#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
MTMR10	54893	genome.wustl.edu	37	15	31267168	31267168	+	Silent	SNP	A	A	G			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr15:31267168A>G	ENST00000435680.1	-	4	394	c.297T>C	c.(295-297)gaT>gaC	p.D99D	MTMR10_ENST00000563714.1_Silent_p.D17D|MTMR10_ENST00000314404.8_5'Flank|MTMR10_ENST00000425768.1_Silent_p.D99D	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	99							phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		TTAAAGGGACATCGTGTTCAC	0.318													ENSG00000166912																																					0													69.0	64.0	65.0					15																	31267168		1832	4077	5909	SO:0001819	synonymous_variant	0			-	AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.297T>C	15.37:g.31267168A>G			Q6P4Q6	Silent	SNP	pfam_Myotubularin_assoc,pfam_Myotubularin-like_Pase_dom	p.D99	ENST00000435680.1	37	c.297	CCDS45204.1	15																																																																																			-	MTMR10	-	NULL		0.318	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR10	HGNC	protein_coding	OTTHUMT00000430747.1	0	0	0	51	51	126	0.00	0.00	A	NM_017762		31267168	-1	21	53	38	79	tier1	no_errors	ENST00000435680	ensembl	human	known	74_37	silent	35.59	40.15	SNP	1.000	G	21	38
TOPBP1	11073	genome.wustl.edu	37	3	133337269	133337269	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr3:133337269C>T	ENST00000260810.5	-	21	3511	c.3380G>A	c.(3379-3381)cGt>cAt	p.R1127H		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1127					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TACTGTCTGACGAGACTGCCT	0.423								Other conserved DNA damage response genes					ENSG00000163781																									Ovarian(21;193 658 4424 15423 17362)												0													136.0	127.0	130.0					3																	133337269		1923	4148	6071	SO:0001583	missense	0			-	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3380G>A	3.37:g.133337269C>T	ENSP00000260810:p.Arg1127His		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.R1127H	ENST00000260810.5	37	c.3380	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753721	0.49362	.	.	ENSG00000163781	ENST00000260810	T	0.12774	2.65	6.17	5.3	0.74995	.	0.044840	0.85682	D	0.000000	T	0.13543	0.0328	L	0.45137	1.4	0.53688	D	0.999973	B;B	0.27192	0.171;0.171	B;B	0.20184	0.023;0.028	T	0.02404	-1.1164	10	0.39692	T	0.17	.	15.01	0.71542	0.0:0.9327:0.0:0.0673	.	1040;1127	A0AV47;Q92547	.;TOPB1_HUMAN	H	1127	ENSP00000260810:R1127H	ENSP00000260810:R1127H	R	-	2	0	TOPBP1	134819959	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	4.430000	0.59907	2.941000	0.99782	0.655000	0.94253	CGT	-	TOPBP1	-	NULL		0.423	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	0	0	0	39	39	111	0.00	0.00	C	NM_007027		133337269	-1	19	26	50	88	tier1	no_errors	ENST00000260810	ensembl	human	known	74_37	missense	27.14	22.81	SNP	1.000	T	19	50
CXCL14	9547	genome.wustl.edu	37	5	134914193	134914193	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr5:134914193A>G	ENST00000337225.5	-	2	601	c.137T>C	c.(136-138)aTc>aCc	p.I46T	CTC-321K16.1_ENST00000509372.1_RNA|CTC-321K16.1_ENST00000514446.1_RNA|CXCL14_ENST00000512158.1_Missense_Mutation_p.I34T	NM_004887.4	NP_004878.2	O95715	CXL14_HUMAN	chemokine (C-X-C motif) ligand 14	46					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inner ear development (GO:0048839)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	chemokine activity (GO:0008009)			large_intestine(2)|lung(2)|prostate(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCTGTAGCGGATCTTGGGTCC	0.597													ENSG00000145824																																					0													148.0	139.0	142.0					5																	134914193		2203	4300	6503	SO:0001583	missense	0			-	AF073957	CCDS4188.1	5q31	2010-04-30	2002-08-22	2002-08-23	ENSG00000145824	ENSG00000145824			10640	protein-coding gene	gene with protein product	"""breast and kidney"""	604186	"""small inducible cytokine subfamily B (Cys-X-Cys), member 14 (BRAK)"""	SCYB14		10049774	Standard	NM_004887		Approved	BRAK, NJAC, bolekine, Kec, MIP-2g, BMAC, KS1	uc003lay.3	O95715	OTTHUMG00000129139	ENST00000337225.5:c.137T>C	5.37:g.134914193A>G	ENSP00000337065:p.Ile46Thr		B3KQU8|Q6UW97|Q86U69|Q9BTR1|Q9NS21	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom	p.I46T	ENST00000337225.5	37	c.137	CCDS4188.1	5	.	.	.	.	.	.	.	.	.	.	A	26.3	4.724197	0.89298	.	.	ENSG00000145824	ENST00000337225;ENST00000512158	T;T	0.09073	3.02;3.02	5.12	5.12	0.69794	Chemokine interleukin-8-like domain (2);	0.000000	0.85682	D	0.000000	T	0.27731	0.0682	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.01356	-1.1376	10	0.87932	D	0	1.3637	13.4744	0.61299	1.0:0.0:0.0:0.0	.	46	O95715	CXL14_HUMAN	T	46;34	ENSP00000337065:I46T;ENSP00000423783:I34T	ENSP00000337065:I46T	I	-	2	0	CXCL14	134942092	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.026000	0.88783	1.927000	0.55829	0.482000	0.46254	ATC	-	CXCL14	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom		0.597	CXCL14-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL14	HGNC	protein_coding		0	0	0	62	62	46	0.00	0.00	A	NM_004887		134914193	-1	26	10	102	88	tier1	no_errors	ENST00000337225	ensembl	human	known	74_37	missense	20.31	10.20	SNP	1.000	G	26	102
RGL3	57139	genome.wustl.edu	37	19	11526773	11526773	+	Silent	SNP	G	G	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr19:11526773G>A	ENST00000380456.3	-	5	540	c.477C>T	c.(475-477)ttC>ttT	p.F159F	RGL3_ENST00000393423.3_Silent_p.F159F	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	159	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						GGGGGTCTCGGAAATCCTGAG	0.637													ENSG00000205517																									GBM(174;751 2067 17998 27979 33959)												0													22.0	26.0	24.0					19																	11526773		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.477C>T	19.37:g.11526773G>A			B5ME84|B7ZL22|Q0P6G0	Missense_Mutation	SNP	superfamily_Ras_GEF_dom,pfscan_Ras-like_Gua-exchang_fac_N	p.P158S	ENST00000380456.3	37	c.472	CCDS32910.1	19																																																																																			-	RGL3	-	pfscan_Ras-like_Gua-exchang_fac_N		0.637	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL3	HGNC	protein_coding	OTTHUMT00000421208.3	0	0	0	19	19	20	0.00	0.00	G	XM_290867		11526773	-1	9	11	17	21	tier1	no_errors	ENST00000563726	ensembl	human	known	74_37	missense	34.62	34.38	SNP	0.981	A	9	17
C9	735	genome.wustl.edu	37	5	39288847	39288847	+	Silent	SNP	G	G	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr5:39288847G>A	ENST00000263408.4	-	10	1718	c.1623C>T	c.(1621-1623)atC>atT	p.I541I		NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	541					complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TTTGTTTACTGATTTCACAGG	0.358													ENSG00000113600																																					0													116.0	111.0	113.0					5																	39288847		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.1623C>T	5.37:g.39288847G>A				Silent	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt	p.I541	ENST00000263408.4	37	c.1623	CCDS3929.1	5																																																																																			-	C9	-	NULL		0.358	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	HGNC	protein_coding	OTTHUMT00000211576.3	0	0	0	35	35	101	0.00	0.00	G			39288847	-1	11	28	71	171	tier1	no_errors	ENST00000263408	ensembl	human	known	74_37	silent	13.41	14.00	SNP	0.001	A	11	71
