#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
LGMN	5641	genome.wustl.edu	37	14	93182482	93182482	+	Splice_Site	SNP	T	T	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr14:93182482T>A	ENST00000393218.2	-	6	740	c.403A>T	c.(403-405)Agt>Tgt	p.S135C	LGMN_ENST00000555699.1_Splice_Site_p.S135C|LGMN_ENST00000334869.4_Splice_Site_p.S135C|LGMN_ENST00000557434.1_Splice_Site_p.S135C	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	135					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		AGACATTACCTCTTCAGGACT	0.468													ENSG00000100600																																					0													160.0	138.0	145.0					14																	93182482		2203	4300	6503	SO:0001630	splice_region_variant	0			-	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.404+1A>T	14.37:g.93182482T>A			O00123|Q86TV2|Q86TV3|Q9BTY1	Missense_Mutation	SNP	pfam_Peptidase_C13,prints_Peptidase_C13	p.S135C	ENST00000393218.2	37	c.403	CCDS9904.1	14	.	.	.	.	.	.	.	.	.	.	T	26.1	4.705494	0.89018	.	.	ENSG00000100600	ENST00000555699;ENST00000334869;ENST00000557434;ENST00000334864;ENST00000262004;ENST00000393218;ENST00000539531;ENST00000535855;ENST00000553802	T;T;T;T;T	0.58506	0.52;0.49;0.55;0.49;0.33	5.51	5.51	0.81932	.	0.181563	0.64402	D	0.000001	D	0.84960	0.5588	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.90629	0.4565	10	0.87932	D	0	-31.54	15.5875	0.76495	0.0:0.0:0.0:1.0	.	135;135;135	Q99538;Q86TV2;Q86TV3	LGMN_HUMAN;.;.	C	135;135;135;135;135;135;112;100;126	ENSP00000451861:S135C;ENSP00000334052:S135C;ENSP00000452572:S135C;ENSP00000376911:S135C;ENSP00000450854:S126C	ENSP00000262004:S135C	S	-	1	0	LGMN	92252235	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.238000	0.78173	2.232000	0.73038	0.533000	0.62120	AGT	-	LGMN	-	pfam_Peptidase_C13,prints_Peptidase_C13		0.468	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LGMN	HGNC	protein_coding	OTTHUMT00000412288.1	0	0		53	53		0.00		T	NM_005606	Missense_Mutation	93182482	-1	11		75		tier1	no_errors	ENST00000334869	ensembl	human	known	74_37	missense	12.79		SNP	1.000	A	11	75
FCHO1	23149	genome.wustl.edu	37	19	17886830	17886830	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr19:17886830G>A	ENST00000596536.1	+	16	1325	c.1042G>A	c.(1042-1044)Gac>Aac	p.D348N	FCHO1_ENST00000539407.1_Missense_Mutation_p.D348N|FCHO1_ENST00000594202.1_Missense_Mutation_p.D348N|FCHO1_ENST00000597512.1_Missense_Mutation_p.D355N|FCHO1_ENST00000600676.1_Missense_Mutation_p.D348N|FCHO1_ENST00000596951.1_Missense_Mutation_p.D348N|FCHO1_ENST00000252771.7_Missense_Mutation_p.D348N|FCHO1_ENST00000595033.1_Missense_Mutation_p.D298N|FCHO1_ENST00000389133.4_Missense_Mutation_p.D348N	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	348	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CAGCGACTCCGACTTCGACGA	0.642											OREG0025349	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000130475																																					0													50.0	52.0	51.0					19																	17886830		2203	4300	6503	SO:0001583	missense	0			-	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1042G>A	19.37:g.17886830G>A	ENSP00000470731:p.Asp348Asn	721	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,superfamily_Clathrin_mu_C,smart_FCH_dom,pfscan_FCH_dom	p.D348N	ENST00000596536.1	37	c.1042	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959749	0.74016	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.48522	0.81;0.81;0.81	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.62563	0.2438	M	0.72894	2.215	0.54753	D	0.999982	D;D	0.76494	0.997;0.999	P;P	0.62014	0.791;0.897	T	0.62840	-0.6769	10	0.37606	T	0.19	-25.5542	12.8696	0.57957	0.0:0.0:1.0:0.0	.	348;348	O14526;O14526-2	FCHO1_HUMAN;.	N	348	ENSP00000252771:D348N;ENSP00000373785:D348N;ENSP00000437978:D348N	ENSP00000252771:D348N	D	+	1	0	FCHO1	17747830	1.000000	0.71417	0.517000	0.27799	0.286000	0.27126	8.183000	0.89700	2.078000	0.62432	0.491000	0.48974	GAC	-	FCHO1	-	NULL		0.642	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	0	0		62	62		0.00		G	NM_015122		17886830	+1	13		91		tier1	no_errors	ENST00000252771	ensembl	human	known	74_37	missense	12.50		SNP	0.994	A	13	91
TLL1	7092	genome.wustl.edu	37	4	166915615	166915615	+	Silent	SNP	C	C	A	rs147468832		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr4:166915615C>A	ENST00000061240.2	+	4	1091	c.444C>A	c.(442-444)gcC>gcA	p.A148A	TLL1_ENST00000513213.1_Silent_p.A148A|TLL1_ENST00000507499.1_Silent_p.A148A	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	148	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTCCCAGAGCCGCTACATCAA	0.418													ENSG00000038295																																					0													75.0	74.0	74.0					4																	166915615		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.444C>A	4.37:g.166915615C>A			B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.A148	ENST00000061240.2	37	c.444	CCDS3811.1	4																																																																																			-	TLL1	-	pirsf_BMP_1/tolloid-like		0.418	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1	0	0		43	43		0.00		C			166915615	+1	4		8		tier1	no_errors	ENST00000061240	ensembl	human	known	74_37	silent	33.33		SNP	0.976	A	4	8
KIAA0040	9674	genome.wustl.edu	37	1	175129948	175129955	+	Frame_Shift_Del	DEL	TCTTCTTG	TCTTCTTG	-	rs3208835|rs542219168|rs71563271|rs202239690|rs386636937|rs57794404		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	TCTTCTTG	TCTTCTTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:175129948_175129955delTCTTCTTG	ENST00000423313.1	-	4	731_738	c.195_202delCAAGAAGA	c.(193-204)aacaagaagaagfs	p.NKK65fs	KIAA0040_ENST00000444639.1_Frame_Shift_Del_p.NKK65fs|KIAA0040_ENST00000545251.2_Frame_Shift_Del_p.NKK65fs|KIAA0040_ENST00000567124.1_5'Flank	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	ttcttcttcttcttcttgttcttctCTG	0.51													ENSG00000235750																																					0																																										SO:0001589	frameshift_variant	0				D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.195_202delCAAGAAGA	1.37:g.175129948_175129955delTCTTCTTG	ENSP00000462172:p.Asn65fs		A8K9H6|Q2NKQ0	Frame_Shift_Del	DEL	NULL	p.N65fs	ENST00000423313.1	37	c.202_195		1																																																																																				KIAA0040	-	NULL		0.510	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	KIAA0040	HGNC	protein_coding	OTTHUMT00000084420.3									TCTTCTTG	NM_014656		175129955	-1					tier1	no_errors	ENST00000423313	ensembl	human	known	74_37	frame_shift_del			DEL	0.979:0.335:0.011:0.006:0.005:0.014:0.019:0.212	-		
NKX6-3	157848	genome.wustl.edu	37	8	41505619	41505619	+	5'Flank	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr8:41505619G>A	ENST00000524115.2	-	0	0					NM_152568.2	NP_689781.1	A6NJ46	NKX63_HUMAN	NK6 homeobox 3						cell fate determination (GO:0001709)|glandular epithelial cell differentiation (GO:0002067)|negative regulation of epithelial cell differentiation (GO:0030857)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(1)	1	Ovarian(28;0.00541)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Esophageal squamous(32;0.0844)|Hepatocellular(245;0.154)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CAGTGAGTATGCCAGCCGTGC	0.632													ENSG00000165066																																					0																																										SO:0001631	upstream_gene_variant	0			-	AK057898	CCDS6118.1	8p11.21	2014-08-12	2007-07-09		ENSG00000165066	ENSG00000165066		"""Homeoboxes / ANTP class : NKL subclass"""	26328	protein-coding gene	gene with protein product		610772	"""NK6 transcription factor related, locus 3 (Drosophila)"""			16326147	Standard	XM_005273422		Approved	FLJ25169	uc003xoa.2	A6NJ46	OTTHUMG00000164083		8.37:g.41505619G>A	Exception_encountered		Q96LR0	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.A173V	ENST00000524115.2	37	c.518	CCDS6118.1	8	.	.	.	.	.	.	.	.	.	.	G	36	5.923680	0.97110	.	.	ENSG00000165066	ENST00000425142;ENST00000518699	D	0.98362	-4.89	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.99777	1.1026	7	0.87932	D	0	.	19.1261	0.93384	0.0:0.0:1.0:0.0	.	.	.	.	V	173	ENSP00000428361:A173V	ENSP00000414183:A173V	A	-	2	0	NKX6-3	41624776	1.000000	0.71417	0.969000	0.41365	0.948000	0.59901	9.238000	0.95380	2.779000	0.95612	0.655000	0.94253	GCA	-	NKX6-3	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif		0.632	NKX6-3-002	KNOWN	basic|exp_conf|CCDS	protein_coding	NKX6-3	HGNC	protein_coding	OTTHUMT00000377166.2	0	0		61	61		0.00		G	NM_152568		41505619	-1	20		117		tier1	no_errors	ENST00000518699	ensembl	human	known	74_37	missense	14.49		SNP	1.000	A	20	117
BRINP1	1620	genome.wustl.edu	37	9	121971060	121971060	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:121971060C>T	ENST00000265922.3	-	7	1543	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	BRINP1_ENST00000482797.1_5'UTR	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	361					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.R361H(1)									GAAAAGCTTGCGGGCAGTGCG	0.582													ENSG00000078725																																					1	Substitution - Missense(1)	endometrium(1)											226.0	188.0	201.0					9																	121971060		2203	4300	6503	SO:0001583	missense	0			-	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1082G>A	9.37:g.121971060C>T	ENSP00000265922:p.Arg361His		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.R361H	ENST00000265922.3	37	c.1082	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291614	0.59976	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.15017	2.46	5.79	5.79	0.91817	.	0.049549	0.85682	D	0.000000	T	0.30479	0.0766	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	T	0.01316	-1.1387	10	0.18276	T	0.48	-13.1734	19.0317	0.92960	0.0:1.0:0.0:0.0	.	361	O60477	DBC1_HUMAN	H	361	ENSP00000265922:R361H	ENSP00000265922:R361H	R	-	2	0	DBC1	121010881	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.655000	0.61476	2.731000	0.93534	0.650000	0.86243	CGC	-	BRINP1	-	NULL		0.582	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2	0	0		108	108		0.00		C	NM_014618		121971060	-1	57		118		tier1	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	32.57		SNP	1.000	T	57	118
STAB2	55576	genome.wustl.edu	37	12	104156110	104156110	+	Missense_Mutation	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr12:104156110G>C	ENST00000388887.2	+	67	7622	c.7418G>C	c.(7417-7419)gGg>gCg	p.G2473A	RP11-341G23.4_ENST00000551299.1_RNA|RP11-341G23.4_ENST00000550029.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CTGGTGACTGGGGCTGTTGCC	0.478													ENSG00000136011																																					0													143.0	128.0	133.0					12																	104156110		2203	4300	6503	SO:0001583	missense	0			-	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7418G>C	12.37:g.104156110G>C	ENSP00000373539:p.Gly2473Ala			Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.G2473A	ENST00000388887.2	37	c.7418	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595518	0.46318	.	.	ENSG00000136011	ENST00000388887	T	0.65916	-0.18	5.25	4.34	0.51931	.	0.144413	0.45126	D	0.000390	T	0.77778	0.4181	M	0.74258	2.255	0.35072	D	0.762556	D	0.89917	1.0	D	0.87578	0.998	T	0.82882	-0.0237	10	0.33141	T	0.24	.	15.6735	0.77297	0.0:0.1376:0.8624:0.0	.	2473	Q8WWQ8	STAB2_HUMAN	A	2473	ENSP00000373539:G2473A	ENSP00000373539:G2473A	G	+	2	0	STAB2	102680240	1.000000	0.71417	0.026000	0.17262	0.003000	0.03518	3.893000	0.56243	1.178000	0.42870	0.561000	0.74099	GGG	-	STAB2	-	NULL		0.478	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	0	0		51	51		0.00		G			104156110	+1	12		67		tier1	no_errors	ENST00000388887	ensembl	human	known	74_37	missense	15.19		SNP	0.724	C	12	67
MMP27	64066	genome.wustl.edu	37	11	102575384	102575384	+	Silent	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:102575384A>G	ENST00000260229.4	-	2	316	c.225T>C	c.(223-225)acT>acC	p.T75T		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	75					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CCAGTTTTCCAGTCACTGTCA	0.453													ENSG00000137675																																					0													125.0	118.0	120.0					11																	102575384		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.225T>C	11.37:g.102575384A>G			Q6UWK6	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.T75	ENST00000260229.4	37	c.225	CCDS8319.1	11																																																																																			-	MMP27	-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,pirsf_Pept_M10A_Metazoans		0.453	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	HGNC	protein_coding	OTTHUMT00000398128.1	0	0		69	69		0.00		A	NM_022122		102575384	-1	9		51		tier1	no_errors	ENST00000260229	ensembl	human	known	74_37	silent	15.00		SNP	0.987	G	9	51
TGFBRAP1	9392	genome.wustl.edu	37	2	105883847	105883847	+	Missense_Mutation	SNP	C	C	T	rs376885416		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr2:105883847C>T	ENST00000393359.2	-	12	3002	c.2576G>A	c.(2575-2577)cGg>cAg	p.R859Q	AC012360.2_ENST00000595531.1_5'Flank|TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.R859Q			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	859					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						TTTTCAAGTCCGAGTGCCAGG	0.552													ENSG00000135966																									Esophageal Squamous(183;794 2019 9730 21801 48859)												0								C	GLN/ARG,GLN/ARG	1,4405		0,1,2202	96.0	83.0	88.0		2576,2576	5.5	1.0	2		88	0,8600		0,0,4300	no	missense,missense	TGFBRAP1	NM_004257.4,NM_001142621.1	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	859/861,859/861	105883847	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.2576G>A	2.37:g.105883847C>T	ENSP00000377027:p.Arg859Gln		A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	pfam_VPS39/TGF_beta_rcpt-assoc_2,pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat,pfam_Citron	p.R859Q	ENST00000393359.2	37	c.2576	CCDS2067.1	2	.	.	.	.	.	.	.	.	.	.	C	18.48	3.634112	0.67130	2.27E-4	0.0	ENSG00000135966	ENST00000393359;ENST00000258449;ENST00000543724	T;T	0.46063	0.88;0.88	5.5	5.5	0.81552	.	0.165679	0.41500	D	0.000870	T	0.28599	0.0708	N	0.22421	0.69	0.30479	N	0.772514	B;B	0.18166	0.026;0.026	B;B	0.08055	0.003;0.003	T	0.18840	-1.0324	10	0.59425	D	0.04	-24.0118	9.6725	0.40021	0.0:0.8403:0.0:0.1597	.	314;859	B3KMM9;Q8WUH2	.;TGFA1_HUMAN	Q	859;859;314	ENSP00000377027:R859Q;ENSP00000258449:R859Q	ENSP00000258449:R859Q	R	-	2	0	TGFBRAP1	105250279	1.000000	0.71417	0.996000	0.52242	0.874000	0.50279	2.866000	0.48420	2.590000	0.87494	0.557000	0.71058	CGG	-	TGFBRAP1	-	NULL		0.552	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBRAP1	HGNC	protein_coding	OTTHUMT00000253354.2	0	0		32	32		0.00		C	NM_004257		105883847	-1	11		43		tier1	no_errors	ENST00000258449	ensembl	human	known	74_37	missense	20.37		SNP	1.000	T	11	43
WASH6P	653440	genome.wustl.edu	37	X	155252089	155252089	+	RNA	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:155252089C>T	ENST00000461007.1	+	0	1097				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TCAGCTCTGTCAGCTCCTTGC	0.617													ENSG00000270726																																					0																																												0			-	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252089C>T			A6NGF1|Q8N305	R	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			-	AJ271736.10	-	-		0.617	WASH6P-016	KNOWN	basic	processed_transcript	ENSG00000270726	Clone_based_vega_gene	pseudogene	OTTHUMT00000058840.1	0	0		70	70		0.00		C	NG_008380		155252089	+1	41		102		tier1	no_errors	ENST00000285718	ensembl	human	known	74_37	rna	28.67		SNP	1.000	T	41	102
TMEM217	221468	genome.wustl.edu	37	6	37182996	37182996	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:37182996C>T	ENST00000336655.2	-	3	707	c.668G>A	c.(667-669)aGa>aAa	p.R223K	TMEM217_ENST00000497775.1_Intron|TMEM217_ENST00000356757.2_Intron	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217	223						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						tattgtgtatctacaggtgct	0.403													ENSG00000172738																																					0													111.0	112.0	111.0					6																	37182996		2203	4300	6503	SO:0001583	missense	0			-		CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.668G>A	6.37:g.37182996C>T	ENSP00000338164:p.Arg223Lys		Q8TC54	Missense_Mutation	SNP	NULL	p.R223K	ENST00000336655.2	37	c.668	CCDS4831.1	6	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435821	0.25813	.	.	ENSG00000172738	ENST00000336655	.	.	.	1.73	-0.545	0.11843	.	.	.	.	.	T	0.05731	0.0150	N	0.08118	0	0.09310	N	1	B	0.18610	0.029	B	0.08055	0.003	T	0.35251	-0.9796	8	0.87932	D	0	.	4.1463	0.10217	0.0:0.4491:0.0:0.5509	.	223	Q8N7C4	TM217_HUMAN	K	223	.	ENSP00000338164:R223K	R	-	2	0	TMEM217	37290974	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-0.360000	0.07622	-0.155000	0.11098	0.462000	0.41574	AGA	-	TMEM217	-	NULL		0.403	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM217	HGNC	protein_coding	OTTHUMT00000357542.1	0	0		74	74		0.00		C	NM_145316		37182996	-1	469		36		tier1	no_errors	ENST00000336655	ensembl	human	known	74_37	missense	92.87		SNP	0.000	T	469	36
