#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
NEMF	9147	genome.wustl.edu	37	14	50295796	50295796	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr14:50295796G>C	ENST00000298310.5	-	13	1657	c.1208C>G	c.(1207-1209)aCa>aGa	p.T403R	NEMF_ENST00000545773.1_Missense_Mutation_p.T361R|NEMF_ENST00000546046.1_Missense_Mutation_p.T403R|NEMF_ENST00000556925.1_5'UTR			O60524	NEMF_HUMAN	nuclear export mediator factor	403					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						AACATGGTTTGTTTGTAGTTT	0.348													ENSG00000165525																																					0													179.0	174.0	176.0					14																	50295796		2203	4300	6503	SO:0001583	missense	0			-	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1208C>G	14.37:g.50295796G>C	ENSP00000298310:p.Thr403Arg		A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	pfam_Fibro-bd_N,pfam_DUF3441,pfam_DUF814,superfamily_FlgN-like_dom	p.T403R	ENST00000298310.5	37	c.1208	CCDS9694.1	14	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757549	0.49468	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000546046;ENST00000534912;ENST00000555970	T;T;T;T	0.42131	0.99;0.98;0.99;0.98	5.34	5.34	0.76211	Fibronectin-binding A, N-terminal (1);	0.105408	0.64402	D	0.000006	T	0.52008	0.1708	L	0.41492	1.28	0.80722	D	1	B;B;B;B;D	0.55605	0.203;0.067;0.203;0.203;0.972	B;B;B;B;P	0.59825	0.099;0.064;0.142;0.061;0.864	T	0.34079	-0.9843	10	0.19590	T	0.45	-17.3322	19.0363	0.92980	0.0:0.0:1.0:0.0	.	403;174;378;361;403	O60524-3;F5H639;O60524-5;O60524-4;O60524	.;.;.;.;NEMF_HUMAN	R	403;361;403;174;361	ENSP00000298310:T403R;ENSP00000438309:T361R;ENSP00000441016:T403R;ENSP00000452540:T361R	ENSP00000298310:T403R	T	-	2	0	NEMF	49365546	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.263000	0.78421	2.496000	0.84212	0.591000	0.81541	ACA	-	NEMF	-	pfam_Fibro-bd_N		0.348	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEMF	HGNC	protein_coding	OTTHUMT00000410798.1	0	0	0	35	35	87	0.00	0.00	G	NM_004713		50295796	-1	12	27	2	16	tier1	no_errors	ENST00000298310	ensembl	human	known	74_37	missense	85.71	62.79	SNP	1.000	C	12	2
TRIOBP	11078	genome.wustl.edu	37	22	38131171	38131171	+	Missense_Mutation	SNP	G	G	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr22:38131171G>A	ENST00000406386.3	+	9	5083	c.4828G>A	c.(4828-4830)Ggg>Agg	p.G1610R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1610					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CAGGGCTTTAGGGCCAGAGCT	0.662											OREG0026548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000100106																																					0													28.0	35.0	33.0					22																	38131171		2014	4159	6173	SO:0001583	missense	0			-	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4828G>A	22.37:g.38131171G>A	ENSP00000384312:p.Gly1610Arg	875	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G1610R	ENST00000406386.3	37	c.4828	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801421	0.50315	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.33438	1.41	5.42	5.42	0.78866	.	.	.	.	.	T	0.40015	0.1100	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	P	0.61940	0.896	T	0.24728	-1.0152	9	0.66056	D	0.02	.	14.7223	0.69317	0.0:0.0:1.0:0.0	.	1610	Q9H2D6	TARA_HUMAN	R	1610;1571	ENSP00000384312:G1610R	ENSP00000384312:G1610R	G	+	1	0	TRIOBP	36461117	0.056000	0.20664	0.025000	0.17156	0.257000	0.26127	1.400000	0.34577	2.539000	0.85634	0.563000	0.77884	GGG	-	TRIOBP	-	NULL		0.662	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	0	0	0	43	43	31	0.00	0.00	G			38131171	+1	18	5	23	11	tier1	no_errors	ENST00000406386	ensembl	human	known	74_37	missense	42.86	31.25	SNP	0.067	A	18	23
PROSER1	80209	genome.wustl.edu	37	13	39598657	39598657	+	Missense_Mutation	SNP	T	T	G			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr13:39598657T>G	ENST00000352251.3	-	7	1350	c.517A>C	c.(517-519)Aac>Cac	p.N173H	PROSER1_ENST00000350125.3_Missense_Mutation_p.N151H|PROSER1_ENST00000484434.3_5'Flank	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	173																	TTGCCTTCGTTAGTACATTCT	0.333													ENSG00000120685																																					0													124.0	107.0	113.0					13																	39598657		2203	4300	6503	SO:0001583	missense	0			-	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.517A>C	13.37:g.39598657T>G	ENSP00000332034:p.Asn173His		A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	NULL	p.N173H	ENST00000352251.3	37	c.517	CCDS9368.2	13	.	.	.	.	.	.	.	.	.	.	T	21.1	4.095831	0.76870	.	.	ENSG00000120685	ENST00000352251;ENST00000350125;ENST00000436678	T;T	0.39056	1.11;1.1	5.65	5.65	0.86999	.	.	.	.	.	T	0.41534	0.1163	N	0.19112	0.55	0.37410	D	0.913184	D;D	0.53885	0.963;0.963	P;P	0.54026	0.74;0.74	T	0.41998	-0.9477	8	.	.	.	-4.0902	15.0632	0.71970	0.0:0.0:0.0:1.0	.	151;173	A6NJ97;Q86XN7	.;PRSR1_HUMAN	H	173;151;152	ENSP00000332034:N173H;ENSP00000339123:N151H	.	N	-	1	0	PROSER1	38496657	1.000000	0.71417	0.941000	0.38009	0.979000	0.70002	7.083000	0.76859	2.155000	0.67459	0.533000	0.62120	AAC	-	PROSER1	-	NULL		0.333	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	0	0	0	41	41	73	0.00	0.00	T	NM_025138		39598657	-1	30	29	7	11	tier1	no_errors	ENST00000352251	ensembl	human	known	74_37	missense	81.08	72.50	SNP	0.989	G	30	7
FAM122B	159090	genome.wustl.edu	37	X	133922773	133922773	+	Missense_Mutation	SNP	C	C	G			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chrX:133922773C>G	ENST00000370790.1	-	5	1293	c.365G>C	c.(364-366)aGg>aCg	p.R122T	FAM122B_ENST00000343004.5_Missense_Mutation_p.R141T|FAM122B_ENST00000298090.6_Missense_Mutation_p.R141T|FAM122B_ENST00000486347.1_Missense_Mutation_p.R122T|FAM122B_ENST00000493333.1_5'UTR	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B	122										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					TCCGAATCCCCTGGTGGGTGA	0.388													ENSG00000156504																																					0													90.0	80.0	83.0					X																	133922773		2203	4300	6503	SO:0001583	missense	0			-	BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.365G>C	X.37:g.133922773C>G	ENSP00000359826:p.Arg122Thr		A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Missense_Mutation	SNP	NULL	p.R141T	ENST00000370790.1	37	c.422	CCDS55497.1	X	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251275	0.80135	.	.	ENSG00000156504	ENST00000370790;ENST00000298090;ENST00000343004;ENST00000486347	.	.	.	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	D	0.84465	0.5478	M	0.87827	2.91	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.996;0.992;0.997;0.997;0.999	D;P;D;D;D;D	0.91635	0.999;0.895;0.974;0.993;0.993;0.925	D	0.87017	0.2126	9	0.66056	D	0.02	.	17.4014	0.87460	0.0:1.0:0.0:0.0	.	88;141;69;122;122;141	B4DN12;G1UD80;Q7Z309-5;Q7Z309-2;Q7Z309;Q7Z309-3	.;.;.;.;F122B_HUMAN;.	T	122;141;141;122	.	ENSP00000298090:R141T	R	-	2	0	FAM122B	133750439	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	5.468000	0.66743	2.322000	0.78497	0.523000	0.50628	AGG	-	FAM122B	-	NULL		0.388	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM122B	HGNC	protein_coding	OTTHUMT00000058382.1	0	0	0	56	56	115	0.00	0.00	C	NM_145284		133922773	-1	24	43	37	63	tier1	no_errors	ENST00000343004	ensembl	human	known	74_37	missense	39.34	40.57	SNP	1.000	G	24	37
ANKRD50	57182	genome.wustl.edu	37	4	125593642	125593642	+	Nonsense_Mutation	SNP	T	T	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr4:125593642T>A	ENST00000504087.1	-	4	1827	c.790A>T	c.(790-792)Aag>Tag	p.K264*	ANKRD50_ENST00000515641.1_Nonsense_Mutation_p.K85*	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	264										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						TGAACATCCTTGACGATATAT	0.348													ENSG00000151458																																					0													64.0	60.0	62.0					4																	125593642		2203	4299	6502	SO:0001587	stop_gained	0			-	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.790A>T	4.37:g.125593642T>A	ENSP00000425658:p.Lys264*		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.K264*	ENST00000504087.1	37	c.790	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	T	43	10.124373	0.99342	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	.	.	.	5.43	5.43	0.79202	.	0.065185	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6396	0.76984	0.0:0.0:0.0:1.0	.	.	.	.	X	264;85	.	ENSP00000425658:K264X	K	-	1	0	ANKRD50	125813092	1.000000	0.71417	0.959000	0.39883	0.162000	0.22319	5.589000	0.67523	2.277000	0.76020	0.528000	0.53228	AAG	-	ANKRD50	-	NULL		0.348	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1	0	0	0	28	28	62	0.00	0.00	T	NM_020337		125593642	-1	16	30	23	81	tier1	no_errors	ENST00000504087	ensembl	human	known	74_37	nonsense	40.00	27.03	SNP	0.999	A	16	23
ARNT	405	genome.wustl.edu	37	1	150804195	150804195	+	Intron	SNP	A	A	G			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr1:150804195A>G	ENST00000358595.5	-	10	1156				ARNT_ENST00000354396.2_Intron|ARNT_ENST00000468970.1_5'UTR|ARNT_ENST00000505755.1_Intron|ARNT_ENST00000515192.1_Intron	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator						cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACACAAAAGTACATTTCATAT	0.333			T	ETV6	AML								ENSG00000143437																												Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	0																																										SO:0001627	intron_variant	0			-	AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.955+98T>C	1.37:g.150804195A>G			B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	R	SNP	-	NULL	ENST00000358595.5	37	NULL	CCDS970.1	1																																																																																			-	ARNT	-	-		0.333	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARNT	HGNC	protein_coding	OTTHUMT00000084741.2	0	0	0	37	37	92	0.00	0.00	A			150804195	-1	17	54	22	120	tier1	no_errors	ENST00000468970	ensembl	human	known	74_37	rna	43.59	31.03	SNP	0.006	G	17	22