ACTR6	64431	genome.wustl.edu	37	12	100613903	100613903	+	Missense_Mutation	SNP	T	T	C			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr12:100613903T>C	ENST00000188312.2	+	10	1805	c.1040T>C	c.(1039-1041)gTt>gCt	p.V347A	ACTR6_ENST00000551617.1_Missense_Mutation_p.V245A|ACTR6_ENST00000546902.1_Missense_Mutation_p.V265A|ACTR6_ENST00000552376.1_Missense_Mutation_p.V327A	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	347						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						GATTATGATGTTTCTGTTGTG	0.383													ENSG00000075089																																					0													145.0	133.0	137.0					12																	100613903		2203	4300	6503	SO:0001583	missense	0			-	AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.1040T>C	12.37:g.100613903T>C	ENSP00000188312:p.Val347Ala		B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related	p.V347A	ENST00000188312.2	37	c.1040	CCDS9074.1	12	.	.	.	.	.	.	.	.	.	.	T	28.8	4.952410	0.92660	.	.	ENSG00000075089	ENST00000188312;ENST00000546902;ENST00000552376;ENST00000551617	D;D;T;T	0.95447	-3.71;-3.71;3.0;3.0	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.97660	0.9233	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.64830	0.992;0.992;0.992;0.994	P;P;D;D	0.67900	0.874;0.874;0.923;0.954	D	0.98344	1.0540	10	0.87932	D	0	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	265;245;327;347	G3V1Y1;F8VSD1;F8W057;Q9GZN1	.;.;.;ARP6_HUMAN	A	347;265;327;245	ENSP00000188312:V347A;ENSP00000448669:V265A;ENSP00000447237:V327A;ENSP00000448356:V245A	ENSP00000188312:V347A	V	+	2	0	ACTR6	99138034	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.417000	0.80156	2.279000	0.76181	0.533000	0.62120	GTT	-	ACTR6	-	pfam_Actin-related,smart_Actin-related		0.383	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR6	HGNC	protein_coding	OTTHUMT00000408159.1	0	0	0	33	33	130	0.00	0.00	T	NM_022496		100613903	+1	22	39	23	51	tier1	no_errors	ENST00000188312	ensembl	human	known	74_37	missense	48.89	43.33	SNP	1.000	C	22	23
NEK10	152110	genome.wustl.edu	37	3	27393955	27393955	+	Splice_Site	SNP	C	C	T			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr3:27393955C>T	ENST00000429845.2	-	4	495		c.e4+1		NEK10_ENST00000341435.5_Splice_Site			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10						positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GAAAACGCTACCTGTTGTTTG	0.368													ENSG00000163491																																					0													140.0	117.0	124.0					3																	27393955		1568	3582	5150	SO:0001630	splice_region_variant	0			-	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.132+1G>A	3.37:g.27393955C>T			A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Splice_Site	SNP	-	e2+1	ENST00000429845.2	37	c.132+1		3	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190036	0.78789	.	.	ENSG00000163491	ENST00000341435;ENST00000396636;ENST00000435750;ENST00000429845	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1584	0.89701	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NEK10	27368959	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	4.829000	0.62737	2.825000	0.97269	0.655000	0.94253	.	-	NEK10	-	-		0.368	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	HGNC	protein_coding	OTTHUMT00000438156.1	0	0	0	25	25	96	0.00	0.00	C	NM_152534	Intron	27393955	-1	12	54	7	55	tier1	no_errors	ENST00000341435	ensembl	human	known	74_37	splice_site	63.16	49.54	SNP	1.000	T	12	7
TUBD1	51174	genome.wustl.edu	37	17	57968332	57968332	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr17:57968332C>T	ENST00000592426.1	-	1	32	c.32G>A	c.(31-33)tGt>tAt	p.C11Y	RPS6KB1_ENST00000406116.3_5'Flank|TUBD1_ENST00000376094.4_Missense_Mutation_p.C11Y|TUBD1_ENST00000394239.3_Missense_Mutation_p.C11Y|TUBD1_ENST00000539018.1_Intron|TUBD1_ENST00000346141.6_Missense_Mutation_p.C11Y|RPS6KB1_ENST00000443572.2_5'Flank|RPS6KB1_ENST00000225577.4_5'Flank|TUBD1_ENST00000325752.3_Missense_Mutation_p.C11Y|TUBD1_ENST00000340993.6_Missense_Mutation_p.C11Y|RPS6KB1_ENST00000393021.3_5'Flank|TUBD1_ENST00000591611.1_5'UTR			Q9UJT1	TBD_HUMAN	tubulin, delta 1	11					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	CTGATTGCCACACTGACCAAG	0.408													ENSG00000108423																																					0													148.0	129.0	136.0					17																	57968332		2203	4300	6503	SO:0001583	missense	0			-	AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.32G>A	17.37:g.57968332C>T	ENSP00000468518:p.Cys11Tyr		B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,prints_Delta_tubulin,prints_Tubulin,prints_Epsilon_tubulin	p.C11Y	ENST00000592426.1	37	c.32	CCDS11620.1	17	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039429	0.75617	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000346141;ENST00000394239;ENST00000376094	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	6.04	5.06	0.68205	Tubulin/FtsZ, GTPase domain (3);	0.043512	0.85682	N	0.000000	D	0.87593	0.6216	M	0.93854	3.465	0.80722	D	1	P;B;B;D;P	0.54964	0.931;0.082;0.008;0.969;0.931	P;B;B;P;P	0.56563	0.739;0.058;0.031;0.801;0.798	D	0.91049	0.4877	10	0.87932	D	0	-9.8784	15.7671	0.78135	0.0:0.9342:0.0:0.0658	.	11;11;11;11;11	E9PCA7;Q9UJT1-3;E9PCQ8;Q9UJT1-2;Q9UJT1	.;.;.;.;TBD_HUMAN	Y	11	ENSP00000320797:C11Y;ENSP00000342399:C11Y;ENSP00000342561:C11Y;ENSP00000377785:C11Y;ENSP00000365262:C11Y	ENSP00000320797:C11Y	C	-	2	0	TUBD1	55323114	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.206000	0.77891	1.554000	0.49487	0.650000	0.86243	TGT	-	TUBD1	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,prints_Tubulin		0.408	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBD1	HGNC	protein_coding	OTTHUMT00000448815.1	0	0	0	8	8	97	0.00	0.00	C	NM_016261		57968332	-1	6	22	11	65	tier1	no_errors	ENST00000325752	ensembl	human	known	74_37	missense	35.29	25.29	SNP	1.000	T	6	11
RTTN	25914	genome.wustl.edu	37	18	67836097	67836097	+	Silent	SNP	C	C	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr18:67836097C>A	ENST00000255674.6	-	12	1969	c.1683G>T	c.(1681-1683)ggG>ggT	p.G561G	RTTN_ENST00000454359.1_Silent_p.G561G|RTTN_ENST00000437017.1_Silent_p.G561G	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	561					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				TTACCTCTTTCCCAATATCAG	0.289													ENSG00000176225																																					0													78.0	78.0	78.0					18																	67836097		1791	4063	5854	SO:0001819	synonymous_variant	0			-	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.1683G>T	18.37:g.67836097C>A			Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	superfamily_ARM-type_fold	p.G561	ENST00000255674.6	37	c.1683	CCDS42443.1	18																																																																																			-	RTTN	-	superfamily_ARM-type_fold		0.289	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	0	0	1	32	32	83	0.00	1.19	C	NM_173630		67836097	-1	16	24	38	69	tier1	no_errors	ENST00000255674	ensembl	human	known	74_37	silent	29.63	25.81	SNP	0.061	A	16	38
TRPM6	140803	genome.wustl.edu	37	9	77390934	77390934	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr9:77390934G>A	ENST00000360774.1	-	24	3505	c.3268C>T	c.(3268-3270)Cgc>Tgc	p.R1090C	TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.R1085C|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000449912.2_Missense_Mutation_p.R1085C|TRPM6_ENST00000451710.3_Missense_Mutation_p.R1090C|TRPM6_ENST00000376864.4_Missense_Mutation_p.R1090C	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1090					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATGATGTAGCGATAGCGGTTG	0.493													ENSG00000119121																																					0													118.0	127.0	124.0					9																	77390934		2203	4300	6503	SO:0001583	missense	0			-	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3268C>T	9.37:g.77390934G>A	ENSP00000354006:p.Arg1090Cys		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.R1090C	ENST00000360774.1	37	c.3268	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.120843	0.94385	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.55588	0.6;0.6;0.6;0.6;0.51	5.76	5.76	0.90799	.	0.046412	0.85682	D	0.000000	T	0.72779	0.3503	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.67900	0.932;0.931;0.954	T	0.74426	-0.3669	10	0.87932	D	0	.	19.9561	0.97218	0.0:0.0:1.0:0.0	.	1090;1085;1085	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	C	1090;1090;1085;1085;1090;753;753	ENSP00000354006:R1090C;ENSP00000407341:R1090C;ENSP00000396672:R1085C;ENSP00000354962:R1085C;ENSP00000366060:R1090C	ENSP00000309693:R753C	R	-	1	0	TRPM6	76580754	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.827000	0.86722	2.725000	0.93324	0.591000	0.81541	CGC	-	TRPM6	-	NULL		0.493	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	0	0	0	58	58	74	0.00	0.00	G	NM_017662		77390934	-1	41	63	15	22	tier1	no_errors	ENST00000451710	ensembl	human	known	74_37	missense	73.21	74.12	SNP	1.000	A	41	15
