#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TUBB8	347688	genome.wustl.edu	37	10	93505	93505	+	Missense_Mutation	SNP	C	C	T	rs147114528	byFrequency	TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr10:93505C>T	ENST00000309812.4	-	4	889	c.827G>A	c.(826-828)cGg>cAg	p.R276Q	TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000447903.2_Missense_Mutation_p.R204Q|TUBB8_ENST00000413237.3_5'Flank	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	276					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R276Q(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CTGGCTGCCCCGGCTGGTCAG	0.627													ENSG00000173876																									Pancreas(192;2041 3010 9013 18103)												1	Substitution - Missense(1)	NS(1)											21.0	26.0	24.0					10																	93505		1645	3246	4891	SO:0001583	missense	0			-	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.827G>A	10.37:g.93505C>T	ENSP00000311042:p.Arg276Gln		Q5SQX9|Q8WZ78	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.R276Q	ENST00000309812.4	37	c.827	CCDS7051.1	10	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301072	0.23650	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.80994	-1.44	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.094074	0.38326	N	0.001737	T	0.77046	0.4073	M	0.66560	2.04	0.28122	N	0.930544	B;P	0.44776	0.06;0.843	B;P	0.45167	0.009;0.472	T	0.71020	-0.4713	9	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	239;276	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	Q	204;242;239;276	ENSP00000403895:R204Q	ENSP00000272035:R242Q	R	-	2	0	RP11-631M21.2	83505	0.994000	0.37717	0.219000	0.23793	0.222000	0.24845	3.707000	0.54838	0.119000	0.18210	0.121000	0.15741	CGG	rs147114528	TUBB8	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Alpha_tubulin		0.627	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	0	0		81	81		0.00		C	NM_177987		93505	-1	6		32		tier1	no_errors	ENST00000309812	ensembl	human	known	74_37	missense	15.00		SNP	1.000	T	6	32
DCHS2	54798	genome.wustl.edu	37	4	155298547	155298547	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr4:155298547G>A	ENST00000357232.4	-	3	283	c.284C>T	c.(283-285)tCt>tTt	p.S95F	DCHS2_ENST00000339452.1_Missense_Mutation_p.S701F	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	95	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATCATAAAGAGAATATTCAAT	0.453													ENSG00000197410																																					0													79.0	78.0	78.0					4																	155298547		2203	4300	6503	SO:0001583	missense	0			-	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.284C>T	4.37:g.155298547G>A	ENSP00000349768:p.Ser95Phe		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_D-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S95F	ENST00000357232.4	37	c.284	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	G	8.603	0.887234	0.17540	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.55052	0.54;0.54	5.64	2.57	0.30868	Cadherin (4);Cadherin-like (1);	0.201719	0.34133	N	0.004230	T	0.44932	0.1317	L	0.48986	1.54	0.58432	D	0.999991	B;B	0.18166	0.016;0.026	B;B	0.19946	0.022;0.027	T	0.39057	-0.9632	10	0.44086	T	0.13	.	10.5153	0.44885	0.2807:0.0:0.7193:0.0	.	701;95	E9PC11;Q6V1P9	.;PCD23_HUMAN	F	95;701;701	ENSP00000349768:S95F;ENSP00000345062:S701F	ENSP00000345062:S701F	S	-	2	0	DCHS2	155517997	0.985000	0.35326	0.487000	0.27428	0.665000	0.39181	0.783000	0.26802	0.748000	0.32831	0.561000	0.74099	TCT	-	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.453	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	0	0		43	43		0.00		G	NM_001142552		155298547	-1	21		22		tier1	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	48.84		SNP	0.861	A	21	22
USH2A	7399	genome.wustl.edu	37	1	216246484	216246484	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr1:216246484C>T	ENST00000307340.3	-	28	6117	c.5731G>A	c.(5731-5733)Gga>Aga	p.G1911R	RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000446411.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.G1911R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1911	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G1911R(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGCTCTTTTCCCTGGTAAACC	0.463										HNSCC(13;0.011)			ENSG00000042781																																					1	Substitution - Missense(1)	ovary(1)											86.0	76.0	79.0					1																	216246484		2203	4300	6503	SO:0001583	missense	0			-	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5731G>A	1.37:g.216246484C>T	ENSP00000305941:p.Gly1911Arg		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.G1911R	ENST00000307340.3	37	c.5731	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.249447	0.95305	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.44881	0.91;0.91	6.03	6.03	0.97812	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.44097	D	0.000492	T	0.67031	0.2850	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65344	-0.6191	10	0.56958	D	0.05	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	1911	O75445	USH2A_HUMAN	R	1911	ENSP00000305941:G1911R;ENSP00000355910:G1911R	ENSP00000305941:G1911R	G	-	1	0	USH2A	214313107	1.000000	0.71417	0.907000	0.35723	0.999000	0.98932	7.294000	0.78760	2.854000	0.98071	0.655000	0.94253	GGA	-	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3		0.463	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0		24	24		0.00		C	NM_007123		216246484	-1	8		9		tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	47.06		SNP	1.000	T	8	9
LIPF	8513	genome.wustl.edu	37	10	90438361	90438361	+	Missense_Mutation	SNP	G	G	C	rs150812830		TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr10:90438361G>C	ENST00000238983.4	+	10	1166	c.1120G>C	c.(1120-1122)Gac>Cac	p.D374H	LIPF_ENST00000608620.1_Missense_Mutation_p.D341H|LIPF_ENST00000394375.3_Missense_Mutation_p.D384H|LIPF_ENST00000355843.2_Missense_Mutation_p.D351H	NM_004190.3	NP_004181.1	P07098	LIPG_HUMAN	lipase, gastric	374					lipid catabolic process (GO:0016042)|malate metabolic process (GO:0006108)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)	lipid binding (GO:0008289)|malate dehydrogenase activity (GO:0016615)|triglyceride lipase activity (GO:0004806)			NS(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(6)	13		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)	Orlistat(DB01083)	CAATCACTTGGACTTTATCTG	0.398													ENSG00000182333																																					0								G	HIS/ASP,HIS/ASP,HIS/ASP,HIS/ASP	1,4405	2.1+/-5.4	0,1,2202	92.0	95.0	94.0		1021,1150,1051,1120	4.1	1.0	10	dbSNP_134	94	0,8600		0,0,4300	no	missense,missense,missense,missense	LIPF	NM_001198828.1,NM_001198829.1,NM_001198830.1,NM_004190.3	81,81,81,81	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	341/366,384/409,351/376,374/399	90438361	1,13005	2203	4300	6503	SO:0001583	missense	0			-	X05997	CCDS7389.1, CCDS55718.1, CCDS55719.1, CCDS65896.1	10q23	2005-10-30			ENSG00000182333	ENSG00000182333	3.1.1.3		6622	protein-coding gene	gene with protein product		601980				3304425, 9186906	Standard	NM_004190		Approved	HGL, HLAL	uc010qmt.2	P07098	OTTHUMG00000018695	ENST00000238983.4:c.1120G>C	10.37:g.90438361G>C	ENSP00000238983:p.Asp374His		B7Z723|F5H1P4|Q2M1P6|Q5VXI7|Q5VXI8|Q658L8	Missense_Mutation	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.D384H	ENST00000238983.4	37	c.1150	CCDS7389.1	10	.	.	.	.	.	.	.	.	.	.	G	18.54	3.647063	0.67358	2.27E-4	0.0	ENSG00000182333	ENST00000394375;ENST00000238983;ENST00000355843	T;T;T	0.72942	-0.7;-0.7;-0.7	5.01	4.1	0.47936	Alpha/beta hydrolase fold-1 (1);	0.000000	0.56097	D	0.000036	D	0.88529	0.6461	H	0.95884	3.735	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.996;1.0	D	0.92027	0.5630	10	0.87932	D	0	-16.174	14.1108	0.65120	0.0:0.0:0.8481:0.1519	.	341;384;351;374	Q5VXI8;F5H1P4;Q658L8;P07098	.;.;.;LIPG_HUMAN	H	384;374;341	ENSP00000377900:D384H;ENSP00000238983:D374H;ENSP00000348101:D341H	ENSP00000238983:D374H	D	+	1	0	LIPF	90428341	1.000000	0.71417	0.990000	0.47175	0.796000	0.44982	6.026000	0.70873	1.466000	0.48025	0.655000	0.94253	GAC	rs150812830	LIPF	-	pfam_AB_hydrolase_1		0.398	LIPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPF	HGNC	protein_coding	OTTHUMT00000049256.1	0	0		68	68		0.00		G			90438361	+1	41		48		tier1	no_errors	ENST00000394375	ensembl	human	known	74_37	missense	45.56		SNP	1.000	C	41	48
GNA15	2769	genome.wustl.edu	37	19	3148865	3148866	+	Intron	INS	-	-	CAGGG	rs201896289|rs371941615	byFrequency	TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr19:3148865_3148866insCAGGG	ENST00000262958.3	+	2	588				AC005264.2_ENST00000587587.1_RNA	NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)						activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		TCCCCAGACTTcagggcagggc	0.678													ENSG00000267551		97	0.019369	0.0038	0.0187	5008	,	,		16436	0.0069		0.0318	False		,,,				2504	0.0409																0																																										SO:0001627	intron_variant	0					CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.330+92->CAGGG	19.37:g.3148871_3148875dupCAGGG			E9KL40|E9KL47|O75247|Q53XK2	R	INS	-	NULL	ENST00000262958.3	37	NULL	CCDS12104.1	19																																																																																				AC005264.2	-	-		0.678	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100996351	Clone_based_vega_gene	protein_coding	OTTHUMT00000452320.2									-	NM_002068		3148866	-1					tier1	no_errors	ENST00000587587	ensembl	human	known	74_37	rna			INS	0.000:0.001	CAGGG		
SETD2	29072	genome.wustl.edu	37	3	47164759	47164759	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr3:47164759C>T	ENST00000409792.3	-	3	1409	c.1367G>A	c.(1366-1368)cGa>cAa	p.R456Q		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	456	Arg-rich.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGAACTCTCTCGTGCTCTGTT	0.453			"""N, F, S, Mis"""		clear cell renal carcinoma								ENSG00000181555																												Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													262.0	201.0	219.0					3																	47164759		692	1591	2283	SO:0001583	missense	0			-	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1367G>A	3.37:g.47164759C>T	ENSP00000386759:p.Arg456Gln		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_dom,superfamily_WW_dom,superfamily_Ferritin-like_SF,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_dom,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_dom	p.R456Q	ENST00000409792.3	37	c.1367	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448030	0.84101	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	T;T	0.14893	2.47;2.47	5.0	5.0	0.66597	.	.	.	.	.	T	0.30541	0.0768	N	0.24115	0.695	0.47037	D	0.99929	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.08848	-1.0702	9	0.87932	D	0	.	18.8556	0.92251	0.0:1.0:0.0:0.0	.	456;456	F2Z317;Q9BYW2	.;SETD2_HUMAN	Q	456;456;456;412	ENSP00000386759:R456Q;ENSP00000416401:R412Q	ENSP00000386759:R456Q	R	-	2	0	SETD2	47139763	1.000000	0.71417	0.993000	0.49108	0.965000	0.64279	5.560000	0.67332	2.758000	0.94735	0.655000	0.94253	CGA	-	SETD2	-	NULL		0.453	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	0	0		88	88		0.00		C	NM_014159		47164759	-1	26		56		tier1	no_errors	ENST00000409792	ensembl	human	known	74_37	missense	31.33		SNP	0.990	T	26	56