SSX2IP	117178	genome.wustl.edu	37	1	85113279	85113279	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:85113279A>G	ENST00000342203.3	-	14	1945	c.1682T>C	c.(1681-1683)gTa>gCa	p.V561A	SSX2IP_ENST00000437941.2_Missense_Mutation_p.V534A|SSX2IP_ENST00000605755.1_Missense_Mutation_p.V534A	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	561					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TATATTCAGTACATTGATTGA	0.368													ENSG00000117155																																					0													148.0	129.0	135.0					1																	85113279		2203	4300	6503	SO:0001583	missense	0			-		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.1682T>C	1.37:g.85113279A>G	ENSP00000340279:p.Val561Ala		A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	pfam_Afadin/alpha-actinin-bd	p.V561A	ENST00000342203.3	37	c.1682	CCDS699.1	1	.	.	.	.	.	.	.	.	.	.	A	1.961	-0.438958	0.04636	.	.	ENSG00000117155	ENST00000342203;ENST00000437941	T;T	0.49720	0.77;0.77	5.77	-1.2	0.09554	.	0.945322	0.08876	N	0.880748	T	0.10723	0.0262	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.25467	-1.0131	10	0.24483	T	0.36	0.4097	2.0259	0.03519	0.3909:0.1351:0.3429:0.1311	.	561;534	Q9Y2D8;B4DFE3	ADIP_HUMAN;.	A	561;534	ENSP00000340279:V561A;ENSP00000412781:V534A	ENSP00000340279:V561A	V	-	2	0	SSX2IP	84885867	0.002000	0.14202	0.001000	0.08648	0.132000	0.20833	1.007000	0.29860	-0.132000	0.11557	0.533000	0.62120	GTA	-	SSX2IP	-	NULL		0.368	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX2IP	HGNC	protein_coding	OTTHUMT00000027469.1	0	0		50	50		0.00		A	NM_014021		85113279	-1	30		21		tier1	no_errors	ENST00000342203	ensembl	human	known	74_37	missense	58.82		SNP	0.000	G	30	21
LONRF3	79836	genome.wustl.edu	37	X	118124513	118124513	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:118124513C>G	ENST00000371628.3	+	5	1436	c.1405C>G	c.(1405-1407)Cta>Gta	p.L469V	LONRF3_ENST00000422289.2_Missense_Mutation_p.L213V|LONRF3_ENST00000472173.1_3'UTR|LONRF3_ENST00000304778.7_Missense_Mutation_p.L428V	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	469							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						TGAATGCGCTCTATGTATGAG	0.468													ENSG00000175556																																					0													308.0	193.0	232.0					X																	118124513		2203	4300	6503	SO:0001583	missense	0			-	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1405C>G	X.37:g.118124513C>G	ENSP00000360690:p.Leu469Val		Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.L469V	ENST00000371628.3	37	c.1405	CCDS35374.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.87|10.87	1.474049|1.474049	0.26423|0.26423	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289|ENST00000439603	T;T;T;T|.	0.15372|.	2.43;2.43;2.43;2.43|.	5.3|5.3	3.53|3.53	0.40419|0.40419	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);|.	0.000000|.	0.64402|.	D|.	0.000007|.	T|T	0.27384|0.27384	0.0672|0.0672	N|N	0.03281|0.03281	-0.365|-0.365	0.80722|0.80722	D|D	1|1	P;P;D|.	0.64830|.	0.529;0.84;0.994|.	P;P;P|.	0.59012|.	0.521;0.767;0.85|.	T|T	0.04017|0.04017	-1.0984|-1.0984	10|5	0.34782|.	T|.	0.22|.	-14.6539|-14.6539	8.0982|8.0982	0.30842|0.30842	0.0:0.7594:0.1542:0.0864|0.0:0.7594:0.1542:0.0864	.|.	213;428;469|.	B3KUN7;Q496Y0-2;Q496Y0|.	.;.;LONF3_HUMAN|.	V|C	428;428;469;213|234	ENSP00000360691:L428V;ENSP00000307732:L428V;ENSP00000360690:L469V;ENSP00000408894:L213V|.	ENSP00000307732:L428V|.	L|S	+|+	1|2	2|0	LONRF3|LONRF3	118008541|118008541	0.938000|0.938000	0.31826|0.31826	0.024000|0.024000	0.17045|0.17045	0.162000|0.162000	0.22319|0.22319	1.477000|1.477000	0.35431|0.35431	0.548000|0.548000	0.28955|0.28955	0.600000|0.600000	0.82982|0.82982	CTA|TCT	-	LONRF3	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.468	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF3	HGNC	protein_coding	OTTHUMT00000355124.2	0	0		26	26		0.00		C	NM_024778		118124513	+1	11		11		tier1	no_errors	ENST00000371628	ensembl	human	known	74_37	missense	50.00		SNP	0.215	G	11	11
PTK2	5747	genome.wustl.edu	37	8	141900797	141900797	+	Missense_Mutation	SNP	G	G	T	rs191376716	byFrequency	TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr8:141900797G>T	ENST00000522684.1	-	3	269	c.40C>A	c.(40-42)Cca>Aca	p.P14T	PTK2_ENST00000535192.1_Missense_Mutation_p.P14T|PTK2_ENST00000520892.1_Missense_Mutation_p.P14T|PTK2_ENST00000519419.1_Missense_Mutation_p.P58T|PTK2_ENST00000519881.1_Missense_Mutation_p.P14T|PTK2_ENST00000395218.2_Missense_Mutation_p.P14T|PTK2_ENST00000517887.1_Missense_Mutation_p.P58T|PTK2_ENST00000521059.1_Missense_Mutation_p.P14T|PTK2_ENST00000340930.3_Missense_Mutation_p.P14T	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	14					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CTCGAATTTGGTGTGTGATTC	0.383													ENSG00000169398																																					0													120.0	98.0	106.0					8																	141900797		2203	4300	6503	SO:0001583	missense	0			-	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.40C>A	8.37:g.141900797G>T	ENSP00000429911:p.Pro14Thr		B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P14T	ENST00000522684.1	37	c.40	CCDS6381.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.12|11.12	1.545147|1.545147	0.27652|0.27652	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000340930;ENST00000519419;ENST00000524357;ENST00000520475;ENST00000519881;ENST00000520892;ENST00000523803;ENST00000521907;ENST00000517453;ENST00000520045;ENST00000521395;ENST00000521332;ENST00000524040|ENST00000519654	T;T;T;T;T;T;T|T	0.76316|0.78003	-1.01;-1.0;-0.98;-1.01;-1.0;-1.0;-0.98|-1.14	5.68|5.68	4.8|4.8	0.61643|0.61643	.|.	0.217942|.	0.48286|.	D|.	0.000193|.	T|T	0.72374|0.72374	0.3452|0.3452	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.04013|.	0.001;0.001;0.001;0.0|.	T|T	0.69862|0.69862	-0.5030|-0.5030	10|7	0.17832|0.27082	T|T	0.49|0.32	.|.	16.8293|16.8293	0.85940|0.85940	0.0:0.1284:0.8716:0.0|0.0:0.1284:0.8716:0.0	.|.	14;14;36;14|.	B4E2N6;Q05397;Q658W2;Q8IYN9|.	.;FAK1_HUMAN;.;.|.	T|N	14;14;58;14;27;14;14;58;14;14;14;14;14;14;14;14;14;14;14|24	ENSP00000429911:P14T;ENSP00000438009:P14T;ENSP00000429082:P58T;ENSP00000429474:P14T;ENSP00000378644:P14T;ENSP00000341189:P14T;ENSP00000429129:P58T|ENSP00000429929:T24N	ENSP00000341189:P14T|ENSP00000429929:T24N	P|T	-|-	1|2	0|0	PTK2|PTK2	141969979|141969979	1.000000|1.000000	0.71417|0.71417	0.921000|0.921000	0.36526|0.36526	0.937000|0.937000	0.57800|0.57800	3.683000|3.683000	0.54663|0.54663	1.372000|1.372000	0.46190|0.46190	0.650000|0.650000	0.86243|0.86243	CCA|ACC	-	PTK2	-	NULL		0.383	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK2	HGNC	protein_coding	OTTHUMT00000378054.5	0	0		95	95		0.00		G	NM_005607		141900797	-1	21		87		tier1	no_errors	ENST00000395218	ensembl	human	known	74_37	missense	19.44		SNP	0.539	T	21	87
NUTM1	256646	genome.wustl.edu	37	15	34649175	34649175	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:34649175C>G	ENST00000333756.4	+	7	3037	c.2882C>G	c.(2881-2883)cCc>cGc	p.P961R	NUTM1_ENST00000438749.3_Missense_Mutation_p.P979R|NUTM1_ENST00000537011.1_Missense_Mutation_p.P989R	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	961						cytoplasm (GO:0005737)|nucleus (GO:0005634)											ACTGGGACTCCCAAAGCAACA	0.488													ENSG00000184507																																					0													55.0	51.0	53.0					15																	34649175		2201	4298	6499	SO:0001583	missense	0			-	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2882C>G	15.37:g.34649175C>G	ENSP00000329448:p.Pro961Arg		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.P961R	ENST00000333756.4	37	c.2882	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	C	5.722	0.317659	0.10845	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.08102	3.13;3.13;3.14	5.3	-0.119	0.13543	.	0.463917	0.20520	N	0.090709	T	0.06962	0.0177	L	0.54323	1.7	0.09310	N	1	B;B;B	0.20887	0.029;0.049;0.006	B;B;B	0.19666	0.016;0.026;0.008	T	0.31138	-0.9954	10	0.62326	D	0.03	.	1.4332	0.02338	0.1491:0.4545:0.1449:0.2516	.	979;989;961	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	R	989;979;961	ENSP00000444896:P989R;ENSP00000407031:P979R;ENSP00000329448:P961R	ENSP00000329448:P961R	P	+	2	0	C15orf55	32436467	0.000000	0.05858	0.011000	0.14972	0.008000	0.06430	0.079000	0.14782	0.094000	0.17404	-0.137000	0.14449	CCC	-	NUTM1	-	NULL		0.488	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTM1	HGNC	protein_coding	OTTHUMT00000418026.1	0	0		32	32		0.00		C	NM_175741		34649175	+1	8		39		tier1	no_errors	ENST00000333756	ensembl	human	known	74_37	missense	17.02		SNP	0.002	G	8	39
HBD	3045	genome.wustl.edu	37	11	5255646	5255646	+	Silent	SNP	A	A	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:5255646A>C	ENST00000380299.3	-	1	232	c.18T>G	c.(16-18)ccT>ccG	p.P6P	HBD_ENST00000292901.3_Silent_p.P6P	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	6					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTTCTCCTCAGGAGTCAGAT	0.507													ENSG00000223609																																					0													180.0	145.0	157.0					11																	5255646		2201	4298	6499	SO:0001819	synonymous_variant	0			-	AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.18T>G	11.37:g.5255646A>C			Q3Y5H3|Q8WXT7	Silent	SNP	pfam_Globin,superfamily_Globin-like,prints_Haemoglobin_b,pfscan_Globin	p.P6	ENST00000380299.3	37	c.18	CCDS31376.1	11																																																																																			-	HBD	-	superfamily_Globin-like,pfscan_Globin		0.507	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBD	HGNC	protein_coding	OTTHUMT00000142970.1	0	0		108	108		0.00		A	NM_000519		5255646	-1	11		117		tier1	no_errors	ENST00000380299	ensembl	human	known	74_37	silent	8.59		SNP	0.000	C	11	117
ACAN	176	genome.wustl.edu	37	15	89398733	89398733	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:89398733C>T	ENST00000561243.1	+	11	2917	c.2917C>T	c.(2917-2919)Ctc>Ttc	p.L973F	ACAN_ENST00000559004.1_Missense_Mutation_p.L973F|ACAN_ENST00000439576.2_Missense_Mutation_p.L973F|ACAN_ENST00000352105.7_Missense_Mutation_p.L973F			P16112	PGCA_HUMAN	aggrecan	972	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGTAGGAGACCTCAGTGGGCT	0.557													ENSG00000157766																																					0													142.0	146.0	145.0					15																	89398733		1842	4088	5930	SO:0001583	missense	0			-	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2917C>T	15.37:g.89398733C>T	ENSP00000453342:p.Leu973Phe		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.L973F	ENST00000561243.1	37	c.2917	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	C	8.690	0.907249	0.17833	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.96685	-4.09;-4.09	4.48	-1.44	0.08856	.	1.458670	0.05162	N	0.497976	D	0.96361	0.8813	M	0.71036	2.16	0.09310	N	1	D;D	0.59357	0.985;0.985	P;P	0.61477	0.889;0.889	D	0.87909	0.2696	10	0.13853	T	0.58	-2.7456	4.1285	0.10138	0.543:0.2503:0.1224:0.0842	.	973;973	E7ENV9;E7EX88	.;.	F	973	ENSP00000387356:L973F;ENSP00000341615:L973F	ENSP00000268134:L973F	L	+	1	0	ACAN	87199737	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-1.178000	0.03093	-0.158000	0.11040	-0.311000	0.09066	CTC	-	ACAN	-	NULL		0.557	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	0	0		71	71		0.00		C	NM_001135		89398733	+1	12		69		tier1	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	14.81		SNP	0.000	T	12	69
PLCE1	51196	genome.wustl.edu	37	10	96012079	96012079	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr10:96012079G>T	ENST00000371380.3	+	8	3338	c.3103G>T	c.(3103-3105)Gga>Tga	p.G1035*	PLCE1_ENST00000371385.3_Nonsense_Mutation_p.G727*|PLCE1_ENST00000260766.3_Nonsense_Mutation_p.G1035*|PLCE1_ENST00000371375.1_Nonsense_Mutation_p.G727*			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1035					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				ACAGGAGGATGGACGGTATGA	0.493													ENSG00000138193																																					0													112.0	112.0	112.0					10																	96012079		2071	4217	6288	SO:0001587	stop_gained	0			-		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.3103G>T	10.37:g.96012079G>T	ENSP00000360431:p.Gly1035*		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.G1035*	ENST00000371380.3	37	c.3103	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	G	47	13.437339	0.99742	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.6293	0.45527	0.1425:0.0:0.8575:0.0	.	.	.	.	X	1035;1035;727;727	.	ENSP00000260766:G1035X	G	+	1	0	PLCE1	96002069	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.488000	0.60300	2.850000	0.98022	0.650000	0.86243	GGA	-	PLCE1	-	NULL		0.493	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	0	0		63	63		0.00		G	NM_016341		96012079	+1	7		43		tier1	no_errors	ENST00000260766	ensembl	human	known	74_37	nonsense	14.00		SNP	1.000	T	7	43
KIAA2026	158358	genome.wustl.edu	37	9	5968024	5968024	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:5968024T>C	ENST00000399933.3	-	3	2206	c.2207A>G	c.(2206-2208)aAa>aGa	p.K736R	KIAA2026_ENST00000381461.2_Missense_Mutation_p.K736R	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	736	Lys-rich.									breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CTTACCAGATTTGTGCTTCTT	0.323													ENSG00000183354																																					0													18.0	18.0	18.0					9																	5968024		1821	4049	5870	SO:0001583	missense	0			-	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2207A>G	9.37:g.5968024T>C	ENSP00000382815:p.Lys736Arg		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.K736R	ENST00000399933.3	37	c.2207		9	.	.	.	.	.	.	.	.	.	.	T	9.831	1.188522	0.21954	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.89	4.75	0.60458	.	.	.	.	.	T	0.48696	0.1514	N	0.14661	0.345	0.37898	D	0.930955	D	0.55385	0.971	P	0.55749	0.783	T	0.57849	-0.7740	8	0.62326	D	0.03	.	11.764	0.51920	0.0:0.0688:0.0:0.9312	.	736	Q5HYC2	K2026_HUMAN	R	736	.	ENSP00000370870:K736R	K	-	2	0	KIAA2026	5958024	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.919000	0.70005	1.052000	0.40392	0.477000	0.44152	AAA	-	KIAA2026	-	NULL		0.323	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	0	0		65	65		0.00		T	NM_001017969		5968024	-1	12		30		tier1	no_errors	ENST00000399933	ensembl	human	novel	74_37	missense	28.57		SNP	1.000	C	12	30
ZNF451	26036	genome.wustl.edu	37	6	57015685	57015685	+	Intron	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:57015685G>C	ENST00000370706.4	+	11	2996				RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|ZNF451_ENST00000357489.3_Intron|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|ZNF451_ENST00000491832.2_Intron|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AAAAACAAAAGAAAACTTTTT	0.338													ENSG00000226803																																					0													79.0	73.0	75.0					6																	57015685		1808	4071	5879	SO:0001627	intron_variant	0			-	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2752+25G>C	6.37:g.57015685G>C			Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	R	SNP	-	NULL	ENST00000370706.4	37	NULL	CCDS43477.1	6																																																																																			-	RP11-203B9.4	-	-		0.338	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927211	Clone_based_vega_gene	protein_coding	OTTHUMT00000041035.2	0	0		35	35		0.00		G	NM_015555		57015685	-1	13		19		tier1	no_errors	ENST00000586466	ensembl	human	known	74_37	rna	40.62		SNP	0.000	C	13	19
PTPRU	10076	genome.wustl.edu	37	1	29630536	29630536	+	Silent	SNP	C	C	T	rs137880682		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:29630536C>T	ENST00000345512.3	+	17	2805	c.2676C>T	c.(2674-2676)taC>taT	p.Y892Y	PTPRU_ENST00000323874.8_Silent_p.Y882Y|PTPRU_ENST00000428026.2_Silent_p.Y882Y|PTPRU_ENST00000356870.3_Silent_p.Y882Y|PTPRU_ENST00000460170.2_Silent_p.Y882Y|PTPRU_ENST00000373779.3_Silent_p.Y882Y|PTPRU_ENST00000415600.2_3'UTR	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	892	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CCGAGGGTTACGGCTTCAAGC	0.647													ENSG00000060656																																					0								C	,,,	2,4404	4.2+/-10.8	0,2,2201	44.0	46.0	45.0		2646,2676,2646,2646	-4.5	0.9	1	dbSNP_134	45	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PTPRU	NM_001195001.1,NM_005704.4,NM_133177.3,NM_133178.3	,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,	882/1434,892/1447,882/1441,882/1437	29630536	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			-	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2676C>T	1.37:g.29630536C>T			A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.Y892	ENST00000345512.3	37	c.2676	CCDS334.1	1																																																																																			rs137880682	PTPRU	-	NULL		0.647	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	0	0		36	36		0.00		C			29630536	+1	17		52		tier1	no_errors	ENST00000345512	ensembl	human	known	74_37	silent	24.64		SNP	0.935	T	17	52
