555*	PFAS_ENST00000545834.1_Nonsense_Mutation_p.W131*|PFAS_ENST00000585319.1_3'UTR	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	555					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TGGAAATCTGGGGGGCTGAGT	0.602													ENSG00000178921																																					0													68.0	69.0	69.0					17																	8167128		2203	4300	6503	SO:0001587	stop_gained	0			-	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.1665G>A	17.37:g.8167128G>A	ENSP00000313490:p.Trp555*		A6H8V8	Nonsense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_PurM_N-like,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth	p.W555*	ENST00000314666.6	37	c.1665	CCDS11136.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.904652	0.98554	.	.	ENSG00000178921	ENST00000545834;ENST00000314666	.	.	.	5.84	5.84	0.93424	.	0.063315	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.304	17.6372	0.88125	0.0:0.0:1.0:0.0	.	.	.	.	X	131;555	.	ENSP00000313490:W555X	W	+	3	0	PFAS	8107853	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.531000	0.90610	2.769000	0.95229	0.563000	0.77884	TGG	-	PFAS	-	pfam_AIR_synth_C_dom,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth		0.602	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	HGNC	protein_coding	OTTHUMT00000226994.2	0	0	0	77	77	60	0.00	0.00	G			8167128	+1	19	22	68	69	tier1	no_errors	ENST00000314666	ensembl	human	known	74_37	nonsense	21.59	24.18	SNP	1.000	A	19	68
FDPS	2224	genome.wustl.edu	37	1	155287648	155287648	+	Intron	SNP	T	T	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:155287648T>G	ENST00000356657.6	+	5	642				RUSC1-AS1_ENST00000543656.1_RNA|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|FDPS_ENST00000368356.4_Intron|FDPS_ENST00000447866.1_Intron	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase						cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	agcaaaaCTATATACAGATAT	0.448													ENSG00000225855																																					0																																										SO:0001627	intron_variant	0			-	J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.481-84T>G	1.37:g.155287648T>G			D3DV91|E9PCI9|Q96G29	R	SNP	-	NULL	ENST00000356657.6	37	NULL	CCDS1110.1	1																																																																																			-	RUSC1-AS1	-	-		0.448	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1-AS1	HGNC	protein_coding	OTTHUMT00000039053.1	0	0	0	24	24	35	0.00	0.00	T	NM_002004		155287648	-1	20	29	37	28	tier1	no_errors	ENST00000446880	ensembl	human	known	74_37	rna	35.09	50.88	SNP	0.092	G	20	37
NCF4	4689	genome.wustl.edu	37	22	37266539	37266539	+	Missense_Mutation	SNP	A	A	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr22:37266539A>T	ENST00000248899.6	+	5	609	c.425A>T	c.(424-426)cAg>cTg	p.Q142L	CTA-833B7.2_ENST00000330602.2_RNA|CTA-833B7.2_ENST00000431290.1_RNA|NCF4_ENST00000397147.4_Missense_Mutation_p.Q142L	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	142					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	GACTCAGAGCAGGTGCCCCAG	0.647													ENSG00000100365																																					0													83.0	75.0	78.0					22																	37266539		2203	4300	6503	SO:0001583	missense	0			-	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.425A>T	22.37:g.37266539A>T	ENSP00000248899:p.Gln142Leu		A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain,prints_NCF_P40,prints_p67phox	p.Q142L	ENST00000248899.6	37	c.425	CCDS13934.1	22	.	.	.	.	.	.	.	.	.	.	a	18.22	3.576541	0.65878	.	.	ENSG00000100365	ENST00000447071;ENST00000248899;ENST00000397147	T;T;T	0.65916	-0.18;1.62;1.62	4.95	4.95	0.65309	Phox homologous domain (2);	0.391386	0.25786	N	0.028317	T	0.63046	0.2478	M	0.69823	2.125	0.47153	D	0.99933	P;P	0.51057	0.941;0.935	P;B	0.47402	0.546;0.348	T	0.61647	-0.7020	10	0.23302	T	0.38	-37.3348	9.2296	0.37428	0.9186:0.0:0.0814:0.0	.	142;142	A8K4F9;Q15080	.;NCF4_HUMAN	L	39;142;142	ENSP00000414958:Q39L;ENSP00000248899:Q142L;ENSP00000380334:Q142L	ENSP00000248899:Q142L	Q	+	2	0	NCF4	35596485	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	6.379000	0.73154	1.850000	0.53721	0.524000	0.50904	CAG	-	NCF4	-	superfamily_Phox,prints_NCF_P40		0.647	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF4	HGNC	protein_coding	OTTHUMT00000318863.1	0	0	0	30	30	30	0.00	0.00	A	NM_000631		37266539	+1	8	8	23	11	tier1	no_errors	ENST00000397147	ensembl	human	known	74_37	missense	25.81	42.11	SNP	1.000	T	8	23
YTHDF3	253943	genome.wustl.edu	37	8	64100288	64100288	+	Silent	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr8:64100288G>A	ENST00000539294.1	+	4	2032	c.1716G>A	c.(1714-1716)gaG>gaA	p.E572E	YTHDF3_ENST00000542911.2_Silent_p.E383E|YTHDF3_ENST00000517371.1_Intron|YTHDF3_ENST00000521674.1_3'UTR	NM_001277817.1|NM_001277818.1|NM_152758.4	NP_001264746.1|NP_001264747.1|NP_689971.4	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	573							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			AAGAAGAGGAGGAAGCCATGC	0.378													ENSG00000185728																																					0													23.0	21.0	21.0					8																	64100288		1834	4073	5907	SO:0001819	synonymous_variant	0			-	BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000539294.1:c.1716G>A	8.37:g.64100288G>A			B3KXL4|Q63Z37|Q659A3	Silent	SNP	pfam_YTH_domain,pfscan_YTH_domain	p.E572	ENST00000539294.1	37	c.1716		8																																																																																			-	YTHDF3	-	NULL		0.378	YTHDF3-201	KNOWN	basic|appris_principal	protein_coding	YTHDF3	HGNC	protein_coding		0	0	0	8	8	117	0.00	0.00	G	NM_152758		64100288	+1	7	26	22	106	tier1	no_errors	ENST00000539294	ensembl	human	known	74_37	silent	24.14	19.70	SNP	1.000	A	7	22
WDR7	23335	genome.wustl.edu	37	18	54605777	54605777	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:54605777C>T	ENST00000254442.3	+	24	4056	c.3845C>T	c.(3844-3846)aCg>aTg	p.T1282M	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.T1249M	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1282					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		CACAGACATACGGCTCTTGCA	0.348													ENSG00000091157																																					0													92.0	85.0	87.0					18																	54605777		2203	4300	6503	SO:0001583	missense	0			-	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.3845C>T	18.37:g.54605777C>T	ENSP00000254442:p.Thr1282Met		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T1282M	ENST00000254442.3	37	c.3845	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	C	14.63	2.591866	0.46214	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.42900	0.96;0.96	5.99	5.99	0.97316	.	0.095167	0.64402	D	0.000001	T	0.46889	0.1416	N	0.24115	0.695	0.42178	D	0.991674	D;D	0.64830	0.994;0.989	P;P	0.53861	0.736;0.548	T	0.45818	-0.9235	10	0.66056	D	0.02	.	20.0728	0.97731	0.0:1.0:0.0:0.0	.	1249;1282	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	M	1282;1249;607;1249	ENSP00000254442:T1282M;ENSP00000350187:T1249M	ENSP00000254442:T1282M	T	+	2	0	WDR7	52756775	1.000000	0.71417	0.270000	0.24601	0.307000	0.27823	5.935000	0.70145	2.840000	0.97914	0.655000	0.94253	ACG	-	WDR7	-	superfamily_ARM-type_fold		0.348	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	0	0	0	33	33	80	0.00	0.00	C			54605777	+1	8	17	25	28	tier1	no_errors	ENST00000254442	ensembl	human	known	74_37	missense	24.24	37.78	SNP	0.951	T	8	25
