#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
BRD8	10902	genome.wustl.edu	37	5	137476530	137476530	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr5:137476530C>A	ENST00000254900.5	-	26	3850	c.3479G>T	c.(3478-3480)gGt>gTt	p.G1160V	NME5_ENST00000265191.2_5'Flank	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	1160	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GCGAATCCGACCCTTAGAGAG	0.428													ENSG00000112983																																					0													265.0	259.0	261.0					5																	137476530		2203	4300	6503	SO:0001583	missense	0			-	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3479G>T	5.37:g.137476530C>A	ENSP00000254900:p.Gly1160Val		O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,superfamily_Peptidase_M20_dimer,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.G1160V	ENST00000254900.5	37	c.3479	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829212	0.90955	.	.	ENSG00000112983	ENST00000254900;ENST00000427976	T;T	0.35421	1.31;1.31	5.84	5.84	0.93424	Bromodomain (5);	0.000000	0.48767	D	0.000161	T	0.70945	0.3282	M	0.92507	3.315	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.77566	-0.2540	10	0.87932	D	0	-10.2484	19.1394	0.93441	0.0:1.0:0.0:0.0	.	1160	Q9H0E9	BRD8_HUMAN	V	1160;266	ENSP00000254900:G1160V;ENSP00000392646:G266V	ENSP00000254900:G1160V	G	-	2	0	BRD8	137504429	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	7.798000	0.85924	2.771000	0.95319	0.655000	0.94253	GGT	-	BRD8	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain		0.428	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	0	0	0	21	21	78	0.00	0.00	C	NM_006696		137476530	-1	5	29	5	38	tier1	no_errors	ENST00000254900	ensembl	human	known	74_37	missense	50.00	43.28	SNP	1.000	A	5	5
SLC9A4	389015	genome.wustl.edu	37	2	103148832	103148832	+	Silent	SNP	C	C	T	rs369230553	byFrequency	TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr2:103148832C>T	ENST00000295269.4	+	12	2539	c.2082C>T	c.(2080-2082)agC>agT	p.S694S		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	694					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TCACGTTCAGCGCATGCTCTC	0.453													ENSG00000180251	c|||	2	0.000399361	0.0008	0.0	5008	,	,		23527	0.0		0.0	False		,,,				2504	0.001																0								T		0,4406		0,0,2203	101.0	100.0	100.0		2082	-5.5	0.0	2		100	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC9A4	NM_001011552.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		694/799	103148832	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.2082C>T	2.37:g.103148832C>T			Q69YK0	Silent	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.S694	ENST00000295269.4	37	c.2082	CCDS33264.1	2																																																																																			-	SLC9A4	-	NULL		0.453	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1	0	0	0	79	79	127	0.00	0.00	C	NM_001011552.3		103148832	+1	13	54	56	93	tier1	no_errors	ENST00000295269	ensembl	human	known	74_37	silent	18.84	36.73	SNP	0.001	T	13	56
ATRX	546	genome.wustl.edu	37	X	76912104	76912104	+	Nonsense_Mutation	SNP	G	G	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chrX:76912104G>C	ENST00000373344.5	-	13	4374	c.4160C>G	c.(4159-4161)tCa>tGa	p.S1387*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.S1349*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1387					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ACTAACTCCTGATTCCTGAAA	0.284			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											66.0	59.0	61.0					X																	76912104		2203	4296	6499	SO:0001587	stop_gained	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4160C>G	X.37:g.76912104G>C	ENSP00000362441:p.Ser1387*		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S1387*	ENST00000373344.5	37	c.4160	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	G	46	12.258433	0.99651	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.24	5.24	0.73138	.	0.000000	0.64402	U	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-4.863	17.5287	0.87808	0.0:0.0:1.0:0.0	.	.	.	.	X	1387;1349;1314	.	ENSP00000362441:S1387X	S	-	2	0	ATRX	76798760	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	6.130000	0.71663	2.167000	0.68274	0.544000	0.68410	TCA	-	ATRX	-	NULL		0.284	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	135	135	113	0.00	0.00	G	NM_000489		76912104	-1	78	56	80	81	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	49.37	40.29	SNP	1.000	C	78	80
