#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
AZGP1	563	genome.wustl.edu	37	7	99564556	99564556	+	3'UTR	SNP	C	C	G			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:99564556C>G	ENST00000292401.4	-	0	1103				AZGP1_ENST00000411734.1_3'UTR|AZGP1_ENST00000483612.1_5'UTR	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					TTCTGTGGTTCAGCTCCCACA	0.592													ENSG00000160862																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.*70G>C	7.37:g.99564556C>G			D6W5T8|O60386|Q5XKQ4|Q8N4N0	R	SNP	-	NULL	ENST00000292401.4	37	NULL	CCDS5680.1	7																																																																																			-	AZGP1	-	-		0.592	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZGP1	HGNC	protein_coding	OTTHUMT00000059387.4	0	0	1	36	36	56	0.00	1.75	C	NM_001185		99564556	-1	18	22	12	15	tier1	no_errors	ENST00000483612	ensembl	human	known	74_37	rna	60.00	59.46	SNP	0.001	G	18	12
GABRG3	2567	genome.wustl.edu	37	15	27777805	27777805	+	Silent	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr15:27777805C>T	ENST00000333743.6	+	10	1436	c.1182C>T	c.(1180-1182)tcC>tcT	p.S394S	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	394					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TAAACAATTCCGTTTACTGGC	0.423													ENSG00000182256																									NSCLC(114;800 1656 7410 37729 45293)												0													97.0	99.0	98.0					15																	27777805		1966	4153	6119	SO:0001819	synonymous_variant	0			-		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1182C>T	15.37:g.27777805C>T			G3V594|Q9HD46|Q9NYT2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg3_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.S394	ENST00000333743.6	37	c.1182	CCDS45195.1	15																																																																																			-	GABRG3	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg3_rcpt,tigrfam_Neur_channel		0.423	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG3	HGNC	protein_coding	OTTHUMT00000103584.2	0	0	0	72	72	223	0.00	0.00	C			27777805	+1	67	73	36	66	tier1	no_errors	ENST00000333743	ensembl	human	known	74_37	silent	65.05	52.52	SNP	1.000	T	67	36
NPC1L1	29881	genome.wustl.edu	37	7	44560685	44560685	+	Missense_Mutation	SNP	T	T	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:44560685T>C	ENST00000289547.4	-	13	3041	c.2986A>G	c.(2986-2988)Atc>Gtc	p.I996V	NPC1L1_ENST00000381160.3_Missense_Mutation_p.I996V|NPC1L1_ENST00000546276.1_Missense_Mutation_p.I950V	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	996					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CCCATCGTGATGCTCATGCAG	0.567													ENSG00000015520																																					0													135.0	132.0	133.0					7																	44560685		2203	4300	6503	SO:0001583	missense	0			-		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2986A>G	7.37:g.44560685T>C	ENSP00000289547:p.Ile996Val		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.I996V	ENST00000289547.4	37	c.2986	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	T	7.160	0.585583	0.13749	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.93366	-3.1;-3.11;-3.21	4.63	-1.91	0.07641	.	4.895910	0.00757	U	0.001119	D	0.84437	0.5472	N	0.17474	0.49	0.09310	N	1	B;B;B	0.12630	0.002;0.001;0.006	B;B;B	0.14578	0.011;0.002;0.006	T	0.75628	-0.3252	10	0.09590	T	0.72	-2.7223	4.2307	0.10601	0.2795:0.0:0.4035:0.3171	.	950;996;996	B7ZLE6;Q17RV5;D3DVK9	.;.;.	V	996;996;950	ENSP00000289547:I996V;ENSP00000370552:I996V;ENSP00000438033:I950V	ENSP00000289547:I996V	I	-	1	0	NPC1L1	44527210	0.000000	0.05858	0.000000	0.03702	0.373000	0.29922	-2.678000	0.00839	-0.276000	0.09206	-0.672000	0.03802	ATC	-	NPC1L1	-	NULL		0.567	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	HGNC	protein_coding	OTTHUMT00000251256.1	0	0	0	26	26	106	0.00	0.00	T	NM_013389		44560685	-1	16	28	22	47	tier1	no_errors	ENST00000289547	ensembl	human	known	74_37	missense	42.11	37.33	SNP	0.000	C	16	22
OR4M1	441670	genome.wustl.edu	37	14	20249229	20249229	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:20249229G>C	ENST00000315957.4	+	1	829	c.748G>C	c.(748-750)Gtg>Ctg	p.V250L		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TACCATTGTGGTGCTAATGTT	0.448													ENSG00000176299																																					0													230.0	209.0	216.0					14																	20249229		2203	4297	6500	SO:0001583	missense	0			-		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.748G>C	14.37:g.20249229G>C	ENSP00000319654:p.Val250Leu		B9EH18|Q6IFA3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V250L	ENST00000315957.4	37	c.748	CCDS32021.1	14	.	.	.	.	.	.	.	.	.	.	.	7.088	0.571506	0.13623	.	.	ENSG00000176299	ENST00000315957	T	0.39787	1.06	4.42	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000411	T	0.21145	0.0509	N	0.04768	-0.165	0.32828	D	0.503717	B	0.25563	0.129	B	0.23852	0.049	T	0.20505	-1.0273	10	0.45353	T	0.12	-12.7343	10.122	0.42627	0.1008:0.0:0.8992:0.0	.	250	Q8NGD0	OR4M1_HUMAN	L	250	ENSP00000319654:V250L	ENSP00000319654:V250L	V	+	1	0	OR4M1	19319069	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	0.346000	0.19997	2.468000	0.83385	0.506000	0.49869	GTG	-	OR4M1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.448	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	HGNC	protein_coding	OTTHUMT00000409770.1	0	0	0	173	173	328	0.00	0.00	G			20249229	+1	38	26	141	101	tier1	no_errors	ENST00000315957	ensembl	human	known	74_37	missense	21.23	20.31	SNP	0.998	C	38	141
ATG2B	55102	genome.wustl.edu	37	14	96784117	96784117	+	Silent	SNP	G	G	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:96784117G>A	ENST00000359933.4	-	19	3848	c.2955C>T	c.(2953-2955)ggC>ggT	p.G985G		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	985					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AAAGCCCAATGCCATAGGAAA	0.343													ENSG00000066739																																					0													97.0	93.0	95.0					14																	96784117		1833	4103	5936	SO:0001819	synonymous_variant	0			-	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2955C>T	14.37:g.96784117G>A			Q6ZRE7|Q96DQ3|Q9NW80	Silent	SNP	pfam_Autophagy-rel_C	p.G985	ENST00000359933.4	37	c.2955	CCDS9944.2	14																																																																																			-	ATG2B	-	NULL		0.343	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	HGNC	protein_coding	OTTHUMT00000314037.1	0	0	1	107	107	158	0.00	0.63	G	NM_018036		96784117	-1	44	33	41	40	tier1	no_errors	ENST00000359933	ensembl	human	known	74_37	silent	51.76	45.21	SNP	0.301	A	44	41
