#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
MAGEA11	4110	genome.wustl.edu	37	X	148798425	148798425	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chrX:148798425G>A	ENST00000355220.5	+	5	1381	c.1279G>A	c.(1279-1281)Gag>Aag	p.E427K	MAGEA11_ENST00000333104.4_Missense_Mutation_p.E398K	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	427						cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGAGGAGGGAGAGGGAGTCTG	0.537													ENSG00000185247																																					0													92.0	69.0	77.0					X																	148798425		2203	4300	6503	SO:0001583	missense	0			-		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.1279G>A	X.37:g.148798425G>A	ENSP00000347358:p.Glu427Lys		Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E427K	ENST00000355220.5	37	c.1279	CCDS48180.1	X	.	.	.	.	.	.	.	.	.	.	N	12.43	1.935024	0.34189	.	.	ENSG00000185247	ENST00000333104;ENST00000355220	T;T	0.03301	3.98;4.02	0.976	0.976	0.19727	.	.	.	.	.	T	0.11793	0.0287	M	0.69823	2.125	0.09310	N	1	D;D	0.71674	0.995;0.998	D;D	0.66979	0.948;0.937	T	0.12218	-1.0556	8	.	.	.	.	4.9662	0.14091	0.0:0.0:1.0:0.0	.	398;427	G5E962;P43364	.;MAGAB_HUMAN	K	398;427	ENSP00000328177:E398K;ENSP00000347358:E427K	.	E	+	1	0	MAGEA11	148575980	0.006000	0.16342	0.015000	0.15790	0.011000	0.07611	2.052000	0.41316	0.761000	0.33130	0.429000	0.28392	GAG	-	MAGEA11	-	NULL		0.537	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEA11	HGNC	protein_coding	OTTHUMT00000058725.4	0	0	0	43	43	77	0.00	0.00	G	NM_005366		148798425	+1	26	30	30	51	tier1	no_errors	ENST00000355220	ensembl	human	known	74_37	missense	46.43	37.04	SNP	0.015	A	26	30
KIAA1919	91749	genome.wustl.edu	37	6	111587229	111587229	+	Missense_Mutation	SNP	A	A	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr6:111587229A>T	ENST00000368847.4	+	4	817	c.464A>T	c.(463-465)gAg>gTg	p.E155V		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	155					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		AACCACACAGAGTCTGACTTC	0.473													ENSG00000173214																																					0													100.0	92.0	95.0					6																	111587229		2203	4300	6503	SO:0001583	missense	0			-	BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.464A>T	6.37:g.111587229A>T	ENSP00000357840:p.Glu155Val		A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.E155V	ENST00000368847.4	37	c.464	CCDS5090.1	6	.	.	.	.	.	.	.	.	.	.	A	5.972	0.363349	0.11296	.	.	ENSG00000173214	ENST00000368847	T	0.46819	0.86	5.85	1.84	0.25277	Major facilitator superfamily domain, general substrate transporter (1);	0.690355	0.15255	N	0.272115	T	0.14527	0.0351	L	0.54323	1.7	0.22034	N	0.999404	P	0.38223	0.623	B	0.34242	0.178	T	0.07616	-1.0763	10	0.19590	T	0.45	-12.8425	1.4056	0.02279	0.4383:0.2808:0.1241:0.1568	.	155	Q5TF39	NAGT1_HUMAN	V	155	ENSP00000357840:E155V	ENSP00000357840:E155V	E	+	2	0	KIAA1919	111693922	0.000000	0.05858	0.120000	0.21714	0.009000	0.06853	-0.066000	0.11598	1.005000	0.39183	0.523000	0.50628	GAG	-	KIAA1919	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.473	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1919	HGNC	protein_coding	OTTHUMT00000041827.1	0	0	0	24	24	100	0.00	0.00	A	NM_153369		111587229	+1	7	48	1	50	tier1	no_errors	ENST00000368847	ensembl	human	known	74_37	missense	87.50	48.98	SNP	0.273	T	7	1
PVRL3	25945	genome.wustl.edu	37	3	110911220	110911220	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr3:110911220C>T	ENST00000493615.1	+	8	1496	c.1244C>T	c.(1243-1245)aCt>aTt	p.T415I		NM_001243288.1	NP_001230217.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	0					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						CCTTTGCAGACTCAGTTCAAA	0.403													ENSG00000177707																																					0																																										SO:0001583	missense	0			-	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000493615.1:c.1244C>T	3.37:g.110911220C>T	ENSP00000420579:p.Thr415Ile		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.T415I	ENST00000493615.1	37	c.1244	CCDS58843.1	3	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643201	0.47153	.	.	ENSG00000177707	ENST00000493615;ENST00000485506	T	0.15952	2.38	5.35	3.42	0.39159	.	.	.	.	.	T	0.15478	0.0373	.	.	.	0.23440	N	0.997672	B	0.32968	0.392	B	0.32624	0.149	T	0.16305	-1.0407	8	0.87932	D	0	.	11.7311	0.51737	0.0:0.6561:0.3439:0.0	.	415	E9PFR0	.	I	415;8	ENSP00000420579:T415I	ENSP00000419829:T8I	T	+	2	0	PVRL3	112393910	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	0.153000	0.16323	1.597000	0.50072	0.655000	0.94253	ACT	-	PVRL3	-	NULL		0.403	PVRL3-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	PVRL3	HGNC	protein_coding	OTTHUMT00000354046.1	0	0	0	45	45	91	0.00	0.00	C	NM_015480		110911220	+1	20	41	23	57	tier1	no_errors	ENST00000493615	ensembl	human	putative	74_37	missense	46.51	41.84	SNP	1.000	T	20	23
SPO11	23626	genome.wustl.edu	37	20	55917803	55917803	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr20:55917803T>A	ENST00000371263.3	+	12	1087	c.978T>A	c.(976-978)gaT>gaA	p.D326E	SPO11_ENST00000345868.4_Missense_Mutation_p.D288E|SPO11_ENST00000371260.4_Missense_Mutation_p.D284E	NM_012444.2	NP_036576.1	Q9Y5K1	SPO11_HUMAN	SPO11 meiotic protein covalently bound to DSB	326					DNA catabolic process, endonucleolytic (GO:0000737)|female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|ovarian follicle development (GO:0001541)|protein localization to chromosome (GO:0034502)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|hydrolase activity (GO:0016787)			autonomic_ganglia(1)|breast(3)|large_intestine(4)|lung(8)|skin(2)	18	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			TACCTAAAGATAGTTTGATTC	0.338								Editing and processing nucleases					ENSG00000054796																																					0													76.0	72.0	73.0					20																	55917803		2203	4299	6502	SO:0001583	missense	0			-	AF169385	CCDS13456.1, CCDS13457.1	20q13.31	2013-06-05	2013-06-05		ENSG00000054796	ENSG00000054796			11250	protein-coding gene	gene with protein product	"""cancer/testis antigen 35"", ""spermatogenesis associated 43"""	605114	"""SPO11, meiotic protein covalently bound to DSB (S. cerevisiae)-like"", ""SPO11 meiotic protein covalently bound to DSB-like (S. cerevisiae)"", ""SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)"""			10534401	Standard	NM_012444		Approved	CT35, SPATA43, TOPVIA	uc002xye.3	Q9Y5K1	OTTHUMG00000032817	ENST00000371263.3:c.978T>A	20.37:g.55917803T>A	ENSP00000360310:p.Asp326Glu		Q5TCI1|Q8N4V0|Q9NQM7|Q9NQM8	Missense_Mutation	SNP	pfam_Meiosis_Spo11,pfam_Spo11/TopoVI_A_N,superfamily_Spo11/TopoVI_A,prints_Meiotic_Spo11,prints_Spo11/TopoVI_A,prints_TopoVI_A	p.D326E	ENST00000371263.3	37	c.978	CCDS13456.1	20	.	