#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ZNF782	158431	genome.wustl.edu	37	9	99607255	99607255	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr9:99607255T>C	ENST00000481138.1	-	4	720	c.59A>G	c.(58-60)gAg>gGg	p.E20G	ZNF782_ENST00000535338.1_Intron|ZNF782_ENST00000466833.1_Intron	NM_001001662.1	NP_001001662.1	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	20	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(8)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)	33		Acute lymphoblastic leukemia(62;0.0527)				CTGCCACTCCTCCTGGCTGAA	0.502													ENSG00000196597																																					0													81.0	71.0	74.0					9																	99607255		2203	4300	6503	SO:0001583	missense	0			-	AK131468	CCDS35075.1	9q22.33	2013-01-08			ENSG00000196597	ENSG00000196597		"""Zinc fingers, C2H2-type"", ""-"""	33110	protein-coding gene	gene with protein product							Standard	NM_001001662		Approved	FLJ16636	uc004awp.1	Q6ZMW2	OTTHUMG00000020310	ENST00000481138.1:c.59A>G	9.37:g.99607255T>C	ENSP00000419397:p.Glu20Gly		B2RNR0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E20G	ENST00000481138.1	37	c.59	CCDS35075.1	9	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413166	0.42817	.	.	ENSG00000196597	ENST00000481138;ENST00000478850	T;T	0.03663	3.85;3.85	3.17	3.17	0.36434	Krueppel-associated box (4);	.	.	.	.	T	0.19167	0.0460	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00516	-1.1694	9	0.87932	D	0	.	8.1297	0.31020	0.0:0.0:0.0:1.0	.	20	Q6ZMW2	ZN782_HUMAN	G	20	ENSP00000419397:E20G;ENSP00000417577:E20G	ENSP00000417577:E20G	E	-	2	0	ZNF782	98647076	0.996000	0.38824	0.996000	0.52242	0.568000	0.35870	0.628000	0.24522	1.691000	0.51100	0.533000	0.62120	GAG	-	ZNF782	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.502	ZNF782-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF782	HGNC	protein_coding	OTTHUMT00000356810.1	0	0	0	94	94	16	0.00	0.00	T	NM_001001662		99607255	-1	65	8	101	13	tier1	no_errors	ENST00000481138	ensembl	human	known	74_37	missense	39.16	38.10	SNP	0.996	C	65	101
OSBPL8	114882	genome.wustl.edu	37	12	76786379	76786379	+	Missense_Mutation	SNP	T	T	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr12:76786379T>G	ENST00000261183.3	-	10	1390	c.911A>C	c.(910-912)cAc>cCc	p.H304P	OSBPL8_ENST00000393250.4_Missense_Mutation_p.H262P|OSBPL8_ENST00000393249.2_Missense_Mutation_p.H262P	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	304					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						ATCACCACTGTGGAGATTGTT	0.413													ENSG00000091039																																					0													212.0	170.0	184.0					12																	76786379		2203	4300	6503	SO:0001583	missense	0			-	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.911A>C	12.37:g.76786379T>G	ENSP00000261183:p.His304Pro		A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.H304P	ENST00000261183.3	37	c.911	CCDS31862.1	12	.	.	.	.	.	.	.	.	.	.	T	13.02	2.111652	0.37242	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250;ENST00000438913;ENST00000547540;ENST00000546946	T;T;T;T;T	0.44881	1.51;1.49;1.51;0.91;0.92	5.77	5.77	0.91146	.	0.398697	0.25753	N	0.028522	T	0.35653	0.0939	L	0.38838	1.175	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.002	T	0.08126	-1.0737	10	0.27082	T	0.32	-8.1677	16.3948	0.83586	0.0:0.0:0.0:1.0	.	279;304	F8VUA7;Q9BZF1	.;OSBL8_HUMAN	P	262;304;289;262;304;304;279	ENSP00000376939:H262P;ENSP00000261183:H304P;ENSP00000376940:H262P;ENSP00000450238:H304P;ENSP00000447893:H279P	ENSP00000261183:H304P	H	-	2	0	OSBPL8	75310510	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.691000	0.54720	2.326000	0.78906	0.533000	0.62120	CAC	-	OSBPL8	-	NULL		0.413	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL8	HGNC	protein_coding	OTTHUMT00000406357.1	0	0	0	37	37	111	0.00	0.00	T	NM_020841		76786379	-1	12	15	23	47	tier1	no_errors	ENST00000261183	ensembl	human	known	74_37	missense	34.29	24.19	SNP	1.000	G	12	23
MCM10	55388	genome.wustl.edu	37	10	13237231	13237231	+	Missense_Mutation	SNP	C	C	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr10:13237231C>G	ENST00000484800.2	+	14	2042	c.1939C>G	c.(1939-1941)Cca>Gca	p.P647A	MCM10_ENST00000378694.1_Missense_Mutation_p.P646A|MCM10_ENST00000378714.3_Missense_Mutation_p.P646A			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	647					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GTCACCACCACCAAGACCAAA	0.512													ENSG00000065328																																					0													47.0	40.0	42.0					10																	13237231		2203	4300	6503	SO:0001583	missense	0			-	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1939C>G	10.37:g.13237231C>G	ENSP00000418268:p.Pro647Ala		A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.P647A	ENST00000484800.2	37	c.1939	CCDS7096.1	10	.	.	.	.	.	.	.	.	.	.	C	16.50	3.139786	0.56936	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.34667	1.35;1.35;1.35	5.6	4.69	0.59074	Replication factor Mcm10 (1);	0.148812	0.64402	D	0.000007	T	0.47948	0.1473	L	0.46741	1.465	0.49299	D	0.999779	D;D;D	0.71674	0.997;0.996;0.998	D;D;D	0.74348	0.957;0.961;0.983	T	0.34601	-0.9822	10	0.16420	T	0.52	-7.852	11.8535	0.52425	0.1379:0.7296:0.1325:0.0	.	646;646;647	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	A	646;647;647;646	ENSP00000367986:P646A;ENSP00000418268:P647A;ENSP00000367966:P646A	ENSP00000354945:P647A	P	+	1	0	MCM10	13277237	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.063000	0.41423	1.485000	0.48380	-0.175000	0.13238	CCA	-	MCM10	-	pfam_Rep_factor_Mcm10		0.512	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	0	0	0	16	16	45	0.00	0.00	C	NM_182751		13237231	+1	6	28	7	38	tier1	no_errors	ENST00000484800	ensembl	human	known	74_37	missense	46.15	41.79	SNP	1.000	G	6	7
ANXA1	301	genome.wustl.edu	37	9	75775261	75775261	+	Missense_Mutation	SNP	T	T	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr9:75775261T>A	ENST00000376911.1	+	4	1235	c.353T>A	c.(352-354)tTt>tAt	p.F118Y	ANXA1_ENST00000257497.6_Missense_Mutation_p.F118Y			P04083	ANXA1_HUMAN	annexin A1	118					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	CCAGCGCAATTTGATGCTGAT	0.428													ENSG00000135046																																					0													105.0	105.0	105.0					9																	75775261		2203	4300	6503	SO:0001583	missense	0			-	X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.353T>A	9.37:g.75775261T>A	ENSP00000366109:p.Phe118Tyr			Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinI	p.F118Y	ENST00000376911.1	37	c.353	CCDS6645.1	9	.	.	.	.	.	.	.	.	.	.	T	7.565	0.665586	0.14710	.	.	ENSG00000135046	ENST00000257497;ENST00000456643;ENST00000376911	T;T;T	0.02890	4.12;4.12;4.12	5.92	5.92	0.95590	.	0.093121	0.85682	D	0.000000	T	0.01661	0.0053	N	0.03983	-0.305	0.45995	D	0.998807	B	0.09022	0.002	B	0.16289	0.015	T	0.41928	-0.9481	10	0.02654	T	1	.	16.0339	0.80608	0.0:0.0:0.0:1.0	.	118	P04083	ANXA1_HUMAN	Y	118;129;118	ENSP00000257497:F118Y;ENSP00000412489:F129Y;ENSP00000366109:F118Y	ENSP00000257497:F118Y	F	+	2	0	ANXA1	74965081	1.000000	0.71417	0.960000	0.40013	0.859000	0.49053	2.154000	0.42291	2.260000	0.74910	0.528000	0.53228	TTT	-	ANXA1	-	pfam_Annexin_repeat		0.428	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA1	HGNC	protein_coding	OTTHUMT00000052665.1	0	0	0	44	44	101	0.00	0.00	T	NM_000700		75775261	+1	22	57	49	80	tier1	no_errors	ENST00000257497	ensembl	human	known	74_37	missense	30.99	41.61	SNP	1.000	A	22	49
TMEM132D	121256	genome.wustl.edu	37	12	130184367	130184367	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr12:130184367C>T	ENST00000422113.2	-	2	1282	c.956G>A	c.(955-957)cGc>cAc	p.R319H	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	319					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CAACGTGAAGCGATCTTCAGT	0.488													ENSG00000151952																																					0													109.0	98.0	102.0					12																	130184367		2203	4300	6503	SO:0001583	missense	0			-	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.956G>A	12.37:g.130184367C>T	ENSP00000408581:p.Arg319His		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.R319H	ENST00000422113.2	37	c.956	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.725067	0.00694	.	.	ENSG00000151952	ENST00000422113	T	0.12147	2.71	5.47	-4.13	0.03904	.	1.178150	0.05998	N	0.647161	T	0.05410	0.0143	N	0.03608	-0.345	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.44065	-0.9352	9	.	.	.	-3.2786	9.3733	0.38268	0.1128:0.1329:0.0:0.7543	.	319	Q14C87	T132D_HUMAN	H	319	ENSP00000408581:R319H	.	R	-	2	0	TMEM132D	128750320	0.001000	0.12720	0.002000	0.10522	0.040000	0.13550	0.073000	0.14640	-0.923000	0.03785	-0.145000	0.13849	CGC	-	TMEM132D	-	NULL		0.488	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	0	0	0	37	37	168	0.00	0.00	C	NM_133448		130184367	-1	5	43	20	94	tier1	no_errors	ENST00000422113	ensembl	human	known	74_37	missense	20.00	31.39	SNP	0.000	T	5	20
PKHD1L1	93035	genome.wustl.edu	37	8	110437395	110437395	+	Missense_Mutation	SNP	A	A	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr8:110437395A>T	ENST00000378402.5	+	24	2883	c.2779A>T	c.(2779-2781)Att>Ttt	p.I927F		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	927					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATTCAAAGAATTCAAGCTGC	0.328										HNSCC(38;0.096)			ENSG00000205038																																					0													44.0	45.0	44.0					8																	110437395		1836	4092	5928	SO:0001583	missense	0			-	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2779A>T	8.37:g.110437395A>T	ENSP00000367655:p.Ile927Phe		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.I927F	ENST00000378402.5	37	c.2779	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506890	0.44558	.	.	ENSG00000205038	ENST00000378402	D	0.86297	-2.1	5.16	1.39	0.22231	.	0.705359	0.13929	N	0.353026	T	0.81019	0.4736	M	0.74258	2.255	0.23309	N	0.997932	P	0.40931	0.733	B	0.34180	0.177	T	0.66575	-0.5889	10	0.10377	T	0.69	.	7.0119	0.24867	0.7244:0.0:0.2756:0.0	.	927	Q86WI1	PKHL1_HUMAN	F	927	ENSP00000367655:I927F	ENSP00000367655:I927F	I	+	1	0	PKHD1L1	110506571	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	1.088000	0.30877	0.058000	0.16222	0.455000	0.32223	ATT	-	PKHD1L1	-	NULL		0.328	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	0	0	0	26	26	74	0.00	0.00	A	NM_177531		110437395	+1	10	18	41	66	tier1	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	19.61	21.43	SNP	0.998	T	10	41
RAP1GAP2	23108	genome.wustl.edu	37	17	2865946	2865946	+	Intron	SNP	T	T	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:2865946T>A	ENST00000254695.8	+	5	291				RAP1GAP2_ENST00000540393.2_Intron|CTD-3060P21.1_ENST00000574885.1_RNA|RAP1GAP2_ENST00000366401.4_Intron|RAP1GAP2_ENST00000542807.1_Intron	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2						negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						GTGGATCCTGTTTTCCTTGTT	0.562													ENSG00000262884																																					0													60.0	49.0	52.0					17																	2865946		1880	4096	5976	SO:0001627	intron_variant	0			-	AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.202-18T>A	17.37:g.2865946T>A			B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	R	SNP	-	NULL	ENST00000254695.8	37	NULL	CCDS45573.1	17																																																																																			-	CTD-3060P21.1	-	-		0.562	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC101927911	Clone_based_vega_gene	protein_coding	OTTHUMT00000438208.2	1	1	0	154	154	83	0.65	0.00	T			2865946	-1	22	25	99	100	tier1	no_errors	ENST00000574885	ensembl	human	known	74_37	rna	18.18	20.00	SNP	0.995	A	22	99
CGN	57530	genome.wustl.edu	37	1	151497206	151497206	+	Silent	SNP	A	A	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr1:151497206A>G	ENST00000271636.7	+	8	1591	c.1458A>G	c.(1456-1458)gtA>gtG	p.V486V		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	480	Glu-rich.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AACAGCGAGTAGAGGAGCAGC	0.567													ENSG00000143375																																					0													26.0	27.0	27.0					1																	151497206		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.1458A>G	1.37:g.151497206A>G			A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	pfam_Myosin_tail	p.V486	ENST00000271636.7	37	c.1458	CCDS999.1	1																																																																																			-	CGN	-	NULL		0.567	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	0	0	0	56	56	36	0.00	0.00	A	NM_020770		151497206	+1	7	8	43	44	tier1	no_errors	ENST00000271636	ensembl	human	known	74_37	silent	14.00	15.38	SNP	0.957	G	7	43
DUSP27	92235	genome.wustl.edu	37	1	167095964	167095964	+	Silent	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr1:167095964C>T	ENST00000361200.2	+	6	1762	c.1596C>T	c.(1594-1596)aaC>aaT	p.N532N	DUSP27_ENST00000443333.1_Silent_p.N532N|DUSP27_ENST00000271385.5_Silent_p.N532N|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	532					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CCTTCTACAACTTCTGCAGCA	0.542													ENSG00000198842																																					0													88.0	84.0	85.0					1																	167095964		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1596C>T	1.37:g.167095964C>T			A0AUM4|Q9C074	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.N532	ENST00000361200.2	37	c.1596	CCDS30932.1	1																																																																																			-	DUSP27	-	NULL		0.542	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	0	0	0	32	32	71	0.00	0.00	C	NM_001080426		167095964	+1	17	46	20	66	tier1	no_errors	ENST00000271385	ensembl	human	known	74_37	silent	45.95	41.07	SNP	1.000	T	17	20
LRRC37A6P	387646	genome.wustl.edu	37	10	27539404	27539404	+	lincRNA	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr10:27539404G>C	ENST00000574842.1	+	0	673				LRRC37A6P_ENST00000284414.4_RNA																							TCTTCTGGAGGCTGAGCTGGG	0.572													ENSG00000230445																																					0													32.0	34.0	33.0					10																	27539404		692	1591	2283			0			-																													10.37:g.27539404G>C				R	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			-	LRRC37A6P	-	-		0.572	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	HGNC	lincRNA	OTTHUMT00000436904.1	0	0	0	70	70	37	0.00	0.00	G			27539404	-1	19	19	45	39	tier1	no_errors	ENST00000284414	ensembl	human	known	74_37	rna	29.69	32.76	SNP	0.283	C	19	45
SPATA31C1	441452	genome.wustl.edu	37	9	90535818	90535818	+	RNA	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr9:90535818G>C	ENST00000602681.1	+	0	1722							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCCAGCCCCTGTCCCATCTGG	0.567													ENSG00000230246																																					0													80.0	75.0	77.0					9																	90535818		692	1591	2283			0			-	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90535818G>C				R	SNP	-	NULL	ENST00000602681.1	37	NULL		9																																																																																			-	SPATA31C1	-	-		0.567	SPATA31C1-002	KNOWN	basic	processed_transcript	SPATA31C1	HGNC	pseudogene	OTTHUMT00000467313.1	0	0	0	260	260	22	0.00	0.00	G	NM_001145124		90535818	+1	106	27	147	19	tier1	no_errors	ENST00000602681	ensembl	human	known	74_37	rna	41.90	58.70	SNP	0.002	C	106	147
EHBP1	23301	genome.wustl.edu	37	2	63272396	63272396	+	Intron	SNP	T	T	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr2:63272396T>G	ENST00000263991.5	+	24	4087				EHBP1_ENST00000496857.1_Intron|AC009501.4_ENST00000412297.1_RNA|AC009501.4_ENST00000437346.1_RNA|AC009501.4_ENST00000413549.1_RNA|EHBP1_ENST00000405015.3_Intron|EHBP1_ENST00000354487.3_Intron|AC009501.4_ENST00000429952.1_RNA|EHBP1_ENST00000431489.1_Intron|EHBP1_ENST00000405289.1_Intron	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1							cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AATCCAGAGGTCGCGGGAGGG	0.687													ENSG00000231609																																					0																																										SO:0001627	intron_variant	0			-	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.3605+81T>G	2.37:g.63272396T>G			O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	R	SNP	-	NULL	ENST00000263991.5	37	NULL	CCDS1872.1	2																																																																																			-	AC009501.4	-	-		0.687	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132215	Clone_based_vega_gene	protein_coding	OTTHUMT00000251616.1	0	0	0	32	32	37	0.00	0.00	T	NM_015252		63272396	-1	29	22	10	15	tier1	no_errors	ENST00000412297	ensembl	human	known	74_37	rna	74.36	59.46	SNP	0.000	G	29	10