FAT2	2196	genome.wustl.edu	37	5	150946545	150946545	+	Missense_Mutation	SNP	A	A	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:150946545A>C	ENST00000261800.5	-	1	1960	c.1948T>G	c.(1948-1950)Tca>Gca	p.S650A		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	650	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTGTGGGTGAGGCATAGTTT	0.418													ENSG00000086570																																					0													98.0	97.0	97.0					5																	150946545		2203	4300	6503	SO:0001583	missense	0			-	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1948T>G	5.37:g.150946545A>C	ENSP00000261800:p.Ser650Ala		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S650A	ENST00000261800.5	37	c.1948	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	A	2.941	-0.218967	0.06101	.	.	ENSG00000086570	ENST00000261800	T	0.42131	0.98	5.78	0.584	0.17422	Cadherin (4);Cadherin-like (1);	0.372511	0.22723	N	0.056432	T	0.23806	0.0576	L	0.44542	1.39	0.09310	N	1	B	0.20671	0.047	B	0.25506	0.061	T	0.14727	-1.0462	10	0.08179	T	0.78	.	0.4991	0.00576	0.4287:0.1344:0.1767:0.2602	.	650	Q9NYQ8	FAT2_HUMAN	A	650	ENSP00000261800:S650A	ENSP00000261800:S650A	S	-	1	0	FAT2	150926738	0.001000	0.12720	0.117000	0.21633	0.993000	0.82548	1.227000	0.32576	0.144000	0.18951	0.533000	0.62120	TCA	-	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.418	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	0	0	0	47	47	237	0.00	0.00	A	NM_001447		150946545	-1	15	63	15	62	tier1	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	50.00	50.40	SNP	0.000	C	15	15
RSPH4A	345895	genome.wustl.edu	37	6	116949179	116949179	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr6:116949179C>T	ENST00000229554.5	+	3	1446	c.1309C>T	c.(1309-1311)Cca>Tca	p.P437S	RSPH4A_ENST00000368581.4_Missense_Mutation_p.P437S|RSPH4A_ENST00000368580.4_Intron	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	437					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)				breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TTGCAATGAACCAGGAAGACC	0.393									Kartagener syndrome				ENSG00000111834																																					0													79.0	77.0	78.0					6																	116949179		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.1309C>T	6.37:g.116949179C>T	ENSP00000229554:p.Pro437Ser		B4DSI1|Q3KP24|Q5TD95	Missense_Mutation	SNP	pfam_Radial_spoke	p.P437S	ENST00000229554.5	37	c.1309	CCDS34521.1	6	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998910	0.74818	.	.	ENSG00000111834	ENST00000368581;ENST00000229554;ENST00000447842	T;T	0.19105	2.17;2.17	5.74	5.74	0.90152	.	0.099483	0.64402	D	0.000001	T	0.38957	0.1060	M	0.80508	2.5	0.58432	D	0.999999	D;D	0.89917	0.998;1.0	D;D	0.79784	0.993;0.987	T	0.17501	-1.0367	10	0.48119	T	0.1	-12.6035	13.064	0.59022	0.0:0.8386:0.1614:0.0	.	437;437	Q5TD94-3;Q5TD94	.;RSH4A_HUMAN	S	437;437;232	ENSP00000357570:P437S;ENSP00000229554:P437S	ENSP00000229554:P437S	P	+	1	0	RSPH4A	117055872	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.709000	0.68384	2.707000	0.92482	0.655000	0.94253	CCA	-	RSPH4A	-	pfam_Radial_spoke		0.393	RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH4A	HGNC	protein_coding	OTTHUMT00000041960.1	0	0	0	74	74	227	0.00	0.00	C	NM_001010892		116949179	+1	45	66	40	49	tier1	no_errors	ENST00000229554	ensembl	human	known	74_37	missense	52.94	57.39	SNP	1.000	T	45	40
MYO9A	4649	genome.wustl.edu	37	15	72190133	72190133	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr15:72190133G>C	ENST00000356056.5	-	25	5183	c.4711C>G	c.(4711-4713)Ctt>Gtt	p.L1571V	MYO9A_ENST00000566885.1_Missense_Mutation_p.L1191V|MYO9A_ENST00000424560.1_Missense_Mutation_p.L1571V|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000564571.1_Missense_Mutation_p.L1571V|MYO9A_ENST00000444904.1_Missense_Mutation_p.L1552V	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1571	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AGTACATTAAGTTCTCCCTTA	0.463													ENSG00000066933																																					0													66.0	60.0	62.0					15																	72190133		2199	4297	6496	SO:0001583	missense	0			-	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.4711C>G	15.37:g.72190133G>C	ENSP00000348349:p.Leu1571Val		B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.L1571V	ENST00000356056.5	37	c.4711	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.507910	0.00984	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.84070	-1.8;-1.78;-1.79	5.92	0.523	0.17060	.	.	.	.	.	T	0.65354	0.2683	N	0.19112	0.55	0.09310	N	1	B;B;B	0.14012	0.009;0.009;0.0	B;B;B	0.12837	0.008;0.008;0.0	T	0.50136	-0.8863	9	0.30854	T	0.27	.	1.9466	0.03358	0.2783:0.1309:0.4636:0.1272	.	1552;1571;1571	B2RTY4-2;B2RTY4-4;B2RTY4	.;.;MYO9A_HUMAN	V	1571;1571;1552	ENSP00000348349:L1571V;ENSP00000399162:L1571V;ENSP00000398250:L1552V	ENSP00000348349:L1571V	L	-	1	0	MYO9A	69977187	0.177000	0.23109	0.114000	0.21550	0.150000	0.21749	0.526000	0.22971	0.378000	0.24764	0.650000	0.86243	CTT	-	MYO9A	-	NULL		0.463	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	0	0	0	45	45	154	0.00	0.00	G	NM_006901		72190133	-1	18	41	47	91	tier1	no_errors	ENST00000424560	ensembl	human	known	74_37	missense	27.69	30.83	SNP	0.012	C	18	47
ADAD2	161931	genome.wustl.edu	37	16	84230276	84230276	+	Missense_Mutation	SNP	G	G	A	rs374328634		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:84230276G>A	ENST00000315906.5	+	9	1602	c.1550G>A	c.(1549-1551)cGt>cAt	p.R517H	RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.R599H	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	517	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						CCTCCCTCCCGTCTCTGCAAG	0.612													ENSG00000140955																																					0								G	HIS/ARG,HIS/ARG	0,4400		0,0,2200	96.0	102.0	100.0		1550,1796	4.2	1.0	16		100	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	29,29	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	517/584,599/666	84230276	1,12999	2200	4300	6500	SO:0001583	missense	0			-	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1550G>A	16.37:g.84230276G>A	ENSP00000325153:p.Arg517His		B2RCL6|Q8NA94	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsR-bd_dom,smart_A_deamin,pfscan_dsR-bd_dom,pfscan_A_deamin	p.R599H	ENST00000315906.5	37	c.1796	CCDS45536.1	16	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500070	0.64298	0.0	1.16E-4	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.94723	-3.5;-3.5	5.27	4.25	0.50352	Adenosine deaminase/editase (2);	0.000000	0.64402	D	0.000001	D	0.97387	0.9145	M	0.91872	3.25	0.47183	D	0.999341	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97499	1.0059	10	0.87932	D	0	-37.8386	11.0193	0.47709	0.0:0.1882:0.8118:0.0	.	517;599	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	H	517;599	ENSP00000325153:R517H;ENSP00000268624:R599H	ENSP00000268624:R599H	R	+	2	0	ADAD2	82787777	1.000000	0.71417	1.000000	0.80357	0.406000	0.30931	3.533000	0.53561	2.440000	0.82611	0.585000	0.79938	CGT	-	ADAD2	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.612	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD2	HGNC	protein_coding	OTTHUMT00000433385.1	0	0	0	35	35	101	0.00	0.00	G	NM_139174		84230276	+1	20	33	18	34	tier1	no_errors	ENST00000268624	ensembl	human	known	74_37	missense	52.63	49.25	SNP	1.000	A	20	18