SERTAD3	29946	genome.wustl.edu	37	19	40949861	40949861	+	Intron	SNP	T	T	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr19:40949861T>A	ENST00000322354.3	-	1	491				SERTAD3_ENST00000392028.4_5'Flank|SERTAD3_ENST00000601217.1_5'Flank|CTC-492K19.4_ENST00000599050.1_RNA	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3						negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAAAAGTTCCTCCCCTCTGTT	0.537													ENSG00000268366																																					0																																										SO:0001627	intron_variant	0			-	AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.5+260A>T	19.37:g.40949861T>A			B3KQB3|Q96CQ2	R	SNP	-	NULL	ENST00000322354.3	37	NULL	CCDS12558.1	19																																																																																			-	CTC-492K19.4	-	-		0.537	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ENSG00000268366	Clone_based_vega_gene	protein_coding	OTTHUMT00000462573.1	0	0	0	35	35	105	0.00	0.00	T	NM_013368		40949861	+1	8	36	6	81	tier1	no_errors	ENST00000599050	ensembl	human	known	74_37	rna	57.14	30.77	SNP	0.430	A	8	6
SEZ6L	23544	genome.wustl.edu	37	22	26701984	26701984	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr22:26701984G>A	ENST00000248933.6	+	6	1483	c.1388G>A	c.(1387-1389)cGc>cAc	p.R463H	SEZ6L_ENST00000404234.3_Missense_Mutation_p.R463H|SEZ6L_ENST00000343706.4_Missense_Mutation_p.R463H|SEZ6L_ENST00000360929.3_Missense_Mutation_p.R463H|SEZ6L_ENST00000402979.1_Missense_Mutation_p.R236H|SEZ6L_ENST00000529632.2_Missense_Mutation_p.R463H|SEZ6L_ENST00000403121.1_Missense_Mutation_p.R236H			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	463	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						ACCATCGGCCGCGTCCTCTCC	0.572													ENSG00000100095																																					0													74.0	67.0	69.0					22																	26701984		2203	4300	6503	SO:0001583	missense	0			-	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1388G>A	22.37:g.26701984G>A	ENSP00000248933:p.Arg463His		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R463H	ENST00000248933.6	37	c.1388	CCDS13833.1	22	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350666	0.61183	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59	4.86	3.85	0.44370	CUB (5);	0.000000	0.49916	D	0.000128	T	0.48909	0.1526	L	0.53671	1.685	0.80722	D	1	B;B;D;P;B;B;B	0.89917	0.194;0.344;1.0;0.581;0.439;0.344;0.344	B;B;D;B;B;B;B	0.91635	0.061;0.091;0.999;0.123;0.123;0.091;0.091	T	0.50915	-0.8771	10	0.87932	D	0	.	12.3347	0.55060	0.0806:0.0:0.9194:0.0	.	463;463;236;463;463;463;463	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	H	463;463;463;463;463;236;236	ENSP00000384772:R463H;ENSP00000437037:R463H;ENSP00000354185:R463H;ENSP00000248933:R463H;ENSP00000342661:R463H;ENSP00000384838:R236H;ENSP00000384733:R236H	ENSP00000248933:R463H	R	+	2	0	SEZ6L	25031984	1.000000	0.71417	0.898000	0.35279	0.913000	0.54294	6.989000	0.76219	1.284000	0.44531	0.655000	0.94253	CGC	-	SEZ6L	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.572	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	HGNC	protein_coding	OTTHUMT00000320359.3	0	0	0	30	30	73	0.00	0.00	G			26701984	+1	14	20	28	102	tier1	no_errors	ENST00000248933	ensembl	human	known	74_37	missense	32.56	16.13	SNP	0.995	A	14	28