BRD3	8019	genome.wustl.edu	37	9	136905253	136905253	+	Missense_Mutation	SNP	C	C	T	rs62639321		TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr9:136905253C>T	ENST00000303407.7	-	9	1731	c.1546G>A	c.(1546-1548)Gag>Aag	p.E516K	BRD3_ENST00000371834.2_Missense_Mutation_p.E516K|BRD3_ENST00000473349.1_Intron|BRD3_ENST00000357885.2_Missense_Mutation_p.E516K	NM_007371.3	NP_031397.1	Q15059	BRD3_HUMAN	bromodomain containing 3	516	Lys-rich.				chromatin modification (GO:0016568)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)		BRD3/C15orf55(3)	kidney(1)|skin(1)|stomach(4)	6				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		ttctcttcctcggccttcact	0.552			T	C15orf55	lethal midline carcinoma of young people								ENSG00000169925																												Dom	yes		9	9q34	8019	bromodomain containing 3		E	0													108.0	68.0	82.0					9																	136905253		2199	4292	6491	SO:0001583	missense	0			-		CCDS6980.1	9q34	2010-12-23	2002-01-14		ENSG00000169925	ENSG00000169925			1104	protein-coding gene	gene with protein product	"""RING3-like"""	601541	"""bromodomain-containing 3"""			7584044, 8781126	Standard	NM_007371		Approved	RING3L, ORFX, KIAA0043	uc004cew.3	Q15059	OTTHUMG00000021004	ENST00000303407.7:c.1546G>A	9.37:g.136905253C>T	ENSP00000305918:p.Glu516Lys		B1APD9|Q4G5Y3|Q5T1R7|Q8N5M3|Q92645	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E516K	ENST00000303407.7	37	c.1546	CCDS6980.1	9	.	.	.	.	.	.	.	.	.	.	C	15.37	2.813320	0.50527	.	.	ENSG00000169925	ENST00000303407;ENST00000540795;ENST00000371834;ENST00000357885	T;T;T	0.27890	1.64;1.64;1.64	4.71	4.71	0.59529	.	0.259960	0.32687	N	0.005774	T	0.31482	0.0798	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.97	T	0.06716	-1.0811	10	0.06891	T	0.86	-23.2329	16.974	0.86309	0.0:1.0:0.0:0.0	.	516;516	Q15059-2;Q15059	.;BRD3_HUMAN	K	516;195;516;516	ENSP00000305918:E516K;ENSP00000360900:E516K;ENSP00000350557:E516K	ENSP00000305918:E516K	E	-	1	0	BRD3	135895074	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.482000	0.81143	2.310000	0.77875	0.561000	0.74099	GAG	rs62639321	BRD3	-	NULL		0.552	BRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD3	HGNC	protein_coding	OTTHUMT00000055390.4	0	0	0	77	77	50	0.00	0.00	C	NM_007371		136905253	-1	19	18	19	23	tier1	no_errors	ENST00000303407	ensembl	human	known	74_37	missense	50.00	43.90	SNP	1.000	T	19	19
EGR2	1959	genome.wustl.edu	37	10	64573803	64573803	+	Missense_Mutation	SNP	A	A	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr10:64573803A>C	ENST00000242480.3	-	2	920	c.595T>G	c.(595-597)Tct>Gct	p.S199A	EGR2_ENST00000411732.1_Missense_Mutation_p.S149A|EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000439032.1_Missense_Mutation_p.S199A	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	199					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					TAGGCCAGAGAGGAAGAGGTG	0.597													ENSG00000122877																																					0													99.0	94.0	95.0					10																	64573803		2203	4300	6503	SO:0001583	missense	0			-	BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.595T>G	10.37:g.64573803A>C	ENSP00000242480:p.Ser199Ala		B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S199A	ENST00000242480.3	37	c.595	CCDS7267.1	10	.	.	.	.	.	.	.	.	.	.	A	3.054	-0.194790	0.06259	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000411732;ENST00000432380	T;T;T	0.12361	2.69;2.69;2.75	5.15	2.79	0.32731	.	0.253950	0.28624	N	0.014689	T	0.05135	0.0137	N	0.05177	-0.1	0.26778	N	0.969667	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.38779	-0.9645	10	0.15952	T	0.53	-12.9997	5.6105	0.17402	0.6273:0.2742:0.0985:0.0	.	149;199	P11161-2;P11161	.;EGR2_HUMAN	A	199;199;149;212	ENSP00000242480:S199A;ENSP00000402040:S199A;ENSP00000387634:S149A	ENSP00000242480:S199A	S	-	1	0	EGR2	64243809	0.259000	0.24043	0.999000	0.59377	0.994000	0.84299	0.126000	0.15769	0.983000	0.38602	0.533000	0.62120	TCT	-	EGR2	-	NULL		0.597	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR2	HGNC	protein_coding	OTTHUMT00000048245.2	0	0	0	82	82	70	0.00	0.00	A	NM_000399		64573803	-1	11	28	48	36	tier1	no_errors	ENST00000242480	ensembl	human	known	74_37	missense	18.64	43.75	SNP	0.997	C	11	48
CDK3	1018	genome.wustl.edu	37	17	73998102	73998102	+	Splice_Site	SNP	G	G	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:73998102G>A	ENST00000425876.2	+	3	282		c.e3-1		CDK3_ENST00000448471.1_Splice_Site|TEN1-CDK3_ENST00000567351.1_RNA			Q00526	CDK3_HUMAN	cyclin-dependent kinase 3						cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			central_nervous_system(1)	1						CTCCCTGTCAGACTGCTGGAC	0.562													ENSG00000250506																																					0													121.0	100.0	107.0					17																	73998102		2203	4300	6503	SO:0001630	splice_region_variant	0			-	X66357	CCDS11736.1	17q25.1	2012-09-20			ENSG00000250506	ENSG00000250506		"""Cyclin-dependent kinases"""	1772	protein-coding gene	gene with protein product		123828				1639063	Standard	NM_001258		Approved		uc010dgt.3	Q00526	OTTHUMG00000154861	ENST00000425876.2:c.195-1G>A	17.37:g.73998102G>A				Splice_Site	SNP	-	e3-1	ENST00000425876.2	37	c.195-1	CCDS11736.1	17	.	.	.	.	.	.	.	.	.	.	G	9.536	1.112093	0.20795	.	.	ENSG00000250506	ENST00000448471;ENST00000425876	.	.	.	5.02	3.98	0.46160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9687	0.64225	0.0:0.1524:0.8476:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDK3	71509697	1.000000	0.71417	0.995000	0.50966	0.003000	0.03518	6.630000	0.74272	2.326000	0.78906	0.655000	0.94253	.	-	CDK3	-	-		0.562	CDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK3	HGNC	protein_coding	OTTHUMT00000337389.2	0	0	0	89	89	87	0.00	0.00	G	NM_001258	Intron	73998102	+1	22	16	68	120	tier1	no_errors	ENST00000425876	ensembl	human	known	74_37	splice_site	24.44	11.68	SNP	1.000	A	22	68
KIAA1549	57670	genome.wustl.edu	37	7	138602589	138602589	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr7:138602589C>A	ENST00000422774.1	-	2	1831	c.1783G>T	c.(1783-1785)Gtt>Ttt	p.V595F	KIAA1549_ENST00000242365.4_Missense_Mutation_p.V545F|KIAA1549_ENST00000440172.1_Missense_Mutation_p.V595F			Q9HCM3	K1549_HUMAN	KIAA1549	595	Ser-rich.					integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						ACTGAAGGAACCAGACTATAA	0.453			O	BRAF	pilocytic astrocytoma								ENSG00000122778																									NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													62.0	64.0	63.0					7																	138602589		1928	4133	6061	SO:0001583	missense	0			-		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1783G>T	7.37:g.138602589C>A	ENSP00000416040:p.Val595Phe		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NULL	p.V595F	ENST00000422774.1	37	c.1783	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	C	9.418	1.082249	0.20309	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.24723	1.84;1.84;1.84	3.97	2.13	0.27403	.	1.928470	0.02814	N	0.124655	T	0.20495	0.0493	N	0.19112	0.55	0.09310	N	1	P;P	0.39157	0.531;0.662	B;B	0.36845	0.118;0.234	T	0.35251	-0.9796	10	0.48119	T	0.1	.	10.3245	0.43785	0.0:0.6127:0.3873:0.0	.	595;595	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	F	595;545;595	ENSP00000406661:V595F;ENSP00000242365:V545F;ENSP00000416040:V595F	ENSP00000242365:V545F	V	-	1	0	KIAA1549	138253129	0.001000	0.12720	0.001000	0.08648	0.104000	0.19210	1.212000	0.32394	0.350000	0.24002	-0.189000	0.12847	GTT	-	KIAA1549	-	NULL		0.453	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	0	0	0	26	26	134	0.00	0.00	C			138602589	-1	9	46	4	57	tier1	no_errors	ENST00000422774	ensembl	human	known	74_37	missense	69.23	44.66	SNP	0.001	A	9	4
C17orf47	284083	genome.wustl.edu	37	17	56620335	56620335	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:56620335C>T	ENST00000321691.3	-	1	1394	c.1213G>A	c.(1213-1215)Gaa>Aaa	p.E405K	RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000457347.2_5'Flank|SEPT4_ENST00000412945.3_5'Flank	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	405										NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGTTCCAGTTCTGCATGGATG	0.517													ENSG00000181013																																					0													147.0	138.0	141.0					17																	56620335		2203	4300	6503	SO:0001583	missense	0			-		CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.1213G>A	17.37:g.56620335C>T	ENSP00000354874:p.Glu405Lys		Q8N821	Missense_Mutation	SNP	NULL	p.E405K	ENST00000321691.3	37	c.1213	CCDS32691.1	17	.	.	.	.	.	.	.	.	.	.	C	16.48	3.134921	0.56828	.	.	ENSG00000181013	ENST00000321691	T	0.41758	0.99	5.27	4.31	0.51392	.	0.088281	0.49305	D	0.000159	T	0.32194	0.0821	L	0.32530	0.975	0.09310	N	0.999998	P	0.40731	0.728	B	0.39904	0.313	T	0.21759	-1.0236	10	0.59425	D	0.04	-6.9559	9.6337	0.39795	0.0:0.9065:0.0:0.0935	.	405	Q8NEP4	CQ047_HUMAN	K	405	ENSP00000354874:E405K	ENSP00000354874:E405K	E	-	1	0	C17orf47	53975334	0.797000	0.28877	0.241000	0.24154	0.408000	0.30992	2.394000	0.44450	1.460000	0.47911	0.561000	0.74099	GAA	-	C17orf47	-	NULL		0.517	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf47	HGNC	protein_coding	OTTHUMT00000445443.1	0	0	0	67	67	116	0.00	0.00	C	NM_001038704		56620335	-1	18	23	84	160	tier1	no_errors	ENST00000321691	ensembl	human	known	74_37	missense	17.65	12.43	SNP	0.353	T	18	84
MCF2	4168	genome.wustl.edu	37	X	138701798	138701798	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chrX:138701798G>A	ENST00000370576.4	-	7	964	c.755C>T	c.(754-756)gCt>gTt	p.A252V	MCF2_ENST00000370573.4_Missense_Mutation_p.A252V|MCF2_ENST00000370578.4_Missense_Mutation_p.A397V|MCF2_ENST00000536274.1_Missense_Mutation_p.A213V|MCF2_ENST00000338585.6_Missense_Mutation_p.A252V|MCF2_ENST00000520602.1_Missense_Mutation_p.A312V|MCF2_ENST00000414978.1_Missense_Mutation_p.A312V|MCF2_ENST00000519895.1_Missense_Mutation_p.A312V	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	252					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TTTTACTTGAGCTATAGTCCC	0.289													ENSG00000101977																																					0													33.0	31.0	32.0					X																	138701798		2202	4281	6483	SO:0001583	missense	0			-		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.755C>T	X.37:g.138701798G>A	ENSP00000359608:p.Ala252Val		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.A397V	ENST00000370576.4	37	c.1190	CCDS14667.1	X	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722197	0.30503	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.2	1.3	0.21679	.	0.348665	0.33553	N	0.004785	T	0.37865	0.1019	L	0.59436	1.845	0.09310	N	1	B;B;B;B;B;B;B;B	0.26809	0.013;0.018;0.009;0.015;0.05;0.015;0.031;0.16	B;B;B;B;B;B;B;B	0.31290	0.08;0.008;0.127;0.059;0.081;0.06;0.043;0.08	T	0.25502	-1.0130	10	0.36615	T	0.2	.	2.9672	0.05911	0.1692:0.1462:0.5445:0.1401	.	312;397;213;252;252;397;252;252	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	V	312;252;213;397;312;312;252;252	ENSP00000427745:A312V;ENSP00000359608:A252V;ENSP00000438155:A213V;ENSP00000359610:A397V;ENSP00000397055:A312V;ENSP00000430276:A312V;ENSP00000359605:A252V;ENSP00000342204:A252V	ENSP00000342204:A252V	A	-	2	0	MCF2	138529464	0.064000	0.20934	0.004000	0.12327	0.892000	0.51952	1.344000	0.33941	0.140000	0.18849	0.600000	0.82982	GCT	-	MCF2	-	smart_Spectrin/alpha-actinin		0.289	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MCF2	HGNC	protein_coding	OTTHUMT00000058560.1	0	0	0	57	57	78	0.00	0.00	G	NM_005369		138701798	-1	25	16	69	95	tier1	no_errors	ENST00000370578	ensembl	human	known	74_37	missense	26.60	14.41	SNP	0.001	A	25	69
ADORA2A	135	genome.wustl.edu	37	22	24836570	24836570	+	Missense_Mutation	SNP	G	G	C	rs200688325		TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr22:24836570G>C	ENST00000337539.7	+	3	811	c.352G>C	c.(352-354)Ggc>Cgc	p.G118R	ADORA2A-AS1_ENST00000326341.4_RNA|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|ADORA2A-AS1_ENST00000427813.2_RNA|ADORA2A_ENST00000496497.1_3'UTR|ADORA2A-AS1_ENST00000543438.1_RNA	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	118					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	CTTGGTGACCGGCACGAGGGC	0.572													ENSG00000128271																																					0													116.0	108.0	111.0					22																	24836570		2203	4300	6503	SO:0001583	missense	0			-	X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.352G>C	22.37:g.24836570G>C	ENSP00000336630:p.Gly118Arg		B2R7E0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adeno_A2A_rcpt,prints_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.G118R	ENST00000337539.7	37	c.352	CCDS13826.1	22	.	.	.	.	.	.	.	.	.	.	G	10.43	1.349218	0.24426	.	.	ENSG00000128271	ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596	T;T	0.70869	-0.52;-0.52	4.97	1.53	0.23141	GPCR, rhodopsin-like superfamily (1);	0.221015	0.47093	D	0.000243	T	0.65873	0.2733	L	0.28458	0.855	0.33102	D	0.539326	D	0.69078	0.997	D	0.72075	0.976	T	0.66031	-0.6024	10	0.09338	T	0.73	-14.0874	4.7794	0.13195	0.1562:0.0:0.5412:0.3026	.	118	P29274	AA2AR_HUMAN	R	118	ENSP00000414802:G118R;ENSP00000336630:G118R	ENSP00000336630:G118R	G	+	1	0	ADORA2A	23166570	0.998000	0.40836	0.015000	0.15790	0.937000	0.57800	2.716000	0.47219	0.538000	0.28769	0.563000	0.77884	GGC	-	ADORA2A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.572	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A	HGNC	protein_coding	OTTHUMT00000319971.2	0	0	0	86	86	67	0.00	0.00	G	NM_000675		24836570	+1	27	29	66	47	tier1	no_errors	ENST00000337539	ensembl	human	known	74_37	missense	29.03	38.16	SNP	0.298	C	27	66
ANKRD36BP2	645784	genome.wustl.edu	37	2	89104342	89104342	+	RNA	SNP	A	A	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr2:89104342A>C	ENST00000393525.3	+	0	4816									ankyrin repeat domain 36B pseudogene 2																		ACTATTAAAAAACAGGATGAC	0.294													ENSG00000230006																																					0																																												0			-			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89104342A>C				R	SNP	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			-	ANKRD36BP2	-	-		0.294	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1	0	0	0	77	77	26	0.00	0.00	A			89104342	+1	49	11	113	17	tier1	no_errors	ENST00000393515	ensembl	human	known	74_37	rna	30.25	39.29	SNP	0.011	C	49	113
RYR2	6262	genome.wustl.edu	37	1	237806668	237806668	+	Silent	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr1:237806668C>T	ENST00000366574.2	+	48	7580	c.7263C>T	c.(7261-7263)tcC>tcT	p.S2421S	RYR2_ENST00000542537.1_Silent_p.S2405S|RYR2_ENST00000360064.6_Silent_p.S2419S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2421	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAATTAGGTCCATTTTGAGAT	0.418													ENSG00000198626																																					0													211.0	199.0	203.0					1																	237806668		1885	4102	5987	SO:0001819	synonymous_variant	0			-	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7263C>T	1.37:g.237806668C>T			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.S2419	ENST00000366574.2	37	c.7257	CCDS55691.1	1																																																																																			-	RYR2	-	NULL		0.418	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	0	0	0	59	59	109	0.00	0.00	C	NM_001035		237806668	+1	21	24	32	36	tier1	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	39.62	40.00	SNP	0.943	T	21	32
OR5T2	219464	genome.wustl.edu	37	11	55999957	55999957	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr11:55999957C>A	ENST00000313264.4	-	1	780	c.705G>T	c.(703-705)caG>caT	p.Q235H		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q235H(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					AGAGTAGAAGCTGGTTTGTGT	0.423													ENSG00000181718																																					1	Substitution - Missense(1)	lung(1)											128.0	120.0	123.0					11																	55999957		2201	4296	6497	SO:0001583	missense	0			-	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.705G>T	11.37:g.55999957C>A	ENSP00000323688:p.Gln235His		B9EGX5|Q6IFC8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q235H	ENST00000313264.4	37	c.705	CCDS31523.1	11	.	.	.	.	.	.	.	.	.	.	C	5.780	0.328336	0.10956	.	.	ENSG00000181718	ENST00000313264	T	0.00158	8.65	4.55	-1.74	0.08056	GPCR, rhodopsin-like superfamily (1);	0.396182	0.17807	N	0.161333	T	0.00210	0.0006	L	0.52823	1.66	0.09310	N	1	B	0.31383	0.321	B	0.43728	0.429	T	0.28073	-1.0055	10	0.72032	D	0.01	.	6.2392	0.20780	0.0:0.4398:0.1289:0.4314	.	235	Q8NGG2	OR5T2_HUMAN	H	235	ENSP00000323688:Q235H	ENSP00000323688:Q235H	Q	-	3	2	OR5T2	55756533	0.000000	0.05858	0.250000	0.24296	0.034000	0.12701	-0.878000	0.04192	-0.191000	0.10448	-0.357000	0.07601	CAG	-	OR5T2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.423	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	HGNC	protein_coding	OTTHUMT00000391598.1	0	0	0	76	76	22	0.00	0.00	C	NM_001004746		55999957	-1	40	14	70	26	tier1	no_errors	ENST00000313264	ensembl	human	known	74_37	missense	36.36	35.00	SNP	0.001	A	40	70
ARHGAP32	9743	genome.wustl.edu	37	11	128844161	128844161	+	Missense_Mutation	SNP	C	C	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr11:128844161C>G	ENST00000310343.9	-	20	2888	c.2889G>C	c.(2887-2889)gaG>gaC	p.E963D	ARHGAP32_ENST00000527272.1_Missense_Mutation_p.E614D|ARHGAP32_ENST00000524655.1_Missense_Mutation_p.E889D|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.E614D	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	963					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						GGGCAACTGTCTCATTTGTTT	0.468													ENSG00000134909																																					0													224.0	230.0	228.0					11																	128844161		2201	4297	6498	SO:0001583	missense	0			-	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.2889G>C	11.37:g.128844161C>G	ENSP00000310561:p.Glu963Asp		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E963D	ENST00000310343.9	37	c.2889	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	C	10.62	1.400613	0.25291	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272	T;T;T;T	0.20738	2.05;2.05;2.05;2.05	5.61	3.59	0.41128	.	0.295243	0.36482	N	0.002561	T	0.14141	0.0342	L	0.33485	1.01	0.23823	N	0.996743	B;B	0.15473	0.0;0.013	B;B	0.13407	0.001;0.009	T	0.17501	-1.0367	10	0.24483	T	0.36	.	8.306	0.32042	0.0:0.4695:0.4444:0.0862	.	897;963	Q86T64;A7KAX9	.;RHG32_HUMAN	D	963;614;889;897;614	ENSP00000310561:E963D;ENSP00000376425:E614D;ENSP00000432468:E889D;ENSP00000432862:E614D	ENSP00000310561:E963D	E	-	3	2	ARHGAP32	128349371	0.992000	0.36948	1.000000	0.80357	0.981000	0.71138	0.314000	0.19432	1.473000	0.48159	0.655000	0.94253	GAG	-	ARHGAP32	-	NULL		0.468	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	0	0	0	35	35	89	0.00	0.00	C	NM_014715		128844161	-1	14	29	15	36	tier1	no_errors	ENST00000310343	ensembl	human	known	74_37	missense	48.28	44.62	SNP	0.996	G	14	15