MARS2	92935	genome.wustl.edu	37	2	198571474	198571474	+	Missense_Mutation	SNP	C	C	G			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr2:198571474C>G	ENST00000282276.6	+	1	1388	c.1345C>G	c.(1345-1347)Ctg>Gtg	p.L449V	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	449					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	GGATTATGCTCTGGTGAGCGC	0.552													ENSG00000247626																																					0													88.0	91.0	90.0					2																	198571474		2203	4300	6503	SO:0001583	missense	0			-	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.1345C>G	2.37:g.198571474C>G	ENSP00000282276:p.Leu449Val		A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	pfam_Methionyl/Leucyl_tR_Synth,pfam_aa-tR-synth_Ia,pfam_Cys-tR/MSH_ligase,superfamily_tRsynth_1a_anticodon-bd,prints_Met-tR_synth,tigrfam_Met-tR_synth	p.L449V	ENST00000282276.6	37	c.1345	CCDS33358.1	2	.	.	.	.	.	.	.	.	.	.	C	10.89	1.479740	0.26511	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.53857	0.6	5.17	-0.14	0.13456	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.230148	0.42964	D	0.000623	T	0.41419	0.1158	L	0.46157	1.445	0.36490	D	0.868386	P	0.38711	0.643	B	0.38327	0.271	T	0.45425	-0.9262	10	0.72032	D	0.01	-10.7732	7.9483	0.29999	0.0:0.3751:0.0:0.6249	.	449	Q96GW9	SYMM_HUMAN	V	449;376	ENSP00000282276:L449V	ENSP00000282276:L449V	L	+	1	2	MARS2	198279719	0.259000	0.24043	0.940000	0.37924	0.989000	0.77384	0.287000	0.18920	0.058000	0.16222	-0.140000	0.14226	CTG	-	MARS2	-	superfamily_tRsynth_1a_anticodon-bd,tigrfam_Met-tR_synth		0.552	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS2	HGNC	protein_coding	OTTHUMT00000335477.1	0	0	0	28	28	96	0.00	0.00	C	NM_138395		198571474	+1	18	35	16	37	tier1	no_errors	ENST00000282276	ensembl	human	known	74_37	missense	52.94	48.61	SNP	0.965	G	18	16
ISM1	140862	genome.wustl.edu	37	20	13279761	13279761	+	Silent	SNP	C	C	T	rs572363345		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr20:13279761C>T	ENST00000262487.4	+	6	1056	c.1050C>T	c.(1048-1050)gaC>gaT	p.D350D	TASP1_ENST00000539805.1_Intron	NM_080826.1	NP_543016.1	B1AKI9	ISM1_HUMAN	isthmin 1, angiogenesis inhibitor	350	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)				NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(8)|lung(5)|urinary_tract(1)	17						GCTGGAAGGACGCCAGCGGGC	0.647													ENSG00000101230	C|||	1	0.000199681	0.0008	0.0	5008	,	,		18261	0.0		0.0	False		,,,				2504	0.0																0													41.0	47.0	45.0					20																	13279761		2144	4237	6381	SO:0001819	synonymous_variant	0			-	AL133463	CCDS46579.1	20p12.1	2013-05-15	2013-05-15	2008-12-23	ENSG00000101230	ENSG00000101230			16213	protein-coding gene	gene with protein product		615793	"""chromosome 20 open reading frame 82"", ""isthmin 1 homolog (zebrafish)"""	C20orf82			Standard	NM_080826		Approved	bA149I18.1	uc010gce.1	B1AKI9		ENST00000262487.4:c.1050C>T	20.37:g.13279761C>T			Q8WVH9	Silent	SNP	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.D350	ENST00000262487.4	37	c.1050	CCDS46579.1	20																																																																																			-	ISM1	-	pfam_AMOP,smart_AMOP,pfscan_AMOP		0.647	ISM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISM1	HGNC	protein_coding	OTTHUMT00000078039.2	0	0	0	31	31	60	0.00	0.00	C			13279761	+1	17	9	16	10	tier1	no_errors	ENST00000262487	ensembl	human	known	74_37	silent	51.52	47.37	SNP	0.980	T	17	16
ERVMER34-1	100288413	genome.wustl.edu	37	4	53610776	53610776	+	Silent	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:53610776C>T	ENST00000443173.1	-	3	1772	c.912G>A	c.(910-912)ggG>ggA	p.G304G	ERVMER34-1_ENST00000540758.1_Silent_p.G304G|ERVMER34-1_ENST00000454756.2_Intron|ERVMER34-1_ENST00000440542.1_Silent_p.G304G	NM_001242690.1	NP_001229619.1	Q9H9K5	MER34_HUMAN	endogenous retrovirus group MER34, member 1	304						integral component of membrane (GO:0016021)|viral envelope (GO:0019031)				endometrium(3)|kidney(1)	4						ctttgtacaccccattgccgc	0.498													ENSG00000226887																																					0													86.0	74.0	78.0					4																	53610776		692	1591	2283	SO:0001819	synonymous_variant	0			-			4q12	2011-10-20			ENSG00000226887	ENSG00000226887			42970	other	endogenous retrovirus							Standard	NM_024534		Approved		uc003gzs.3	Q9H9K5	OTTHUMG00000150366	ENST00000443173.1:c.912G>A	4.37:g.53610776C>T			B3KTB4|Q0P5R3|Q6NWN0	Silent	SNP	pfam_TLV/ENV_coat_polyprotein	p.G304	ENST00000443173.1	37	c.912		4																																																																																			-	ERVMER34-1	-	NULL		0.498	ERVMER34-1-002	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	ERVMER34-1	HGNC	protein_coding	OTTHUMT00000317860.2	0	0	0	59	59	261	0.00	0.00	C	NM_024534		53610776	-1	25	76	29	80	tier1	no_errors	ENST00000440542	ensembl	human	known	74_37	silent	46.30	48.72	SNP	0.006	T	25	29
DNMT1	1786	genome.wustl.edu	37	19	10287970	10287970	+	Silent	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:10287970C>T	ENST00000340748.4	-	5	754	c.519G>A	c.(517-519)aaG>aaA	p.K173K	DNMT1_ENST00000359526.4_Silent_p.K189K|DNMT1_ENST00000540357.1_Silent_p.K173K			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	173	Interaction with DNMT3B.|Interaction with PCNA.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	ATACTGACCCCTTTGCAAAAT	0.463													ENSG00000130816																																					0													145.0	128.0	134.0					19																	10287970		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.519G>A	19.37:g.10287970C>T			A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	pirsf_D_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.K189	ENST00000340748.4	37	c.567	CCDS12228.1	19																																																																																			-	DNMT1	-	pirsf_D_C5-MeTrfase_1_euk		0.463	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	HGNC	protein_coding	OTTHUMT00000451166.1	0	0	0	82	82	221	0.00	0.00	C	NM_001379		10287970	-1	32	64	81	114	tier1	no_errors	ENST00000359526	ensembl	human	known	74_37	silent	28.32	35.96	SNP	0.692	T	32	81