OR8D1	283159	genome.wustl.edu	37	11	124180329	124180329	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr11:124180329C>A	ENST00000357821.2	-	1	404	c.334G>T	c.(334-336)Ggt>Tgt	p.G112C		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		AGGAGGTAACCCTCAGCCACC	0.468													ENSG00000196341																																					0													77.0	71.0	73.0					11																	124180329		2201	4299	6500	SO:0001583	missense	0			-	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.334G>T	11.37:g.124180329C>A	ENSP00000350474:p.Gly112Cys		B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G112C	ENST00000357821.2	37	c.334	CCDS31706.1	11	.	.	.	.	.	.	.	.	.	.	c	3.041	-0.197412	0.06259	.	.	ENSG00000196341	ENST00000357821	T	0.01051	5.4	4.29	-8.58	0.00897	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37669	U	0.001983	T	0.00271	0.0008	N	0.00143	-2	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.28427	-1.0044	10	0.02654	T	1	.	9.5223	0.39143	0.6708:0.1276:0.0:0.2016	.	112	Q8WZ84	OR8D1_HUMAN	C	112	ENSP00000350474:G112C	ENSP00000350474:G112C	G	-	1	0	OR8D1	123685539	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.667000	0.00846	-1.730000	0.01362	-0.363000	0.07495	GGT	-	OR8D1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.468	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D1	HGNC	protein_coding	OTTHUMT00000387285.1	0	0	0	63	63	111	0.00	0.00	C	NM_001002917		124180329	-1	27	37	38	59	tier1	no_errors	ENST00000357821	ensembl	human	known	74_37	missense	41.54	38.54	SNP	0.000	A	27	38
TIMELESS	8914	genome.wustl.edu	37	12	56827326	56827326	+	Missense_Mutation	SNP	T	T	C			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr12:56827326T>C	ENST00000553532.1	-	4	512	c.362A>G	c.(361-363)aAa>aGa	p.K121R	TIMELESS_ENST00000229201.4_Missense_Mutation_p.K121R|TIMELESS_ENST00000554616.1_Missense_Mutation_p.K121R					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CCTCACCTCTTTGTAGGCCTG	0.488													ENSG00000111602																																					0													105.0	110.0	108.0					12																	56827326		2203	4300	6503	SO:0001583	missense	0			-	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.362A>G	12.37:g.56827326T>C	ENSP00000450607:p.Lys121Arg			Missense_Mutation	SNP	pfam_TIMELESS_C,pfam_Timeless	p.K121R	ENST00000553532.1	37	c.362	CCDS8918.1	12	.	.	.	.	.	.	.	.	.	.	T	25.1	4.607422	0.87157	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.76448	-1.02;-1.02;-1.02	5.42	5.42	0.78866	Timeless protein (1);	0.000000	0.85682	D	0.000000	D	0.89884	0.6844	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91923	0.5549	10	0.87932	D	0	-21.1443	14.7612	0.69607	0.0:0.0:0.0:1.0	.	121;121	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	R	121	ENSP00000229201:K121R;ENSP00000450607:K121R;ENSP00000450848:K121R	ENSP00000229201:K121R	K	-	2	0	TIMELESS	55113593	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.869000	0.87170	2.191000	0.70037	0.528000	0.53228	AAA	-	TIMELESS	-	pfam_Timeless		0.488	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	0	0	0	29	29	131	0.00	0.00	T	NM_003920		56827326	-1	13	34	3	17	tier1	no_errors	ENST00000553532	ensembl	human	known	74_37	missense	81.25	66.67	SNP	1.000	C	13	3
ZBTB3	79842	genome.wustl.edu	37	11	62520110	62520110	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr11:62520110G>A	ENST00000394807.3	-	2	1302	c.1177C>T	c.(1177-1179)Cag>Tag	p.Q393*		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						GCCTCTGGCTGGGAGGGCTGT	0.567													ENSG00000185670																																					0													50.0	49.0	49.0					11																	62520110		2202	4299	6501	SO:0001587	stop_gained	0			-	AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.1177C>T	11.37:g.62520110G>A	ENSP00000378286:p.Gln393*			Nonsense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q393*	ENST00000394807.3	37	c.1177	CCDS8034.1	11	.	.	.	.	.	.	.	.	.	.	G	14.74	2.624503	0.46840	.	.	ENSG00000185670	ENST00000394807	.	.	.	3.98	3.98	0.46160	.	1.052510	0.07429	N	0.895452	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	8.9515	0.35792	0.0:0.0:0.7787:0.2213	.	.	.	.	X	393	.	ENSP00000378286:Q393X	Q	-	1	0	ZBTB3	62276686	0.004000	0.15560	0.940000	0.37924	0.402000	0.30811	1.109000	0.31135	2.066000	0.61787	0.561000	0.74099	CAG	-	ZBTB3	-	NULL		0.567	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB3	HGNC	protein_coding	OTTHUMT00000395342.1	0	0	1	37	37	72	0.00	1.37	G	NM_024784		62520110	-1	13	24	22	35	tier1	no_errors	ENST00000394807	ensembl	human	known	74_37	nonsense	37.14	40.68	SNP	0.008	A	13	22
POM121L2	94026	genome.wustl.edu	37	6	27278742	27278742	+	Missense_Mutation	SNP	G	G	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr6:27278742G>A	ENST00000444565.1	-	1	1207	c.1208C>T	c.(1207-1209)cCt>cTt	p.P403L	POM121L2_ENST00000377451.2_Intron	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	403										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						TTCCAACTGAGGATTTGCTCC	0.498													ENSG00000158553																																					0													103.0	86.0	91.0					6																	27278742		692	1591	2283	SO:0001583	missense	0			-	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1208C>T	6.37:g.27278742G>A	ENSP00000392726:p.Pro403Leu		C9J1I7	Missense_Mutation	SNP	NULL	p.P403L	ENST00000444565.1	37	c.1208	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423513	0.25639	.	.	ENSG00000158553	ENST00000444565	T	0.15718	2.4	3.85	1.11	0.20524	.	.	.	.	.	T	0.05227	0.0139	L	0.42744	1.35	0.09310	N	1	B	0.27229	0.172	B	0.27262	0.078	T	0.37407	-0.9707	9	0.87932	D	0	.	5.8549	0.18714	0.3403:0.0:0.6597:0.0	.	403	C9J1I7	.	L	403	ENSP00000392726:P403L	ENSP00000392726:P403L	P	-	2	0	POM121L2	27386721	0.464000	0.25807	0.001000	0.08648	0.006000	0.05464	2.306000	0.43673	0.220000	0.20860	-0.258000	0.10820	CCT	-	POM121L2	-	NULL		0.498	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	0	0	0	64	64	72	0.00	0.00	G	NM_033482		27278742	-1	17	18	44	46	tier1	no_errors	ENST00000444565	ensembl	human	known	74_37	missense	27.87	28.12	SNP	0.001	A	17	44
SCN1A	6323	genome.wustl.edu	37	2	166854673	166854673	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr2:166854673G>T	ENST00000303395.4	-	23	4350	c.4351C>A	c.(4351-4353)Cct>Act	p.P1451T	SCN1A_ENST00000375405.3_Missense_Mutation_p.P1440T|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.P1423T|SCN1A_ENST00000423058.2_Missense_Mutation_p.P1451T			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1451			P -> L (in EIEE6; dbSNP:rs121917945). {ECO:0000269|PubMed:17054684}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCATACTTAGGCTGGAGTTCC	0.338													ENSG00000144285																																					0													79.0	72.0	74.0					2																	166854673		2203	4292	6495	SO:0001583	missense	0			-	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4351C>A	2.37:g.166854673G>T	ENSP00000303540:p.Pro1451Thr		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.P1451T	ENST00000303395.4	37	c.4351	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433211	0.83776	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98280	-4.84;-4.84;-4.78;-4.74	5.29	5.29	0.74685	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99432	0.9799	H	0.98199	4.17	0.80722	D	1	D;D;D	0.89917	0.985;1.0;1.0	P;D;D	0.97110	0.86;0.998;1.0	D	0.98239	1.0487	10	0.87932	D	0	.	18.9263	0.92546	0.0:0.0:1.0:0.0	.	1440;1423;1451	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	T	1451;1451;1440;1423	ENSP00000407030:P1451T;ENSP00000303540:P1451T;ENSP00000364554:P1440T;ENSP00000386312:P1423T	ENSP00000303540:P1451T	P	-	1	0	SCN1A	166562919	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.685000	0.98661	2.461000	0.83175	0.460000	0.39030	CCT	-	SCN1A	-	pfam_Ion_trans_dom		0.338	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	0	0	0	36	36	100	0.00	0.00	G	NM_006920		166854673	-1	13	47	28	56	tier1	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	30.95	45.63	SNP	1.000	T	13	28
ELL3	80237	genome.wustl.edu	37	15	44067551	44067551	+	Missense_Mutation	SNP	G	G	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr15:44067551G>A	ENST00000319359.3	-	6	1239	c.598C>T	c.(598-600)Cct>Tct	p.P200S	ELL3_ENST00000497465.1_5'UTR|RP11-296A16.1_ENST00000417761.2_3'UTR|SERF2_ENST00000381359.1_5'Flank	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	200					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)			cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		GCCTGAACAGGTTCTCTGTTT	0.428													ENSG00000128886																																					0													44.0	44.0	44.0					15																	44067551		2198	4298	6496	SO:0001583	missense	0			-	AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.598C>T	15.37:g.44067551G>A	ENSP00000320346:p.Pro200Ser		B3KQ66|B3KX08|Q6I9Z7|Q9H634	Missense_Mutation	SNP	pfam_R_pol_II_elong_fac_ELL,pfam_Occludin_Rpol2_elong_fac_ELL	p.P200S	ENST00000319359.3	37	c.598	CCDS10102.1	15	.	.	.	.	.	.	.	.	.	.	G	13.22	2.173100	0.38413	.	.	ENSG00000128886	ENST00000319359	T	0.38560	1.13	5.8	3.94	0.45596	.	0.100322	0.44902	N	0.000412	T	0.51991	0.1707	M	0.75447	2.3	0.30816	N	0.738296	P;P;P	0.44380	0.834;0.834;0.834	P;P;P	0.52856	0.711;0.711;0.711	T	0.54450	-0.8292	10	0.27082	T	0.32	-30.1387	8.8297	0.35076	0.1711:0.0:0.8289:0.0	.	200;200;154	B3KX08;Q9HB65;B3KQ66	.;ELL3_HUMAN;.	S	200	ENSP00000320346:P200S	ENSP00000320346:P200S	P	-	1	0	ELL3	41854843	0.220000	0.23631	0.650000	0.29550	0.263000	0.26337	1.407000	0.34657	0.811000	0.34303	0.455000	0.32223	CCT	-	ELL3	-	pfam_R_pol_II_elong_fac_ELL		0.428	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL3	HGNC	protein_coding	OTTHUMT00000133236.2	0	0	0	21	21	139	0.00	0.00	G	NM_025165		44067551	-1	18	53	2	20	tier1	no_errors	ENST00000319359	ensembl	human	known	74_37	missense	90.00	72.60	SNP	0.982	A	18	2