.	.	.	.	.	.	.	.	.	T	10.16	1.273780	0.23221	.	.	ENSG00000054796	ENST00000371263;ENST00000345868;ENST00000371260	T;T;T	0.18016	2.24;2.27;2.27	5.15	1.0	0.19881	.	0.618485	0.18610	N	0.136192	T	0.10294	0.0252	L	0.31578	0.945	0.35562	D	0.804753	B;B	0.15719	0.014;0.005	B;B	0.16722	0.016;0.011	T	0.27123	-1.0083	10	0.20519	T	0.43	-1.0315	6.5409	0.22380	0.0:0.1094:0.1447:0.7459	.	288;326	Q9Y5K1-2;Q9Y5K1	.;SPO11_HUMAN	E	326;288;284	ENSP00000360310:D326E;ENSP00000316034:D288E;ENSP00000360307:D284E	ENSP00000316034:D288E	D	+	3	2	SPO11	55351210	0.989000	0.36119	0.315000	0.25238	0.990000	0.78478	0.140000	0.16056	-0.030000	0.13804	0.482000	0.46254	GAT	-	SPO11	-	superfamily_Spo11/TopoVI_A,prints_Meiotic_Spo11		0.338	SPO11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPO11	HGNC	protein_coding	OTTHUMT00000079836.2	0	0	0	13	13	129	0.00	0.00	T	NM_012444		55917803	+1	16	69	14	70	tier1	no_errors	ENST00000371263	ensembl	human	known	74_37	missense	53.33	49.64	SNP	0.991	A	16	14
PSME4	23198	genome.wustl.edu	37	2	54176323	54176323	+	Missense_Mutation	SNP	T	T	C			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr2:54176323T>C	ENST00000404125.1	-	2	395	c.340A>G	c.(340-342)Agc>Ggc	p.S114G	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	114					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGCATCATGCTGATTTCCAGT	0.348													ENSG00000068878																																					0													95.0	94.0	94.0					2																	54176323		2203	4300	6503	SO:0001583	missense	0			-	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.340A>G	2.37:g.54176323T>C	ENSP00000384211:p.Ser114Gly		Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	pfam_DUF3437,superfamily_ARM-type_fold	p.S114G	ENST00000404125.1	37	c.340	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447936	0.43429	.	.	ENSG00000068878	ENST00000404125	D	0.91686	-2.89	5.1	5.1	0.69264	.	0.000000	0.85682	U	0.000000	D	0.88890	0.6560	M	0.65498	2.005	0.80722	D	1	P	0.40875	0.731	B	0.32211	0.142	D	0.87693	0.2555	10	0.22109	T	0.4	.	15.1872	0.73012	0.0:0.0:0.0:1.0	.	114	Q14997	PSME4_HUMAN	G	114	ENSP00000384211:S114G	ENSP00000374643:S114G	S	-	1	0	PSME4	54029827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.030000	0.59900	0.533000	0.62120	AGC	-	PSME4	-	NULL		0.348	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1	0	0	0	26	26	120	0.00	0.00	T	XM_040158		54176323	-1	22	54	16	56	tier1	no_errors	ENST00000404125	ensembl	human	known	74_37	missense	57.89	49.09	SNP	1.000	C	22	16
OR52W1	120787	genome.wustl.edu	37	11	6221371	6221371	+	Silent	SNP	A	A	G			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr11:6221371A>G	ENST00000311352.2	+	1	996	c.918A>G	c.(916-918)agA>agG	p.R306R	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCAGATCAGAGACCGACTCC	0.547													ENSG00000175485																																					0													121.0	133.0	129.0					11																	6221371		2201	4296	6497	SO:0001819	synonymous_variant	0			-	AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.918A>G	11.37:g.6221371A>G			Q8NH78	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.R306	ENST00000311352.2	37	c.918	CCDS31407.1	11																																																																																			-	OR52W1	-	NULL		0.547	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52W1	HGNC	protein_coding	OTTHUMT00000383758.1	0	0	0	44	44	146	0.00	0.00	A	NM_001005178		6221371	+1	21	52	18	53	tier1	no_errors	ENST00000311352	ensembl	human	known	74_37	silent	53.85	49.52	SNP	0.072	G	21	18
IK	3550	genome.wustl.edu	37	5	140038905	140038905	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr5:140038905G>T	ENST00000417647.2	+	13	1321	c.1182G>T	c.(1180-1182)atG>atT	p.M394I		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	394					cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCAGCCCATGGACGTTGACA	0.493													ENSG00000113141																																					0													120.0	111.0	114.0					5																	140038905		1999	4179	6178	SO:0001583	missense	0			-	BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.1182G>T	5.37:g.140038905G>T	ENSP00000396301:p.Met394Ile		Q6IPD8	Missense_Mutation	SNP	pfam_RED_N,pfam_RED_C	p.M394I	ENST00000417647.2	37	c.1182	CCDS47280.1	5	.	.	.	.	.	.	.	.	.	.	G	8.731	0.916694	0.17907	.	.	ENSG00000113141	ENST00000417647	.	.	.	5.47	0.135	0.14775	.	0.516795	0.22752	N	0.056068	T	0.25419	0.0618	N	0.12182	0.205	0.39076	D	0.960819	B	0.02656	0.0	B	0.01281	0.0	T	0.03981	-1.0987	9	0.34782	T	0.22	.	2.1977	0.03915	0.1546:0.1184:0.2512:0.4758	.	394	Q13123	RED_HUMAN	I	394	.	ENSP00000396301:M394I	M	+	3	0	IK	140019089	0.958000	0.32768	0.998000	0.56505	0.945000	0.59286	0.022000	0.13511	0.323000	0.23307	-0.126000	0.14955	ATG	-	IK	-	NULL		0.493	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	IK	HGNC	protein_coding	OTTHUMT00000372897.1	0	0	0	34	34	119	0.00	0.00	G	NM_006083		140038905	+1	23	50	23	73	tier1	no_errors	ENST00000417647	ensembl	human	known	74_37	missense	50.00	40.65	SNP	0.990	T	23	23
DNAH17	8632	genome.wustl.edu	37	17	76503585	76503585	+	Silent	SNP	G	G	A	rs12943086	byFrequency	TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:76503585G>A	ENST00000585328.1	-	28	4654	c.4530C>T	c.(4528-4530)ctC>ctT	p.L1510L	DNAH17_ENST00000389840.5_Silent_p.L1509L	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1509	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGTCCCCCGGGAGCTGGGTGC	0.597													ENSG00000187775																																					0													45.0	50.0	48.0					17																	76503585		2076	4241	6317	SO:0001819	synonymous_variant	0			-	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.4530C>T	17.37:g.76503585G>A			O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.L1509	ENST00000585328.1	37	c.4527		17																																																																																			-	DH17	-	pfam_Dynein_heavy_dom-2		0.597	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DH17	HGNC	protein_coding	OTTHUMT00000318962.2	0	0	0	40	40	57	0.00	0.00	G	NM_173628		76503585	-1	16	42	15	41	tier1	no_errors	ENST00000389840	ensembl	human	known	74_37	silent	51.61	50.60	SNP	0.970	A	16	15