RS1	6247	genome.wustl.edu	37	X	18660178	18660178	+	Silent	SNP	G	G	A	rs281865360		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:18660178G>A	ENST00000379984.3	-	6	661	c.621C>T	c.(619-621)caC>caT	p.H207H	CDKL5_ENST00000379989.3_Intron|CDKL5_ENST00000379996.3_Intron|RS1_ENST00000476595.1_5'UTR	NM_000330.3	NP_000321.1	O15537	XLRS1_HUMAN	retinoschisin 1	207	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.		H -> Q (in XLRS1).		adaptation of rhodopsin mediated signaling (GO:0016062)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|retina layer formation (GO:0010842)|visual perception (GO:0007601)	extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(4)|large_intestine(5)|lung(2)|ovary(2)|skin(1)	15	Hepatocellular(33;0.183)					CAATGCGGACGTGCCAGCCCA	0.652													ENSG00000102104																																					0			GRCh37	CM981771	RS1	M							62.0	56.0	58.0					X																	18660178		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF014459	CCDS14187.1	Xp22.2-p22.1	2014-09-17	2008-07-29		ENSG00000102104	ENSG00000102104			10457	protein-coding gene	gene with protein product		300839	"""retinoschisis (X-linked, juvenile) 1"""	RS		9326935, 17804407	Standard	NM_000330		Approved	XLRS1	uc004cyo.3	O15537	OTTHUMG00000021216	ENST00000379984.3:c.621C>T	X.37:g.18660178G>A			Q0QD39	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.H207	ENST00000379984.3	37	c.621	CCDS14187.1	X																																																																																			-	RS1	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.652	RS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RS1	HGNC	protein_coding	OTTHUMT00000055949.1	0	0		69	69		0.00		G			18660178	-1	39		126		tier1	no_errors	ENST00000379984	ensembl	human	known	74_37	silent	23.64		SNP	0.995	A	39	126
PLCB2	5330	genome.wustl.edu	37	15	40591138	40591138	+	Silent	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:40591138C>T	ENST00000260402.3	-	9	960	c.711G>A	c.(709-711)acG>acA	p.T237T	PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000557821.1_Silent_p.T237T|PLCB2_ENST00000456256.2_Silent_p.T237T	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	237					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GGTGCTCCTTCGTCATGTAGG	0.577													ENSG00000137841																																					0													94.0	98.0	97.0					15																	40591138		2031	4182	6213	SO:0001819	synonymous_variant	0			-		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.711G>A	15.37:g.40591138C>T			A8K6J2|B9EGH5	Silent	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLC-beta_C,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.T237	ENST00000260402.3	37	c.711	CCDS42020.1	15																																																																																			-	PLCB2	-	pirsf_PLC-beta,pfam_PLipase_C_EF-hand-like		0.577	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCB2	HGNC	protein_coding	OTTHUMT00000418430.1	0	0		71	71		0.00		C			40591138	-1	16		130		tier1	no_errors	ENST00000260402	ensembl	human	known	74_37	silent	10.96		SNP	0.989	T	16	130
ANKFN1	162282	genome.wustl.edu	37	17	54554883	54554883	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:54554883G>A	ENST00000318698.2	+	15	1852	c.1817G>A	c.(1816-1818)cGt>cAt	p.R606H	ANKFN1_ENST00000566473.2_Missense_Mutation_p.R606H	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	606										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						AGTCATCAGCGTCTCTTTCCT	0.378													ENSG00000153930																																					0													112.0	104.0	107.0					17																	54554883		2203	4300	6503	SO:0001583	missense	0			-	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1817G>A	17.37:g.54554883G>A	ENSP00000321627:p.Arg606His			Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Fibronectin_type3,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3	p.R606H	ENST00000318698.2	37	c.1817	CCDS32686.1	17	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847275	0.71603	.	.	ENSG00000153930	ENST00000318698	T	0.25579	1.79	5.82	5.82	0.92795	.	0.101764	0.64402	D	0.000003	T	0.37210	0.0995	L	0.61218	1.895	0.50313	D	0.999862	D	0.61697	0.99	P	0.46299	0.511	T	0.16928	-1.0386	10	0.62326	D	0.03	-9.4834	20.1012	0.97876	0.0:0.0:1.0:0.0	.	606	Q8N957	ANKF1_HUMAN	H	606	ENSP00000321627:R606H	ENSP00000321627:R606H	R	+	2	0	ANKFN1	51909882	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.779000	0.62375	2.754000	0.94517	0.650000	0.86243	CGT	-	ANKFN1	-	NULL		0.378	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKFN1	HGNC	protein_coding	OTTHUMT00000338043.1	0	0		36	36		0.00		G	NM_153228		54554883	+1	14		11		tier1	no_errors	ENST00000318698	ensembl	human	known	74_37	missense	56.00		SNP	1.000	A	14	11
CTC-305H11.1	0	genome.wustl.edu	37	5	13174884	13174884	+	lincRNA	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:13174884G>A	ENST00000513283.1	+	0	0				AC016553.1_ENST00000410785.1_RNA																							GTTATAttaggttggtacaaa	0.259													ENSG00000222717																																					0																																												0			-																													5.37:g.13174884G>A				R	SNP	-	NULL	ENST00000513283.1	37	NULL		5																																																																																			-	AC016553.1	-	-		0.259	CTC-305H11.1-001	KNOWN	basic	lincRNA	ENSG00000222717	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000367808.1	0	0		66	66		0.00		G			13174884	-1	8		26		tier1	no_errors	ENST00000410785	ensembl	human	novel	74_37	rna	23.53		SNP	0.001	A	8	26
DOPEY2	9980	genome.wustl.edu	37	21	37617593	37617593	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr21:37617593C>G	ENST00000399151.3	+	19	3400	c.3315C>G	c.(3313-3315)gaC>gaG	p.D1105E		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1105					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCGCCCCGGACAGCAGCGAGC	0.642													ENSG00000142197																																					0													120.0	88.0	99.0					21																	37617593		2203	4300	6503	SO:0001583	missense	0			-	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3315C>G	21.37:g.37617593C>G	ENSP00000382104:p.Asp1105Glu		D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	pfam_Dopey_N	p.D1105E	ENST00000399151.3	37	c.3315	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	C	4.325	0.059765	0.08339	.	.	ENSG00000142197	ENST00000399151	T	0.26373	1.74	5.36	2.41	0.29592	.	0.520028	0.20825	N	0.084988	T	0.20210	0.0486	L	0.49350	1.555	0.32917	D	0.515257	B;B	0.13594	0.008;0.004	B;B	0.15870	0.014;0.006	T	0.14615	-1.0466	10	0.27785	T	0.31	.	6.9775	0.24683	0.0:0.5937:0.1332:0.273	.	1105;1105	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	E	1105	ENSP00000382104:D1105E	ENSP00000382104:D1105E	D	+	3	2	DOPEY2	36539463	0.320000	0.24616	0.971000	0.41717	0.292000	0.27327	-0.651000	0.05372	0.685000	0.31468	0.650000	0.86243	GAC	-	DOPEY2	-	NULL		0.642	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	0	0		10	10		0.00		C	NM_005128		37617593	+1	15		33		tier1	no_errors	ENST00000399151	ensembl	human	known	74_37	missense	31.25		SNP	0.987	G	15	33
SREBF2	6721	genome.wustl.edu	37	22	42276779	42276779	+	Silent	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr22:42276779A>G	ENST00000361204.4	+	10	1987	c.1821A>G	c.(1819-1821)gcA>gcG	p.A607A		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	607					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						TGGGCCGGGCACTGCCCACCT	0.587													ENSG00000198911																																					0													49.0	53.0	52.0					22																	42276779		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1821A>G	22.37:g.42276779A>G			Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.T641A	ENST00000361204.4	37	c.1921	CCDS14023.1	22	.	.	.	.	.	.	.	.	.	.	A	10.23	1.294067	0.23564	.	.	ENSG00000198911	ENST00000444813	.	.	.	4.95	-9.89	0.00464	.	.	.	.	.	T	0.41880	0.1178	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47947	-0.9077	4	.	.	.	-7.2948	4.9726	0.14123	0.3077:0.1776:0.427:0.0877	.	.	.	.	A	641	.	.	T	+	1	0	SREBF2	40606725	0.000000	0.05858	0.530000	0.27963	0.845000	0.48019	-3.534000	0.00439	-2.328000	0.00635	-0.436000	0.05848	ACT	-	SREBF2	-	NULL		0.587	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	HGNC	protein_coding	OTTHUMT00000321956.1	0	0		46	46		0.00		A	NM_004599		42276779	+1	19		56		tier1	no_errors	ENST00000424354	ensembl	human	known	74_37	missense	25.33		SNP	0.045	G	19	56
METTL16	79066	genome.wustl.edu	37	17	2310396	2310396	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:2310396G>A	ENST00000609667.1	-	3	455	c.376C>T	c.(376-378)Cag>Tag	p.Q126*																								GAGCTCTTCTGAGAAACCAGA	0.557													ENSG00000205821																																					0													59.0	63.0	62.0					17																	2310396		1926	4131	6057	SO:0001587	stop_gained	0			-																												ENST00000609667.1:c.376C>T	17.37:g.2310396G>A	ENSP00000476359:p.Gln126*			Nonsense_Mutation	SNP	NULL	p.Q126*	ENST00000609667.1	37	c.376		17	.	.	.	.	.	.	.	.	.	.	G	12.44	1.938292	0.34189	.	.	ENSG00000205821	ENST00000381977	.	.	.	4.31	-0.349	0.12609	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.3053	0.06997	0.3856:0.2091:0.4054:0.0	.	.	.	.	X	126	.	ENSP00000371404:Q126X	Q	-	1	0	AC006435.1	2257146	1.000000	0.71417	0.987000	0.45799	0.349000	0.29174	0.949000	0.29109	0.096000	0.17463	-0.373000	0.07131	CAG	-	AC006435.1	-	NULL		0.557	AC006435.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000205821	Clone_based_ensembl_gene	protein_coding		0	0		49	49		0.00		G			2310396	-1	4		37		tier1	no_errors	ENST00000609667	ensembl	human	known	74_37	nonsense	9.76		SNP	0.982	A	4	37
AMZ1	155185	genome.wustl.edu	37	7	2748796	2748796	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:2748796C>T	ENST00000312371.4	+	5	1057	c.689C>T	c.(688-690)gCa>gTa	p.A230V	AMZ1_ENST00000489665.1_Intron|AMZ1_ENST00000407112.1_Intron	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	230							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		GTAGAGGCAGCAGCAGACGGC	0.682													ENSG00000174945																																					0													15.0	19.0	17.0					7																	2748796		2200	4296	6496	SO:0001583	missense	0			-	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.689C>T	7.37:g.2748796C>T	ENSP00000308149:p.Ala230Val		B3KRS0|Q8TF51	Missense_Mutation	SNP	pfam_Pept_M54_archaemetzincn	p.A230V	ENST00000312371.4	37	c.689	CCDS34589.1	7	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641105	0.29157	.	.	ENSG00000174945	ENST00000312371	T	0.24350	1.86	4.49	1.61	0.23674	.	0.194108	0.25578	N	0.029715	T	0.14056	0.0340	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.20042	-1.0287	10	0.27082	T	0.32	-10.2357	3.8725	0.09042	0.1163:0.5381:0.1983:0.1473	.	230	Q400G9	AMZ1_HUMAN	V	230	ENSP00000308149:A230V	ENSP00000308149:A230V	A	+	2	0	AMZ1	2715322	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.067000	0.14510	0.088000	0.17205	-0.448000	0.05591	GCA	-	AMZ1	-	NULL		0.682	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ1	HGNC	protein_coding	OTTHUMT00000325244.1	0	0		15	15		0.00		C	NM_133463		2748796	+1	8		17		tier1	no_errors	ENST00000312371	ensembl	human	known	74_37	missense	32.00		SNP	0.000	T	8	17
ZNF273	10793	genome.wustl.edu	37	7	64388928	64388928	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:64388928delG	ENST00000476120.1	+	4	1293	c.1222delG	c.(1222-1224)ggtfs	p.G408fs	ZNF273_ENST00000319636.5_Frame_Shift_Del_p.G343fs|ZNF273_ENST00000527278.1_3'UTR	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	408					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TGAAGAATGTGGTAAAGCCTT	0.358													ENSG00000198039																									Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												0													45.0	49.0	47.0					7																	64388928		2203	4297	6500	SO:0001589	frameshift_variant	0				X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.1222delG	7.37:g.64388928delG	ENSP00000418719:p.Gly408fs		B3KQZ5|Q6P3V4	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G408fs	ENST00000476120.1	37	c.1222	CCDS5528.2	7																																																																																				ZNF273	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF273	HGNC	protein_coding	OTTHUMT00000313502.1	0	0		73	73		0.00		G			64388928	+1	2		15		tier1	no_errors	ENST00000476120	ensembl	human	known	74_37	frame_shift_del	11.76		DEL	1.000	-	2	15
ATG2A	23130	genome.wustl.edu	37	11	64678645	64678645	+	Missense_Mutation	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:64678645G>C	ENST00000377264.3	-	10	1443	c.1331C>G	c.(1330-1332)cCa>cGa	p.P444R	ATG2A_ENST00000421419.2_Missense_Mutation_p.P444R	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	444					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						TCCGGAAGATGGGGCAGACGT	0.602													ENSG00000110046																																					0													124.0	114.0	117.0					11																	64678645		2201	4297	6498	SO:0001583	missense	0			-		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.1331C>G	11.37:g.64678645G>C	ENSP00000366475:p.Pro444Arg		O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.P444R	ENST00000377264.3	37	c.1331	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310179	0.60414	.	.	ENSG00000110046	ENST00000421419;ENST00000377264	T;T	0.07800	3.16;3.16	4.69	3.78	0.43462	.	0.190463	0.45361	D	0.000367	T	0.08980	0.0222	L	0.61218	1.895	0.44254	D	0.997104	P	0.44877	0.845	B	0.39379	0.298	T	0.09357	-1.0678	10	0.44086	T	0.13	.	5.8198	0.18520	0.0975:0.0:0.711:0.1915	.	444	Q2TAZ0	ATG2A_HUMAN	R	444	ENSP00000410522:P444R;ENSP00000366475:P444R	ENSP00000366475:P444R	P	-	2	0	ATG2A	64435221	0.967000	0.33354	0.846000	0.33378	0.951000	0.60555	1.639000	0.37176	1.345000	0.45676	0.462000	0.41574	CCA	-	ATG2A	-	NULL		0.602	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1	0	0		32	32		0.00		G	NM_015104		64678645	-1	17		34		tier1	no_errors	ENST00000421419	ensembl	human	known	74_37	missense	33.33		SNP	0.971	C	17	34
NPTN	27020	genome.wustl.edu	37	15	73879883	73879883	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:73879883C>T	ENST00000345330.4	-	4	885	c.688G>A	c.(688-690)Gcc>Acc	p.A230T	NPTN_ENST00000542234.1_Intron|NPTN_ENST00000287226.8_Missense_Mutation_p.A230T|NPTN_ENST00000564551.1_5'UTR|NPTN_ENST00000563691.1_Missense_Mutation_p.A230T|NPTN_ENST00000351217.6_Missense_Mutation_p.A114T|NPTN_ENST00000545878.1_Missense_Mutation_p.A230T|NPTN_ENST00000562924.1_Missense_Mutation_p.A114T	NM_001161363.1|NM_012428.3	NP_001154835.1|NP_036560.1	Q9Y639	NPTN_HUMAN	neuroplastin	230	Ig-like 2.				homophilic cell adhesion (GO:0007156)|long-term synaptic potentiation (GO:0060291)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)	cell adhesion molecule binding (GO:0050839)|type 1 fibroblast growth factor receptor binding (GO:0005105)	p.A230T(2)		breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	13						TCAATGGTGGCGTTTGCTTTA	0.498													ENSG00000156642																									Pancreas(101;1519 1568 9459 19537 41286)|Esophageal Squamous(143;1278 1787 35254 36835 44843)												2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|prostate(1)											131.0	120.0	124.0					15																	73879883		2198	4297	6495	SO:0001583	missense	0			-	AF035287	CCDS10249.1, CCDS10250.1, CCDS58379.1, CCDS58380.1	15q24.1	2013-01-29	2006-02-22	2006-02-22	ENSG00000156642	ENSG00000156642		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17867	protein-coding gene	gene with protein product		612820	"""stromal cell derived factor receptor 1"""	SDFR1		8619474, 9110174	Standard	NM_012428		Approved	SDR1, GP55, GP65, np65, np55	uc002avs.3	Q9Y639	OTTHUMG00000137586	ENST00000345330.4:c.688G>A	15.37:g.73879883C>T	ENSP00000290401:p.Ala230Thr		B2RAL7|B7Z4D3|B7ZLL2|Q17R52|Q59EJ9|Q6NVX7|Q9Y640	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_MFS_dom_general_subst_transpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A230T	ENST00000345330.4	37	c.688	CCDS10249.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.441587	0.96187	.	.	ENSG00000156642	ENST00000345330;ENST00000351217;ENST00000545878;ENST00000287226	T;T;T;T	0.37752	1.18;2.91;2.8;2.91	5.59	5.59	0.84812	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.64929	0.2643	M	0.81942	2.565	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77004	0.954;0.989;0.973;0.981	T	0.67975	-0.5531	10	0.66056	D	0.02	.	19.5805	0.95465	0.0:1.0:0.0:0.0	.	230;114;230;114	Q9Y639-5;B2RAL7;Q9Y639;Q9Y639-3	.;.;NPTN_HUMAN;.	T	230;114;230;230	ENSP00000290401:A230T;ENSP00000342958:A114T;ENSP00000444548:A230T;ENSP00000287226:A230T	ENSP00000287226:A230T	A	-	1	0	NPTN	71666936	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.627000	0.46469	2.616000	0.88540	0.563000	0.77884	GCC	-	NPTN	-	smart_Ig_sub,pfscan_Ig-like_dom		0.498	NPTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPTN	HGNC	protein_coding	OTTHUMT00000268980.1	0	0		42	42		0.00		C	NM_012428		73879883	-1	15		75		tier1	no_errors	ENST00000345330	ensembl	human	known	74_37	missense	16.67		SNP	1.000	T	15	75
SLC9A8	23315	genome.wustl.edu	37	20	48467301	48467301	+	Intron	DEL	T	T	-	rs564652819		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr20:48467301delT	ENST00000361573.2	+	7	576				SLC9A8_ENST00000539601.1_Intron|SLC9A8_ENST00000541138.1_Intron|SLC9A8_ENST00000417961.1_Frame_Shift_Del_p.G179fs			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8						ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TTCTCCAGGGTTTTTTTTTTG	0.333													ENSG00000197818																																					0										105,169,3990		0,0,105,2,165,1860	46.0	46.0	46.0			3.5	0.9	20		47	200,298,7756		0,0,200,6,286,3635	no	intron	SLC9A8	NM_015266.1		0,0,305,8,451,5495	A1A1,A1A2,A1R,A2A2,A2R,RR		6.0334,6.4259,6.1671			48467301	305,467,11746	2203	4300	6503	SO:0001627	intron_variant	0				AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.535-46T>-	20.37:g.48467301delT			B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Frame_Shift_Del	DEL	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.F182fs	ENST00000361573.2	37	c.537	CCDS13421.1	20																																																																																				SLC9A8	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.333	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	HGNC	protein_coding	OTTHUMT00000106483.3	0	0		14	14		0.00		T	XM_030524		48467301	+1	5		15		tier1	no_errors	ENST00000417961	ensembl	human	known	74_37	frame_shift_del	25.00		DEL	0.189	-	5	15