DNAH5	1767	genome.wustl.edu	37	5	13766211	13766211	+	Silent	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr5:13766211G>A	ENST00000265104.4	-	59	10079	c.9975C>T	c.(9973-9975)tgC>tgT	p.C3325C	DNAH5_ENST00000504001.3_Intron	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3325	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCAGCAGTACGCAATCCATGA	0.517									Kartagener syndrome				ENSG00000039139																																					0													113.0	109.0	110.0					5																	13766211		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9975C>T	5.37:g.13766211G>A			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.C3325	ENST00000265104.4	37	c.9975	CCDS3882.1	5																																																																																			-	DH5	-	NULL		0.517	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0	0	42	42	69	0.00	0.00	G	NM_001369		13766211	-1	11	23	29	81	tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	silent	27.50	21.90	SNP	0.693	A	11	29
UROC1	131669	genome.wustl.edu	37	3	126219578	126219578	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr3:126219578C>A	ENST00000290868.2	-	11	1158	c.1105G>T	c.(1105-1107)Gcc>Tcc	p.A369S	UROC1_ENST00000383579.3_Missense_Mutation_p.A429S	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	369					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		GGGTTGGAGGCCATGAGGCTC	0.597													ENSG00000159650																																					0													147.0	138.0	141.0					3																	126219578		2203	4300	6503	SO:0001583	missense	0			-	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.1105G>T	3.37:g.126219578C>A	ENSP00000290868:p.Ala369Ser		E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	pfam_Urocanase,superfamily_Urocanase,pirsf_Urocanase	p.A369S	ENST00000290868.2	37	c.1105	CCDS3038.1	3	.	.	.	.	.	.	.	.	.	.	c	9.568	1.120191	0.20877	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.42131	0.98;0.98	4.47	3.56	0.40772	Urocanase domain (2);	0.759389	0.12860	N	0.433184	T	0.33265	0.0857	L	0.39147	1.195	0.30362	N	0.783734	B;B	0.10296	0.003;0.001	B;B	0.15870	0.014;0.003	T	0.26780	-1.0093	10	0.30078	T	0.28	-1.7373	9.3805	0.38311	0.2231:0.7769:0.0:0.0	.	429;369	E9PE13;Q96N76	.;HUTU_HUMAN	S	369;429	ENSP00000290868:A369S;ENSP00000373073:A429S	ENSP00000290868:A369S	A	-	1	0	UROC1	127702268	1.000000	0.71417	0.995000	0.50966	0.418000	0.31294	0.888000	0.28268	0.816000	0.34421	0.486000	0.48141	GCC	-	UROC1	-	pfam_Urocanase,superfamily_Urocanase,pirsf_Urocanase		0.597	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROC1	HGNC	protein_coding	OTTHUMT00000370325.2	0	0	0	66	66	52	0.00	0.00	C	NM_144639		126219578	-1	18	10	37	61	tier1	no_errors	ENST00000290868	ensembl	human	known	74_37	missense	32.73	14.08	SNP	1.000	A	18	37
FAM196B	100131897	genome.wustl.edu	37	5	169310676	169310676	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr5:169310676G>C	ENST00000377365.3	-	2	1608	c.227C>G	c.(226-228)cCc>cGc	p.P76R	DOCK2_ENST00000520908.1_Intron|DOCK2_ENST00000523351.1_Intron|DOCK2_ENST00000540750.1_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000256935.8_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	76										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						GTAGGTGGGGGGAAGATGGTG	0.562													ENSG00000204767																																					0													106.0	112.0	110.0					5																	169310676		692	1591	2283	SO:0001583	missense	0			-		CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.227C>G	5.37:g.169310676G>C	ENSP00000366582:p.Pro76Arg			Missense_Mutation	SNP	NULL	p.P76R	ENST00000377365.3	37	c.227	CCDS47336.1	5	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469622	0.43839	.	.	ENSG00000204767	ENST00000377365	T	0.42900	0.96	5.43	3.36	0.38483	.	0.208142	0.34245	N	0.004127	T	0.30103	0.0754	L	0.29908	0.895	0.09310	N	1	P	0.46220	0.874	B	0.44224	0.444	T	0.13872	-1.0493	10	0.59425	D	0.04	-7.6609	4.9166	0.13849	0.6667:0.0:0.3333:0.0	.	76	A6NMK8	F196B_HUMAN	R	76	ENSP00000366582:P76R	ENSP00000366582:P76R	P	-	2	0	FAM196B	169243254	0.024000	0.19004	0.973000	0.42090	0.844000	0.47949	1.461000	0.35255	1.105000	0.41606	0.655000	0.94253	CCC	-	FAM196B	-	NULL		0.562	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196B	HGNC	protein_coding	OTTHUMT00000371629.1	0	0	0	53	53	44	0.00	0.00	G	NM_001129891		169310676	-1	12	25	17	49	tier1	no_errors	ENST00000377365	ensembl	human	known	74_37	missense	41.38	33.33	SNP	0.259	C	12	17