PRRT3	285368	genome.wustl.edu	37	3	9990873	9990873	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr3:9990873C>A	ENST00000412055.1	-	2	1056	c.927G>T	c.(925-927)caG>caT	p.Q309H	PRRT3-AS1_ENST00000431558.1_RNA|PRRT3_ENST00000411976.2_Missense_Mutation_p.Q309H	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	309	Pro-rich.					integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						GAAGGTCAGCCTGCTTGGGCG	0.642													ENSG00000163704																																					0													66.0	75.0	72.0					3																	9990873		1951	4143	6094	SO:0001583	missense	0			-	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.927G>T	3.37:g.9990873C>A	ENSP00000392511:p.Gln309His		Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	NULL	p.Q309H	ENST00000412055.1	37	c.927	CCDS43049.1	3	.	.	.	.	.	.	.	.	.	.	C	15.11	2.737495	0.49045	.	.	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.22743	2.28;1.94	3.41	2.5	0.30297	.	0.463064	0.16228	N	0.223737	T	0.21022	0.0506	L	0.32530	0.975	0.09310	N	1	P;P	0.47677	0.899;0.681	P;B	0.50490	0.642;0.371	T	0.05289	-1.0894	9	.	.	.	-0.9681	7.8927	0.29688	0.2461:0.7539:0.0:0.0	.	309;309	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	H	309	ENSP00000392511:Q309H;ENSP00000404512:Q309H	.	Q	-	3	2	PRRT3	9965873	0.003000	0.15002	0.006000	0.13384	0.084000	0.17831	0.864000	0.27926	0.982000	0.38575	0.655000	0.94253	CAG	-	PRRT3	-	NULL		0.642	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT3	HGNC	protein_coding	OTTHUMT00000339322.1	0	0	0	11	11	36	0.00	0.00	C	NM_207351		9990873	-1	14	4	12	26	tier1	no_errors	ENST00000295984	ensembl	human	known	74_37	missense	53.85	13.33	SNP	0.010	A	14	12
LINC01330	646168	genome.wustl.edu	37	3	167630632	167630632	+	lincRNA	SNP	A	A	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr3:167630632A>T	ENST00000481578.1	+	0	431																											TCCCAAGGAAAAGAGTTCTTG	0.363													ENSG00000244227																																					0																																												0			-																													3.37:g.167630632A>T				R	SNP	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			-	RP11-298O21.5	-	-		0.363	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	Clone_based_vega_gene	lincRNA	OTTHUMT00000351188.1	0	0	0	77	77	76	0.00	0.00	A			167630632	+1	56	38	68	42	tier1	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	45.16	47.50	SNP	0.937	T	56	68
CTTN	2017	genome.wustl.edu	37	11	70269070	70269070	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr11:70269070A>G	ENST00000301843.8	+	12	1132	c.926A>G	c.(925-927)aAg>aGg	p.K309R	CTTN_ENST00000538675.1_5'UTR|CTTN_ENST00000346329.3_Missense_Mutation_p.K272R|CTTN_ENST00000376561.3_Missense_Mutation_p.K272R	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	309					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		TTCGGCGGGAAGTATGGGGTG	0.567													ENSG00000085733																																					0													179.0	151.0	160.0					11																	70269070		2200	4294	6494	SO:0001583	missense	0			-	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.926A>G	11.37:g.70269070A>G	ENSP00000301843:p.Lys309Arg		Q8N707|Q96H99	Missense_Mutation	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.K309R	ENST00000301843.8	37	c.926	CCDS41680.1	11	.	.	.	.	.	.	.	.	.	.	A	16.66	3.185225	0.57909	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561	T;T;T	0.36520	1.33;1.38;1.25	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	M	0.63843	1.955	0.80722	D	1	P;B;B	0.34639	0.461;0.027;0.309	B;B;B	0.39904	0.198;0.075;0.313	T	0.24977	-1.0145	10	0.29301	T	0.29	-29.2198	15.0683	0.72014	1.0:0.0:0.0:0.0	.	272;309;272	Q96H99;Q14247;Q8N707	.;SRC8_HUMAN;.	R	272;309;272	ENSP00000317189:K272R;ENSP00000301843:K309R;ENSP00000365745:K272R	ENSP00000301843:K309R	K	+	2	0	CTTN	69946718	1.000000	0.71417	0.083000	0.20561	0.847000	0.48162	6.638000	0.74309	1.966000	0.57179	0.533000	0.62120	AAG	-	CTTN	-	pfam_Hs1_Cortactin,pfscan_Hs1_Cortactin		0.567	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	HGNC	protein_coding	OTTHUMT00000259233.2	0	0	0	99	99	110	0.00	0.00	A	NM_138565		70269070	+1	38	30	40	48	tier1	no_errors	ENST00000301843	ensembl	human	known	74_37	missense	48.72	38.46	SNP	0.997	G	38	40
AP3D1	8943	genome.wustl.edu	37	19	2117232	2117232	+	Silent	SNP	T	T	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr19:2117232T>A	ENST00000345016.5	-	16	2079	c.1848A>T	c.(1846-1848)ccA>ccT	p.P616P	AP3D1_ENST00000356926.4_Silent_p.P525P|AP3D1_ENST00000350812.6_Silent_p.P447P|AP3D1_ENST00000355272.6_Silent_p.P616P	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	616					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCGGGGACTGGAACCTTCT	0.637													ENSG00000065000																																					0													40.0	46.0	44.0					19																	2117232		2007	4164	6171	SO:0001819	synonymous_variant	0			-	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.1848A>T	19.37:g.2117232T>A			O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.P616	ENST00000345016.5	37	c.1848	CCDS42459.1	19																																																																																			-	AP3D1	-	superfamily_ARM-type_fold,pirsf_AP3_complex_dsu		0.637	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	HGNC	protein_coding	OTTHUMT00000450912.1	0	0	0	36	36	92	0.00	0.00	T			2117232	-1	13	30	5	60	tier1	no_errors	ENST00000355272	ensembl	human	known	74_37	silent	72.22	33.33	SNP	0.403	A	13	5