SPHKAP	80309	genome.wustl.edu	37	2	228883262	228883262	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr2:228883262T>C	ENST00000392056.3	-	7	2354	c.2308A>G	c.(2308-2310)Agc>Ggc	p.S770G	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S770G	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	770						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGAGAGCTGCTGGAGGATTCA	0.498													ENSG00000153820																																					0													193.0	193.0	193.0					2																	228883262		2203	4300	6503	SO:0001583	missense	0			-		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2308A>G	2.37:g.228883262T>C	ENSP00000375909:p.Ser770Gly		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.S770G	ENST00000392056.3	37	c.2308	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	T	3.955	-0.011527	0.07727	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.13307	2.6;2.6	5.67	0.452	0.16634	.	0.538057	0.22248	N	0.062585	T	0.11537	0.0281	L	0.55481	1.735	0.09310	N	1	B;B	0.33171	0.006;0.4	B;B	0.33960	0.004;0.173	T	0.15983	-1.0418	10	0.42905	T	0.14	.	5.1039	0.14773	0.1265:0.3007:0.0:0.5728	.	770;770	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	G	770	ENSP00000375909:S770G;ENSP00000339886:S770G	ENSP00000339886:S770G	S	-	1	0	SPHKAP	228591506	0.194000	0.23325	0.001000	0.08648	0.122000	0.20287	0.385000	0.20685	-0.080000	0.12685	0.533000	0.62120	AGC	-	SPHKAP	-	NULL		0.498	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	0	0	1	51	51	95	0.00	1.04	T	NM_030623		228883262	-1	13	32	41	47	tier1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	24.07	40.51	SNP	0.011	C	13	41
STOML1	9399	genome.wustl.edu	37	15	74280989	74280989	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr15:74280989G>A	ENST00000316900.5	-	4	669	c.545C>T	c.(544-546)cCg>cTg	p.P182L	STOML1_ENST00000564777.1_Missense_Mutation_p.P132L|STOML1_ENST00000359750.4_Missense_Mutation_p.P182L|STOML1_ENST00000541638.1_Missense_Mutation_p.P140L|STOML1_ENST00000316911.6_Missense_Mutation_p.P132L|STOML1_ENST00000561656.1_Missense_Mutation_p.P95L	NM_001256672.1|NM_001256675.1|NM_001256677.1|NM_004809.4	NP_001243601.1|NP_001243604.1|NP_001243606.1|NP_004800.2	Q9UBI4	STML1_HUMAN	stomatin (EPB72)-like 1	182						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CTCCCGCAGCGGCCTCTTGAG	0.612													ENSG00000067221																																					0													89.0	80.0	83.0					15																	74280989		2198	4297	6495	SO:0001583	missense	0			-	Y16522	CCDS10254.1, CCDS58381.1, CCDS58382.1, CCDS58383.1, CCDS58384.1, CCDS58385.1	15q24-q25	2008-07-18			ENSG00000067221	ENSG00000067221			14560	protein-coding gene	gene with protein product	"""stomatin-like 1"", ""stomatin (EBP72)-like 1"""	608326				9931417	Standard	NM_004809		Approved	hUNC-24, SLP-1, STORP, FLJ36370	uc002awe.4	Q9UBI4	OTTHUMG00000137608	ENST00000316900.5:c.545C>T	15.37:g.74280989G>A	ENSP00000319323:p.Pro182Leu		B3KQN0|B4DUU5|B4DXM9|E7ESC0|H3BRP3|O95675|Q4PNR4|Q6FGL8|Q8WYI7|Q9UMB9|Q9UMC0|Q9Y6H9	Missense_Mutation	SNP	pfam_Band_7,pfam_SCP2_sterol-bd_dom,superfamily_SCP2_sterol-bd_dom,smart_Band_7,prints_Stomatin	p.P182L	ENST00000316900.5	37	c.545	CCDS10254.1	15	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121692	0.37436	.	.	ENSG00000067221	ENST00000316900;ENST00000316911;ENST00000541638;ENST00000359750	D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51	4.34	2.29	0.28610	.	0.523497	0.20612	N	0.088956	T	0.81936	0.4928	N	0.11064	0.09	0.32344	N	0.559364	B;P;B;P;B;B	0.46020	0.001;0.871;0.001;0.871;0.001;0.386	B;B;B;B;B;B	0.37047	0.003;0.24;0.001;0.24;0.001;0.087	T	0.80725	-0.1254	10	0.23891	T	0.37	-14.0097	2.3608	0.04307	0.1028:0.1474:0.4546:0.2951	.	140;182;132;182;182;182	B4DUU5;E7ESC0;Q9UBI4-2;Q4PNR4;Q53HB6;Q9UBI4	.;.;.;.;.;STML1_HUMAN	L	182;132;140;182	ENSP00000319323:P182L;ENSP00000319384:P132L;ENSP00000442478:P140L;ENSP00000352788:P182L	ENSP00000319323:P182L	P	-	2	0	STOML1	72068042	0.978000	0.34361	0.859000	0.33776	0.983000	0.72400	1.776000	0.38594	1.052000	0.40392	-0.137000	0.14449	CCG	-	STOML1	-	pfam_Band_7,smart_Band_7,prints_Stomatin		0.612	STOML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOML1	HGNC	protein_coding	OTTHUMT00000269022.1	0	0	0	66	66	53	0.00	0.00	G	NM_004809		74280989	-1	13	14	34	31	tier1	no_errors	ENST00000316900	ensembl	human	known	74_37	missense	27.66	31.11	SNP	0.328	A	13	34
ANO4	121601	genome.wustl.edu	37	12	101433740	101433740	+	Missense_Mutation	SNP	A	A	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr12:101433740A>T	ENST00000392977.3	+	11	1115	c.905A>T	c.(904-906)tAt>tTt	p.Y302F	RP11-350G24.1_ENST00000549036.1_RNA|ANO4_ENST00000392979.3_Missense_Mutation_p.Y267F|ANO4_ENST00000299222.9_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4	302					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CAGGGAAGTTATAGAAGTAAA	0.453										HNSCC(74;0.22)			ENSG00000151572																																					0													90.0	94.0	93.0					12																	101433740		2203	4300	6503	SO:0001583	missense	0			-	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.905A>T	12.37:g.101433740A>T	ENSP00000376703:p.Tyr302Phe		Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	pfam_Anoctamin	p.Y302F	ENST00000392977.3	37	c.905		12	.	.	.	.	.	.	.	.	.	.	A	20.4	3.979297	0.74360	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.64803	-0.12;-0.12	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000001	T	0.61949	0.2388	L	0.41027	1.25	0.80722	D	1	P;P	0.48230	0.907;0.835	P;P	0.48654	0.585;0.571	T	0.60352	-0.7280	10	0.33940	T	0.23	.	16.087	0.81065	1.0:0.0:0.0:0.0	.	302;267	Q32M45;Q32M45-2	ANO4_HUMAN;.	F	267;302	ENSP00000376705:Y267F;ENSP00000376703:Y302F	ENSP00000376703:Y302F	Y	+	2	0	ANO4	99957871	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.339000	0.96797	2.202000	0.70862	0.533000	0.62120	TAT	-	ANO4	-	NULL		0.453	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	0	0	0	34	34	98	0.00	0.00	A	NM_178826		101433740	+1	9	38	25	73	tier1	no_errors	ENST00000392977	ensembl	human	known	74_37	missense	26.47	33.93	SNP	1.000	T	9	25
ARID1B	57492	genome.wustl.edu	37	6	157256633	157256633	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr6:157256633C>T	ENST00000350026.5	+	4	1922	c.1921C>T	c.(1921-1923)Caa>Taa	p.Q641*	ARID1B_ENST00000367148.1_Nonsense_Mutation_p.Q641*|ARID1B_ENST00000275248.4_Nonsense_Mutation_p.Q583*|ARID1B_ENST00000346085.5_Nonsense_Mutation_p.Q654*	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	641					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AACTAGATCTCAACCTCCTCT	0.378													ENSG00000049618																																					0													168.0	158.0	161.0					6																	157256633		2203	4300	6503	SO:0001587	stop_gained	0			-	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.1921C>T	6.37:g.157256633C>T	ENSP00000055163:p.Gln641*		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_D-bd,superfamily_ARID/BRIGHT_D-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_D-bd,pfscan_ARID/BRIGHT_D-bd	p.Q641*	ENST00000350026.5	37	c.1921	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	C	39	7.659641	0.98415	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000535255;ENST00000414678;ENST00000319584	.	.	.	5.71	5.71	0.89125	.	0.106387	0.37715	N	0.001971	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	19.8604	0.96781	0.0:1.0:0.0:0.0	.	.	.	.	X	654;641;641;583;62;11;140;63	.	ENSP00000275248:Q583X	Q	+	1	0	ARID1B	157298325	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.989000	0.70587	2.699000	0.92147	0.650000	0.86243	CAA	-	ARID1B	-	NULL		0.378	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	0	0	0	59	59	130	0.00	0.00	C	NM_020732		157256633	+1	55	78	34	55	tier1	no_errors	ENST00000367148	ensembl	human	known	74_37	nonsense	61.80	58.65	SNP	1.000	T	55	34
RANBP3	8498	genome.wustl.edu	37	19	5918597	5918597	+	Silent	SNP	G	G	C	rs377714973		TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr19:5918597G>C	ENST00000340578.6	-	15	1440	c.1383C>G	c.(1381-1383)gcC>gcG	p.A461A	RANBP3_ENST00000541471.1_Silent_p.A333A|RANBP3_ENST00000439268.2_Silent_p.A456A|RANBP3_ENST00000591092.1_Silent_p.A388A|RANBP3_ENST00000034275.8_Silent_p.A393A	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	461	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						TCTGCATCTGGGCCCACAGCT	0.627													ENSG00000031823																																					0								G	,,	0,4290		0,0,2145	136.0	154.0	148.0		1368,1179,1383	-10.0	0.4	19		148	1,8493		0,1,4246	no	coding-synonymous,coding-synonymous,coding-synonymous	RANBP3	NM_003624.2,NM_007320.2,NM_007322.2	,,	0,1,6391	CC,CG,GG		0.0118,0.0,0.0078	,,	456/563,393/500,461/568	5918597	1,12783	2145	4247	6392	SO:0001819	synonymous_variant	0			-	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1383C>G	19.37:g.5918597G>C			B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.A461	ENST00000340578.6	37	c.1383	CCDS42478.1	19																																																																																			-	RANBP3	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom		0.627	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	0	0	0	61	61	35	0.00	0.00	G	NM_007322		5918597	-1	27	27	40	56	tier1	no_errors	ENST00000340578	ensembl	human	known	74_37	silent	40.30	32.53	SNP	0.010	C	27	40
PAPPA	5069	genome.wustl.edu	37	9	119124887	119124887	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr9:119124887T>C	ENST00000328252.3	+	18	4733	c.4364T>C	c.(4363-4365)gTc>gCc	p.V1455A	PAPPA_ENST00000534838.1_Missense_Mutation_p.V493A	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1455	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GGGAGCAATGTCATTCATTGC	0.488													ENSG00000182752																																					0													119.0	111.0	114.0					9																	119124887		2203	4300	6503	SO:0001583	missense	0			-		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4364T>C	9.37:g.119124887T>C	ENSP00000330658:p.Val1455Ala		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.V1455A	ENST00000328252.3	37	c.4364	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	T	3.282	-0.146852	0.06627	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.65916	-0.18;-0.18	5.39	2.93	0.34026	Complement control module (2);Sushi/SCR/CCP (3);	0.660771	0.15481	N	0.260091	T	0.50735	0.1633	L	0.59436	1.845	0.09310	N	1	B;B	0.16603	0.001;0.018	B;B	0.19148	0.005;0.024	T	0.40459	-0.9562	10	0.07030	T	0.85	-3.6176	7.6237	0.28200	0.1257:0.0696:0.0:0.8047	.	493;1455	F5GZ19;Q13219	.;PAPP1_HUMAN	A	1455;493	ENSP00000330658:V1455A;ENSP00000441461:V493A	ENSP00000330658:V1455A	V	+	2	0	PAPPA	118164708	0.843000	0.29541	0.517000	0.27799	0.019000	0.09904	1.779000	0.38624	0.304000	0.22809	-0.336000	0.08194	GTC	-	PAPPA	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.488	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	0	0	0	26	26	98	0.00	0.00	T	NM_002581		119124887	+1	27	66	29	72	tier1	no_errors	ENST00000328252	ensembl	human	known	74_37	missense	48.21	47.83	SNP	0.174	C	27	29
C17orf47	284083	genome.wustl.edu	37	17	56620182	56620182	+	Missense_Mutation	SNP	C	C	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:56620182C>G	ENST00000321691.3	-	1	1547	c.1366G>C	c.(1366-1368)Gat>Cat	p.D456H	RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000457347.2_5'Flank|SEPT4_ENST00000412945.3_5'Flank	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	456										NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AATAAAAGATCTAGGGAAGGA	0.478													ENSG00000181013																																					0													144.0	158.0	153.0					17																	56620182		2203	4300	6503	SO:0001583	missense	0			-		CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.1366G>C	17.37:g.56620182C>G	ENSP00000354874:p.Asp456His		Q8N821	Missense_Mutation	SNP	NULL	p.D456H	ENST00000321691.3	37	c.1366	CCDS32691.1	17	.	.	.	.	.	.	.	.	.	.	C	9.385	1.074003	0.20147	.	.	ENSG00000181013	ENST00000321691	T	0.59906	0.23	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000004	T	0.66886	0.2835	L	0.34521	1.04	0.30265	N	0.792821	D	0.89917	1.0	D	0.97110	1.0	T	0.67011	-0.5778	10	0.62326	D	0.03	-16.7723	15.1489	0.72681	0.0:1.0:0.0:0.0	.	456	Q8NEP4	CQ047_HUMAN	H	456	ENSP00000354874:D456H	ENSP00000354874:D456H	D	-	1	0	C17orf47	53975181	0.746000	0.28272	0.179000	0.23059	0.028000	0.11728	2.329000	0.43876	2.637000	0.89404	0.561000	0.74099	GAT	-	C17orf47	-	NULL		0.478	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf47	HGNC	protein_coding	OTTHUMT00000445443.1	0	0	0	52	52	95	0.00	0.00	C	NM_001038704		56620182	-1	9	34	43	110	tier1	no_errors	ENST00000321691	ensembl	human	known	74_37	missense	17.31	23.61	SNP	0.528	G	9	43
ODAM	54959	genome.wustl.edu	37	4	71063870	71063870	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr4:71063870G>T	ENST00000396094.2	+	4	419	c.371G>T	c.(370-372)aGt>aTt	p.S124I		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	124	Gln-rich.				biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						CCAGGCCCCAGTCACGTAAGT	0.478													ENSG00000109205																																					0													71.0	73.0	73.0					4																	71063870		1902	4116	6018	SO:0001583	missense	0			-	AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.371G>T	4.37:g.71063870G>T	ENSP00000379401:p.Ser124Ile		Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	NULL	p.S124I	ENST00000396094.2	37	c.371	CCDS3536.2	4	.	.	.	.	.	.	.	.	.	.	G	1.954	-0.440458	0.04636	.	.	ENSG00000109205	ENST00000396094;ENST00000510709;ENST00000514097	T;T	0.45276	0.9;0.9	4.99	0.969	0.19686	.	.	.	.	.	T	0.28001	0.0690	N	0.22421	0.69	0.09310	N	1	B	0.19445	0.036	B	0.24155	0.051	T	0.26189	-1.0110	9	0.56958	D	0.05	.	7.1781	0.25757	0.7304:0.0:0.2696:0.0	.	124	A1E959	ODAM_HUMAN	I	124;110;77	ENSP00000379401:S124I;ENSP00000426106:S77I	ENSP00000379401:S124I	S	+	2	0	ODAM	71098459	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	1.141000	0.31528	0.037000	0.15575	-1.456000	0.01031	AGT	-	ODAM	-	NULL		0.478	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODAM	HGNC	protein_coding	OTTHUMT00000251562.1	0	0	0	18	18	108	0.00	0.00	G	NM_017855		71063870	+1	8	33	38	84	tier1	no_errors	ENST00000396094	ensembl	human	known	74_37	missense	17.39	28.21	SNP	0.001	T	8	38
DNAJA4	55466	genome.wustl.edu	37	15	78565508	78565508	+	Missense_Mutation	SNP	C	C	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr15:78565508C>G	ENST00000394852.3	+	3	575	c.385C>G	c.(385-387)Ctc>Gtc	p.L129V	DNAJA4_ENST00000394855.3_Missense_Mutation_p.L158V|DNAJA4_ENST00000343789.3_Missense_Mutation_p.L129V|DNAJA4_ENST00000446172.2_Missense_Mutation_p.L102V	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	129					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						GAAATTGGCCCTCCAGAAAAA	0.353													ENSG00000140403																																					0													81.0	85.0	84.0					15																	78565508		2196	4293	6489	SO:0001583	missense	0			-	AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.385C>G	15.37:g.78565508C>G	ENSP00000378321:p.Leu129Val		E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_DnaJ_C,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_domain,pfscan_DnaJ_domain,pfscan_HSP_DnaJ_Cys-rich_dom,prints_DnaJ_domain	p.L158V	ENST00000394852.3	37	c.472	CCDS45316.1	15	.	.	.	.	.	.	.	.	.	.	C	11.44	1.638330	0.29157	.	.	ENSG00000140403	ENST00000394855;ENST00000343789;ENST00000394852;ENST00000446172	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.47	3.6	0.41247	HSP40/DnaJ peptide-binding (1);Heat shock protein DnaJ, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.32255	0.0823	L	0.33792	1.035	0.80722	D	1	B;B;B;B	0.28350	0.114;0.132;0.132;0.208	B;B;B;B	0.29862	0.032;0.05;0.05;0.108	T	0.07424	-1.0773	10	0.40728	T	0.16	-5.3136	11.2558	0.49052	0.0:0.8529:0.0:0.1471	.	44;102;129;158	Q9P1H1;E9PDM9;Q8WW22;Q8WW22-2	.;.;DNJA4_HUMAN;.	V	158;129;129;102	ENSP00000378324:L158V;ENSP00000339581:L129V;ENSP00000378321:L129V;ENSP00000413499:L102V	ENSP00000339581:L129V	L	+	1	0	DNAJA4	76352563	1.000000	0.71417	0.186000	0.23195	0.406000	0.30931	5.889000	0.69766	0.690000	0.31570	-0.145000	0.13849	CTC	-	DJA4	-	pfam_HSP_DnaJ_Cys-rich_dom,superfamily_HSP40/DnaJ_pept-bd,pfscan_HSP_DnaJ_Cys-rich_dom		0.353	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DJA4	HGNC	protein_coding	OTTHUMT00000289801.1	0	0	0	34	34	92	0.00	0.00	C	NM_018602		78565508	+1	19	69	7	63	tier1	no_errors	ENST00000394855	ensembl	human	known	74_37	missense	73.08	52.27	SNP	0.995	G	19	7