RIMBP2	23504	genome.wustl.edu	37	12	130927134	130927134	+	Missense_Mutation	SNP	G	G	A	rs549158714		TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr12:130927134G>A	ENST00000261655.4	-	8	875	c.712C>T	c.(712-714)Cgg>Tgg	p.R238W	RIMBP2_ENST00000535703.1_Missense_Mutation_p.R146W|RIMBP2_ENST00000536002.1_Missense_Mutation_p.R146W	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	238					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CTTGCCAACCGCGACTCGTTG	0.587													ENSG00000060709	G|||	1	0.000199681	0.0	0.0	5008	,	,		18516	0.0		0.0	False		,,,				2504	0.001																0													130.0	129.0	129.0					12																	130927134		2203	4300	6503	SO:0001583	missense	0			-	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.712C>T	12.37:g.130927134G>A	ENSP00000261655:p.Arg238Trp		Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.R238W	ENST00000261655.4	37	c.712	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885658	0.51908	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.30448	1.53;1.53;1.53	4.53	3.61	0.41365	Src homology-3 domain (1);	0.538961	0.20115	N	0.098937	T	0.52837	0.1759	M	0.68317	2.08	0.42057	D	0.991146	D;D	0.89917	0.998;1.0	D;D	0.83275	0.928;0.996	T	0.55611	-0.8114	10	0.66056	D	0.02	-24.1815	13.5684	0.61832	0.0:0.0:0.8432:0.1568	.	146;238	O15034-2;O15034	.;RIMB2_HUMAN	W	238;146;146;146	ENSP00000261655:R238W;ENSP00000440347:R146W;ENSP00000439159:R146W	ENSP00000261655:R238W	R	-	1	2	RIMBP2	129493087	1.000000	0.71417	0.020000	0.16555	0.317000	0.28152	5.216000	0.65246	0.840000	0.34995	0.561000	0.74099	CGG	-	RIMBP2	-	superfamily_SH3_domain		0.587	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	0	0	0	53	53	69	0.00	0.00	G	NM_015347		130927134	-1	14	16	46	61	tier1	no_errors	ENST00000261655	ensembl	human	known	74_37	missense	22.95	20.78	SNP	0.780	A	14	46
EXTL3	2137	genome.wustl.edu	37	8	28575380	28575380	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr8:28575380C>T	ENST00000220562.4	+	3	2706	c.1804C>T	c.(1804-1806)Cgc>Tgc	p.R602C	EXTL3_ENST00000523149.1_Missense_Mutation_p.R218C|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	602					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TGACTTTTACCGCAGCTGGAA	0.587													ENSG00000012232																																					0													94.0	82.0	86.0					8																	28575380		2203	4300	6503	SO:0001583	missense	0			-	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.1804C>T	8.37:g.28575380C>T	ENSP00000220562:p.Arg602Cys		D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	pfam_Hexc_Trfase_a,pfam_Exostosin	p.R602C	ENST00000220562.4	37	c.1804	CCDS6070.1	8	.	.	.	.	.	.	.	.	.	.	C	15.05	2.719325	0.48728	.	.	ENSG00000012232	ENST00000523149;ENST00000220562	D;D	0.95482	-3.33;-3.72	6.04	5.16	0.70880	.	0.050594	0.85682	D	0.000000	D	0.95338	0.8487	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	P	0.58391	0.838	D	0.95595	0.8658	10	0.62326	D	0.03	-22.9675	14.5566	0.68103	0.318:0.682:0.0:0.0	.	602	O43909	EXTL3_HUMAN	C	218;602	ENSP00000428691:R218C;ENSP00000220562:R602C	ENSP00000220562:R602C	R	+	1	0	EXTL3	28631299	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.262000	0.51538	1.542000	0.49330	0.563000	0.77884	CGC	-	EXTL3	-	NULL		0.587	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXTL3	HGNC	protein_coding	OTTHUMT00000219987.3	0	0	0	39	39	102	0.00	0.00	C	NM_001440		28575380	+1	11	30	46	95	tier1	no_errors	ENST00000220562	ensembl	human	known	74_37	missense	19.30	24.00	SNP	1.000	T	11	46
SRMS	6725	genome.wustl.edu	37	20	62172208	62172208	+	Missense_Mutation	SNP	C	C	T	rs368421364		TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr20:62172208C>T	ENST00000217188.1	-	8	1470	c.1430G>A	c.(1429-1431)cGg>cAg	p.R477Q		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	477	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CAGCTTCTCCCGCAGCGTGGC	0.711													ENSG00000125508	C|||	1	0.000199681	0.0	0.0	5008	,	,		16932	0.0		0.0	False		,,,				2504	0.001																0								C	GLN/ARG	1,4403	2.1+/-5.4	0,1,2201	101.0	90.0	94.0		1430	-2.4	0.6	20		94	0,8600		0,0,4300	no	missense	SRMS	NM_080823.2	43	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	benign	477/489	62172208	1,13003	2202	4300	6502	SO:0001583	missense	0			-		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.1430G>A	20.37:g.62172208C>T	ENSP00000217188:p.Arg477Gln			Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.R477Q	ENST00000217188.1	37	c.1430	CCDS13525.1	20	.	.	.	.	.	.	.	.	.	.	C	0.542	-0.852984	0.02630	2.27E-4	0.0	ENSG00000125508	ENST00000217188	T	0.11495	2.77	5.17	-2.36	0.06663	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	1.024840	0.07842	N	0.963191	T	0.08846	0.0219	L	0.52573	1.65	0.19775	N	0.999953	B	0.19200	0.034	B	0.17098	0.017	T	0.47459	-0.9116	10	0.02654	T	1	.	10.2345	0.43275	0.0:0.7031:0.1318:0.1651	.	477	Q9H3Y6	SRMS_HUMAN	Q	477	ENSP00000217188:R477Q	ENSP00000217188:R477Q	R	-	2	0	SRMS	61642652	0.000000	0.05858	0.554000	0.28268	0.068000	0.16541	-0.025000	0.12413	-0.325000	0.08577	-0.345000	0.07892	CGG	-	SRMS	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.711	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	SRMS	HGNC	protein_coding	OTTHUMT00000080148.1	0	0	0	58	58	31	0.00	0.00	C	NM_080823		62172208	-1	22	3	41	17	tier1	no_errors	ENST00000217188	ensembl	human	known	74_37	missense	34.92	14.29	SNP	0.388	T	22	41
MUC6	4588	genome.wustl.edu	37	11	1031025	1031025	+	Silent	SNP	G	G	T			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr11:1031025G>T	ENST00000421673.2	-	6	656	c.606C>A	c.(604-606)gcC>gcA	p.A202A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	202	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTTCTGGAGGGCAGCAAACT	0.682													ENSG00000184956																																					0													36.0	42.0	40.0					11																	1031025		1927	4109	6036	SO:0001819	synonymous_variant	0			-	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.606C>A	11.37:g.1031025G>T			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.A202	ENST00000421673.2	37	c.606	CCDS44513.1	11																																																																																			-	MUC6	-	NULL		0.682	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	0	0	0	48	48	33	0.00	0.00	G	XM_290540		1031025	-1	11	3	16	22	tier1	no_errors	ENST00000421673	ensembl	human	known	74_37	silent	40.74	12.00	SNP	0.015	T	11	16
ZNF19	7567	genome.wustl.edu	37	16	71509307	71509307	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr16:71509307C>A	ENST00000288177.5	-	6	1398	c.1143G>T	c.(1141-1143)caG>caT	p.Q381H	AC010547.9_ENST00000561908.1_Intron|ZNF19_ENST00000564230.1_Missense_Mutation_p.Q381H|ZNF19_ENST00000565637.1_Missense_Mutation_p.Q339H|ZNF19_ENST00000565100.2_Missense_Mutation_p.Q311H|ZNF19_ENST00000567225.1_Intron	NM_006961.3	NP_008892.2	P17023	ZNF19_HUMAN	zinc finger protein 19	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|prostate(1)|stomach(1)	22		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		AGGAAGACTCCTGAGTATGAA	0.403													ENSG00000157429																																					0													89.0	87.0	87.0					16																	71509307		2198	4300	6498	SO:0001583	missense	0			-	X52343	CCDS10901.1	16q22	2013-01-08	2006-05-10		ENSG00000157429	ENSG00000157429		"""Zinc fingers, C2H2-type"", ""-"""	12981	protein-coding gene	gene with protein product		194525	"""zinc finger protein 19 (KOX 12)"""			1505991, 1946370	Standard	NM_006961		Approved	KOX12, MGC51021	uc002fam.1	P17023	OTTHUMG00000137593	ENST00000288177.5:c.1143G>T	16.37:g.71509307C>A	ENSP00000288177:p.Gln381His		A8K895|Q86Y66|Q8NDE2|Q96M79|Q96NE5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q381H	ENST00000288177.5	37	c.1143	CCDS10901.1	16	.	.	.	.	.	.	.	.	.	.	C	8.104	0.777201	0.16120	.	.	ENSG00000157429	ENST00000288177	T	0.18810	2.19	3.27	-0.948	0.10379	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.539851	0.13974	N	0.349970	T	0.20981	0.0505	L	0.42632	1.34	0.23886	N	0.996561	P	0.40731	0.728	P	0.46110	0.504	T	0.15665	-1.0429	10	0.87932	D	0	.	7.5294	0.27674	0.0:0.5757:0.0:0.4243	.	381	P17023	ZNF19_HUMAN	H	381	ENSP00000288177:Q381H	ENSP00000288177:Q381H	Q	-	3	2	ZNF19	70066808	0.000000	0.05858	0.001000	0.08648	0.108000	0.19459	-3.209000	0.00557	-0.149000	0.11215	-0.150000	0.13652	CAG	-	ZNF19	-	pfscan_Znf_C2H2		0.403	ZNF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF19	HGNC	protein_coding	OTTHUMT00000268993.2	0	0	1	67	67	76	0.00	1.30	C	NM_006961		71509307	-1	14	26	60	74	tier1	no_errors	ENST00000288177	ensembl	human	known	74_37	missense	18.92	26.00	SNP	0.938	A	14	60