DCHS2	54798	genome.wustl.edu	37	4	155253963	155253963	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr4:155253963A>G	ENST00000357232.4	-	9	1899	c.1900T>C	c.(1900-1902)Ttt>Ctt	p.F634L	DCHS2_ENST00000339452.1_Missense_Mutation_p.F1133L|DCHS2_ENST00000507542.1_5'Flank	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	634	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CGGATTCCAAACATAGCAGAG	0.517													ENSG00000197410																																					0													50.0	52.0	51.0					4																	155253963		2203	4300	6503	SO:0001583	missense	0			-	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1900T>C	4.37:g.155253963A>G	ENSP00000349768:p.Phe634Leu		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_D-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F634L	ENST00000357232.4	37	c.1900	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	A	34	5.355189	0.95854	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.70749	-0.42;-0.51	5.06	5.06	0.68205	Cadherin (3);Cadherin-like (1);	0.000000	0.64402	D	0.000006	D	0.85762	0.5772	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.994	D	0.88462	0.3056	10	0.72032	D	0.01	.	15.1162	0.72404	1.0:0.0:0.0:0.0	.	1133;634	E9PC11;Q6V1P9	.;PCD23_HUMAN	L	634;1133;1133	ENSP00000349768:F634L;ENSP00000345062:F1133L	ENSP00000345062:F1133L	F	-	1	0	DCHS2	155473413	1.000000	0.71417	0.412000	0.26496	0.199000	0.23934	8.260000	0.89857	2.019000	0.59389	0.533000	0.62120	TTT	-	DCHS2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.517	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	0	0	0	33	33	52	0.00	0.00	A	NM_001142552		155253963	-1	15	30	19	26	tier1	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	44.12	53.57	SNP	0.998	G	15	19
CDHR3	222256	genome.wustl.edu	37	7	105671282	105671282	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:105671282T>A	ENST00000317716.9	+	18	2429	c.2349T>A	c.(2347-2349)gaT>gaA	p.D783E	CDHR3_ENST00000542731.1_Missense_Mutation_p.D783E|CDHR3_ENST00000478080.1_Missense_Mutation_p.D695E|CDHR3_ENST00000343407.5_3'UTR|CDHR3_ENST00000470188.1_3'UTR	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	783					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						AAGCCATAGATCCAGGTAATT	0.408													ENSG00000128536																																					0													122.0	116.0	118.0					7																	105671282		1919	4133	6052	SO:0001583	missense	0			-	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2349T>A	7.37:g.105671282T>A	ENSP00000325954:p.Asp783Glu		Q8TCI7	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D783E	ENST00000317716.9	37	c.2349	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	T	15.69	2.909126	0.52439	.	.	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080	T;T;T	0.61627	0.09;0.12;0.09	5.48	3.45	0.39498	.	0.000000	0.64402	D	0.000001	T	0.69984	0.3172	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.66606	-0.5881	10	0.42905	T	0.14	-16.5655	7.5169	0.27606	0.0:0.7101:0.0:0.2899	.	770;783	B3KYA0;Q6ZTQ4	.;CDHR3_HUMAN	E	783;783;695	ENSP00000439766:D783E;ENSP00000325954:D783E;ENSP00000417771:D695E	ENSP00000325954:D783E	D	+	3	2	CDHR3	105458518	0.997000	0.39634	0.983000	0.44433	0.368000	0.29767	0.276000	0.18716	0.511000	0.28236	0.459000	0.35465	GAT	-	CDHR3	-	NULL		0.408	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	0	0	0	60	60	89	0.00	0.00	T	NM_152750		105671282	+1	32	25	47	50	tier1	no_errors	ENST00000317716	ensembl	human	known	74_37	missense	40.51	33.33	SNP	1.000	A	32	47
PLCG1	5335	genome.wustl.edu	37	20	39792474	39792474	+	Splice_Site	SNP	G	G	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr20:39792474G>T	ENST00000373271.1	+	10	1415		c.e10+1		PLCG1_ENST00000373272.2_Splice_Site|PLCG1_ENST00000244007.3_Splice_Site	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1						activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CGCACAACACGTGAGTGTGGC	0.582													ENSG00000124181																																					0													117.0	109.0	111.0					20																	39792474		2203	4300	6503	SO:0001630	splice_region_variant	0			-	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.1010+1G>T	20.37:g.39792474G>T			B7ZLY7|B9EGH4|E1P5W4|Q2V575	Splice_Site	SNP	-	e10+1	ENST00000373271.1	37	c.1010+1	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358305	0.82243	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8016	0.96509	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLCG1	39225888	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.869000	0.99810	2.677000	0.91161	0.655000	0.94253	.	-	PLCG1	-	-		0.582	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3	0	0	0	53	53	86	0.00	0.00	G	NM_182811	Intron	39792474	+1	36	40	46	73	tier1	no_errors	ENST00000244007	ensembl	human	known	74_37	splice_site	43.90	35.40	SNP	1.000	T	36	46
SEPT14	346288	genome.wustl.edu	37	7	55910726	55910726	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:55910726G>T	ENST00000388975.3	-	5	583	c.467C>A	c.(466-468)tCt>tAt	p.S156Y	SEPT14_ENST00000477628.1_5'Flank	NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	156	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GTGGACGCGAGAATCATGGTA	0.393													ENSG00000154997																																					0													101.0	92.0	95.0					7																	55910726		1901	4129	6030	SO:0001583	missense	0			-	AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.467C>A	7.37:g.55910726G>T	ENSP00000373627:p.Ser156Tyr		A6NCC2|B4DXD6	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.S156Y	ENST00000388975.3	37	c.467	CCDS5519.2	7	.	.	.	.	.	.	.	.	.	.	g	14.22	2.469775	0.43839	.	.	ENSG00000154997	ENST00000388975	T	0.53640	0.61	4.33	4.33	0.51752	.	0.258545	0.25397	N	0.030965	T	0.68751	0.3035	M	0.79614	2.46	0.44711	D	0.997703	D	0.71674	0.998	D	0.76071	0.987	T	0.73956	-0.3819	10	0.87932	D	0	.	15.1266	0.72486	0.0:0.0:1.0:0.0	.	156	Q6ZU15	SEP14_HUMAN	Y	156	ENSP00000373627:S156Y	ENSP00000373627:S156Y	S	-	2	0	SEPT14	55878220	0.998000	0.40836	0.015000	0.15790	0.024000	0.10985	6.206000	0.72154	2.318000	0.78349	0.655000	0.94253	TCT	-	SEPT14	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin		0.393	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT14	HGNC	protein_coding	OTTHUMT00000251489.2	0	0	0	37	37	120	0.00	0.00	G	NM_207366		55910726	-1	10	48	10	69	tier1	no_errors	ENST00000388975	ensembl	human	known	74_37	missense	50.00	41.03	SNP	0.994	T	10	10