PKP2	5318	genome.wustl.edu	37	12	32975533	32975533	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr12:32975533G>T	ENST00000070846.6	-	9	1863	c.1839C>A	c.(1837-1839)aaC>aaA	p.N613K	PKP2_ENST00000340811.4_Missense_Mutation_p.N569K	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	613					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GGTAGGAGAGGTTATGAAGAA	0.408													ENSG00000057294																																					0			GRCh37	CM085058	PKP2	M							95.0	93.0	94.0					12																	32975533		2203	4300	6503	SO:0001583	missense	0			-	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1839C>A	12.37:g.32975533G>T	ENSP00000070846:p.Asn613Lys		A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.N613K	ENST00000070846.6	37	c.1839	CCDS8731.1	12	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637682	0.67130	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.84944	-1.92;-1.92	5.05	3.2	0.36748	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90511	0.7027	M	0.81497	2.545	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.989;0.983	D	0.89744	0.3935	10	0.87932	D	0	-7.0754	7.1379	0.25539	0.3194:0.0:0.6806:0.0	.	569;569;613	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	K	569;613;613	ENSP00000342800:N569K;ENSP00000070846:N613K	ENSP00000070846:N613K	N	-	3	2	PKP2	32866800	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.824000	0.48088	1.114000	0.41781	0.563000	0.77884	AAC	-	PKP2	-	superfamily_ARM-type_fold,smart_Armadillo		0.408	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	HGNC	protein_coding	OTTHUMT00000404449.1	0	0		37	37		0.00		G	NM_004572		32975533	-1	7		53		tier1	no_errors	ENST00000070846	ensembl	human	known	74_37	missense	11.67		SNP	1.000	T	7	53
CDH18	1016	genome.wustl.edu	37	5	19838992	19838992	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:19838992C>A	ENST00000507958.1	-	5	1094	c.104G>T	c.(103-105)aGa>aTa	p.R35I	CDH18_ENST00000274170.4_Missense_Mutation_p.R35I|CDH18_ENST00000511273.1_Missense_Mutation_p.R35I|CDH18_ENST00000502796.1_Missense_Mutation_p.R35I|CDH18_ENST00000382275.1_Missense_Mutation_p.R35I|CDH18_ENST00000506372.1_Missense_Mutation_p.R35I			Q13634	CAD18_HUMAN	cadherin 18, type 2	35					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GGTTTGGTTTCTCATCACCTT	0.433													ENSG00000145526																																					0													231.0	190.0	204.0					5																	19838992		2203	4300	6503	SO:0001583	missense	0			-	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.104G>T	5.37:g.19838992C>A	ENSP00000425093:p.Arg35Ile		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R35I	ENST00000507958.1	37	c.104	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548075	0.45383	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000511273	T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39	5.93	4.16	0.48862	.	0.525108	0.21879	N	0.067763	T	0.19846	0.0477	N	0.08118	0	0.49915	D	0.999833	B;B	0.28512	0.214;0.012	B;B	0.31812	0.136;0.01	T	0.05599	-1.0875	9	.	.	.	.	11.2906	0.49247	0.0:0.8525:0.0:0.1475	.	35;35	B4DHG6;Q13634	.;CAD18_HUMAN	I	35	ENSP00000371710:R35I;ENSP00000425093:R35I;ENSP00000274170:R35I;ENSP00000424931:R35I;ENSP00000422138:R35I;ENSP00000425854:R35I	.	R	-	2	0	CDH18	19874749	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	2.350000	0.44063	0.844000	0.35094	0.655000	0.94253	AGA	-	CDH18	-	NULL		0.433	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	HGNC	protein_coding	OTTHUMT00000366747.1	0	0		143	143		0.00		C	NM_004934		19838992	-1	18		177		tier1	no_errors	ENST00000274170	ensembl	human	known	74_37	missense	9.23		SNP	1.000	A	18	177
DCHS2	54798	genome.wustl.edu	37	4	155160445	155160445	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr4:155160445G>A	ENST00000357232.4	-	24	6003	c.6004C>T	c.(6004-6006)Cct>Tct	p.P2002S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2002	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATTGATTCAGGAACTGTGACC	0.403													ENSG00000197410																																					0													66.0	63.0	64.0					4																	155160445		2203	4300	6503	SO:0001583	missense	0			-	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6004C>T	4.37:g.155160445G>A	ENSP00000349768:p.Pro2002Ser		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_D-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P2002S	ENST00000357232.4	37	c.6004	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	G	11.35	1.614114	0.28712	.	.	ENSG00000197410	ENST00000357232	T	0.52983	0.64	5.95	4.13	0.48395	Cadherin (3);Cadherin-like (1);	0.161498	0.43110	N	0.000617	T	0.34745	0.0908	L	0.33710	1.025	0.80722	D	1	B	0.27166	0.17	B	0.26310	0.068	T	0.12760	-1.0535	10	0.30078	T	0.28	.	10.3418	0.43882	0.1577:0.0:0.8423:0.0	.	2002	Q6V1P9	PCD23_HUMAN	S	2002	ENSP00000349768:P2002S	ENSP00000349768:P2002S	P	-	1	0	DCHS2	155379895	0.996000	0.38824	0.954000	0.39281	0.938000	0.57974	1.442000	0.35046	1.403000	0.46800	0.650000	0.86243	CCT	-	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.403	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	0	0		46	46		0.00		G	NM_001142552		155160445	-1	8		29		tier1	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	21.62		SNP	1.000	A	8	29
ARHGEF15	22899	genome.wustl.edu	37	17	8218893	8218893	+	Splice_Site	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:8218893G>T	ENST00000361926.3	+	7	1531		c.e7+1		ARHGEF15_ENST00000421050.1_Splice_Site|AC135178.7_ENST00000458568.1_RNA	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15						negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						TCAGCGAGCGGTCAGTGGCTT	0.627													ENSG00000198844																																					0													69.0	56.0	60.0					17																	8218893		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1421+1G>T	17.37:g.8218893G>T			A8K6G1|Q8N449|Q9H8B4	Splice_Site	SNP	-	e6+1	ENST00000361926.3	37	c.1421+1	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623867	0.66901	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9743	0.64262	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGEF15	8159618	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	7.579000	0.82511	2.686000	0.91538	0.561000	0.74099	.	-	ARHGEF15	-	-		0.627	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	0	0		34	34		0.00		G	NM_173728	Intron	8218893	+1	11		43		tier1	no_errors	ENST00000361926	ensembl	human	known	74_37	splice_site	20.37		SNP	1.000	T	11	43
FOLH1B	219595	genome.wustl.edu	37	11	89405054	89405054	+	RNA	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:89405054G>T	ENST00000532352.1	+	0	994							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						ATGCTTTCTAGACAGATATGT	0.413													ENSG00000134612																																					0													86.0	85.0	85.0					11																	89405054		2201	4296	6497			0			-	AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89405054G>T				Splice_Site	SNP	-	NULL	ENST00000532352.1	37	c.NULL		11																																																																																			-	FOLH1B	-	-		0.413	FOLH1B-004	KNOWN	basic	processed_transcript	FOLH1B	HGNC	pseudogene	OTTHUMT00000395421.1	0	0		52	52		0.00		G	NM_153696		89405054	+1	5		48		tier1	no_errors	ENST00000525540	ensembl	human	known	74_37	splice_site	9.43		SNP	1.000	T	5	48
WNK3	65267	genome.wustl.edu	37	X	54264792	54264792	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:54264792G>T	ENST00000375159.2	-	18	3996	c.3997C>A	c.(3997-3999)Cag>Aag	p.Q1333K	WNK3_ENST00000375169.3_Missense_Mutation_p.Q1286K|WNK3_ENST00000354646.2_Missense_Mutation_p.Q1333K			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1333					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CGACCCCGCTGAAATGATCCA	0.443													ENSG00000196632																																					0													104.0	89.0	95.0					X																	54264792		2203	4300	6503	SO:0001583	missense	0			-	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.3997C>A	X.37:g.54264792G>T	ENSP00000364301:p.Gln1333Lys		B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q1333K	ENST00000375159.2	37	c.3997	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	G	5.519	0.280619	0.10458	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.70164	-0.45;-0.46;-0.46	5.17	5.17	0.71159	.	0.000000	0.53938	D	0.000056	T	0.46600	0.1401	N	0.19112	0.55	0.26287	N	0.978182	B;B	0.29136	0.234;0.057	B;B	0.30782	0.12;0.027	T	0.34950	-0.9808	10	0.02654	T	1	-6.2791	11.6912	0.51516	0.0:0.0:0.8229:0.1771	.	1286;1333	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	K	1286;1333;1333	ENSP00000364312:Q1286K;ENSP00000346667:Q1333K;ENSP00000364301:Q1333K	ENSP00000346667:Q1333K	Q	-	1	0	WNK3	54281517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.358000	0.52284	2.144000	0.66660	0.600000	0.82982	CAG	-	WNK3	-	NULL		0.443	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	0	0		60	60		0.00		G	NM_020922		54264792	-1	14		91		tier1	no_errors	ENST00000354646	ensembl	human	known	74_37	missense	13.33		SNP	1.000	T	14	91
GCM2	9247	genome.wustl.edu	37	6	10877424	10877424	+	Missense_Mutation	SNP	G	G	A	rs536827295		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:10877424G>A	ENST00000379491.4	-	2	439	c.292C>T	c.(292-294)Cgc>Tgc	p.R98C	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	98					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				AGCTGCAGGCGGGAACCGTCG	0.607													ENSG00000124827																																					0													76.0	71.0	73.0					6																	10877424		2203	4300	6503	SO:0001583	missense	0			-	AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.292C>T	6.37:g.10877424G>A	ENSP00000368805:p.Arg98Cys		D3GDV6|Q5THN5	Missense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.R98C	ENST00000379491.4	37	c.292	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434355	0.62955	.	.	ENSG00000124827	ENST00000379491	T	0.74632	-0.86	5.69	1.33	0.21861	.	0.360015	0.31963	N	0.006784	T	0.43942	0.1270	L	0.48642	1.525	0.58432	D	0.999998	B	0.30236	0.274	B	0.23275	0.045	T	0.44937	-0.9295	10	0.87932	D	0	-5.0006	3.9707	0.09452	0.0845:0.1031:0.2908:0.5215	.	98	O75603	GCM2_HUMAN	C	98	ENSP00000368805:R98C	ENSP00000368805:R98C	R	-	1	0	GCM2	10985410	0.992000	0.36948	0.885000	0.34714	0.712000	0.41017	1.838000	0.39211	0.303000	0.22785	0.650000	0.86243	CGC	-	GCM2	-	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif		0.607	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1	0	0		36	36		0.00		G			10877424	-1	13		88		tier1	no_errors	ENST00000379491	ensembl	human	known	74_37	missense	12.87		SNP	0.869	A	13	88
ZNF451	26036	genome.wustl.edu	37	6	57015498	57015498	+	Intron	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:57015498G>C	ENST00000370706.4	+	11	2852				RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|ZNF451_ENST00000357489.3_Intron|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|ZNF451_ENST00000491832.2_Intron|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AACTCATGTTGATATTTCTCT	0.333													ENSG00000226803																																					0													74.0	68.0	70.0					6																	57015498		1815	4072	5887	SO:0001627	intron_variant	0			-	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2609-19G>C	6.37:g.57015498G>C			Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	R	SNP	-	NULL	ENST00000370706.4	37	NULL	CCDS43477.1	6																																																																																			-	RP11-203B9.4	-	-		0.333	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927211	Clone_based_vega_gene	protein_coding	OTTHUMT00000041035.2	0	0		44	44		0.00		G	NM_015555		57015498	-1	10		35		tier1	no_errors	ENST00000589263	ensembl	human	known	74_37	rna	21.74		SNP	0.001	C	10	35
HEY2	23493	genome.wustl.edu	37	6	126070965	126070965	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:126070965G>T	ENST00000368364.3	+	1	240	c.43G>T	c.(43-45)Gac>Tac	p.D15Y	RP11-624M8.1_ENST00000606001.1_RNA|RP11-624M8.1_ENST00000451660.2_RNA|RP11-624M8.1_ENST00000432121.1_RNA|HEY2_ENST00000368365.1_Intron	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	15					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		GAGCGACATGGACGAGACCAT	0.701													ENSG00000135547																																					0													25.0	24.0	24.0					6																	126070965		2182	4283	6465	SO:0001583	missense	0			-	AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.43G>T	6.37:g.126070965G>T	ENSP00000357348:p.Asp15Tyr			Missense_Mutation	SNP	pfam_bHLH_dom,pfam_Orange,superfamily_bHLH_dom,smart_bHLH_dom,smart_Orange_subgr,pfscan_Orange,pfscan_bHLH_dom,prints_Antifreeze_1	p.D15Y	ENST00000368364.3	37	c.43	CCDS5131.1	6	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486008	0.84854	.	.	ENSG00000135547	ENST00000368364	T	0.66460	-0.21	4.65	4.65	0.58169	.	0.062795	0.64402	D	0.000013	T	0.67392	0.2888	M	0.64404	1.975	0.80722	D	1	D	0.67145	0.996	P	0.51453	0.67	T	0.73827	-0.3860	10	0.87932	D	0	1.8526	17.887	0.88858	0.0:0.0:1.0:0.0	.	15	Q9UBP5	HEY2_HUMAN	Y	15	ENSP00000357348:D15Y	ENSP00000357348:D15Y	D	+	1	0	HEY2	126112658	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	9.168000	0.94781	2.277000	0.76020	0.462000	0.41574	GAC	-	HEY2	-	NULL		0.701	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEY2	HGNC	protein_coding	OTTHUMT00000042077.1	0	0		39	39		0.00		G			126070965	+1	4		39		tier1	no_errors	ENST00000368364	ensembl	human	known	74_37	missense	9.09		SNP	1.000	T	4	39
SLC25A48	153328	genome.wustl.edu	37	5	135188461	135188461	+	Silent	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:135188461G>T	ENST00000420621.1	+	4	544	c.372G>T	c.(370-372)gtG>gtT	p.V124V	SLC25A48_ENST00000412661.2_Silent_p.V124V|SLC25A48_ENST00000274513.5_Silent_p.V124V|SLC25A48_ENST00000433282.2_Silent_p.V70V|SLC25A48_ENST00000425402.1_Intron			Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	124					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						GAGGGCCCGTGGACCTCATCA	0.667													ENSG00000145832																																					0													32.0	35.0	34.0					5																	135188461		1970	4135	6105	SO:0001819	synonymous_variant	0			-		CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000420621.1:c.372G>T	5.37:g.135188461G>T			Q8TAV9	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.V124	ENST00000420621.1	37	c.372		5																																																																																			-	SLC25A48	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier		0.667	SLC25A48-201	KNOWN	basic|appris_principal	protein_coding	SLC25A48	HGNC	protein_coding		0	0		59	59		0.00		G	NM_145282		135188461	+1	20		68		tier1	no_errors	ENST00000420621	ensembl	human	known	74_37	silent	22.73		SNP	1.000	T	20	68
AMZ2	51321	genome.wustl.edu	37	17	66247426	66247427	+	Intron	INS	-	-	CTGTATAG	rs200969552|rs58359332	byFrequency	TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:66247426_66247427insCTGTATAG	ENST00000359904.3	+	4	1718				AMZ2_ENST00000392720.2_Intron|AMZ2_ENST00000577866.1_Intron|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000580753.1_Intron|AMZ2_ENST00000577985.1_Intron|AMZ2_ENST00000359783.4_Intron|AMZ2_ENST00000577273.1_Intron	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GATATTTAAAATATTTTCAGTT	0.356													ENSG00000196704		1657	0.330871	0.5121	0.3487	5008	,	,		15358	0.2768		0.1918	False		,,,				2504	0.272																0																																										SO:0001627	intron_variant	0				CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.586+107->CTGTATAG	17.37:g.66247426_66247427insCTGTATAG			A6NLD9|B3KR44|Q5XKF1|Q9NZE2	R	INS	-	NULL	ENST00000359904.3	37	NULL	CCDS11674.1	17																																																																																				AMZ2	-	-		0.356	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	HGNC	protein_coding	OTTHUMT00000448261.1									-	NM_016627		66247427	+1					tier1	no_errors	ENST00000581779	ensembl	human	known	74_37	rna			INS	0.001:0.003	CTGTATAG		
PNMA2	10687	genome.wustl.edu	37	8	26366390	26366390	+	5'UTR	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr8:26366390G>A	ENST00000522362.2	-	0	776				PNMA2_ENST00000522764.1_5'Flank	NM_007257.5	NP_009188.1	Q9UL42	PNMA2_HUMAN	paraneoplastic Ma antigen 2						positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)	11		all_cancers(63;0.109)|Ovarian(32;2.61e-05)|all_epithelial(46;0.105)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0196)|Epithelial(17;3.13e-11)|Colorectal(74;0.123)		ACCCACCAATGAATGGGTCCC	0.438													ENSG00000240694																																					0																																										SO:0001623	5_prime_UTR_variant	0			-		CCDS34868.1	8p21.1	2012-02-09	2012-02-09		ENSG00000240694	ENSG00000240694		"""Paraneoplastic Ma antigens"""	9159	protein-coding gene	gene with protein product		603970	"""paraneoplastic antigen MA2"""			10362822	Standard	NM_007257		Approved	MA2, RGAG2	uc003xez.2	Q9UL42	OTTHUMG00000163816	ENST00000522362.2:c.-119C>T	8.37:g.26366390G>A			B3KNY9|O94959|O95145|Q49A18|Q9UL43	R	SNP	-	NULL	ENST00000522362.2	37	NULL	CCDS34868.1	8																																																																																			-	PNMA2	-	-		0.438	PNMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA2	HGNC	protein_coding	OTTHUMT00000375709.2	0	0		34	34		0.00		G	NM_007257		26366390	-1	10		23		tier1	no_errors	ENST00000518212	ensembl	human	known	74_37	rna	30.30		SNP	0.000	A	10	23