ZNF610	162963	genome.wustl.edu	37	19	52869687	52869687	+	Silent	SNP	C	C	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr19:52869687C>G	ENST00000403906.3	+	6	1512	c.1056C>G	c.(1054-1056)gtC>gtG	p.V352V	ZNF610_ENST00000327920.8_Silent_p.V352V|ZNF610_ENST00000601151.1_Silent_p.V309V|ZNF610_ENST00000321287.8_Silent_p.V352V	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GTGGCAAGGTCTTTAGTCTGC	0.418													ENSG00000167554																																					0													89.0	90.0	90.0					19																	52869687		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.1056C>G	19.37:g.52869687C>G			A8K4C3|Q86YH8|Q8NDS9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V352	ENST00000403906.3	37	c.1056	CCDS12851.1	19																																																																																			-	ZNF610	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	HGNC	protein_coding	OTTHUMT00000462880.1	0	0	0	22	22	76	0.00	0.00	C	NM_173530		52869687	+1	8	15	28	53	tier1	no_errors	ENST00000321287	ensembl	human	known	74_37	silent	22.22	22.06	SNP	0.015	G	8	28
MIEF1	54471	genome.wustl.edu	37	22	39909888	39909888	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr22:39909888C>T	ENST00000325301.2	+	6	1376	c.952C>T	c.(952-954)Ctc>Ttc	p.L318F	MIEF1_ENST00000404569.1_Missense_Mutation_p.L318F|MIEF1_ENST00000402881.1_Missense_Mutation_p.L318F	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	318					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)										ATCAGTGACCCTCGGTGACAC	0.622											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000100335																																					0													85.0	78.0	81.0					22																	39909888		2203	4300	6503	SO:0001583	missense	0			-	AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.952C>T	22.37:g.39909888C>T	ENSP00000327124:p.Leu318Phe	889	Q7L890|Q9BUI3	Missense_Mutation	SNP	NULL	p.L318F	ENST00000325301.2	37	c.952	CCDS13995.1	22	.	.	.	.	.	.	.	.	.	.	C	12.93	2.085790	0.36758	.	.	ENSG00000100335	ENST00000402881;ENST00000325301;ENST00000404569	T;T;T	0.09445	2.98;2.98;2.98	6.07	5.04	0.67666	.	0.048280	0.85682	D	0.000000	T	0.15522	0.0374	L	0.40543	1.245	0.48452	D	0.999659	P;D	0.58268	0.78;0.982	B;P	0.57620	0.329;0.824	T	0.02950	-1.1090	10	0.09084	T	0.74	-14.4569	11.2099	0.48793	0.1265:0.8072:0.0:0.0663	.	318;318	Q9NQG6;B0QY95	MID51_HUMAN;.	F	318	ENSP00000385110:L318F;ENSP00000327124:L318F;ENSP00000385191:L318F	ENSP00000327124:L318F	L	+	1	0	SMCR7L	38239834	0.992000	0.36948	1.000000	0.80357	0.990000	0.78478	2.742000	0.47434	2.884000	0.98904	0.655000	0.94253	CTC	-	MIEF1	-	NULL		0.622	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEF1	HGNC	protein_coding	OTTHUMT00000321325.1	0	0	0	59	59	68	0.00	0.00	C	NM_019008		39909888	+1	15	22	47	37	tier1	no_errors	ENST00000325301	ensembl	human	known	74_37	missense	24.19	37.29	SNP	1.000	T	15	47
IQCA1	79781	genome.wustl.edu	37	2	237374267	237374267	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:237374267C>A	ENST00000409907.3	-	6	1081	c.807G>T	c.(805-807)aaG>aaT	p.K269N	IQCA1_ENST00000431676.2_Missense_Mutation_p.K269N|IQCA1_ENST00000309507.5_Missense_Mutation_p.K265N	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	269							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						CCTCTTCATGCTTTATCTGCA	0.463													ENSG00000132321																																					0													160.0	147.0	151.0					2																	237374267		1963	4147	6110	SO:0001583	missense	0			-	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.807G>T	2.37:g.237374267C>A	ENSP00000387347:p.Lys269Asn		B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.K269N	ENST00000409907.3	37	c.807	CCDS46549.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.74|12.74	2.027292|2.027292	0.35797|0.35797	.|.	.|.	ENSG00000132321|ENSG00000132321	ENST00000418802|ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437	.|D;D;D	.|0.94330	.|-3.28;-3.28;-3.4	5.37|5.37	3.54|3.54	0.40534|0.40534	.|.	.|0.583249	.|0.16413	.|N	.|0.215498	D|D	0.90518|0.90518	0.7029|0.7029	L|L	0.54323|0.54323	1.7|1.7	0.27653|0.27653	N|N	0.947319|0.947319	.|B;B;B	.|0.30326	.|0.036;0.276;0.061	.|B;B;B	.|0.35278	.|0.011;0.199;0.017	D|D	0.84641|0.84641	0.0695|0.0695	5|10	.|0.48119	.|T	.|0.1	.|.	7.1246|7.1246	0.25465|0.25465	0.0:0.656:0.0:0.344|0.0:0.656:0.0:0.344	.|.	.|269;276;269	.|E7EWQ0;E9PH78;Q86XH1	.|.;.;IQCA1_HUMAN	S|N	288|269;276;265;269;265	.|ENSP00000387347:K269N;ENSP00000311951:K265N;ENSP00000407213:K269N	.|ENSP00000254653:K269N	A|K	-|-	1|3	0|2	IQCA1|IQCA1	237039006|237039006	0.874000|0.874000	0.30092|0.30092	0.347000|0.347000	0.25668|0.25668	0.037000|0.037000	0.13140|0.13140	0.926000|0.926000	0.28804|0.28804	1.236000|1.236000	0.43740|0.43740	0.563000|0.563000	0.77884|0.77884	GCA|AAG	-	IQCA1	-	NULL		0.463	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	HGNC	protein_coding	OTTHUMT00000329266.1	0	0	0	42	42	97	0.00	0.00	C	NM_024726		237374267	-1	19	24	53	74	tier1	no_errors	ENST00000409907	ensembl	human	known	74_37	missense	26.39	24.49	SNP	0.787	A	19	53
ZNF519	162655	genome.wustl.edu	37	18	14132371	14132371	+	5'UTR	SNP	T	T	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:14132371T>A	ENST00000590202.1	-	0	58				ZNF519_ENST00000589203.1_5'UTR|ZNF519_ENST00000589498.1_5'UTR	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519						negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						ATCACCGAAGTCTCCCGGAGC	0.577													ENSG00000175322																																					0													30.0	28.0	29.0					18																	14132371		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			-	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.-95A>T	18.37:g.14132371T>A				R	SNP	-	NULL	ENST00000590202.1	37	NULL	CCDS32797.1	18																																																																																			-	ZNF519	-	-		0.577	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1	0	0	0	50	50	43	0.00	0.00	T	NM_145287		14132371	-1	19	13	40	52	tier1	no_errors	ENST00000586507	ensembl	human	known	74_37	rna	32.20	20.00	SNP	0.003	A	19	40
CSMD1	64478	genome.wustl.edu	37	8	3266956	3266956	+	Missense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr8:3266956G>T	ENST00000520002.1	-	14	2291	c.1736C>A	c.(1735-1737)cCc>cAc	p.P579H	CSMD1_ENST00000539096.1_Missense_Mutation_p.P578H|CSMD1_ENST00000602723.1_Missense_Mutation_p.P579H|CSMD1_ENST00000400186.3_Missense_Mutation_p.P579H|CSMD1_ENST00000542608.1_Missense_Mutation_p.P578H|CSMD1_ENST00000602557.1_Missense_Mutation_p.P579H|CSMD1_ENST00000537824.1_Missense_Mutation_p.P578H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	579	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TACACAGCTGGGCTTGTTGCC	0.522													ENSG00000183117																																					0													49.0	50.0	50.0					8																	3266956		1974	4167	6141	SO:0001583	missense	0			-			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1736C>A	8.37:g.3266956G>T	ENSP00000430733:p.Pro579His		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P579H	ENST00000520002.1	37	c.1736		8	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765743	0.90020	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000001	D	0.93245	0.7848	H	0.98388	4.22	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.95870	0.8890	10	0.87932	D	0	.	18.8659	0.92292	0.0:0.0:1.0:0.0	.	579	E5RIG2	.	H	579;579;441;578;578;578	ENSP00000383047:P579H;ENSP00000430733:P579H;ENSP00000441462:P578H;ENSP00000446243:P578H;ENSP00000441675:P578H	ENSP00000320445:P441H	P	-	2	0	CSMD1	3254363	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.549000	0.98106	2.443000	0.82685	0.573000	0.79308	CCC	-	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.522	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	0	0	0	53	53	79	0.00	0.00	G	NM_033225		3266956	-1	13	16	41	48	tier1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	24.07	24.62	SNP	1.000	T	13	41