HUWE1	10075	genome.wustl.edu	37	X	53620560	53620560	+	Splice_Site	SNP	T	T	C			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chrX:53620560T>C	ENST00000342160.3	-	31	3962	c.3505A>G	c.(3505-3507)Act>Gct	p.T1169A	HUWE1_ENST00000218328.8_Splice_Site_p.T1169A|HUWE1_ENST00000262854.6_Splice_Site_p.T1169A			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1169					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAGTTGAAAGTTCTAAATTCA	0.433													ENSG00000086758																																					0													45.0	39.0	41.0					X																	53620560		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.3504-1A>G	X.37:g.53620560T>C			O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.T1169A	ENST00000342160.3	37	c.3505	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.86|12.86	2.064867|2.064867	0.36470|0.36470	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854;ENST00000218328	.|T;T;T	.|0.48201	.|1.07;1.07;0.82	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.34164|0.34164	0.0888|0.0888	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999997|0.999997	.|B	.|0.33212	.|0.402	.|B	.|0.30105	.|0.111	T|T	0.13522|0.13522	-1.0506|-1.0506	5|10	.|0.17832	.|T	.|0.49	.|.	13.8006|13.8006	0.63196|0.63196	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1169	.|Q7Z6Z7	.|HUWE1_HUMAN	S|A	202|1169	.|ENSP00000340648:T1169A;ENSP00000262854:T1169A;ENSP00000218328:T1169A	.|ENSP00000218328:T1169A	N|T	-|-	2|1	0|0	HUWE1|HUWE1	53637285|53637285	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.760000|7.760000	0.85248|0.85248	1.904000|1.904000	0.55121|0.55121	0.356000|0.356000	0.21956|0.21956	AAC|ACT	-	HUWE1	-	NULL		0.433	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	0	0	0	27	27	82	0.00	0.00	T	XM_497119	Missense_Mutation	53620560	-1	11	31	16	53	tier1	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	40.74	36.90	SNP	1.000	C	11	16
HMGCS1	3157	genome.wustl.edu	37	5	43293070	43293070	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr5:43293070C>A	ENST00000325110.6	-	9	1395	c.1189G>T	c.(1189-1191)Gct>Tct	p.A397S	HMGCS1_ENST00000433297.2_Missense_Mutation_p.A397S|CTD-2636A23.2_ENST00000569313.1_RNA	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	397					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						TTATCAAGAGCAGACCCTAAA	0.343													ENSG00000112972																																					0													54.0	57.0	56.0					5																	43293070		2203	4300	6503	SO:0001583	missense	0			-		CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.1189G>T	5.37:g.43293070C>A	ENSP00000322706:p.Ala397Ser		B2RDL8	Missense_Mutation	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.A397S	ENST00000325110.6	37	c.1189	CCDS34154.1	5	.	.	.	.	.	.	.	.	.	.	C	4.104	0.017447	0.07959	.	.	ENSG00000112972	ENST00000325110;ENST00000433297;ENST00000545275	T;T	0.76578	-1.03;-1.03	5.73	2.78	0.32641	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.325659	0.35936	N	0.002885	T	0.48943	0.1528	N	0.03209	-0.39	0.50467	D	0.999873	B	0.02656	0.0	B	0.04013	0.001	T	0.35301	-0.9794	10	0.07482	T	0.82	-11.2346	8.7069	0.34360	0.459:0.4708:0.0:0.0702	.	397	Q01581	HMCS1_HUMAN	S	397;397;386	ENSP00000322706:A397S;ENSP00000399402:A397S	ENSP00000322706:A397S	A	-	1	0	HMGCS1	43328827	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	1.588000	0.36633	0.738000	0.32606	-0.136000	0.14681	GCT	-	HMGCS1	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk		0.343	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS1	HGNC	protein_coding	OTTHUMT00000368022.1	0	0	0	16	16	93	0.00	0.00	C			43293070	-1	12	41	5	57	tier1	no_errors	ENST00000325110	ensembl	human	known	74_37	missense	70.59	41.84	SNP	1.000	A	12	5
WDR78	79819	genome.wustl.edu	37	1	67301325	67301325	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:67301325G>A	ENST00000371026.3	-	11	1772	c.1717C>T	c.(1717-1719)Cca>Tca	p.P573S	WDR78_ENST00000431318.1_Missense_Mutation_p.P319S	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	573					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						TCCAGAACTGGAACATTACTG	0.348													ENSG00000152763																																					0													99.0	95.0	96.0					1																	67301325		2203	4300	6503	SO:0001583	missense	0			-	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.1717C>T	1.37:g.67301325G>A	ENSP00000360065:p.Pro573Ser		A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P573S	ENST00000371026.3	37	c.1717	CCDS635.1	1	.	.	.	.	.	.	.	.	.	.	G	4.022	0.001479	0.07819	.	.	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352	D;D;D	0.91068	-2.78;-2.78;-2.78	5.35	3.43	0.39272	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.213333	0.48286	D	0.000182	T	0.77363	0.4119	L	0.52759	1.655	0.25790	N	0.98462	B;B	0.22080	0.039;0.064	B;B	0.29942	0.109;0.051	T	0.68769	-0.5321	10	0.45353	T	0.12	-12.9788	3.9675	0.09437	0.1338:0.2532:0.4961:0.1169	.	319;573	Q5VTH9-3;Q5VTH9	.;WDR78_HUMAN	S	573;319;339	ENSP00000360065:P573S;ENSP00000393182:P319S;ENSP00000433682:P339S	ENSP00000360065:P573S	P	-	1	0	WDR78	67073913	0.987000	0.35691	0.870000	0.34147	0.134000	0.20937	1.979000	0.40608	1.230000	0.43646	0.644000	0.83932	CCA	-	WDR78	-	superfamily_WD40_repeat_dom		0.348	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	HGNC	protein_coding	OTTHUMT00000025404.1	0	0	0	32	32	89	0.00	0.00	G	NM_024763		67301325	-1	6	51	12	53	tier1	no_errors	ENST00000371026	ensembl	human	known	74_37	missense	33.33	49.04	SNP	0.425	A	6	12
SLC15A5	729025	genome.wustl.edu	37	12	16392642	16392650	+	In_Frame_Del	DEL	CTCTCTTAG	CTCTCTTAG	-	rs375565160	byFrequency	TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	CTCTCTTAG	CTCTCTTAG	CTCTCTTAG	-	CTCTCTTAG	CTCTCTTAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr12:16392642_16392650delCTCTCTTAG	ENST00000344941.3	-	5	1126_1134	c.1127_1135delCTAAGAGAG	c.(1126-1137)tctaagagagtt>ttt	p.376_379SKRV>F		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	376					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						AATGATCCAACTCTCTTAGAGGGAAACAG	0.397													ENSG00000188991																																					0																																										SO:0001651	inframe_deletion	0						12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.1127_1135delCTAAGAGAG	12.37:g.16392642_16392650delCTCTCTTAG	ENSP00000340402:p.Ser376_Val379delinsPhe			In_Frame_Del	DEL	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt	p.SKRV376in_frame_delF	ENST00000344941.3	37	c.1135_1127		12																																																																																				SLC15A5	-	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt		0.397	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	0	0	0	90	90	90	0.00	0.00	CTCTCTTAG	XM_001129090		16392650	-1	14	14	65	65	tier1	no_errors	ENST00000344941	ensembl	human	novel	74_37	in_frame_del	17.72	17.72	DEL	0.139:0.131:0.134:0.147:0.147:0.137:0.102:0.054:0.068	-	14	65