MLLT3	4300	genome.wustl.edu	37	9	20622417	20622417	+	5'UTR	SNP	G	G	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr9:20622417G>A	ENST00000380338.4	-	0	125				MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_5'Flank|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3						anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		Gcgctcgcttgctcgctcgct	0.567			T	MLL	ALL								ENSG00000171843																												Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	0																																										SO:0001623	5_prime_UTR_variant	0			-	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.-162C>T	9.37:g.20622417G>A			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	R	SNP	-	NULL	ENST00000380338.4	37	NULL	CCDS6494.1	9																																																																																			-	MLLT3	-	-		0.567	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1	0	0		58	58		0.00		G	NM_004529		20622417	-1	27		31		tier1	no_errors	ENST00000475957	ensembl	human	known	74_37	rna	46.55		SNP	0.983	A	27	31
NPIPA1	9284	genome.wustl.edu	37	16	15045631	15045631	+	Missense_Mutation	SNP	G	G	A	rs201805072	byFrequency	TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr16:15045631G>A	ENST00000328085.6	+	8	802	c.802G>A	c.(802-804)Gag>Aag	p.E268K	NPIPA1_ENST00000472413.1_3'UTR	NM_006985.2	NP_008916.2	Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1	268	Pro-rich.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											GACACCTTCCGAGTGTCTGCT	0.517													ENSG00000183426																																					0													83.0	70.0	75.0					16																	15045631		1386	2350	3736	SO:0001583	missense	0			-	AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000328085.6:c.802G>A	16.37:g.15045631G>A	ENSP00000331843:p.Glu268Lys		O15102	Missense_Mutation	SNP	NULL	p.E268K	ENST00000328085.6	37	c.802	CCDS10557.1	16	.	.	.	.	.	.	.	.	.	.	.	7.020	0.558597	0.13436	.	.	ENSG00000183426	ENST00000432470;ENST00000328085	T	0.51817	0.69	.	.	.	.	.	.	.	.	T	0.42720	0.1215	M	0.64997	1.995	0.09310	N	1	P	0.41265	0.744	B	0.40410	0.328	T	0.34030	-0.9845	7	0.66056	D	0.02	.	.	.	.	.	268	Q9UND3	NPIP_HUMAN	K	268	ENSP00000331843:E268K	ENSP00000331843:E268K	E	+	1	0	NPIP	14953132	0.018000	0.18449	0.031000	0.17742	0.031000	0.12232	0.112000	0.15479	0.121000	0.18284	0.123000	0.15791	GAG	rs201805072	NPIPA1	-	NULL		0.517	NPIPA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	NPIPA1	HGNC	protein_coding	OTTHUMT00000207326.2	0	0		43	43		0.00		G	NM_006985		15045631	+1	5		38		tier1	no_errors	ENST00000328085	ensembl	human	novel	74_37	missense	11.63		SNP	0.032	A	5	38
FAM230B	642633	genome.wustl.edu	37	22	21537762	21537762	+	RNA	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr22:21537762C>T	ENST00000451257.1	+	0	748									family with sequence similarity 230, member B (non-protein coding)																		CCAGCGAGGACGCCGCCCAGG	0.716													ENSG00000215498																																					0																																												0			-	BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21537762C>T				R	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			-	FAM230B	-	-		0.716	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1	0	0		58	58		0.00		C	NR_108107		21537762	+1	55		46		tier1	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	53.92		SNP	0.003	T	55	46
MTUS2	23281	genome.wustl.edu	37	13	29675048	29675048	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr13:29675048C>T	ENST00000431530.3	+	3	2673	c.2615C>T	c.(2614-2616)tCa>tTa	p.S872L		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	862	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.|Sufficient for interaction with KIF2C.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGCGTCTCCTCAGTCTCCAGC	0.632													ENSG00000132938																																					0													8.0	9.0	9.0					13																	29675048		2032	4183	6215	SO:0001583	missense	0			-	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2615C>T	13.37:g.29675048C>T	ENSP00000392057:p.Ser872Leu		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.S872L	ENST00000431530.3	37	c.2615	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	C	16.43	3.121251	0.56613	.	.	ENSG00000132938	ENST00000431530	T	0.28255	1.62	5.25	5.25	0.73442	.	0.094831	0.41938	D	0.000799	T	0.47414	0.1444	L	0.59436	1.845	0.80722	D	1	D	0.63046	0.992	P	0.56865	0.808	T	0.35076	-0.9803	9	.	.	.	.	17.8374	0.88701	0.0:1.0:0.0:0.0	.	862	Q5JR59	MTUS2_HUMAN	L	872	ENSP00000392057:S872L	.	S	+	2	0	MTUS2	28573048	1.000000	0.71417	0.928000	0.36995	0.159000	0.22180	5.218000	0.65257	2.454000	0.82982	0.563000	0.77884	TCA	-	MTUS2	-	NULL		0.632	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	0	0		75	75		0.00		C	XM_166270		29675048	+1	27		40		tier1	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	40.30		SNP	0.999	T	27	40
TUBGCP3	10426	genome.wustl.edu	37	13	113170867	113170867	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr13:113170867C>T	ENST00000261965.3	-	17	2159	c.1973G>A	c.(1972-1974)aGc>aAc	p.S658N	TUBGCP3_ENST00000375669.3_Missense_Mutation_p.S658N	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	658					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					TAGGTAGTGGCTCATACATTC	0.438													ENSG00000126216																																					0													111.0	96.0	101.0					13																	113170867		2203	4300	6503	SO:0001583	missense	0			-	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.1973G>A	13.37:g.113170867C>T	ENSP00000261965:p.Ser658Asn		O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	pfam_TUBGCP	p.S658N	ENST00000261965.3	37	c.1973	CCDS9525.1	13	.	.	.	.	.	.	.	.	.	.	C	12.38	1.919618	0.33908	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	T;T	0.08634	3.07;3.07	5.31	5.31	0.75309	.	0.043504	0.85682	D	0.000000	T	0.08582	0.0213	L	0.31664	0.95	0.58432	D	0.999999	B;B;B	0.32467	0.372;0.055;0.205	B;B;B	0.33121	0.158;0.089;0.103	T	0.37596	-0.9699	10	0.17832	T	0.49	-19.7862	19.0482	0.93030	0.0:1.0:0.0:0.0	.	648;658;658	B4DYP7;Q96CW5-2;Q96CW5	.;.;GCP3_HUMAN	N	658	ENSP00000261965:S658N;ENSP00000364821:S658N	ENSP00000261965:S658N	S	-	2	0	TUBGCP3	112218868	1.000000	0.71417	1.000000	0.80357	0.225000	0.24961	7.132000	0.77251	2.514000	0.84764	0.460000	0.39030	AGC	-	TUBGCP3	-	pfam_TUBGCP		0.438	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2	0	0		42	42		0.00		C	NM_006322		113170867	-1	19		20		tier1	no_errors	ENST00000261965	ensembl	human	known	74_37	missense	48.72		SNP	1.000	T	19	20
GPR179	440435	genome.wustl.edu	37	17	36482852	36482852	+	Silent	SNP	C	C	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr17:36482852C>A	ENST00000342292.4	-	11	6620	c.6600G>T	c.(6598-6600)ctG>ctT	p.L2200L	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	2200					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GTTCTGGGTCCAGGGCACCTG	0.562													ENSG00000188888																																					0													84.0	84.0	84.0					17																	36482852		2069	4208	6277	SO:0001819	synonymous_variant	0			-		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.6600G>T	17.37:g.36482852C>A				Silent	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt_N_dom,pfscan_GPCR_3_C	p.L2200	ENST00000342292.4	37	c.6600	CCDS42308.1	17																																																																																			-	GPR179	-	NULL		0.562	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	0	0		45	45		0.00		C			36482852	-1	4		36		tier1	no_errors	ENST00000342292	ensembl	human	known	74_37	silent	10.00		SNP	0.004	A	4	36
HMP19	51617	genome.wustl.edu	37	5	173534646	173534646	+	3'UTR	SNP	C	C	T	rs576800071		TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr5:173534646C>T	ENST00000303177.3	+	0	916				NSG2_ENST00000521585.1_Intron|NSG2_ENST00000521959.1_3'UTR	NM_015980.4	NP_057064.1	Q9Y328	NSG2_HUMAN							clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											GGGGGAAGAACGCACCAAAAA	0.547													ENSG00000170091																																					0																																										SO:0001624	3_prime_UTR_variant	0			-																												ENST00000303177.3:c.*138C>T	5.37:g.173534646C>T			B2R5Y0|D3DQN0|Q9UHX8	R	SNP	-	NULL	ENST00000303177.3	37	NULL	CCDS4391.1	5																																																																																			-	NSG2	-	-		0.547	NSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMP19	Uniprot_gn	protein_coding	OTTHUMT00000252966.2	0	0		15	15		0.00		C			173534646	+1	6		6		tier1	no_errors	ENST00000521146	ensembl	human	known	74_37	rna	50.00		SNP	0.007	T	6	6
AC026369.1	0	genome.wustl.edu	37	12	148078	148078	+	IGR	SNP	G	G	A	rs8181620		TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr12:148078G>A	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							cacaattgccgtgctccttgg	0.537													ENSG00000206114																																					0																																										SO:0001628	intergenic_variant	0			-																													12.37:g.148078G>A				R	SNP	-	NULL	ENST00000594563.1	37	NULL		12																																																																																			rs8181620	FAM138D	-	-		0.537	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	FAM138D	HGNC	protein_coding		0	0		11	11		0.00		G			148078	-1	5		4		tier1	no_errors	ENST00000320165	ensembl	human	known	74_37	rna	55.56		SNP	0.000	A	5	4