AC131094.1	0	genome.wustl.edu	37	4	176394181	176394181	+	RNA	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr4:176394181C>T	ENST00000408209.1	+	0	29																											gttaaaatttcgctggggcct	0.542													ENSG00000221136																																					0																																												0			-																													4.37:g.176394181C>T				R	SNP	-	NULL	ENST00000408209.1	37	NULL		4																																																																																			-	AC131094.1	-	-		0.542	AC131094.1-201	NOVEL	basic	miRNA	ENSG00000221136	Clone_based_ensembl_gene	miRNA		0	0		92	92		0.00		C			176394181	+1	12		62		tier1	no_errors	ENST00000408209	ensembl	human	novel	74_37	rna	16.22		SNP	0.049	T	12	62
ZNF451	26036	genome.wustl.edu	37	6	57017071	57017071	+	Silent	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:57017071G>A	ENST00000370706.4	+	12	3049	c.2805G>A	c.(2803-2805)ctG>ctA	p.L935L	RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|ZNF451_ENST00000357489.3_Silent_p.L887L|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|ZNF451_ENST00000491832.2_Silent_p.L935L|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	935					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			ATAACTACCTGAACAGGATTG	0.363													ENSG00000112200																																					0													123.0	118.0	120.0					6																	57017071		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2805G>A	6.37:g.57017071G>A			Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L935	ENST00000370706.4	37	c.2805	CCDS43477.1	6																																																																																			-	ZNF451	-	NULL		0.363	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2	0	0		68	68		0.00		G	NM_015555		57017071	+1	20		90		tier1	no_errors	ENST00000370706	ensembl	human	known	74_37	silent	18.18		SNP	0.997	A	20	90
FDXACB1	91893	genome.wustl.edu	37	11	111746328	111746328	+	Missense_Mutation	SNP	C	C	T	rs137921139		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:111746328C>T	ENST00000260257.4	-	5	1240	c.1193G>A	c.(1192-1194)gGg>gAg	p.G398E	ALG9_ENST00000527377.1_Intron|FDXACB1_ENST00000542429.1_Missense_Mutation_p.G249E|ALG9_ENST00000524880.1_Intron	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	398					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						TTGATTAACCCCAAGGATAAA	0.458													ENSG00000255561	C|||	1	0.000199681	0.0008	0.0	5008	,	,		22224	0.0		0.0	False		,,,				2504	0.0																0													165.0	164.0	164.0					11																	111746328		1883	4111	5994	SO:0001583	missense	0			GMAF=0.0005		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.1193G>A	11.37:g.111746328C>T	ENSP00000260257:p.Gly398Glu		A0PJW7|B4DUU2	Missense_Mutation	SNP	pfam_DUF2431,pfam_PheS_beta_Fdx_antiC-bd,superfamily_PheS_beta_Fdx_antiC-bd,smart_PheS_beta_Fdx_antiC-bd	p.G398E	ENST00000260257.4	37	c.1193	CCDS44729.1	11	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	11.85	1.761897	0.31228	.	.	ENSG00000255561	ENST00000260257;ENST00000542429;ENST00000528274	T;T;T	0.35605	1.3;1.3;1.3	6.17	3.28	0.37604	.	0.204938	0.49916	D	0.000134	T	0.28267	0.0698	L	0.50333	1.59	0.31800	N	0.628506	B	0.26445	0.149	B	0.23419	0.046	T	0.25502	-1.0130	10	0.24483	T	0.36	.	7.7225	0.28740	0.1075:0.4893:0.3402:0.063	.	398	Q9BRP7	FDXA1_HUMAN	E	398;249;309	ENSP00000260257:G398E;ENSP00000441304:G249E;ENSP00000435572:G309E	ENSP00000260257:G398E	G	-	2	0	FDXACB1	111251538	0.870000	0.30015	0.356000	0.25785	0.407000	0.30961	1.747000	0.38298	0.472000	0.27344	0.655000	0.94253	GGG	rs137921139	FDXACB1	-	NULL		0.458	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDXACB1	HGNC	protein_coding	OTTHUMT00000391497.1	0	0		15	15		0.00		C	NM_138378		111746328	-1	5		5		tier1	no_errors	ENST00000260257	ensembl	human	known	74_37	missense	50.00		SNP	0.475	T	5	5
PIKFYVE	200576	genome.wustl.edu	37	2	209215655	209215655	+	Silent	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr2:209215655C>A	ENST00000264380.4	+	37	5753	c.5595C>A	c.(5593-5595)gcC>gcA	p.A1865A		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1865	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						CAGGAGCTGCCTTCTATGCAA	0.478													ENSG00000115020																																					0													90.0	83.0	85.0					2																	209215655		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5595C>A	2.37:g.209215655C>A			Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.A1865	ENST00000264380.4	37	c.5595	CCDS2382.1	2																																																																																			-	PIKFYVE	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub		0.478	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	0	0		81	81		0.00		C	NM_015040		209215655	+1	14		86		tier1	no_errors	ENST00000264380	ensembl	human	known	74_37	silent	14.00		SNP	0.912	A	14	86
HSPA12B	116835	genome.wustl.edu	37	20	3729966	3729966	+	Splice_Site	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr20:3729966G>C	ENST00000254963.2	+	9	1082		c.e9+1		HSPA12B_ENST00000542646.1_Splice_Site	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B								ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						ATGCAAGCAGGTAGGGGGAAA	0.627													ENSG00000132622																																					0													55.0	55.0	55.0					20																	3729966		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.937+1G>C	20.37:g.3729966G>C			D3DVX7|Q2TAK3|Q9BR52	Splice_Site	SNP	-	e8+1	ENST00000254963.2	37	c.937+1	CCDS13061.1	20	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275400	0.80580	.	.	ENSG00000132622	ENST00000254963;ENST00000542646;ENST00000399701	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6736	0.85273	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HSPA12B	3677966	1.000000	0.71417	0.997000	0.53966	0.761000	0.43186	9.430000	0.97488	2.537000	0.85549	0.561000	0.74099	.	-	HSPA12B	-	-		0.627	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12B	HGNC	protein_coding	OTTHUMT00000077756.2	0	0		45	45		0.00		G	NM_052970	Intron	3729966	+1	25		72		tier1	no_errors	ENST00000254963	ensembl	human	known	74_37	splice_site	25.77		SNP	1.000	C	25	72
CMPK2	129607	genome.wustl.edu	37	2	6988912	6988912	+	3'UTR	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr2:6988912C>T	ENST00000256722.5	-	0	2418				CMPK2_ENST00000458098.1_Intron|CMPK2_ENST00000478738.1_5'UTR	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial						cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TATAATTTCCCCCTCACTCAG	0.353													ENSG00000134326																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.*1069G>A	2.37:g.6988912C>T			A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	R	SNP	-	NULL	ENST00000256722.5	37	NULL	CCDS42648.1	2																																																																																			-	CMPK2	-	-		0.353	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CMPK2	HGNC	protein_coding	OTTHUMT00000323339.2	0	0		67	67		0.00		C	NM_207315		6988912	-1	13		27		tier1	no_errors	ENST00000478738	ensembl	human	known	74_37	rna	32.50		SNP	0.000	T	13	27
ZNHIT2	741	genome.wustl.edu	37	11	64884288	64884288	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:64884288G>T	ENST00000310597.4	-	1	882	c.838C>A	c.(838-840)Ccc>Acc	p.P280T	AP003068.12_ENST00000527789.1_RNA	NM_014205.2	NP_055020.1	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT-type containing 2	280							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						GTGCCCAGGGGCCCCGGCGGG	0.701													ENSG00000174276																																					0													13.0	16.0	15.0					11																	64884288		2186	4276	6462	SO:0001583	missense	0			-		CCDS8094.1	11q13	2012-08-08	2010-09-15	2004-07-14	ENSG00000174276	ENSG00000174276		"""Zinc fingers, HIT-type"""	1177	protein-coding gene	gene with protein product		604575	"""chromosome 11 open reading frame 5"", ""zinc finger, HIT domain containing 2"""	C11orf5			Standard	NM_014205		Approved	FON	uc001ocw.3	Q9UHR6	OTTHUMG00000165604	ENST00000310597.4:c.838C>A	11.37:g.64884288G>T	ENSP00000308548:p.Pro280Thr		Q3SY14|Q8IUV0	Missense_Mutation	SNP	pfam_Znf_HIT,pfscan_Znf_HIT	p.P280T	ENST00000310597.4	37	c.838	CCDS8094.1	11	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007418	0.54361	.	.	ENSG00000174276	ENST00000310597;ENST00000528598	T	0.30182	1.54	4.67	4.67	0.58626	.	0.706801	0.12776	U	0.440054	T	0.39489	0.1080	N	0.24115	0.695	0.40598	D	0.981551	D	0.76494	0.999	D	0.71184	0.972	T	0.04650	-1.0936	10	0.16420	T	0.52	-16.8793	15.0938	0.72217	0.0:0.0:1.0:0.0	.	280	Q9UHR6	ZNHI2_HUMAN	T	280;115	ENSP00000308548:P280T	ENSP00000308548:P280T	P	-	1	0	ZNHIT2	64640864	0.977000	0.34250	0.959000	0.39883	0.292000	0.27327	2.631000	0.46502	2.417000	0.82017	0.561000	0.74099	CCC	-	ZNHIT2	-	NULL		0.701	ZNHIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT2	HGNC	protein_coding	OTTHUMT00000385260.1	0	0		18	18		0.00		G	NM_014205		64884288	-1	5		18		tier1	no_errors	ENST00000310597	ensembl	human	known	74_37	missense	21.74		SNP	0.995	T	5	18
ALS2CL	259173	genome.wustl.edu	37	3	46716064	46716064	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr3:46716064A>T	ENST00000318962.4	-	21	2504	c.2421T>A	c.(2419-2421)gaT>gaA	p.D807E	ALS2CL_ENST00000415953.1_Missense_Mutation_p.D807E|ALS2CL_ENST00000383742.3_Missense_Mutation_p.D154E	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	807	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		ACTTCTGCACATCCAGGAACT	0.557													ENSG00000178038																																					0													193.0	183.0	186.0					3																	46716064		2203	4300	6503	SO:0001583	missense	0			-	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2421T>A	3.37:g.46716064A>T	ENSP00000313670:p.Asp807Glu		Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	pfam_MORN,pfam_VPS9,superfamily_DH-domain,smart_MORN,pfscan_VPS9	p.D807E	ENST00000318962.4	37	c.2421	CCDS2743.1	3	.	.	.	.	.	.	.	.	.	.	A	10.04	1.242424	0.22796	.	.	ENSG00000178038	ENST00000318962;ENST00000415953;ENST00000383742	T;T;T	0.33438	1.41;1.41;1.41	5.28	-10.6	0.00265	Vacuolar sorting protein 9 (1);	0.177007	0.37577	N	0.002025	T	0.12347	0.0300	L	0.31664	0.95	0.24245	N	0.995342	B	0.22541	0.071	B	0.23150	0.044	T	0.05146	-1.0903	10	0.51188	T	0.08	.	2.2986	0.04156	0.2789:0.1764:0.3813:0.1634	.	807	Q60I27	AL2CL_HUMAN	E	807;807;154	ENSP00000313670:D807E;ENSP00000413223:D807E;ENSP00000373248:D154E	ENSP00000313670:D807E	D	-	3	2	ALS2CL	46691068	0.000000	0.05858	0.192000	0.23308	0.724000	0.41520	-2.618000	0.00880	-2.862000	0.00326	-0.331000	0.08364	GAT	-	ALS2CL	-	pfscan_VPS9		0.557	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CL	HGNC	protein_coding	OTTHUMT00000250567.3	0	0		21	21		0.00		A	NM_147129		46716064	-1	25		17		tier1	no_errors	ENST00000318962	ensembl	human	known	74_37	missense	59.52		SNP	0.031	T	25	17
TSKS	60385	genome.wustl.edu	37	19	50247562	50247562	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr19:50247562C>G	ENST00000246801.3	-	8	1369	c.1287G>C	c.(1285-1287)caG>caC	p.Q429H	TSKS_ENST00000358830.3_Missense_Mutation_p.Q229H	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	429					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		TTCGAGAGTTCTGAAATTGCC	0.622													ENSG00000126467																																					0													78.0	70.0	73.0					19																	50247562		2203	4300	6503	SO:0001583	missense	0			-	BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.1287G>C	19.37:g.50247562C>G	ENSP00000246801:p.Gln429His		Q8WXJ0	Missense_Mutation	SNP	NULL	p.Q429H	ENST00000246801.3	37	c.1287	CCDS12780.1	19	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092320	0.55968	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	T;T	0.32272	1.46;1.46	4.85	1.25	0.21368	.	0.485483	0.18165	N	0.149647	T	0.24509	0.0594	L	0.27053	0.805	0.26749	N	0.970242	P	0.43094	0.799	P	0.48141	0.568	T	0.07347	-1.0777	10	0.72032	D	0.01	-25.947	4.6896	0.12774	0.0:0.6006:0.1942:0.2052	.	429	Q9UJT2	TSKS_HUMAN	H	429;229	ENSP00000246801:Q429H;ENSP00000351691:Q229H	ENSP00000246801:Q429H	Q	-	3	2	TSKS	54939374	0.498000	0.26075	1.000000	0.80357	0.985000	0.73830	-0.055000	0.11807	0.616000	0.30141	0.555000	0.69702	CAG	-	TSKS	-	NULL		0.622	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	HGNC	protein_coding	OTTHUMT00000465795.1	0	0		28	28		0.00		C	NM_021733		50247562	-1	19		21		tier1	no_errors	ENST00000246801	ensembl	human	known	74_37	missense	47.50		SNP	0.974	G	19	21
RGS3	5998	genome.wustl.edu	37	9	116356457	116356457	+	Intron	SNP	C	C	A	rs555206859		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:116356457C>A	ENST00000374140.2	+	23	3289				RGS3_ENST00000374134.3_Intron|RGS3_ENST00000462403.1_Silent_p.T86T|RGS3_ENST00000350696.5_Intron|RGS3_ENST00000394646.3_Intron|RGS3_ENST00000342620.5_Intron|RGS3_ENST00000343817.5_Intron|RGS3_ENST00000462143.1_Intron	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3						inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CAGCCTGCACCGTTGCTGCCC	0.662													ENSG00000138835																																					0													46.0	52.0	50.0					9																	116356457		2203	4299	6502	SO:0001627	intron_variant	0			-	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.3081-253C>A	9.37:g.116356457C>A			A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Silent	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.T86	ENST00000374140.2	37	c.258	CCDS43869.1	9																																																																																			-	RGS3	-	NULL		0.662	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	0	0		13	13		0.00		C	NM_017790		116356457	+1	9		18		tier1	no_errors	ENST00000462403	ensembl	human	known	74_37	silent	33.33		SNP	0.000	A	9	18
TMEM110	375346	genome.wustl.edu	37	3	52877150	52877150	+	Intron	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr3:52877150C>T	ENST00000355083.5	-	7	764				TMEM110-MUSTN1_ENST00000504329.1_Intron|TMEM110_ENST00000464769.1_5'UTR	NM_198563.2	NP_940965.1	Q86TL2	TM110_HUMAN	transmembrane protein 110							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)	4				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)		TTCCCAGTCTCCACATCCTCG	0.502													ENSG00000213533																																					0																																										SO:0001627	intron_variant	0			-	BC047015	CCDS2866.1	3p21.1	2010-08-13			ENSG00000213533	ENSG00000213533			30526	protein-coding gene	gene with protein product						12477932	Standard	NM_198563		Approved	MGC52022		Q86TL2	OTTHUMG00000150346	ENST00000355083.5:c.619-174G>A	3.37:g.52877150C>T				R	SNP	-	NULL	ENST00000355083.5	37	NULL	CCDS2866.1	3																																																																																			-	TMEM110	-	-		0.502	TMEM110-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM110	HGNC	protein_coding	OTTHUMT00000352949.2	0	0		13	13		0.00		C	NM_198563		52877150	-1	5		4		tier1	no_errors	ENST00000464769	ensembl	human	known	74_37	rna	55.56		SNP	0.005	T	5	4
TTC23	64927	genome.wustl.edu	37	15	99679888	99679888	+	Intron	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:99679888C>T	ENST00000394132.2	-	13	1961				TTC23_ENST00000394136.1_Intron|TTC23_ENST00000394130.1_Intron|RP11-6O2.3_ENST00000564527.1_RNA|TTC23_ENST00000262074.4_Intron|TTC23_ENST00000394135.3_Intron|TTC23_ENST00000558663.1_Intron|TTC23_ENST00000558613.1_Intron			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23											endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			AAGGCAAGAACCTTGGTACTG	0.303													ENSG00000261616																																					0																																										SO:0001627	intron_variant	0			-		CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.1144-284G>A	15.37:g.99679888C>T			A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	R	SNP	-	NULL	ENST00000394132.2	37	NULL	CCDS10379.2	15																																																																																			-	RP11-6O2.3	-	-		0.303	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261616	Clone_based_vega_gene	protein_coding	OTTHUMT00000303953.2	0	0		47	47		0.00		C	NM_022905		99679888	+1	6		53		tier1	no_errors	ENST00000564527	ensembl	human	known	74_37	rna	10.17		SNP	0.000	T	6	53