AKNAD1	254268	genome.wustl.edu	37	1	109394814	109394816	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	TTC	TTC	TTC	-	TTC	TTC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:109394814_109394816delTTC	ENST00000370001.3	-	2	739_741	c.471_473delGAA	c.(469-474)aagaat>aat	p.K157del	AKNAD1_ENST00000369994.1_In_Frame_Del_p.K157del|AKNAD1_ENST00000369995.3_In_Frame_Del_p.K157del|AKNAD1_ENST00000357393.4_Intron	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	157						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TGGCCAAGAATTCTTATTATAAC	0.419													ENSG00000162641																																					0																																										SO:0001651	inframe_deletion	0				AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.471_473delGAA	1.37:g.109394814_109394816delTTC	ENSP00000359018:p.Lys157del		B9EK62|Q5T1N0|Q8N990|Q8NCN9	In_Frame_Del	DEL	pfam_TF_AT-hook	p.K157in_frame_del	ENST00000370001.3	37	c.473_471	CCDS791.2	1																																																																																				AKD1	-	NULL		0.419	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding	OTTHUMT00000030923.2	0	0	0	8	8	101	0.00	0.00	TTC	NM_152763		109394816	-1	4	37	11	50	tier1	no_errors	ENST00000370001	ensembl	human	known	74_37	in_frame_del	26.67	42.53	DEL	0.000:0.009:0.013	-	4	11
ALOX15B	247	genome.wustl.edu	37	17	7945777	7945777	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:7945777G>T	ENST00000380183.4	+	4	679	c.540G>T	c.(538-540)aaG>aaT	p.K180N	ALOX15B_ENST00000572022.1_Missense_Mutation_p.K180N|ALOX15B_ENST00000380173.2_Missense_Mutation_p.K180N|ALOX15B_ENST00000573359.1_Missense_Mutation_p.K180N	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	180	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						CCACAGCCAAGAATGCCAACT	0.552													ENSG00000179593																																					0													123.0	106.0	111.0					17																	7945777		2203	4300	6503	SO:0001583	missense	0			-	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.540G>T	17.37:g.7945777G>T	ENSP00000369530:p.Lys180Asn		D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.K180N	ENST00000380183.4	37	c.540	CCDS11128.1	17	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032244	0.75504	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	D;D	0.92397	-3.03;-3.03	4.39	3.4	0.38934	Lipoxygenase, C-terminal (2);	0.235941	0.43416	D	0.000563	D	0.96337	0.8805	H	0.95224	3.64	0.34432	D	0.698676	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.988;0.995;0.995;0.988	D	0.96758	0.9559	10	0.87932	D	0	-34.4467	6.1622	0.20370	0.2034:0.0:0.7965:0.0	.	180;180;180;180	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	N	180	ENSP00000369520:K180N;ENSP00000369530:K180N	ENSP00000344337:K180N	K	+	3	2	ALOX15B	7886502	1.000000	0.71417	0.389000	0.26208	0.408000	0.30992	3.011000	0.49567	2.135000	0.66039	0.561000	0.74099	AAG	-	ALOX15B	-	superfamily_LipOase_C		0.552	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15B	HGNC	protein_coding	OTTHUMT00000226985.2	0	0	0	17	17	89	0.00	0.00	G			7945777	+1	9	54	1	9	tier1	no_errors	ENST00000380183	ensembl	human	known	74_37	missense	90.00	85.71	SNP	0.878	T	9	1
FAM83B	222584	genome.wustl.edu	37	6	54805246	54805246	+	Missense_Mutation	SNP	C	C	T	rs373419492		TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr6:54805246C>T	ENST00000306858.7	+	5	1593	c.1477C>T	c.(1477-1479)Cgt>Tgt	p.R493C	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	493										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GTCATTCCTACGTAACTGGAG	0.408													ENSG00000168143																																					0								C	CYS/ARG	0,4406		0,0,2203	93.0	93.0	93.0		1477	5.6	1.0	6		93	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAM83B	NM_001010872.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	493/1012	54805246	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1477C>T	6.37:g.54805246C>T	ENSP00000304078:p.Arg493Cys		Q2M1P3|Q96DQ2	Missense_Mutation	SNP	pfam_DUF1669	p.R493C	ENST00000306858.7	37	c.1477	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264202	0.80358	0.0	1.16E-4	ENSG00000168143	ENST00000306858	T	0.35421	1.31	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.43897	0.1268	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.44081	-0.9351	10	0.87932	D	0	-18.1053	19.8898	0.96926	0.0:1.0:0.0:0.0	.	493	Q5T0W9	FA83B_HUMAN	C	493	ENSP00000304078:R493C	ENSP00000304078:R493C	R	+	1	0	FAM83B	54913205	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	4.365000	0.59486	2.775000	0.95449	0.655000	0.94253	CGT	-	FAM83B	-	NULL		0.408	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	HGNC	protein_coding	OTTHUMT00000040994.1	0	0	0	28	28	172	0.00	0.00	C	XM_294139		54805246	+1	21	78	3	9	tier1	no_errors	ENST00000306858	ensembl	human	known	74_37	missense	87.50	89.66	SNP	1.000	T	21	3
KRT32	3882	genome.wustl.edu	37	17	39619137	39619137	+	Silent	SNP	G	G	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:39619137G>T	ENST00000225899.3	-	6	1265	c.1162C>A	c.(1162-1164)Cgg>Agg	p.R388R		NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	388	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				CCCTCCAGCCGGGCCCGGACG	0.637													ENSG00000108759																																					0													76.0	76.0	76.0					17																	39619137		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.1162C>A	17.37:g.39619137G>T				Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.R388	ENST00000225899.3	37	c.1162	CCDS11393.1	17																																																																																			-	KRT32	-	pfam_IF		0.637	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT32	HGNC	protein_coding	OTTHUMT00000257293.1	0	0	0	39	39	8	0.00	0.00	G	NM_002278		39619137	-1	26	7	21	7	tier1	no_errors	ENST00000225899	ensembl	human	known	74_37	silent	55.32	50.00	SNP	0.999	T	26	21