ALAS2	212	genome.wustl.edu	37	X	55051216	55051216	+	Missense_Mutation	SNP	C	C	G			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chrX:55051216C>G	ENST00000330807.5	-	3	376	c.239G>C	c.(238-240)gGg>gCg	p.G80A	ALAS2_ENST00000396198.3_Missense_Mutation_p.G104A|ALAS2_ENST00000335854.4_Missense_Mutation_p.G80A	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	80					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	CTTGCTCTTCCCATCCTGGAG	0.488													ENSG00000158578																																					0													208.0	132.0	158.0					X																	55051216		2203	4300	6503	SO:0001583	missense	0			-		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.239G>C	X.37:g.55051216C>G	ENSP00000332369:p.Gly80Ala		A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,pfam_5aminolev_synth_preseq,pfam_Aminotrans_V/Cys_dSase,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth	p.G80A	ENST00000330807.5	37	c.239	CCDS14366.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.89|13.89	2.370739|2.370739	0.42003|0.42003	.|.	.|.	ENSG00000158578|ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854|ENST00000455688	D;D;D|D	0.96685|0.90385	-4.05;-4.09;-4.05|-2.66	5.02|5.02	5.02|5.02	0.67125|0.67125	5-aminolevulinate synthase presequence (1);|.	0.169599|0.169599	0.41605|0.41605	D|N	0.000844|0.000844	D|D	0.83774|0.83774	0.5327|0.5327	N|N	0.11255|0.11255	0.115|0.115	0.25450|0.25450	N|N	0.988015|0.988015	B;B;B|.	0.22211|.	0.004;0.013;0.066|.	B;B;B|.	0.32928|.	0.012;0.02;0.155|.	T|T	0.74031|0.74031	-0.3795|-0.3795	10|7	0.14656|.	T|.	0.56|.	-11.2229|-11.2229	16.4963|16.4963	0.84246|0.84246	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	80;104;80|.	A8K6C4;Q5JZF5;P22557|.	.;.;HEM0_HUMAN|.	A|R	80;104;80|32	ENSP00000332369:G80A;ENSP00000379501:G104A;ENSP00000337131:G80A|ENSP00000407204:G32R	ENSP00000332369:G80A|.	G|G	-|-	2|1	0|0	ALAS2|ALAS2	55067941|55067941	0.990000|0.990000	0.36364|0.36364	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.411000|2.411000	0.44600|0.44600	2.237000|2.237000	0.73441|0.73441	0.600000|0.600000	0.82982|0.82982	GGG|GGA	-	ALAS2	-	pfam_5aminolev_synth_preseq		0.488	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAS2	HGNC	protein_coding	OTTHUMT00000056843.3	0	0		79	79		0.00		C	NM_000032		55051216	-1	28		79		tier1	no_errors	ENST00000330807	ensembl	human	known	74_37	missense	26.17		SNP	1.000	G	28	79
PPP1R32	220004	genome.wustl.edu	37	11	61249257	61249257	+	5'UTR	SNP	C	C	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr11:61249257C>A	ENST00000338608.2	+	0	101				RP11-286N22.8_ENST00000544880.1_Intron|PPP1R32_ENST00000432063.2_5'UTR|RP11-286N22.8_ENST00000543044.1_3'UTR	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32								phosphatase binding (GO:0019902)										TTTCTAGGCCCCCTGGGGCCC	0.657													ENSG00000256591																																					0													11.0	13.0	12.0					11																	61249257		2196	4291	6487	SO:0001623	5_prime_UTR_variant	0			-	AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.-25C>A	11.37:g.61249257C>A			Q4G0P4|Q96M77	Missense_Mutation	SNP	pfam_SDH,superfamily_SDH	p.P125H	ENST00000338608.2	37	c.374	CCDS8008.1	11																																																																																			-	RP11-286N22.8	-	NULL		0.657	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDHAF2	Clone_based_vega_gene	protein_coding	OTTHUMT00000398621.1	0	0		26	26		0.00		C	NM_145017		61249257	+1	15		17		tier1	no_errors	ENST00000538594	ensembl	human	known	74_37	missense	46.88		SNP	0.085	A	15	17
MTUS2	23281	genome.wustl.edu	37	13	29674957	29674957	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr13:29674957C>T	ENST00000431530.3	+	3	2582	c.2524C>T	c.(2524-2526)Ccg>Tcg	p.P842S		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	832	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.|Sufficient for interaction with KIF2C.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						ATCCAATCTCCCGAAATCTGG	0.453													ENSG00000132938																																					0													10.0	10.0	10.0					13																	29674957		1716	3810	5526	SO:0001583	missense	0			-	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2524C>T	13.37:g.29674957C>T	ENSP00000392057:p.Pro842Ser		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.P842S	ENST00000431530.3	37	c.2524	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	C	12.43	1.934678	0.34189	.	.	ENSG00000132938	ENST00000431530	T	0.25749	1.78	5.79	4.08	0.47627	.	0.079154	0.51477	D	0.000096	T	0.28830	0.0715	M	0.66939	2.045	0.50467	D	0.999875	B	0.22683	0.073	B	0.28139	0.086	T	0.03898	-1.0994	9	.	.	.	.	11.8593	0.52457	0.0:0.8588:0.0:0.1412	.	832	Q5JR59	MTUS2_HUMAN	S	842	ENSP00000392057:P842S	.	P	+	1	0	MTUS2	28572957	.	.	0.002000	0.10522	0.004000	0.04260	.	.	0.808000	0.34231	0.655000	0.94253	CCG	-	MTUS2	-	NULL		0.453	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	0	0		61	61		0.00		C	XM_166270		29674957	+1	27		35		tier1	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	43.55		SNP	0.182	T	27	35
NALCN	259232	genome.wustl.edu	37	13	101717809	101717809	+	Silent	SNP	G	G	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr13:101717809G>A	ENST00000251127.6	-	40	4632	c.4551C>T	c.(4549-4551)taC>taT	p.Y1517Y		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1517					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCTCCATTTCGTAGCACATGT	0.582													ENSG00000102452																																					0													175.0	135.0	149.0					13																	101717809		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4551C>T	13.37:g.101717809G>A			Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	pfam_Ion_trans_dom	p.Y1517	ENST00000251127.6	37	c.4551	CCDS9498.1	13																																																																																			-	LCN	-	NULL		0.582	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN	HGNC	protein_coding	OTTHUMT00000045663.2	0	0		51	51		0.00		G	NM_052867		101717809	-1	19		20		tier1	no_errors	ENST00000251127	ensembl	human	known	74_37	silent	48.72		SNP	0.943	A	19	20
KIAA0753	9851	genome.wustl.edu	37	17	6531919	6531920	+	Frame_Shift_Ins	INS	-	-	CT	rs201379908	byFrequency	TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr17:6531919_6531920insCT	ENST00000361413.3	-	3	593_594	c.235_236insAG	c.(235-237)gttfs	p.V79fs	KIAA0753_ENST00000542606.1_5'UTR|KIAA0753_ENST00000572370.1_5'UTR	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	79						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		GTCAGGACCAACTCTACAATCT	0.426													ENSG00000198920																																					0																																										SO:0001589	frameshift_variant	0					CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.234_235dupAG	17.37:g.6531922_6531923dupCT	ENSP00000355250:p.Val79fs		A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Frame_Shift_Ins	INS	NULL	p.V79fs	ENST00000361413.3	37	c.236_235	CCDS42247.1	17																																																																																				KIAA0753	-	NULL		0.426	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0753	HGNC	protein_coding	OTTHUMT00000439769.3	0	0		51	51		0.00		-	NM_014804		6531920	-1	2		17		tier1	no_errors	ENST00000361413	ensembl	human	known	74_37	frame_shift_ins	10.53		INS	0.000:0.001	CT	2	17
MTUS2	23281	genome.wustl.edu	37	13	29675028	29675028	+	Silent	SNP	C	C	G			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr13:29675028C>G	ENST00000431530.3	+	3	2653	c.2595C>G	c.(2593-2595)gtC>gtG	p.V865V		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	855	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.|Sufficient for interaction with KIF2C.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TTGGCTTTGTCCGGAGCTCCA	0.622													ENSG00000132938																																					0													9.0	10.0	10.0					13																	29675028		2018	4165	6183	SO:0001819	synonymous_variant	0			-	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2595C>G	13.37:g.29675028C>G			A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	NULL	p.V865	ENST00000431530.3	37	c.2595	CCDS45022.1	13																																																																																			-	MTUS2	-	NULL		0.622	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	0	0		76	76		0.00		C	XM_166270		29675028	+1	30		43		tier1	no_errors	ENST00000431530	ensembl	human	known	74_37	silent	41.10		SNP	1.000	G	30	43
FKBP4	2288	genome.wustl.edu	37	12	2907947	2907947	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr12:2907947C>T	ENST00000001008.4	+	4	656	c.469C>T	c.(469-471)Cgc>Tgc	p.R157C	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	157					androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			AATACAGACTCGCGGTGAAGG	0.473													ENSG00000004478																																					0													140.0	126.0	131.0					12																	2907947		2203	4300	6503	SO:0001583	missense	0			-	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.469C>T	12.37:g.2907947C>T	ENSP00000001008:p.Arg157Cys		D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.R157C	ENST00000001008.4	37	c.469	CCDS8512.1	12	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430606	0.62844	.	.	ENSG00000004478	ENST00000001008	D	0.81908	-1.55	4.87	3.94	0.45596	.	0.053349	0.64402	D	0.000002	T	0.75339	0.3836	L	0.38838	1.175	0.50313	D	0.999869	D	0.69078	0.997	B	0.42882	0.401	T	0.79115	-0.1936	10	0.72032	D	0.01	-20.5487	11.3624	0.49651	0.3866:0.6134:0.0:0.0	.	157	Q02790	FKBP4_HUMAN	C	157	ENSP00000001008:R157C	ENSP00000001008:R157C	R	+	1	0	FKBP4	2778208	0.999000	0.42202	0.999000	0.59377	0.425000	0.31504	4.247000	0.58750	2.242000	0.73789	0.563000	0.77884	CGC	-	FKBP4	-	NULL		0.473	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP4	HGNC	protein_coding	OTTHUMT00000206861.1	0	0		62	62		0.00		C			2907947	+1	29		31		tier1	no_errors	ENST00000001008	ensembl	human	known	74_37	missense	48.33		SNP	0.975	T	29	31
TTC41P	253724	genome.wustl.edu	37	12	104308806	104308806	+	RNA	SNP	A	A	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr12:104308806A>T	ENST00000548897.1	-	0	1996																											ACCTATAAAAACATTACCTTT	0.274													ENSG00000214198																																					0																																												0			-																													12.37:g.104308806A>T				R	SNP	-	NULL	ENST00000548897.1	37	NULL		12																																																																																			-	RP11-642P15.1	-	-		0.274	RP11-642P15.1-003	KNOWN	basic	processed_transcript	GNN	Clone_based_vega_gene	pseudogene	OTTHUMT00000407243.1	0	0		16	16		0.00		A			104308806	-1	5		5		tier1	no_errors	ENST00000388789	ensembl	human	known	74_37	rna	50.00		SNP	0.012	T	5	5