ZNF644	84146	genome.wustl.edu	37	1	91404037	91404037	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:91404037C>A	ENST00000370440.1	-	3	3091	c.2874G>T	c.(2872-2874)ttG>ttT	p.L958F	ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.L958F|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	958					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCTCAAGAGACAAATCAGTCC	0.398													ENSG00000122482																																					0													74.0	66.0	69.0					1																	91404037		2203	4299	6502	SO:0001583	missense	0			-	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.2874G>T	1.37:g.91404037C>A	ENSP00000359469:p.Leu958Phe		A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L958F	ENST00000370440.1	37	c.2874	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729856	0.48833	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000536941	T;T	0.00856	5.61;5.61	5.84	4.92	0.64577	.	0.000000	0.64402	D	0.000001	T	0.01489	0.0048	L	0.34521	1.04	0.49915	D	0.99983	D	0.89917	1.0	D	0.80764	0.994	T	0.69165	-0.5217	10	0.66056	D	0.02	-4.2518	12.5795	0.56383	0.0:0.8695:0.0:0.1305	.	958	Q9H582	ZN644_HUMAN	F	958;958;530	ENSP00000359469:L958F;ENSP00000337008:L958F	ENSP00000337008:L958F	L	-	3	2	ZNF644	91176625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.336000	0.33850	2.779000	0.95612	0.591000	0.81541	TTG	-	ZNF644	-	NULL		0.398	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	0	0	0	28	28	83	0.00	0.00	C	NM_032186		91404037	-1	6	9	23	79	tier1	no_errors	ENST00000337393	ensembl	human	known	74_37	missense	20.69	10.23	SNP	1.000	A	6	23
CDK13	8621	genome.wustl.edu	37	7	40134028	40134028	+	Missense_Mutation	SNP	G	G	A	rs527978475		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr7:40134028G>A	ENST00000181839.4	+	14	4593	c.3988G>A	c.(3988-3990)Gtg>Atg	p.V1330M	CDK13_ENST00000340829.5_Missense_Mutation_p.V1270M	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1330					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						AGACACTTACGTGTCCACTTC	0.493													ENSG00000065883																																					0													171.0	165.0	167.0					7																	40134028		2203	4300	6503	SO:0001583	missense	0			-	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.3988G>A	7.37:g.40134028G>A	ENSP00000181839:p.Val1330Met		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V1330M	ENST00000181839.4	37	c.3988	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	G	6.937	0.542561	0.13250	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.70164	-0.44;-0.46	5.54	4.66	0.58398	.	.	.	.	.	T	0.52191	0.1719	L	0.36672	1.1	0.09310	N	1	B;B	0.24675	0.109;0.066	B;B	0.14578	0.011;0.005	T	0.37384	-0.9708	8	.	.	.	-1.7932	7.4497	0.27231	0.1457:0.1372:0.717:0.0	.	1270;1330	Q14004-2;Q14004	.;CDK13_HUMAN	M	1330;1270	ENSP00000181839:V1330M;ENSP00000340557:V1270M	.	V	+	1	0	CDK13	40100553	0.791000	0.28800	0.284000	0.24805	0.873000	0.50193	3.291000	0.51764	1.342000	0.45619	0.655000	0.94253	GTG	-	CDK13	-	NULL		0.493	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2	0	0	0	52	52	90	0.00	0.00	G	NM_003718		40134028	+1	8	14	36	61	tier1	no_errors	ENST00000181839	ensembl	human	known	74_37	missense	18.18	18.67	SNP	0.109	A	8	36
COL6A5	256076	genome.wustl.edu	37	3	130187932	130187932	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr3:130187932G>A	ENST00000432398.2	+	38	7578	c.7084G>A	c.(7084-7086)Gtt>Att	p.V2362I	COL6A5_ENST00000265379.6_Missense_Mutation_p.V2362I	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2362	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						ATTTGATTTGGTTACTTATAA	0.443													ENSG00000172752																																					0													77.0	72.0	73.0					3																	130187932		1961	4135	6096	SO:0001583	missense	0			-	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.7084G>A	3.37:g.130187932G>A	ENSP00000390895:p.Val2362Ile		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.V2362I	ENST00000432398.2	37	c.7084		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.083|2.083	-0.410308|-0.410308	0.04799|0.04799	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000512836|ENST00000432398;ENST00000265379;ENST00000373157;ENST00000512482	.|T;T;T;T	.|0.13538	.|2.58;2.58;2.58;2.58	5.35|5.35	-6.19|-6.19	0.02078|0.02078	.|von Willebrand factor, type A (3);	.|0.804236	.|0.10560	.|N	.|0.660409	T|T	0.06826|0.06826	0.0174|0.0174	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B;B	.|0.17038	.|0.02;0.007	.|B;B	.|0.20384	.|0.029;0.011	T|T	0.39143|0.39143	-0.9628|-0.9628	5|10	.|0.20519	.|T	.|0.43	.|.	7.2781|7.2781	0.26296|0.26296	0.3315:0.4103:0.2582:0.0|0.3315:0.4103:0.2582:0.0	.|.	.|2362;2362	.|A8TX70;A8TX70-2	.|CO6A5_HUMAN;.	D|I	613|2362;2362;305;197	.|ENSP00000390895:V2362I;ENSP00000265379:V2362I;ENSP00000362250:V305I;ENSP00000424968:V197I	.|ENSP00000265379:V2362I	G|V	+|+	2|1	0|0	COL6A5|COL6A5	131670622|131670622	0.000000|0.000000	0.05858|0.05858	0.027000|0.027000	0.17364|0.17364	0.158000|0.158000	0.22134|0.22134	-0.591000|-0.591000	0.05753|0.05753	-1.479000|-1.479000	0.01867|0.01867	-0.175000|-0.175000	0.13238|0.13238	GGT|GTT	-	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.443	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		0	0	0	33	33	104	0.00	0.00	G	NM_153264		130187932	+1	19	31	17	44	tier1	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	52.78	41.33	SNP	0.059	A	19	17
C1QTNF9	338872	genome.wustl.edu	37	13	24889933	24889933	+	Intron	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr13:24889933C>T	ENST00000382071.2	+	2	63				RP11-307N16.6_ENST00000382141.4_Intron|C1QTNF9_ENST00000332018.4_Intron|C1QTNF9-AS1_ENST00000449656.1_RNA			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9							collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GTGTTACCTTCCAAGGACAGT	0.478													ENSG00000240868																																					0																																										SO:0001627	intron_variant	0			-	BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.-22-187C>T	13.37:g.24889933C>T			A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	R	SNP	-	NULL	ENST00000382071.2	37	NULL	CCDS9306.1	13																																																																																			-	C1QTNF9-AS1	-	-		0.478	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF9-AS1	HGNC	protein_coding	OTTHUMT00000044177.1	0	0	0	11	11	44	0.00	0.00	C	NM_178540		24889933	-1	5	33	5	29	tier1	no_errors	ENST00000449656	ensembl	human	known	74_37	rna	50.00	53.23	SNP	0.000	T	5	5
FAR2P1	440905	genome.wustl.edu	37	2	130807609	130807609	+	RNA	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:130807609G>T	ENST00000325390.3	-	0	1095					NR_026758.1																						CCGGGGAGGGGTAGGTACCAA	0.532													ENSG00000180178																																					0																																												0			-																													2.37:g.130807609G>T				R	SNP	-	NULL	ENST00000325390.3	37	NULL		2																																																																																			-	AC018865.8	-	-		0.532	AC018865.8-002	KNOWN	basic	processed_transcript	LOC440905	Clone_based_vega_gene	pseudogene	OTTHUMT00000331630.3	0	0	0	67	67	60	0.00	0.00	G			130807609	-1	14	8	47	27	tier1	no_errors	ENST00000325390	ensembl	human	known	74_37	rna	22.95	22.86	SNP	0.026	T	14	47