IFNLR1	163702	genome.wustl.edu	37	1	24484288	24484288	+	Missense_Mutation	SNP	T	T	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:24484288T>A	ENST00000327535.1	-	7	907	c.895A>T	c.(895-897)Acc>Tcc	p.T299S	IFNLR1_ENST00000327575.2_3'UTR|IFNLR1_ENST00000374421.3_Missense_Mutation_p.T270S	NM_170743.3|NM_173064.2	NP_734464.1|NP_775087.1	Q8IU57	INLR1_HUMAN	interferon, lambda receptor 1	299					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mucosal immune response (GO:0002385)|negative regulation of cell proliferation (GO:0008285)|regulation of defense response to virus by host (GO:0050691)|response to type III interferon (GO:0034342)	integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)											ACCCCTCTGGTCAGTTCCTTT	0.562													ENSG00000185436																																					0													112.0	118.0	116.0					1																	24484288		2203	4300	6503	SO:0001583	missense	0			-	AY129153	CCDS248.1, CCDS249.1, CCDS250.1	1p36.11	2012-11-27	2012-11-26	2012-11-26	ENSG00000185436	ENSG00000185436		"""Interferons"""	18584	protein-coding gene	gene with protein product	"""interferon lambda receptor 1"""	607404	"""interleukin 28 receptor, alpha"", ""interleukin 28 receptor, alpha (interferon, lambda receptor)"""	IL28RA			Standard	NM_173064		Approved	CRF2/12, IFNLR, IL-28R1	uc001bis.3	Q8IU57	OTTHUMG00000003036	ENST00000327535.1:c.895A>T	1.37:g.24484288T>A	ENSP00000327824:p.Thr299Ser		Q5VTX5|Q5VTX7|Q5VTX8|Q6ZML8|Q8IV66|Q8IZI7|Q8IZI8	Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.T299S	ENST00000327535.1	37	c.895	CCDS248.1	1	.	.	.	.	.	.	.	.	.	.	T	6.881	0.531998	0.13127	.	.	ENSG00000185436	ENST00000327535;ENST00000374421	.	.	.	5.38	-1.86	0.07760	.	0.946429	0.08947	N	0.870671	T	0.30479	0.0766	L	0.59436	1.845	0.09310	N	0.999995	B;B	0.26195	0.144;0.094	B;B	0.23275	0.036;0.045	T	0.30592	-0.9973	9	0.12430	T	0.62	-2.0418	4.6022	0.12359	0.0:0.2575:0.3013:0.4412	.	299;270	Q8IU57;Q8IU57-2	I28RA_HUMAN;.	S	299;270	.	ENSP00000327824:T299S	T	-	1	0	IL28RA	24356875	0.000000	0.05858	0.010000	0.14722	0.090000	0.18270	-0.161000	0.10026	-0.150000	0.11195	-0.242000	0.12053	ACC	-	IFNLR1	-	NULL		0.562	IFNLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFNLR1	HGNC	protein_coding	OTTHUMT00000008402.1	0	0	0	55	55	188	0.00	0.00	T	NM_170743		24484288	-1	22	53	33	67	tier1	no_errors	ENST00000327535	ensembl	human	known	74_37	missense	40.00	44.17	SNP	0.104	A	22	33
PPP1R3F	89801	genome.wustl.edu	37	X	49130125	49130125	+	Intron	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chrX:49130125G>T	ENST00000055335.6	+	1	1020				PPP1R3F_ENST00000495799.1_Intron|PPP1R3F_ENST00000466508.1_Intron|PPP1R3F_ENST00000438316.1_Intron|LL0XNC01-7P3.1_ENST00000602455.1_lincRNA	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F						regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					TTGAAGACTAGCCACCCTTTG	0.478													ENSG00000270012																																					0																																										SO:0001627	intron_variant	0			-		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1004+2789G>T	X.37:g.49130125G>T			A2VDJ8|B3KPW2|E9PCM3	R	SNP	-	NULL	ENST00000055335.6	37	NULL	CCDS35254.1	X																																																																																			-	LL0XNC01-7P3.1	-	-		0.478	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000270012	Clone_based_vega_gene	protein_coding	OTTHUMT00000060819.2	0	0	0	17	17	177	0.00	0.00	G	NM_033215		49130125	+1	7	28	10	55	tier1	no_errors	ENST00000602455	ensembl	human	known	74_37	rna	41.18	33.73	SNP	0.891	T	7	10
TRIML2	205860	genome.wustl.edu	37	4	189012788	189012788	+	Silent	SNP	A	A	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:189012788A>T	ENST00000512729.1	-	7	1277	c.903T>A	c.(901-903)acT>acA	p.T301T	TRIML2_ENST00000326754.3_Silent_p.T326T	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	301	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		AGACCCAGAGAGTCCACTCGG	0.562													ENSG00000179046																																					0													135.0	150.0	145.0					4																	189012788		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.903T>A	4.37:g.189012788A>T			B7Z6J6	Silent	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.T301	ENST00000512729.1	37	c.903	CCDS3850.1	4																																																																																			-	TRIML2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.562	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	0	0	0	43	43	132	0.00	0.00	A	NM_173553		189012788	-1	16	30	18	34	tier1	no_errors	ENST00000512729	ensembl	human	known	74_37	silent	47.06	46.15	SNP	0.000	T	16	18
ADAMTS12	81792	genome.wustl.edu	37	5	33561192	33561192	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:33561192G>C	ENST00000504830.1	-	20	4400	c.4065C>G	c.(4063-4065)gaC>gaG	p.D1355E	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.D1270E	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1355	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TTTTTGCAGGGTCAGGTCTCT	0.567										HNSCC(64;0.19)			ENSG00000151388																																					0													131.0	118.0	122.0					5																	33561192		2203	4300	6503	SO:0001583	missense	0			-	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4065C>G	5.37:g.33561192G>C	ENSP00000422554:p.Asp1355Glu		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D1355E	ENST00000504830.1	37	c.4065	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	G	7.890	0.732197	0.15507	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.59638	0.25;0.25	5.4	3.56	0.40772	.	0.239932	0.43416	N	0.000563	T	0.26376	0.0644	N	0.05487	-0.04	0.80722	D	1	B;B	0.25048	0.096;0.117	B;B	0.22601	0.024;0.04	T	0.19095	-1.0316	10	0.02654	T	1	.	4.0046	0.09595	0.169:0.0:0.4784:0.3526	.	1270;1355	P58397-3;P58397	.;ATS12_HUMAN	E	1355;1270	ENSP00000422554:D1355E;ENSP00000344847:D1270E	ENSP00000344847:D1270E	D	-	3	2	ADAMTS12	33596949	0.978000	0.34361	0.999000	0.59377	0.559000	0.35586	0.137000	0.15995	0.604000	0.29930	-0.188000	0.12872	GAC	-	ADAMTS12	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.567	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	0	0	0	77	77	147	0.00	0.00	G	NM_030955		33561192	-1	37	43	29	53	tier1	no_errors	ENST00000504830	ensembl	human	known	74_37	missense	56.06	44.33	SNP	0.998	C	37	29
AKAP11	11215	genome.wustl.edu	37	13	42891697	42891697	+	Missense_Mutation	SNP	C	C	T	rs529206918		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr13:42891697C>T	ENST00000025301.2	+	12	5613	c.5438C>T	c.(5437-5439)aCg>aTg	p.T1813M		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1813					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		CTGCTAATTACGAATATTGAC	0.378													ENSG00000023516	C|||	1	0.000199681	0.0	0.0	5008	,	,		19758	0.0		0.0	False		,,,				2504	0.001																0													125.0	115.0	119.0					13																	42891697		2203	4300	6503	SO:0001583	missense	0			-	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5438C>T	13.37:g.42891697C>T	ENSP00000025301:p.Thr1813Met		O75124|Q9NUK7	Missense_Mutation	SNP	NULL	p.T1813M	ENST00000025301.2	37	c.5438	CCDS9383.1	13	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495713	0.26774	.	.	ENSG00000023516	ENST00000025301	T	0.14022	2.54	5.79	2.67	0.31697	.	0.540943	0.18111	N	0.151344	T	0.06508	0.0167	L	0.27053	0.805	0.09310	N	1	P	0.38167	0.621	B	0.24006	0.05	T	0.30909	-0.9962	10	0.44086	T	0.13	.	4.7101	0.12868	0.0:0.4758:0.164:0.3601	.	1813	Q9UKA4	AKA11_HUMAN	M	1813	ENSP00000025301:T1813M	ENSP00000025301:T1813M	T	+	2	0	AKAP11	41789697	0.001000	0.12720	0.015000	0.15790	0.989000	0.77384	0.562000	0.23531	0.769000	0.33313	0.557000	0.71058	ACG	-	AKAP11	-	NULL		0.378	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	HGNC	protein_coding	OTTHUMT00000044700.2	0	0	0	47	47	212	0.00	0.00	C	NM_016248		42891697	+1	7	20	46	94	tier1	no_errors	ENST00000025301	ensembl	human	known	74_37	missense	13.21	17.54	SNP	0.000	T	7	46