RAB6A	5870	genome.wustl.edu	37	11	73429869	73429869	+	Intron	SNP	G	G	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr11:73429869G>A	ENST00000336083.3	-	4	639				RAB6A_ENST00000310653.6_Missense_Mutation_p.R84C|RAB6A_ENST00000541588.1_Intron|RAB6A_ENST00000536566.1_Missense_Mutation_p.R51C	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family						antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)	p.R84C(1)		large_intestine(2)|lung(2)	4						GCAGAATCACGGATGTAACTG	0.398													ENSG00000175582																																					1	Substitution - Missense(1)	large_intestine(1)											128.0	125.0	126.0					11																	73429869		2200	4293	6493	SO:0001627	intron_variant	0			-	AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.184-106C>T	11.37:g.73429869G>A			A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R84C	ENST00000336083.3	37	c.250	CCDS8224.1	11	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366959	0.82463	.	.	ENSG00000175582	ENST00000310653;ENST00000393571;ENST00000536566;ENST00000539750	D;D	0.82526	-1.62;-1.62	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.95014	0.8386	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96244	0.9178	10	0.87932	D	0	-1.1727	19.2924	0.94105	0.0:0.0:1.0:0.0	.	84	P20340-2	.	C	84;84;51;84	ENSP00000311449:R84C;ENSP00000437863:R51C	ENSP00000311449:R84C	R	-	1	0	RAB6A	73107517	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.199000	0.72112	2.878000	0.98634	0.650000	0.86243	CGT	-	RAB6A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom		0.398	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAB6A	HGNC	protein_coding	OTTHUMT00000259241.2	0	0		71	71		0.00		G			73429869	-1	32		31		tier1	no_errors	ENST00000310653	ensembl	human	known	74_37	missense	50.79		SNP	1.000	A	32	31
DCAF16	54876	genome.wustl.edu	37	4	17805189	17805189	+	Silent	SNP	A	A	G			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr4:17805189A>G	ENST00000382247.1	-	3	1636	c.576T>C	c.(574-576)acT>acC	p.T192T	DCAF16_ENST00000536863.1_Silent_p.T192T|DCAF16_ENST00000507768.1_5'Flank	NM_017741.3	NP_060211.3	Q9NXF7	DCA16_HUMAN	DDB1 and CUL4 associated factor 16	192					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				cervix(1)|endometrium(1)|lung(2)|ovary(1)	5						TGATGGGTTCAGTACGAGTTG	0.408													ENSG00000163257																																					0													214.0	198.0	203.0					4																	17805189		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK000287	CCDS3423.1	4p15.32	2009-07-17	2009-07-17	2009-07-17	ENSG00000163257	ENSG00000163257		"""DDB1 and CUL4 associated factors"""	25987	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 30"""	C4orf30		12477932	Standard	XM_005248169		Approved	FLJ20280	uc003gpn.3	Q9NXF7	OTTHUMG00000128536	ENST00000382247.1:c.576T>C	4.37:g.17805189A>G			B3KPB7	Silent	SNP	NULL	p.T192	ENST00000382247.1	37	c.576	CCDS3423.1	4																																																																																			-	DCAF16	-	NULL		0.408	DCAF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF16	HGNC	protein_coding	OTTHUMT00000250371.1	0	0		148	148		0.00		A	NM_017741		17805189	-1	22		99		tier1	no_errors	ENST00000382247	ensembl	human	known	74_37	silent	18.03		SNP	0.702	G	22	99
DIP2B	57609	genome.wustl.edu	37	12	51125291	51125291	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr12:51125291G>T	ENST00000301180.5	+	31	3815	c.3781G>T	c.(3781-3783)Ggt>Tgt	p.G1261C		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1261						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CTGCACCAAAGGTCTTGGGAA	0.502													ENSG00000066084																																					0													85.0	87.0	86.0					12																	51125291		2203	4300	6503	SO:0001583	missense	0			-	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.3781G>T	12.37:g.51125291G>T	ENSP00000301180:p.Gly1261Cys		Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.G1261C	ENST00000301180.5	37	c.3781	CCDS31799.1	12	.	.	.	.	.	.	.	.	.	.	G	26.1	4.709543	0.89018	.	.	ENSG00000066084	ENST00000301180	T	0.10860	2.83	4.85	4.85	0.62838	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.02774	-1.1112	10	0.66056	D	0.02	-15.4181	18.5347	0.91006	0.0:0.0:1.0:0.0	.	1261	Q9P265	DIP2B_HUMAN	C	1261	ENSP00000301180:G1261C	ENSP00000301180:G1261C	G	+	1	0	DIP2B	49411558	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.860000	0.86993	2.686000	0.91538	0.555000	0.69702	GGT	-	DIP2B	-	pfam_AMP-dep_Synth/Lig		0.502	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	0	0		22	22		0.00		G	NM_173602		51125291	+1	16		12		tier1	no_errors	ENST00000301180	ensembl	human	known	74_37	missense	57.14		SNP	1.000	T	16	12
TUBBP5	643224	genome.wustl.edu	37	9	141070741	141070741	+	RNA	SNP	C	C	G	rs199744699	byFrequency	TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr9:141070741C>G	ENST00000503395.1	+	0	1516									tubulin, beta pseudogene 5																		TGGACGTTGTCAGAAAGGAGG	0.612													ENSG00000159247																																					0																																												0			-	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070741C>G				R	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			rs199744699	TUBBP5	-	-		0.612	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	0	0		23	23		0.00		C	NR_027156		141070741	+1	6		21		tier1	no_errors	ENST00000290377	ensembl	human	known	74_37	rna	22.22		SNP	0.999	G	6	21
PPFIBP2	8495	genome.wustl.edu	37	11	7669673	7669673	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr11:7669673G>T	ENST00000299492.4	+	18	2090	c.1702G>T	c.(1702-1704)Gag>Tag	p.E568*	PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000528883.1_Nonsense_Mutation_p.E456*|PPFIBP2_ENST00000533792.1_Nonsense_Mutation_p.E410*|PPFIBP2_ENST00000530181.1_Nonsense_Mutation_p.E425*	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	568	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TGCATGGCTGGAGGACTTTGG	0.547													ENSG00000166387																																					0													171.0	128.0	143.0					11																	7669673		2201	4296	6497	SO:0001587	stop_gained	0			-	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1702G>T	11.37:g.7669673G>T	ENSP00000299492:p.Glu568*		B7Z433|E9PK77|O75337|Q8WW26	Nonsense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_D-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E568*	ENST00000299492.4	37	c.1702	CCDS31419.1	11	.	.	.	.	.	.	.	.	.	.	G	39	7.877456	0.98539	.	.	ENSG00000166387	ENST00000299492;ENST00000533792;ENST00000541115;ENST00000528883;ENST00000530181	.	.	.	5.74	4.82	0.62117	.	0.137093	0.49916	D	0.000131	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-13.8167	14.7604	0.69602	0.0:0.145:0.855:0.0	.	.	.	.	X	568;410;491;456;425	.	ENSP00000299492:E568X	E	+	1	0	PPFIBP2	7626249	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.639000	0.74314	1.409000	0.46915	0.561000	0.74099	GAG	-	PPFIBP2	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.547	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2	0	0		54	54		0.00		G	NM_003621		7669673	+1	16		32		tier1	no_errors	ENST00000299492	ensembl	human	known	74_37	nonsense	33.33		SNP	1.000	T	16	32
TSC2	7249	genome.wustl.edu	37	16	2107142	2107143	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr16:2107142_2107143delAG	ENST00000219476.3	+	9	1441_1442	c.811_812delAG	c.(811-813)agcfs	p.S271fs	TSC2_ENST00000401874.2_Frame_Shift_Del_p.S271fs|TSC2_ENST00000353929.4_Frame_Shift_Del_p.S271fs|TSC2_ENST00000439673.2_Frame_Shift_Del_p.S234fs|TSC2_ENST00000568454.1_Frame_Shift_Del_p.S282fs|TSC2_ENST00000350773.4_Frame_Shift_Del_p.S271fs|TSC2_ENST00000382538.6_Frame_Shift_Del_p.S222fs	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	271	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCTGGGCCACAGCGCCATCTAC	0.668			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis				ENSG00000103197																											yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0																																										SO:0001589	frameshift_variant	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease		AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.811_812delAG	16.37:g.2107142_2107143delAG	ENSP00000219476:p.Ser271fs		A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Del	DEL	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom,prints_Tuberin	p.S271fs	ENST00000219476.3	37	c.811_812	CCDS10458.1	16																																																																																				TSC2	-	pfam_Tuberin_N,superfamily_ARM-type_fold		0.668	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	0	0		72	72		0.00		AG	NM_000548		2107143	+1	30		55		tier1	no_errors	ENST00000219476	ensembl	human	known	74_37	frame_shift_del	35.29		DEL	1.000:1.000	-	30	55
C1orf210	149466	genome.wustl.edu	37	1	43748630	43748630	+	Silent	SNP	G	G	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr1:43748630G>T	ENST00000523677.1	-	3	401	c.168C>A	c.(166-168)ctC>ctA	p.L56L	C1orf210_ENST00000423420.1_Silent_p.L56L	NM_001164829.1|NM_182517.2	NP_001158301.1|NP_872323.1	Q8IVY1	CA210_HUMAN	chromosome 1 open reading frame 210	56						integral component of membrane (GO:0016021)				breast(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATCGGCGGCAGAGGTGGCATT	0.632													ENSG00000253313																																					0													52.0	51.0	51.0					1																	43748630		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC041633	CCDS481.1	1p34.2	2006-03-22			ENSG00000253313	ENSG00000253313			28755	protein-coding gene	gene with protein product						12477932	Standard	NM_182517		Approved	MGC52423	uc001cit.4	Q8IVY1	OTTHUMG00000007289	ENST00000523677.1:c.168C>A	1.37:g.43748630G>T			D3DPX2	Silent	SNP	NULL	p.L56	ENST00000523677.1	37	c.168	CCDS481.1	1																																																																																			-	C1orf210	-	NULL		0.632	C1orf210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf210	HGNC	protein_coding	OTTHUMT00000019035.2	0	0		35	35		0.00		G	NM_182517		43748630	-1	29		26		tier1	no_errors	ENST00000423420	ensembl	human	known	74_37	silent	52.73		SNP	1.000	T	29	26
SUCNR1	56670	genome.wustl.edu	37	3	151598364	151598364	+	Missense_Mutation	SNP	C	C	G			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr3:151598364C>G	ENST00000362032.5	+	3	138	c.33C>G	c.(31-33)tgC>tgG	p.C11W	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_033050.4	NP_149039.2	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	11						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	ATGCAACTTGCAAAAACTGGC	0.388													ENSG00000198829																																					0													77.0	80.0	79.0					3																	151598364		2202	4299	6501	SO:0001583	missense	0			-	AF348078	CCDS3162.1	3q25.1	2012-08-21	2004-07-08	2004-07-09	ENSG00000198829	ENSG00000198829		"""GPCR / Class A : Orphans"""	4542	protein-coding gene	gene with protein product		606381	"""G protein-coupled receptor 91"""	GPR91		11273702, 15141213, 17192395	Standard	NM_033050		Approved		uc003ezf.2	Q9BXA5	OTTHUMG00000159880	ENST00000362032.5:c.33C>G	3.37:g.151598364C>G	ENSP00000355156:p.Cys11Trp		A8K305|Q8TDQ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.C11W	ENST00000362032.5	37	c.33	CCDS3162.1	3	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642187	0.47153	.	.	ENSG00000198829	ENST00000362032	T	0.60672	0.17	5.17	-0.183	0.13284	.	0.057591	0.64402	D	0.000001	T	0.47985	0.1475	N	0.08118	0	0.32473	N	0.542584	D	0.76494	0.999	D	0.65140	0.932	T	0.57033	-0.7880	10	0.56958	D	0.05	.	7.2244	0.26007	0.1056:0.4728:0.0:0.4215	.	11	Q9BXA5	SUCR1_HUMAN	W	11	ENSP00000355156:C11W	ENSP00000355156:C11W	C	+	3	2	SUCNR1	153081054	0.006000	0.16342	0.099000	0.21106	0.195000	0.23768	-0.255000	0.08769	-0.021000	0.14009	0.655000	0.94253	TGC	-	SUCNR1	-	NULL		0.388	SUCNR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCNR1	HGNC	protein_coding	OTTHUMT00000357897.2	0	0		71	71		0.00		C	NM_033050		151598364	+1	7		76		tier1	no_errors	ENST00000362032	ensembl	human	known	74_37	missense	8.43		SNP	0.015	G	7	76