COL28A1	340267	genome.wustl.edu	37	7	7550731	7550731	+	Silent	SNP	T	T	C			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr7:7550731T>C	ENST00000399429.3	-	9	1058	c.918A>G	c.(916-918)aaA>aaG	p.K306K		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	306	Collagen-like 2.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		CCTTGTCACCTTTTATCCCTG	0.378													ENSG00000215018																																					0													138.0	126.0	130.0					7																	7550731		1856	4103	5959	SO:0001819	synonymous_variant	0			-	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.918A>G	7.37:g.7550731T>C			A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Silent	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.K306	ENST00000399429.3	37	c.918	CCDS43553.1	7																																																																																			-	COL28A1	-	NULL		0.378	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1	0	0	1	49	49	114	0.00	0.87	T	NM_001037763		7550731	-1	9	27	23	67	tier1	no_errors	ENST00000399429	ensembl	human	known	74_37	silent	28.12	28.72	SNP	1.000	C	9	23
FBXO38	81545	genome.wustl.edu	37	5	147774413	147774413	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr5:147774413A>G	ENST00000340253.5	+	2	242	c.74A>G	c.(73-75)gAa>gGa	p.E25G	FBXO38_ENST00000394370.3_Missense_Mutation_p.E25G|FBXO38_ENST00000296701.6_Missense_Mutation_p.E25G|FBXO38_ENST00000513826.1_Missense_Mutation_p.E25G|FBXO38_ENST00000509699.2_3'UTR			Q6PIJ6	FBX38_HUMAN	F-box protein 38	25					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGCAGATGAAACAAAGGAC	0.383													ENSG00000145868																																					0													178.0	165.0	170.0					5																	147774413		2203	4300	6503	SO:0001583	missense	0			-	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.74A>G	5.37:g.147774413A>G	ENSP00000342023:p.Glu25Gly		Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	superfamily_F-box_dom	p.E25G	ENST00000340253.5	37	c.74		5	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062369	0.76187	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.35236	1.32;1.34;1.32;1.34	5.56	5.56	0.83823	F-box domain, Skp2-like (1);	0.047993	0.85682	D	0.000000	T	0.29389	0.0732	L	0.27053	0.805	0.80722	D	1	P;P;B	0.50528	0.936;0.763;0.447	B;B;B	0.41917	0.37;0.311;0.075	T	0.10042	-1.0647	10	0.66056	D	0.02	-9.1294	14.8438	0.70246	1.0:0.0:0.0:0.0	.	25;25;25	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	G	25	ENSP00000342023:E25G;ENSP00000296701:E25G;ENSP00000377895:E25G;ENSP00000426410:E25G	ENSP00000296701:E25G	E	+	2	0	FBXO38	147754606	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	8.105000	0.89553	2.240000	0.73641	0.533000	0.62120	GAA	-	FBXO38	-	superfamily_F-box_dom		0.383	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	FBXO38	HGNC	protein_coding	OTTHUMT00000252185.2	0	0	0	64	64	56	0.00	0.00	A	NM_030793		147774413	+1	26	22	102	94	tier1	no_errors	ENST00000340253	ensembl	human	known	74_37	missense	20.31	18.97	SNP	1.000	G	26	102
TBX3	6926	genome.wustl.edu	37	12	115112627	115112627	+	Silent	SNP	G	G	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr12:115112627G>A	ENST00000257566.3	-	7	1502	c.1113C>T	c.(1111-1113)agC>agT	p.S371S	TBX3_ENST00000349155.2_Silent_p.S351S	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	371					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		TCTCACCCTCGCTGGGACATA	0.602													ENSG00000135111																																					0													7.0	8.0	8.0					12																	115112627		2150	4185	6335	SO:0001819	synonymous_variant	0			-	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1113C>T	12.37:g.115112627G>A			Q8TB20|Q9UKF8	Silent	SNP	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_D-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.S371	ENST00000257566.3	37	c.1113	CCDS9176.1	12																																																																																			-	TBX3	-	pfam_TBX		0.602	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	0	0	0	36	36	46	0.00	0.00	G	NM_016569, NM_005996		115112627	-1	14	13	32	24	tier1	no_errors	ENST00000257566	ensembl	human	known	74_37	silent	30.43	34.21	SNP	1.000	A	14	32
TP53	7157	genome.wustl.edu	37	17	7577033	7577033	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr17:7577033C>A	ENST00000269305.4	-	8	1094	c.905G>T	c.(904-906)gGg>gTg	p.G302V	TP53_ENST00000445888.2_Missense_Mutation_p.G302V|TP53_ENST00000420246.2_Missense_Mutation_p.G302V|TP53_ENST00000455263.2_Missense_Mutation_p.G302V|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G302V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	302	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		G -> A (in a sporadic cancer; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in a sporadic cancer; somatic mutation).|G -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.G302E(3)|p.P301_S303delPGS(1)|p.L299fs*2(1)|p.L265_K305del41(1)|p.G302fs*2(1)|p.G293fs*1(1)|p.H296_S303delHHELPPGS(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTAGTGCTCCCTGGGGGCAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	20	Whole gene deletion(8)|Substitution - Missense(3)|Unknown(3)|Deletion - In frame(3)|Deletion - Frameshift(3)	bone(5)|breast(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|urinary_tract(1)|lung(1)|oesophagus(1)											113.0	99.0	104.0					17																	7577033		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.905G>T	17.37:g.7577033C>A	ENSP00000269305:p.Gly302Val		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G302V	ENST00000269305.4	37	c.905	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367445	0.61513	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99760	-5.9;-5.62;-5.93;-5.92;-5.62;-6.66	5.26	2.06	0.26882	.	2.455680	0.01443	N	0.015197	D	0.99576	0.9847	M	0.85945	2.785	0.54753	D	0.999985	P;B;P;P	0.42556	0.745;0.355;0.783;0.751	P;B;P;B	0.48141	0.568;0.276;0.48;0.365	D	0.97727	1.0200	10	0.66056	D	0.02	-10.7674	6.155	0.20332	0.0:0.6957:0.0:0.3043	.	302;302;302;302	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	302;302;302;302;302;291;170	ENSP00000352610:G302V;ENSP00000269305:G302V;ENSP00000398846:G302V;ENSP00000391127:G302V;ENSP00000391478:G302V;ENSP00000425104:G170V	ENSP00000269305:G302V	G	-	2	0	TP53	7517758	0.000000	0.05858	0.095000	0.20976	0.224000	0.24922	0.496000	0.22499	0.804000	0.34136	0.561000	0.74099	GGG	-	TP53	-	NULL		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	60	60	69	0.00	0.00	C	NM_000546		7577033	-1	31	41	24	22	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	56.36	64.06	SNP	0.865	A	31	24