ZNF423	23090	genome.wustl.edu	37	16	49670663	49670663	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr16:49670663G>C	ENST00000561648.1	-	4	2453	c.2400C>G	c.(2398-2400)atC>atG	p.I800M	ZNF423_ENST00000563137.2_Missense_Mutation_p.I740M|ZNF423_ENST00000562871.1_Missense_Mutation_p.I740M|ZNF423_ENST00000567169.1_Missense_Mutation_p.I683M|ZNF423_ENST00000562520.1_Missense_Mutation_p.I740M|ZNF423_ENST00000535559.1_Missense_Mutation_p.I683M|ZNF423_ENST00000262383.2_Missense_Mutation_p.I800M	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	800					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TGTGTGTGGTGATGTGGCACT	0.562													ENSG00000102935																																					0													192.0	185.0	187.0					16																	49670663		2198	4300	6498	SO:0001583	missense	0			-	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2400C>G	16.37:g.49670663G>C	ENSP00000455426:p.Ile800Met		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I800M	ENST00000561648.1	37	c.2400	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	G	12.52	1.961305	0.34565	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.27557	1.66;1.66	4.81	2.81	0.32909	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.099676	0.64402	D	0.000002	T	0.28433	0.0703	N	0.04508	-0.205	0.41392	D	0.987627	D	0.89917	1.0	D	0.91635	0.999	T	0.10177	-1.0641	9	.	.	.	-28.6831	11.0264	0.47746	0.1541:0.0:0.8459:0.0	.	800	Q2M1K9	ZN423_HUMAN	M	800;683	ENSP00000262383:I800M;ENSP00000442321:I683M	.	I	-	3	3	ZNF423	48228164	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.958000	0.56737	1.036000	0.39998	0.561000	0.74099	ATC	-	ZNF423	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.562	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	0	0	0	53	53	50	0.00	0.00	G	NM_015069		49670663	-1	9	25	38	95	tier1	no_errors	ENST00000262383	ensembl	human	known	74_37	missense	19.15	20.83	SNP	1.000	C	9	38
KLHL1	57626	genome.wustl.edu	37	13	70371041	70371041	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr13:70371041C>T	ENST00000377844.4	-	7	2227	c.1468G>A	c.(1468-1470)Ggg>Agg	p.G490R	KLHL1_ENST00000545028.1_Missense_Mutation_p.G297R	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	490					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TTCATCATCCCTGCCTGGATC	0.383													ENSG00000150361																																					0													192.0	174.0	180.0					13																	70371041		2203	4300	6503	SO:0001583	missense	0			-	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1468G>A	13.37:g.70371041C>T	ENSP00000367075:p.Gly490Arg		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.G490R	ENST00000377844.4	37	c.1468	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491401	0.84962	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.77620	-1.11;-1.11	5.31	5.31	0.75309	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	D	0.000005	D	0.84179	0.5415	L	0.53729	1.69	0.46521	D	0.999083	D;D	0.67145	0.996;0.969	D;P	0.73380	0.98;0.806	D	0.84602	0.0673	10	0.59425	D	0.04	.	12.6628	0.56824	0.0:0.9241:0.0:0.0759	.	490;490	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	R	490;297	ENSP00000367075:G490R;ENSP00000439602:G297R	ENSP00000367075:G490R	G	-	1	0	KLHL1	69269042	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.051000	0.71072	2.639000	0.89480	0.655000	0.94253	GGG	-	KLHL1	-	pfam_Kelch_1,smart_Kelch_1		0.383	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	0	0	0	53	53	74	0.00	0.00	C	NM_020866		70371041	-1	27	20	129	120	tier1	no_errors	ENST00000377844	ensembl	human	known	74_37	missense	17.20	14.18	SNP	1.000	T	27	129
ALOX5	240	genome.wustl.edu	37	10	45939225	45939225	+	Silent	SNP	C	C	A	rs375279868		TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr10:45939225C>A	ENST00000374391.2	+	12	1676	c.1623C>A	c.(1621-1623)acC>acA	p.T541T	ALOX5_ENST00000542434.1_Silent_p.T541T|RP11-67C2.2_ENST00000435635.1_RNA	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	541	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	AGTACCTGACCGTGGTGATCT	0.701													ENSG00000012779																																					0													39.0	38.0	39.0					10																	45939225		2202	4300	6502	SO:0001819	synonymous_variant	0			-	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1623C>A	10.37:g.45939225C>A			B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Silent	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C,pfscan_PLAT/LH2_dom	p.T541	ENST00000374391.2	37	c.1623	CCDS7212.1	10																																																																																			-	ALOX5	-	pfam_LipOase_C,superfamily_LipOase_C		0.701	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	HGNC	protein_coding	OTTHUMT00000047780.1	0	0	0	75	75	31	0.00	0.00	C			45939225	+1	24	9	32	16	tier1	no_errors	ENST00000374391	ensembl	human	known	74_37	silent	42.86	36.00	SNP	0.000	A	24	32
PPP1R3A	5506	genome.wustl.edu	37	7	113518694	113518694	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr7:113518694T>C	ENST00000284601.3	-	4	2521	c.2453A>G	c.(2452-2454)gAg>gGg	p.E818G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	818					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTCTTCCTTCTCCATTTCATC	0.383													ENSG00000154415																																					0													149.0	126.0	134.0					7																	113518694		2203	4300	6503	SO:0001583	missense	0			-	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2453A>G	7.37:g.113518694T>C	ENSP00000284601:p.Glu818Gly		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.E818G	ENST00000284601.3	37	c.2453	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	T	8.649	0.897809	0.17686	.	.	ENSG00000154415	ENST00000284601	T	0.17370	2.28	5.92	0.378	0.16204	.	1.183250	0.06059	N	0.657929	T	0.16938	0.0407	L	0.60455	1.87	0.09310	N	1	P	0.38922	0.651	B	0.35240	0.198	T	0.28870	-1.0030	10	0.48119	T	0.1	-0.9331	6.0453	0.19755	0.139:0.3005:0.0:0.5606	.	818	Q16821	PPR3A_HUMAN	G	818	ENSP00000284601:E818G	ENSP00000284601:E818G	E	-	2	0	PPP1R3A	113305930	0.704000	0.27836	0.025000	0.17156	0.589000	0.36550	1.370000	0.34238	0.138000	0.18790	0.528000	0.53228	GAG	-	PPP1R3A	-	NULL		0.383	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	0	0	0	68	68	99	0.00	0.00	T	NM_002711		113518694	-1	16	38	55	70	tier1	no_errors	ENST00000284601	ensembl	human	known	74_37	missense	22.54	35.19	SNP	0.000	C	16	55
EHBP1	23301	genome.wustl.edu	37	2	63272423	63272423	+	Intron	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr2:63272423C>T	ENST00000263991.5	+	24	4087				EHBP1_ENST00000496857.1_Intron|AC009501.4_ENST00000412297.1_RNA|AC009501.4_ENST00000437346.1_RNA|AC009501.4_ENST00000413549.1_RNA|EHBP1_ENST00000405015.3_Intron|EHBP1_ENST00000354487.3_Intron|AC009501.4_ENST00000429952.1_RNA|EHBP1_ENST00000431489.1_Intron|EHBP1_ENST00000405289.1_Intron	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1							cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			CAGCCTCCCACTGGCCTGGTG	0.632													ENSG00000231609																																					0																																										SO:0001627	intron_variant	0			-	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.3605+108C>T	2.37:g.63272423C>T			O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	R	SNP	-	NULL	ENST00000263991.5	37	NULL	CCDS1872.1	2																																																																																			-	AC009501.4	-	-		0.632	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132215	Clone_based_vega_gene	protein_coding	OTTHUMT00000251616.1	0	0	0	27	27	37	0.00	0.00	C	NM_015252		63272423	-1	19	20	16	17	tier1	no_errors	ENST00000412297	ensembl	human	known	74_37	rna	54.29	54.05	SNP	0.000	T	19	16
FAM47C	442444	genome.wustl.edu	37	X	37028953	37028953	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chrX:37028953C>A	ENST00000358047.3	+	1	2522	c.2470C>A	c.(2470-2472)Cta>Ata	p.L824I		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	824										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGCGTCCCATCTAAAAGAACT	0.532													ENSG00000198173																																					0													74.0	71.0	72.0					X																	37028953		2202	4300	6502	SO:0001583	missense	0			-	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2470C>A	X.37:g.37028953C>A	ENSP00000367913:p.Leu824Ile		Q6ZU46	Missense_Mutation	SNP	NULL	p.L824I	ENST00000358047.3	37	c.2470	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	C	9.276	1.047002	0.19748	.	.	ENSG00000198173	ENST00000358047	T	0.20881	2.04	1.01	1.01	0.19927	.	.	.	.	.	T	0.23611	0.0571	L	0.59912	1.85	0.09310	N	1	P	0.36110	0.537	B	0.44224	0.444	T	0.22347	-1.0219	9	0.25751	T	0.34	.	5.6514	0.17618	0.0:1.0:0.0:0.0	.	824	Q5HY64	FA47C_HUMAN	I	824	ENSP00000367913:L824I	ENSP00000367913:L824I	L	+	1	2	FAM47C	36938874	.	.	0.007000	0.13788	0.007000	0.05969	.	.	0.273000	0.22049	0.277000	0.19347	CTA	-	FAM47C	-	NULL		0.532	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	0	0	0	102	102	37	0.00	0.00	C	NM_001013736		37028953	+1	56	25	79	28	tier1	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	41.48	47.17	SNP	0.018	A	56	79
GNL3L	54552	genome.wustl.edu	37	X	54578772	54578772	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chrX:54578772C>A	ENST00000336470.4	+	13	1368	c.1229C>A	c.(1228-1230)cCc>cAc	p.P410H	GNL3L_ENST00000360845.2_Missense_Mutation_p.P410H	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	410					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						CACACTCTGCCCACCCATCTC	0.507													ENSG00000130119																																					0													197.0	152.0	167.0					X																	54578772		2203	4300	6503	SO:0001583	missense	0			-	AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.1229C>A	X.37:g.54578772C>A	ENSP00000338573:p.Pro410His			Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.P410H	ENST00000336470.4	37	c.1229	CCDS14360.1	X	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249445	0.39797	.	.	ENSG00000130119	ENST00000336470;ENST00000360845	T;T	0.19250	2.16;2.16	3.58	3.58	0.41010	.	0.000000	0.85682	D	0.000000	T	0.19725	0.0474	L	0.54965	1.715	0.58432	D	0.999999	P	0.37985	0.613	B	0.33620	0.167	T	0.06570	-1.0819	10	0.52906	T	0.07	-15.5782	12.1483	0.54036	0.0:1.0:0.0:0.0	.	410	Q9NVN8	GNL3L_HUMAN	H	410	ENSP00000338573:P410H;ENSP00000354091:P410H	ENSP00000338573:P410H	P	+	2	0	GNL3L	54595497	1.000000	0.71417	0.871000	0.34182	0.657000	0.38888	6.847000	0.75404	1.730000	0.51580	0.544000	0.68410	CCC	-	GNL3L	-	NULL		0.507	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	HGNC	protein_coding	OTTHUMT00000056805.1	0	0	0	58	58	71	0.00	0.00	C	NM_019067		54578772	+1	22	32	86	68	tier1	no_errors	ENST00000336470	ensembl	human	known	74_37	missense	20.37	32.00	SNP	1.000	A	22	86
PCMTD2	55251	genome.wustl.edu	37	20	62896684	62896684	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr20:62896684C>A	ENST00000308824.6	+	4	611	c.484C>A	c.(484-486)Cgt>Agt	p.R162S	PCMTD2_ENST00000299468.7_Missense_Mutation_p.R162S|PCMTD2_ENST00000369758.4_Missense_Mutation_p.R162S|PCMTD2_ENST00000609372.1_Intron	NM_018257.2	NP_060727.2	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2	162						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|upper_aerodigestive_tract(1)	17	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TCAGTATGATCGTGTATACTG	0.458													ENSG00000203880																																					0													153.0	143.0	146.0					20																	62896684		2203	4300	6503	SO:0001583	missense	0			-	AK001745	CCDS13559.1, CCDS46631.1	20q13.33	2012-10-02	2005-10-06	2005-10-06	ENSG00000203880	ENSG00000203880			15882	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 36"""	C20orf36			Standard	NM_018257		Approved	FLJ10883	uc002yil.4	Q9NV79	OTTHUMG00000033029	ENST00000308824.6:c.484C>A	20.37:g.62896684C>A	ENSP00000307854:p.Arg162Ser		E1P5H3|Q8IW60|Q9H4K2	Missense_Mutation	SNP	pfam_PCMT	p.R162S	ENST00000308824.6	37	c.484	CCDS13559.1	20	.	.	.	.	.	.	.	.	.	.	.	13.81	2.349621	0.41599	.	.	ENSG00000203880	ENST00000369758;ENST00000299468;ENST00000308824	T;T;T	0.43688	0.94;0.94;0.94	5.59	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.68357	0.2992	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74057	-0.3787	10	0.54805	T	0.06	-26.1328	14.4418	0.67323	0.0:0.9291:0.0:0.0709	.	162;162	Q9NV79-2;Q9NV79	.;PCMD2_HUMAN	S	162	ENSP00000358773:R162S;ENSP00000299468:R162S;ENSP00000307854:R162S	ENSP00000299468:R162S	R	+	1	0	PCMTD2	62367128	1.000000	0.71417	0.137000	0.22149	0.029000	0.11900	2.683000	0.46943	1.366000	0.46076	-0.142000	0.14014	CGT	-	PCMTD2	-	pfam_PCMT		0.458	PCMTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCMTD2	HGNC	protein_coding	OTTHUMT00000080301.1	0	0	0	170	170	87	0.00	0.00	C	NM_018257		62896684	+1	69	47	93	43	tier1	no_errors	ENST00000308824	ensembl	human	known	74_37	missense	42.59	52.22	SNP	1.000	A	69	93
SP140	11262	genome.wustl.edu	37	2	231112669	231112669	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr2:231112669T>C	ENST00000392045.3	+	8	895	c.781T>C	c.(781-783)Tac>Cac	p.Y261H	SP140_ENST00000343805.6_Missense_Mutation_p.Y235H|SP140_ENST00000486687.2_Intron|SP140_ENST00000350136.5_Intron|SP140_ENST00000420434.3_Missense_Mutation_p.Y261H|SP140_ENST00000417495.3_Intron	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	261					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GGCAAGGACATACAGCACAGC	0.453													ENSG00000079263																																					0													164.0	164.0	164.0					2																	231112669		1987	4168	6155	SO:0001583	missense	0			-	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.781T>C	2.37:g.231112669T>C	ENSP00000375899:p.Tyr261His		E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.Y261H	ENST00000392045.3	37	c.781	CCDS42831.1	2	.	.	.	.	.	.	.	.	.	.	T	0.199	-1.046441	0.01997	.	.	ENSG00000079263	ENST00000392044;ENST00000392045;ENST00000343805;ENST00000420434	T;T;T	0.59638	0.7;0.25;0.67	1.71	-0.859	0.10685	.	.	.	.	.	T	0.27489	0.0675	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.16012	-1.0417	9	0.15066	T	0.55	.	2.3443	0.04268	0.0:0.1973:0.3078:0.4949	.	261;235;261;261	E7EUR5;E9PFJ6;Q13342;E7EX75	.;.;LY10_HUMAN;.	H	261;261;235;261	ENSP00000375899:Y261H;ENSP00000342096:Y235H;ENSP00000398210:Y261H	ENSP00000342096:Y235H	Y	+	1	0	SP140	230820913	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.738000	0.04871	-0.214000	0.10078	0.260000	0.18958	TAC	-	SP140	-	NULL		0.453	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	HGNC	protein_coding	OTTHUMT00000332015.1	0	0	0	13	13	74	0.00	0.00	T	NM_007237		231112669	+1	6	16	14	36	tier1	no_errors	ENST00000392045	ensembl	human	known	74_37	missense	30.00	30.77	SNP	0.000	C	6	14
NR1H2	7376	genome.wustl.edu	37	19	50839923	50839923	+	Intron	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr19:50839923C>T	ENST00000600978.1	+	2	74				NR1H2_ENST00000542413.1_Intron|NAPSB_ENST00000527780.1_RNA			P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2						cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TCCCACAGAGCTTCCCCGAAA	0.532													ENSG00000131401																																					0																																										SO:0001627	intron_variant	0			-	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000600978.1:c.75-1336C>T	19.37:g.50839923C>T			A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	R	SNP	-	NULL	ENST00000600978.1	37	NULL		19																																																																																			-	PSB	-	-		0.532	NR1H2-012	KNOWN	basic	processed_transcript	PSB	HGNC	protein_coding	OTTHUMT00000464783.1	0	0	0	70	70	96	0.00	0.00	C			50839923	-1	45	34	36	55	tier1	no_errors	ENST00000527780	ensembl	human	known	74_37	rna	55.56	38.20	SNP	1.000	T	45	36
TFDP2	7029	genome.wustl.edu	37	3	141713978	141713978	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr3:141713978T>C	ENST00000489671.1	-	5	622	c.192A>G	c.(190-192)atA>atG	p.I64M	TFDP2_ENST00000486111.1_Missense_Mutation_p.I3M|TFDP2_ENST00000310282.6_Missense_Mutation_p.I3M|TFDP2_ENST00000467072.1_Missense_Mutation_p.I3M|TFDP2_ENST00000464782.1_Intron|TFDP2_ENST00000477292.1_Intron|TFDP2_ENST00000317104.7_Missense_Mutation_p.I3M|TFDP2_ENST00000495310.1_Intron|TFDP2_ENST00000397991.4_Missense_Mutation_p.I36M|TFDP2_ENST00000499676.2_Missense_Mutation_p.I3M|TFDP2_ENST00000479040.1_Missense_Mutation_p.I3M			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)	64			I -> T.		gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			kidney(1)|upper_aerodigestive_tract(2)	3						GTGGTGTGCTTATAATCTGTA	0.373													ENSG00000114126																																					0													78.0	72.0	74.0					3																	141713978		1822	4085	5907	SO:0001583	missense	0			-	U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.192A>G	3.37:g.141713978T>C	ENSP00000420616:p.Ile64Met		B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Missense_Mutation	SNP	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcrpt_fac_DP	p.I64M	ENST00000489671.1	37	c.192	CCDS54650.1	3	.	.	.	.	.	.	.	.	.	.	T	20.9	4.073134	0.76415	.	.	ENSG00000114126	ENST00000499676;ENST00000489671;ENST00000486111;ENST00000467072;ENST00000317104;ENST00000310282;ENST00000479040;ENST00000397991;ENST00000467667;ENST00000497579;ENST00000488107;ENST00000475734;ENST00000494358;ENST00000467634	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.52983	1.55;1.66;1.55;1.55;1.55;1.55;1.55;1.5;1.31;1.31;1.16;0.77;0.64;1.11	5.4	5.4	0.78164	.	0.054564	0.64402	D	0.000001	T	0.57577	0.2063	L	0.61218	1.895	0.47441	D	0.999427	D;D	0.56521	0.976;0.96	P;P	0.51918	0.624;0.684	T	0.62959	-0.6743	10	0.72032	D	0.01	-6.7658	15.4271	0.75061	0.0:0.0:0.0:1.0	.	64;3	Q14188;Q14188-5	TFDP2_HUMAN;.	M	3;64;3;3;3;3;3;36;3;3;3;3;3;64	ENSP00000439782:I3M;ENSP00000420616:I64M;ENSP00000420599:I3M;ENSP00000418590:I3M;ENSP00000315668:I3M;ENSP00000309622:I3M;ENSP00000417585:I3M;ENSP00000381078:I36M;ENSP00000417726:I3M;ENSP00000417220:I3M;ENSP00000420456:I3M;ENSP00000417108:I3M;ENSP00000420657:I3M;ENSP00000419540:I64M	ENSP00000309622:I3M	I	-	3	3	TFDP2	143196668	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.668000	0.68074	2.036000	0.60181	0.533000	0.62120	ATA	-	TFDP2	-	pirsf_Transcrpt_fac_DP		0.373	TFDP2-001	KNOWN	basic|CCDS	protein_coding	TFDP2	HGNC	protein_coding	OTTHUMT00000353294.4	0	0	0	44	44	59	0.00	0.00	T	NM_006286		141713978	-1	14	20	81	83	tier1	no_errors	ENST00000489671	ensembl	human	known	74_37	missense	14.74	19.42	SNP	1.000	C	14	81