XPNPEP2	7512	genome.wustl.edu	37	X	128894541	128894541	+	Missense_Mutation	SNP	T	T	G			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chrX:128894541T>G	ENST00000371106.3	+	16	1674	c.1482T>G	c.(1480-1482)ttT>ttG	p.F494L		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	494						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GGCTCATCTTTCCCGCTGCTA	0.567													ENSG00000122121																																					0													247.0	214.0	225.0					X																	128894541		2203	4300	6503	SO:0001583	missense	0			-	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1482T>G	X.37:g.128894541T>G	ENSP00000360147:p.Phe494Leu		A0AV16|O75994	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.F494L	ENST00000371106.3	37	c.1482	CCDS14613.1	X	.	.	.	.	.	.	.	.	.	.	T	14.25	2.477919	0.44044	.	.	ENSG00000122121	ENST00000371106	T	0.76839	-1.05	5.25	0.0952	0.14484	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	T	0.80555	0.4645	M	0.88906	2.99	0.45621	D	0.998554	P	0.34639	0.461	B	0.40636	0.335	T	0.77910	-0.2411	10	0.87932	D	0	-16.4242	8.8238	0.35043	0.0:0.6738:0.0:0.3262	.	494	O43895	XPP2_HUMAN	L	494	ENSP00000360147:F494L	ENSP00000360147:F494L	F	+	3	2	XPNPEP2	128722222	1.000000	0.71417	0.963000	0.40424	0.463000	0.32649	1.092000	0.30927	-0.069000	0.12931	0.417000	0.27973	TTT	-	XPNPEP2	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain		0.567	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	HGNC	protein_coding	OTTHUMT00000058210.1	0	0		42	42		0.00		T	NM_003399		128894541	+1	20		22		tier1	no_errors	ENST00000371106	ensembl	human	known	74_37	missense	47.62		SNP	0.998	G	20	22
ATP6AP1	537	genome.wustl.edu	37	X	153660771	153660771	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chrX:153660771G>T	ENST00000369762.2	+	4	584	c.523G>T	c.(523-525)Gct>Tct	p.A175S	ATP6AP1_ENST00000484908.1_3'UTR	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	175					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAGCCTCCCTGCTCTGCTGCT	0.662													ENSG00000071553																																					0													38.0	30.0	33.0					X																	153660771		2202	4298	6500	SO:0001583	missense	0			-	D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.523G>T	X.37:g.153660771G>T	ENSP00000358777:p.Ala175Ser		A6ZKI4|Q8NBT4|Q9H0C7	Missense_Mutation	SNP	pfam_BIG/ATPase_V1_suS1	p.A175S	ENST00000369762.2	37	c.523	CCDS35451.1	X	.	.	.	.	.	.	.	.	.	.	G	8.414	0.844947	0.16963	.	.	ENSG00000071553	ENST00000369762;ENST00000449556	.	.	.	5.84	3.97	0.46021	.	0.244492	0.48767	D	0.000172	T	0.26882	0.0658	N	0.21097	0.63	0.32765	N	0.504552	B;B	0.27951	0.078;0.195	B;B	0.30316	0.038;0.114	T	0.27262	-1.0079	9	0.07644	T	0.81	-23.2905	5.735	0.18061	0.094:0.0:0.6016:0.3043	.	135;175	B3KR70;Q15904	.;VAS1_HUMAN	S	175	.	ENSP00000358777:A175S	A	+	1	0	ATP6AP1	153313965	0.996000	0.38824	0.295000	0.24960	0.325000	0.28411	2.638000	0.46562	1.222000	0.43521	0.529000	0.55759	GCT	-	ATP6AP1	-	pfam_BIG/ATPase_V1_suS1		0.662	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6AP1	HGNC	protein_coding	OTTHUMT00000081639.4	0	0		43	43		0.00		G	NM_001183		153660771	+1	26		34		tier1	no_errors	ENST00000369762	ensembl	human	known	74_37	missense	43.33		SNP	0.742	T	26	34
ARRDC1	92714	genome.wustl.edu	37	9	140508122	140508122	+	Silent	SNP	G	G	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr9:140508122G>A	ENST00000371421.4	+	4	400	c.336G>A	c.(334-336)agG>agA	p.R112R	ARRDC1_ENST00000491911.1_3'UTR|C9orf37_ENST00000496793.1_5'Flank	NM_152285.2	NP_689498.1	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1	112						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)		ACCAGGTGAGGGCCGCCATCC	0.587													ENSG00000197070																																					0													165.0	140.0	148.0					9																	140508122		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ420420	CCDS7049.1	9q34.3	2013-10-11			ENSG00000197070	ENSG00000197070			28633	protein-coding gene	gene with protein product	"""alpha-arrestin 1"""					23886940	Standard	XM_005266119		Approved	MGC40555	uc004cns.3	Q8N5I2	OTTHUMG00000020993	ENST00000371421.4:c.336G>A	9.37:g.140508122G>A				Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.R112	ENST00000371421.4	37	c.336	CCDS7049.1	9																																																																																			-	ARRDC1	-	pfam_Arrestin-like_N,superfamily_Ig_E-set		0.587	ARRDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC1	HGNC	protein_coding	OTTHUMT00000055358.1	0	0		65	65		0.00		G	NM_152285		140508122	+1	40		39		tier1	no_errors	ENST00000371421	ensembl	human	known	74_37	silent	50.63		SNP	0.999	A	40	39
TMTC3	160418	genome.wustl.edu	37	12	88566467	88566467	+	Missense_Mutation	SNP	A	A	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr12:88566467A>T	ENST00000266712.6	+	8	1364	c.1144A>T	c.(1144-1146)Agc>Tgc	p.S382C		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	382					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						ATATGTTCCCAGCATGGGGTT	0.373													ENSG00000139324																																					0													123.0	118.0	119.0					12																	88566467		2203	4299	6502	SO:0001583	missense	0			-		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.1144A>T	12.37:g.88566467A>T	ENSP00000266712:p.Ser382Cys		Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,pfam_DUF1736,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S382C	ENST00000266712.6	37	c.1144	CCDS9032.1	12	.	.	.	.	.	.	.	.	.	.	A	27.2	4.811623	0.90707	.	.	ENSG00000139324	ENST00000266712	T	0.52057	0.68	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.75766	0.3894	M	0.92077	3.27	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.82123	-0.0613	10	0.62326	D	0.03	-8.4958	15.6784	0.77349	1.0:0.0:0.0:0.0	.	382	Q6ZXV5-2	.	C	382	ENSP00000266712:S382C	ENSP00000266712:S382C	S	+	1	0	TMTC3	87090598	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.228000	0.95250	2.090000	0.63153	0.528000	0.53228	AGC	-	TMTC3	-	NULL		0.373	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC3	HGNC	protein_coding	OTTHUMT00000406421.1	0	0		34	34		0.00		A	NM_181783		88566467	+1	18		20		tier1	no_errors	ENST00000266712	ensembl	human	known	74_37	missense	47.37		SNP	1.000	T	18	20
TP53	7157	genome.wustl.edu	37	17	7578395	7578395	+	Missense_Mutation	SNP	G	G	T	rs587780070		TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr17:7578395G>T	ENST00000269305.4	-	5	724	c.535C>A	c.(535-537)Cat>Aat	p.H179N	TP53_ENST00000455263.2_Missense_Mutation_p.H179N|TP53_ENST00000420246.2_Missense_Mutation_p.H179N|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.H179N|TP53_ENST00000413465.2_Missense_Mutation_p.H179N|TP53_ENST00000445888.2_Missense_Mutation_p.H179N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	179	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179Y(98)|p.H179N(16)|p.H179D(13)|p.P177_C182delPHHERC(8)|p.0?(8)|p.H47Y(6)|p.H86Y(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.H179fs*68(1)|p.C176fs*65(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.H47D(1)|p.R174fs*3(1)|p.H86D(1)|p.H178_H179>QY(1)|p.H47N(1)|p.H86N(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCGCTCATGGTGGGGGCAG	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	197	Substitution - Missense(143)|Deletion - In frame(25)|Deletion - Frameshift(19)|Whole gene deletion(8)|Complex - deletion inframe(1)|Complex - compound substitution(1)	skin(28)|upper_aerodigestive_tract(27)|large_intestine(27)|lung(27)|breast(18)|haematopoietic_and_lymphoid_tissue(11)|oesophagus(11)|central_nervous_system(8)|ovary(8)|stomach(7)|liver(7)|bone(5)|urinary_tract(3)|soft_tissue(2)|pancreas(2)|cervix(1)|vulva(1)|eye(1)|kidney(1)|endometrium(1)|prostate(1)	GRCh37	CM067054	TP53	M							47.0	47.0	47.0					17																	7578395		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.535C>A	17.37:g.7578395G>T	ENSP00000269305:p.His179Asn		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H179N	ENST00000269305.4	37	c.535	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.129353	0.94473	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99909	-7.85;-7.85;-7.85;-7.85;-7.85;-7.85;-7.85;-7.85	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.048592	0.85682	D	0.000000	D	0.99923	0.9964	M	0.92507	3.315	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.985;1.0;0.993;1.0;0.994;1.0;0.998	D;D;D;D;D;D;D	0.97110	0.967;0.998;0.958;1.0;0.993;0.996;0.98	D	0.96235	0.9171	10	0.87932	D	0	-15.4889	17.4784	0.87667	0.0:0.0:1.0:0.0	.	140;179;179;86;179;179;179	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	179;179;179;179;179;179;168;86;47;86;47	ENSP00000410739:H179N;ENSP00000352610:H179N;ENSP00000269305:H179N;ENSP00000398846:H179N;ENSP00000391127:H179N;ENSP00000391478:H179N;ENSP00000425104:H47N;ENSP00000423862:H86N	ENSP00000269305:H179N	H	-	1	0	TP53	7519120	1.000000	0.71417	0.990000	0.47175	0.864000	0.49448	9.813000	0.99286	2.804000	0.96469	0.655000	0.94253	CAT	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0		35	35		0.00		G	NM_000546		7578395	-1	18		3		tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	85.71		SNP	1.000	T	18	3