TADA3	10474	genome.wustl.edu	37	3	9833131	9833131	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr3:9833131C>T	ENST00000301964.2	-	2	578	c.20G>A	c.(19-21)tGc>tAc	p.C7Y	ARPC4-TTLL3_ENST00000397256.1_5'Flank|TADA3_ENST00000492635.1_Intron|ARPC4_ENST00000498623.2_5'Flank|TADA3_ENST00000343450.2_Missense_Mutation_p.C7Y|ARPC4_ENST00000433034.1_5'Flank|ARPC4_ENST00000397261.3_5'Flank|TADA3_ENST00000440161.1_Missense_Mutation_p.C7Y|ARPC4_ENST00000287613.7_5'Flank	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	7					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						CTGCAAGGGGCAGTCTTTCAA	0.562													ENSG00000171148																																					0													69.0	58.0	62.0					3																	9833131		2203	4300	6503	SO:0001583	missense	0			-	AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.20G>A	3.37:g.9833131C>T	ENSP00000307684:p.Cys7Tyr		Q6FI83|Q9UFS2	Missense_Mutation	SNP	pfam_Histone_AcTrfase_su3	p.C7Y	ENST00000301964.2	37	c.20	CCDS2583.1	3	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230430	0.79688	.	.	ENSG00000171148	ENST00000301964;ENST00000440161;ENST00000343450;ENST00000439043	.	.	.	4.77	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.44685	0.1305	L	0.50333	1.59	0.80722	D	1	D	0.56521	0.976	P	0.44359	0.447	T	0.49360	-0.8948	9	0.02654	T	1	-3.6403	14.1568	0.65422	0.1513:0.8487:0.0:0.0	.	7	O75528	TADA3_HUMAN	Y	7	.	ENSP00000307684:C7Y	C	-	2	0	TADA3	9808131	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	0.979000	0.38497	0.561000	0.74099	TGC	-	TADA3	-	NULL		0.562	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA3	HGNC	protein_coding	OTTHUMT00000250236.1	0	0	0	28	28	56	0.00	0.00	C			9833131	-1	9	16	12	56	tier1	no_errors	ENST00000301964	ensembl	human	known	74_37	missense	42.86	22.22	SNP	1.000	T	9	12
C17orf70	80233	genome.wustl.edu	37	17	79517588	79517588	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr17:79517588C>A	ENST00000327787.8	-	3	978	c.932G>T	c.(931-933)tGc>tTc	p.C311F	C17orf70_ENST00000537152.1_Missense_Mutation_p.C160F|C17orf70_ENST00000425898.2_5'Flank			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	311					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GGCCACCAGGCAGTCACAGTG	0.612													ENSG00000185504																																					0													46.0	48.0	47.0					17																	79517588		2202	4300	6502	SO:0001583	missense	0			-	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.932G>T	17.37:g.79517588C>A	ENSP00000333283:p.Cys311Phe		A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Missense_Mutation	SNP	NULL	p.C311F	ENST00000327787.8	37	c.932	CCDS32765.2	17	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433328	0.62844	.	.	ENSG00000185504	ENST00000327787;ENST00000537152;ENST00000541246;ENST00000544302	T;T	0.50001	0.76;0.79	3.91	2.89	0.33648	.	0.061261	0.64402	N	0.000003	T	0.64789	0.2630	M	0.72894	2.215	0.50039	D	0.999842	D	0.76494	0.999	D	0.87578	0.998	T	0.67094	-0.5757	10	0.87932	D	0	.	11.3157	0.49390	0.184:0.816:0.0:0.0	.	311	Q0VG06	FP100_HUMAN	F	311;160;160;160	ENSP00000333283:C311F;ENSP00000440151:C160F	ENSP00000333283:C311F	C	-	2	0	C17orf70	77128030	1.000000	0.71417	0.996000	0.52242	0.969000	0.65631	5.090000	0.64498	0.770000	0.33336	0.563000	0.77884	TGC	-	C17orf70	-	NULL		0.612	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf70	HGNC	protein_coding	OTTHUMT00000396170.1	0	0	0	43	43	22	0.00	0.00	C	NM_025161		79517588	-1	7	9	17	13	tier1	no_errors	ENST00000327787	ensembl	human	known	74_37	missense	29.17	40.91	SNP	1.000	A	7	17
NKX2-2	4821	genome.wustl.edu	37	20	21494277	21494277	+	Missense_Mutation	SNP	A	A	C			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr20:21494277A>C	ENST00000377142.4	-	1	387	c.31T>G	c.(31-33)Tcg>Gcg	p.S11A	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	11					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						TCCTTGACCGAAAACCCCGTC	0.567													ENSG00000125820																																					0													65.0	65.0	65.0					20																	21494277		2203	4300	6503	SO:0001583	missense	0			-	AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.31T>G	20.37:g.21494277A>C	ENSP00000366347:p.Ser11Ala			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.S11A	ENST00000377142.4	37	c.31	CCDS13145.1	20	.	.	.	.	.	.	.	.	.	.	A	18.61	3.662115	0.67700	.	.	ENSG00000125820	ENST00000377142	D	0.91011	-2.77	4.75	4.75	0.60458	.	0.071666	0.64402	D	0.000017	D	0.86577	0.5966	L	0.47716	1.5	0.46222	D	0.998938	P	0.34864	0.473	B	0.30105	0.111	D	0.87069	0.2158	10	0.66056	D	0.02	.	13.9483	0.64099	1.0:0.0:0.0:0.0	.	11	O95096	NKX22_HUMAN	A	11	ENSP00000366347:S11A	ENSP00000366347:S11A	S	-	1	0	NKX2-2	21442277	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.854000	0.75440	1.774000	0.52232	0.460000	0.39030	TCG	-	NKX2-2	-	NULL		0.567	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-2	HGNC	protein_coding	OTTHUMT00000078278.9	0	0	0	50	50	65	0.00	0.00	A			21494277	-1	35	41	35	60	tier1	no_errors	ENST00000377142	ensembl	human	known	74_37	missense	50.00	40.59	SNP	1.000	C	35	35
COL4A2	1284	genome.wustl.edu	37	13	111114516	111114516	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr13:111114516G>A	ENST00000360467.5	+	23	1958	c.1652G>A	c.(1651-1653)aGa>aAa	p.R551K	COL4A2-AS2_ENST00000458403.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	551	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGAGATTCCAGAACAATCACA	0.532													ENSG00000134871																																					0													75.0	80.0	78.0					13																	111114516		1968	4157	6125	SO:0001583	missense	0			-	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1652G>A	13.37:g.111114516G>A	ENSP00000353654:p.Arg551Lys		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.R551K	ENST00000360467.5	37	c.1652	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	G	7.925	0.739414	0.15642	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93189	-3.18	5.48	4.62	0.57501	.	0.243677	0.29707	N	0.011408	D	0.84920	0.5579	N	0.08118	0	0.09310	N	1	P	0.40144	0.704	B	0.42462	0.388	T	0.77373	-0.2612	10	0.51188	T	0.08	.	6.3305	0.21266	0.0904:0.0:0.726:0.1836	.	551	P08572	CO4A2_HUMAN	K	551	ENSP00000353654:R551K	ENSP00000257309:R551K	R	+	2	0	COL4A2	109912517	0.007000	0.16637	0.016000	0.15963	0.535000	0.34838	1.159000	0.31749	2.576000	0.86940	0.655000	0.94253	AGA	-	COL4A2	-	NULL		0.532	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2	0	0	0	59	59	67	0.00	0.00	G	NM_001846		111114516	+1	8	19	23	49	tier1	no_errors	ENST00000360467	ensembl	human	known	74_37	missense	25.81	27.94	SNP	0.003	A	8	23
UPK1B	7348	genome.wustl.edu	37	3	118909894	118909894	+	Silent	SNP	T	T	C			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr3:118909894T>C	ENST00000264234.3	+	5	560	c.411T>C	c.(409-411)aaT>aaC	p.N137N	UPK1B_ENST00000497685.1_Silent_p.N57N|UPK1B_ENST00000460625.1_Silent_p.N129N	NM_006952.3	NP_008883.2	O75841	UPK1B_HUMAN	uroplakin 1B	137				N -> D (in Ref. 1; BAA33724). {ECO:0000305}.	epithelial cell differentiation (GO:0030855)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	14				GBM - Glioblastoma multiforme(114;0.222)		CTCCAAACAATGATGACCAGT	0.478													ENSG00000114638																																					0													269.0	266.0	267.0					3																	118909894		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF082888	CCDS2985.1	3q13.32	2013-02-14			ENSG00000114638	ENSG00000114638		"""Tetraspanins"""	12578	protein-coding gene	gene with protein product		602380		UPK1		9935153, 9846985	Standard	NM_006952		Approved	TSPAN20	uc003ecc.3	O75841	OTTHUMG00000159354	ENST00000264234.3:c.411T>C	3.37:g.118909894T>C			O60753|Q9UIM2|Q9UNX6	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.N137	ENST00000264234.3	37	c.411	CCDS2985.1	3																																																																																			-	UPK1B	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2		0.478	UPK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPK1B	HGNC	protein_coding	OTTHUMT00000354883.2	0	0	0	54	54	119	0.00	0.00	T			118909894	+1	9	14	34	114	tier1	no_errors	ENST00000264234	ensembl	human	known	74_37	silent	20.93	10.94	SNP	0.941	C	9	34