ACSF2	80221	genome.wustl.edu	37	17	48548432	48548432	+	Missense_Mutation	SNP	A	A	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:48548432A>C	ENST00000300441.4	+	11	1363	c.1259A>C	c.(1258-1260)cAc>cCc	p.H420P	CHAD_ENST00000258969.4_5'Flank|ACSF2_ENST00000506085.1_3'UTR|CHAD_ENST00000508540.1_5'Flank|ACSF2_ENST00000502667.1_Missense_Mutation_p.H407P|ACSF2_ENST00000541920.1_Missense_Mutation_p.H260P|ACSF2_ENST00000427954.2_Missense_Mutation_p.H445P|ACSF2_ENST00000504392.1_Missense_Mutation_p.H377P	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	420					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			ACATTCGCGCACTTCCCTGAG	0.562													ENSG00000167107																																					0													112.0	97.0	102.0					17																	48548432		2203	4300	6503	SO:0001583	missense	0			-	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1259A>C	17.37:g.48548432A>C	ENSP00000300441:p.His420Pro		B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.H420P	ENST00000300441.4	37	c.1259	CCDS11567.1	17	.	.	.	.	.	.	.	.	.	.	A	7.082	0.570340	0.13560	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	4.67	1.27	0.21489	AMP-dependent synthetase/ligase (1);	0.624103	0.15823	N	0.242916	T	0.26340	0.0643	N	0.12853	0.265	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.19257	-1.0311	10	0.87932	D	0	-11.195	6.3858	0.21559	0.526:0.0:0.474:0.0	.	407;445;377;420	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	P	420;260;377;445;407	ENSP00000300441:H420P;ENSP00000437987:H260P;ENSP00000425964:H377P;ENSP00000401831:H445P;ENSP00000421884:H407P	ENSP00000300441:H420P	H	+	2	0	ACSF2	45903431	0.113000	0.22115	0.927000	0.36925	0.062000	0.15995	0.424000	0.21330	0.181000	0.19994	-0.609000	0.04063	CAC	-	ACSF2	-	pfam_AMP-dep_Synth/Lig		0.562	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3	0	0	0	49	49	57	0.00	0.00	A	NM_025149		48548432	+1	7	16	39	67	tier1	no_errors	ENST00000300441	ensembl	human	known	74_37	missense	15.22	19.28	SNP	0.077	C	7	39
PROKR2	128674	genome.wustl.edu	37	20	5294713	5294713	+	Silent	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr20:5294713C>T	ENST00000217270.3	-	1	302	c.303G>A	c.(301-303)ctG>ctA	p.L101L	PROKR2_ENST00000546004.1_Silent_p.L101L	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	101					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						TGATGGCCACCAGGAAGTCGG	0.567										HNSCC(71;0.22)			ENSG00000101292																																					0													164.0	126.0	139.0					20																	5294713		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.303G>A	20.37:g.5294713C>T			A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.L101	ENST00000217270.3	37	c.303	CCDS13089.1	20																																																																																			-	PROKR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.567	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR2	HGNC	protein_coding	OTTHUMT00000077854.1	0	0	1	104	104	74	0.00	1.33	C	NM_144773		5294713	-1	29	25	85	47	tier1	no_errors	ENST00000217270	ensembl	human	known	74_37	silent	25.44	34.25	SNP	1.000	T	29	85
DMD	1756	genome.wustl.edu	37	X	32663086	32663086	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chrX:32663086G>C	ENST00000357033.4	-	10	1350	c.1144C>G	c.(1144-1146)Cat>Gat	p.H382D	DMD_ENST00000378677.2_Missense_Mutation_p.H378D|DMD_ENST00000288447.4_Missense_Mutation_p.H374D	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	382					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTACCTCATGAGTATGAAAC	0.353													ENSG00000198947																																					0													197.0	166.0	176.0					X																	32663086		2202	4300	6502	SO:0001583	missense	0			-	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1144C>G	X.37:g.32663086G>C	ENSP00000354923:p.His382Asp		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.H382D	ENST00000357033.4	37	c.1144	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	18.78	3.696516	0.68386	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.61040	0.14;0.14;0.14	5.52	5.52	0.82312	.	0.000000	0.38272	U	0.001749	T	0.79902	0.4526	M	0.86178	2.8	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.992;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.996;0.995;0.998	T	0.83111	-0.0123	10	0.87932	D	0	.	18.7432	0.91782	0.0:0.0:1.0:0.0	.	378;374;374;382;378	B1AK23;Q4G0X0;P11532-4;P11532;E9PDN5	.;.;.;DMD_HUMAN;.	D	374;378;382;382;259;374	ENSP00000367948:H378D;ENSP00000354923:H382D;ENSP00000288447:H374D	ENSP00000288447:H374D	H	-	1	0	DMD	32573007	1.000000	0.71417	1.000000	0.80357	0.444000	0.32077	9.674000	0.98633	2.458000	0.83093	0.600000	0.82982	CAT	-	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.353	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	0	0	0	45	45	93	0.00	0.00	G	NM_004006		32663086	-1	33	34	41	67	tier1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	44.59	33.66	SNP	1.000	C	33	41
THEMIS	387357	genome.wustl.edu	37	6	128176258	128176258	+	Missense_Mutation	SNP	A	A	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr6:128176258A>T	ENST00000368248.2	-	2	315	c.167T>A	c.(166-168)gTt>gAt	p.V56D	THEMIS_ENST00000537166.1_Missense_Mutation_p.V21D|THEMIS_ENST00000368250.1_5'UTR|THEMIS_ENST00000543064.1_Missense_Mutation_p.V56D	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	56	CABIT 1.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						GATCTTCTTAACTTTGAGACC	0.348													ENSG00000172673																																					0													101.0	99.0	99.0					6																	128176258		2203	4300	6503	SO:0001583	missense	0			-	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.167T>A	6.37:g.128176258A>T	ENSP00000357231:p.Val56Asp		A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	NULL	p.V56D	ENST00000368248.2	37	c.167	CCDS34534.1	6	.	.	.	.	.	.	.	.	.	.	A	21.6	4.178990	0.78564	.	.	ENSG00000172673	ENST00000543064;ENST00000368248;ENST00000537166	T;T;T	0.20332	2.08;2.08;2.58	5.43	5.43	0.79202	.	0.123070	0.52532	D	0.000063	T	0.13841	0.0335	N	0.19112	0.55	0.45914	D	0.998756	P;P	0.40875	0.731;0.484	P;P	0.47786	0.502;0.557	T	0.04307	-1.0961	10	0.87932	D	0	-12.3268	15.7605	0.78076	1.0:0.0:0.0:0.0	.	56;56	F5H1J9;Q8N1K5	.;THMS1_HUMAN	D	56;56;21	ENSP00000439594:V56D;ENSP00000357231:V56D;ENSP00000439863:V21D	ENSP00000357231:V56D	V	-	2	0	THEMIS	128217951	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.695000	0.74593	2.171000	0.68590	0.528000	0.53228	GTT	-	THEMIS	-	NULL		0.348	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	THEMIS	HGNC	protein_coding		0	0	0	44	44	87	0.00	0.00	A	NM_001010923		128176258	-1	12	28	32	65	tier1	no_errors	ENST00000543064	ensembl	human	known	74_37	missense	27.27	30.11	SNP	1.000	T	12	32
SV2C	22987	genome.wustl.edu	37	5	75427805	75427805	+	Missense_Mutation	SNP	A	A	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr5:75427805A>G	ENST00000502798.2	+	2	672	c.230A>G	c.(229-231)gAa>gGa	p.E77G	SV2C_ENST00000322285.7_Missense_Mutation_p.E77G	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	77					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GGCTCAAGTGAAGCCACTGAG	0.512													ENSG00000122012																																					0													79.0	82.0	81.0					5																	75427805		2100	4249	6349	SO:0001583	missense	0			-	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.230A>G	5.37:g.75427805A>G	ENSP00000423541:p.Glu77Gly		Q496K1|Q9UPU8	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	p.E77G	ENST00000502798.2	37	c.230	CCDS43331.1	5	.	.	.	.	.	.	.	.	.	.	A	16.24	3.066484	0.55539	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.30448	1.53;1.53	5.76	5.76	0.90799	Major facilitator superfamily domain, general substrate transporter (1);	0.049903	0.85682	D	0.000000	T	0.28466	0.0704	L	0.36672	1.1	0.80722	D	1	B	0.28933	0.228	B	0.29077	0.098	T	0.03981	-1.0987	10	0.48119	T	0.1	-26.5101	16.075	0.80962	1.0:0.0:0.0:0.0	.	77	Q496J9	SV2C_HUMAN	G	77	ENSP00000423541:E77G;ENSP00000316983:E77G	ENSP00000316983:E77G	E	+	2	0	SV2C	75463561	1.000000	0.71417	0.857000	0.33713	0.500000	0.33767	9.339000	0.96797	2.195000	0.70347	0.533000	0.62120	GAA	-	SV2C	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_SV2		0.512	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2C	HGNC	protein_coding	OTTHUMT00000368700.4	0	0	0	32	32	64	0.00	0.00	A			75427805	+1	13	13	26	56	tier1	no_errors	ENST00000502798	ensembl	human	known	74_37	missense	33.33	18.84	SNP	1.000	G	13	26
BCL9	607	genome.wustl.edu	37	1	147096599	147096599	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr1:147096599C>A	ENST00000234739.3	+	10	4860	c.4120C>A	c.(4120-4122)Cct>Act	p.P1374T		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1374	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CCACCCTGGGCCTGTGGGCTC	0.642			T	"""IGH@, IGL@"""	B-ALL								ENSG00000116128																												Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0													34.0	38.0	36.0					1																	147096599		2203	4300	6503	SO:0001583	missense	0			-	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.4120C>A	1.37:g.147096599C>A	ENSP00000234739:p.Pro1374Thr		Q5T489	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.P1374T	ENST00000234739.3	37	c.4120	CCDS30833.1	1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611426	0.66558	.	.	ENSG00000116128	ENST00000234739	T	0.57595	0.39	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.60625	0.2283	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.66716	0.946;0.946	T	0.63107	-0.6711	10	0.62326	D	0.03	-9.3341	18.9922	0.92798	0.0:1.0:0.0:0.0	.	1374;1374	Q1JQ81;O00512	.;BCL9_HUMAN	T	1374	ENSP00000234739:P1374T	ENSP00000234739:P1374T	P	+	1	0	BCL9	145563223	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.769000	0.85360	2.486000	0.83907	0.650000	0.86243	CCT	-	BCL9	-	NULL		0.642	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	0	0	0	29	29	29	0.00	0.00	C	NM_004326		147096599	+1	5	8	44	20	tier1	no_errors	ENST00000234739	ensembl	human	known	74_37	missense	10.20	28.57	SNP	1.000	A	5	44
KSR1	8844	genome.wustl.edu	37	17	25919582	25919582	+	Missense_Mutation	SNP	A	A	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:25919582A>T	ENST00000319524.6	+	9	1229	c.1229A>T	c.(1228-1230)gAc>gTc	p.D410V	KSR1_ENST00000581975.1_3'UTR|KSR1_ENST00000268763.6_Missense_Mutation_p.D273V|KSR1_ENST00000509603.2_Missense_Mutation_p.D410V|KSR1_ENST00000398988.3_Missense_Mutation_p.D273V			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	410					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GTCCCCTCGGACATCAACAAC	0.537													ENSG00000141068																									Esophageal Squamous(88;1120 1336 6324 10502 16832)												0													87.0	83.0	85.0					17																	25919582		1901	4118	6019	SO:0001583	missense	0			-	U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.1229A>T	17.37:g.25919582A>T	ENSP00000323178:p.Asp410Val		F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D410V	ENST00000319524.6	37	c.1229		17	.	.	.	.	.	.	.	.	.	.	A	25.2	4.616476	0.87359	.	.	ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982	D;T;T	0.81659	-1.52;-1.47;-1.48	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.88822	0.6541	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.75484	0.924;0.986	D	0.88106	0.2822	10	0.33141	T	0.24	.	13.6662	0.62396	1.0:0.0:0.0:0.0	.	408;410	Q8IVT5;F5H0K8	KSR1_HUMAN;.	V	410;410;273;273	ENSP00000323178:D410V;ENSP00000438795:D410V;ENSP00000268763:D273V	ENSP00000268763:D273V	D	+	2	0	KSR1	22943709	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	8.832000	0.92079	1.832000	0.53329	0.482000	0.46254	GAC	-	KSR1	-	NULL		0.537	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding		0	0	0	73	73	104	0.00	0.00	A	NM_014238		25919582	+1	21	37	57	86	tier1	no_errors	ENST00000319524	ensembl	human	known	74_37	missense	26.92	30.08	SNP	1.000	T	21	57
CENPE	1062	genome.wustl.edu	37	4	104061997	104061997	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr4:104061997C>T	ENST00000265148.3	-	36	5817	c.5728G>A	c.(5728-5730)Gaa>Aaa	p.E1910K	CENPE_ENST00000380026.3_Missense_Mutation_p.E1885K	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1910					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGCAGGCTTTCCTTGAGTTGG	0.383													ENSG00000138778																																					0													134.0	118.0	124.0					4																	104061997		2203	4300	6503	SO:0001583	missense	0			-	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5728G>A	4.37:g.104061997C>T	ENSP00000265148:p.Glu1910Lys		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1910K	ENST00000265148.3	37	c.5728	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	6.138	0.393698	0.11638	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.72051	-0.62;-0.62	5.21	2.39	0.29439	.	.	.	.	.	T	0.54224	0.1845	L	0.31578	0.945	0.09310	N	1	B;B	0.18610	0.029;0.001	B;B	0.15052	0.012;0.005	T	0.37009	-0.9724	9	0.23891	T	0.37	.	7.4791	0.27393	0.0:0.616:0.2282:0.1558	.	1885;1910	Q02224-3;Q02224	.;CENPE_HUMAN	K	1910;1910;1885	ENSP00000265148:E1910K;ENSP00000369365:E1885K	ENSP00000265148:E1910K	E	-	1	0	CENPE	104281446	0.000000	0.05858	0.070000	0.20053	0.005000	0.04900	0.074000	0.14662	0.702000	0.31825	-0.154000	0.13518	GAA	-	CENPE	-	NULL		0.383	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		0	0	0	50	50	117	0.00	0.00	C			104061997	-1	34	56	37	47	tier1	no_errors	ENST00000265148	ensembl	human	known	74_37	missense	47.89	54.37	SNP	0.035	T	34	37
ARHGAP27	201176	genome.wustl.edu	37	17	43474374	43474374	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:43474374G>C	ENST00000428638.1	-	11	1858	c.1859C>G	c.(1858-1860)cCa>cGa	p.P620R	ARHGAP27_ENST00000532891.2_Missense_Mutation_p.P598R|CTB-39G8.3_ENST00000592389.1_RNA|ARHGAP27_ENST00000528384.1_Missense_Mutation_p.P252R|ARHGAP27_ENST00000582826.1_5'Flank|ARHGAP27_ENST00000376922.2_Missense_Mutation_p.P279R|ARHGAP27_ENST00000442348.1_Missense_Mutation_p.P593R|ARHGAP27_ENST00000455881.1_Missense_Mutation_p.P279R|ARHGAP27_ENST00000532038.1_Missense_Mutation_p.P398R			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	620					positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					GCTCTCCTCTGGGGGCAGCTC	0.647													ENSG00000159314																																					0													53.0	50.0	51.0					17																	43474374		2203	4300	6503	SO:0001583	missense	0			-	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.1859C>G	17.37:g.43474374G>C	ENSP00000403323:p.Pro620Arg		A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_WW_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.P620R	ENST00000428638.1	37	c.1859		17	.	.	.	.	.	.	.	.	.	.	G	8.202	0.798465	0.16397	.	.	ENSG00000159314	ENST00000532038;ENST00000376922;ENST00000528384;ENST00000532891;ENST00000428638;ENST00000442348;ENST00000455881	T;T;T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3	4.66	-3.64	0.04515	.	0.853808	0.10207	N	0.702626	T	0.62925	0.2468	L	0.40543	1.245	0.09310	N	1	B;B	0.34181	0.078;0.44	B;B	0.31191	0.051;0.125	T	0.51268	-0.8727	10	0.16420	T	0.52	.	3.9351	0.09302	0.3912:0.0:0.3434:0.2654	.	593;620	F8WBX1;Q6ZUM4	.;RHG27_HUMAN	R	398;279;252;598;620;593;279	ENSP00000432762:P398R;ENSP00000366121:P279R;ENSP00000431591:P252R;ENSP00000433942:P598R;ENSP00000403323:P620R;ENSP00000409330:P593R;ENSP00000408235:P279R	ENSP00000366121:P279R	P	-	2	0	ARHGAP27	40830157	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-0.034000	0.12225	-0.950000	0.03659	0.462000	0.41574	CCA	-	ARHGAP27	-	NULL		0.647	ARHGAP27-202	KNOWN	basic	protein_coding	ARHGAP27	HGNC	protein_coding		0	0	0	113	113	21	0.00	0.00	G	NM_199282		43474374	-1	23	12	63	29	tier1	no_errors	ENST00000428638	ensembl	human	known	74_37	missense	26.74	29.27	SNP	0.000	C	23	63