RELN	5649	genome.wustl.edu	37	7	103251252	103251252	+	Missense_Mutation	SNP	T	T	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr7:103251252T>A	ENST00000428762.1	-	22	3057	c.2898A>T	c.(2896-2898)gaA>gaT	p.E966D	RELN_ENST00000424685.2_Missense_Mutation_p.E966D|RELN_ENST00000343529.5_Missense_Mutation_p.E966D	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	966					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTGGAAGGCATTCCTGAAAGA	0.423													ENSG00000189056																									NSCLC(146;835 1944 15585 22231 52158)												0													102.0	89.0	93.0					7																	103251252		2203	4300	6503	SO:0001583	missense	0			-		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.2898A>T	7.37:g.103251252T>A	ENSP00000392423:p.Glu966Asp		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.E966D	ENST00000428762.1	37	c.2898	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	T	14.16	2.452111	0.43531	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.23754	1.89;1.89;1.89	6.08	3.64	0.41730	.	0.055729	0.85682	D	0.000000	T	0.16811	0.0404	N	0.25485	0.75	0.32880	D	0.510377	B;B	0.31625	0.185;0.332	B;B	0.31101	0.124;0.079	T	0.17684	-1.0361	10	0.31617	T	0.26	.	9.8083	0.40805	0.0:0.1364:0.0:0.8636	.	966;966	P78509-2;P78509	.;RELN_HUMAN	D	966	ENSP00000392423:E966D;ENSP00000345694:E966D;ENSP00000388446:E966D	ENSP00000345694:E966D	E	-	3	2	RELN	103038488	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	2.377000	0.44300	0.498000	0.27948	0.533000	0.62120	GAA	-	RELN	-	superfamily_Sialidases		0.423	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	0	0	0	49	49	145	0.00	0.00	T	NM_005045		103251252	-1	20	34	11	63	tier1	no_errors	ENST00000424685	ensembl	human	known	74_37	missense	64.52	35.05	SNP	1.000	A	20	11
OR1G1	8390	genome.wustl.edu	37	17	3030180	3030180	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr17:3030180G>C	ENST00000328890.2	-	1	695	c.666C>G	c.(664-666)ttC>ttG	p.F222L		NM_003555.1	NP_003546.1	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G, member 1	222					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F222F(1)		kidney(1)|large_intestine(4)|lung(3)|skin(3)	11						GGATGGTCGAGAAAACGTTCG	0.507													ENSG00000183024																									Colon(127;1481 1654 8243 19426 50557)												1	Substitution - coding silent(1)	large_intestine(1)											92.0	89.0	90.0					17																	3030180		2203	4300	6503	SO:0001583	missense	0			-	U04689	CCDS11020.1	17p13.3	2012-08-09			ENSG00000183024	ENSG00000183024		"""GPCR / Class A : Olfactory receptors"""	8204	protein-coding gene	gene with protein product				OR1G2		8004088, 9500546	Standard	NM_003555		Approved	OR17-209	uc002fvc.1	P47890	OTTHUMG00000090618	ENST00000328890.2:c.666C>G	17.37:g.3030180G>C	ENSP00000331545:p.Phe222Leu		Q4VBM1|Q6IFL9|Q9UM76	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F222L	ENST00000328890.2	37	c.666	CCDS11020.1	17	.	.	.	.	.	.	.	.	.	.	G	9.246	1.039548	0.19669	.	.	ENSG00000183024	ENST00000328890	T	0.00058	8.79	4.64	1.44	0.22558	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.11064	0.09	0.09310	N	1	B	0.18968	0.032	B	0.19666	0.026	T	0.26292	-1.0107	9	0.62326	D	0.03	.	2.3258	0.04222	0.1696:0.1529:0.5195:0.158	.	222	P47890	OR1G1_HUMAN	L	222	ENSP00000331545:F222L	ENSP00000331545:F222L	F	-	3	2	OR1G1	2976930	0.000000	0.05858	0.001000	0.08648	0.564000	0.35744	-0.819000	0.04462	0.184000	0.20083	0.523000	0.50628	TTC	-	OR1G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.507	OR1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1G1	HGNC	protein_coding	OTTHUMT00000207206.2	0	0	0	48	48	78	0.00	0.00	G			3030180	-1	14	30	18	48	tier1	no_errors	ENST00000328890	ensembl	human	known	74_37	missense	42.42	38.46	SNP	0.000	C	14	18
SMC3	9126	genome.wustl.edu	37	10	112349397	112349397	+	Missense_Mutation	SNP	G	G	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr10:112349397G>A	ENST00000361804.4	+	14	1466	c.1340G>A	c.(1339-1341)cGa>cAa	p.R447Q		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	447					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GTCAAAGCTCGAGTAGAAGAA	0.284													ENSG00000108055																																					0													30.0	31.0	31.0					10																	112349397		2200	4298	6498	SO:0001583	missense	0			-	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.1340G>A	10.37:g.112349397G>A	ENSP00000354720:p.Arg447Gln		A8K156|O60464|Q5T482	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.R447Q	ENST00000361804.4	37	c.1340	CCDS31285.1	10	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261732	0.39995	.	.	ENSG00000108055	ENST00000361804	T	0.75704	-0.96	5.95	5.95	0.96441	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.48259	0.1490	N	0.02158	-0.66	0.80722	D	1	B	0.29886	0.26	B	0.22152	0.038	T	0.56745	-0.7928	10	0.06625	T	0.88	.	20.3747	0.98911	0.0:0.0:1.0:0.0	.	447	Q9UQE7	SMC3_HUMAN	Q	447	ENSP00000354720:R447Q	ENSP00000354720:R447Q	R	+	2	0	SMC3	112339387	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.466000	0.97665	2.817000	0.96982	0.563000	0.77884	CGA	-	SMC3	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase		0.284	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SMC3	HGNC	protein_coding	OTTHUMT00000050337.1	0	0	0	18	18	86	0.00	0.00	G	NM_005445		112349397	+1	7	38	4	13	tier1	no_errors	ENST00000361804	ensembl	human	known	74_37	missense	63.64	74.51	SNP	1.000	A	7	4
MALAT1	378938	genome.wustl.edu	37	11	65270167	65270167	+	lincRNA	SNP	G	G	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr11:65270167G>T	ENST00000534336.1	+	0	4935					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TGGCCTAGATGCAGAGAAAAC	0.378													ENSG00000251562																																					0													44.0	45.0	44.0					11																	65270167		874	1988	2862			0			-	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65270167G>T				R	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	MALAT1	-	-		0.378	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	0	0	0	21	21	88	0.00	0.00	G	NR_002819		65270167	+1	8	35	26	51	tier1	no_errors	ENST00000508832	ensembl	human	known	74_37	rna	23.53	40.70	SNP	1.000	T	8	26
AHNAK2	113146	genome.wustl.edu	37	14	105420716	105420716	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr14:105420716C>T	ENST00000333244.5	-	7	1191	c.1072G>A	c.(1072-1074)Gag>Aag	p.E358K	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	358						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCCCAACTCTTCCAGGACC	0.637													ENSG00000185567																																					0													43.0	44.0	44.0					14																	105420716		1927	4128	6055	SO:0001583	missense	0			-	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1072G>A	14.37:g.105420716C>T	ENSP00000353114:p.Glu358Lys		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E358K	ENST00000333244.5	37	c.1072	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	c	15.38	2.817891	0.50633	.	.	ENSG00000185567	ENST00000333244	T	0.03860	3.78	4.43	3.51	0.40186	.	.	.	.	.	T	0.05456	0.0144	L	0.47716	1.5	0.09310	N	1	P	0.36392	0.551	B	0.35688	0.208	T	0.31779	-0.9931	9	0.12430	T	0.62	.	11.557	0.50755	0.0:0.8186:0.1814:0.0	.	358	Q8IVF2	AHNK2_HUMAN	K	358	ENSP00000353114:E358K	ENSP00000353114:E358K	E	-	1	0	AHNAK2	104491761	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.516000	0.22817	0.946000	0.37632	0.585000	0.79938	GAG	-	AHK2	-	NULL		0.637	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK2	HGNC	protein_coding	OTTHUMT00000410300.1	0	0	0	41	41	43	0.00	0.00	C	NM_138420		105420716	-1	6	10	22	17	tier1	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	21.43	37.04	SNP	0.006	T	6	22
PCDHA9	9752	genome.wustl.edu	37	5	140242448	140242448	+	Intron	SNP	G	G	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr5:140242448G>A	ENST00000532602.1	+	1	3427				PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA14_ENST00000562220.1_RNA|AC005609.1_ENST00000502505.1_Silent_p.S176S|PCDHA7_ENST00000525929.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAATGTGACGCTGCCAGGTA	0.622													ENSG00000249034																									Melanoma(55;1800 1972 14909)												0																																										SO:0001627	intron_variant	0			-	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2394+11974G>A	5.37:g.140242448G>A			O15053|Q2M3S5	Silent	SNP	NULL	p.S176	ENST00000532602.1	37	c.528	CCDS54920.1	5																																																																																			-	AC005609.1	-	NULL		0.622	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000249034	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000372896.2	0	0	0	100	100	22	0.00	0.00	G	NM_031857		140242448	-1	8	5	75	13	tier1	no_errors	ENST00000502505	ensembl	human	known	74_37	silent	9.64	27.78	SNP	0.839	A	8	75