OR5AP2	338675	genome.wustl.edu	37	11	56409671	56409671	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:56409671G>A	ENST00000302981.1	-	1	244	c.245C>T	c.(244-246)tCc>tTc	p.S82F	OR5AP2_ENST00000544374.1_Missense_Mutation_p.S83F	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						GGGAGTGACGGAAGAAGAGTA	0.458													ENSG00000172464																																					0													61.0	62.0	62.0					11																	56409671		2201	4296	6497	SO:0001583	missense	0			-	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.245C>T	11.37:g.56409671G>A	ENSP00000303111:p.Ser82Phe		B2RNM8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S83F	ENST00000302981.1	37	c.248	CCDS31534.1	11	.	.	.	.	.	.	.	.	.	.	G	14.44	2.536290	0.45176	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.00428	7.44;7.44	4.97	4.06	0.47325	GPCR, rhodopsin-like superfamily (1);	0.292311	0.24942	N	0.034365	T	0.00412	0.0013	L	0.54908	1.71	0.09310	N	1	P	0.47604	0.898	P	0.44477	0.451	T	0.52087	-0.8622	10	0.87932	D	0	.	7.9236	0.29861	0.2475:0.0:0.7525:0.0	.	82	Q8NGF4	O5AP2_HUMAN	F	83;82	ENSP00000442701:S83F;ENSP00000303111:S82F	ENSP00000303111:S82F	S	-	2	0	OR5AP2	56166247	0.000000	0.05858	0.998000	0.56505	0.994000	0.84299	0.291000	0.18994	1.320000	0.45209	0.637000	0.83480	TCC	-	OR5AP2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.458	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OR5AP2	HGNC	protein_coding	OTTHUMT00000391613.1	0	0	0	28	28	66	0.00	0.00	G	NM_001002925		56409671	-1	8	16	15	33	tier1	no_errors	ENST00000544374	ensembl	human	known	74_37	missense	34.78	32.65	SNP	0.002	A	8	15
NADSYN1	55191	genome.wustl.edu	37	11	71164372	71164372	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:71164372C>T	ENST00000319023.2	+	1	218	c.30C>T	c.(28-30)tgC>tgT	p.C10C	RP11-660L16.2_ENST00000529369.1_RNA	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	10	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	TGGCCACCTGCGCACTCAACC	0.667													ENSG00000172890																									Ovarian(79;763 1781 6490 50276)												0													38.0	37.0	38.0					11																	71164372		2200	4293	6493	SO:0001819	synonymous_variant	0			-	AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.30C>T	11.37:g.71164372C>T			B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Silent	SNP	pfam_C-N_Hydrolase,pfam_D/GMP_synthase,superfamily_C-N_Hydrolase,pirsf_Gln-dep_D_synthase,pfscan_C-N_Hydrolase,tigrfam_D_synthase	p.C10	ENST00000319023.2	37	c.30	CCDS8201.1	11																																																																																			-	DSYN1	-	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Gln-dep_D_synthase,pfscan_C-N_Hydrolase		0.667	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSYN1	HGNC	protein_coding	OTTHUMT00000394356.1	0	0	0	63	63	39	0.00	0.00	C	NM_018161		71164372	+1	34	17	80	16	tier1	no_errors	ENST00000319023	ensembl	human	known	74_37	silent	29.57	51.52	SNP	1.000	T	34	80
FCRL1	115350	genome.wustl.edu	37	1	157771769	157771769	+	Silent	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:157771769G>A	ENST00000368176.3	-	5	889	c.822C>T	c.(820-822)taC>taT	p.Y274Y	FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000358292.3_Silent_p.Y274Y|FCRL1_ENST00000491942.1_Silent_p.Y274Y	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	274	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCTCACAGGAGTAGTTTCCAG	0.552													ENSG00000163534																									GBM(54;482 1003 11223 30131 35730)												0													78.0	82.0	81.0					1																	157771769		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.822C>T	1.37:g.157771769G>A			B2RE05|Q8N759|Q8NDI0|Q96PJ6	Silent	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Y274	ENST00000368176.3	37	c.822	CCDS1170.1	1																																																																																			-	FCRL1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.552	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	HGNC	protein_coding	OTTHUMT00000051401.1	0	0	0	34	34	68	0.00	0.00	G	NM_052938		157771769	-1	11	24	32	52	tier1	no_errors	ENST00000368176	ensembl	human	known	74_37	silent	25.58	31.58	SNP	0.626	A	11	32
POMGNT2	84892	genome.wustl.edu	37	3	43121738	43121738	+	Missense_Mutation	SNP	T	T	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr3:43121738T>C	ENST00000344697.2	-	2	1531	c.1186A>G	c.(1186-1188)Atg>Gtg	p.M396V	POMGNT2_ENST00000441964.1_Missense_Mutation_p.M396V	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	396					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										TCTGGCATCATGTTCCGCCAG	0.592													ENSG00000144647																																					0													80.0	70.0	74.0					3																	43121738		2203	4300	6503	SO:0001583	missense	0			-	AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.1186A>G	3.37:g.43121738T>C	ENSP00000344125:p.Met396Val		B3KWC3|Q96SY3	Missense_Mutation	SNP	pfam_Glycosyltransferase_AER61,superfamily_Fibronectin_type3	p.M396V	ENST00000344697.2	37	c.1186	CCDS2709.1	3	.	.	.	.	.	.	.	.	.	.	T	9.764	1.170750	0.21621	.	.	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.75589	-0.95;-0.95	5.53	3.09	0.35607	.	0.210813	0.49305	D	0.000160	T	0.53367	0.1792	N	0.14661	0.345	0.25675	N	0.985851	B	0.02656	0.0	B	0.01281	0.0	T	0.38045	-0.9679	10	0.31617	T	0.26	-22.0436	7.6273	0.28220	0.0:0.0733:0.1412:0.7855	.	396	Q8NAT1	AGO61_HUMAN	V	396	ENSP00000408992:M396V;ENSP00000344125:M396V	ENSP00000344125:M396V	M	-	1	0	C3orf39	43096742	0.973000	0.33851	0.612000	0.29024	0.956000	0.61745	1.441000	0.35035	0.379000	0.24794	0.529000	0.55759	ATG	-	POMGNT2	-	NULL		0.592	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT2	HGNC	protein_coding	OTTHUMT00000256643.1	0	0	0	35	35	57	0.00	0.00	T	NM_032806		43121738	-1	16	17	26	46	tier1	no_errors	ENST00000344697	ensembl	human	known	74_37	missense	38.10	26.98	SNP	0.983	C	16	26
GPR98	84059	genome.wustl.edu	37	5	90052854	90052854	+	Missense_Mutation	SNP	T	T	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:90052854T>A	ENST00000405460.2	+	57	11912	c.11816T>A	c.(11815-11817)gTt>gAt	p.V3939D		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3939	Calx-beta 26. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTTCTTCAAGTTCCTGTAGTC	0.453													ENSG00000164199																																					0													96.0	94.0	94.0					5																	90052854		1853	4093	5946	SO:0001583	missense	0			-	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11816T>A	5.37:g.90052854T>A	ENSP00000384582:p.Val3939Asp		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.V3939D	ENST00000405460.2	37	c.11816	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.350101|4.350101	0.82132|0.82132	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000509621|ENST00000405460;ENST00000296619	.|T	.|0.32753	.|1.44	5.3|5.3	5.3|5.3	0.74995|0.74995	.|Na-Ca exchanger/integrin-beta4 (2);	.|0.391921	.|0.28760	.|N	.|0.014240	T|T	0.50343|0.50343	0.1610|0.1610	M|M	0.76938|0.76938	2.355|2.355	0.80722|0.80722	D|D	1|1	.|D;P	.|0.56521	.|0.976;0.921	.|P;P	.|0.54312	.|0.748;0.478	T|T	0.57551|0.57551	-0.7792|-0.7792	5|10	.|0.87932	.|D	.|0	.|.	15.5333|15.5333	0.75980|0.75980	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|3939;3939	.|E7ETI5;Q8WXG9	.|.;GPR98_HUMAN	I|D	1505|3939	.|ENSP00000384582:V3939D	.|ENSP00000296619:V3939D	F|V	+|+	1|2	0|0	GPR98|GPR98	90088610|90088610	0.991000|0.991000	0.36638|0.36638	0.285000|0.285000	0.24819|0.24819	0.872000|0.872000	0.50106|0.50106	7.073000|7.073000	0.76784|0.76784	2.129000|2.129000	0.65627|0.65627	0.383000|0.383000	0.25322|0.25322	TTC|GTT	-	GPR98	-	pfam_Calx_beta,smart_Calx_beta		0.453	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	0	0	0	34	34	85	0.00	0.00	T	NM_032119		90052854	+1	34	47	16	24	tier1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	68.00	65.28	SNP	0.763	A	34	16