TCP11L2	255394	genome.wustl.edu	37	12	106729591	106729591	+	Missense_Mutation	SNP	A	A	C			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr12:106729591A>C	ENST00000299045.3	+	7	1121	c.947A>C	c.(946-948)aAa>aCa	p.K316T		NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	316										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						TATCAGAAAAAAGAATTACCA	0.388													ENSG00000166046																																					0													69.0	74.0	72.0					12																	106729591		2203	4300	6503	SO:0001583	missense	0			-	BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.947A>C	12.37:g.106729591A>C	ENSP00000299045:p.Lys316Thr		B2RA65|G3V1Y9	Missense_Mutation	SNP	pfam_Tcp11	p.K316T	ENST00000299045.3	37	c.947	CCDS9104.1	12	.	.	.	.	.	.	.	.	.	.	A	13.17	2.155780	0.38021	.	.	ENSG00000166046	ENST00000299045	T	0.11712	2.75	5.9	3.54	0.40534	.	0.436773	0.28889	N	0.013805	T	0.10208	0.0250	N	0.24115	0.695	0.80722	D	1	B	0.34399	0.452	B	0.43155	0.41	T	0.32613	-0.9900	10	0.25751	T	0.34	-1.7492	10.3366	0.43854	0.8659:0.0:0.1341:0.0	.	316	Q8N4U5	T11L2_HUMAN	T	316	ENSP00000299045:K316T	ENSP00000299045:K316T	K	+	2	0	TCP11L2	105253721	0.998000	0.40836	0.991000	0.47740	0.996000	0.88848	2.989000	0.49393	1.067000	0.40740	0.460000	0.39030	AAA	-	TCP11L2	-	pfam_Tcp11		0.388	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP11L2	HGNC	protein_coding	OTTHUMT00000407206.1	0	0	0	25	25	97	0.00	0.00	A	NM_152772		106729591	+1	11	22	10	99	tier1	no_errors	ENST00000299045	ensembl	human	known	74_37	missense	52.38	18.18	SNP	0.993	C	11	10
TAT	6898	genome.wustl.edu	37	16	71610109	71610109	+	Frame_Shift_Del	DEL	G	G	-			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr16:71610109delG	ENST00000355962.4	-	2	343	c.210delC	c.(208-210)aacfs	p.N70fs	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	70			N -> D (in dbSNP:rs16973344).		2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	TCATGGTTTTGTTTGGATTTG	0.498													ENSG00000198650																									Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)												0													172.0	130.0	144.0					16																	71610109		2198	4300	6498	SO:0001589	frameshift_variant	0					CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.210delC	16.37:g.71610109delG	ENSP00000348234:p.Asn70fs		B2R8I1|D3DWS2	Frame_Shift_Del	DEL	pfam_Aminotransferase_I/II,pfam_Tyr_aminoTrfase_ubiquitination,pfam_ArAA_b-elim_lyase/Thr_aldolase,pfam_Aminotrans_V/Cys_dSase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase,pirsf_Tyrosine_transaminase,tigrfam_Tyrosine_aminoTrfase,tigrfam_TyrNic_aminoTrfase	p.N70fs	ENST00000355962.4	37	c.210	CCDS10903.1	16																																																																																				TAT	-	superfamily_PyrdxlP-dep_Trfase,pirsf_Tyrosine_transaminase,tigrfam_Tyrosine_aminoTrfase,tigrfam_TyrNic_aminoTrfase		0.498	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAT	HGNC	protein_coding	OTTHUMT00000268989.1	0	0	0	133	133	132	0.00	0.00	G			71610109	-1	29	40	104	121	tier1	no_errors	ENST00000355962	ensembl	human	known	74_37	frame_shift_del	21.80	24.84	DEL	0.983	-	29	104
TP53	7157	genome.wustl.edu	37	17	7577029	7577032	+	Frame_Shift_Del	DEL	GCTC	GCTC	-	rs587782391		TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	GCTC	GCTC	GCTC	-	GCTC	GCTC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr17:7577029_7577032delGCTC	ENST00000269305.4	-	8	1095_1098	c.906_909delGAGC	c.(904-909)gggagcfs	p.GS302fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.GS302fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.GS302fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.GS302fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.GS302fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	302	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		G -> A (in a sporadic cancer; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in a sporadic cancer; somatic mutation).|G -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.S303N(3)|p.S303T(3)|p.G302G(3)|p.S303C(2)|p.P301_S303delPGS(1)|p.L265_K305del41(1)|p.G302fs*2(1)|p.S303fs*42(1)|p.G293fs*1(1)|p.H296_S303delHHELPPGS(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCGCTTAGTGCTCCCTGGGGGCA	0.559		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	28	Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(3)|Unknown(3)|Deletion - Frameshift(3)|Substitution - coding silent(3)	bone(5)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|lung(3)|stomach(2)|central_nervous_system(2)|urinary_tract(2)|oesophagus(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|prostate(1)																																								SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.906_909delGAGC	17.37:g.7577029_7577032delGCTC	ENSP00000269305:p.Gly302fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.S303fs	ENST00000269305.4	37	c.909_906	CCDS11118.1	17																																																																																				TP53	-	NULL		0.559	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	62	62	65	0.00	0.00	GCTC	NM_000546		7577032	-1	30	39	26	25	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	53.57	60.94	DEL	0.989:0.998:1.000:0.995	-	30	26
ATRX	546	genome.wustl.edu	37	X	76888683	76888697	+	Splice_Site	DEL	TTAATACCTTACCTG	TTAATACCTTACCTG	-			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	TTAATACCTTACCTG	TTAATACCTTACCTG	TTAATACCTTACCTG	-	TTAATACCTTACCTG	TTAATACCTTACCTG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chrX:76888683_76888697delTTAATACCTTACCTG	ENST00000373344.5	-	19	5346_5349	c.5132_5135delCAGGTAAGGTATTAA	c.(5131-5136)ccaggt>ct	p.PG1711del	ATRX_ENST00000395603.3_Splice_Site_p.PG1673del|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1711	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TCACTGTCTATTAATACCTTACCTGGATCAACCAA	0.316			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								SO:0001630	splice_region_variant	0				U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5134+1CAGGTAAGGTATTAA>-	X.37:g.76888683_76888697delTTAATACCTTACCTG			D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Splice_Site	DEL	-	e20-1	ENST00000373344.5	37	c.5134+4_5134+1	CCDS14434.1	X																																																																																				ATRX	-	-		0.316	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	119	119	119	0.00	0.00	TTAATACCTTACCTG	NM_000489	In_Frame_Del	76888697	-1	5	5	22	22	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	splice_site_del	18.52	18.52	DEL	0.000:0.000:0.001:0.001:0.060:0.078:0.018:0.028:0.138:0.969:1.000:1.000:1.000:1.000:1.000	-	5	22
KRTAP12-2	353323	genome.wustl.edu	37	21	46086641	46086641	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr21:46086641A>G	ENST00000360770.3	-	1	203	c.163T>C	c.(163-165)Tgc>Cgc	p.C55R	TSPEAR_ENST00000323084.4_Intron	NM_181684.2	NP_859012.1	P59991	KR122_HUMAN	keratin associated protein 12-2	55	23 X 5 AA approximate repeats.					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(1)|lung(3)	5						ACGGGCAGGCACACGGCTGGC	0.627													ENSG00000221864																																					0													69.0	79.0	75.0					21																	46086641		2193	4282	6475	SO:0001583	missense	0			-	AJ566389	CCDS42965.1	21q22.3	2006-03-13			ENSG00000221864	ENSG00000221864		"""Keratin associated proteins"""	20530	protein-coding gene	gene with protein product							Standard	NM_181684		Approved	KRTAP12.2, KAP12.2	uc002zfu.3	P59991	OTTHUMG00000057636	ENST00000360770.3:c.163T>C	21.37:g.46086641A>G	ENSP00000354001:p.Cys55Arg		A6NIS1|A6NMS9|Q0VAS4	Missense_Mutation	SNP	pfam_KRTAP_PMG	p.C55R	ENST00000360770.3	37	c.163	CCDS42965.1	21	.	.	.	.	.	.	.	.	.	.	a	10.03	1.238613	0.22711	.	.	ENSG00000221864	ENST00000360770	T	0.06768	3.26	2.69	2.69	0.31865	.	.	.	.	.	T	0.14570	0.0352	M	0.85630	2.765	0.27643	N	0.947649	B	0.16396	0.017	B	0.10450	0.005	T	0.08743	-1.0707	9	0.87932	D	0	.	8.9666	0.35881	1.0:0.0:0.0:0.0	.	55	P59991	KR122_HUMAN	R	55	ENSP00000354001:C55R	ENSP00000354001:C55R	C	-	1	0	KRTAP12-2	44911069	0.001000	0.12720	0.011000	0.14972	0.017000	0.09413	0.358000	0.20216	1.280000	0.44463	0.321000	0.21382	TGC	-	KRTAP12-2	-	pfam_KRTAP_PMG		0.627	KRTAP12-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP12-2	HGNC	protein_coding	OTTHUMT00000128039.1	0	0	0	62	62	19	0.00	0.00	A	NM_181684		46086641	-1	19	2	30	8	tier1	no_errors	ENST00000360770	ensembl	human	known	74_37	missense	38.78	20.00	SNP	0.153	G	19	30