XRCC3	7517	genome.wustl.edu	37	14	104165290	104165290	+	Silent	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr14:104165290G>A	ENST00000553264.1	-	8	1682	c.886C>T	c.(886-888)Ctg>Ttg	p.L296L	KLC1_ENST00000554280.1_Intron|XRCC3_ENST00000352127.7_Silent_p.L296L|XRCC3_ENST00000554913.1_Silent_p.L296L|KLC1_ENST00000334553.6_Intron|KLC1_ENST00000452929.2_Intron|RP11-73M18.8_ENST00000602422.1_RNA|KLC1_ENST00000348520.6_Intron|XRCC3_ENST00000445556.1_Silent_p.L296L|KLC1_ENST00000557450.1_Intron|XRCC3_ENST00000555055.1_Silent_p.L296L|KLC1_ENST00000555836.1_Intron|XRCC3_ENST00000554974.1_Silent_p.L91L			O43542	XRCC3_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 3	296					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|response to organic substance (GO:0010033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)		TCAGCCAGCAGTCTCACCAGG	0.667								Direct reversal of damage;Homologous recombination					ENSG00000126215																																					0													23.0	21.0	22.0					14																	104165290		2195	4299	6494	SO:0001819	synonymous_variant	0			-	AF035586	CCDS9984.1	14q32.3	2006-05-04				ENSG00000126215			12830	protein-coding gene	gene with protein product	"""RAD51-like"""	600675				7603995	Standard	NM_001100118		Approved		uc001ynz.4	O43542		ENST00000553264.1:c.886C>T	14.37:g.104165290G>A			O43568|Q9BU18	Silent	SNP	pfam_D_recomb/repair_Rad51_C,superfamily_P-loop_NTPase,pirsf_D_recomb/repair_RecA-like,pfscan_D_recomb_RecA/RadB_ATP-bd	p.L296	ENST00000553264.1	37	c.886	CCDS9984.1	14																																																																																			-	XRCC3	-	pfam_D_recomb/repair_Rad51_C,superfamily_P-loop_NTPase,pirsf_D_recomb/repair_RecA-like		0.667	XRCC3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC3	HGNC	protein_coding	OTTHUMT00000414631.1	0	0		24	24		0.00		G	NM_005432		104165290	-1	10		29		tier1	no_errors	ENST00000352127	ensembl	human	known	74_37	silent	25.64		SNP	1.000	A	10	29
PNMA2	10687	genome.wustl.edu	37	8	26366391	26366391	+	5'UTR	SNP	A	A	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr8:26366391A>T	ENST00000522362.2	-	0	775				PNMA2_ENST00000522764.1_5'Flank	NM_007257.5	NP_009188.1	Q9UL42	PNMA2_HUMAN	paraneoplastic Ma antigen 2						positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)	11		all_cancers(63;0.109)|Ovarian(32;2.61e-05)|all_epithelial(46;0.105)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0196)|Epithelial(17;3.13e-11)|Colorectal(74;0.123)		CCCACCAATGAATGGGTCCCA	0.443													ENSG00000240694																																					0																																										SO:0001623	5_prime_UTR_variant	0			-		CCDS34868.1	8p21.1	2012-02-09	2012-02-09		ENSG00000240694	ENSG00000240694		"""Paraneoplastic Ma antigens"""	9159	protein-coding gene	gene with protein product		603970	"""paraneoplastic antigen MA2"""			10362822	Standard	NM_007257		Approved	MA2, RGAG2	uc003xez.2	Q9UL42	OTTHUMG00000163816	ENST00000522362.2:c.-120T>A	8.37:g.26366391A>T			B3KNY9|O94959|O95145|Q49A18|Q9UL43	R	SNP	-	NULL	ENST00000522362.2	37	NULL	CCDS34868.1	8																																																																																			-	PNMA2	-	-		0.443	PNMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA2	HGNC	protein_coding	OTTHUMT00000375709.2	0	0		35	35		0.00		A	NM_007257		26366391	-1	11		23		tier1	no_errors	ENST00000518212	ensembl	human	known	74_37	rna	32.35		SNP	0.000	T	11	23
POTEM	641455	genome.wustl.edu	37	14	20007611	20007611	+	Silent	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr14:20007611G>A	ENST00000551509.1	-	6	1128	c.1077C>T	c.(1075-1077)gaC>gaT	p.D359D	RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	359										endometrium(4)|kidney(1)|lung(4)	9						TTTCTTTGTAGTCAGAAAGTA	0.269													ENSG00000187537																																					0													1.0	1.0	1.0					14																	20007611		2	5	7	SO:0001819	synonymous_variant	0			-		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.1077C>T	14.37:g.20007611G>A				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D359	ENST00000551509.1	37	c.1077	CCDS45076.1	14																																																																																			-	POTEM	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt		0.269	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	0	0		64	64		0.00		G	NM_001145442		20007611	-1	4		23		tier1	no_errors	ENST00000547848	ensembl	human	known	74_37	silent	14.81		SNP	0.230	A	4	23
IDUA	3425	genome.wustl.edu	37	4	995781	995781	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr4:995781C>A	ENST00000247933.4	+	7	892	c.804C>A	c.(802-804)agC>agA	p.S268R	IDUA_ENST00000514224.1_Missense_Mutation_p.S136R|IDUA_ENST00000453894.1_Missense_Mutation_p.L255I	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	268					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GTGCGCGCAGCTCCATCTCCA	0.711													ENSG00000127415																																					0													19.0	20.0	20.0					4																	995781		2172	4256	6428	SO:0001583	missense	0			-	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.804C>A	4.37:g.995781C>A	ENSP00000247933:p.Ser268Arg		B3KWK6	Missense_Mutation	SNP	pfam_Glyco_hydro_39,superfamily_Glycoside_hydrolase_SF,superfamily_Fibronectin_type3,prints_Glyco_hydro_39	p.L255I	ENST00000247933.4	37	c.763	CCDS3343.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.612|8.612	0.889279|0.889279	0.17540|0.17540	.|.	.|.	ENSG00000127415|ENSG00000127415	ENST00000453894|ENST00000247933;ENST00000502910;ENST00000514192;ENST00000514224	D|D;D;D;D	0.94497|0.95482	-3.44|-3.72;-3.35;-3.35;-3.72	4.91|4.91	2.19|2.19	0.27852|0.27852	.|Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.|0.273028	.|0.42294	.|D	.|0.000724	D|D	0.88894|0.88894	0.6561|0.6561	L|L	0.38838|0.38838	1.175|1.175	0.21675|0.21675	N|N	0.999598|0.999598	D|B	0.58268|0.31077	0.982|0.307	P|B	0.48738|0.26693	0.588|0.072	T|T	0.76798|0.76798	-0.2826|-0.2826	9|10	0.33141|0.15066	T|T	0.24|0.55	4.9721|4.9721	6.5043|6.5043	0.22186|0.22186	0.0:0.619:0.0:0.381|0.0:0.619:0.0:0.381	.|.	255|268	B3KWK6|P35475	.|IDUA_HUMAN	I|R	255|268;221;207;136	ENSP00000396458:L255I|ENSP00000247933:S268R;ENSP00000422952:S221R;ENSP00000423685:S207R;ENSP00000425081:S136R	ENSP00000396458:L255I|ENSP00000247933:S268R	L|S	+|+	1|3	0|2	IDUA|IDUA	985781|985781	0.975000|0.975000	0.34042|0.34042	1.000000|1.000000	0.80357|0.80357	0.187000|0.187000	0.23431|0.23431	0.334000|0.334000	0.19787|0.19787	0.603000|0.603000	0.29913|0.29913	0.561000|0.561000	0.74099|0.74099	CTC|AGC	-	IDUA	-	NULL		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IDUA	HGNC	protein_coding	OTTHUMT00000201812.1	0	0		14	14		0.00		C	NM_000203		995781	+1	14		19		tier1	no_errors	ENST00000453894	ensembl	human	known	74_37	missense	42.42		SNP	1.000	A	14	19
CYP4Z1	199974	genome.wustl.edu	37	1	47583592	47583592	+	Nonsense_Mutation	SNP	A	A	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:47583592A>T	ENST00000334194.3	+	12	1507	c.1504A>T	c.(1504-1506)Aaa>Taa	p.K502*	CYP4Z1_ENST00000471598.1_3'UTR|CYP4A22-AS1_ENST00000444042.2_lincRNA	NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	502						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						TGTGTTTGCAAAAAAAGTTTG	0.383													ENSG00000186160																																					0													53.0	47.0	49.0					1																	47583592		2203	4300	6503	SO:0001587	stop_gained	0			-	AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.1504A>T	1.37:g.47583592A>T	ENSP00000334246:p.Lys502*		Q5VVE4	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.K502*	ENST00000334194.3	37	c.1504	CCDS545.1	1	.	.	.	.	.	.	.	.	.	.	a	18.47	3.631623	0.67015	.	.	ENSG00000186160	ENST00000334194	.	.	.	1.23	1.23	0.21249	.	0.154606	0.41823	U	0.000809	.	.	.	.	.	.	0.25997	N	0.982163	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0122	0.30359	1.0:0.0:0.0:0.0	.	.	.	.	X	502	.	ENSP00000334246:K502X	K	+	1	0	CYP4Z1	47356179	0.520000	0.26250	0.006000	0.13384	0.485000	0.33311	0.964000	0.29306	0.847000	0.35167	0.225000	0.17782	AAA	-	CYP4Z1	-	superfamily_Cyt_P450		0.383	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4Z1	HGNC	protein_coding	OTTHUMT00000022020.1	0	0		44	44		0.00		A	NM_178134		47583592	+1	12		20		tier1	no_errors	ENST00000334194	ensembl	human	known	74_37	nonsense	37.50		SNP	0.507	T	12	20
RB1	5925	genome.wustl.edu	37	13	48951157	48951157	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr13:48951157delA	ENST00000267163.4	+	13	1457	c.1319delA	c.(1318-1320)gaafs	p.E440fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	440	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGTTGTGTCGAAATTGGATCA	0.343		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)											107.0	115.0	112.0					13																	48951157		2203	4299	6502	SO:0001589	frameshift_variant	0	Familial Cancer Database			M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1319delA	13.37:g.48951157delA	ENSP00000267163:p.Glu440fs		A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.I441fs	ENST00000267163.4	37	c.1319	CCDS31973.1	13																																																																																				RB1	-	pfam_RB_A,superfamily_Cyclin-like		0.343	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0		48	48		0.00		A			48951157	+1	16		11		tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	59.26		DEL	1.000	-	16	11
IQCK	124152	genome.wustl.edu	37	16	19800230	19800230	+	Missense_Mutation	SNP	T	T	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr16:19800230T>A	ENST00000320394.6	+	8	1375	c.676T>A	c.(676-678)Tgg>Agg	p.W226R	IQCK_ENST00000562762.1_3'UTR|IQCK_ENST00000564186.1_Missense_Mutation_p.W226R|IQCK_ENST00000433597.2_Missense_Mutation_p.W138R|IQCK_ENST00000541926.1_Intron	NM_153208.1	NP_694940.1	Q8N0W5	IQCK_HUMAN	IQ motif containing K	226										kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						TCAATCCTTCTGGAGAGCCTG	0.478													ENSG00000174628																																					0													109.0	106.0	107.0					16																	19800230		2197	4300	6497	SO:0001583	missense	0			-	AF520569	CCDS10580.1	16p12.3	2008-02-05			ENSG00000174628	ENSG00000174628			28556	protein-coding gene	gene with protein product						10493829	Standard	NM_153208		Approved	MGC35048, FLJ36575	uc002dgr.3	Q8N0W5	OTTHUMG00000131453	ENST00000320394.6:c.676T>A	16.37:g.19800230T>A	ENSP00000324901:p.Trp226Arg		B2RDU0|O43327|Q8NFF4	Missense_Mutation	SNP	NULL	p.W226R	ENST00000320394.6	37	c.676	CCDS10580.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.66|18.66	3.671814|3.671814	0.67928|0.67928	.|.	.|.	ENSG00000174628|ENSG00000174628	ENST00000308214|ENST00000320394;ENST00000433597	.|T;T	.|0.24350	.|1.86;1.86	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	.|0.000000	.|0.51477	.|D	.|0.000090	T|T	0.49779|0.49779	0.1577|0.1577	M|M	0.70275|0.70275	2.135|2.135	0.44345|0.44345	D|D	0.997239|0.997239	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.48007|0.48007	-0.9072|-0.9072	5|9	.|.	.|.	.|.	-11.6879|-11.6879	14.0439|14.0439	0.64693|0.64693	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|226	.|Q8N0W5	.|IQCK_HUMAN	Q|R	182|226;138	.|ENSP00000324901:W226R;ENSP00000406013:W138R	.|.	L|W	+|+	2|1	0|0	IQCK|IQCK	19707731|19707731	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.655000|0.655000	0.38815|0.38815	4.848000|4.848000	0.62874|0.62874	2.125000|2.125000	0.65367|0.65367	0.533000|0.533000	0.62120|0.62120	CTG|TGG	-	IQCK	-	NULL		0.478	IQCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCK	HGNC	protein_coding	OTTHUMT00000254273.2	0	0		62	62		0.00		T	NM_153208		19800230	+1	28		54		tier1	no_errors	ENST00000320394	ensembl	human	known	74_37	missense	34.15		SNP	1.000	A	28	54
MT-CO1	4512	genome.wustl.edu	37	M	6264	6264	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrM:6264G>A	ENST00000361624.2	+	1	361	c.361G>A	c.(361-363)Gga>Aga	p.G121R	MT-TC_ENST00000387405.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	121					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TAGTGGAGGCCGGAGCAGGAA	0.547													ENSG00000198804																																					0																																										SO:0001583	missense	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.361G>A	M.37:g.6264G>A	ENSP00000354499:p.Gly121Arg		Q34770	Nonsense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.G121*	ENST00000361624.2	37	c.361		MT																																																																																			-	MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom		0.547	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		0	0		99	99		0.00		G	YP_003024028		6264	+1	20		24		tier1	no_errors	ENST00000361624	ensembl	human	known	74_37	nonsense	45.45		SNP	NULL	A	20	24
DMPK	1760	genome.wustl.edu	37	19	46275980	46275980	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr19:46275980C>G	ENST00000291270.4	-	10	1388	c.1263G>C	c.(1261-1263)atG>atC	p.M421I	AC074212.5_ENST00000592217.2_RNA|DMPK_ENST00000343373.4_Missense_Mutation_p.M431I|DMPK_ENST00000447742.2_Missense_Mutation_p.M416I|DMPK_ENST00000354227.5_Missense_Mutation_p.M416I|AC074212.6_ENST00000591530.1_RNA|DMPK_ENST00000458663.2_Missense_Mutation_p.M416I|AC074212.6_ENST00000590076.1_RNA|AC074212.6_ENST00000586498.1_RNA|AC074212.6_ENST00000586251.1_RNA|DMPK_ENST00000600757.1_Missense_Mutation_p.M426I|DMPK_ENST00000595361.1_5'Flank	NM_004409.3	NP_004400.4	Q09013	DMPK_HUMAN	dystrophia myotonica-protein kinase	421					cellular calcium ion homeostasis (GO:0006874)|muscle cell apoptotic process (GO:0010657)|nuclear envelope organization (GO:0006998)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|regulation of excitatory postsynaptic membrane potential involved in skeletal muscle contraction (GO:0014853)|regulation of heart contraction (GO:0008016)|regulation of myotube differentiation (GO:0010830)|regulation of skeletal muscle contraction by calcium ion signaling (GO:0014722)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of mitochondrial outer membrane (GO:0031307)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|myosin phosphatase regulator activity (GO:0017020)|protein serine/threonine kinase activity (GO:0004674)			endometrium(5)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)|urinary_tract(2)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		CCTCCAGTTCCATGGGTGTGG	0.617													ENSG00000104936																									Esophageal Squamous(35;307 869 9153 24033 28903)												0													41.0	42.0	42.0					19																	46275980		2203	4300	6503	SO:0001583	missense	0			-	L19268	CCDS12674.1, CCDS46117.1, CCDS46118.1, CCDS46119.1, CCDS74400.1	19q13.3	2014-02-05					2.7.11.1		2933	protein-coding gene	gene with protein product	"""dystrophia myotonica 1"", ""DM protein kinase"", ""myotonin protein kinase A"", ""myotonic dystrophy associated protein kinase"", ""thymopoietin homolog"""	605377	"""dystrophia myotonica 1 (includes dystrophia myotonia protein kinase)"""	DM1, DM		1546325, 1546326	Standard	NM_001288765		Approved	DMK, DM1PK, MDPK, MT-PK	uc002pdf.1	Q09013		ENST00000291270.4:c.1263G>C	19.37:g.46275980C>G	ENSP00000291270:p.Met421Ile		E5KR08|Q16205|Q6P5Z6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.M431I	ENST00000291270.4	37	c.1293	CCDS12674.1	19	.	.	.	.	.	.	.	.	.	.	c	13.63	2.293352	0.40594	.	.	ENSG00000104936	ENST00000458663;ENST00000342805;ENST00000291270;ENST00000447742;ENST00000377750;ENST00000343373;ENST00000348168;ENST00000354227	T;T;T;T;T	0.66099	-0.19;-0.17;-0.18;-0.18;-0.11	3.87	3.87	0.44632	AGC-kinase, C-terminal (1);	0.000000	0.52532	D	0.000072	T	0.53254	0.1785	L	0.50333	1.59	0.80722	D	1	B;B;B;B;B;B;B;B	0.32781	0.065;0.228;0.274;0.085;0.146;0.062;0.384;0.179	B;B;B;B;B;B;B;B	0.31290	0.098;0.083;0.112;0.026;0.038;0.036;0.127;0.058	T	0.54788	-0.8241	10	0.35671	T	0.21	.	11.5239	0.50569	0.0:1.0:0.0:0.0	.	416;421;447;416;416;421;463;431	Q09013-12;Q09013-16;G5E982;E5KR07;E5KR05;Q09013;Q59FU6;E5KR08	.;.;.;.;.;DMPK_HUMAN;.;.	I	416;447;421;416;416;431;431;416	ENSP00000401753:M416I;ENSP00000291270:M421I;ENSP00000413417:M416I;ENSP00000345997:M431I;ENSP00000346168:M416I	ENSP00000291270:M421I	M	-	3	0	DMPK	50967820	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.947000	0.40293	2.157000	0.67596	0.561000	0.74099	ATG	-	DMPK	-	NULL		0.617	DMPK-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DMPK	HGNC	protein_coding	OTTHUMT00000460572.1	0	0		44	44		0.00		C	NM_004409		46275980	-1	22		87		tier1	no_errors	ENST00000343373	ensembl	human	known	74_37	missense	20.18		SNP	1.000	G	22	87
TOPORS	10210	genome.wustl.edu	37	9	32552393	32552393	+	Intron	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:32552393G>A	ENST00000360538.2	-	1	120				TOPORS-AS1_ENST00000453396.1_RNA|TOPORS-AS1_ENST00000540066.1_RNA|TOPORS-AS1_ENST00000425533.1_RNA|TOPORS-AS1_ENST00000450093.1_RNA|TOPORS-AS1_ENST00000458036.1_RNA|TOPORS_ENST00000379858.1_Intron	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		AAGGCCCGCAGCTCCCGCCAG	0.652													ENSG00000235453																																					0													11.0	13.0	12.0					9																	32552393		2201	4290	6491	SO:0001627	intron_variant	0			-	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.3+38C>T	9.37:g.32552393G>A			O43273|Q6P987|Q9NS55|Q9UNR9	R	SNP	-	NULL	ENST00000360538.2	37	NULL	CCDS6527.1	9																																																																																			-	TOPORS-AS1	-	-		0.652	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS-AS1	HGNC	protein_coding	OTTHUMT00000052007.1	0	0		33	33		0.00		G	NM_005802		32552393	+1	22		42		tier1	no_errors	ENST00000425533	ensembl	human	known	74_37	rna	33.85		SNP	0.000	A	22	42