CD22	933	genome.wustl.edu	37	19	35832259	35832259	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr19:35832259C>T	ENST00000085219.5	+	8	1587	c.1521C>T	c.(1519-1521)gaC>gaT	p.D507D	CD22_ENST00000544992.2_Silent_p.D507D|CD22_ENST00000270311.6_Silent_p.D387D|CD22_ENST00000341773.6_Silent_p.D330D|CD22_ENST00000536635.2_Silent_p.D419D|CD22_ENST00000419549.2_Silent_p.D335D|CD22_ENST00000594250.1_Silent_p.D330D	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	507	Ig-like C2-type 5.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCCCCCGAGACGTGAGGGTCC	0.607													ENSG00000012124																									Ovarian(42;1009 1133 23674 26041)												0													28.0	28.0	28.0					19																	35832259		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1521C>T	19.37:g.35832259C>T			F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D507	ENST00000085219.5	37	c.1521	CCDS12457.1	19																																																																																			-	CD22	-	pfscan_Ig-like_dom		0.607	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1	0	0	0	35	35	46	0.00	0.00	C	NM_001771		35832259	+1	13	18	27	42	tier1	no_errors	ENST00000085219	ensembl	human	known	74_37	silent	32.50	30.00	SNP	0.000	T	13	27
CACNA2D4	93589	genome.wustl.edu	37	12	1988202	1988202	+	Splice_Site	SNP	G	G	A	rs572396211		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr12:1988202G>A	ENST00000382722.5	-	15	1926	c.1564C>T	c.(1564-1566)Cga>Tga	p.R522*	CACNA2D4_ENST00000587995.1_Splice_Site_p.R522*|CACNA2D4_ENST00000588077.1_Splice_Site_p.R458*|CACNA2D4_ENST00000585732.1_Splice_Site_p.R407*|CACNA2D4_ENST00000586184.1_Splice_Site_p.R522*|CACNA2D4_ENST00000585708.1_Splice_Site_p.R458*	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	522	Cache.				calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CCATGGGATCGCTGGAAGGAA	0.607													ENSG00000151062																									Colon(2;101 179 21030 23310 28141)												0													39.0	44.0	42.0					12																	1988202		2000	4163	6163	SO:0001630	splice_region_variant	0			-	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.1564-1C>T	12.37:g.1988202G>A			Q7Z3S8|Q86XZ5|Q8IZS9	Nonsense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R522*	ENST00000382722.5	37	c.1564	CCDS44785.1	12	.	.	.	.	.	.	.	.	.	.	G	39	7.749322	0.98468	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	.	.	.	5.23	-2.27	0.06846	.	0.061153	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4151	0.87497	0.0:0.0:0.3435:0.6565	.	.	.	.	X	458;522;522	.	ENSP00000280663:R522X	R	-	1	2	CACNA2D4	1858463	0.745000	0.28261	0.860000	0.33809	0.946000	0.59487	-0.171000	0.09883	-0.256000	0.09473	0.655000	0.94253	CGA	-	CAC2D4	-	pfam_Cache_domain		0.607	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CAC2D4	HGNC	protein_coding	OTTHUMT00000398230.2	0	0	0	20	20	71	0.00	0.00	G		Nonsense_Mutation	1988202	-1	7	38	22	49	tier1	no_errors	ENST00000382722	ensembl	human	known	74_37	nonsense	24.14	43.68	SNP	0.793	A	7	22
OTUB1	55611	genome.wustl.edu	37	11	63764938	63764938	+	Missense_Mutation	SNP	C	C	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:63764938C>G	ENST00000538426.1	+	7	780	c.736C>G	c.(736-738)Ccg>Gcg	p.P246A	OTUB1_ENST00000428192.2_Missense_Mutation_p.P246A|OTUB1_ENST00000541478.1_Missense_Mutation_p.P145A|OTUB1_ENST00000543004.1_Missense_Mutation_p.P255A|OTUB1_ENST00000535715.1_Intron|OTUB1_ENST00000543988.1_Missense_Mutation_p.P216A|OTUB1_ENST00000422031.2_Missense_Mutation_p.P283A	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1	246	Free ubiquitin binding.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						CACCACCAATCCGCACATCTT	0.622													ENSG00000167770																																					0													117.0	110.0	113.0					11																	63764938		2201	4297	6498	SO:0001583	missense	0			-	AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.736C>G	11.37:g.63764938C>G	ENSP00000444357:p.Pro246Ala		Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Missense_Mutation	SNP	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU	p.P283A	ENST00000538426.1	37	c.847	CCDS8055.1	11	.	.	.	.	.	.	.	.	.	.	C	1.247	-0.619652	0.03663	.	.	ENSG00000167770	ENST00000541478;ENST00000428192;ENST00000422031;ENST00000538426;ENST00000543004;ENST00000543988	T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05	5.43	4.52	0.55395	Ovarian tumour, otubain (1);	0.241003	0.41396	D	0.000892	T	0.14485	0.0350	N	0.01482	-0.84	0.30660	N	0.754537	B;B;B;B	0.11235	0.0;0.0;0.004;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.17048	-1.0382	10	0.10636	T	0.68	.	8.4158	0.32670	0.1537:0.7664:0.0:0.0799	.	283;145;290;246	B4DPD5;F5H3F0;Q96FW1-2;Q96FW1	.;.;.;OTUB1_HUMAN	A	145;246;283;246;255;216	ENSP00000439142:P145A;ENSP00000402551:P246A;ENSP00000416973:P283A;ENSP00000444357:P246A;ENSP00000437453:P255A;ENSP00000441328:P216A	ENSP00000416973:P283A	P	+	1	0	OTUB1	63521514	1.000000	0.71417	0.716000	0.30569	0.047000	0.14425	3.621000	0.54210	1.426000	0.47256	0.655000	0.94253	CCG	-	OTUB1	-	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU		0.622	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUB1	HGNC	protein_coding	OTTHUMT00000396277.1	0	0	0	46	46	53	0.00	0.00	C	NM_017670		63764938	+1	12	15	33	41	tier1	no_errors	ENST00000422031	ensembl	human	known	74_37	missense	26.67	26.79	SNP	1.000	G	12	33
YARS2	51067	genome.wustl.edu	37	12	32908155	32908155	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr12:32908155C>A	ENST00000324868.8	-	1	681	c.654G>T	c.(652-654)gaG>gaT	p.E218D		NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	218					gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	GGTAAAAGAACTCGGCCAAGC	0.602											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000139131																																					0													74.0	81.0	79.0					12																	32908155		2203	4300	6503	SO:0001583	missense	0			-	AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.654G>T	12.37:g.32908155C>A	ENSP00000320658:p.Glu218Asp	836	D3DUW8|Q9H817	Missense_Mutation	SNP	pfam_aa-tR-synth_Ic,prints_Tyr-tR-ligase,tigrfam_Tyr-tR-ligase	p.E218D	ENST00000324868.8	37	c.654	CCDS31770.1	12	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069589	0.76301	.	.	ENSG00000139131	ENST00000324868	T	0.56941	0.43	5.09	3.24	0.37175	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.165303	0.53938	D	0.000045	T	0.74589	0.3736	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.76788	-0.2830	10	0.87932	D	0	-1.3071	9.2659	0.37641	0.0:0.7584:0.0:0.2416	.	218	Q9Y2Z4	SYYM_HUMAN	D	218	ENSP00000320658:E218D	ENSP00000320658:E218D	E	-	3	2	YARS2	32799422	1.000000	0.71417	0.981000	0.43875	0.938000	0.57974	1.709000	0.37909	0.687000	0.31509	-0.212000	0.12691	GAG	-	YARS2	-	pfam_aa-tR-synth_Ic,prints_Tyr-tR-ligase,tigrfam_Tyr-tR-ligase		0.602	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS2	HGNC	protein_coding	OTTHUMT00000404153.1	0	0	0	51	51	49	0.00	0.00	C	NM_015936		32908155	-1	12	14	43	51	tier1	no_errors	ENST00000324868	ensembl	human	known	74_37	missense	21.82	21.21	SNP	1.000	A	12	43