DNAJB2	3300	genome.wustl.edu	37	2	220147939	220147939	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr2:220147939G>T	ENST00000336576.5	+	7	818	c.530G>T	c.(529-531)cGc>cTc	p.R177L	DNAJB2_ENST00000463463.1_3'UTR|DNAJB2_ENST00000392086.4_Missense_Mutation_p.R177L	NM_006736.5	NP_006727.2	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2	177					cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein deubiquitination (GO:0090086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|inclusion body (GO:0016234)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTCCAAGGACGCCGCATCACC	0.547													ENSG00000135924																																					0													78.0	68.0	71.0					2																	220147939		2203	4300	6503	SO:0001583	missense	0			-		CCDS2439.1, CCDS46519.1	2q32-q34	2011-09-02			ENSG00000135924	ENSG00000135924		"""Heat shock proteins / DNAJ (HSP40)"""	5228	protein-coding gene	gene with protein product		604139		HSJ1		1599432, 10516435	Standard	NM_006736		Approved	HSPF3	uc002vkx.1	P25686	OTTHUMG00000133134	ENST00000336576.5:c.530G>T	2.37:g.220147939G>T	ENSP00000338019:p.Arg177Leu		A8K9P6|Q8IUK1|Q8IUK2|Q96F52	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_DnaJ_domain,prints_DnaJ_domain	p.R177L	ENST00000336576.5	37	c.530	CCDS2439.1	2	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408861	0.42715	.	.	ENSG00000135924	ENST00000336576;ENST00000425450;ENST00000392086;ENST00000392087	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.46	-4.83	0.03161	.	0.282909	0.29466	N	0.012077	T	0.45895	0.1365	M	0.81341	2.54	0.21147	N	0.999772	B;B	0.33413	0.411;0.095	B;B	0.31101	0.124;0.084	T	0.46830	-0.9163	10	0.87932	D	0	.	15.8328	0.78769	0.6754:0.0:0.3246:0.0	.	177;177	P25686;P25686-2	DNJB2_HUMAN;.	L	177;177;177;146	ENSP00000338019:R177L;ENSP00000414796:R177L;ENSP00000375936:R177L;ENSP00000375937:R146L	ENSP00000338019:R177L	R	+	2	0	DNAJB2	219856183	0.000000	0.05858	0.507000	0.27676	0.703000	0.40648	-0.809000	0.04510	-1.183000	0.02723	-1.008000	0.02478	CGC	-	DJB2	-	NULL		0.547	DNAJB2-001	KNOWN	basic|CCDS	protein_coding	DJB2	HGNC	protein_coding	OTTHUMT00000256823.2	0	0		71	71		0.00		G			220147939	+1	33		19		tier1	no_errors	ENST00000336576	ensembl	human	known	74_37	missense	63.46		SNP	0.121	T	33	19
TRPM5	29850	genome.wustl.edu	37	11	2443469	2443469	+	Missense_Mutation	SNP	A	A	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr11:2443469A>T	ENST00000155858.6	-	2	208	c.200T>A	c.(199-201)cTg>cAg	p.L67Q	TRPM5_ENST00000533060.1_Missense_Mutation_p.L67Q|TRPM5_ENST00000528453.1_Missense_Mutation_p.L67Q|TRPM5_ENST00000452833.1_Missense_Mutation_p.L67Q	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GGACACCACCAGGTTGGGGGC	0.647													ENSG00000070985																									NSCLC(1;49 61 17205 18850 43201)												0													49.0	53.0	52.0					11																	2443469		2201	4297	6498	SO:0001583	missense	0			-	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.200T>A	11.37:g.2443469A>T	ENSP00000155858:p.Leu67Gln			Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.L67Q	ENST00000155858.6	37	c.200	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	a	18.44	3.625237	0.66901	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78	3.43	2.28	0.28536	.	0.000000	0.46442	U	0.000296	T	0.30634	0.0771	M	0.88906	2.99	0.34506	D	0.706614	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.992;0.992;0.994	T	0.36625	-0.9740	10	0.87932	D	0	-2.9042	3.2509	0.06814	0.6742:0.0:0.1211:0.2047	.	67;67;67	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	Q	59;67;67;67;67;67	ENSP00000434383:L59Q;ENSP00000155858:L67Q;ENSP00000387965:L67Q;ENSP00000434121:L67Q;ENSP00000436809:L67Q	ENSP00000155858:L67Q	L	-	2	0	TRPM5	2400045	1.000000	0.71417	0.968000	0.41197	0.944000	0.59088	5.716000	0.68437	0.491000	0.27793	0.478000	0.44815	CTG	-	TRPM5	-	NULL		0.647	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	0	0		37	37		0.00		A	NM_014555		2443469	-1	22		20		tier1	no_errors	ENST00000452833	ensembl	human	known	74_37	missense	52.38		SNP	1.000	T	22	20
ZBTB16	7704	genome.wustl.edu	37	11	113934249	113934249	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr11:113934249C>T	ENST00000335953.4	+	2	607	c.227C>T	c.(226-228)tCg>tTg	p.S76L	ZBTB16_ENST00000392996.2_Missense_Mutation_p.S76L	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	76	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GACTTCCTCTCGCCAAAGACC	0.557													ENSG00000109906																																					0													91.0	73.0	79.0					11																	113934249		2201	4296	6497	SO:0001583	missense	0			-	Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.227C>T	11.37:g.113934249C>T	ENSP00000338157:p.Ser76Leu		Q8TAL4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S76L	ENST00000335953.4	37	c.227	CCDS8367.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169646	0.78452	.	.	ENSG00000109906	ENST00000335953;ENST00000544220;ENST00000535700;ENST00000392996;ENST00000310883	T;T;T;T	0.26373	1.74;1.74;1.74;1.74	5.53	5.53	0.82687	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.57814	0.2079	M	0.84219	2.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.61978	-0.6951	10	0.87932	D	0	-4.7149	19.827	0.96621	0.0:1.0:0.0:0.0	.	76;81	Q05516;Q59H43	ZBT16_HUMAN;.	L	76	ENSP00000338157:S76L;ENSP00000437716:S76L;ENSP00000443013:S76L;ENSP00000376721:S76L	ENSP00000309507:S76L	S	+	2	0	ZBTB16	113439459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.755000	0.85180	2.759000	0.94783	0.561000	0.74099	TCG	-	ZBTB16	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.557	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1	0	0		40	40		0.00		C	NM_006006		113934249	+1	15		36		tier1	no_errors	ENST00000335953	ensembl	human	known	74_37	missense	29.41		SNP	1.000	T	15	36
TEKT4	150483	genome.wustl.edu	37	2	95539831	95539831	+	Missense_Mutation	SNP	T	T	C	rs199573327		TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr2:95539831T>C	ENST00000295201.4	+	3	828	c.691T>C	c.(691-693)Tac>Cac	p.Y231H	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	231					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						GGCTCATCCGTACTCCACCAC	0.667													ENSG00000163060																																					0													74.0	71.0	72.0					2																	95539831		2203	4300	6503	SO:0001583	missense	0			-	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.691T>C	2.37:g.95539831T>C	ENSP00000295201:p.Tyr231His			Missense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.Y231H	ENST00000295201.4	37	c.691	CCDS2005.1	2	.	.	.	.	.	.	.	.	.	.	.	5.627	0.300387	0.10678	.	.	ENSG00000163060	ENST00000295201	T	0.02345	4.33	2.24	-1.96	0.07525	.	0.327469	0.33813	N	0.004535	T	0.00845	0.0028	N	0.00801	-1.175	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.55860	-0.8074	10	0.35671	T	0.21	-21.4175	3.0502	0.06167	0.1905:0.3928:0.0:0.4167	.	231	Q8WW24	TEKT4_HUMAN	H	231	ENSP00000295201:Y231H	ENSP00000295201:Y231H	Y	+	1	0	TEKT4	94903558	0.993000	0.37304	0.023000	0.16930	0.013000	0.08279	1.214000	0.32419	-1.071000	0.03145	-0.818000	0.03119	TAC	rs199573327	TEKT4	-	pfam_Tektin		0.667	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT4	HGNC	protein_coding	OTTHUMT00000252777.1	0	0		31	31		0.00		T	NM_144705		95539831	+1	8		35		tier1	no_errors	ENST00000295201	ensembl	human	known	74_37	missense	18.60		SNP	0.907	C	8	35
CHRD	8646	genome.wustl.edu	37	3	184099338	184099339	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr3:184099338_184099339insC	ENST00000204604.1	+	4	683_684	c.437_438insC	c.(436-441)gacccgfs	p.DP146fs	EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000348986.3_Frame_Shift_Ins_p.DP146fs|CHRD_ENST00000545352.1_5'Flank|CHRD_ENST00000482805.1_3'UTR|CHRD_ENST00000450923.1_Frame_Shift_Ins_p.DP146fs	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	146					BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TATCCGCGGGACCCGGAGCATC	0.703													ENSG00000090539																																					0																																										SO:0001589	frameshift_variant	0				AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.440dupC	3.37:g.184099341_184099341dupC	ENSP00000204604:p.Asp146fs		O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Frame_Shift_Ins	INS	pfam_CHRD,pfam_VWF_C,smart_VWF_C,smart_CHRD,pirsf_Chordin,pfscan_CHRD,pfscan_VWF_C	p.E148fs	ENST00000204604.1	37	c.437_438	CCDS3266.1	3																																																																																				CHRD	-	pirsf_Chordin		0.703	CHRD-001	KNOWN	basic|CCDS	protein_coding	CHRD	HGNC	protein_coding	OTTHUMT00000280432.1	0	0		21	21		0.00		-	NM_003741		184099339	+1	11		19		tier1	no_errors	ENST00000204604	ensembl	human	known	74_37	frame_shift_ins	36.67		INS	1.000:0.988	C	11	19
RLIM	51132	genome.wustl.edu	37	X	73812716	73812716	+	Missense_Mutation	SNP	C	C	A	rs201582522		TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chrX:73812716C>A	ENST00000332687.6	-	4	652	c.434G>T	c.(433-435)cGt>cTt	p.R145L	RLIM_ENST00000349225.2_Missense_Mutation_p.R145L	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	145				NR -> YS (in Ref. 2; CAC14228). {ECO:0000305}.	negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCATTATTACGGTTAACATT	0.408													ENSG00000131263																									Esophageal Squamous(169;1899 1923 14997 18818 32118)												0													171.0	156.0	161.0					X																	73812716		2203	4300	6503	SO:0001583	missense	0			-	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.434G>T	X.37:g.73812716C>A	ENSP00000328059:p.Arg145Leu		B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R145L	ENST00000332687.6	37	c.434	CCDS14427.1	X	.	.	.	.	.	.	.	.	.	.	C	13.49	2.251617	0.39797	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.09163	3.01;3.01	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.24160	0.0585	L	0.39898	1.24	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.03443	-1.1036	10	0.09843	T	0.71	-0.8248	19.4644	0.94932	0.0:1.0:0.0:0.0	.	145	Q9NVW2	RNF12_HUMAN	L	145	ENSP00000328059:R145L;ENSP00000253571:R145L	ENSP00000328059:R145L	R	-	2	0	RLIM	73729441	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.761000	0.68801	2.551000	0.86045	0.600000	0.82982	CGT	-	RLIM	-	NULL		0.408	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLIM	HGNC	protein_coding	OTTHUMT00000057268.1	0	0		76	76		0.00		C	NM_016120		73812716	-1	53		39		tier1	no_errors	ENST00000332687	ensembl	human	known	74_37	missense	57.61		SNP	1.000	A	53	39
BCAP31	10134	genome.wustl.edu	37	X	152981004	152981004	+	Silent	SNP	G	G	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chrX:152981004G>A	ENST00000345046.6	-	4	741	c.334C>T	c.(334-336)Ctg>Ttg	p.L112L	BCAP31_ENST00000441714.1_Silent_p.L112L|BCAP31_ENST00000468947.1_5'Flank|BCAP31_ENST00000458587.2_Silent_p.L179L	NM_001256447.1	NP_001243376.1	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31	112					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein localization to endoplasmic reticulum exit site (GO:0070973)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(2)|prostate(1)	7	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACAAGGACAGCAGCAAGGAA	0.577													ENSG00000185825																																					0													131.0	103.0	112.0					X																	152981004		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X81109	CCDS14727.1, CCDS48191.1	Xq28	2005-10-11			ENSG00000185825	ENSG00000185825			16695	protein-coding gene	gene with protein product		300398					Standard	NM_001139441		Approved	DXS1357E, BAP31, 6C6-Ag, CDM	uc011mza.1	P51572	OTTHUMG00000024218	ENST00000345046.6:c.334C>T	X.37:g.152981004G>A			B3KQ79|D3DWV5|Q13836|Q96CF0	Silent	SNP	pfam_Bap31	p.L179	ENST00000345046.6	37	c.535	CCDS14727.1	X																																																																																			-	BCAP31	-	pfam_Bap31		0.577	BCAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAP31	HGNC	protein_coding	OTTHUMT00000061071.1	0	0		100	100		0.00		G	NM_005745		152981004	-1	26		59		tier1	no_errors	ENST00000458587	ensembl	human	known	74_37	silent	30.23		SNP	1.000	A	26	59