MAGED1	9500	genome.wustl.edu	37	X	51637744	51637744	+	Intron	SNP	G	G	C			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chrX:51637744G>C	ENST00000375722.1	+	2	297				MAGED1_ENST00000375772.3_Intron|MAGED1_ENST00000494718.1_Intron|MAGED1_ENST00000375695.2_Missense_Mutation_p.V23L|MAGED1_ENST00000326587.7_Intron			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					TTGTAGAGCAGTCTGTCACCC	0.567										Multiple Myeloma(10;0.10)	OREG0019786	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000179222																																					0													35.0	32.0	33.0					X																	51637744		2203	4299	6502	SO:0001627	intron_variant	0			-	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.45+299G>C	X.37:g.51637744G>C		978	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.V23L	ENST00000375722.1	37	c.67	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	G	0.233	-1.019692	0.02078	.	.	ENSG00000179222	ENST00000375695	T	0.02837	4.14	2.79	1.91	0.25777	.	.	.	.	.	T	0.02848	0.0085	.	.	.	0.09310	N	0.999996	B	0.02656	0.0	B	0.04013	0.001	T	0.40384	-0.9566	8	0.87932	D	0	.	6.8661	0.24094	0.0:0.3095:0.6905:0.0	.	23	Q9Y5V3-2	.	L	23	ENSP00000364847:V23L	ENSP00000364847:V23L	V	+	1	0	MAGED1	51654484	0.041000	0.20044	0.539000	0.28077	0.131000	0.20780	-0.037000	0.12164	0.586000	0.29626	0.425000	0.28330	GTC	-	MAGED1	-	NULL		0.567	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	0	0	0	50	50	15	0.00	0.00	G	NM_001005332		51637744	+1	7	6	50	7	tier1	no_errors	ENST00000375695	ensembl	human	known	74_37	missense	12.28	46.15	SNP	0.484	C	7	50
NFATC2	4773	genome.wustl.edu	37	20	50049142	50049142	+	Missense_Mutation	SNP	G	G	C			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr20:50049142G>C	ENST00000396009.3	-	9	2403	c.2184C>G	c.(2182-2184)tgC>tgG	p.C728W	NFATC2_ENST00000609507.1_Missense_Mutation_p.C509W|NFATC2_ENST00000414705.1_Missense_Mutation_p.C708W|NFATC2_ENST00000609943.1_Missense_Mutation_p.C708W|NFATC2_ENST00000371564.3_Missense_Mutation_p.C728W|NFATC2_ENST00000610033.1_Missense_Mutation_p.C509W	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	728					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GGAACTGCTGGCAGGGAGCCA	0.692													ENSG00000101096																																					0													22.0	27.0	26.0					20																	50049142		2201	4298	6499	SO:0001583	missense	0			-	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2184C>G	20.37:g.50049142G>C	ENSP00000379330:p.Cys728Trp		B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	pfam_RHD,pfam_IPT,superfamily_p53-like_TF_D-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.C728W	ENST00000396009.3	37	c.2184	CCDS13437.1	20	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487428	0.63962	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.22945	1.93;1.94;1.97	5.31	5.31	0.75309	.	0.096682	0.64402	D	0.000001	T	0.47116	0.1428	M	0.64170	1.965	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.85130	0.985;0.993;0.997;0.986	T	0.43750	-0.9372	10	0.72032	D	0.01	-20.9615	12.347	0.55126	0.0769:0.0:0.9231:0.0	.	708;708;728;728	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	W	728;728;708	ENSP00000360619:C728W;ENSP00000379330:C728W;ENSP00000396471:C708W	ENSP00000360619:C728W	C	-	3	2	NFATC2	49482549	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.619000	0.61218	2.494000	0.84150	0.555000	0.69702	TGC	-	NFATC2	-	NULL		0.692	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	HGNC	protein_coding	OTTHUMT00000079730.2	0	0	0	136	136	14	0.00	0.00	G	NM_012340		50049142	-1	16	3	111	7	tier1	no_errors	ENST00000396009	ensembl	human	known	74_37	missense	12.60	30.00	SNP	1.000	C	16	111
GLRA1	2741	genome.wustl.edu	37	5	151235943	151235943	+	Splice_Site	SNP	T	T	C			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr5:151235943T>C	ENST00000455880.2	-	5	764	c.478A>G	c.(478-480)Atc>Gtc	p.I160V	GLRA1_ENST00000274576.4_Splice_Site_p.I160V|GLRA1_ENST00000545569.1_Splice_Site_p.I77V|GLRA1_ENST00000471351.2_5'UTR			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	160					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTCAGGGTGATTCTGGGAAGA	0.473													ENSG00000145888																																					0													97.0	89.0	92.0					5																	151235943		2203	4300	6503	SO:0001630	splice_region_variant	0			-		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.477-1A>G	5.37:g.151235943T>C			B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A1,prints_Neur_channel,tigrfam_Neur_channel	p.I160V	ENST00000455880.2	37	c.478	CCDS54942.1	5	.	.	.	.	.	.	.	.	.	.	T	13.76	2.333919	0.41297	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	T;T;T	0.79454	-1.27;-1.27;-1.27	4.78	4.78	0.61160	Neurotransmitter-gated ion-channel ligand-binding (3);	0.097831	0.64402	D	0.000002	T	0.72415	0.3457	L	0.43646	1.37	0.41149	D	0.986013	B;B;B	0.22480	0.067;0.07;0.055	B;B;B	0.33121	0.158;0.158;0.098	T	0.70252	-0.4923	10	0.42905	T	0.14	.	10.7437	0.46168	0.0:0.0:0.1593:0.8407	.	160;77;160	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	V	160;160;77	ENSP00000274576:I160V;ENSP00000411593:I160V;ENSP00000445913:I77V	ENSP00000274576:I160V	I	-	1	0	GLRA1	151216136	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.585000	0.36600	1.914000	0.55421	0.477000	0.44152	ATC	-	GLRA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.473	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA1	HGNC	protein_coding	OTTHUMT00000373959.1	0	0	0	25	25	66	0.00	0.00	T		Missense_Mutation	151235943	-1	8	7	45	73	tier1	no_errors	ENST00000455880	ensembl	human	known	74_37	missense	15.09	8.75	SNP	1.000	C	8	45
CFP	5199	genome.wustl.edu	37	X	47487931	47487931	+	Intron	SNP	C	C	T			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chrX:47487931C>T	ENST00000396992.3	-	3	348				CFP_ENST00000480317.1_5'UTR|CFP_ENST00000247153.3_Intron|CFP_ENST00000377005.2_Intron	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						AACACCAGGTCCGCAGTAAGC	0.453													ENSG00000126759																																					0																																										SO:0001627	intron_variant	0			-	M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.228-255G>A	X.37:g.47487931C>T			O15134|O15135|O15136|O75826	R	SNP	-	NULL	ENST00000396992.3	37	NULL	CCDS14282.1	X																																																																																			-	CFP	-	-		0.453	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	HGNC	protein_coding	OTTHUMT00000056435.2	0	0	0	88	88	135	0.00	0.00	C	NM_002621		47487931	-1	15	10	133	141	tier1	no_errors	ENST00000480317	ensembl	human	known	74_37	rna	10.14	6.62	SNP	0.000	T	15	133
SRSF5	6430	genome.wustl.edu	37	14	70234913	70234930	+	In_Frame_Del	DEL	GCGGCCAGGGAGAAGGAC	GCGGCCAGGGAGAAGGAC	-	rs149960633		TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	GCGGCCAGGGAGAAGGAC	GCGGCCAGGGAGAAGGAC	GCGGCCAGGGAGAAGGAC	-	GCGGCCAGGGAGAAGGAC	GCGGCCAGGGAGAAGGAC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr14:70234913_70234930delGCGGCCAGGGAGAAGGAC	ENST00000553521.1	+	3	1493_1510	c.40_57delGCGGCCAGGGAGAAGGAC	c.(40-57)gcggccagggagaaggacdel	p.AAREKD14del	SRSF5_ENST00000553635.1_In_Frame_Del_p.AAREKD14del|SRSF5_ENST00000554021.1_In_Frame_Del_p.AAREKD14del|SRSF5_ENST00000556587.1_3'UTR|SRSF5_ENST00000451983.2_In_Frame_Del_p.AAREKD14del|SRSF5_ENST00000555349.1_In_Frame_Del_p.AAREKD14del|SRSF5_ENST00000553548.1_In_Frame_Del_p.AAREKD14del|SRSF5_ENST00000557154.1_In_Frame_Del_p.AAREKD14del|SRSF5_ENST00000394366.2_In_Frame_Del_p.AAREKD14del			Q13243	SRSF5_HUMAN	serine/arginine-rich splicing factor 5	14	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of cell cycle (GO:0051726)|response to wounding (GO:0009611)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|liver(1)	2						ACTAAATCCAGCGGCCAGGGAGAAGGACGTGGAAAGAT	0.427													ENSG00000100650																																					0																																										SO:0001651	inframe_deletion	0				AF020307	CCDS32109.1	14q24	2013-02-12	2010-06-22	2010-06-22	ENSG00000100650	ENSG00000100650		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10787	protein-coding gene	gene with protein product	"""SR splicing factor 5"""	600914	"""splicing factor, arginine/serine-rich 5"""	SFRS5		7686911, 20516191	Standard	XM_005267998		Approved	SRP40, HRS	uc001xlp.3	Q13243		ENST00000553521.1:c.40_57delGCGGCCAGGGAGAAGGAC	14.37:g.70234913_70234930delGCGGCCAGGGAGAAGGAC	ENSP00000452123:p.Ala14_Asp19del		O14797|Q16662|Q49AD6|Q6FGE0	In_Frame_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.AAREKD14in_frame_del	ENST00000553521.1	37	c.40_57	CCDS32109.1	14																																																																																				SRSF5	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.427	SRSF5-003	NOVEL	basic|appris_principal|CCDS	protein_coding	SRSF5	HGNC	protein_coding	OTTHUMT00000412456.1	0	0	0	117	117	117	0.00	0.00	GCGGCCAGGGAGAAGGAC	NM_001039465		70234930	+1	5	5	117	117	tier1	no_errors	ENST00000451983	ensembl	human	known	74_37	in_frame_del	4.10	4.10	DEL	0.897:0.990:0.986:1.000:1.000:1.000:0.990:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.993:1.000:1.000:1.000	-	5	117