ABCC11	85320	genome.wustl.edu	37	16	48218534	48218534	+	Missense_Mutation	SNP	A	A	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr16:48218534A>T	ENST00000394747.1	-	22	3424	c.3075T>A	c.(3073-3075)ttT>ttA	p.F1025L	ABCC11_ENST00000356608.2_Missense_Mutation_p.F1025L|ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000353782.5_Missense_Mutation_p.F1025L|ABCC11_ENST00000394748.1_Missense_Mutation_p.F1025L	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1025	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	TCAGCCTCTTAAACCTGAGAA	0.502													ENSG00000121270																																					0													133.0	116.0	122.0					16																	48218534		2201	4300	6501	SO:0001583	missense	0			-	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3075T>A	16.37:g.48218534A>T	ENSP00000378230:p.Phe1025Leu		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.F1025L	ENST00000394747.1	37	c.3075	CCDS10732.1	16	.	.	.	.	.	.	.	.	.	.	A	11.24	1.581621	0.28180	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72	5.48	3.17	0.36434	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.257343	0.38164	N	0.001790	D	0.84160	0.5411	L	0.53671	1.685	0.80722	D	1	B;B	0.29766	0.01;0.256	B;B	0.32090	0.017;0.14	T	0.73313	-0.4022	10	0.14656	T	0.56	-8.0738	3.4005	0.07321	0.6236:0.2397:0.1367:0.0	.	1025;1025	Q96J66-2;Q96J66	.;ABCCB_HUMAN	L	1025	ENSP00000311326:F1025L;ENSP00000349017:F1025L;ENSP00000378231:F1025L;ENSP00000378230:F1025L	ENSP00000311326:F1025L	F	-	3	2	ABCC11	46776035	0.986000	0.35501	0.766000	0.31476	0.025000	0.11179	0.716000	0.25836	0.908000	0.36671	-0.374000	0.07098	TTT	-	ABCC11	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom		0.502	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABCC11	HGNC	protein_coding	OTTHUMT00000429984.1	0	0	0	31	31	108	0.00	0.00	A	NM_032583		48218534	-1	19	42	3	13	tier1	no_errors	ENST00000356608	ensembl	human	known	74_37	missense	86.36	76.36	SNP	0.987	T	19	3
STON1	11037	genome.wustl.edu	37	2	48822428	48822428	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr2:48822428G>T	ENST00000406226.1	+	5	2390	c.2195G>T	c.(2194-2196)tGc>tTc	p.C732F	STON1_ENST00000309835.3_Missense_Mutation_p.C732F|STON1-GTF2A1L_ENST00000394751.3_Intron|STON1-GTF2A1L_ENST00000405008.1_Intron|STON1_ENST00000404752.1_Missense_Mutation_p.C732F|STON1-GTF2A1L_ENST00000394754.1_Intron|STON1-GTF2A1L_ENST00000309827.2_Intron|STON1-GTF2A1L_ENST00000402114.2_Intron	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	732					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ATTGGTGACTGCATAACTCAG	0.388													ENSG00000243244																																					0													128.0	115.0	119.0					2																	48822428		2203	4300	6503	SO:0001583	missense	0			-	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.2195G>T	2.37:g.48822428G>T	ENSP00000384615:p.Cys732Phe		A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C,pfscan_SHD	p.C732F	ENST00000406226.1	37	c.2195	CCDS1841.1	2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275892	0.80580	.	.	ENSG00000243244	ENST00000404752;ENST00000406226;ENST00000309835	T;T;T	0.12465	2.68;2.68;2.68	4.72	4.72	0.59763	.	.	.	.	.	T	0.29882	0.0747	L	0.44542	1.39	0.80722	D	1	D	0.69078	0.997	D	0.65573	0.936	T	0.02519	-1.1147	9	0.87932	D	0	.	17.8536	0.88755	0.0:0.0:1.0:0.0	.	732	Q9Y6Q2	STON1_HUMAN	F	732	ENSP00000385273:C732F;ENSP00000384615:C732F;ENSP00000310969:C732F	ENSP00000310969:C732F	C	+	2	0	STON1	48675932	1.000000	0.71417	0.938000	0.37757	0.914000	0.54420	7.478000	0.81082	2.448000	0.82819	0.455000	0.32223	TGC	-	STON1	-	pirsf_Stonin		0.388	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1	HGNC	protein_coding	OTTHUMT00000323848.2	0	0	0	49	49	82	0.00	0.00	G	NM_006873		48822428	+1	25	29	39	50	tier1	no_errors	ENST00000309835	ensembl	human	known	74_37	missense	39.06	36.71	SNP	0.998	T	25	39
TEX30	93081	genome.wustl.edu	37	13	103419825	103419825	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr13:103419825C>T	ENST00000376032.4	-	5	491	c.302G>A	c.(301-303)cGt>cAt	p.R101H	TEX30_ENST00000376022.1_Intron|TEX30_ENST00000487260.1_5'Flank|TEX30_ENST00000376027.1_Intron|TEX30_ENST00000376019.1_Missense_Mutation_p.R60H|TEX30_ENST00000376029.3_Intron|TEX30_ENST00000376021.4_Missense_Mutation_p.R60H	NM_138779.3	NP_620134.3	Q5JUR7	TEX30_HUMAN	testis expressed 30	101										lung(1)|urinary_tract(1)	2						GCCCATTGAACGACCTAAAAT	0.368													ENSG00000151287																																					0													48.0	45.0	46.0					13																	103419825		2203	4300	6503	SO:0001583	missense	0			-	AF070559	CCDS9503.2, CCDS66577.1, CCDS66578.1	13q33.1	2012-02-09	2012-02-09	2012-02-09	ENSG00000151287	ENSG00000151287			25188	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 27"""	C13orf27			Standard	XM_005254097		Approved		uc001vpo.3	Q5JUR7	OTTHUMG00000017306	ENST00000376032.4:c.302G>A	13.37:g.103419825C>T	ENSP00000365200:p.Arg101His		Q5JUR8|Q96KZ8	Missense_Mutation	SNP	pfam_Dienelactn_hydro	p.R101H	ENST00000376032.4	37	c.302	CCDS9503.2	13	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828970	0.90955	.	.	ENSG00000151287	ENST00000376019;ENST00000376021;ENST00000376032	T;T;T	0.15372	2.43;2.43;2.43	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.35566	0.0936	M	0.63843	1.955	0.80722	D	1	D	0.61697	0.99	P	0.55011	0.766	T	0.06588	-1.0818	10	0.87932	D	0	-10.8175	19.4444	0.94841	0.0:1.0:0.0:0.0	.	101	Q5JUR7	CM027_HUMAN	H	60;60;101	ENSP00000365187:R60H;ENSP00000365189:R60H;ENSP00000365200:R101H	ENSP00000365187:R60H	R	-	2	0	C13orf27	102217826	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.028000	0.70889	2.658000	0.90341	0.585000	0.79938	CGT	-	TEX30	-	NULL		0.368	TEX30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX30	HGNC	protein_coding	OTTHUMT00000045691.4	0	0	0	27	27	79	0.00	0.00	C	NM_138779		103419825	-1	16	53	17	62	tier1	no_errors	ENST00000376032	ensembl	human	known	74_37	missense	48.48	45.69	SNP	1.000	T	16	17
CNOT1	23019	genome.wustl.edu	37	16	58575428	58575428	+	Missense_Mutation	SNP	C	C	G			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr16:58575428C>G	ENST00000317147.5	-	34	5109	c.4777G>C	c.(4777-4779)Gga>Cga	p.G1593R	CNOT1_ENST00000569240.1_Missense_Mutation_p.G1588R|CNOT1_ENST00000245138.4_Missense_Mutation_p.G444R	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1593	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GCTAAAAATCCCGTGGGCTGA	0.383													ENSG00000125107																																					0													99.0	98.0	99.0					16																	58575428		2198	4300	6498	SO:0001583	missense	0			-	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4777G>C	16.37:g.58575428C>G	ENSP00000320949:p.Gly1593Arg		Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.G1593R	ENST00000317147.5	37	c.4777	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148884	0.78001	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200	T	0.44881	0.91	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.41003	0.1140	L	0.47716	1.5	0.80722	D	1	P;P;P	0.47106	0.89;0.685;0.79	B;B;B	0.42361	0.231;0.214;0.385	T	0.12967	-1.0527	10	0.15066	T	0.55	-25.8097	19.9054	0.97006	0.0:1.0:0.0:0.0	.	444;1593;1588	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	R	1593;444;1588	ENSP00000320949:G1593R	ENSP00000245138:G444R	G	-	1	0	CNOT1	57132929	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.092000	0.71414	2.698000	0.92095	0.655000	0.94253	GGA	-	CNOT1	-	NULL		0.383	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	0	0	0	32	32	136	0.00	0.00	C	NM_016284		58575428	-1	15	61	4	22	tier1	no_errors	ENST00000317147	ensembl	human	known	74_37	missense	78.95	73.49	SNP	1.000	G	15	4
FAM122B	159090	genome.wustl.edu	37	X	133922772	133922772	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chrX:133922772C>A	ENST00000370790.1	-	5	1294	c.366G>T	c.(364-366)agG>agT	p.R122S	FAM122B_ENST00000343004.5_Missense_Mutation_p.R141S|FAM122B_ENST00000298090.6_Missense_Mutation_p.R141S|FAM122B_ENST00000486347.1_Missense_Mutation_p.R122S|FAM122B_ENST00000493333.1_5'UTR	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B	122										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					TTCCGAATCCCCTGGTGGGTG	0.388													ENSG00000156504																																					0													90.0	80.0	83.0					X																	133922772		2203	4300	6503	SO:0001583	missense	0			-	BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.366G>T	X.37:g.133922772C>A	ENSP00000359826:p.Arg122Ser		A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Missense_Mutation	SNP	NULL	p.R141S	ENST00000370790.1	37	c.423	CCDS55497.1	X	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313248	0.60414	.	.	ENSG00000156504	ENST00000370790;ENST00000298090;ENST00000343004;ENST00000486347	.	.	.	5.56	4.41	0.53225	.	0.000000	0.64402	D	0.000001	T	0.70771	0.3262	M	0.69248	2.105	0.58432	D	0.999998	D;D;D;D;D;D	0.76494	0.999;0.996;0.992;0.997;0.997;0.999	D;P;D;D;D;D	0.91635	0.999;0.895;0.974;0.993;0.993;0.925	T	0.69258	-0.5192	9	0.48119	T	0.1	.	9.2668	0.37645	0.0:0.0867:0.0:0.9133	.	88;141;69;122;122;141	B4DN12;G1UD80;Q7Z309-5;Q7Z309-2;Q7Z309;Q7Z309-3	.;.;.;.;F122B_HUMAN;.	S	122;141;141;122	.	ENSP00000298090:R141S	R	-	3	2	FAM122B	133750438	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	1.922000	0.40045	0.755000	0.32990	-0.407000	0.06327	AGG	-	FAM122B	-	NULL		0.388	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM122B	HGNC	protein_coding	OTTHUMT00000058382.1	0	0	0	59	59	115	0.00	0.00	C	NM_145284		133922772	-1	24	43	36	63	tier1	no_errors	ENST00000343004	ensembl	human	known	74_37	missense	39.34	40.57	SNP	1.000	A	24	36