TSHZ1	10194	genome.wustl.edu	37	18	72998202	72998202	+	Silent	SNP	C	C	T	rs573970992		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr18:72998202C>T	ENST00000580243.1	+	2	1188	c.840C>T	c.(838-840)tcC>tcT	p.S280S	TSHZ1_ENST00000322038.5_Silent_p.S235S			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	280					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		ACAAGGACTCCGAGAAGACCA	0.587													ENSG00000179981																																					0													111.0	89.0	96.0					18																	72998202		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.840C>T	18.37:g.72998202C>T			O60534|Q4LE29|Q53EU4	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.S280	ENST00000580243.1	37	c.840		18																																																																																			-	TSHZ1	-	NULL		0.587	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	HGNC	protein_coding	OTTHUMT00000444913.1	0	0	0	42	42	99	0.00	0.00	C	NM_005786		72998202	+1	33	34	27	40	tier1	no_errors	ENST00000580243	ensembl	human	known	74_37	silent	55.00	45.95	SNP	0.999	T	33	27
NDST3	9348	genome.wustl.edu	37	4	119154221	119154221	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:119154221C>T	ENST00000296499.5	+	9	2277	c.1874C>T	c.(1873-1875)tCc>tTc	p.S625F	NDST3_ENST00000433996.2_Missense_Mutation_p.S544F	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	625	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						CTTAGTAACTCCCCCAGCCCA	0.363													ENSG00000164100																																					0													161.0	159.0	160.0					4																	119154221		2203	4300	6503	SO:0001583	missense	0			-	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1874C>T	4.37:g.119154221C>T	ENSP00000296499:p.Ser625Phe		B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S625F	ENST00000296499.5	37	c.1874	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	C	8.384	0.838135	0.16891	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.55052	0.54;0.54	5.64	5.64	0.86602	Sulfotransferase domain (1);	0.057217	0.64402	D	0.000001	T	0.23532	0.0569	N	0.01431	-0.87	0.32449	N	0.545642	B;B	0.15719	0.014;0.0	B;B	0.14578	0.011;0.004	T	0.21690	-1.0238	10	0.09338	T	0.73	.	12.9795	0.58555	0.0:0.926:0.0:0.074	.	544;625	B4DI67;O95803	.;NDST3_HUMAN	F	625;544	ENSP00000296499:S625F;ENSP00000396625:S544F	ENSP00000296499:S625F	S	+	2	0	NDST3	119373669	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.344000	0.44010	2.645000	0.89757	0.637000	0.83480	TCC	-	NDST3	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.363	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	HGNC	protein_coding	OTTHUMT00000256517.4	0	0	0	108	108	311	0.00	0.00	C	NM_004784		119154221	+1	39	63	60	68	tier1	no_errors	ENST00000296499	ensembl	human	known	74_37	missense	39.39	48.09	SNP	1.000	T	39	60
ITGB7	3695	genome.wustl.edu	37	12	53589909	53589909	+	Silent	SNP	G	G	A	rs372436147		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:53589909G>A	ENST00000267082.5	-	7	1122	c.891C>T	c.(889-891)gaC>gaT	p.D297D	ITGB7_ENST00000550743.2_Silent_p.D297D|ITGB7_ENST00000338737.4_Silent_p.D297D|ITGB7_ENST00000422257.3_Silent_p.D297D	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	297	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCAACTTCCCGTCCCCAGCTG	0.552													ENSG00000139626	G|||	1	0.000199681	0.0008	0.0	5008	,	,		20336	0.0		0.0	False		,,,				2504	0.0																0								G		1,4405	2.1+/-5.4	0,1,2202	104.0	93.0	97.0		891	-2.3	1.0	12		97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ITGB7	NM_000889.1		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		297/799	53589909	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.891C>T	12.37:g.53589909G>A			Q9UCP7|Q9UCS7	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Plexin-like_fold,superfamily_Integrin_bsu_tail,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.D297	ENST00000267082.5	37	c.891	CCDS8849.1	12																																																																																			-	ITGB7	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,prints_Integrin_bsu		0.552	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB7	HGNC	protein_coding	OTTHUMT00000405821.2	0	0	0	51	51	163	0.00	0.00	G			53589909	-1	32	45	24	49	tier1	no_errors	ENST00000267082	ensembl	human	known	74_37	silent	57.14	47.87	SNP	0.990	A	32	24
BCL2L12	83596	genome.wustl.edu	37	19	50169166	50169166	+	Missense_Mutation	SNP	T	T	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:50169166T>A	ENST00000246785.3	+	1	344	c.86T>A	c.(85-87)aTt>aAt	p.I29N	IRF3_ENST00000599144.1_5'Flank|IRF3_ENST00000442265.2_5'Flank|IRF3_ENST00000598808.1_5'Flank|IRF3_ENST00000600911.1_5'Flank|IRF3_ENST00000593922.1_5'Flank|IRF3_ENST00000309877.7_5'Flank|IRF3_ENST00000596765.1_5'Flank|BCL2L12_ENST00000246784.3_Missense_Mutation_p.I29N|IRF3_ENST00000596822.1_5'Flank|IRF3_ENST00000600022.1_5'Flank|IRF3_ENST00000597198.1_5'Flank|IRF3_ENST00000599223.1_5'Flank|BCL2L12_ENST00000441864.2_Missense_Mutation_p.I29N|IRF3_ENST00000377135.4_5'Flank|IRF3_ENST00000601291.1_5'Flank|IRF3_ENST00000377139.3_5'Flank	NM_001040668.1|NM_138639.1	NP_001035758.1|NP_619580.1	Q9HB09	B2L12_HUMAN	BCL2-like 12 (proline rich)	29					inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	8		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.000681)|GBM - Glioblastoma multiforme(134;0.0214)		CACATGCAAATTGAGCGTGCA	0.602													ENSG00000126453																																					0													37.0	39.0	39.0					19																	50169166		2203	4300	6503	SO:0001583	missense	0			-	AF289220	CCDS12776.1, CCDS46144.1, CCDS74424.1, CCDS74423.1	19q13.3	2014-03-07				ENSG00000126453			13787	protein-coding gene	gene with protein product		610837					Standard	NM_001040668		Approved		uc002ppa.3	Q9HB09		ENST00000246785.3:c.86T>A	19.37:g.50169166T>A	ENSP00000246785:p.Ile29Asn		Q3SY11|Q3SY13|Q96I96|Q9HB08	Missense_Mutation	SNP	NULL	p.I29N	ENST00000246785.3	37	c.86	CCDS12776.1	19	.	.	.	.	.	.	.	.	.	.	T	16.56	3.158751	0.57368	.	.	ENSG00000126453	ENST00000246785;ENST00000441864;ENST00000246784	T;T;T	0.56776	0.62;0.62;0.44	3.62	3.62	0.41486	.	0.459704	0.16205	U	0.224767	T	0.37705	0.1013	N	0.08118	0	0.29706	N	0.839742	P;P	0.47677	0.899;0.899	P;P	0.47705	0.555;0.555	T	0.31447	-0.9943	10	0.87932	D	0	0.1035	8.8927	0.35444	0.0:0.0:0.0:1.0	.	29;29	Q3SY13;Q9HB09	.;B2L12_HUMAN	N	29	ENSP00000246785:I29N;ENSP00000393803:I29N;ENSP00000246784:I29N	ENSP00000246784:I29N	I	+	2	0	BCL2L12	54860978	0.980000	0.34600	0.877000	0.34402	0.435000	0.31806	1.996000	0.40776	1.898000	0.54952	0.383000	0.25322	ATT	-	BCL2L12	-	NULL		0.602	BCL2L12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L12	HGNC	protein_coding	OTTHUMT00000465770.1	0	0	0	54	54	113	0.00	0.00	T	NM_052842		50169166	+1	42	19	61	38	tier1	no_errors	ENST00000246785	ensembl	human	known	74_37	missense	40.78	33.33	SNP	0.888	A	42	61