AL589743.1	0	genome.wustl.edu	37	14	19686793	19686793	+	lincRNA	SNP	T	T	C			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr14:19686793T>C	ENST00000418499.3	+	0	3904																											TCACAGATCGTGTGGTTGTTT	0.647													ENSG00000225210																																					0																																												0			-																													14.37:g.19686793T>C				R	SNP	-	NULL	ENST00000418499.3	37	NULL		14																																																																																			-	AL589743.1	-	-		0.647	AL589743.1-003	KNOWN	basic	lincRNA	LOC440157	Clone_based_vega_gene	lincRNA	OTTHUMT00000317887.3	0	0		12	12		0.00		T			19686793	+1	4		4		tier1	no_errors	ENST00000418499	ensembl	human	known	74_37	rna	50.00		SNP	0.018	C	4	4
CASR	846	genome.wustl.edu	37	3	122000728	122000729	+	Intron	DEL	TG	TG	-	rs200602784|rs10533065	byFrequency	TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr3:122000728_122000729delTG	ENST00000490131.1	+	6	1980				CASR_ENST00000296154.5_Intron|AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000498619.1_Intron	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor						anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	tgcatgcacatgtgtgtgtgtg	0.446													ENSG00000221474																																					0																																										SO:0001627	intron_variant	0				U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1609-231TG>-	3.37:g.122000738_122000739delTG			Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	R	DEL	-	NULL	ENST00000490131.1	37	NULL	CCDS3010.1	3																																																																																				AC068754.1	-	-		0.446	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221474	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000355761.1	0	0		29	29		0.00		TG	NM_000388		122000729	+1	6		20		tier1	no_errors	ENST00000408547	ensembl	human	novel	74_37	rna	23.08		DEL	0.000:0.001	-	6	20
IGSF9	57549	genome.wustl.edu	37	1	159896888	159896895	+	3'UTR	DEL	AGAGAGAG	AGAGAGAG	-			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	AGAGAGAG	AGAGAGAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr1:159896888_159896895delAGAGAGAG	ENST00000368094.1	-	0	3977_3984				IGSF9_ENST00000493195.1_5'UTR|TAGLN2_ENST00000478033.1_5'Flank|TAGLN2_ENST00000368097.4_5'Flank|IGSF9_ENST00000361509.3_3'UTR|TAGLN2_ENST00000320307.4_5'Flank	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9						dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			acacacacacagagagagagagagagag	0.447													ENSG00000085552																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.*247CTCTCTCT>-	1.37:g.159896896_159896903delAGAGAGAG				R	DEL	-	NULL	ENST00000368094.1	37	NULL	CCDS44254.1	1																																																																																				IGSF9	-	-		0.447	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	HGNC	protein_coding	OTTHUMT00000059115.1									AGAGAGAG	NM_020789		159896895	-1					tier1	no_errors	ENST00000476102	ensembl	human	known	74_37	rna			DEL	0.745:0.529:0.496:0.454:0.373:0.271:0.214:0.033	-		
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495													ENSG00000215933																																					0																																												0																																X.37:g.71372202_71372209delCGCGCGCA				R	DEL	-	NULL	ENST00000401114.1	37	NULL		X																																																																																				BX119917.1	-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	Clone_based_ensembl_gene	miRNA										CGCGCGCA			71372209	-1					tier1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna			DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-		
TPRXL	348825	genome.wustl.edu	37	3	14106367	14106367	+	Missense_Mutation	SNP	T	T	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr3:14106367T>A	ENST00000424053.1	+	3	1238	c.691T>A	c.(691-693)Tgc>Agc	p.C231S	TPRXL_ENST00000429201.1_Missense_Mutation_p.C231S|TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_Missense_Mutation_p.C231S			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						cagcagcagcTGCCCCAGTGC	0.706													ENSG00000180438																																					0																																										SO:0001583	missense	0			-	AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.691T>A	3.37:g.14106367T>A	ENSP00000400448:p.Cys231Ser		Q8NAM5	Missense_Mutation	SNP	NULL	p.C231S	ENST00000424053.1	37	c.691		3	.	.	.	.	.	.	.	.	.	.	t	2.221	-0.378393	0.05000	.	.	ENSG00000180438	ENST00000326972;ENST00000424053;ENST00000429201	.	.	.	0.294	0.294	0.15747	.	.	.	.	.	T	0.17746	0.0426	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27262	-1.0079	5	.	.	.	.	.	.	.	.	237	Q17RH7	TPRXL_HUMAN	S	231	.	.	C	+	1	0	TPRXL	14081368	0.921000	0.31238	0.000000	0.03702	0.000000	0.00434	-2.842000	0.00737	-1.117000	0.02965	-1.141000	0.01876	TGC	-	TPRXL	-	NULL		0.706	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	HGNC	protein_coding	OTTHUMT00000340436.1	0	0		30	30		0.00		T	NR_002223		14106367	+1	9		53		tier1	no_errors	ENST00000326972	ensembl	human	known	74_37	missense	14.52		SNP	0.007	A	9	53
SRSF4	6429	genome.wustl.edu	37	1	29475424	29475424	+	Missense_Mutation	SNP	C	C	T	rs377019095		TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr1:29475424C>T	ENST00000373795.4	-	6	1217	c.983G>A	c.(982-984)cGc>cAc	p.R328H	SRSF4_ENST00000546138.1_3'UTR|SRSF4_ENST00000466448.1_5'UTR|RP11-242O24.3_ENST00000413004.1_lincRNA	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	328	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						ccgactctggcggaggctctt	0.612													ENSG00000116350																																					0								C	HIS/ARG	1,4403	2.1+/-5.4	0,1,2201	41.0	42.0	42.0		983	-2.1	0.0	1		42	0,8600		0,0,4300	no	missense	SRSF4	NM_005626.4	29	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	benign	328/495	29475424	1,13003	2202	4300	6502	SO:0001583	missense	0			-	BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.983G>A	1.37:g.29475424C>T	ENSP00000362900:p.Arg328His		Q5VXP1|Q9BUA4|Q9UEB5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R328H	ENST00000373795.4	37	c.983	CCDS333.1	1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.313065	0.23908	2.27E-4	0.0	ENSG00000116350	ENST00000373795;ENST00000434636	T	0.13657	2.57	5.54	-2.08	0.07254	.	0.905594	0.09098	N	0.848956	T	0.07007	0.0178	N	0.14661	0.345	0.20764	N	0.999857	B	0.02656	0.0	B	0.01281	0.0	T	0.35822	-0.9773	10	0.46703	T	0.11	.	5.0504	0.14505	0.1452:0.566:0.1911:0.0976	.	328	Q08170	SRSF4_HUMAN	H	328	ENSP00000362900:R328H	ENSP00000362900:R328H	R	-	2	0	SRSF4	29348011	0.444000	0.25649	0.002000	0.10522	0.726000	0.41606	0.163000	0.16520	-0.829000	0.04268	-0.262000	0.10625	CGC	-	SRSF4	-	NULL		0.612	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF4	HGNC	protein_coding	OTTHUMT00000010392.1	0	0		50	50		0.00		C	NM_005626		29475424	-1	24		25		tier1	no_errors	ENST00000373795	ensembl	human	known	74_37	missense	48.98		SNP	0.011	T	24	25
PPFIBP2	8495	genome.wustl.edu	37	11	7669672	7669672	+	Silent	SNP	G	G	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr11:7669672G>T	ENST00000299492.4	+	18	2089	c.1701G>T	c.(1699-1701)ctG>ctT	p.L567L	PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000528883.1_Silent_p.L455L|PPFIBP2_ENST00000533792.1_Silent_p.L409L|PPFIBP2_ENST00000530181.1_Silent_p.L424L	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	567	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GTGCATGGCTGGAGGACTTTG	0.542													ENSG00000166387																																					0													169.0	127.0	141.0					11																	7669672		2201	4296	6497	SO:0001819	synonymous_variant	0			-	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1701G>T	11.37:g.7669672G>T			B7Z433|E9PK77|O75337|Q8WW26	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_D-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.L567	ENST00000299492.4	37	c.1701	CCDS31419.1	11																																																																																			-	PPFIBP2	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.542	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2	0	0		54	54		0.00		G	NM_003621		7669672	+1	15		32		tier1	no_errors	ENST00000299492	ensembl	human	known	74_37	silent	31.91		SNP	1.000	T	15	32
JARID2	3720	genome.wustl.edu	37	6	15496913	15496913	+	Missense_Mutation	SNP	A	A	G			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr6:15496913A>G	ENST00000341776.2	+	7	1701	c.1457A>G	c.(1456-1458)aAg>aGg	p.K486R	JARID2_ENST00000397311.3_Missense_Mutation_p.K314R|JARID2_ENST00000541660.1_Missense_Mutation_p.K448R	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	486					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GGACACGTGAAGAAGGAAGTG	0.677													ENSG00000008083																																					0													30.0	34.0	33.0					6																	15496913		2203	4299	6502	SO:0001583	missense	0			-	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1457A>G	6.37:g.15496913A>G	ENSP00000341280:p.Lys486Arg		A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_ARID/BRIGHT_D-bd,pfam_TF_JmjN,pfam_Znf_C5HC2,superfamily_ARID/BRIGHT_D-bd,smart_TF_JmjN,smart_ARID/BRIGHT_D-bd,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_ARID/BRIGHT_D-bd	p.K486R	ENST00000341776.2	37	c.1457	CCDS4533.1	6	.	.	.	.	.	.	.	.	.	.	A	11.78	1.741266	0.30865	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.88975	-1.81;-1.81;-2.45	5.4	2.66	0.31614	.	0.385685	0.28647	N	0.014608	T	0.65974	0.2743	N	0.17082	0.46	0.25253	N	0.98965	B;B;B	0.17465	0.001;0.022;0.0	B;B;B	0.17433	0.004;0.018;0.001	T	0.59915	-0.7364	10	0.41790	T	0.15	-13.1268	10.7128	0.45993	0.7903:0.0:0.2097:0.0	.	448;350;486	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	R	350;486;314;448	ENSP00000341280:K486R;ENSP00000380478:K314R;ENSP00000444623:K448R	ENSP00000341280:K486R	K	+	2	0	JARID2	15604892	1.000000	0.71417	0.951000	0.38953	0.797000	0.45037	2.338000	0.43957	0.877000	0.35895	0.459000	0.35465	AAG	-	JARID2	-	NULL		0.677	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JARID2	HGNC	protein_coding	OTTHUMT00000039926.1	0	0		37	37		0.00		A	NM_004973		15496913	+1	27		2		tier1	no_errors	ENST00000341776	ensembl	human	known	74_37	missense	93.10		SNP	0.620	G	27	2