PLA2G12B	84647	genome.wustl.edu	37	10	74714308	74714308	+	Missense_Mutation	SNP	C	C	T	rs372066733		TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr10:74714308C>T	ENST00000373032.3	-	1	228	c.136G>A	c.(136-138)Gtc>Atc	p.V46I		NM_032562.2	NP_115951.2	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB	46					cholesterol homeostasis (GO:0042632)|lipid catabolic process (GO:0016042)|triglyceride homeostasis (GO:0070328)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	9	Prostate(51;0.0198)					TAGCTATTGACGGATTCAAAG	0.562													ENSG00000138308																																					0								C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	133.0	141.0	138.0		136	4.6	0.9	10		138	0,8600		0,0,4300	no	missense	PLA2G12B	NM_032562.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	46/196	74714308	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF349540	CCDS7319.1	10q22.1	2008-09-19	2004-01-13	2004-01-14	ENSG00000138308	ENSG00000138308	3.1.1.4		18555	protein-coding gene	gene with protein product		611653	"""phospholipase A2, group XIII"""	PLA2G13			Standard	NM_032562		Approved		uc001jtf.1	Q9BX93	OTTHUMG00000018446	ENST00000373032.3:c.136G>A	10.37:g.74714308C>T	ENSP00000362123:p.Val46Ile		B7ZL23|Q52LB2|Q96Q99	Missense_Mutation	SNP	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2_dom	p.V46I	ENST00000373032.3	37	c.136	CCDS7319.1	10	.	.	.	.	.	.	.	.	.	.	C	8.246	0.808023	0.16467	2.27E-4	0.0	ENSG00000138308	ENST00000373032	.	.	.	5.54	4.6	0.57074	.	0.060261	0.64402	N	0.000004	T	0.37489	0.1005	L	0.42686	1.345	0.80722	D	1	P;P	0.49253	0.921;0.768	B;B	0.36567	0.228;0.072	T	0.29366	-1.0014	9	0.07813	T	0.8	-9.7987	13.0639	0.59022	0.0:0.9167:0.0:0.0833	.	46;46	B7ZL23;Q9BX93	.;PG12B_HUMAN	I	46	.	ENSP00000362123:V46I	V	-	1	0	PLA2G12B	74384314	1.000000	0.71417	0.935000	0.37517	0.229000	0.25112	4.374000	0.59543	1.241000	0.43820	-0.345000	0.07892	GTC	-	PLA2G12B	-	pfam_PLipase_A2_secretory_G12		0.562	PLA2G12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G12B	HGNC	protein_coding	OTTHUMT00000048598.1	0	0	0	40	40	80	0.00	0.00	C	NM_032562		74714308	-1	26	27	14	11	tier1	no_errors	ENST00000373032	ensembl	human	known	74_37	missense	65.00	71.05	SNP	0.997	T	26	14
ROBO3	64221	genome.wustl.edu	37	11	124743602	124743602	+	Missense_Mutation	SNP	G	G	A	rs372770487		TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr11:124743602G>A	ENST00000397801.1	+	11	1820	c.1628G>A	c.(1627-1629)gGa>gAa	p.G543E	ROBO3_ENST00000538940.1_Missense_Mutation_p.G521E	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	543					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GAAGACTGGGGAGTATCACCA	0.527													ENSG00000154134																																					0								G	GLU/GLY	0,3714		0,0,1857	32.0	35.0	34.0		1628	2.9	1.0	11		34	2,8182		0,2,4090	no	missense	ROBO3	NM_022370.3	98	0,2,5947	AA,AG,GG		0.0244,0.0,0.0168	possibly-damaging	543/1387	124743602	2,11896	1857	4092	5949	SO:0001583	missense	0			-	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1628G>A	11.37:g.124743602G>A	ENSP00000380903:p.Gly543Glu			Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G543E	ENST00000397801.1	37	c.1628	CCDS44755.1	11	.	.	.	.	.	.	.	.	.	.	G	13.58	2.279860	0.40294	0.0	2.44E-4	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.64438	-0.1;-0.09	4.92	2.91	0.33838	.	0.399613	0.18179	N	0.149210	T	0.52549	0.1741	L	0.55990	1.75	0.58432	D	0.999991	P	0.42735	0.788	B	0.38264	0.269	T	0.56019	-0.8048	10	0.59425	D	0.04	.	7.6758	0.28484	0.0928:0.0:0.7343:0.1728	.	543	Q96MS0	ROBO3_HUMAN	E	543;521	ENSP00000380903:G543E;ENSP00000441797:G521E	ENSP00000380903:G543E	G	+	2	0	ROBO3	124248812	0.977000	0.34250	0.998000	0.56505	0.808000	0.45660	2.423000	0.44705	1.306000	0.44926	-0.253000	0.11424	GGA	-	ROBO3	-	NULL		0.527	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1	0	0	0	26	26	76	0.00	0.00	G	XM_370663		124743602	+1	12	21	15	54	tier1	no_errors	ENST00000397801	ensembl	human	known	74_37	missense	44.44	28.00	SNP	0.589	A	12	15
ASTL	431705	genome.wustl.edu	37	2	96803348	96803348	+	Silent	SNP	G	G	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr2:96803348G>T	ENST00000342380.2	-	2	146	c.147C>A	c.(145-147)gcC>gcA	p.A49A		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						TGTCCCCGGAGGCCTGGGTTC	0.607													ENSG00000188886																																					0													150.0	132.0	138.0					2																	96803348		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.147C>A	2.37:g.96803348G>T				Silent	SNP	pfam_Peptidase_M12A,smart_Peptidase_Metallo,prints_Peptidase_M12A	p.A49	ENST00000342380.2	37	c.147	CCDS33249.1	2																																																																																			-	ASTL	-	NULL		0.607	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTL	HGNC	protein_coding	OTTHUMT00000338801.1	0	0	0	64	64	96	0.00	0.00	G			96803348	-1	39	35	36	49	tier1	no_errors	ENST00000342380	ensembl	human	known	74_37	silent	52.00	41.67	SNP	0.000	T	39	36
AHNAK	79026	genome.wustl.edu	37	11	62296044	62296044	+	Missense_Mutation	SNP	C	C	G			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr11:62296044C>G	ENST00000378024.4	-	5	6119	c.5845G>C	c.(5845-5847)Gga>Cga	p.G1949R	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1949					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GTTAAATCTCCCTCCAATTTT	0.512													ENSG00000124942																																					0													208.0	217.0	214.0					11																	62296044		2202	4299	6501	SO:0001583	missense	0			-	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5845G>C	11.37:g.62296044C>G	ENSP00000367263:p.Gly1949Arg		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G1949R	ENST00000378024.4	37	c.5845	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	c	3.798	-0.042365	0.07452	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.03358	3.96	2.53	2.53	0.30540	.	.	.	.	.	T	0.29423	0.0733	H	0.97783	4.075	0.32152	N	0.584036	D	0.89917	1.0	D	0.76575	0.988	T	0.57906	-0.7730	9	0.66056	D	0.02	.	13.0281	0.58827	0.0:1.0:0.0:0.0	.	1949	Q09666	AHNK_HUMAN	R	38;1949	ENSP00000367263:G1949R	ENSP00000244934:G38R	G	-	1	0	AHNAK	62052620	0.000000	0.05858	0.269000	0.24586	0.004000	0.04260	-0.018000	0.12568	1.422000	0.47177	0.457000	0.33378	GGA	-	AHK	-	NULL		0.512	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK	HGNC	protein_coding	OTTHUMT00000395572.1	1	1	0	104	104	64	0.95	0.00	C	NM_024060		62296044	-1	38	33	71	40	tier1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	34.86	45.21	SNP	1.000	G	38	71
SLC6A17	388662	genome.wustl.edu	37	1	110717458	110717458	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr1:110717458C>T	ENST00000331565.4	+	5	1114	c.629C>T	c.(628-630)gCc>gTc	p.A210V	RP5-1028L10.2_ENST00000440688.1_RNA|RP5-1028L10.1_ENST00000443008.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	210					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TACCGAGAGGCCTTGGACATC	0.582													ENSG00000197106																																					0													111.0	97.0	102.0					1																	110717458		2203	4300	6503	SO:0001583	missense	0			-		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.629C>T	1.37:g.110717458C>T	ENSP00000330199:p.Ala210Val		A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.A210V	ENST00000331565.4	37	c.629	CCDS30799.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.448389	0.96205	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.71817	-0.6	5.27	5.27	0.74061	.	0.097447	0.64402	D	0.000001	T	0.66781	0.2824	N	0.12746	0.255	0.58432	D	0.999993	D	0.63046	0.992	D	0.65773	0.938	T	0.75025	-0.3463	10	0.72032	D	0.01	.	19.2447	0.93898	0.0:1.0:0.0:0.0	.	210	Q9H1V8	S6A17_HUMAN	V	210	ENSP00000330199:A210V	ENSP00000330199:A210V	A	+	2	0	SLC6A17	110518981	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.445000	0.80570	2.614000	0.88457	0.655000	0.94253	GCC	-	SLC6A17	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport_orphan		0.582	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A17	HGNC	protein_coding	OTTHUMT00000032550.2	0	0	0	53	53	71	0.00	0.00	C	XM_371280		110717458	+1	19	16	22	27	tier1	no_errors	ENST00000331565	ensembl	human	known	74_37	missense	46.34	37.21	SNP	1.000	T	19	22
FOLR3	2352	genome.wustl.edu	37	11	71850758	71850758	+	Silent	SNP	C	C	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr11:71850758C>T	ENST00000445078.2	+	5	812	c.741C>T	c.(739-741)ggC>ggT	p.G247G	FOLR3_ENST00000442948.2_Silent_p.G206G|FOLR3_ENST00000456237.1_Silent_p.G249G			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	205					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)			large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	GAGGGAGCGGCCGCTGCATCC	0.597													ENSG00000110203																																					0													40.0	41.0	41.0					11																	71850758		2200	4293	6493	SO:0001819	synonymous_variant	0			-	U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.741C>T	11.37:g.71850758C>T			J3KQ90|Q05C14	Silent	SNP	pfam_Folate_rcpt-like	p.G249	ENST00000445078.2	37	c.747		11																																																																																			-	FOLR3	-	pfam_Folate_rcpt-like		0.597	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	FOLR3	HGNC	protein_coding	OTTHUMT00000396739.1	0	0	0	45	45	22	0.00	0.00	C	NM_000804		71850758	+1	24	11	21	11	tier1	no_errors	ENST00000456237	ensembl	human	known	74_37	silent	53.33	50.00	SNP	1.000	T	24	21
ATRX	546	genome.wustl.edu	37	X	76814204	76814204	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chrX:76814204C>A	ENST00000373344.5	-	29	6654	c.6440G>T	c.(6439-6441)aGt>aTt	p.S2147I	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.S2109I	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2147	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TCTGAATATACTCTGGATGTC	0.338			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											86.0	83.0	84.0					X																	76814204		2203	4294	6497	SO:0001583	missense	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6440G>T	X.37:g.76814204C>A	ENSP00000362441:p.Ser2147Ile		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S2147I	ENST00000373344.5	37	c.6440	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	17.88	3.498344	0.64186	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	T;T	0.74632	-0.86;-0.86	5.21	5.21	0.72293	Helicase, C-terminal (3);	0.000000	0.85682	U	0.000000	D	0.88306	0.6401	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.90585	0.4532	10	0.87932	D	0	-9.1076	17.8291	0.88676	0.0:1.0:0.0:0.0	.	2109;2147	P46100-4;P46100	.;ATRX_HUMAN	I	2147;2109	ENSP00000362441:S2147I;ENSP00000378967:S2109I	ENSP00000362441:S2147I	S	-	2	0	ATRX	76700860	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.141000	0.66446	0.600000	0.82982	AGT	-	ATRX	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.338	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	74	74	115	0.00	0.00	C	NM_000489		76814204	-1	23	82	59	72	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	28.05	53.25	SNP	1.000	A	23	59