OR4D5	219875	genome.wustl.edu	37	11	123810923	123810923	+	Silent	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:123810923G>A	ENST00000307033.2	+	1	674	c.600G>A	c.(598-600)gtG>gtA	p.V200V		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTTTAATGGTGTCTAACAATG	0.502													ENSG00000171014																																					0													251.0	238.0	242.0					11																	123810923		2202	4299	6501	SO:0001819	synonymous_variant	0			-	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.600G>A	11.37:g.123810923G>A			B9EGZ4|Q6IFE6	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V200	ENST00000307033.2	37	c.600	CCDS31699.1	11																																																																																			-	OR4D5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.502	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D5	HGNC	protein_coding	OTTHUMT00000387263.1	0	0	0	54	54	131	0.00	0.00	G	NM_001001965		123810923	+1	12	25	32	100	tier1	no_errors	ENST00000307033	ensembl	human	known	74_37	silent	27.27	20.00	SNP	0.346	A	12	32
SLMO1	10650	genome.wustl.edu	37	18	12427223	12427223	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:12427223C>T	ENST00000440960.1	+	5	446	c.366C>T	c.(364-366)acC>acT	p.T122T	SLMO1_ENST00000592149.1_Silent_p.T101T|SLMO1_ENST00000590956.1_Silent_p.T32T|SLMO1_ENST00000336990.4_Silent_p.T122T|SLMO1_ENST00000587735.1_Silent_p.T32T	NM_001142405.1	NP_001135877.1	Q96N28	SLMO1_HUMAN	slowmo homolog 1 (Drosophila)	122	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)	1						TTTGCAGGACCGTGCTCACAC	0.498													ENSG00000141391																																					0													121.0	106.0	111.0					18																	12427223		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK056046	CCDS11860.1	18p11.21	2007-02-20	2007-02-06	2007-02-06	ENSG00000141391	ENSG00000141391			24639	protein-coding gene	gene with protein product	"""erythroid differentiation and denucleation factor 1"""		"""chromosome 18 open reading frame 43"""	C18orf43			Standard	NM_006553		Approved	HFL-EDDG1, FLJ31484, PRELID3A	uc010wzu.2	Q96N28	OTTHUMG00000131694	ENST00000440960.1:c.366C>T	18.37:g.12427223C>T			B0YJ10|B4E0C9|D3DUJ1|Q6AHX2	Silent	SNP	pfam_PRELI/MSF1,pfscan_PRELI/MSF1	p.T122	ENST00000440960.1	37	c.366	CCDS11860.1	18																																																																																			-	SLMO1	-	pfam_PRELI/MSF1,pfscan_PRELI/MSF1		0.498	SLMO1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLMO1	HGNC	protein_coding	OTTHUMT00000254602.2	0	0	0	92	92	65	0.00	0.00	C	NM_006553		12427223	+1	58	38	46	27	tier1	no_errors	ENST00000336990	ensembl	human	known	74_37	silent	55.77	58.46	SNP	0.027	T	58	46
SYCP1	6847	genome.wustl.edu	37	1	115419372	115419372	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:115419372G>T	ENST00000369522.3	+	11	982	c.742G>T	c.(742-744)Gaa>Taa	p.E248*	SYCP1_ENST00000369518.1_Nonsense_Mutation_p.E248*	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	248					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGAAGATTATGAAAAAATCCA	0.229													ENSG00000198765																																					0													20.0	22.0	21.0					1																	115419372		2099	4111	6210	SO:0001587	stop_gained	0			-	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.742G>T	1.37:g.115419372G>T	ENSP00000358535:p.Glu248*		O14963|Q5VXJ6	Nonsense_Mutation	SNP	pfam_SCP-1	p.E248*	ENST00000369522.3	37	c.742	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.456930	0.96223	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	.	.	.	4.92	4.92	0.64577	.	0.192207	0.45606	D	0.000356	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-15.3342	15.9721	0.80027	0.0:0.0:1.0:0.0	.	.	.	.	X	248	.	ENSP00000358531:E248X	E	+	1	0	SYCP1	115220895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.768000	0.68858	2.432000	0.82394	0.650000	0.86243	GAA	-	SYCP1	-	pfam_SCP-1		0.229	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1	0	0	0	50	50	80	0.00	0.00	G	NM_003176		115419372	+1	12	13	60	72	tier1	no_errors	ENST00000369518	ensembl	human	known	74_37	nonsense	16.67	15.29	SNP	1.000	T	12	60
SMC2	10592	genome.wustl.edu	37	9	106888987	106888987	+	Silent	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr9:106888987G>A	ENST00000286398.7	+	19	2805	c.2517G>A	c.(2515-2517)caG>caA	p.Q839Q	SMC2_ENST00000374787.3_Silent_p.Q839Q|SMC2_ENST00000374793.3_Silent_p.Q839Q|SMC2_ENST00000303219.8_Silent_p.Q839Q	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	839					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						ACAAACAACAGCTTGAAGCTG	0.353													ENSG00000136824																																					0													82.0	84.0	83.0					9																	106888987		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2517G>A	9.37:g.106888987G>A			Q6IEE0|Q9P1P2	Silent	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.Q839	ENST00000286398.7	37	c.2517	CCDS35086.1	9																																																																																			-	SMC2	-	superfamily_P-loop_NTPase		0.353	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1	0	0	0	43	43	63	0.00	0.00	G			106888987	+1	14	24	31	48	tier1	no_errors	ENST00000286398	ensembl	human	known	74_37	silent	31.11	33.33	SNP	1.000	A	14	31
PCDHB8	56128	genome.wustl.edu	37	5	140559085	140559085	+	Silent	SNP	G	G	A	rs145141248	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:140559085G>A	ENST00000239444.2	+	1	1715	c.1470G>A	c.(1468-1470)tcG>tcA	p.S490S	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	490	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCACCTACTCGCTGCTGCCGC	0.662													ENSG00000120322																																					0													92.0	141.0	125.0					5																	140559085		2203	4297	6500	SO:0001819	synonymous_variant	0			-	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1470G>A	5.37:g.140559085G>A			B9EGV1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S490	ENST00000239444.2	37	c.1470	CCDS4250.1	5																																																																																			-	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.662	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	0	0	0	454	454	28	0.00	0.00	G	NM_019120		140559085	+1	55	2	332	14	tier1	no_errors	ENST00000239444	ensembl	human	known	74_37	silent	14.21	12.50	SNP	0.988	A	55	332
ALOX12	239	genome.wustl.edu	37	17	6913105	6913105	+	Missense_Mutation	SNP	A	A	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:6913105A>G	ENST00000251535.6	+	12	1633	c.1580A>G	c.(1579-1581)cAt>cGt	p.H527R	RNASEK_ENST00000548577.1_5'Flank|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000399540.2_Intron|RNASEK_ENST00000402093.1_5'Flank|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000573939.1_Intron|AC027763.2_ENST00000574377.1_Intron	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	527	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CAACTCTGCCATTTCCTCACC	0.547													ENSG00000108839																																					0													139.0	117.0	124.0					17																	6913105		2203	4300	6503	SO:0001583	missense	0			-	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1580A>G	17.37:g.6913105A>G	ENSP00000251535:p.His527Arg		O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.H527R	ENST00000251535.6	37	c.1580	CCDS11084.1	17	.	.	.	.	.	.	.	.	.	.	A	10.95	1.494755	0.26774	.	.	ENSG00000108839	ENST00000251535	T	0.06218	3.33	5.28	4.2	0.49525	Lipoxygenase, C-terminal (3);	0.132515	0.51477	D	0.000093	T	0.05227	0.0139	L	0.35542	1.07	0.35859	D	0.827347	B	0.22800	0.075	B	0.19666	0.026	T	0.35176	-0.9799	10	0.17369	T	0.5	-4.4808	9.3901	0.38367	0.916:0.0:0.084:0.0	.	527	P18054	LOX12_HUMAN	R	527	ENSP00000251535:H527R	ENSP00000251535:H527R	H	+	2	0	ALOX12	6853829	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.795000	0.62489	1.025000	0.39708	0.460000	0.39030	CAT	-	ALOX12	-	pfam_LipOase_C,superfamily_LipOase_C		0.547	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12	HGNC	protein_coding	OTTHUMT00000219922.2	0	0	0	53	53	51	0.00	0.00	A			6913105	+1	32	25	56	31	tier1	no_errors	ENST00000251535	ensembl	human	known	74_37	missense	36.36	44.64	SNP	0.983	G	32	56