SMCHD1	23347	genome.wustl.edu	37	18	2656092	2656092	+	Silent	SNP	C	C	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr18:2656092C>T	ENST00000320876.6	+	1	356	c.18C>T	c.(16-18)ggC>ggT	p.G6G	CBX3P2_ENST00000579647.1_RNA|SMCHD1_ENST00000261598.8_Silent_p.G6G	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	6					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						CGGCGGACGGCGGCGGGCCTG	0.692													ENSG00000101596																																					0													5.0	9.0	8.0					18																	2656092		1717	3892	5609	SO:0001819	synonymous_variant	0			-	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.18C>T	18.37:g.2656092C>T			O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.G6	ENST00000320876.6	37	c.18	CCDS45822.1	18																																																																																			-	SMCHD1	-	NULL		0.692	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	0	0	0	34	34	10	0.00	0.00	C			2656092	+1	18	6	17	9	tier1	no_errors	ENST00000320876	ensembl	human	known	74_37	silent	47.37	40.00	SNP	0.917	T	18	17
TP53	7157	genome.wustl.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:7577568C>T	ENST00000269305.4	-	7	902	c.713G>A	c.(712-714)tGt>tAt	p.C238Y	TP53_ENST00000420246.2_Missense_Mutation_p.C238Y|TP53_ENST00000413465.2_Missense_Mutation_p.C238Y|TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y|TP53_ENST00000445888.2_Missense_Mutation_p.C238Y|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	GRCh37	CM034930	TP53	M							132.0	103.0	113.0					17																	7577568		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>A	17.37:g.7577568C>T	ENSP00000269305:p.Cys238Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C238Y	ENST00000269305.4	37	c.713	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327056	0.81690	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238Y;ENSP00000352610:C238Y;ENSP00000269305:C238Y;ENSP00000398846:C238Y;ENSP00000391127:C238Y;ENSP00000391478:C238Y;ENSP00000425104:C106Y;ENSP00000423862:C145Y	ENSP00000269305:C238Y	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	53	53	66	0.00	0.00	C	NM_000546		7577568	-1	16	44	0	5	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	100.00	89.80	SNP	1.000	T	16	0
ANP32BP1	646791	genome.wustl.edu	37	15	75614887	75614887	+	RNA	SNP	G	G	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr15:75614887G>A	ENST00000564205.1	-	0	147									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		TTAACTTTCCGCAGCGGGGGC	0.642													ENSG00000259790																																					0																																												0			-			15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614887G>A				R	SNP	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			-	ANP32BP1	-	-		0.642	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	HGNC	pseudogene	OTTHUMT00000419801.1	0	0	0	42	42	5	0.00	0.00	G			75614887	-1	18	0	29	7	tier1	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	38.30	0.00	SNP	0.017	A	18	29
SRC	6714	genome.wustl.edu	37	20	36032316	36032316	+	3'UTR	SNP	C	C	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr20:36032316C>T	ENST00000373578.2	+	0	2494				SRC_ENST00000373567.2_3'UTR|SRC_ENST00000373558.2_3'UTR|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000360723.4_3'UTR|SRC_ENST00000445403.1_3'UTR|SRC_ENST00000358208.4_3'UTR	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	CCGCTGCTTCCAGGCTGGGCA	0.657													ENSG00000197122																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.*534C>T	20.37:g.36032316C>T			E1P5V4|Q76P87|Q86VB9|Q9H5A8	R	SNP	-	NULL	ENST00000373578.2	37	NULL	CCDS13294.1	20																																																																																			-	SRC	-	-		0.657	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SRC	HGNC	protein_coding	OTTHUMT00000268142.1	0	0	0	31	31	17	0.00	0.00	C	NM_005417		36032316	+1	17	0	36	9	tier1	no_errors	ENST00000477066	ensembl	human	known	74_37	rna	32.08	0.00	SNP	0.007	T	17	36
CYP2A6	1548	genome.wustl.edu	37	19	41354534	41354534	+	Missense_Mutation	SNP	G	G	T	rs60563539		TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr19:41354534G>T	ENST00000301141.5	-	3	498	c.478C>A	c.(478-480)Ctc>Atc	p.L160I	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	160			L -> H (in allele CYP2A6*2; unable to catalyze 7-hydroxylation of coumarin; causes switching from coumarin 7- hydroxylation to 3-hydroxylation; dbSNP:rs1801272). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2322567, ECO:0000269|PubMed:2748347, ECO:0000269|Ref.6}.		coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GTGCCCCGGAGGGCGTCGATG	0.706													ENSG00000255974																																					0													35.0	39.0	37.0					19																	41354534		2203	4299	6502	SO:0001583	missense	0			-	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.478C>A	19.37:g.41354534G>T	ENSP00000301141:p.Leu160Ile		A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.L160I	ENST00000301141.5	37	c.478	CCDS12568.1	19	.	.	.	.	.	.	.	.	.	.	-	7.661	0.684983	0.14973	.	.	ENSG00000255974	ENST00000301141	T	0.72282	-0.64	2.95	-5.91	0.02269	.	0.336308	0.29676	U	0.011482	T	0.46814	0.1412	L	0.28649	0.875	0.09310	N	1	B	0.02656	0.0	B	0.25506	0.061	T	0.25187	-1.0139	10	0.49607	T	0.09	.	0.9801	0.01434	0.4696:0.1142:0.2033:0.2128	rs60563539	160	P11509	CP2A6_HUMAN	I	160	ENSP00000301141:L160I	ENSP00000301141:L160I	L	-	1	0	CYP2A6	46046374	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.497000	0.00969	-2.055000	0.00899	-1.602000	0.00811	CTC	rs60563539	CYP2A6	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.706	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A6	HGNC	protein_coding	OTTHUMT00000463259.1	0	0	0	66	66	0	0.00	0.00	G	NM_000762		41354534	-1	7	0	52	0	tier1	no_errors	ENST00000301141	ensembl	human	known	74_37	missense	11.86	0.00	SNP	0.000	T	7	52
DNM1P46	196968	genome.wustl.edu	37	15	100340305	100340305	+	RNA	SNP	T	T	A			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr15:100340305T>A	ENST00000341853.1	-	0	621					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										ACGAGTGTCTTCTGGTTCCCA	0.612													ENSG00000182397																																					0													19.0	22.0	21.0					15																	100340305		1301	3222	4523			0			-	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340305T>A			Q3ZCN3	R	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			-	DNM1P46	-	-		0.612	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	0	0	0	46	46	0	0.00	0.00	T	NR_003260		100340305	-1	4	0	37	0	tier1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	9.76	0.00	SNP	0.986	A	4	37