ZNF462	58499	genome.wustl.edu	37	9	109691436	109691436	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:109691436C>T	ENST00000277225.5	+	3	5532	c.5243C>T	c.(5242-5244)cCg>cTg	p.P1748L	ZNF462_ENST00000441147.2_Missense_Mutation_p.P593L|ZNF462_ENST00000457913.1_Missense_Mutation_p.P1748L			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1748					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						ATCCCATCCCCGCCCAAGGAC	0.567													ENSG00000148143																																					0													106.0	87.0	93.0					9																	109691436		2203	4300	6503	SO:0001583	missense	0			-	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.5243C>T	9.37:g.109691436C>T	ENSP00000277225:p.Pro1748Leu		Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P1748L	ENST00000277225.5	37	c.5243	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890472	0.72524	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.06768	3.26;3.69;3.74;3.81	6.08	6.08	0.98989	.	0.103096	0.64402	D	0.000002	T	0.13756	0.0333	N	0.14661	0.345	0.80722	D	1	D;D	0.71674	0.998;0.992	P;P	0.56751	0.805;0.644	T	0.08229	-1.0732	10	0.40728	T	0.16	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	1748;1748	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	L	1748;1748;631;593	ENSP00000277225:P1748L;ENSP00000414570:P1748L;ENSP00000363818:P631L;ENSP00000397306:P593L	ENSP00000277225:P1748L	P	+	2	0	ZNF462	108731257	0.988000	0.35896	0.915000	0.36163	0.953000	0.61014	5.545000	0.67237	2.894000	0.99253	0.591000	0.81541	CCG	-	ZNF462	-	NULL		0.567	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	0	0		32	32		0.00		C	NM_021224		109691436	+1	12		39		tier1	no_errors	ENST00000457913	ensembl	human	known	74_37	missense	23.53		SNP	0.994	T	12	39
ZNF451	26036	genome.wustl.edu	37	6	57017129	57017129	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:57017129G>A	ENST00000370706.4	+	12	3107	c.2863G>A	c.(2863-2865)Gat>Aat	p.D955N	RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.D907N|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.D955N|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	955					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AGATGCTGCTGATTTTGCCAT	0.378													ENSG00000112200																																					0													150.0	142.0	145.0					6																	57017129		2203	4300	6503	SO:0001583	missense	0			-	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2863G>A	6.37:g.57017129G>A	ENSP00000359740:p.Asp955Asn		Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D955N	ENST00000370706.4	37	c.2863	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000296	0.93227	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.07908	3.15;3.15;3.15	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	M	0.78801	2.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.02226	-1.1192	10	0.87932	D	0	-20.7387	19.1881	0.93653	0.0:0.0:1.0:0.0	.	907;955;955	Q9Y4E5-2;Q9Y4E5;E9PH99	.;ZN451_HUMAN;.	N	955;907;955	ENSP00000359740:D955N;ENSP00000350083:D907N;ENSP00000421645:D955N	ENSP00000350083:D907N	D	+	1	0	ZNF451	57125088	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.722000	0.74735	2.604000	0.88044	0.655000	0.94253	GAT	-	ZNF451	-	NULL		0.378	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2	0	0		56	56		0.00		G	NM_015555		57017129	+1	13		72		tier1	no_errors	ENST00000370706	ensembl	human	known	74_37	missense	15.29		SNP	1.000	A	13	72
IQGAP3	128239	genome.wustl.edu	37	1	156507018	156507018	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:156507018G>A	ENST00000361170.2	-	27	3387	c.3377C>T	c.(3376-3378)aCt>aTt	p.T1126I	IQGAP3_ENST00000498755.1_5'UTR	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1126	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAACTTATCAGTCATGGCGAG	0.572													ENSG00000183856																																					0													170.0	142.0	151.0					1																	156507018		2203	4300	6503	SO:0001583	missense	0			-	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3377C>T	1.37:g.156507018G>A	ENSP00000354451:p.Thr1126Ile		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.T1126I	ENST00000361170.2	37	c.3377	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883267	0.91740	.	.	ENSG00000183856	ENST00000361170	T	0.79653	-1.29	4.93	4.93	0.64822	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	D	0.87426	0.6174	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.88594	0.3145	10	0.87932	D	0	-14.6168	16.8795	0.86060	0.0:0.0:1.0:0.0	.	1126	Q86VI3	IQGA3_HUMAN	I	1126	ENSP00000354451:T1126I	ENSP00000354451:T1126I	T	-	2	0	IQGAP3	154773642	1.000000	0.71417	0.339000	0.25562	0.991000	0.79684	9.657000	0.98554	2.566000	0.86566	0.561000	0.74099	ACT	-	IQGAP3	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP		0.572	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	0	0		78	78		0.00		G	NM_178229		156507018	-1	33		105		tier1	no_errors	ENST00000361170	ensembl	human	known	74_37	missense	23.91		SNP	1.000	A	33	105
OR13D1	286365	genome.wustl.edu	37	9	107456942	107456942	+	Silent	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:107456942C>A	ENST00000318763.5	+	1	283	c.240C>A	c.(238-240)atC>atA	p.I80I		NM_001004484.1	NP_001004484.1	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D, member 1	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(10)|ovary(1)|prostate(2)|skin(2)	19						TCATTATCATCACCATCTTGG	0.453													ENSG00000179055																																					0													222.0	222.0	222.0					9																	107456942		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS35094.1	9q31.1	2013-09-24			ENSG00000179055	ENSG00000179055		"""GPCR / Class A : Olfactory receptors"""	14695	protein-coding gene	gene with protein product							Standard	NM_001004484		Approved		uc011lvs.2	Q8NGV5	OTTHUMG00000020412	ENST00000318763.5:c.240C>A	9.37:g.107456942C>A			B9EIS1|Q6IFL1	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I80	ENST00000318763.5	37	c.240	CCDS35094.1	9																																																																																			-	OR13D1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.453	OR13D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13D1	HGNC	protein_coding	OTTHUMT00000053483.1	0	0		81	81		0.00		C			107456942	+1	13		84		tier1	no_errors	ENST00000318763	ensembl	human	known	74_37	silent	13.40		SNP	0.000	A	13	84
APEX2	27301	genome.wustl.edu	37	X	55033727	55033727	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:55033727C>A	ENST00000374987.3	+	6	1482	c.1416C>A	c.(1414-1416)caC>caA	p.H472Q	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	472					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						GTGGGGGCCACAGGGAGCCAT	0.612								Other BER factors					ENSG00000169188																																					0													29.0	24.0	26.0					X																	55033727		2203	4298	6501	SO:0001583	missense	0			-	AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.1416C>A	X.37:g.55033727C>A	ENSP00000364126:p.His472Gln		Q9Y5X7	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Znf_GRF,superfamily_Endo/exonuclease/phosphatase,tigrfam_AP_endonuc_1	p.H472Q	ENST00000374987.3	37	c.1416	CCDS14365.1	X	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350825	0.61183	.	.	ENSG00000169188	ENST00000374987	T	0.26223	1.75	4.87	1.9	0.25705	Zinc finger, GRF-type (1);	0.000000	0.85682	D	0.000000	T	0.57198	0.2037	H	0.95645	3.7	0.52501	D	0.99995	D	0.71674	0.998	D	0.77004	0.989	T	0.59043	-0.7528	10	0.87932	D	0	-25.6851	7.7494	0.28888	0.0:0.4789:0.0:0.5211	.	472	Q9UBZ4	APEX2_HUMAN	Q	472	ENSP00000364126:H472Q	ENSP00000364126:H472Q	H	+	3	2	APEX2	55050452	0.816000	0.29132	0.435000	0.26784	0.963000	0.63663	0.467000	0.22035	0.113000	0.18004	0.513000	0.50165	CAC	-	APEX2	-	pfam_Znf_GRF		0.612	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX2	HGNC	protein_coding	OTTHUMT00000056845.1	0	0		37	37		0.00		C			55033727	+1	24		114		tier1	no_errors	ENST00000374987	ensembl	human	known	74_37	missense	17.39		SNP	0.973	A	24	114
SERPIND1	3053	genome.wustl.edu	37	22	21138335	21138335	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr22:21138335A>T	ENST00000215727.5	+	3	1248	c.965A>T	c.(964-966)aAg>aTg	p.K322M	SERPIND1_ENST00000406799.1_Missense_Mutation_p.K322M|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000255882.6_Intron|PI4KA_ENST00000572273.1_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	322					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	GAGGTAGTTAAGGTTTCCATG	0.522											OREG0026325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000099937																																					0													166.0	149.0	155.0					22																	21138335		2203	4300	6503	SO:0001583	missense	0			-	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.965A>T	22.37:g.21138335A>T	ENSP00000215727:p.Lys322Met	746	B2RAI1|D3DX34|Q6IBZ5	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.K322M	ENST00000215727.5	37	c.965	CCDS13783.1	22	.	.	.	.	.	.	.	.	.	.	A	17.58	3.425615	0.62733	.	.	ENSG00000099937	ENST00000215727;ENST00000406799	D;D	0.85339	-1.97;-1.97	4.25	4.25	0.50352	Serpin domain (3);	0.049932	0.85682	D	0.000000	D	0.84497	0.5485	M	0.62154	1.92	0.51012	D	0.999909	P;P	0.35894	0.526;0.526	B;B	0.39971	0.315;0.315	D	0.85319	0.1083	10	0.49607	T	0.09	.	13.8128	0.63273	1.0:0.0:0.0:0.0	.	322;322	Q8IVC0;P05546	.;HEP2_HUMAN	M	322	ENSP00000215727:K322M;ENSP00000384050:K322M	ENSP00000215727:K322M	K	+	2	0	SERPIND1	19468335	1.000000	0.71417	0.932000	0.37286	0.783000	0.44284	5.892000	0.69790	1.913000	0.55393	0.533000	0.62120	AAG	-	SERPIND1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.522	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPIND1	HGNC	protein_coding	OTTHUMT00000319961.1	0	0		36	36		0.00		A	NM_000185		21138335	+1	13		59		tier1	no_errors	ENST00000215727	ensembl	human	known	74_37	missense	18.06		SNP	1.000	T	13	59
ZSWIM8	23053	genome.wustl.edu	37	10	75553404	75553404	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr10:75553404G>T	ENST00000605216.1	+	11	2589	c.2372G>T	c.(2371-2373)cGt>cTt	p.R791L	ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.R791L|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.R791L|ZSWIM8_ENST00000431225.1_3'UTR|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.R758L|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.R791L	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	791							zinc ion binding (GO:0008270)										GAGGCCTCCCGTCTCACTGTG	0.597													ENSG00000214655																																					0													81.0	85.0	84.0					10																	75553404		2062	4181	6243	SO:0001583	missense	0			-	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.2372G>T	10.37:g.75553404G>T	ENSP00000474748:p.Arg791Leu		B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.R791L	ENST00000605216.1	37	c.2372		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.195309|4.195309	0.78902|0.78902	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000398706|ENST00000431225;ENST00000412198	T|.	0.43688|.	0.94|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.096864|.	0.42172|.	U|.	0.000751|.	T|T	0.73118|0.73118	0.3546|0.3546	L|L	0.59436|0.59436	1.845|1.845	0.54753|0.54753	D|D	0.999987|0.999987	P;P;P;P|.	0.38020|.	0.462;0.615;0.462;0.462|.	B;B;B;B|.	0.35931|.	0.153;0.21;0.214;0.153|.	T|T	0.69209|0.69209	-0.5205|-0.5205	10|5	0.51188|.	T|.	0.08|.	-6.1033|-6.1033	19.4432|19.4432	0.94831|0.94831	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	791;791;791;791|.	A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4|.	K0913_HUMAN;.;.;.|.	L|F	791|288;61	ENSP00000381693:R791L|.	ENSP00000381693:R791L|.	R|V	+|+	2|1	0|0	KIAA0913|KIAA0913	75223410|75223410	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	5.540000|5.540000	0.67205|0.67205	2.833000|2.833000	0.97629|0.97629	0.650000|0.650000	0.86243|0.86243	CGT|GTC	-	ZSWIM8	-	NULL		0.597	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	ZSWIM8	HGNC	protein_coding	OTTHUMT00000468545.1	0	0		22	22		0.00		G	NM_001242487		75553404	+1	18		16		tier1	no_errors	ENST00000398706	ensembl	human	known	74_37	missense	52.94		SNP	1.000	T	18	16
RIT2	6014	genome.wustl.edu	37	18	40503652	40503652	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr18:40503652C>T	ENST00000326695.5	-	4	482	c.311G>A	c.(310-312)cGt>cAt	p.R104H	RIT2_ENST00000590910.1_Missense_Mutation_p.V125I|RIT2_ENST00000282028.4_Missense_Mutation_p.R104H|RIT2_ENST00000589109.1_Missense_Mutation_p.R104H	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	104					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AAATGATTGACGGTCAGTGAC	0.468													ENSG00000152214																																					0													218.0	222.0	220.0					18																	40503652		2203	4300	6503	SO:0001583	missense	0			-	BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.311G>A	18.37:g.40503652C>T	ENSP00000321805:p.Arg104His		B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R104H	ENST00000326695.5	37	c.311	CCDS11921.1	18	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664843	0.88251	.	.	ENSG00000152214	ENST00000326695;ENST00000282028	T;T	0.78364	-1.17;-1.17	5.45	4.58	0.56647	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000002	D	0.86920	0.6049	M	0.81802	2.56	0.48087	D	0.99958	D;D	0.89917	1.0;1.0	D;D	0.63703	0.917;0.911	D	0.88331	0.2968	10	0.56958	D	0.05	.	14.4894	0.67639	0.0:0.9291:0.0:0.0709	.	104;104	Q99578-2;Q99578	.;RIT2_HUMAN	H	104	ENSP00000321805:R104H;ENSP00000282028:R104H	ENSP00000282028:R104H	R	-	2	0	RIT2	38757650	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.704000	0.54815	1.444000	0.47605	0.655000	0.94253	CGT	-	RIT2	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom		0.468	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIT2	HGNC	protein_coding	OTTHUMT00000255852.1	0	0		28	28		0.00		C	NM_002930		40503652	-1	19		20		tier1	no_errors	ENST00000326695	ensembl	human	known	74_37	missense	48.72		SNP	1.000	T	19	20
ZNF793	390927	genome.wustl.edu	37	19	38024339	38024339	+	Intron	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr19:38024339A>G	ENST00000587143.1	+	5	473				ZNF793_ENST00000445217.1_Intron|ZNF793_ENST00000542455.1_Intron|ZNF793_ENST00000588578.1_Intron|ZNF793_ENST00000587986.1_Missense_Mutation_p.E91G|ZNF793_ENST00000589319.1_Intron			Q6ZN11	ZN793_HUMAN	zinc finger protein 793						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGGGGTACTGAAGGAGGCTGG	0.498													ENSG00000188227																									Melanoma(44;400 1431 1499 19093)												0													54.0	55.0	54.0					19																	38024339		1922	4122	6044	SO:0001627	intron_variant	0			-	AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.238+34A>G	19.37:g.38024339A>G			E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.E91G	ENST00000587143.1	37	c.272	CCDS46062.1	19																																																																																			-	ZNF793	-	NULL		0.498	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF793	HGNC	protein_coding	OTTHUMT00000458621.1	0	0		97	97		0.00		A	NM_001013659		38024339	+1	30		46		tier1	no_errors	ENST00000587986	ensembl	human	putative	74_37	missense	39.47		SNP	0.000	G	30	46
MT-ND5	4540	genome.wustl.edu	37	M	12986	12986	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrM:12986T>C	ENST00000361567.2	+	1	650	c.650T>C	c.(649-651)cTc>cCc	p.L217P	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	217					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ACTAGGCCTCCTCCTAGCAGC	0.542													ENSG00000198786																																					0																																										SO:0001583	missense	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.650T>C	M.37:g.12986T>C	ENSP00000354813:p.Leu217Pro		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_DH_UbQ/plastoQ_OxRdtase,pfam_DH_DH_su5_C,pfam_DH_UbQ_OxRdtase_chain5/L_N,tigrfam_DHpl_OxRdtase_5	p.L217P	ENST00000361567.2	37	c.650		MT																																																																																			-	MT-ND5	-	pfam_DH_UbQ/plastoQ_OxRdtase,tigrfam_DHpl_OxRdtase_5		0.542	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		0	0		73	73		0.00		T	YP_003024036		12986	+1	52		4		tier1	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	92.86		SNP	NULL	C	52	4
TMEM217	221468	genome.wustl.edu	37	6	37186212	37186212	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:37186212C>G	ENST00000336655.2	-	2	634	c.595G>C	c.(595-597)Gag>Cag	p.E199Q	TMEM217_ENST00000497775.1_Intron|TMEM217_ENST00000356757.2_Missense_Mutation_p.E199Q	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217	199						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						ctctgcctctcaaagtactgg	0.473													ENSG00000172738																																					0													26.0	28.0	27.0					6																	37186212		2203	4297	6500	SO:0001583	missense	0			-		CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.595G>C	6.37:g.37186212C>G	ENSP00000338164:p.Glu199Gln		Q8TC54	Missense_Mutation	SNP	NULL	p.E199Q	ENST00000336655.2	37	c.595	CCDS4831.1	6	.	.	.	.	.	.	.	.	.	.	C	0.548	-0.850621	0.02651	.	.	ENSG00000172738	ENST00000356757;ENST00000336655	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	T	0.06416	0.0165	N	0.14661	0.345	0.09310	N	1	B;B	0.23891	0.001;0.093	B;B	0.17979	0.0;0.02	T	0.37407	-0.9707	7	0.30078	T	0.28	.	.	.	.	.	199;199	Q8N7C4-2;Q8N7C4	.;TM217_HUMAN	Q	199	.	ENSP00000338164:E199Q	E	-	1	0	TMEM217	37294190	0.001000	0.12720	0.010000	0.14722	0.016000	0.09150	-0.338000	0.07842	0.192000	0.20272	0.195000	0.17529	GAG	-	TMEM217	-	NULL		0.473	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM217	HGNC	protein_coding	OTTHUMT00000357542.1	0	0		19	19		0.00		C	NM_145316		37186212	-1	192		20		tier1	no_errors	ENST00000336655	ensembl	human	known	74_37	missense	90.14		SNP	0.013	G	192	20