DNMT3B	1789	genome.wustl.edu	37	20	31376688	31376688	+	Missense_Mutation	SNP	T	T	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr20:31376688T>G	ENST00000328111.2	+	7	1004	c.683T>G	c.(682-684)cTc>cGc	p.L228R	DNMT3B_ENST00000344505.4_Missense_Mutation_p.L228R|DNMT3B_ENST00000375623.4_Missense_Mutation_p.L186R|DNMT3B_ENST00000443239.3_Missense_Mutation_p.L186R|DNMT3B_ENST00000456297.2_Missense_Mutation_p.L152R|DNMT3B_ENST00000201963.3_Missense_Mutation_p.L240R|DNMT3B_ENST00000353855.2_Missense_Mutation_p.L228R|DNMT3B_ENST00000348286.2_Missense_Mutation_p.L228R	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	228	Interaction with DNMT1 and DNMT3A.|PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ATAGGGGACCTCGTGTGGGGA	0.577													ENSG00000088305																																					0													87.0	87.0	87.0					20																	31376688		2203	4300	6503	SO:0001583	missense	0			-		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.683T>G	20.37:g.31376688T>G	ENSP00000328547:p.Leu228Arg		A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.L228R	ENST00000328111.2	37	c.683	CCDS13205.1	20	.	.	.	.	.	.	.	.	.	.	T	26.8	4.768165	0.90020	.	.	ENSG00000088305	ENST00000328111;ENST00000537219;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000375623;ENST00000201963	T;T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.61	5.61	0.85477	PWWP (3);	0.068872	0.64402	D	0.000016	D	0.89884	0.6844	M	0.90425	3.115	0.53688	D	0.999976	D;D;D;D;D;D	0.89917	0.998;1.0;0.999;0.998;0.999;0.996	D;D;D;D;D;D	0.77557	0.978;0.99;0.962;0.962;0.962;0.978	D	0.91929	0.5553	10	0.87932	D	0	-22.8925	14.9828	0.71324	0.0:0.0:0.0:1.0	.	152;186;240;228;228;228	E9PBF2;E7EN63;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;DNM3B_HUMAN	R	228;314;228;228;186;152;228;186;240	ENSP00000328547:L228R;ENSP00000313397:L228R;ENSP00000337764:L228R;ENSP00000403169:L186R;ENSP00000412305:L152R;ENSP00000345105:L228R;ENSP00000364774:L186R;ENSP00000201963:L240R	ENSP00000201963:L240R	L	+	2	0	DNMT3B	30840349	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	8.005000	0.88553	2.136000	0.66102	0.379000	0.24179	CTC	-	DNMT3B	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom		0.577	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMT3B	HGNC	protein_coding	OTTHUMT00000078643.2	0	0	0	148	148	42	0.00	0.00	T	NM_006892		31376688	+1	38	17	178	57	tier1	no_errors	ENST00000328111	ensembl	human	known	74_37	missense	17.59	22.67	SNP	0.999	G	38	178
KAT2B	8850	genome.wustl.edu	37	3	20153214	20153214	+	Silent	SNP	A	A	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr3:20153214A>G	ENST00000263754.4	+	6	1433	c.978A>G	c.(976-978)caA>caG	p.Q326Q		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	326					cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						TCCTGGAACAAGCAAGACAGG	0.453													ENSG00000114166																																					0													137.0	119.0	125.0					3																	20153214		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.978A>G	3.37:g.20153214A>G			Q6NSK1	Silent	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_GT_dom	p.Q326	ENST00000263754.4	37	c.978	CCDS2634.1	3																																																																																			-	KAT2B	-	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N		0.453	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1	0	0	0	68	68	100	0.00	0.00	A	NM_003884		20153214	+1	23	24	76	94	tier1	no_errors	ENST00000263754	ensembl	human	known	74_37	silent	23.23	20.34	SNP	1.000	G	23	76
TTN	7273	genome.wustl.edu	37	2	179440976	179440976	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr2:179440976C>T	ENST00000591111.1	-	276	65184	c.64960G>A	c.(64960-64962)Gcc>Acc	p.A21654T	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A14422T|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A23295T|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A20727T|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A14355T|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A14230T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21654	Fibronectin type-III 57. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTCTGAGGGCGGTTCCTGTG	0.473													ENSG00000155657																																					0													73.0	73.0	73.0					2																	179440976		1900	4128	6028	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.64960G>A	2.37:g.179440976C>T	ENSP00000465570:p.Ala21654Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A20727T	ENST00000591111.1	37	c.62179		2	.	.	.	.	.	.	.	.	.	.	C	9.759	1.169627	0.21621	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.87	4.09	0.47781	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32346	0.0826	N	0.05031	-0.125	0.35998	D	0.837176	B;B;B;B	0.14012	0.009;0.009;0.009;0.009	B;B;B;B	0.15052	0.012;0.012;0.012;0.012	T	0.28808	-1.0032	9	0.87932	D	0	.	11.5342	0.50628	0.1252:0.8102:0.0:0.0646	.	14230;14355;14422;21654	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	20727;14230;14422;14355;14228	ENSP00000343764:A20727T;ENSP00000434586:A14230T;ENSP00000340554:A14422T;ENSP00000352154:A14355T	ENSP00000340554:A14422T	A	-	1	0	TTN	179149222	0.983000	0.35010	0.490000	0.27465	0.559000	0.35586	2.590000	0.46154	0.833000	0.34828	-0.152000	0.13540	GCC	-	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.473	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	11	11	104	0.00	0.00	C	NM_133378		179440976	-1	4	22	4	35	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	50.00	38.60	SNP	0.948	T	4	4
KIF12	113220	genome.wustl.edu	37	9	116854198	116854198	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr9:116854198G>C	ENST00000374118.3	-	16	1722	c.1485C>G	c.(1483-1485)agC>agG	p.S495R	KIF12_ENST00000473174.1_5'Flank	NM_138424.1	NP_612433.1	Q96FN5	KIF12_HUMAN	kinesin family member 12	628	Pro-rich.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	17						AGGGTGGCTGGCTGCGGCCAC	0.647													ENSG00000136883																																					0													38.0	38.0	38.0					9																	116854198		2203	4300	6503	SO:0001583	missense	0			-	BC010626	CCDS6801.1	9q33.1	2008-02-05			ENSG00000136883	ENSG00000136883		"""Kinesins"""	21495	protein-coding gene	gene with protein product		611278					Standard	NM_138424		Approved		uc004bif.3	Q96FN5	OTTHUMG00000020533	ENST00000374118.3:c.1485C>G	9.37:g.116854198G>C	ENSP00000363232:p.Ser495Arg		Q5TBE0	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S495R	ENST00000374118.3	37	c.1485	CCDS6801.1	9	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491899	0.44352	.	.	ENSG00000136883	ENST00000374118;ENST00000259410	T	0.72942	-0.7	3.86	2.92	0.33932	.	0.454723	0.22829	N	0.055132	T	0.50103	0.1596	N	0.17082	0.46	0.26692	N	0.971339	B	0.06786	0.001	B	0.01281	0.0	T	0.35400	-0.9790	10	0.29301	T	0.29	.	8.5055	0.33184	0.0:0.0:0.7577:0.2423	.	628	Q96FN5	KIF12_HUMAN	R	495;628	ENSP00000363232:S495R	ENSP00000259410:S628R	S	-	3	2	KIF12	115894019	0.895000	0.30542	0.925000	0.36789	0.703000	0.40648	0.419000	0.21247	1.150000	0.42419	0.442000	0.29010	AGC	-	KIF12	-	NULL		0.647	KIF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF12	HGNC	protein_coding	OTTHUMT00000053751.1	0	0	0	68	68	14	0.00	0.00	G	NM_138424		116854198	-1	12	5	54	14	tier1	no_errors	ENST00000374118	ensembl	human	known	74_37	missense	18.18	26.32	SNP	0.931	C	12	54
ATP10D	57205	genome.wustl.edu	37	4	47548647	47548647	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr4:47548647G>A	ENST00000273859.3	+	10	1672	c.1403G>A	c.(1402-1404)aGg>aAg	p.R468K	ATP10D_ENST00000504445.1_Missense_Mutation_p.R453K	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	468					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						ACAGCCAGGAGGTTGGAGTCC	0.458													ENSG00000145246																																					0													99.0	97.0	98.0					4																	47548647		2203	4300	6503	SO:0001583	missense	0			-	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1403G>A	4.37:g.47548647G>A	ENSP00000273859:p.Arg468Lys		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R468K	ENST00000273859.3	37	c.1403	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690377	0.88735	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.66280	-0.2;0.92	4.84	4.84	0.62591	HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.74481	0.3722	M	0.77486	2.375	0.29873	N	0.826649	P;B	0.42649	0.786;0.06	P;B	0.51297	0.665;0.094	T	0.75368	-0.3342	10	0.66056	D	0.02	-14.9422	17.0897	0.86618	0.0:0.0:1.0:0.0	.	468;453	Q9P241;Q6PEW3	AT10D_HUMAN;.	K	468;453	ENSP00000273859:R468K;ENSP00000420909:R453K	ENSP00000273859:R468K	R	+	2	0	ATP10D	47243404	1.000000	0.71417	0.991000	0.47740	0.917000	0.54804	8.180000	0.89694	2.513000	0.84729	0.491000	0.48974	AGG	-	ATP10D	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp		0.458	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	0	0	0	32	32	79	0.00	0.00	G	NM_020453		47548647	+1	9	18	25	50	tier1	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	26.47	26.47	SNP	1.000	A	9	25
SLC52A3	113278	genome.wustl.edu	37	20	746010	746020	+	Frame_Shift_Del	DEL	AGTAGGTGGGC	AGTAGGTGGGC	-	rs527853872		TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	AGTAGGTGGGC	AGTAGGTGGGC	AGTAGGTGGGC	-	AGTAGGTGGGC	AGTAGGTGGGC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr20:746010_746020delAGTAGGTGGGC	ENST00000217254.7	-	2	640_650	c.399_409delGCCCACCTACT	c.(397-411)ctgcccacctactacfs	p.PTYY134fs	SLC52A3_ENST00000473664.1_5'UTR|SLC52A3_ENST00000381944.3_Frame_Shift_Del_p.PTYY134fs	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	134					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)										GTGGTGAGGTAGTAGGTGGGCAGCCGGCTCA	0.616													ENSG00000101276																																					0																																										SO:0001589	frameshift_variant	0				AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.399_409delGCCCACCTACT	20.37:g.746010_746020delAGTAGGTGGGC	ENSP00000217254:p.Pro134fs		A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Frame_Shift_Del	DEL	pfam_Endogenous_retrovirus_rcpt	p.T135fs	ENST00000217254.7	37	c.409_399	CCDS13007.1	20																																																																																				SLC52A3	-	NULL		0.616	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC52A3	HGNC	protein_coding	OTTHUMT00000077482.2	0	0	0	32	32	32	0.00	0.00	AGTAGGTGGGC	NM_033409		746020	-1	4	4	31	31	tier1	no_errors	ENST00000217254	ensembl	human	known	74_37	frame_shift_del	11.43	11.43	DEL	1.000:0.009:0.002:0.001:0.001:0.374:0.000:0.001:0.971:1.000:1.000	-	4	31
TTN	7273	genome.wustl.edu	37	2	179664458	179664459	+	Splice_Site	DEL	TC	TC	-			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	TC	TC	TC	-	TC	TC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr2:179664458_179664459delTC	ENST00000591111.1	-	6	894	c.670delGA	c.(670-672)gaa>aa	p.E224fs	TTN_ENST00000342175.6_Splice_Site_p.E224fs|TTN_ENST00000589042.1_Splice_Site_p.E224fs|TTN_ENST00000342992.6_Splice_Site_p.E224fs|TTN_ENST00000360870.5_Splice_Site_p.E224fs|TTN_ENST00000359218.5_Splice_Site_p.E224fs|TTN_ENST00000460472.2_Splice_Site_p.E224fs			Q8WZ42	TITIN_HUMAN	titin	33898					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTCAATCTTCTGTAAAAGAT	0.446													ENSG00000155657																																					0																																										SO:0001630	splice_region_variant	0				X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.670-1GA>-	2.37:g.179664458_179664459delTC			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K224fs	ENST00000591111.1	37	c.670		2																																																																																				TTN	-	NULL		0.446	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	32	32	57	0.00	0.00	TC	NM_133378	Frame_Shift_Del	179664459	-1	10	12	23	23	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	frame_shift_del	30.30	34.29	DEL	1.000	-	10	23
ZCCHC6	79670	genome.wustl.edu	37	9	88967642	88967663	+	Frame_Shift_Del	DEL	TCTTTATGAAACAGTCGTCTTA	TCTTTATGAAACAGTCGTCTTA	-			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	TCTTTATGAAACAGTCGTCTTA	TCTTTATGAAACAGTCGTCTTA	TCTTTATGAAACAGTCGTCTTA	-	TCTTTATGAAACAGTCGTCTTA	TCTTTATGAAACAGTCGTCTTA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr9:88967642_88967663delTCTTTATGAAACAGTCGTCTTA	ENST00000375963.3	-	2	624_645	c.452_473delTAAGACGACTGTTTCATAAAGA	c.(451-474)gtaagacgactgtttcataaagacfs	p.VRRLFHKD151fs	ZCCHC6_ENST00000375961.2_Frame_Shift_Del_p.VRRLFHKD151fs|ZCCHC6_ENST00000375947.1_5'Flank|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375960.2_Frame_Shift_Del_p.VRRLFHKD151fs	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	151					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.R152R(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						GCTTGTTAGGTCTTTATGAAACAGTCGTCTTACAGTTCTGCA	0.414													ENSG00000083223																																					1	Substitution - coding silent(1)	kidney(1)																																								SO:0001589	frameshift_variant	0				AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.452_473delTAAGACGACTGTTTCATAAAGA	9.37:g.88967642_88967663delTCTTTATGAAACAGTCGTCTTA	ENSP00000365130:p.Val151fs		Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Frame_Shift_Del	DEL	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.V151fs	ENST00000375963.3	37	c.473_452	CCDS35057.1	9																																																																																				ZCCHC6	-	NULL		0.414	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	HGNC	protein_coding	OTTHUMT00000052918.1	0	0	0	128	128	128	0.00	0.00	TCTTTATGAAACAGTCGTCTTA	NM_024617		88967663	-1	20	20	108	108	tier1	no_errors	ENST00000375963	ensembl	human	known	74_37	frame_shift_del	15.62	15.62	DEL	0.914:0.999:0.999:1.000:1.000:0.999:1.000:1.000:0.995:0.985:0.928:0.467:0.530:0.514:0.411:0.720:0.780:0.976:1.000:1.000:0.985:0.998	-	20	108
LDHB	3945	genome.wustl.edu	37	12	21799948	21799956	+	Splice_Site	DEL	AGACTGTAA	AGACTGTAA	-	rs200371155	byFrequency	TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	AGACTGTAA	AGACTGTAA	AGACTGTAA	-	AGACTGTAA	AGACTGTAA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr12:21799948_21799956delAGACTGTAA	ENST00000396076.1	-	3	462_464	c.130_132delTTACAGTCT	c.(130-132)ttadel	p.L45del	LDHB_ENST00000350669.1_Splice_Site_p.L45del	NM_001174097.1	NP_001167568.1	P07195	LDHB_HUMAN	lactate dehydrogenase B	45					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|lactate metabolic process (GO:0006089)|NAD metabolic process (GO:0019674)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	L-lactate dehydrogenase activity (GO:0004459)|NAD binding (GO:0051287)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	26						CATCAGCCAGAGACTGTAAACGCAAAAAC	0.416													ENSG00000111716																																					0																																										SO:0001630	splice_region_variant	0					CCDS8691.1	12p12.2-p12.1	2012-10-02			ENSG00000111716	ENSG00000111716	1.1.1.27		6541	protein-coding gene	gene with protein product		150100					Standard	NM_002300		Approved		uc001rfe.3	P07195	OTTHUMG00000133760	ENST00000396076.1:c.130-1TTACAGTCT>-	12.37:g.21799948_21799956delAGACTGTAA				Splice_Site	DEL	-	e2-1	ENST00000396076.1	37	c.130-6_130-1	CCDS8691.1	12																																																																																				LDHB	-	-		0.416	LDHB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LDHB	HGNC	protein_coding	OTTHUMT00000258220.2	0	0	0	110	110	110	0.00	0.00	AGACTGTAA	NM_002300	In_Frame_Del	21799956	-1	11	11	77	77	tier1	no_errors	ENST00000350669	ensembl	human	known	74_37	splice_site_del	12.50	12.50	DEL	1.000:1.000:1.000:1.000:0.991:0.006:0.000:0.001:0.002	-	11	77
SNAP91	9892	genome.wustl.edu	37	6	84311022	84311023	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr6:84311022_84311023insT	ENST00000439399.2	-	16	1607_1608	c.1291_1292insA	c.(1291-1293)actfs	p.T431fs	SNAP91_ENST00000437520.1_Intron|SNAP91_ENST00000195649.6_Frame_Shift_Ins_p.T431fs|SNAP91_ENST00000428679.2_Frame_Shift_Ins_p.T431fs|SNAP91_ENST00000520302.1_Frame_Shift_Ins_p.T429fs|SNAP91_ENST00000521485.1_Frame_Shift_Ins_p.T431fs|SNAP91_ENST00000369694.2_Frame_Shift_Ins_p.T431fs|SNAP91_ENST00000520213.1_Intron|SNAP91_ENST00000521743.1_Frame_Shift_Ins_p.T431fs	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	431	Ala-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AGTGACAGCAGTAACAGTTGTA	0.436													ENSG00000065609																																					0																																										SO:0001589	frameshift_variant	0				AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.1292dupA	6.37:g.84311023_84311023dupT	ENSP00000400459:p.Thr431fs		A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Frame_Shift_Ins	INS	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.T431fs	ENST00000439399.2	37	c.1292_1291	CCDS47455.1	6																																																																																				SP91	-	NULL		0.436	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SP91	HGNC	protein_coding	OTTHUMT00000375296.1	0	0	0	59	59	104	0.00	0.00	-			84311023	-1	34	25	43	51	tier1	no_errors	ENST00000369694	ensembl	human	known	74_37	frame_shift_ins	44.16	32.89	INS	1.000:0.998	T	34	43
GPX5	2880	genome.wustl.edu	37	6	28501767	28501767	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr6:28501767delG	ENST00000412168.2	+	5	578	c.489delG	c.(487-489)ttgfs	p.L163fs	GPX5_ENST00000469384.1_3'UTR|GPX5_ENST00000442674.2_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	163					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	CTGAGATTTTGGGCACATTCA	0.458													ENSG00000224586																																					0													182.0	181.0	181.0					6																	28501767		2203	4300	6503	SO:0001589	frameshift_variant	0				AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.489delG	6.37:g.28501767delG	ENSP00000392398:p.Leu163fs		A1A4Y0	Frame_Shift_Del	DEL	pfam_Glutathione_peroxidase,superfamily_Thioredoxin-like_fold,pirsf_Glutathione_peroxidase,prints_Glutathione_peroxidase	p.G164fs	ENST00000412168.2	37	c.489	CCDS4652.1	6																																																																																				GPX5	-	superfamily_Thioredoxin-like_fold,pirsf_Glutathione_peroxidase		0.458	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPX5	HGNC	protein_coding	OTTHUMT00000043672.2	0	0	0	90	90	117	0.00	0.00	G			28501767	+1	79	52	61	38	tier1	no_errors	ENST00000412168	ensembl	human	known	74_37	frame_shift_del	56.43	57.78	DEL	0.701	-	79	61