ALDH1L1	10840	genome.wustl.edu	37	3	125836884	125836884	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr3:125836884G>T	ENST00000393434.2	-	17	2295	c.1946C>A	c.(1945-1947)aCa>aAa	p.T649K	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.T649K|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.T548K|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.T659K|ALDH1L1_ENST00000393431.2_3'UTR	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	649	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	TGTGGAGCCTGTGAACCCGAT	0.637													ENSG00000144908																																					0													80.0	73.0	76.0					3																	125836884		2203	4300	6503	SO:0001583	missense	0			-	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1946C>A	3.37:g.125836884G>T	ENSP00000377083:p.Thr649Lys		B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.T649K	ENST00000393434.2	37	c.1946	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735610	0.69189	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	4.38	4.38	0.52667	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.95516	0.8543	H	0.99887	4.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.993;0.995	D	0.97314	0.9939	10	0.87932	D	0	.	14.4536	0.67401	0.0:0.0:1.0:0.0	.	548;649	E9PBX3;O75891	.;AL1L1_HUMAN	K	659;649;548;649	ENSP00000273450:T659K;ENSP00000420293:T649K;ENSP00000395881:T548K;ENSP00000377083:T649K	ENSP00000273450:T659K	T	-	2	0	ALDH1L1	127319574	1.000000	0.71417	0.971000	0.41717	0.425000	0.31504	8.487000	0.90454	2.286000	0.76751	0.313000	0.20887	ACA	-	ALDH1L1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH		0.637	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	0	0	0	85	85	58	0.00	0.00	G	NM_012190		125836884	-1	19	17	73	36	tier1	no_errors	ENST00000393434	ensembl	human	known	74_37	missense	20.65	32.08	SNP	0.999	T	19	73
PPP1R10	5514	genome.wustl.edu	37	6	30571953	30571953	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr6:30571953G>A	ENST00000376511.2	-	14	1892	c.1340C>T	c.(1339-1341)gCg>gTg	p.A447V		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	447	Essential for PPP1CA inhibition. {ECO:0000250}.|Interaction with WDR82. {ECO:0000250}.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						CAGACGCCGCGCTGTCTCAAA	0.552													ENSG00000204569																																					0													95.0	98.0	97.0					6																	30571953		2203	4300	6503	SO:0001583	missense	0			-	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.1340C>T	6.37:g.30571953G>A	ENSP00000365694:p.Ala447Val		O00405	Missense_Mutation	SNP	pfam_TFIIS_N,pfam_Znf_CCCH,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_Znf_CCCH	p.A447V	ENST00000376511.2	37	c.1340	CCDS4681.1	6	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168021	0.78339	.	.	ENSG00000204569	ENST00000376511	T	0.54279	0.58	4.82	4.82	0.62117	.	0.052489	0.85682	D	0.000000	T	0.59649	0.2209	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	P	0.58331	0.837	T	0.64795	-0.6323	10	0.87932	D	0	-16.4598	16.8491	0.85989	0.0:0.0:1.0:0.0	.	447	Q96QC0	PP1RA_HUMAN	V	447	ENSP00000365694:A447V	ENSP00000365694:A447V	A	-	2	0	PPP1R10	30679932	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	8.685000	0.91246	2.498000	0.84270	0.467000	0.42956	GCG	-	PPP1R10	-	NULL		0.552	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R10	HGNC	protein_coding	OTTHUMT00000076556.2	0	0	0	46	46	58	0.00	0.00	G	NM_002714		30571953	-1	5	6	44	48	tier1	no_errors	ENST00000376511	ensembl	human	known	74_37	missense	10.20	10.91	SNP	1.000	A	5	44