TRAPPC3	27095	genome.wustl.edu	37	1	36602255	36602255	+	3'UTR	SNP	G	G	C			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr1:36602255G>C	ENST00000373166.3	-	0	1182				TRAPPC3_ENST00000462715.1_5'UTR	NM_001270894.1|NM_014408.4	NP_001257823.1|NP_055223.1	O43617	TPPC3_HUMAN	trafficking protein particle complex 3						ER to Golgi vesicle-mediated transport (GO:0006888)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|TRAPP complex (GO:0030008)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Myeloproliferative disorder(586;0.0393)				AGGAGATGTTGCCTCCAACAG	0.438													ENSG00000054116																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF041432	CCDS404.1, CCDS59194.1, CCDS72757.1, CCDS72758.1	1p34.2	2011-10-10			ENSG00000054116	ENSG00000054116		"""Trafficking protein particle complex"""	19942	protein-coding gene	gene with protein product		610955				8619474	Standard	NM_014408		Approved	BET3	uc031pls.1	O43617	OTTHUMG00000007664	ENST00000373166.3:c.*549C>G	1.37:g.36602255G>C			A6NDN0|B2RDN2|D3DPS2	R	SNP	-	NULL	ENST00000373166.3	37	NULL	CCDS404.1	1																																																																																			-	TRAPPC3	-	-		0.438	TRAPPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC3	HGNC	protein_coding	OTTHUMT00000020384.1	0	0	0	46	46	108	0.00	0.00	G	NM_014408		36602255	-1	17	39	33	62	tier1	no_errors	ENST00000462715	ensembl	human	known	74_37	rna	34.00	38.24	SNP	0.978	C	17	33
COPS4	51138	genome.wustl.edu	37	4	83987594	83987594	+	Missense_Mutation	SNP	C	C	G			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr4:83987594C>G	ENST00000264389.2	+	8	1025	c.890C>G	c.(889-891)tCc>tGc	p.S297C	COPS4_ENST00000509093.1_Missense_Mutation_p.S297C|COPS4_ENST00000503682.1_Missense_Mutation_p.S329C|COPS4_ENST00000511653.1_Missense_Mutation_p.S297C	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	297	PCI.				cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				GTTTAAGGTTCCAGCATCTTG	0.318													ENSG00000138663																																					0													87.0	90.0	89.0					4																	83987594		2203	4296	6499	SO:0001583	missense	0			-	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.890C>G	4.37:g.83987594C>G	ENSP00000264389:p.Ser297Cys		B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.S297C	ENST00000264389.2	37	c.890	CCDS3600.1	4	.	.	.	.	.	.	.	.	.	.	C	22.7	4.326920	0.81690	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000509317;ENST00000503682;ENST00000511653	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.23	5.23	0.72850	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.000000	0.85682	D	0.000000	T	0.59514	0.2199	M	0.81942	2.565	0.80722	D	1	D;P;D;D	0.89917	1.0;0.721;1.0;0.999	D;B;D;D	0.85130	0.992;0.349;0.997;0.979	T	0.58228	-0.7673	10	0.39692	T	0.17	-8.8041	18.9944	0.92806	0.0:1.0:0.0:0.0	.	297;329;297;297	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	C	297;297;185;329;297	ENSP00000425976:S297C;ENSP00000264389:S297C;ENSP00000425486:S185C;ENSP00000424791:S329C;ENSP00000424655:S297C	ENSP00000264389:S297C	S	+	2	0	COPS4	84206618	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	7.367000	0.79558	2.726000	0.93360	0.655000	0.94253	TCC	-	COPS4	-	pfam_PCI_dom,smart_PCI_dom		0.318	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS4	HGNC	protein_coding	OTTHUMT00000252643.1	0	0	0	38	38	83	0.00	0.00	C			83987594	+1	14	47	25	45	tier1	no_errors	ENST00000264389	ensembl	human	known	74_37	missense	35.90	51.09	SNP	1.000	G	14	25
P4HA2	8974	genome.wustl.edu	37	5	131528746	131528746	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr5:131528746C>T	ENST00000401867.1	-	16	2133	c.1565G>A	c.(1564-1566)gGa>gAa	p.G522E	P4HA2_ENST00000360568.3_Missense_Mutation_p.G520E|P4HA2_ENST00000379104.2_Missense_Mutation_p.G522E|P4HA2_ENST00000166534.4_Missense_Mutation_p.G522E|P4HA2_ENST00000379086.1_Missense_Mutation_p.G520E|P4HA2-AS1_ENST00000417667.1_RNA|P4HA2_ENST00000379100.2_Missense_Mutation_p.G520E			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	522					peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	GAACTCCTGTCCTCGTTCATG	0.448													ENSG00000072682																									Esophageal Squamous(68;117 1135 17362 19256 34242)												0													242.0	186.0	205.0					5																	131528746		2203	4300	6503	SO:0001583	missense	0			-	U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.1565G>A	5.37:g.131528746C>T	ENSP00000384999:p.Gly522Glu		D3DQ85|D3DQ86|Q8WWN0	Missense_Mutation	SNP	pfam_Pro_4_hyd_alph_N,pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G522E	ENST00000401867.1	37	c.1565	CCDS4151.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.222417	0.95139	.	.	ENSG00000072682	ENST00000401867;ENST00000379086;ENST00000166534;ENST00000360568;ENST00000379104;ENST00000379100	T;T;T;T;T;T	0.48836	0.81;0.8;0.81;0.8;0.81;0.8	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.70509	0.3232	M	0.70842	2.15	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.76071	0.97;0.987	T	0.71248	-0.4649	10	0.87932	D	0	-7.3123	20.3732	0.98896	0.0:1.0:0.0:0.0	.	522;520	O15460;O15460-2	P4HA2_HUMAN;.	E	522;520;522;520;522;520	ENSP00000384999:G522E;ENSP00000368379:G520E;ENSP00000166534:G522E;ENSP00000353772:G520E;ENSP00000368398:G522E;ENSP00000368394:G520E	ENSP00000166534:G522E	G	-	2	0	P4HA2	131556645	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.434000	0.80377	2.809000	0.96659	0.650000	0.86243	GGA	-	P4HA2	-	NULL		0.448	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P4HA2	HGNC	protein_coding	OTTHUMT00000132653.4	0	0	0	22	22	108	0.00	0.00	C	NM_004199		131528746	-1	18	44	22	88	tier1	no_errors	ENST00000166534	ensembl	human	known	74_37	missense	45.00	32.84	SNP	1.000	T	18	22
SMARCA2	6595	genome.wustl.edu	37	9	2097414	2097414	+	Silent	SNP	C	C	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr9:2097414C>T	ENST00000382203.1	+	21	3230	c.3021C>T	c.(3019-3021)aaC>aaT	p.N1007N	SMARCA2_ENST00000357248.2_Silent_p.N1007N|SMARCA2_ENST00000382194.1_Silent_p.N1007N|SMARCA2_ENST00000349721.2_Silent_p.N1007N			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1007					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CACTTATGAACACTATTATGC	0.378													ENSG00000080503																																					0													155.0	146.0	149.0					9																	2097414		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3021C>T	9.37:g.2097414C>T			B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_D-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_D-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.N1007	ENST00000382203.1	37	c.3021	CCDS34977.1	9																																																																																			-	SMARCA2	-	pfam_SNF2_N,superfamily_P-loop_NTPase		0.378	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	0	0	0	40	40	83	0.00	0.00	C	NM_003070		2097414	+1	20	41	12	53	tier1	no_errors	ENST00000349721	ensembl	human	known	74_37	silent	60.61	43.62	SNP	1.000	T	20	12
SNTG1	54212	genome.wustl.edu	37	8	51363127	51363127	+	Missense_Mutation	SNP	G	G	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr8:51363127G>A	ENST00000522124.1	+	7	950	c.289G>A	c.(289-291)Gga>Aga	p.G97R	SNTG1_ENST00000518864.1_Missense_Mutation_p.G97R|SNTG1_ENST00000517473.1_Missense_Mutation_p.G97R|SNTG1_ENST00000276467.5_Missense_Mutation_p.G97R	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	97	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GGAACTTTCAGGACTACTTTT	0.303													ENSG00000147481																																					0													166.0	157.0	160.0					8																	51363127		2203	4300	6503	SO:0001583	missense	0			-	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.289G>A	8.37:g.51363127G>A	ENSP00000429842:p.Gly97Arg		Q2M3Q0|Q9NY98	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.G97R	ENST00000522124.1	37	c.289	CCDS6147.1	8	.	.	.	.	.	.	.	.	.	.	G	16.04	3.011138	0.54361	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.32	5.32	0.75619	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.78515	0.4295	M	0.86097	2.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.80171	-0.1493	10	0.46703	T	0.11	.	16.4853	0.84183	0.0:0.0:1.0:0.0	.	97;97	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	R	97	ENSP00000429276:G97R;ENSP00000429842:G97R;ENSP00000431123:G97R;ENSP00000276467:G97R	ENSP00000276467:G97R	G	+	1	0	SNTG1	51525680	1.000000	0.71417	0.993000	0.49108	0.199000	0.23934	6.388000	0.73195	2.475000	0.83589	0.650000	0.86243	GGA	-	SNTG1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.303	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	0	0	0	53	53	98	0.00	0.00	G			51363127	+1	25	43	38	49	tier1	no_errors	ENST00000518864	ensembl	human	known	74_37	missense	39.68	46.74	SNP	1.000	A	25	38