FOXN4	121643	genome.wustl.edu	37	12	109725976	109725976	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr12:109725976G>T	ENST00000299162.5	-	4	346	c.242C>A	c.(241-243)gCt>gAt	p.A81D	FOXN4_ENST00000355216.1_Intron	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	81	Pro-rich.				amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						GGCCACCCCAGCCAAGGCACC	0.662													ENSG00000139445																																					0													4.0	6.0	5.0					12																	109725976		659	1526	2185	SO:0001583	missense	0			-	AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.242C>A	12.37:g.109725976G>T	ENSP00000299162:p.Ala81Asp		Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A81D	ENST00000299162.5	37	c.242	CCDS9126.2	12	.	.	.	.	.	.	.	.	.	.	G	11.60	1.685564	0.29962	.	.	ENSG00000139445	ENST00000266856;ENST00000299162	D	0.93763	-3.28	4.64	2.74	0.32292	.	5.005580	0.04733	N	0.421475	D	0.90947	0.7154	L	0.50333	1.59	0.36133	D	0.846264	B	0.06786	0.001	B	0.04013	0.001	T	0.81250	-0.1018	10	0.72032	D	0.01	-24.3012	6.6685	0.23056	0.0942:0.0:0.7296:0.1762	.	81	Q96NZ1	FOXN4_HUMAN	D	81	ENSP00000299162:A81D	ENSP00000266856:A81D	A	-	2	0	FOXN4	108210359	0.973000	0.33851	0.462000	0.27118	0.575000	0.36095	1.810000	0.38932	0.457000	0.26962	0.561000	0.74099	GCT	-	FOXN4	-	NULL		0.662	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN4	HGNC	protein_coding	OTTHUMT00000328306.1	0	0	0	57	57	2	0.00	0.00	G	XM_062735		109725976	-1	4	0	27	1	tier1	no_errors	ENST00000299162	ensembl	human	known	74_37	missense	12.90	0.00	SNP	0.808	T	4	27
GOLGA6L4	643707	genome.wustl.edu	37	15	84909385	84909385	+	Missense_Mutation	SNP	G	G	A	rs77228815	byFrequency	TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr15:84909385G>A	ENST00000510439.2	+	6	1341	c.1279G>A	c.(1279-1281)Gat>Aat	p.D427N	GOLGA6L4_ENST00000424966.1_Missense_Mutation_p.D8N|GOLGA6L4_ENST00000422563.2_Missense_Mutation_p.D103N	NM_001267536.1	NP_001254465.1	A6NEF3	GG6L4_HUMAN	golgin A6 family-like 4	427																	TCGGCAACAGGATGAGAGGCT	0.657													ENSG00000184206	g|||	1748	0.349042	0.4652	0.1729	5008	,	,		18779	0.4563		0.175	False		,,,				2504	0.3855																0																																										SO:0001583	missense	0			-	BC101294	CCDS73774.1	15q25.2	2012-11-16	2010-02-12		ENSG00000184206	ENSG00000184206			27256	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 4"""			12477932	Standard	NG_006151		Approved		uc021stn.2	A6NEF3	OTTHUMG00000163050	ENST00000510439.2:c.1279G>A	15.37:g.84909385G>A	ENSP00000421586:p.Asp427Asn		D6REZ9	Missense_Mutation	SNP	NULL	p.D103N	ENST00000510439.2	37	c.307		15	.	.	.	.	.	.	.	.	.	.	.	6.987	0.552282	0.13374	.	.	ENSG00000184206	ENST00000510439;ENST00000424966;ENST00000422563	T	0.15139	2.45	0.613	0.613	0.17597	.	.	.	.	.	T	0.21227	0.0511	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.31998	-0.9923	5	0.72032	D	0.01	.	7.3831	0.26868	1.0E-4:0.0:0.9999:0.0	.	.	.	.	N	427;8;103	ENSP00000421586:D427N	ENSP00000389305:D103N	D	+	1	0	GOLGA6L4	82700389	0.000000	0.05858	0.010000	0.14722	0.008000	0.06430	-0.956000	0.03865	0.701000	0.31803	0.504000	0.49776	GAT	rs77228815	GOLGA6L4	-	NULL		0.657	GOLGA6L4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate_longest	protein_coding	GOLGA6L4	HGNC	protein_coding	OTTHUMT00000371478.2	0	0	0	91	91	0	0.00	0.00	G	NM_001267536		84909385	+1	12	0	118	0	tier1	no_errors	ENST00000422563	ensembl	human	known	74_37	missense	9.23	0.00	SNP	0.004	A	12	118
ALG1	56052	genome.wustl.edu	37	16	5125535	5125536	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr16:5125535_5125536insGA	ENST00000262374.5	+	4	568_569	c.537_538insGA	c.(538-540)tggfs	p.W180fs	ALG1_ENST00000544428.1_Frame_Shift_Ins_p.W69fs|ALG1_ENST00000588623.1_Frame_Shift_Ins_p.W69fs	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	180					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				TGCTGGCCAAGTGGTGAGAGTC	0.545													ENSG00000033011																																					0																																										SO:0001589	frameshift_variant	0				AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	Exception_encountered	16.37:g.5125535_5125536insGA	ENSP00000262374:p.Trp180fs		B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Frame_Shift_Ins	INS	pfam_Glyco_trans_1	p.W179fs	ENST00000262374.5	37	c.537_538	CCDS10528.1	16																																																																																				ALG1	-	NULL		0.545	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1	HGNC	protein_coding	OTTHUMT00000251716.2	0	0	0	52	52	92	0.00	0.00	-	NM_019109		5125536	+1	5	3	40	94	tier1	no_errors	ENST00000262374	ensembl	human	known	74_37	frame_shift_ins	11.11	3.09	INS	0.998:1.000	GA	5	40
ALG1	56052	genome.wustl.edu	37	16	5125537	5125538	+	Splice_Site	INS	-	-	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr16:5125537_5125538insA	ENST00000262374.5	+	4	570	c.539_539insA	c.(538-540)tgg>tAgg	p.W180fs	ALG1_ENST00000544428.1_Splice_Site_p.W69fs|ALG1_ENST00000588623.1_Splice_Site_p.W69fs	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	180					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				CTGGCCAAGTGGTGAGAGTCTA	0.545													ENSG00000033011																																					0																																										SO:0001630	splice_region_variant	0				AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.539+1->A	16.37:g.5125537_5125538insA			B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Frame_Shift_Ins	INS	pfam_Glyco_trans_1	p.W180fs	ENST00000262374.5	37	c.539_540	CCDS10528.1	16																																																																																				ALG1	-	NULL		0.545	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1	HGNC	protein_coding	OTTHUMT00000251716.2	0	0	0	49	49	91	0.00	0.00	-	NM_019109	Frame_Shift_Ins	5125538	+1	5	3	39	93	tier1	no_errors	ENST00000262374	ensembl	human	known	74_37	frame_shift_ins	11.36	3.12	INS	1.000:1.000	A	5	39
C1orf35	79169	genome.wustl.edu	37	1	228288708	228288709	+	3'UTR	INS	-	-	A			TCGA-K1-A42W-01A-11D-A24N-09	TCGA-K1-A42W-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	dd93f952-2796-426f-add8-9a7ab441c794	39fd2203-42c8-4284-98bc-ff7ca45239ac	g.chr1:228288708_228288709insA	ENST00000272139.4	-	0	1149_1150				C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35								poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				GGCTGGTGCCCAGAGCCACTTC	0.614													ENSG00000143793																																					0																																										SO:0001624	3_prime_UTR_variant	0				AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.*124->T	1.37:g.228288709_228288709dupA			Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	R	INS	-	NULL	ENST00000272139.4	37	NULL	CCDS1566.1	1																																																																																				C1orf35	-	-		0.614	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf35	HGNC	protein_coding	OTTHUMT00000092245.1	0	0	0	40	40	35	0.00	0.00	-	NM_024319		228288709	-1	6	2	28	37	tier1	no_errors	ENST00000469781	ensembl	human	known	74_37	rna	17.65	5.13	INS	0.000:0.001	A	6	28