ENAM	10117	genome.wustl.edu	37	4	71509722	71509722	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr4:71509722delA	ENST00000396073.3	+	9	2860	c.2579delA	c.(2578-2580)caafs	p.Q860fs	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	860					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			CCATCAGGTCAAAAAGAAGCA	0.443													ENSG00000132464																																					0													100.0	98.0	98.0					4																	71509722		2203	4300	6503	SO:0001589	frameshift_variant	0				AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.2579delA	4.37:g.71509722delA	ENSP00000379383:p.Gln860fs		Q17RI5|Q9H3D1	Frame_Shift_Del	DEL	NULL	p.E862fs	ENST00000396073.3	37	c.2579	CCDS3544.2	4																																																																																				EM	-	NULL		0.443	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EM	HGNC	protein_coding	OTTHUMT00000252166.3	0	0	0	12	12	117	0.00	0.00	A	NM_031889		71509722	+1	7	20	17	89	tier1	no_errors	ENST00000396073	ensembl	human	known	74_37	frame_shift_del	29.17	18.35	DEL	0.998	-	7	17
PARP2	10038	genome.wustl.edu	37	14	20811609	20811609	+	5'Flank	DEL	A	A	-			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr14:20811609delA	ENST00000250416.5	+	0	0				PARP2_ENST00000527915.1_5'Flank|RPPH1_ENST00000554988.1_RNA|PARP2_ENST00000429687.3_5'Flank|RP11-203M5.2_ENST00000528210.1_RNA	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2						base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		TAAGATTCCCAAATCCAAAGA	0.507								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA					ENSG00000259001																																					0																																										SO:0001631	upstream_gene_variant	0				AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106		14.37:g.20811609delA	Exception_encountered		Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	R	DEL	-	NULL	ENST00000250416.5	37	NULL	CCDS41910.1	14																																																																																				RPPH1	-	-		0.507	PARP2-002	KNOWN	basic|CCDS	protein_coding	RPPH1	HGNC	protein_coding	OTTHUMT00000387847.2	0	0	0	27	27	57	0.00	0.00	A			20811609	-1	12	37	8	14	tier1	no_errors	ENST00000554988	ensembl	human	known	74_37	rna	60.00	72.55	DEL	0.000	-	12	8
GPR123	84435	genome.wustl.edu	37	10	134916200	134916200	+	Splice_Site	SNP	G	G	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr10:134916200G>T	ENST00000392607.3	+	5	691		c.e5-1		GPR123_ENST00000607359.1_Splice_Site|GPR123_ENST00000392606.2_Splice_Site	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123						G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CTCCCCCACAGGTGGGCATCG	0.622													ENSG00000197177																																					0													39.0	30.0	33.0					10																	134916200		2202	4299	6501	SO:0001630	splice_region_variant	0			-	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.256-1G>T	10.37:g.134916200G>T			A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Splice_Site	SNP	-	e14-1	ENST00000392607.3	37	c.2416-1	CCDS41580.1	10	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205997	0.39003	.	.	ENSG00000197177	ENST00000368577;ENST00000392609;ENST00000392607	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2692	0.66140	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPR123	134766190	1.000000	0.71417	0.999000	0.59377	0.364000	0.29643	8.725000	0.91468	2.047000	0.60756	0.462000	0.41574	.	-	GPR123	-	-		0.622	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	GPR123	HGNC	protein_coding	OTTHUMT00000051113.2	0	0	0	113	113	25	0.00	0.00	G		Intron	134916200	+1	22	10	9	2	tier1	no_errors	ENST00000607359	ensembl	human	putative	74_37	splice_site	68.75	83.33	SNP	1.000	T	22	9
GRIN3B	116444	genome.wustl.edu	37	19	1005248	1005248	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr19:1005248C>T	ENST00000234389.3	+	3	1767	c.1748C>T	c.(1747-1749)gCg>gTg	p.A583V	GRIN3B_ENST00000588335.1_3'UTR|AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	583					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)	p.A583V(1)		breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGCGTCTTTGCGGCCCTGCAC	0.672													ENSG00000116032																																					1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											61.0	57.0	58.0					19																	1005248		2203	4300	6503	SO:0001583	missense	0			-		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1748C>T	19.37:g.1005248C>T	ENSP00000234389:p.Ala583Val		Q5EAK7|Q7RTW9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A583V	ENST00000234389.3	37	c.1748	CCDS32861.1	19	.	.	.	.	.	.	.	.	.	.	C	0.478	-0.881016	0.02530	.	.	ENSG00000116032	ENST00000234389	T	0.21932	1.98	4.53	3.41	0.39046	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.059979	0.64402	D	0.000004	T	0.04497	0.0123	N	0.01535	-0.81	0.33456	D	0.584297	B	0.27997	0.197	B	0.20184	0.028	T	0.31752	-0.9932	10	0.02654	T	1	.	3.5939	0.07998	0.0:0.6204:0.0:0.3796	.	583	O60391	NMD3B_HUMAN	V	583	ENSP00000234389:A583V	ENSP00000234389:A583V	A	+	2	0	GRIN3B	956248	1.000000	0.71417	0.576000	0.28549	0.016000	0.09150	4.065000	0.57513	2.100000	0.63781	0.485000	0.47835	GCG	-	GRIN3B	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt		0.672	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3B	HGNC	protein_coding	OTTHUMT00000103923.2	0	0	0	139	139	18	0.00	0.00	C			1005248	+1	74	23	10	1	tier1	no_errors	ENST00000234389	ensembl	human	known	74_37	missense	87.06	95.83	SNP	0.994	T	74	10
HPN-AS1	100128675	genome.wustl.edu	37	19	35597197	35597197	+	5'UTR	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr19:35597197C>T	ENST00000313865.6	+	0	325				HPN-AS1_ENST00000392227.2_RNA																							CTCCTCCTGTCCTAGCTCTTG	0.562													ENSG00000227392																																					0																																										SO:0001623	5_prime_UTR_variant	0			-																												ENST00000313865.6:c.-93C>T	19.37:g.35597197C>T				R	SNP	-	NULL	ENST00000313865.6	37	NULL		19																																																																																			-	HPN-AS1	-	-		0.562	AC020907.1-201	KNOWN	basic|appris_principal	protein_coding	HPN-AS1	HGNC	protein_coding		0	0	0	104	104	18	0.00	0.00	C			35597197	-1	40	4	11	2	tier1	no_errors	ENST00000392227	ensembl	human	known	74_37	rna	78.43	66.67	SNP	0.995	T	40	11
KNDC1	85442	genome.wustl.edu	37	10	135024137	135024137	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr10:135024137G>C	ENST00000304613.3	+	21	3838	c.3817G>C	c.(3817-3819)Gtg>Ctg	p.V1273L	KNDC1_ENST00000368572.2_Missense_Mutation_p.V1275L			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1273	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GGAGGGTTATGTGCAGCAATT	0.642													ENSG00000171798																																					0													249.0	195.0	213.0					10																	135024137		2203	4300	6503	SO:0001583	missense	0			-	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3817G>C	10.37:g.135024137G>C	ENSP00000304437:p.Val1273Leu		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.V1275L	ENST00000304613.3	37	c.3823	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	G	8.689	0.907008	0.17833	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.46063	0.88;0.88	3.66	3.66	0.41972	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.078699	0.50627	U	0.000105	T	0.38241	0.1033	L	0.57536	1.79	0.35233	D	0.777066	P	0.39094	0.659	B	0.38921	0.285	T	0.49960	-0.8883	10	0.18710	T	0.47	-21.4269	13.2821	0.60222	0.0:0.0:1.0:0.0	.	1273	Q76NI1	VKIND_HUMAN	L	1273;1275	ENSP00000304437:V1273L;ENSP00000357561:V1275L	ENSP00000304437:V1273L	V	+	1	0	KNDC1	134874127	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	5.640000	0.67875	1.796000	0.52611	0.196000	0.17591	GTG	-	KNDC1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N		0.642	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	0	0	1	127	127	54	0.00	1.82	G	NM_152643		135024137	+1	37	40	9	6	tier1	no_errors	ENST00000368572	ensembl	human	known	74_37	missense	80.43	86.96	SNP	1.000	C	37	9
MGAT5B	146664	genome.wustl.edu	37	17	74944891	74944891	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:74944891C>T	ENST00000569840.2	+	18	2924	c.2350C>T	c.(2350-2352)Cag>Tag	p.Q784*	MGAT5B_ENST00000428789.2_Nonsense_Mutation_p.Q793*|MGAT5B_ENST00000301618.4_Nonsense_Mutation_p.Q782*|RP11-87G24.3_ENST00000564292.1_RNA	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	784					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCGCAAGGGCCAGGTGGCCTT	0.672													ENSG00000167889																																					0													21.0	24.0	23.0					17																	74944891		2203	4297	6500	SO:0001587	stop_gained	0			-	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.2350C>T	17.37:g.74944891C>T	ENSP00000456037:p.Gln784*		Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Nonsense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase	p.Q793*	ENST00000569840.2	37	c.2377	CCDS59299.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.398900	0.96030	.	.	ENSG00000167889	ENST00000301618;ENST00000428789	.	.	.	5.25	4.28	0.50868	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-28.2616	13.1143	0.59292	0.0:0.9222:0.0:0.0778	.	.	.	.	X	782;793	.	ENSP00000301618:Q782X	Q	+	1	0	MGAT5B	72456486	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.631000	0.83237	1.206000	0.43276	0.462000	0.41574	CAG	-	MGAT5B	-	NULL		0.672	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGAT5B	HGNC	protein_coding	OTTHUMT00000460624.2	0	0	0	132	132	7	0.00	0.00	C	NM_144677		74944891	+1	70	3	68	7	tier1	no_errors	ENST00000428789	ensembl	human	known	74_37	nonsense	50.72	30.00	SNP	1.000	T	70	68
MTTP	4547	genome.wustl.edu	37	4	100543870	100543870	+	Silent	SNP	C	C	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr4:100543870C>A	ENST00000265517.5	+	18	2753	c.2550C>A	c.(2548-2550)ggC>ggA	p.G850G	MTTP_ENST00000457717.1_Silent_p.G850G|MTTP_ENST00000511045.1_Silent_p.G877G|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	850					cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TGTCCACAGGCAGAGGTTATG	0.433													ENSG00000138823																																					0													128.0	127.0	127.0					4																	100543870		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2550C>A	4.37:g.100543870C>A			A8K428|Q08AM4|Q6P5T3	Silent	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.G850	ENST00000265517.5	37	c.2550	CCDS3651.1	4																																																																																			-	MTTP	-	NULL		0.433	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	0	0	0	35	35	54	0.00	0.00	C			100543870	+1	25	38	11	7	tier1	no_errors	ENST00000265517	ensembl	human	known	74_37	silent	69.44	84.44	SNP	0.981	A	25	11
PCDHA1	56147	genome.wustl.edu	37	5	140167415	140167415	+	Missense_Mutation	SNP	A	A	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr5:140167415A>G	ENST00000504120.2	+	1	1540	c.1540A>G	c.(1540-1542)Agc>Ggc	p.S514G	PCDHA1_ENST00000378133.3_Missense_Mutation_p.S514G|PCDHA1_ENST00000394633.3_Missense_Mutation_p.S514G	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	514	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACGCGGAGAGCGGCAAGGT	0.697													ENSG00000204970																																					0													73.0	75.0	74.0					5																	140167415		2203	4300	6503	SO:0001583	missense	0			-	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1540A>G	5.37:g.140167415A>G	ENSP00000420840:p.Ser514Gly		O75288|Q9NRT7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S514G	ENST00000504120.2	37	c.1540	CCDS54913.1	5	.	.	.	.	.	.	.	.	.	.	a	22.2	4.263661	0.80358	.	.	ENSG00000204970	ENST00000504120;ENST00000394633;ENST00000378133	T;T;T	0.53640	0.61;0.61;0.61	3.63	3.63	0.41609	Cadherin (5);Cadherin-like (1);	0.000000	0.49916	U	0.000138	T	0.70116	0.3187	M	0.87381	2.88	0.28427	N	0.917459	D;D;D	0.89917	0.997;0.998;1.0	D;D;D	0.74023	0.973;0.924;0.982	T	0.67810	-0.5574	10	0.87932	D	0	.	12.5955	0.56468	1.0:0.0:0.0:0.0	.	514;514;514	Q9Y5I3;Q9Y5I3-2;Q9Y5I3-3	PCDA1_HUMAN;.;.	G	514	ENSP00000420840:S514G;ENSP00000378129:S514G;ENSP00000367373:S514G	ENSP00000367373:S514G	S	+	1	0	PCDHA1	140147599	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.761000	0.91691	1.443000	0.47586	0.449000	0.29647	AGC	-	PCDHA1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.697	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	0	0	0	170	170	16	0.00	0.00	A	NM_018900		140167415	+1	37	2	66	7	tier1	no_errors	ENST00000504120	ensembl	human	known	74_37	missense	35.92	22.22	SNP	1.000	G	37	66
PHLPP2	23035	genome.wustl.edu	37	16	71712775	71712775	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr16:71712775G>A	ENST00000568954.1	-	8	1529	c.1151C>T	c.(1150-1152)cCt>cTt	p.P384L	PHLPP2_ENST00000356272.3_Missense_Mutation_p.P384L|PHLPP2_ENST00000567016.1_Missense_Mutation_p.P419L|PHLPP2_ENST00000393524.2_Missense_Mutation_p.P384L|PHLPP2_ENST00000360429.3_Missense_Mutation_p.P384L			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	384					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						ATAAACCTCAGGAATTTGACT	0.403													ENSG00000040199																																					0													87.0	83.0	84.0					16																	71712775		2198	4300	6498	SO:0001583	missense	0			-	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.1151C>T	16.37:g.71712775G>A	ENSP00000457991:p.Pro384Leu		A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom	p.P384L	ENST00000568954.1	37	c.1151	CCDS32479.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.218450	0.95104	.	.	ENSG00000040199	ENST00000299971;ENST00000360429;ENST00000356272;ENST00000393524;ENST00000538126	T;T;T	0.30714	1.52;1.52;1.52	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.68091	0.2963	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.76217	-0.3040	10	0.87932	D	0	-15.5586	19.0677	0.93119	0.0:0.0:1.0:0.0	.	384;384	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	L	191;384;384;384;384	ENSP00000353610:P384L;ENSP00000348611:P384L;ENSP00000377159:P384L	ENSP00000299971:P191L	P	-	2	0	PHLPP2	70270276	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.869000	0.99810	2.747000	0.94245	0.650000	0.86243	CCT	-	PHLPP2	-	smart_Leu-rich_rpt_typical-subtyp		0.403	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHLPP2	HGNC	protein_coding	OTTHUMT00000434139.1	0	0	0	30	30	95	0.00	0.00	G	NM_015020		71712775	-1	14	36	3	6	tier1	no_errors	ENST00000356272	ensembl	human	known	74_37	missense	82.35	85.71	SNP	1.000	A	14	3
SPTBN4	57731	genome.wustl.edu	37	19	41019260	41019260	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr19:41019260G>A	ENST00000352632.3	+	14	2650	c.2564G>A	c.(2563-2565)cGc>cAc	p.R855H	SPTBN4_ENST00000598249.1_Missense_Mutation_p.R855H|SPTBN4_ENST00000595535.1_Missense_Mutation_p.R855H|SPTBN4_ENST00000344104.3_Missense_Mutation_p.R855H|SPTBN4_ENST00000338932.3_Missense_Mutation_p.R855H			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	855					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGCAGGTGCGCGTGGTGGAA	0.711													ENSG00000160460																																					0													18.0	22.0	21.0					19																	41019260		2201	4293	6494	SO:0001583	missense	0			-	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.2564G>A	19.37:g.41019260G>A	ENSP00000263373:p.Arg855His		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R855H	ENST00000352632.3	37	c.2564	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701983	0.68501	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.56275	0.47;0.47;0.47	3.39	3.39	0.38822	.	0.000000	0.64402	D	0.000005	T	0.65657	0.2712	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.98;0.993	T	0.66575	-0.5889	10	0.51188	T	0.08	.	10.3098	0.43702	0.0:0.2024:0.7976:0.0	.	855;855	Q9H254;Q71S06	SPTN4_HUMAN;.	H	855	ENSP00000263373:R855H;ENSP00000340345:R855H;ENSP00000340741:R855H	ENSP00000340345:R855H	R	+	2	0	SPTBN4	45711100	0.995000	0.38212	1.000000	0.80357	0.611000	0.37282	7.357000	0.79456	1.918000	0.55548	0.313000	0.20887	CGC	-	SPTBN4	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.711	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	0	0	0	45	45	6	0.00	0.00	G			41019260	+1	4	2	7	0	tier1	no_errors	ENST00000352632	ensembl	human	known	74_37	missense	33.33	100.00	SNP	1.000	A	4	7
NEUROG3	50674	genome.wustl.edu	37	10	71332468	71332468	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr10:71332468G>C	ENST00000242462.4	-	2	361	c.332C>G	c.(331-333)cCc>cGc	p.P111R		NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	111	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						TGGGAAGGTGGGCAGGACACC	0.627													ENSG00000122859																																					0													96.0	69.0	78.0					10																	71332468		2203	4300	6503	SO:0001583	missense	0			-	AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.332C>G	10.37:g.71332468G>C	ENSP00000242462:p.Pro111Arg		Q5VVI0|Q6DJX6|Q9BY24	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.P111R	ENST00000242462.4	37	c.332	CCDS31212.1	10	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337015	0.81801	.	.	ENSG00000122859	ENST00000242462	D	0.97378	-4.36	4.53	4.53	0.55603	Helix-loop-helix DNA-binding (5);	0.000000	0.40728	N	0.001039	D	0.98985	0.9654	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99305	1.0902	10	0.87932	D	0	-23.753	15.9925	0.80217	0.0:0.0:1.0:0.0	.	111	Q9Y4Z2	NGN3_HUMAN	R	111	ENSP00000242462:P111R	ENSP00000242462:P111R	P	-	2	0	NEUROG3	71002474	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	9.479000	0.97929	2.307000	0.77673	0.591000	0.81541	CCC	-	NEUROG3	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom		0.627	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROG3	HGNC	protein_coding	OTTHUMT00000048464.1	0	0	1	86	86	30	0.00	3.23	G	NM_020999		71332468	-1	43	28	35	9	tier1	no_errors	ENST00000242462	ensembl	human	known	74_37	missense	55.13	75.68	SNP	1.000	C	43	35