URB2	9816	genome.wustl.edu	37	1	229773350	229773352	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr1:229773350_229773352delTCC	ENST00000258243.2	+	4	3126_3128	c.2990_2992delTCC	c.(2989-2994)ttcctc>ttc	p.L998del		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	998						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TGGCTGGAATTCCTCCAAGTGAT	0.429													ENSG00000135763																																					0																																										SO:0001651	inframe_deletion	0				D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2990_2992delTCC	1.37:g.229773353_229773355delTCC	ENSP00000258243:p.Leu998del		Q5VYC9	In_Frame_Del	DEL	pfam_Urb2/Npa2_C	p.L998in_frame_del	ENST00000258243.2	37	c.2990_2992	CCDS31052.1	1																																																																																				URB2	-	NULL		0.429	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	0	0		65	65		0.00		TCC	NM_014777		229773352	+1	33		37		tier1	no_errors	ENST00000258243	ensembl	human	known	74_37	in_frame_del	47.14		DEL	0.539:0.527:0.923	-	33	37
RRP7A	27341	genome.wustl.edu	37	22	42905075	42905075	+	IGR	SNP	G	G	A	rs139392843	byFrequency	TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr22:42905075G>A	ENST00000323013.6	-	0	3801				SERHL_ENST00000359906.2_RNA	NM_015703.4	NP_056518.2	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A (S. cerevisiae)								nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	10						AGCTGTGTGCGCATTCCATCA	0.557													ENSG00000172250																																					0								G		2,4404		0,2,2201	166.0	117.0	133.0			2.1	0.0	22	dbSNP_134	133	0,8600		0,0,4300	no	utr-3	RRP7A	NM_015703.4		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154			42905075	2,13004	2203	4300	6503	SO:0001628	intergenic_variant	0			-	BC035992	CCDS14036.1	22q13.2	2008-08-08			ENSG00000189306	ENSG00000189306			24286	protein-coding gene	gene with protein product						10810093, 12087473	Standard	NM_015703		Approved	CGI-96	uc003bcq.3	Q9Y3A4	OTTHUMG00000150891		22.37:g.42905075G>A			A4FTX2|B2RBG4|Q0VAD0|Q5JZ94|Q6P4B5|Q8IVR9|Q8IVY0|Q8N5Q3|Q8NEY6|Q9Y3H5	R	SNP	-	NULL	ENST00000323013.6	37	NULL	CCDS14036.1	22																																																																																			rs139392843	SERHL	-	-		0.557	RRP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERHL	HGNC	protein_coding	OTTHUMT00000320451.1	0	0		81	81		0.00		G	NM_015703		42905075	+1	4		46		tier1	no_errors	ENST00000359906	ensembl	human	known	74_37	rna	8.00		SNP	0.051	A	4	46
LRP1B	53353	genome.wustl.edu	37	2	141202013	141202013	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr2:141202013G>T	ENST00000389484.3	-	65	11151	c.10180C>A	c.(10180-10182)Cat>Aat	p.H3394N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3394					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGGCAGACATGTGTGTCTAGA	0.363										TSP Lung(27;0.18)			ENSG00000168702																									Colon(99;50 2074 2507 20106)												0													158.0	146.0	150.0					2																	141202013		2203	4300	6503	SO:0001583	missense	0			-	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10180C>A	2.37:g.141202013G>T	ENSP00000374135:p.His3394Asn		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.H3394N	ENST00000389484.3	37	c.10180	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006161	0.54361	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.58797	0.31	5.32	5.32	0.75619	.	0.072938	0.56097	U	0.000027	T	0.63295	0.2499	L	0.48174	1.505	0.38559	D	0.949641	D	0.53619	0.961	P	0.51974	0.686	T	0.61078	-0.7135	10	0.30854	T	0.27	.	19.189	0.93656	0.0:0.0:1.0:0.0	.	3394	Q9NZR2	LRP1B_HUMAN	N	3394;3332	ENSP00000374135:H3394N	ENSP00000374135:H3394N	H	-	1	0	LRP1B	140918483	1.000000	0.71417	1.000000	0.80357	0.475000	0.33008	5.877000	0.69675	2.767000	0.95098	0.563000	0.77884	CAT	-	LRP1B	-	superfamily_LDrepeatLR_classA_rpt		0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	0	0		70	70		0.00		G	NM_018557		141202013	-1	30		3		tier1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	90.91		SNP	1.000	T	30	3
NGEF	25791	genome.wustl.edu	37	2	233877660	233877660	+	Intron	SNP	C	C	T			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr2:233877660C>T	ENST00000264051.3	-	1	205				AC106876.2_ENST00000409905.1_Silent_p.L33L	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor						apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		GGGGGCTCCTCCTCAGTGAAT	0.493													ENSG00000222001																																					0																																										SO:0001627	intron_variant	0			-	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.73+117G>A	2.37:g.233877660C>T			B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	NULL	p.L33	ENST00000264051.3	37	c.99	CCDS2500.1	2																																																																																			-	AC106876.2	-	NULL		0.493	NGEF-001	KNOWN	basic|CCDS	protein_coding	ENSG00000222001	Clone_based_vega_gene	protein_coding	OTTHUMT00000257051.2	0	0		63	63		0.00		C	XM_044799		233877660	+1	35		54		tier1	no_errors	ENST00000409905	ensembl	human	putative	74_37	silent	39.33		SNP	0.000	T	35	54
LILRB4	11006	genome.wustl.edu	37	19	55179128	55179128	+	Nonsense_Mutation	SNP	A	A	T	rs2764337	byFrequency	TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr19:55179128A>T	ENST00000391736.1	+	13	1399	c.1084A>T	c.(1084-1086)Aag>Tag	p.K362*	LILRB4_ENST00000391734.3_Intron|LILRB4_ENST00000391733.3_Nonsense_Mutation_p.K363*|LILRB4_ENST00000270452.2_Nonsense_Mutation_p.K362*|LILRB4_ENST00000430952.2_Nonsense_Mutation_p.K361*	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	362			K -> E (in dbSNP:rs2764337). {ECO:0000269|PubMed:10941837}.|K -> T (in dbSNP:rs11574589).		immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		GACGTATGCCAAGGTGAAACA	0.567													ENSG00000186818																																					0													121.0	124.0	123.0					19																	55179128		2197	4300	6497	SO:0001587	stop_gained	0			-	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.1084A>T	19.37:g.55179128A>T	ENSP00000375616:p.Lys362*		A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Nonsense_Mutation	SNP	pfam_Immunoglobulin,pfscan_Ig-like_dom	p.K362*	ENST00000391736.1	37	c.1084	CCDS12902.1	19	.	.	.	.	.	.	.	.	.	.	N	9.186	1.024764	0.19433	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391733;ENST00000434286	.	.	.	1.55	-2.81	0.05805	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	4.7776	0.13187	0.3772:0.2441:0.3787:0.0	.	.	.	.	X	362;362;361;363;361	.	ENSP00000270452:K362X	K	+	1	0	LILRB4	59870940	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.332000	0.02670	-1.245000	0.02513	-3.071000	0.00067	AAG	-	LILRB4	-	NULL		0.567	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB4	HGNC	protein_coding	OTTHUMT00000141127.3	0	0		127	127		0.00		A			55179128	+1	38		50		tier1	no_errors	ENST00000270452	ensembl	human	known	74_37	nonsense	41.76		SNP	0.000	T	38	50
DOK7	285489	genome.wustl.edu	37	4	3475303	3475303	+	Missense_Mutation	SNP	T	T	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chr4:3475303T>A	ENST00000340083.5	+	3	336	c.271T>A	c.(271-273)Ttt>Att	p.F91I	DOK7_ENST00000389653.2_Missense_Mutation_p.F91I|DOK7_ENST00000507039.1_Missense_Mutation_p.F91I	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	91	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CATGCTGGGCTTTGACAGCCA	0.697													ENSG00000175920																																					0													25.0	29.0	28.0					4																	3475303		2080	4208	6288	SO:0001583	missense	0			-	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.271T>A	4.37:g.3475303T>A	ENSP00000344432:p.Phe91Ile		A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.F91I	ENST00000340083.5	37	c.271	CCDS3370.2	4	.	.	.	.	.	.	.	.	.	.	T	22.6	4.305466	0.81247	.	.	ENSG00000175920	ENST00000389653;ENST00000507039;ENST00000340083	T;T;T	0.80824	-1.42;-1.42;-1.42	3.7	3.7	0.42460	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.87478	0.6187	M	0.72894	2.215	0.46927	D	0.999255	D	0.76494	0.999	D	0.77557	0.99	D	0.88409	0.3020	10	0.72032	D	0.01	-15.6363	11.7281	0.51720	0.0:0.0:0.0:1.0	.	91	Q18PE1	DOK7_HUMAN	I	91	ENSP00000374304:F91I;ENSP00000423614:F91I;ENSP00000344432:F91I	ENSP00000344432:F91I	F	+	1	0	DOK7	3445101	1.000000	0.71417	0.999000	0.59377	0.623000	0.37688	7.125000	0.77193	1.558000	0.49541	0.402000	0.26972	TTT	-	DOK7	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.697	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOK7	HGNC	protein_coding	OTTHUMT00000313538.1	0	0		69	69		0.00		T	NM_173660		3475303	+1	38		41		tier1	no_errors	ENST00000389653	ensembl	human	known	74_37	missense	48.10		SNP	1.000	A	38	41
FAM122B	159090	genome.wustl.edu	37	X	133930160	133930160	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QT-01A-11D-A27P-09	TCGA-KD-A5QT-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	b10488d2-fee5-4732-9162-299bcbdc6b5c	41bf2742-b039-42a5-a300-014f3714424a	g.chrX:133930160C>A	ENST00000370790.1	-	1	1004	c.76G>T	c.(76-78)Gct>Tct	p.A26S	FAM122C_ENST00000414371.2_5'Flank|FAM122B_ENST00000298090.6_Missense_Mutation_p.A26S|FAM122B_ENST00000493333.1_5'UTR|FAM122B_ENST00000486347.1_Missense_Mutation_p.A26S|FAM122B_ENST00000343004.5_Missense_Mutation_p.A26S	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B	26										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					ATTAGGGGAGCGCTGCTGGAT	0.567													ENSG00000156504																																					0													90.0	74.0	79.0					X																	133930160		2203	4300	6503	SO:0001583	missense	0			-	BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.76G>T	X.37:g.133930160C>A	ENSP00000359826:p.Ala26Ser		A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Missense_Mutation	SNP	NULL	p.A26S	ENST00000370790.1	37	c.76	CCDS55497.1	X	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473048	0.84640	.	.	ENSG00000156504	ENST00000370790;ENST00000298090;ENST00000343004;ENST00000394270;ENST00000486347;ENST00000370787	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	4.72	4.72	0.59763	.	0.000000	0.56097	D	0.000027	T	0.75072	0.3800	M	0.84683	2.71	0.49582	D	0.999808	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.87578	0.997;0.997;0.997;0.998	T	0.80011	-0.1561	10	0.72032	D	0.01	.	15.5029	0.75713	0.0:1.0:0.0:0.0	.	26;26;26;26	G1UD80;Q7Z309-2;Q7Z309;Q7Z309-3	.;.;F122B_HUMAN;.	S	26	ENSP00000359826:A26S;ENSP00000298090:A26S;ENSP00000339207:A26S;ENSP00000419592:A26S	ENSP00000298090:A26S	A	-	1	0	FAM122B	133757826	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	6.430000	0.73391	2.306000	0.77630	0.600000	0.82982	GCT	-	FAM122B	-	NULL		0.567	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM122B	HGNC	protein_coding	OTTHUMT00000058382.1	0	0		35	35		0.00		C	NM_145284		133930160	-1	21		22		tier1	no_errors	ENST00000343004	ensembl	human	known	74_37	missense	48.84		SNP	1.000	A	21	22