NHSL2	340527	genome.wustl.edu	37	X	71359451	71359451	+	Missense_Mutation	SNP	A	A	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chrX:71359451A>T	ENST00000373677.1	+	2	2217	c.955A>T	c.(955-957)Act>Tct	p.T319S	NHSL2_ENST00000510661.1_Missense_Mutation_p.T454S|NHSL2_ENST00000535692.1_Missense_Mutation_p.T319S|NHSL2_ENST00000540800.1_Missense_Mutation_p.T685S			Q5HYW2	NHSL2_HUMAN	NHS-like 2	319	Ser-rich.									NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					CTCCAGAGCCACTACACCTTC	0.592													ENSG00000204131																																					0													53.0	45.0	47.0					X																	71359451		2203	4300	6503	SO:0001583	missense	0			-			Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.955A>T	X.37:g.71359451A>T	ENSP00000362781:p.Thr319Ser		B2RN94	Missense_Mutation	SNP	NULL	p.T685S	ENST00000373677.1	37	c.2053		X	.	.	.	.	.	.	.	.	.	.	A	18.48	3.632717	0.67015	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.58652	1.24;0.37;0.32;0.37	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.71239	0.3316	L	0.55213	1.73	0.47994	D	0.999563	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.997	T	0.74106	-0.3772	10	0.87932	D	0	-11.4435	13.0145	0.58749	1.0:0.0:0.0:0.0	.	685;454;319	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	S	685;319;454;319	ENSP00000444617:T685S;ENSP00000362781:T319S;ENSP00000424079:T454S;ENSP00000444914:T319S	ENSP00000362781:T319S	T	+	1	0	NHSL2	71276176	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	7.285000	0.78660	1.982000	0.57802	0.486000	0.48141	ACT	-	NHSL2	-	NULL		0.592	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	0	0	0	26	26	81	0.00	0.00	A	NM_001013627		71359451	+1	10	20	20	46	tier1	no_errors	ENST00000540800	ensembl	human	known	74_37	missense	33.33	30.30	SNP	1.000	T	10	20
LOC101928517	101928517	genome.wustl.edu	37	19	51675359	51675359	+	RNA	SNP	C	C	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr19:51675359C>A	ENST00000600074.1	-	0	493				SIGLEC17P_ENST00000598286.1_RNA																							GTTGTTTTGGCCGTGGGGGTA	0.547													ENSG00000171101																																					0																																												0			-																													19.37:g.51675359C>A				R	SNP	-	NULL	ENST00000600074.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	.	12.36	1.915462	0.33815	.	.	ENSG00000171101	ENST00000305812;ENST00000341811	.	.	.	2.26	0.0677	0.14367	.	1.594230	0.04935	U	0.457635	T	0.20129	0.0484	.	.	.	.	.	.	P;P	0.52842	0.956;0.956	B;B	0.37650	0.255;0.255	T	0.23476	-1.0187	7	0.48119	T	0.1	.	4.5623	0.12166	0.0:0.6681:0.0:0.3319	.	237;247	B4DW22;Q9P0F8	.;.	D	246;237	.	ENSP00000303760:A246D	A	+	2	0	AC063977.1	56367171	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.279000	0.18771	0.084000	0.17077	-0.145000	0.13849	GCC	-	SIGLEC17P	-	-		0.547	CTD-3187F8.14-001	KNOWN	basic	antisense	SIGLEC17P	HGNC	antisense	OTTHUMT00000465635.1	1	1	0	173	173	135	0.57	0.00	C			51675359	+1	65	38	98	81	tier1	no_errors	ENST00000341811	ensembl	human	known	74_37	rna	39.63	31.93	SNP	0.001	A	65	98
C3AR1	719	genome.wustl.edu	37	12	8212621	8212621	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr12:8212621C>T	ENST00000307637.4	-	2	364	c.161G>A	c.(160-162)cGg>cAg	p.R54Q		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	54					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		GTTCACTGTCCGCTGCATCTT	0.567													ENSG00000171860																																					0													97.0	82.0	87.0					12																	8212621		2203	4300	6503	SO:0001583	missense	0			-	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.161G>A	12.37:g.8212621C>T	ENSP00000302079:p.Arg54Gln		O43771|Q92868	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Anaphtx_C3AR1,prints_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_Formyl_pep_rcpt,prints_Anaphtx_C5AR1/C5AR2	p.R54Q	ENST00000307637.4	37	c.161	CCDS8588.1	12	.	.	.	.	.	.	.	.	.	.	C	20.0	3.929886	0.73327	.	.	ENSG00000171860	ENST00000307637;ENST00000546241	T;T	0.42131	0.98;0.98	5.8	3.98	0.46160	GPCR, rhodopsin-like superfamily (1);	0.078265	0.46442	D	0.000298	T	0.45776	0.1359	M	0.73319	2.225	0.22096	N	0.99936	P	0.51653	0.947	P	0.45998	0.5	T	0.43893	-0.9363	10	0.62326	D	0.03	.	9.7848	0.40670	0.0:0.7819:0.141:0.0772	.	54	Q16581	C3AR_HUMAN	Q	54	ENSP00000302079:R54Q;ENSP00000444500:R54Q	ENSP00000302079:R54Q	R	-	2	0	C3AR1	8103888	0.868000	0.29978	0.003000	0.11579	0.754000	0.42855	1.606000	0.36826	0.783000	0.33636	0.585000	0.79938	CGG	-	C3AR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Anaphtx_C3AR1,prints_Formyl_pep_rcpt,prints_Anaphtx_C5AR1/C5AR2		0.567	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3AR1	HGNC	protein_coding	OTTHUMT00000400254.1	0	0	0	30	30	93	0.00	0.00	C			8212621	-1	28	60	18	35	tier1	no_errors	ENST00000307637	ensembl	human	known	74_37	missense	60.87	63.16	SNP	0.414	T	28	18
PHKA2	5256	genome.wustl.edu	37	X	18915280	18915280	+	Splice_Site	DEL	C	C	-			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chrX:18915280delC	ENST00000379942.4	-	30	3948		c.e30+1		PHKA2-AS1_ENST00000452900.1_RNA|PHKA2_ENST00000481718.1_5'Flank|PHKA2-AS1_ENST00000439295.1_RNA	NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)						carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TCTCGGCTTACCTTCTGGAGG	0.622													ENSG00000044446																																					0													120.0	117.0	118.0					X																	18915280		2203	4300	6503	SO:0001630	splice_region_variant	0					CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3282+1G>-	X.37:g.18915280delC			A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Splice_Site	DEL	-	e30+1	ENST00000379942.4	37	c.3282+1	CCDS14190.1	X																																																																																				PHKA2	-	-		0.622	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	0	0	0	62	62	73	0.00	0.00	C	NM_000292	Intron	18915280	-1	40	21	32	35	tier1	no_errors	ENST00000379942	ensembl	human	known	74_37	splice_site_del	55.56	37.50	DEL	1.000	-	40	32
VPS13B	157680	genome.wustl.edu	37	8	100026141	100026142	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr8:100026141_100026142insA	ENST00000358544.2	+	2	236_237	c.125_126insA	c.(124-129)ttaaagfs	p.LK42fs	VPS13B_ENST00000355155.1_Frame_Shift_Ins_p.LK42fs|RP11-410L14.2_ENST00000521696.1_lincRNA|VPS13B_ENST00000357162.2_Frame_Shift_Ins_p.LK42fs|VPS13B_ENST00000441350.2_Frame_Shift_Ins_p.LK42fs|VPS13B_ENST00000395996.1_Frame_Shift_Ins_p.LK42fs	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	42					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAGCTCGAGTTAAAGTTGGATG	0.411													ENSG00000132549																									Colon(161;2205 2542 7338 31318)												0																																										SO:0001589	frameshift_variant	0				AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.128dupA	8.37:g.100026144_100026144dupA	ENSP00000351346:p.Leu42fs		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Frame_Shift_Ins	INS	pfam_Autophagy-rel_C	p.L44fs	ENST00000358544.2	37	c.125_126	CCDS6280.1	8																																																																																				VPS13B	-	NULL		0.411	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	0	0	0	66	66	126	0.00	0.00	-	NM_184042		100026142	+1	24	42	51	79	tier1	no_errors	ENST00000358544	ensembl	human	known	74_37	frame_shift_ins	32.00	34.71	INS	1.000:1.000	A	24	51
CCDC85B	11007	genome.wustl.edu	37	11	65658627	65658627	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr11:65658627G>T	ENST00000312579.2	+	1	753	c.373G>T	c.(373-375)Ggc>Tgc	p.G125C	FIBP_ENST00000426652.2_5'Flank|FIBP_ENST00000357519.4_5'Flank|FIBP_ENST00000338369.2_5'Flank|FIBP_ENST00000533045.1_5'Flank	NM_006848.2	NP_006839.2	Q15834	CC85B_HUMAN	coiled-coil domain containing 85B	125					cell differentiation (GO:0030154)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)									READ - Rectum adenocarcinoma(159;0.166)		CGAGCTGGAGGGCCGCCAGGA	0.746													ENSG00000175602																																					0													3.0	5.0	4.0					11																	65658627		1941	3898	5839	SO:0001583	missense	0			-	BC008796	CCDS8120.1	11q13.1	2010-12-24				ENSG00000175602			24926	protein-coding gene	gene with protein product	"""hepatitis delta antigen interacting protein A"""	605360				8810253, 15644333, 17873903	Standard	NM_006848		Approved	DIPA	uc001ogf.3	Q15834		ENST00000312579.2:c.373G>T	11.37:g.65658627G>T	ENSP00000311695:p.Gly125Cys		B2R598|Q96HA0	Missense_Mutation	SNP	pfam_DUF2216_coiled-coil	p.G125C	ENST00000312579.2	37	c.373	CCDS8120.1	11	.	.	.	.	.	.	.	.	.	.	G	17.76	3.467632	0.63625	.	.	ENSG00000175602	ENST00000312579	.	.	.	3.87	1.96	0.26148	.	0.167468	0.40302	U	0.001133	T	0.33847	0.0877	N	0.22421	0.69	0.32261	N	0.570089	D	0.67145	0.996	P	0.51945	0.685	T	0.43081	-0.9413	9	0.56958	D	0.05	-6.7232	5.9941	0.19483	0.3286:0.0:0.6714:0.0	.	125	Q15834	CC85B_HUMAN	C	125	.	ENSP00000311695:G125C	G	+	1	0	CCDC85B	65415203	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.560000	0.45896	0.411000	0.25702	0.455000	0.32223	GGC	-	CCDC85B	-	pfam_DUF2216_coiled-coil		0.746	CCDC85B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85B	HGNC	protein_coding	OTTHUMT00000391196.1	0	0	0	19	19	17	0.00	0.00	G	NM_006848		65658627	+1	5	2	6	6	tier1	no_errors	ENST00000312579	ensembl	human	known	74_37	missense	45.45	25.00	SNP	1.000	T	5	6
QRFPR	84109	genome.wustl.edu	37	4	122301664	122301664	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr4:122301664C>A	ENST00000394427.2	-	1	550	c.139G>T	c.(139-141)Gcc>Tcc	p.A47S	QRFPR_ENST00000334383.5_Missense_Mutation_p.A47S	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	47					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						AGCACGAGGGCCAGCTTGGCG	0.662													ENSG00000186867																																					0													44.0	41.0	42.0					4																	122301664		2203	4300	6503	SO:0001583	missense	0			-	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.139G>T	4.37:g.122301664C>A	ENSP00000377948:p.Ala47Ser			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.A47S	ENST00000394427.2	37	c.139	CCDS3719.1	4	.	.	.	.	.	.	.	.	.	.	C	13.39	2.222053	0.39300	.	.	ENSG00000186867	ENST00000394427;ENST00000334383	T;T	0.37915	1.17;1.17	4.91	4.91	0.64330	.	0.221417	0.46145	D	0.000313	T	0.33527	0.0866	L	0.39898	1.24	0.44603	D	0.997573	B;P;P	0.39424	0.22;0.544;0.673	B;B;B	0.37144	0.058;0.084;0.242	T	0.25082	-1.0142	10	0.59425	D	0.04	.	17.6969	0.88283	0.0:1.0:0.0:0.0	.	47;47;47	F2Z3L3;Q96P65;G4XH69	.;QRFPR_HUMAN;.	S	47	ENSP00000377948:A47S;ENSP00000335610:A47S	ENSP00000335610:A47S	A	-	1	0	QRFPR	122521114	0.998000	0.40836	1.000000	0.80357	0.547000	0.35210	2.279000	0.43435	2.231000	0.72958	0.467000	0.42956	GCC	-	QRFPR	-	prints_GPCR_Rhodpsn		0.662	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QRFPR	HGNC	protein_coding	OTTHUMT00000256641.2	0	0	0	34	34	10	0.00	0.00	C	NM_198179		122301664	-1	27	7	17	4	tier1	no_errors	ENST00000394427	ensembl	human	known	74_37	missense	61.36	63.64	SNP	1.000	A	27	17