ECE2	9718	genome.wustl.edu	37	3	184009139	184009139	+	Missense_Mutation	SNP	A	A	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr3:184009139A>C	ENST00000402825.3	+	18	2387	c.2387A>C	c.(2386-2388)aAa>aCa	p.K796T	ECE2_ENST00000357474.5_Missense_Mutation_p.K724T|ECE2_ENST00000404464.3_Missense_Mutation_p.K678T|ECE2_ENST00000359140.4_Missense_Mutation_p.K649T|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	796	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGGCTTACAAAGCATGGCTG	0.627													ENSG00000145194																																					0													75.0	76.0	75.0					3																	184009139		2203	4300	6503	SO:0001583	missense	0			-	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.2387A>C	3.37:g.184009139A>C	ENSP00000384223:p.Lys796Thr		A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.K796T	ENST00000402825.3	37	c.2387	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	A	6.030	0.373840	0.11409	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81	5.19	2.75	0.32379	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.406947	0.26609	N	0.023431	D	0.89608	0.6764	M	0.70275	2.135	0.25362	N	0.98878	B;B;B;B;B	0.26602	0.154;0.011;0.001;0.001;0.0	B;B;B;B;B	0.38020	0.263;0.029;0.003;0.003;0.005	T	0.82291	-0.0530	10	0.52906	T	0.07	-1.8311	6.3379	0.21306	0.7556:0.1595:0.0848:0.0	.	398;678;724;649;796	B4DHU4;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;ECE2_HUMAN	T	796;649;678;724;670	ENSP00000384223:K796T;ENSP00000352052:K649T;ENSP00000385846:K678T;ENSP00000350066:K724T;ENSP00000398444:K670T	ENSP00000350066:K724T	K	+	2	0	ECE2	185491833	0.005000	0.15991	0.603000	0.28903	0.429000	0.31625	1.864000	0.39469	0.289000	0.22422	0.459000	0.35465	AAA	-	ECE2	-	pfam_Peptidase_M13_C		0.627	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	0	0	0	54	54	91	0.00	0.00	A	NM_014693		184009139	+1	21	21	22	27	tier1	no_errors	ENST00000402825	ensembl	human	known	74_37	missense	48.84	43.75	SNP	0.106	C	21	22
ELMO1	9844	genome.wustl.edu	37	7	36895294	36895295	+	Frame_Shift_Ins	INS	-	-	G	rs182459066		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-	-	G	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:36895294_36895295insG	ENST00000310758.4	-	22	2692_2693	c.2045_2046insC	c.(2044-2046)acgfs	p.T682fs	ELMO1_ENST00000396040.2_Frame_Shift_Ins_p.T202fs|ELMO1_ENST00000341056.3_Frame_Shift_Ins_p.T384fs|ELMO1_ENST00000442504.1_Frame_Shift_Ins_p.T682fs|ELMO1_ENST00000396045.3_Frame_Shift_Ins_p.T202fs|ELMO1_ENST00000448602.1_Frame_Shift_Ins_p.T682fs	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	682					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GGTCATTCCGCGTCAGGTCGCT	0.574													ENSG00000155849																																					0																																										SO:0001589	frameshift_variant	0				AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.2046dupC	7.37:g.36895295_36895295dupG	ENSP00000312185:p.Thr682fs		A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Frame_Shift_Ins	INS	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.R683fs	ENST00000310758.4	37	c.2046_2045	CCDS5449.1	7																																																																																				ELMO1	-	NULL		0.574	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	0	0	0	37	37	126	0.00	0.00	-	NM_130442		36895295	-1	17	19	18	36	tier1	no_errors	ENST00000310758	ensembl	human	known	74_37	frame_shift_ins	48.57	34.55	INS	0.017:0.999	G	17	18
FAM230C	26080	genome.wustl.edu	37	22	21663891	21663891	+	lincRNA	SNP	T	T	C	rs482113		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr22:21663891T>C	ENST00000436681.1	-	0	279																											TGGTGTGATGTATGGAGGTGG	0.537													ENSG00000206142																																					0																																												0			-																													22.37:g.21663891T>C				R	SNP	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			-	KB-1183D5.13	-	-		0.537	KB-1183D5.13-003	KNOWN	basic	lincRNA	FAM230C	Clone_based_vega_gene	lincRNA	OTTHUMT00000320109.1	0	0	0	63	63	7	0.00	0.00	T			21663891	-1	8	2	1	0	tier1	no_errors	ENST00000436681	ensembl	human	known	74_37	rna	88.89	100.00	SNP	0.411	C	8	1
HMGB1P5	10354	genome.wustl.edu	37	3	22424060	22424060	+	RNA	SNP	G	G	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr3:22424060G>A	ENST00000451497.1	+	0	625									high mobility group box 1 pseudogene 5																		TGTAAGATTTGTTTTTAAACT	0.338													ENSG00000132967																																					0																																												0			-	AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424060G>A				R	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			-	HMGB1P5	-	-		0.338	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1	0	0	0	51	51	17	0.00	0.00	G	NG_000897		22424060	+1	32	7	30	3	tier1	no_errors	ENST00000451497	ensembl	human	known	74_37	rna	51.61	70.00	SNP	1.000	A	32	30
LENG8	114823	genome.wustl.edu	37	19	54967914	54967914	+	Silent	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:54967914C>A	ENST00000326764.5	+	11	2024	c.1545C>A	c.(1543-1545)cgC>cgA	p.R515R	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	478										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GGGCAGCCCGCTTCCAGCACG	0.677													ENSG00000167615																																					0													24.0	27.0	26.0					19																	54967914		2200	4296	6496	SO:0001819	synonymous_variant	0			-	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.1545C>A	19.37:g.54967914C>A			B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.R515	ENST00000326764.5	37	c.1545	CCDS12894.1	19																																																																																			-	LENG8	-	NULL		0.677	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG8	HGNC	protein_coding	OTTHUMT00000140523.2	0	0	0	51	51	13	0.00	0.00	C	NM_052925		54967914	+1	28	7	25	3	tier1	no_errors	ENST00000326764	ensembl	human	known	74_37	silent	52.83	70.00	SNP	1.000	A	28	25