ERC2	26059	genome.wustl.edu	37	3	55886574	55886574	+	Intron	DEL	A	A	-	rs10575780|rs59684995|rs398062340	byFrequency	TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr3:55886574delA	ENST00000288221.6	-	14	2820				MIR3938_ENST00000582157.1_RNA	NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		tttttaaattaaaaaaaaatt	0.373													ENSG00000264013																																					0																																										SO:0001627	intron_variant	0				AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2564+35842T>-	3.37:g.55886574delA			Q2T9F6|Q86TK4	R	DEL	-	NULL	ENST00000288221.6	37	NULL	CCDS46851.1	3																																																																																				MIR3938	-	-		0.373	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3938	HGNC	protein_coding	OTTHUMT00000350884.2	0	0	1	21	21	39	0.00	2.50	A	NM_015576		55886574	-1	13	13	23	22	tier1	no_errors	ENST00000582157	ensembl	human	known	74_37	rna	36.11	37.14	DEL	0.000	-	13	23
IL17C	27189	genome.wustl.edu	37	16	88706424	88706424	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr16:88706424delA	ENST00000244241.4	+	3	587	c.538delA	c.(538-540)accfs	p.T180fs		NM_013278.3	NP_037410.1	Q9P0M4	IL17C_HUMAN	interleukin 17C	180					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|neutrophil differentiation (GO:0030223)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			large_intestine(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0477)		TGCCTTCCACACCGAGTTCAT	0.716													ENSG00000124391																																					0													48.0	54.0	52.0					16																	88706424		1979	4140	6119	SO:0001589	frameshift_variant	0				AF152099	CCDS42217.1	16q24	2011-07-14			ENSG00000124391	ENSG00000124391		"""Interleukins and interleukin receptors"""	5983	protein-coding gene	gene with protein product		604628				10639155	Standard	NM_013278		Approved	IL-17C, CX2, IL-21, MGC126884, MGC138401	uc002fla.3	Q9P0M4		ENST00000244241.4:c.538delA	16.37:g.88706424delA	ENSP00000244241:p.Thr180fs		Q3MIG8|Q9HC75	Frame_Shift_Del	DEL	pfam_IL-17_fam,prints_IL-17_chr	p.T180fs	ENST00000244241.4	37	c.538	CCDS42217.1	16																																																																																				IL17C	-	pfam_IL-17_fam,prints_IL-17_chr		0.716	IL17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17C	HGNC	protein_coding	OTTHUMT00000422575.1	0	0	0	79	79	12	0.00	0.00	A	NM_013278		88706424	+1	2	0	16	6	tier1	no_errors	ENST00000244241	ensembl	human	known	74_37	frame_shift_del	11.11	0.00	DEL	0.000	-	2	16
TNRC6A	27327	genome.wustl.edu	37	16	24788423	24788434	+	In_Frame_Del	DEL	GCAGCCACAGCC	GCAGCCACAGCC	-	rs10593507|rs60829899|rs71156436|rs11644562|rs71383714	byFrequency	TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	GCAGCCACAGCC	GCAGCCACAGCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr16:24788423_24788434delGCAGCCACAGCC	ENST00000395799.3	+	5	462_473	c.333_344delGCAGCCACAGCC	c.(331-345)cagcagccacagccg>cag	p.QPQP112del	TNRC6A_ENST00000315183.7_In_Frame_Del_p.QPQP112del	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	112	Gln-rich.|Interaction with argonaute family proteins.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		agccacagcagcagccacagccgcagccgcag	0.59													ENSG00000090905		660	0.131789	0.0908	0.1455	5008	,	,		12550	0.126		0.162	False		,,,				2504	0.1524																0										502,3262		90,322,1470						1.3	0.2		dbSNP_130	23	1410,6010		189,1032,2489	no	coding	TNRC6A	NM_014494.2		279,1354,3959	A1A1,A1R,RR		19.0027,13.3369,17.0959				1912,9272				SO:0001651	inframe_deletion	0				U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.333_344delGCAGCCACAGCC	16.37:g.24788423_24788434delGCAGCCACAGCC	ENSP00000379144:p.Gln112_Pro115del		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	In_Frame_Del	DEL	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.PQPQ115in_frame_del	ENST00000395799.3	37	c.333_344	CCDS10624.2	16																																																																																				TNRC6A	-	NULL		0.590	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1	0	0	0	5	5	5	0.00	0.00	GCAGCCACAGCC	NM_020847		24788434	+1	0	0	4	4	tier1	no_errors	ENST00000395799	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.272:0.260:0.233:0.187:0.163:0.109:0.101:0.113:0.113:0.139:0.129:0.003	-	0	4
YY1	7528	genome.wustl.edu	37	14	100705951	100705951	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr14:100705951G>T	ENST00000262238.4	+	1	630	c.370G>T	c.(370-372)Gag>Tag	p.E124*	RP11-638I2.4_ENST00000554537.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	124	Interaction with the SMAD1/SMAD4 complex.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				GCTGCGCGCCGAGGACGGCTT	0.706													ENSG00000100811																																					0													35.0	38.0	37.0					14																	100705951		2196	4297	6493	SO:0001587	stop_gained	0			-	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.370G>T	14.37:g.100705951G>T	ENSP00000262238:p.Glu124*		Q14935	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.E124*	ENST00000262238.4	37	c.370	CCDS9957.1	14	.	.	.	.	.	.	.	.	.	.	G	38	6.985642	0.97983	.	.	ENSG00000100811	ENST00000262238	.	.	.	2.63	0.865	0.19074	.	0.065771	0.64402	U	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	7.2023	0.25887	0.2159:0.0:0.7841:0.0	.	.	.	.	X	124	.	ENSP00000262238:E124X	E	+	1	0	YY1	99775704	1.000000	0.71417	0.995000	0.50966	0.986000	0.74619	7.171000	0.77595	0.161000	0.19458	0.549000	0.68633	GAG	-	YY1	-	pirsf_TF_Yin_yang		0.706	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY1	HGNC	protein_coding	OTTHUMT00000318277.1	0	0	0	49	49	12	0.00	0.00	G	NM_003403		100705951	+1	3	0	10	9	tier1	no_errors	ENST00000262238	ensembl	human	known	74_37	nonsense	23.08	0.00	SNP	1.000	T	3	10
CYP4F24P	388514	genome.wustl.edu	37	19	15871188	15871188	+	lincRNA	SNP	C	C	G			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr19:15871188C>G	ENST00000595525.1	+	0	4																											GCGCCAGGACCACCTTCATCT	0.657													ENSG00000268673																																					0																																												0			-																													19.37:g.15871188C>G				R	SNP	-	NULL	ENST00000595525.1	37	NULL		19																																																																																			-	LLNLR-249E10.1	-	-		0.657	LLNLR-249E10.1-001	KNOWN	basic	lincRNA	ENSG00000268673	Clone_based_vega_gene	lincRNA	OTTHUMT00000472008.1	0	0	0	127	127	2	0.00	0.00	C			15871188	+1	52	0	195	1	tier1	no_errors	ENST00000595525	ensembl	human	known	74_37	rna	21.05	0.00	SNP	1.000	G	52	195
FAM86HP	729375	genome.wustl.edu	37	3	129824474	129824474	+	RNA	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr3:129824474G>C	ENST00000500074.2	-	0	155									family with sequence similarity 86, member H, pseudogene																		ACAGCCTCGTGCTGGGGGCAG	0.527													ENSG00000253540																																					0																																												0			-			3q22.1	2011-07-01			ENSG00000253540	ENSG00000253540			42359	pseudogene	pseudogene							Standard	NR_024252		Approved		uc011ble.1		OTTHUMG00000159796		3.37:g.129824474G>C				R	SNP	-	NULL	ENST00000500074.2	37	NULL		3																																																																																			-	FAM86HP	-	-		0.527	FAM86HP-002	PUTATIVE	basic	processed_transcript	FAM86HP	HGNC	pseudogene	OTTHUMT00000358348.1	0	0	0	185	185	0	0.00	0.00	G			129824474	-1	50	0	135	0	tier1	no_errors	ENST00000500074	ensembl	human	putative	74_37	rna	27.03	0.00	SNP	1.000	C	50	135
GALNT6	11226	genome.wustl.edu	37	12	51785401	51785402	+	5'Flank	INS	-	-	AGCCGC	rs143011477	byFrequency	TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr12:51785401_51785402insAGCCGC	ENST00000356317.3	-	0	0				GALNT6_ENST00000603203.1_5'UTR|SLC4A8_ENST00000535225.2_Intron	NM_007210.3	NP_009141.2	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGCCGAGGCAAAGCCGCAGCCG	0.757													ENSG00000139629		1258	0.251198	0.0234	0.245	5008	,	,		9662	0.2897		0.4155	False		,,,				2504	0.3548																0																																										SO:0001631	upstream_gene_variant	0				Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4			12.37:g.51785402_51785407dupAGCCGC	Exception_encountered		Q8IYH4|Q9H6G2|Q9UIV5	R	INS	-	NULL	ENST00000356317.3	37	NULL	CCDS8813.1	12																																																																																				GALNT6	-	-		0.757	GALNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT6	HGNC	protein_coding	OTTHUMT00000469736.1	0	0	0	1	1	1	0.00	0.00	-	NM_007210		51785402	-1	0	0	0	0	tier1	no_errors	ENST00000603203	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.021:0.127	AGCCGC	0	0
GOLGA8M	653720	genome.wustl.edu	37	15	28953550	28953550	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr15:28953550T>C	ENST00000563027.1	-	5	318	c.319A>G	c.(319-321)Aag>Gag	p.K107E	GOLGA8M_ENST00000563213.1_5'Flank|GOLGA8M_ENST00000340249.3_5'UTR					golgin A8 family, member M																		ACTTGTTTCTTCTGTTGTTTC	0.517													ENSG00000188626																																					0																																										SO:0001583	missense	0			-		CCDS61572.1	15q13.1	2014-03-21			ENSG00000188626	ENSG00000188626			44404	protein-coding gene	gene with protein product							Standard	NM_001282468		Approved			H3BSY2	OTTHUMG00000176338	ENST00000563027.1:c.319A>G	15.37:g.28953550T>C	ENSP00000456927:p.Lys107Glu			Missense_Mutation	SNP	NULL	p.K107E	ENST00000563027.1	37	c.319		15																																																																																			-	GOLGA8M	-	NULL		0.517	GOLGA8M-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8M	HGNC	protein_coding	OTTHUMT00000431777.1	0	0	0	39	39	0	0.00	0.00	T			28953550	-1	23	0	36	0	tier1	no_errors	ENST00000563027	ensembl	human	novel	74_37	missense	38.98	0.00	SNP	0.825	C	23	36
HS3ST3B1	9953	genome.wustl.edu	37	17	14248744	14248744	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr17:14248744G>T	ENST00000360954.2	+	2	1390	c.954G>T	c.(952-954)aaG>aaT	p.K318N		NM_006041.1	NP_006032.1	Q9Y662	HS3SB_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1	318					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)			large_intestine(3)|lung(3)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)		TGGGCCTCAAGAGGATCATCA	0.642													ENSG00000125430																																					0													5.0	5.0	5.0					17																	14248744		1836	3820	5656	SO:0001583	missense	0			-	AF105377	CCDS11167.1	17p12	2007-04-02			ENSG00000125430	ENSG00000125430	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5198	protein-coding gene	gene with protein product		604058				9988767	Standard	NM_006041		Approved	3OST3B1, 30ST3B1	uc002goh.1	Q9Y662	OTTHUMG00000058810	ENST00000360954.2:c.954G>T	17.37:g.14248744G>T	ENSP00000354213:p.Lys318Asn		B3KN58|D3DTS6	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.K318N	ENST00000360954.2	37	c.954	CCDS11167.1	17	.	.	.	.	.	.	.	.	.	.	G	17.50	3.406046	0.62288	.	.	ENSG00000125430	ENST00000360954	T	0.42900	0.96	4.85	3.88	0.44766	Sulfotransferase domain (1);	0.000000	0.85682	U	0.000000	T	0.60792	0.2296	M	0.65975	2.015	0.80722	D	1	D	0.60575	0.988	D	0.71656	0.974	T	0.65286	-0.6205	10	0.66056	D	0.02	.	13.8485	0.63481	0.0754:0.0:0.9246:0.0	.	318	Q9Y662	HS3SB_HUMAN	N	318	ENSP00000354213:K318N	ENSP00000354213:K318N	K	+	3	2	HS3ST3B1	14189469	1.000000	0.71417	0.999000	0.59377	0.575000	0.36095	5.561000	0.67339	1.363000	0.46019	-0.262000	0.10625	AAG	-	HS3ST3B1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.642	HS3ST3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST3B1	HGNC	protein_coding	OTTHUMT00000129998.1	0	0	0	23	23	1	0.00	0.00	G	NM_006041		14248744	+1	5	0	27	3	tier1	no_errors	ENST00000360954	ensembl	human	known	74_37	missense	15.62	0.00	SNP	1.000	T	5	27
INSM2	84684	genome.wustl.edu	37	14	36004278	36004278	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr14:36004278G>T	ENST00000307169.3	+	1	1031	c.820G>T	c.(820-822)Gac>Tac	p.D274Y		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	274					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		GCAGTACGCAGACCCCTTCGC	0.682													ENSG00000168348																																					0													29.0	29.0	29.0					14																	36004278		2202	4294	6496	SO:0001583	missense	0			-	AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.820G>T	14.37:g.36004278G>T	ENSP00000306523:p.Asp274Tyr		A1L432|J9Y024|Q8N8K7|Q96Q84	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D274Y	ENST00000307169.3	37	c.820	CCDS9657.1	14	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420738	0.83559	.	.	ENSG00000168348	ENST00000307169	T	0.27720	1.65	4.95	4.95	0.65309	Zinc finger, C2H2-like (1);	0.000000	0.34002	N	0.004359	T	0.54695	0.1874	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56177	-0.8022	10	0.51188	T	0.08	-26.6406	16.9569	0.86262	0.0:0.0:1.0:0.0	.	274	Q96T92	INSM2_HUMAN	Y	274	ENSP00000306523:D274Y	ENSP00000306523:D274Y	D	+	1	0	INSM2	35074029	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.382000	0.97209	2.269000	0.75478	0.563000	0.77884	GAC	-	INSM2	-	smart_Znf_C2H2-like		0.682	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSM2	HGNC	protein_coding	OTTHUMT00000276686.1	0	0	0	89	89	0	0.00	0.00	G			36004278	+1	4	0	34	2	tier1	no_errors	ENST00000307169	ensembl	human	known	74_37	missense	10.53	0.00	SNP	1.000	T	4	34
PLEKHN1	84069	genome.wustl.edu	37	1	906235	906235	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr1:906235G>C	ENST00000379409.2	+	5	611	c.581G>C	c.(580-582)tGt>tCt	p.C194S	PLEKHN1_ENST00000379410.3_Intron|PLEKHN1_ENST00000379407.3_Intron			Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N member 1	194	PH 1.									central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	9	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		GTGTATGTGTGTGCCCTCTCT	0.682													ENSG00000187583																																					0													19.0	24.0	22.0					1																	906235		2200	4294	6494	SO:0001583	missense	0			-	AL136730	CCDS4.1, CCDS53256.1	1p36.33	2013-01-11			ENSG00000187583	ENSG00000187583		"""Pleckstrin homology (PH) domain containing"""	25284	protein-coding gene	gene with protein product						11230166	Standard	NM_032129		Approved	DKFZP434H2010	uc001acd.3	Q494U1	OTTHUMG00000040756	ENST00000379409.2:c.581G>C	1.37:g.906235G>C	ENSP00000368719:p.Cys194Ser		Q494U2|Q5SV98|Q9H0M7	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.C194S	ENST00000379409.2	37	c.581		1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.714533	0.00706	.	.	ENSG00000187583	ENST00000379409	T	0.42900	0.96	2.46	-3.7	0.04437	Pleckstrin homology domain (1);	1.807340	0.03907	U	0.281223	T	0.23766	0.0575	.	.	.	0.09310	N	1	B	0.21309	0.054	B	0.11329	0.006	T	0.12243	-1.0555	8	.	.	.	5.355	6.5243	0.22293	0.0:0.2433:0.6063:0.1504	.	194	Q494U1	PKHN1_HUMAN	S	194	ENSP00000368719:C194S	.	C	+	2	0	PLEKHN1	896098	0.002000	0.14202	0.001000	0.08648	0.008000	0.06430	0.131000	0.15870	-0.770000	0.04614	-0.537000	0.04273	TGT	-	PLEKHN1	-	smart_Pleckstrin_homology		0.682	PLEKHN1-005	KNOWN	basic	protein_coding	PLEKHN1	HGNC	protein_coding	OTTHUMT00000473256.1	0	0	0	23	23	1	0.00	0.00	G	NM_032129		906235	+1	5	0	4	0	tier1	no_errors	ENST00000379409	ensembl	human	known	74_37	missense	55.56	0.00	SNP	0.001	C	5	4
TMEM191C	645426	genome.wustl.edu	37	22	21822373	21822385	+	lincRNA	DEL	AGGATCCGGGGGT	AGGATCCGGGGGT	-	rs3016118		TCGA-KD-A5QS-01A-11D-A27P-09	TCGA-KD-A5QS-10A-01D-A27P-09	AGGATCCGGGGGT	AGGATCCGGGGGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e341a72a-16fb-4279-b2af-6e2e1e0dafbc	40e2c457-030c-4524-af8a-0da16e6a4b63	g.chr22:21822373_21822385delAGGATCCGGGGGT	ENST00000449424.1	+	0	415_427							A6NGB0	T191C_HUMAN	transmembrane protein 191C							integral component of membrane (GO:0016021)											ggaagggggcaggatccgggggtggggtgaggt	0.704													ENSG00000206140																																					0																																												0						22q11.21	2013-04-03			ENSG00000206140	ENSG00000206140			33601	other	unknown							Standard	NM_001207052		Approved		uc021wmg.1	A6NGB0	OTTHUMG00000150780		22.37:g.21822373_21822385delAGGATCCGGGGGT				R	DEL	-	NULL	ENST00000449424.1	37	NULL		22																																																																																				TMEM191C	-	-		0.704	TMEM191C-004	KNOWN	basic|exp_conf	lincRNA	TMEM191C	HGNC	lincRNA	OTTHUMT00000320053.1	0	0	0	0	0	0	0.00	0.00	AGGATCCGGGGGT	NM_001207052		21822385	+1	0	0	0	0	tier1	no_errors	ENST00000449424	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.003:0.005:0.001:0.001:0.002:0.003:0.000:0.000:0.000:0.057:0.077:0.000:0.000	-	0	0