AL162430.1	0	genome.wustl.edu	37	1	51656628	51656629	+	RNA	INS	-	-	A	rs191510247|rs200336691	byFrequency	TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:51656628_51656629insA	ENST00000408565.1	+	0	74_75				AL162430.2_ENST00000459498.1_RNA														p.0?(2)									aacctggtctcaaaaaaaacaa	0.465													ENSG00000221492	|||unknown(LONG_INSERTION)	19	0.00379393	0.0098	0.0014	5008	,	,		14847	0.003		0.002	False		,,,				2504	0.0																2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)																																										0																																1.37:g.51656636_51656636dupA				R	INS	-	NULL	ENST00000408565.1	37	NULL		1																																																																																				AL162430.1	-	-		0.465	AL162430.1-201	NOVEL	basic	miRNA	ENSG00000221492	Clone_based_ensembl_gene	miRNA		0	0	0	30	30	0	0.00	0.00	-			51656629	+1	14	0	16	0	tier1	no_errors	ENST00000408565	ensembl	human	novel	74_37	rna	46.67	0.00	INS	0.273:0.275	A	14	16
KCP	375616	genome.wustl.edu	37	7	128547390	128547390	+	RNA	SNP	G	G	A	rs560712849	byFrequency	TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:128547390G>A	ENST00000476647.2	-	0	379				AC025594.1_ENST00000408474.1_RNA			Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						CTGTGCAGGCGTCAGGCTCCC	0.701													ENSG00000135253	G|||	5	0.000998403	0.0023	0.0	5008	,	,		16773	0.0		0.001	False		,,,				2504	0.001																0													23.0	28.0	27.0					7																	128547390		692	1591	2283			0			-	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128547390G>A			Q8NBE0	R	SNP	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			-	KCP	-	-		0.701	KCP-006	KNOWN	basic	processed_transcript	KCP	HGNC	processed_transcript	OTTHUMT00000403051.1	0	0	0	16	16	4	0.00	0.00	G	NM_199349		128547390	-1	9	1	11	0	tier1	no_errors	ENST00000297801	ensembl	human	known	74_37	rna	45.00	100.00	SNP	0.180	A	9	11
DLGAP1	9229	genome.wustl.edu	37	18	3729210	3729210	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr18:3729210C>T	ENST00000315677.3	-	7	2111	c.1516G>A	c.(1516-1518)Gac>Aac	p.D506N	DLGAP1_ENST00000400145.2_Missense_Mutation_p.D204N|DLGAP1_ENST00000584874.1_Missense_Mutation_p.D506N|DLGAP1_ENST00000400149.3_Missense_Mutation_p.D214N|DLGAP1_ENST00000539435.1_Missense_Mutation_p.D204N|DLGAP1_ENST00000581527.1_Missense_Mutation_p.D506N|DLGAP1_ENST00000400147.2_Missense_Mutation_p.D204N|DLGAP1_ENST00000400150.3_Missense_Mutation_p.D212N|DLGAP1_ENST00000478161.1_5'UTR|DLGAP1_ENST00000515196.2_Missense_Mutation_p.D506N|DLGAP1_ENST00000400155.1_Missense_Mutation_p.D212N|DLGAP1_ENST00000534970.1_Missense_Mutation_p.D218N|DLGAP1_ENST00000581699.1_Missense_Mutation_p.D212N	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	506					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				ACGCACTCGTCGTCCTGGGAG	0.687													ENSG00000170579																																					0													54.0	41.0	46.0					18																	3729210		2203	4299	6502	SO:0001583	missense	0			-	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1516G>A	18.37:g.3729210C>T	ENSP00000316377:p.Asp506Asn		A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	pfam_GKAP	p.D506N	ENST00000315677.3	37	c.1516	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	C	18.74	3.689378	0.68271	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;D;D;D;D;D;D;T;T	0.87966	2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;1.59;2.32	5.9	5.9	0.94986	.	0.105150	0.64402	D	0.000004	D	0.91673	0.7368	M	0.75615	2.305	0.58432	D	0.999993	D;D;P;D;P;D;P;P;D	0.59767	0.957;0.976;0.944;0.957;0.944;0.986;0.876;0.944;0.967	B;P;P;B;B;P;B;P;P	0.53313	0.284;0.51;0.533;0.284;0.428;0.704;0.381;0.533;0.723	D	0.92046	0.5644	10	0.87932	D	0	-33.1494	20.2821	0.98520	0.0:1.0:0.0:0.0	.	506;218;192;212;204;506;204;506;204	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;Q6IS01;O14490-3;O14490;O14490-2	.;.;.;.;.;.;.;DLGP1_HUMAN;.	N	506;204;212;214;212;218;204;204;506	ENSP00000316377:D506N;ENSP00000383011:D204N;ENSP00000383014:D212N;ENSP00000383013:D214N;ENSP00000383019:D212N;ENSP00000437817:D218N;ENSP00000446312:D204N;ENSP00000383010:D204N;ENSP00000445973:D506N	ENSP00000316377:D506N	D	-	1	0	DLGAP1	3719210	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.083000	0.71326	2.786000	0.95864	0.563000	0.77884	GAC	-	DLGAP1	-	NULL		0.687	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	HGNC	protein_coding	OTTHUMT00000254394.4	0	0	0	43	43	4	0.00	0.00	C			3729210	-1	41	8	38	8	tier1	no_errors	ENST00000315677	ensembl	human	known	74_37	missense	51.90	50.00	SNP	1.000	T	41	38
ATXN1L	342371	genome.wustl.edu	37	16	71884767	71884768	+	Frame_Shift_Ins	INS	-	-	G			TCGA-K1-A3PN-01A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e554430-e3c5-4c9b-9681-3e9c0f4236f1	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr16:71884767_71884768insG	ENST00000427980.2	+	3	1417_1418	c.1124_1125insG	c.(1123-1128)gaggggfs	p.EG375fs	ATXN1L_ENST00000569119.1_Intron	NM_001137675.3	NP_001131147.1	P0C7T5	ATX1L_HUMAN	ataxin 1-like	375					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)	4						CATCAGGGTGAGGGGCGAGGGT	0.579													ENSG00000224470																																					0																																										SO:0001589	frameshift_variant	0					CCDS45523.1	16q22.2	2014-09-04			ENSG00000224470	ENSG00000224470			33279	protein-coding gene	gene with protein product	"""brother of ataxin 1"""	614301				16121196, 17322884, 21475249	Standard	NM_001137675		Approved	BOAT1	uc002fbd.3	P0C7T5	OTTHUMG00000176872	ENST00000427980.2:c.1128dupG	16.37:g.71884771_71884771dupG	ENSP00000415822:p.Glu375fs			Frame_Shift_Ins	INS	pfam_Ataxin-1_HBP1,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.R377fs	ENST00000427980.2	37	c.1124_1125	CCDS45523.1	16																																																																																				ATXN1L	-	NULL		0.579	ATXN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1L	HGNC	protein_coding	OTTHUMT00000434171.1	0	0	0	25	25	99	0.00	0.00	-	NM_001137675.2		71884768	+1	13	2	4	63	tier1	no_errors	ENST00000427980	ensembl	human	known	74_37	frame_shift_ins	76.47	3.08	INS	1.000:0.993	G	13	4