PLD4	122618	genome.wustl.edu	37	14	105394089	105394089	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:105394089C>T	ENST00000392593.4	+	3	338	c.170C>T	c.(169-171)cCt>cTt	p.P57L	PLD4_ENST00000540372.1_Missense_Mutation_p.P64L	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	57					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			GTGCCCCGTCCTCCCACCTGG	0.687													ENSG00000166428																																					0													18.0	23.0	21.0					14																	105394089		2126	4247	6373	SO:0001583	missense	0			-		CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.170C>T	14.37:g.105394089C>T	ENSP00000376372:p.Pro57Leu		Q6UWD2	Missense_Mutation	SNP	pfam_PLipase_D/transphosphatidylase,smart_PLipase_D/transphosphatidylase,pfscan_PLipase_D/transphosphatidylase	p.P57L	ENST00000392593.4	37	c.170	CCDS9995.2	14	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470648	0.26423	.	.	ENSG00000166428	ENST00000540372;ENST00000392593;ENST00000557573	T;T;T	0.26223	1.81;1.83;1.75	3.28	0.44	0.16572	.	1.201940	0.06377	U	0.714593	T	0.15305	0.0369	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.31251	-0.9950	10	0.28530	T	0.3	-0.0024	5.3366	0.15961	0.0:0.6065:0.0:0.3935	.	64;57	F5H2B5;Q96BZ4	.;PLD4_HUMAN	L	64;57;55	ENSP00000438677:P64L;ENSP00000376372:P57L;ENSP00000451278:P55L	ENSP00000376372:P57L	P	+	2	0	PLD4	104465134	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.262000	0.18460	0.076000	0.16826	0.511000	0.50034	CCT	-	PLD4	-	NULL		0.687	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLD4	HGNC	protein_coding	OTTHUMT00000291348.2	0	0	0	92	92	28	0.00	0.00	C	NM_138790		105394089	+1	46	4	59	7	tier1	no_errors	ENST00000392593	ensembl	human	known	74_37	missense	43.81	33.33	SNP	0.000	T	46	59
CASZ1	54897	genome.wustl.edu	37	1	10725140	10725140	+	Splice_Site	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:10725140C>A	ENST00000377022.3	-	5	822	c.505G>T	c.(505-507)Gga>Tga	p.G169*	CASZ1_ENST00000344008.5_Splice_Site_p.G169*|CASZ1_ENST00000478728.2_5'UTR	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	169					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		AGGCACCCACCTGAAGCCTGC	0.677													ENSG00000130940																																					0													27.0	25.0	26.0					1																	10725140		2203	4299	6502	SO:0001630	splice_region_variant	0			-	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.505+1G>T	1.37:g.10725140C>A			Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G169*	ENST00000377022.3	37	c.505	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.636306	0.96693	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	3.9	3.9	0.45041	.	0.063982	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.6697	9.7154	0.40272	0.0:0.8965:0.0:0.1035	.	.	.	.	X	169	.	.	G	-	1	0	CASZ1	10647727	1.000000	0.71417	0.999000	0.59377	0.473000	0.32948	2.457000	0.45005	2.191000	0.70037	0.511000	0.50034	GGA	-	CASZ1	-	NULL		0.677	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	0	0	0	29	29	37	0.00	0.00	C	NM_017766	Nonsense_Mutation	10725140	-1	4	0	44	6	tier1	no_errors	ENST00000377022	ensembl	human	known	74_37	nonsense	8.33	0.00	SNP	1.000	A	4	44
CDC42EP1	11135	genome.wustl.edu	37	22	37964613	37964613	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr22:37964613G>T	ENST00000249014.4	+	3	1382	c.962G>T	c.(961-963)tGg>tTg	p.W321L		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	321					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					GGCAGGCACTGGGGAGCAGGC	0.701													ENSG00000128283																																					0													11.0	13.0	12.0					22																	37964613		2189	4287	6476	SO:0001583	missense	0			-	M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.962G>T	22.37:g.37964613G>T	ENSP00000249014:p.Trp321Leu		A8K825|Q96GN1	Missense_Mutation	SNP	pfam_CRIB_dom,smart_CRIB_dom,pfscan_CRIB_dom	p.W321L	ENST00000249014.4	37	c.962	CCDS13949.1	22	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027279	0.75390	.	.	ENSG00000128283	ENST00000249014	T	0.52057	0.68	4.81	4.81	0.61882	.	1.594300	0.03911	N	0.281911	T	0.43166	0.1235	L	0.29908	0.895	0.20975	N	0.999815	B	0.15473	0.013	B	0.11329	0.006	T	0.31110	-0.9955	10	0.13470	T	0.59	-5.2856	17.2474	0.87032	0.0:0.0:1.0:0.0	.	321	Q00587	BORG5_HUMAN	L	321	ENSP00000249014:W321L	ENSP00000249014:W321L	W	+	2	0	CDC42EP1	36294559	0.997000	0.39634	0.819000	0.32651	0.239000	0.25481	3.552000	0.53705	2.375000	0.81037	0.561000	0.74099	TGG	-	CDC42EP1	-	NULL		0.701	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP1	HGNC	protein_coding	OTTHUMT00000318993.1	0	0	0	36	36	14	0.00	0.00	G	NM_152243		37964613	+1	3	0	20	6	tier1	no_errors	ENST00000249014	ensembl	human	known	74_37	missense	13.04	0.00	SNP	0.365	T	3	20
KRTAP5-5	439915	genome.wustl.edu	37	11	1651210	1651239	+	In_Frame_Del	DEL	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	-	rs190828070|rs553119014|rs71454096|rs117674201|rs369130959	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:1651210_1651239delGCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	ENST00000399676.2	+	1	178_207	c.140_169delGCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	c.(139-171)ggctgtggctccggctgtgcgggctgtggggga>gga	p.47_57GCGSGCAGCGG>G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.A53A(1)|p.G54V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ggctgtgggggctgtggctccggctgtgcgggctgtgggggatgtggctc	0.691													ENSG00000185940																																					2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|kidney(1)																																								SO:0001651	inframe_deletion	0				AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.140_169delGCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	11.37:g.1651210_1651239delGCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	ENSP00000382584:p.Gly47_Gly56del		A8MWN2	In_Frame_Del	DEL	NULL	p.GCAGCGGCGS51in_frame_del	ENST00000399676.2	37	c.140_169	CCDS41592.1	11																																																																																				KRTAP5-5	-	NULL		0.691	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	0	0	0	6	6	6	0.00	0.00	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG			1651239	+1	0	0	2	2	tier1	no_errors	ENST00000399676	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.818:0.967:0.993:0.997:0.997:0.999:1.000:0.998:0.998:0.991:0.983:0.976:1.000:1.000:0.999:0.995:0.061:0.083:0.113:0.325:0.996:0.999:1.000:1.000:0.999:0.994:0.996:0.995:0.546:0.579	-	0	2
PTGDS	5730	genome.wustl.edu	37	9	139873774	139873774	+	Intron	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr9:139873774C>A	ENST00000371625.3	+	3	405				PTGDS_ENST00000224167.2_Silent_p.P118P|RP11-229P13.19_ENST00000413913.2_RNA|PTGDS_ENST00000460340.1_3'UTR	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)						arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TCCACCGGCCCCCTGGGCCCA	0.711													ENSG00000107317																																					0													20.0	26.0	24.0					9																	139873774		2201	4295	6496	SO:0001627	intron_variant	0			-	AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.331+23C>A	9.37:g.139873774C>A			B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_PstgldnD_synth	p.P118	ENST00000371625.3	37	c.354	CCDS7019.1	9																																																																																			-	PTGDS	-	superfamily_Calycin-like		0.711	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDS	HGNC	protein_coding	OTTHUMT00000055188.1	0	0	0	73	73	12	0.00	0.00	C	NM_000954		139873774	+1	4	0	32	2	tier1	no_errors	ENST00000224167	ensembl	human	known	74_37	silent	11.11	0.00	SNP	0.000	A	4	32