DIAPH1	1729	genome.wustl.edu	37	5	140896391	140896391	+	3'UTR	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:140896391G>A	ENST00000398557.4	-	0	3986				DIAPH1_ENST00000389054.3_3'UTR|DIAPH1_ENST00000398562.2_3'UTR|DIAPH1_ENST00000520569.1_3'UTR|DIAPH1_ENST00000253811.6_3'UTR|DIAPH1_ENST00000398566.3_3'UTR|DIAPH1_ENST00000389057.5_3'UTR|DIAPH1_ENST00000518047.1_3'UTR	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1						actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCCGCTGAGGAGCTGCCGC	0.587													ENSG00000131504																																					0													67.0	68.0	68.0					5																	140896391		2088	4201	6289	SO:0001624	3_prime_UTR_variant	0			-	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.*27C>T	5.37:g.140896391G>A			A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	R	SNP	-	NULL	ENST00000398557.4	37	NULL	CCDS43374.1	5																																																																																			-	DIAPH1	-	-		0.587	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		0	0	0	65	65	39	0.00	0.00	G	NM_005219		140896391	-1	16	18	27	25	tier1	no_errors	ENST00000468119	ensembl	human	putative	74_37	rna	37.21	41.86	SNP	0.005	A	16	27
TRPV2	51393	genome.wustl.edu	37	17	16342924	16342925	+	IGR	DEL	GT	GT	-	rs11540320		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	GT	GT	GT	-	GT	GT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:16342924_16342925delGT	ENST00000338560.7	+	0	2808				C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000384229.1_RNA|C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000484836.1_RNA	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TTAGTTGACCGTAACTGCCAGA	0.505													ENSG00000175061																																					0																																										SO:0001628	intergenic_variant	0				AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989		17.37:g.16342924_16342925delGT			A6NML2|A8K0Z0|Q9Y670	R	DEL	-	NULL	ENST00000338560.7	37	NULL	CCDS32576.1	17																																																																																				C17orf76-AS1	-	-		0.505	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf76-AS1	HGNC	protein_coding	OTTHUMT00000130464.2	0	0	0	52	52	101	0.00	0.00	GT	NM_016113		16342925	+1	28	44	51	98	tier1	no_errors	ENST00000460249	ensembl	human	known	74_37	rna	35.44	30.99	DEL	0.000:0.000	-	28	51
ANKRD20A19P	400110	genome.wustl.edu	37	13	24519966	24519966	+	RNA	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr13:24519966C>T	ENST00000442969.1	-	0	955									ankyrin repeat domain 20 family, member A19, pseudogene																		CCTTGACAGCCGCCCTTGGAT	0.697													ENSG00000196593																																					0													9.0	11.0	11.0					13																	24519966		691	1590	2281			0			-			13q12.12	2012-10-16			ENSG00000196593	ENSG00000196593			42737	pseudogene	pseudogene							Standard	NR_073430		Approved		uc001upb.2		OTTHUMG00000016572		13.37:g.24519966C>T				R	SNP	-	NULL	ENST00000442969.1	37	NULL		13																																																																																			-	ANKRD20A19P	-	-		0.697	ANKRD20A19P-001	KNOWN	basic	processed_transcript	ANKRD20A19P	HGNC	pseudogene	OTTHUMT00000044167.2	0	0	0	120	120	24	0.00	0.00	C			24519966	-1	44	9	52	5	tier1	no_errors	ENST00000420143	ensembl	human	known	74_37	rna	45.83	64.29	SNP	0.092	T	44	52
BMS1P21	100288974	genome.wustl.edu	37	10	81664709	81664709	+	IGR	SNP	T	T	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr10:81664709T>G								NUTM2E (54077 upstream) : MBL1P (15224 downstream)																							GGTCTTTTTTTTCTGCCTTTT	0.592													ENSG00000242600																																					0																																										SO:0001628	intergenic_variant	0			-																													10.37:g.81664709T>G				R	SNP	-	NULL		37	NULL		10																																																																																			-	MBL1P	-	-	0	0.592					MBL1P	HGNC			0	0	0	39	39	25	0.00	0.00	T			81664709	+1	14	9	8	5	tier1	no_errors	ENST00000453174	ensembl	human	known	74_37	rna	63.64	64.29	SNP	0.047	G	14	8
RB1	5925	genome.wustl.edu	37	13	48953730	48953730	+	Splice_Site	SNP	C	C	T	rs3092891	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr13:48953730C>T	ENST00000267163.4	+	14	1471	c.1333C>T	c.(1333-1335)Cga>Tga	p.R445*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	445	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.R445*(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTGTTTGTAGCGATACAAACT	0.333		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	25	Whole gene deletion(15)|Unknown(8)|Substitution - Nonsense(2)	bone(11)|breast(5)|eye(3)|central_nervous_system(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	GRCh37	CM900192|CX011720	RB1	M|X	rs3092891						18.0	19.0	19.0					13																	48953730		2200	4300	6500	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1333-1C>T	13.37:g.48953730C>T			A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R445*	ENST00000267163.4	37	c.1333	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	38	7.075321	0.98048	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.74	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7109	0.62667	0.3973:0.6027:0.0:0.0	rs3092891;rs3092891	.	.	.	X	424;445	.	.	R	+	1	2	RB1	47851731	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.278000	0.43426	1.383000	0.46405	0.557000	0.71058	CGA	rs3092891	RB1	-	pfam_RB_A,superfamily_Cyclin-like		0.333	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	52	52	54	0.00	0.00	C		Nonsense_Mutation	48953730	+1	38	18	12	5	tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	76.00	78.26	SNP	1.000	T	38	12
PRR5L	79899	genome.wustl.edu	37	11	36485195	36485195	+	3'UTR	DEL	A	A	-	rs200390084	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:36485195delA	ENST00000378867.3	+	0	2371				PRR5L_ENST00000311599.5_3'UTR|PRR5L_ENST00000389693.3_3'UTR	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like						negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						TGTATCGTTTAAAAAAAAAAA	0.393													ENSG00000135362	|||unknown(HR)	1189	0.23742	0.2224	0.3184	5008	,	,		21881	0.1944		0.2913	False		,,,				2504	0.1892																0																																										SO:0001624	3_prime_UTR_variant	0					CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.*909A>-	11.37:g.36485195delA			A4QN22|E9PKY1|Q96H46|Q9H7V4	R	DEL	-	NULL	ENST00000378867.3	37	NULL	CCDS31463.1	11																																																																																				PRR5L	-	-		0.393	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	HGNC	protein_coding	OTTHUMT00000389209.1	0	0	1	16	16	56	0.00	1.75	A	NM_024841		36485195	+1	3	4	9	45	tier1	no_errors	ENST00000389693	ensembl	human	known	74_37	rna	25.00	8.16	DEL	0.022	-	3	9