TGM4	7047	genome.wustl.edu	37	3	44916168	44916168	+	5'UTR	SNP	G	G	C			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr3:44916168G>C	ENST00000296125.4	+	0	66				TGM4_ENST00000471637.1_3'UTR	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4						mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	AGAATCTGAAGGGATGATGGA	0.542													ENSG00000163810																																					0													108.0	93.0	98.0					3																	44916168		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			-	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.-3G>C	3.37:g.44916168G>C			Q16707|Q96QN4	R	SNP	-	NULL	ENST00000296125.4	37	NULL	CCDS2723.1	3																																																																																			-	TGM4	-	-		0.542	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM4	HGNC	protein_coding	OTTHUMT00000256755.2	0	0	0	65	65	66	0.00	0.00	G	NM_003241		44916168	+1	29	36	11	8	tier1	no_errors	ENST00000471637	ensembl	human	known	74_37	rna	72.50	81.82	SNP	0.004	C	29	11
WNT5B	81029	genome.wustl.edu	37	12	1755193	1755193	+	Silent	SNP	C	C	T			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr12:1755193C>T	ENST00000397196.2	+	5	1087	c.855C>T	c.(853-855)ccC>ccT	p.P285P	WNT5B_ENST00000310594.3_Silent_p.P285P|WNT5B_ENST00000537031.1_Silent_p.P285P|WNT5B_ENST00000545747.1_3'UTR	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	285					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			ACCCCAGCCCCGACTACTGCC	0.687													ENSG00000111186																																					0													42.0	43.0	43.0					12																	1755193		2202	4299	6501	SO:0001819	synonymous_variant	0			-	AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.855C>T	12.37:g.1755193C>T			A8K315|D3DUP9|Q96S49|Q9BV04	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt	p.P285	ENST00000397196.2	37	c.855	CCDS8510.1	12																																																																																			-	WNT5B	-	pfam_Wnt,smart_Wnt,prints_Wnt		0.687	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT5B	HGNC	protein_coding	OTTHUMT00000206747.2	0	0	0	58	58	7	0.00	0.00	C			1755193	+1	23	8	31	7	tier1	no_errors	ENST00000310594	ensembl	human	known	74_37	silent	41.82	53.33	SNP	0.016	T	23	31
PROM1	8842	genome.wustl.edu	37	4	15993986	15993986	+	Missense_Mutation	SNP	T	T	A			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr4:15993986T>A	ENST00000510224.1	-	17	2044	c.1796A>T	c.(1795-1797)gAa>gTa	p.E599V	PROM1_ENST00000505450.1_Missense_Mutation_p.E590V|PROM1_ENST00000539194.1_Missense_Mutation_p.E599V|PROM1_ENST00000540805.1_Missense_Mutation_p.E599V|PROM1_ENST00000447510.2_Missense_Mutation_p.E599V|PROM1_ENST00000543373.1_Missense_Mutation_p.E590V|PROM1_ENST00000508167.1_Missense_Mutation_p.E590V			O43490	PROM1_HUMAN	prominin 1	599					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						CTTCAGACTTTCCAATTCACT	0.373													ENSG00000007062																																					0													78.0	77.0	77.0					4																	15993986		1844	4102	5946	SO:0001583	missense	0			-	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1796A>T	4.37:g.15993986T>A	ENSP00000426809:p.Glu599Val		Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	pfam_Prominin	p.E599V	ENST00000510224.1	37	c.1796	CCDS47029.1	4	.	.	.	.	.	.	.	.	.	.	T	15.45	2.837496	0.50951	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.29	4.09	0.47781	.	0.353403	0.34652	N	0.003797	T	0.62282	0.2415	M	0.73962	2.25	0.09310	N	0.999995	D;D;D;D;D;P	0.62365	0.991;0.991;0.991;0.991;0.986;0.792	P;P;P;P;P;P	0.60682	0.878;0.878;0.878;0.878;0.76;0.643	T	0.56245	-0.8011	10	0.56958	D	0.05	-6.2559	10.2054	0.43109	0.0:0.0:0.1672:0.8328	.	590;599;590;599;590;599	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	V	599;599;599;590;590;599;590	ENSP00000415481:E599V;ENSP00000438045:E599V;ENSP00000443620:E599V;ENSP00000426090:E590V;ENSP00000427346:E590V;ENSP00000426809:E599V;ENSP00000445526:E590V	ENSP00000415481:E599V	E	-	2	0	PROM1	15603084	0.012000	0.17670	0.002000	0.10522	0.007000	0.05969	1.671000	0.37513	0.826000	0.34661	0.533000	0.62120	GAA	-	PROM1	-	pfam_Prominin		0.373	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROM1	HGNC	protein_coding	OTTHUMT00000359595.2	0	0	2	37	37	111	0.00	1.77	T	NM_006017		15993986	-1	8	43	10	53	tier1	no_errors	ENST00000447510	ensembl	human	known	74_37	missense	44.44	44.79	SNP	0.017	A	8	10
TMEM205	374882	genome.wustl.edu	37	19	11459737	11459737	+	5'Flank	SNP	A	A	G			TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr19:11459737A>G	ENST00000586956.1	-	0	0				TMEM205_ENST00000588560.1_5'Flank|RAB3D_ENST00000589655.1_5'Flank|TMEM205_ENST00000593256.2_5'Flank|TMEM205_ENST00000587948.1_5'Flank|TMEM205_ENST00000586590.1_5'Flank|TMEM205_ENST00000447337.1_5'Flank|CCDC159_ENST00000588790.1_Intron|TMEM205_ENST00000589555.1_5'Flank|TMEM205_ENST00000586218.1_5'Flank|CCDC159_ENST00000458408.1_Intron	NM_198536.2	NP_940938.1	Q6UW68	TM205_HUMAN	transmembrane protein 205							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						GGACACAGTGAGGACTGCAGA	0.627													ENSG00000183401																																					0													22.0	23.0	22.0					19																	11459737		1975	4141	6116	SO:0001631	upstream_gene_variant	0			-	AK127147	CCDS32909.1	19p13.2	2008-01-09				ENSG00000105518			29631	protein-coding gene	gene with protein product		613771				12975309	Standard	NM_198536		Approved	UNQ501, MBC3205	uc002mrb.2	Q6UW68			19.37:g.11459737A>G	Exception_encountered			Nonstop_Mutation	SNP	NULL	p.*39W	ENST00000586956.1	37	c.117	CCDS32909.1	19	.	.	.	.	.	.	.	.	.	.	A	6.846	0.525359	0.13066	.	.	ENSG00000183401	ENST00000427879	.	.	.	3.76	1.45	0.22620	.	.	.	.	.	T	0.30792	0.0776	.	.	.	0.09310	N	1	B	0.16166	0.016	B	0.11329	0.006	T	0.24693	-1.0153	7	0.54805	T	0.06	.	8.6688	0.34137	0.4544:0.5456:0.0:0.0	.	78	P0C7I6	CC159_HUMAN	G	78	.	ENSP00000390400:R78G	R	+	1	2	CCDC159	11320737	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.726000	0.25984	0.237000	0.21200	0.460000	0.39030	AGG	-	CCDC159	-	NULL		0.627	TMEM205-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCDC159	HGNC	protein_coding	OTTHUMT00000458746.1	0	0	0	30	30	17	0.00	0.00	A	NM_198536		11459737	+1	8	0	21	5	tier1	no_errors	ENST00000590636	ensembl	human	known	74_37	nonstop	27.59	0.00	SNP	0.000	G	8	21
POMZP3	22932	genome.wustl.edu	37	7	76256104	76256105	+	5'UTR	INS	-	-	GGAGGGCGGTGT	rs199981312|rs370134150		TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr7:76256104_76256105insGGAGGGCGGTGT	ENST00000310842.4	-	0	453_454				UPK3B_ENST00000443097.2_Intron|POMZP3_ENST00000275569.4_5'UTR|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000419923.2_Intron	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion											kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				TGGGTCGGCGGGGAGGGCGGTG	0.743													ENSG00000205485																																					0																																										SO:0001623	5_prime_UTR_variant	0				U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.-232->ACACCGCCCTCC	7.37:g.76256104_76256105insGGAGGGCGGTGT			F6STJ3|Q12903|Q9BWB4	R	INS	-	NULL	ENST00000310842.4	37	NULL	CCDS43606.1	7																																																																																				AC004980.7	-	-		0.743	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133091	Clone_based_vega_gene	protein_coding	OTTHUMT00000341775.1	0	0	0	10	10	10	0.00	0.00	-	NM_012230		76256105	+1	1	1	6	6	tier1	no_errors	ENST00000418663	ensembl	human	known	74_37	rna	14.29	14.29	INS	0.012:0.012	GGAGGGCGGTGT	1	6
WISP2	8839	genome.wustl.edu	37	20	43343900	43343905	+	5'UTR	DEL	GTGAGC	GTGAGC	-	rs1980802|rs376618937|rs369745130|rs540165300|rs1980801|rs60539660|rs201204669	byFrequency	TCGA-JV-A5VE-01A-11D-A29N-09	TCGA-JV-A5VE-10A-01D-A29N-09	GTGAGC	GTGAGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2809193b-495e-4159-9be7-fd3e2f4192b5	ca89a56f-8f9e-485f-8106-8c0c0cc69ded	g.chr20:43343900_43343905delGTGAGC	ENST00000190983.4	+	0	15_20				WISP2_ENST00000372868.2_Intron|WISP2_ENST00000372865.4_5'UTR|RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA	NM_003881.2	NP_003872.1	O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				gtgtgtgtgtgtgagcgcgcgcgcgc	0.568													ENSG00000064205																																					0																																										SO:0001623	5_prime_UTR_variant	0				AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000190983.4:c.-127GTGAGC>-	20.37:g.43343900_43343905delGTGAGC			B2R9N4|E1P612|Q6PEG3	R	DEL	-	NULL	ENST00000190983.4	37	NULL	CCDS13336.1	20																																																																																				WISP2	-	-		0.568	WISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000080484.2	0	0	0	1	1	1	0.00	0.00	GTGAGC	NM_003881		43343905	+1	0	0	0	0	tier1	no_errors	ENST00000497421	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.008:0.006:0.005:0.000:0.000:0.000	-	0	0