CSPG4P5	114817	genome.wustl.edu	37	15	84957480	84957499	+	RNA	DEL	GGCCCCACATCCATTGAGAA	GGCCCCACATCCATTGAGAA	-	rs554759799|rs529134831|rs548880213	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	GGCCCCACATCCATTGAGAA	GGCCCCACATCCATTGAGAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr15:84957480_84957499delGGCCCCACATCCATTGAGAA	ENST00000558801.1	-	0	7230_7249									DNM1 pseudogene 51																		TGTGTGCACTGGCCCCACATCCATTGAGAAGGCCCCACAT	0.586													ENSG00000235370		762	0.152157	0.146	0.3256	5008	,	,		24353	0.1339		0.1481	False		,,,				2504	0.0603																0																																												0						15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84957480_84957499delGGCCCCACATCCATTGAGAA				R	DEL	-	NULL	ENST00000558801.1	37	NULL		15																																																																																				DNM1P51	-	-		0.586	DNM1P51-001	KNOWN	basic	processed_transcript	DNM1P51	HGNC	pseudogene	OTTHUMT00000471721.1	0	0	0	1	1	1	0.00	0.00	GGCCCCACATCCATTGAGAA			84957499	-1	1	1	1	1	tier1	no_errors	ENST00000558801	ensembl	human	known	74_37	rna	50.00	50.00	DEL	0.404:0.401:0.398:0.395:0.392:0.390:0.387:0.385:0.382:0.380:0.378:0.376:0.374:0.372:0.370:0.368:0.366:0.365:0.363:0.362	-	1	1
FAM27B	100133121	genome.wustl.edu	37	9	67793683	67793684	+	Intron	INS	-	-	CT			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr9:67793683_67793684insCT	ENST00000377484.3	-	1	215				RP11-12A20.7_ENST00000315762.5_RNA			Q5VT28	FAM27_HUMAN	family with sequence similarity 27, member B																		acacacacacacactcacacac	0.515													ENSG00000236233																																					0																																										SO:0001627	intron_variant	0						9q13	2014-05-06			ENSG00000170215	ENSG00000278763			23667	other	unknown							Standard	NR_027422		Approved	bA12A20.3, FAM27A2	uc004aet.4	Q5VT28	OTTHUMG00000188586	ENST00000377484.3:c.78+212->AG	9.37:g.67793683_67793684insCT				R	INS	-	NULL	ENST00000377484.3	37	NULL		9																																																																																				RP11-12A20.7	-	-		0.515	FAM27B-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000236233	Clone_based_vega_gene	protein_coding	OTTHUMT00000037106.1	0	0	0	10	10	0	0.00	0.00	-	NR_027422		67793684	+1	6	0	7	1	tier1	no_errors	ENST00000315762	ensembl	human	known	74_37	rna	46.15	0.00	INS	0.063:0.065	CT	6	7
PSG8	440533	genome.wustl.edu	37	19	43257095	43257096	+	IGR	INS	-	-	GGTTGAGATGGTTGAGA	rs377417293	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:43257095_43257096insGGTTGAGATGGTTGAGA	ENST00000306511.4	-	0	1441				PSG8_ENST00000401467.2_3'UTR|PSG8_ENST00000404209.4_3'UTR|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000406636.3_3'UTR	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8							extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GAGATGTTATGTAAAAGTTTGG	0.416													ENSG00000124467		372	0.0742812	0.093	0.1023	5008	,	,		21813	0.0198		0.0656	False		,,,				2504	0.0941																0																																										SO:0001628	intergenic_variant	0				M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118		19.37:g.43257095_43257096insGGTTGAGATGGTTGAGA			A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	R	INS	-	NULL	ENST00000306511.4	37	NULL	CCDS33037.1	19																																																																																				PSG8	-	-		0.416	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	HGNC	protein_coding	OTTHUMT00000464526.1	0	0	0	0	0	0	0.00	0.00	-			43257096	-1	0	0	0	0	tier1	no_errors	ENST00000600709	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.099:0.098	GGTTGAGATGGTTGAGA	0	0
SGK223	157285	genome.wustl.edu	37	8	8176387	8176388	+	In_Frame_Ins	INS	-	-	GGGGCG	rs143409664|rs369009941|rs71217287		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr8:8176387_8176388insGGGGCG	ENST00000520004.1	-	6	3761_3762	c.3497_3498insCGCCCC	c.(3496-3498)ccg>ccCGCCCCg	p.1166_1166P>PAP	SGK223_ENST00000330777.4_In_Frame_Ins_p.1166_1166P>PAP			Q86YV5	SG223_HUMAN		1170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										gggcgggagccggggcgggggc	0.782													ENSG00000182319																									GBM(34;731 755 10259 33573 33867)												0										1183,1443		406,371,536						-9.8	0.0		dbSNP_134	4	2724,3170		936,852,1159	no	coding	SGK223	NM_001080826.1		1342,1223,1695	A1A1,A1R,RR		46.2165,45.0495,45.8568				3907,4613				SO:0001652	inframe_insertion	0																															ENST00000520004.1:c.3492_3497dupCGCCCC	8.37:g.8176388_8176393dupGGGGCG	ENSP00000428054:p.AlaPro1170dup		Q8N3N5	In_Frame_Ins	INS	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.1170in_frame_insPA	ENST00000520004.1	37	c.3498_3497	CCDS43706.1	8																																																																																				SGK223	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.782	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1	0	0	0	0	0	0	0.00	0.00	-			8176388	-1	0	0	0	0	tier1	no_errors	ENST00000330777	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.000:0.034	GGGGCG	0	0
CHD2	1106	genome.wustl.edu	37	15	93558113	93558113	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr15:93558113C>A	ENST00000394196.4	+	37	5948	c.4880C>A	c.(4879-4881)cCc>cAc	p.P1627H	CHD2_ENST00000557381.1_Missense_Mutation_p.P1627H	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1627					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TACAATCACCCCAACAAGAGA	0.448													ENSG00000173575																																					0													148.0	144.0	146.0					15																	93558113		2197	4298	6495	SO:0001583	missense	0			-	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.4880C>A	15.37:g.93558113C>A	ENSP00000377747:p.Pro1627His		C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1627H	ENST00000394196.4	37	c.4880	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	C	11.14	1.552287	0.27739	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000557759	D;D;T	0.89746	-2.56;-2.53;0.89	5.8	5.8	0.92144	.	0.000000	0.33650	U	0.004689	D	0.88314	0.6403	N	0.14661	0.345	0.80722	D	1	D;D	0.61697	0.983;0.99	P;P	0.56474	0.635;0.799	D	0.89369	0.3673	10	0.52906	T	0.07	-14.3291	20.0544	0.97645	0.0:1.0:0.0:0.0	.	1627;1627	O14647;O14647-2	CHD2_HUMAN;.	H	1627;1627;152	ENSP00000377747:P1627H;ENSP00000451366:P1627H;ENSP00000451539:P152H	ENSP00000377747:P1627H	P	+	2	0	CHD2	91359117	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.299000	0.65716	2.746000	0.94184	0.591000	0.81541	CCC	-	CHD2	-	NULL		0.448	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	0	0	0	29	29	242	0.00	0.00	C	NM_001271		93558113	+1	4	2	46	153	tier1	no_errors	ENST00000557381	ensembl	human	putative	74_37	missense	8.00	1.29	SNP	1.000	A	4	46