INTS4	92105	genome.wustl.edu	37	11	77629129	77629129	+	Intron	SNP	T	T	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:77629129T>C	ENST00000534064.1	-	15	1957				AAMDC_ENST00000532481.1_Missense_Mutation_p.L84S	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4						snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ggggcacagttagatctgaat	0.473													ENSG00000087884																																					0																																										SO:0001627	intron_variant	0			-	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1922+737A>G	11.37:g.77629129T>C			Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	pfam_DH_Ub_cplx-1_asu_assmbl-fac3,superfamily_DH_Ub_cplx-1_asu_assmbl-fac3	p.L84S	ENST00000534064.1	37	c.251	CCDS31644.1	11	.	.	.	.	.	.	.	.	.	.	T	3.766	-0.048663	0.07407	.	.	ENSG00000087884	ENST00000532481	.	.	.	3.39	0.849	0.18972	.	.	.	.	.	T	0.22003	0.0530	.	.	.	0.09310	N	1	B	0.30281	0.275	B	0.24269	0.052	T	0.22871	-1.0204	7	0.87932	D	0	.	2.9104	0.05734	0.2152:0.1228:0.0:0.6621	.	84	Q9H7C9-3	.	S	84	.	ENSP00000433293:L84S	L	+	2	0	C11orf67	77306777	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.370000	0.07523	0.146000	0.19002	0.528000	0.53228	TTA	-	AAMDC	-	NULL		0.473	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAMDC	HGNC	protein_coding	OTTHUMT00000390927.1	0	0	0	79	79	8	0.00	0.00	T	NM_033547		77629129	+1	20	1	89	6	tier1	no_errors	ENST00000532481	ensembl	human	putative	74_37	missense	18.35	14.29	SNP	0.002	C	20	89
GLS	2744	genome.wustl.edu	37	2	191745647	191745647	+	5'UTR	SNP	C	C	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:191745647C>G	ENST00000320717.3	+	0	95				AC005540.3_ENST00000413911.1_RNA|GLS_ENST00000338435.4_5'UTR	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase						cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	agcagcagcaCCCGCATCCGC	0.662													ENSG00000235852																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.-164C>G	2.37:g.191745647C>G			Q9UL05|Q9UL06|Q9UL07|Q9UN40	R	SNP	-	NULL	ENST00000320717.3	37	NULL	CCDS2308.1	2																																																																																			-	AC005540.3	-	-		0.662	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000235852	Clone_based_vega_gene	protein_coding	OTTHUMT00000255999.2	0	0	0	8	8	5	0.00	0.00	C			191745647	-1	4	0	8	9	tier1	no_errors	ENST00000413911	ensembl	human	known	74_37	rna	30.77	0.00	SNP	0.000	G	4	8
MT-CO2	4513	genome.wustl.edu	37	M	8156	8156	+	Missense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chrM:8156G>T	ENST00000361739.1	+	1	571	c.571G>T	c.(571-573)Gta>Tta	p.V191L	MT-TN_ENST00000387400.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	191					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CACGACCGGGGGTATACTACG	0.468													ENSG00000198712																																					0																																										SO:0001583	missense	0			-			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.571G>T	M.37:g.8156G>T	ENSP00000354876:p.Val191Leu		Q37526	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.V191L	ENST00000361739.1	37	c.571		MT																																																																																			-	MT-CO2	-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2		0.468	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		0	0	0	71	71	6	0.00	0.00	G	YP_003024029		8156	+1	2	0	8	1	tier1	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	20.00	0.00	SNP	NULL	T	2	8
CR1	1378	genome.wustl.edu	37	1	207726288	207726289	+	Intron	INS	-	-	T	rs557359271	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:207726288_207726289insT	ENST00000367049.4	+	19	3101				CR1_ENST00000367050.4_Intron|CR1_ENST00000367051.1_Intron|CR1_ENST00000367052.1_Intron|CR1_ENST00000400960.2_Intron|CR1_ENST00000367053.1_Intron|RP11-78B10.2_ENST00000439443.1_RNA|RP11-78B10.2_ENST00000597497.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)						complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AGGCTATTGCCACCTGCTCTTA	0.441													ENSG00000236911	-|-|T|insertion	866	0.172923	0.1029	0.1614	5008	,	,		18024	0.2183		0.1044	False		,,,				2504	0.2996																0																																										SO:0001627	intron_variant	0				Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.3101+92->T	1.37:g.207726288_207726289insT			Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	R	INS	-	NULL	ENST00000367049.4	37	NULL	CCDS44308.1	1																																																																																				RP11-78B10.2	-	-		0.441	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000236911	Clone_based_vega_gene	protein_coding	OTTHUMT00000382527.1	0	0	0	11	11	4	0.00	0.00	-	NM_000573		207726289	-1	4	0	10	5	tier1	no_errors	ENST00000439443	ensembl	human	known	74_37	rna	28.57	0.00	INS	0.000:0.000	T	4	10
LOC441666	441666	genome.wustl.edu	37	10	42832502	42832503	+	RNA	INS	-	-	TATCA	rs368679059		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr10:42832502_42832503insTATCA	ENST00000609841.1	-	0	1400_1401					NR_024380.1																						CCCCTATCAATTATGTTTAGTA	0.366													ENSG00000215146																																					0																																												0																																10.37:g.42832502_42832503insTATCA				R	INS	-	NULL	ENST00000609841.1	37	NULL		10																																																																																				RP11-313J2.1	-	-		0.366	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	0	0	0	1	1	1	0.00	0.00	-			42832503	-1	0	0	0	0	tier1	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.995:0.996	TATCA	0	0
MT-ND1	4535	genome.wustl.edu	37	M	932	932	+	5'Flank	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chrM:932C>A	ENST00000361390.2	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTCAATAGAAGCCGGCGTAAA	0.428													ENSG00000211459																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.932C>A	Exception_encountered		C0JKH6|Q37523	R	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	MT-RNR1	-	-		0.428	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		0	0	0	104	104	2	0.00	0.00	C	YP_003024026		932	+1	2	0	17	0	tier1	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	10.53	0.00	SNP	NULL	A	2	17
PSD2	84249	genome.wustl.edu	37	5	139216824	139216824	+	Splice_Site	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:139216824G>T	ENST00000274710.3	+	11	1870		c.e11+1			NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2						neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGCAGAAGGTGAGAGACTG	0.637													ENSG00000146005																																					0													65.0	67.0	66.0					5																	139216824		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1665+1G>T	5.37:g.139216824G>T			D3DQD3|Q8N3J8	Splice_Site	SNP	-	e10+1	ENST00000274710.3	37	c.1665+1	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605765	0.87157	.	.	ENSG00000146005	ENST00000274710	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7524	0.91820	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PSD2	139197008	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	9.826000	0.99387	2.441000	0.82636	0.484000	0.47621	.	-	PSD2	-	-		0.637	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	0	0	0	49	49	82	0.00	0.00	G	NM_032289	Intron	139216824	+1	4	2	41	47	tier1	no_errors	ENST00000274710	ensembl	human	known	74_37	splice_site	8.89	4.08	SNP	1.000	T	4	41