TP53	7157	genome.wustl.edu	37	17	7574017	7574017	+	Missense_Mutation	SNP	C	C	A	rs121912664		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:7574017C>A	ENST00000269305.4	-	10	1199	c.1010G>T	c.(1009-1011)cGc>cTc	p.R337L	TP53_ENST00000445888.2_Missense_Mutation_p.R337L|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	337	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9452042}.|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11481490}.|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R337L(15)|p.0?(8)|p.R337H(4)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATCTCGAAGCGCTCACGCCC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	29	Substitution - Missense(19)|Whole gene deletion(8)|Unknown(1)|Deletion - Frameshift(1)	lung(8)|liver(8)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|breast(1)	GRCh37	CM012663	TP53	M	rs121912664						57.0	45.0	49.0					17																	7574017		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1010G>T	17.37:g.7574017C>A	ENSP00000269305:p.Arg337Leu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R337L	ENST00000269305.4	37	c.1010	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539589	0.45176	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.95137	-3.62;-3.62	5.43	3.45	0.39498	p53, tetramerisation domain (3);	0.000000	0.85682	D	0.000000	D	0.96558	0.8877	M	0.82323	2.585	0.42190	D	0.991726	D	0.65815	0.995	D	0.66716	0.946	D	0.95854	0.8877	10	0.66056	D	0.02	-7.3279	9.8868	0.41266	0.0:0.8331:0.0:0.1669	.	337	P04637	P53_HUMAN	L	337;337;326	ENSP00000269305:R337L;ENSP00000391478:R337L	ENSP00000269305:R337L	R	-	2	0	TP53	7514742	0.593000	0.26840	0.008000	0.14137	0.280000	0.26924	0.875000	0.28079	0.671000	0.31185	0.561000	0.74099	CGC	-	TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0		20	20		0.00		C	NM_000546		7574017	-1	20		4		tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	83.33		SNP	0.896	A	20	4
UBA1	7317	genome.wustl.edu	37	X	47060958	47060958	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:47060958C>T	ENST00000335972.6	+	8	943	c.760C>T	c.(760-762)Cag>Tag	p.Q254*	UBA1_ENST00000377351.4_Nonsense_Mutation_p.Q254*	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	254	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTCAGAAGTACAGGGCATGGT	0.537													ENSG00000130985																																					0													40.0	33.0	35.0					X																	47060958		2203	4300	6503	SO:0001587	stop_gained	0			-	AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.760C>T	X.37:g.47060958C>T	ENSP00000338413:p.Gln254*		Q5JRR8|Q96E13	Nonsense_Mutation	SNP	pfam_ThiF_D_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.Q254*	ENST00000335972.6	37	c.760	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	C	36	5.677928	0.96764	.	.	ENSG00000130985	ENST00000377351;ENST00000412206;ENST00000442035;ENST00000335972	.	.	.	4.74	4.74	0.60224	.	0.061537	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-19.7391	12.1745	0.54178	0.0:0.8304:0.1696:0.0	.	.	.	.	X	254;254;268;254	.	ENSP00000338413:Q254X	Q	+	1	0	UBA1	46945902	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.847000	0.55895	2.339000	0.79563	0.509000	0.49947	CAG	-	UBA1	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1		0.537	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	0	0		33	33		0.00		C	NM_003334		47060958	+1	20		68		tier1	no_errors	ENST00000335972	ensembl	human	known	74_37	nonsense	22.73		SNP	1.000	T	20	68
RUNDC3B	154661	genome.wustl.edu	37	7	87329764	87329764	+	Missense_Mutation	SNP	G	G	A	rs139503670		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:87329764G>A	ENST00000338056.3	+	4	728	c.317G>A	c.(316-318)aGt>aAt	p.S106N	RUNDC3B_ENST00000493037.1_Missense_Mutation_p.S89N|RUNDC3B_ENST00000394654.3_Missense_Mutation_p.S89N|ABCB1_ENST00000265724.3_Intron	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	106	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					GGTTATGAAAGTCCTCGTAGC	0.348													ENSG00000105784																																					0													81.0	77.0	79.0					7																	87329764		2203	4300	6503	SO:0001583	missense	0			-		CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.317G>A	7.37:g.87329764G>A	ENSP00000337732:p.Ser106Asn		B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.S106N	ENST00000338056.3	37	c.317	CCDS5609.1	7	.	.	.	.	.	.	.	.	.	.	G	29.1	4.978403	0.92982	.	.	ENSG00000105784	ENST00000338056;ENST00000493037;ENST00000394654	T;T;T	0.11169	2.8;2.8;2.8	5.18	5.18	0.71444	RUN (2);	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	L	0.40543	1.245	0.80722	D	1	P;P;P;D;P	0.57899	0.896;0.896;0.728;0.981;0.741	P;P;B;D;P	0.66351	0.649;0.649;0.42;0.943;0.665	T	0.00577	-1.1662	10	0.37606	T	0.19	-12.1603	18.2905	0.90129	0.0:0.0:1.0:0.0	.	89;89;11;89;106	E9PBR4;B4DFD0;Q96NL0-2;Q96NL0-4;Q96NL0	.;.;.;.;RUN3B_HUMAN	N	106;89;89	ENSP00000337732:S106N;ENSP00000420394:S89N;ENSP00000378149:S89N	ENSP00000337732:S106N	S	+	2	0	RUNDC3B	87167700	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.566000	0.82347	2.402000	0.81655	0.585000	0.79938	AGT	-	RUNDC3B	-	pfam_Run,pfscan_Run		0.348	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	RUNDC3B	HGNC	protein_coding	OTTHUMT00000253679.1	0	0		28	28		0.00		G	NM_138290		87329764	+1	11		40		tier1	no_errors	ENST00000338056	ensembl	human	known	74_37	missense	21.57		SNP	1.000	A	11	40
PLXNB1	5364	genome.wustl.edu	37	3	48462755	48462756	+	Frame_Shift_Ins	INS	-	-	GGCCACA			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr3:48462755_48462756insGGCCACA	ENST00000358536.4	-	8	1960_1961	c.1691_1692insTGTGGCC	c.(1690-1692)ccafs	p.-564fs	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000456774.1_Frame_Shift_Ins_p.-564fs|PLXNB1_ENST00000296440.6_Frame_Shift_Ins_p.-564fs|PLXNB1_ENST00000358459.4_Frame_Shift_Ins_p.-564fs	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1						axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ATGACTCCCCTGGCCACAGGGG	0.594													ENSG00000164050																																					0																																										SO:0001589	frameshift_variant	0				X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.1685_1691dupTGTGGCC	3.37:g.48462756_48462762dupGGCCACA	ENSP00000351338:p.Pro564fs		A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Frame_Shift_Ins	INS	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G565fs	ENST00000358536.4	37	c.1692_1691	CCDS2765.1	3																																																																																				PLXNB1	-	NULL		0.594	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	HGNC	protein_coding	OTTHUMT00000344454.1									-	NM_002673		48462756	-1					tier1	no_errors	ENST00000296440	ensembl	human	known	74_37	frame_shift_ins			INS	0.457:0.965	GGCCACA		
ALDH7A1	501	genome.wustl.edu	37	5	125887816	125887816	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:125887816G>T	ENST00000409134.3	-	14	1433	c.1214C>A	c.(1213-1215)cCt>cAt	p.P405H	ALDH7A1_ENST00000447989.2_Missense_Mutation_p.P368H|RNU6-963P_ENST00000363477.1_RNA|ALDH7A1_ENST00000553117.1_Missense_Mutation_p.P341H	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	405					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		ATAATTTCCAGGGCGATCCAT	0.403													ENSG00000164904																																					0													70.0	63.0	65.0					5																	125887816		2203	4300	6503	SO:0001583	missense	0			-	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.1214C>A	5.37:g.125887816G>T	ENSP00000387123:p.Pro405His		B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.P405H	ENST00000409134.3	37	c.1214	CCDS4137.2	5	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866353	0.71949	.	.	ENSG00000164904	ENST00000409134;ENST00000553117;ENST00000447989;ENST00000437170	D;D;D	0.90844	-2.74;-2.74;-2.74	4.88	4.88	0.63580	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.048568	0.85682	D	0.000000	D	0.92932	0.7751	L	0.43646	1.37	0.38535	D	0.949077	D;D	0.76494	0.994;0.999	P;D	0.65323	0.885;0.934	D	0.93976	0.7254	10	0.62326	D	0.03	.	18.1741	0.89756	0.0:0.0:1.0:0.0	.	368;405	E7EPT3;P49419	.;AL7A1_HUMAN	H	405;341;368;213	ENSP00000387123:P405H;ENSP00000448593:P341H;ENSP00000414132:P368H	ENSP00000387123:P405H	P	-	2	0	ALDH7A1	125915715	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.394000	0.97261	2.688000	0.91661	0.655000	0.94253	CCT	-	ALDH7A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH		0.403	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH7A1	HGNC	protein_coding	OTTHUMT00000250921.2	0	0		34	34		0.00		G	NM_001182		125887816	-1	4		40		tier1	no_errors	ENST00000409134	ensembl	human	known	74_37	missense	9.09		SNP	1.000	T	4	40
OR4M2	390538	genome.wustl.edu	37	15	22368626	22368626	+	Silent	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:22368626A>G	ENST00000332663.2	+	1	149	c.51A>G	c.(49-51)ctA>ctG	p.L17L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCACTGGCCTATCCCAGACTC	0.348													ENSG00000182974																																					0													265.0	234.0	245.0					15																	22368626		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.51A>G	15.37:g.22368626A>G			B9EH16|Q6IEY2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L17	ENST00000332663.2	37	c.51	CCDS32172.1	15																																																																																			-	OR4M2	-	NULL		0.348	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	OR4M2	HGNC	protein_coding	OTTHUMT00000414921.1	0	0		138	138		0.00		A			22368626	+1	20		75		tier1	no_errors	ENST00000332663	ensembl	human	putative	74_37	silent	21.05		SNP	0.984	G	20	75
CASP8AP2	9994	genome.wustl.edu	37	6	90584050	90584050	+	RNA	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:90584050C>T	ENST00000551025.1	+	0	14688									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		cacacataAACGGCTTTGCCT	0.244													ENSG00000118412																									Colon(187;1656 2025 17045 31481 39901)												0																																												0			-	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90584050C>T				R	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			-	CASP8AP2	-	-		0.244	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		0	0		84	84		0.00		C	NM_001137667		90584050	+1	7		59		tier1	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	10.61		SNP	0.826	T	7	59
FAM188B	84182	genome.wustl.edu	37	7	30921893	30921893	+	Missense_Mutation	SNP	G	G	A	rs199649103		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:30921893G>A	ENST00000265299.6	+	16	2146	c.2069G>A	c.(2068-2070)cGt>cAt	p.R690H	AQP1_ENST00000509504.1_Missense_Mutation_p.R153H|INMT-FAM188B_ENST00000458257.1_3'UTR|AQP1_ENST00000434909.2_Missense_Mutation_p.R36H	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	690										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGGCTCCTGCGTGACTGGAGG	0.607													ENSG00000106125																																					0								G	HIS/ARG	0,3910		0,0,1955	60.0	63.0	62.0		2069	-1.3	0.1	7		62	4,8282		0,4,4139	yes	missense	FAM188B	NM_032222.2	29	0,4,6094	AA,AG,GG		0.0483,0.0,0.0328	probably-damaging	690/758	30921893	4,12192	1955	4143	6098	SO:0001583	missense	0			-	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.2069G>A	7.37:g.30921893G>A	ENSP00000265299:p.Arg690His		Q71AZ7|Q9H6D2	Missense_Mutation	SNP	NULL	p.R690H	ENST00000265299.6	37	c.2069	CCDS43565.1	7	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133261	0.37630	0.0	4.83E-4	ENSG00000106125;ENSG00000106125;ENSG00000240583;ENSG00000250424	ENST00000265299;ENST00000409881;ENST00000434909;ENST00000509504	T;T;T	0.31247	1.5;1.5;1.5	5.38	-1.28	0.09318	.	0.985940	0.08295	N	0.967772	T	0.36635	0.0974	L	0.47190	1.495	0.09310	N	1	P;D;D	0.69078	0.579;0.994;0.997	B;P;P	0.54590	0.147;0.756;0.756	T	0.36187	-0.9758	10	0.87932	D	0	1.4457	7.4316	0.27131	0.2962:0.14:0.5638:0.0	.	36;210;690	B4E220;B8ZZX1;Q4G0A6	.;.;F188B_HUMAN	H	690;210;36;153	ENSP00000265299:R690H;ENSP00000395059:R36H;ENSP00000421315:R153H	ENSP00000265299:R690H	R	+	2	0	RP5-877J2.1;FAM188B;AQP1	30888418	0.032000	0.19561	0.091000	0.20842	0.290000	0.27261	1.215000	0.32431	-0.058000	0.13177	0.655000	0.94253	CGT	rs199649103	FAM188B	-	NULL		0.607	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188B	HGNC	protein_coding	OTTHUMT00000327962.1	0	0		29	29		0.00		G	NM_032222		30921893	+1	19		71		tier1	no_errors	ENST00000265299	ensembl	human	known	74_37	missense	21.11		SNP	0.004	A	19	71
PCDHGA3	56112	genome.wustl.edu	37	5	140724710	140724710	+	Silent	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:140724710C>T	ENST00000253812.6	+	1	1110	c.1110C>T	c.(1108-1110)gaC>gaT	p.D370D	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	370	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTTATCGACGTGCATGACC	0.433													ENSG00000254245																																					0													116.0	120.0	119.0					5																	140724710		1986	4182	6168	SO:0001819	synonymous_variant	0			-	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1110C>T	5.37:g.140724710C>T			Q9Y5D4	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D370	ENST00000253812.6	37	c.1110	CCDS47290.1	5																																																																																			-	PCDHGA3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.433	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	0	0		21	21		0.00		C	NM_018916		140724710	+1	9		25		tier1	no_errors	ENST00000253812	ensembl	human	known	74_37	silent	26.47		SNP	0.415	T	9	25
CEP131	22994	genome.wustl.edu	37	17	79173312	79173312	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:79173312G>T	ENST00000269392.4	-	10	1308	c.1061C>A	c.(1060-1062)gCg>gAg	p.A354E	AZI1_ENST00000374782.3_Missense_Mutation_p.A354E|AZI1_ENST00000575907.1_Missense_Mutation_p.A354E|AZI1_ENST00000570482.2_5'Flank|RP11-455O6.2_ENST00000571085.1_RNA|AZI1_ENST00000450824.2_Missense_Mutation_p.A354E	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		354					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GGCAGTGCTCGCCTTCTGGGC	0.652													ENSG00000141577																																					0													40.0	31.0	34.0					17																	79173312		2192	4295	6487	SO:0001583	missense	0			-																												ENST00000269392.4:c.1061C>A	17.37:g.79173312G>T	ENSP00000269392:p.Ala354Glu		A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	superfamily_t-SRE	p.A354E	ENST00000269392.4	37	c.1061		17	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127383	0.37533	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.30448	1.53;1.53;1.53	4.33	2.26	0.28386	.	0.815154	0.10370	N	0.682887	T	0.26955	0.0660	L	0.34521	1.04	0.09310	N	1	P;P;D;P	0.60575	0.688;0.815;0.988;0.815	B;B;P;B	0.51324	0.209;0.287;0.666;0.287	T	0.08229	-1.0732	10	0.10111	T	0.7	.	6.3599	0.21422	0.0977:0.0:0.7222:0.1801	.	354;354;354;354	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	E	354	ENSP00000393583:A354E;ENSP00000363914:A354E;ENSP00000269392:A354E	ENSP00000269392:A354E	A	-	2	0	AZI1	76787907	0.000000	0.05858	0.057000	0.19452	0.048000	0.14542	0.577000	0.23758	0.422000	0.26005	-0.657000	0.03884	GCG	-	AZI1	-	NULL		0.652	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	AZI1	HGNC	protein_coding	OTTHUMT00000256070.1	0	0		44	44		0.00		G			79173312	-1	9		99		tier1	no_errors	ENST00000269392	ensembl	human	known	74_37	missense	8.33		SNP	0.005	T	9	99
HPCA	3208	genome.wustl.edu	37	1	33354493	33354493	+	5'UTR	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:33354493G>A	ENST00000373467.3	+	0	96				HPCA_ENST00000480118.1_3'UTR	NM_002143.2	NP_002134.2	P84074	HPCA_HUMAN	hippocalcin						inner ear development (GO:0048839)		actin binding (GO:0003779)|calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				GACTTGGCTCGGCGGCCATGG	0.627													ENSG00000121905																																					0													46.0	49.0	48.0					1																	33354493		2203	4299	6502	SO:0001623	5_prime_UTR_variant	0			-	BC001777	CCDS370.1	1p35-p34.2	2013-01-10			ENSG00000121905	ENSG00000121905		"""EF-hand domain containing"""	5144	protein-coding gene	gene with protein product		142622				8166736, 9931466	Standard	NM_002143		Approved		uc001bwh.3	P84074	OTTHUMG00000004017	ENST00000373467.3:c.-7G>A	1.37:g.33354493G>A			B2R9T3|D3DPQ7|P32076|P41211|P70510	R	SNP	-	NULL	ENST00000373467.3	37	NULL	CCDS370.1	1																																																																																			-	HPCA	-	-		0.627	HPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCA	HGNC	protein_coding	OTTHUMT00000011480.1	0	0		26	26		0.00		G	NM_002143		33354493	+1	10		46		tier1	no_errors	ENST00000480118	ensembl	human	known	74_37	rna	17.86		SNP	0.000	A	10	46
BOC	91653	genome.wustl.edu	37	3	112969691	112969691	+	Intron	SNP	T	T	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr3:112969691T>C	ENST00000495514.1	+	4	1080				BOC_ENST00000273395.4_Intron|BOC_ENST00000355385.3_Intron|BOC_ENST00000484034.1_Silent_p.A129A|BOC_ENST00000485230.1_Silent_p.A129A			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GTGAGTCTGCTCCTTTGCCTC	0.597													ENSG00000144857																																					0													31.0	31.0	31.0					3																	112969691		2203	4300	6503	SO:0001627	intron_variant	0			-	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.376+11T>C	3.37:g.112969691T>C			A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A129	ENST00000495514.1	37	c.387	CCDS2971.1	3																																																																																			-	BOC	-	NULL		0.597	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3	0	0		37	37		0.00		T	NM_033254		112969691	+1	15		67		tier1	no_errors	ENST00000484034	ensembl	human	putative	74_37	silent	18.29		SNP	0.000	C	15	67