NOL8	55035	genome.wustl.edu	37	9	95078413	95078413	+	Missense_Mutation	SNP	T	T	G	rs41305617	byFrequency	TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr9:95078413T>G	ENST00000535387.1	-	6	493	c.494A>C	c.(493-495)aAa>aCa	p.K165T	NOL8_ENST00000358855.4_Missense_Mutation_p.K97T|NOL8_ENST00000542053.1_Missense_Mutation_p.K97T|NOL8_ENST00000442668.2_Missense_Mutation_p.K165T|NOL8_ENST00000545558.1_Missense_Mutation_p.K165T					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						GGGATCATATTTGATGATGTT	0.363													ENSG00000198000																																					0													96.0	85.0	89.0					9																	95078413		1859	4105	5964	SO:0001583	missense	0			-	AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.494A>C	9.37:g.95078413T>G	ENSP00000441300:p.Lys165Thr			Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K165T	ENST00000535387.1	37	c.494	CCDS47993.1	9	.	.	.	.	.	.	.	.	.	.	T	18.20	3.572054	0.65765	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000358855;ENST00000545558;ENST00000535387;ENST00000542053;ENST00000432670;ENST00000433029;ENST00000421075;ENST00000411621;ENST00000535807	T;T;T;T;T;T;T;T	0.54479	2.12;2.01;2.12;2.32;2.01;1.84;0.57;0.67	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	L	0.49126	1.545	0.51233	D	0.999914	D	0.89917	1.0	D	0.91635	0.999	T	0.70842	-0.4762	10	0.87932	D	0	-23.0153	15.1284	0.72500	0.0:0.0:0.0:1.0	.	165	Q76FK4	NOL8_HUMAN	T	165;167;97;165;165;97;165;165;165;97;97	ENSP00000401177:K165T;ENSP00000351723:K97T;ENSP00000441140:K165T;ENSP00000441300:K165T;ENSP00000440709:K97T;ENSP00000414112:K165T;ENSP00000412471:K165T;ENSP00000390143:K165T	ENSP00000351723:K97T	K	-	2	0	NOL8	94118234	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	7.001000	0.76297	2.021000	0.59480	0.528000	0.53228	AAA	-	NOL8	-	NULL		0.363	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	NOL8	HGNC	protein_coding	OTTHUMT00000053082.2	0	0	0	47	47	78	0.00	0.00	T	NM_017948		95078413	-1	37	48	16	53	tier1	no_errors	ENST00000442668	ensembl	human	known	74_37	missense	69.81	47.06	SNP	1.000	G	37	16
PIWIL3	440822	genome.wustl.edu	37	22	25124262	25124262	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr22:25124262G>T	ENST00000332271.5	-	15	2230	c.1814C>A	c.(1813-1815)cCa>cAa	p.P605Q	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000527701.1_Missense_Mutation_p.P487Q|PIWIL3_ENST00000533313.1_Missense_Mutation_p.P487Q	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	605	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						ACACTGGCTTGGAATTGGGCA	0.443													ENSG00000184571																																					0													229.0	209.0	216.0					22																	25124262		2203	4300	6503	SO:0001583	missense	0			-	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.1814C>A	22.37:g.25124262G>T	ENSP00000330031:p.Pro605Gln			Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.P605Q	ENST00000332271.5	37	c.1814	CCDS33623.1	22	.	.	.	.	.	.	.	.	.	.	G	15.69	2.906744	0.52333	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.19105	2.17;2.17;2.17	2.57	1.51	0.23008	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.064533	0.64402	U	0.000006	T	0.43255	0.1239	M	0.84156	2.68	0.54753	D	0.999987	D;P;D	0.89917	1.0;0.95;0.999	D;P;D	0.97110	1.0;0.876;0.986	T	0.29822	-0.9999	10	0.66056	D	0.02	-5.6034	7.199	0.25871	0.1463:0.0:0.8537:0.0	.	487;596;605	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	Q	605;487;487	ENSP00000330031:P605Q;ENSP00000431843:P487Q;ENSP00000435718:P487Q	ENSP00000330031:P605Q	P	-	2	0	PIWIL3	23454262	1.000000	0.71417	0.667000	0.29798	0.032000	0.12392	4.687000	0.61708	0.426000	0.26116	0.491000	0.48974	CCA	-	PIWIL3	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi		0.443	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL3	HGNC	protein_coding	OTTHUMT00000320084.2	0	0	0	70	70	137	0.00	0.00	G	NM_001008496		25124262	-1	21	36	92	150	tier1	no_errors	ENST00000332271	ensembl	human	known	74_37	missense	18.58	19.35	SNP	1.000	T	21	92
IQCE	23288	genome.wustl.edu	37	7	2646853	2646853	+	Missense_Mutation	SNP	C	C	G			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr7:2646853C>G	ENST00000402050.2	+	21	2145	c.1961C>G	c.(1960-1962)gCt>gGt	p.A654G	IQCE_ENST00000404984.1_Missense_Mutation_p.A603G|IQCE_ENST00000325979.7_Missense_Mutation_p.A589G|IQCE_ENST00000438376.2_Missense_Mutation_p.A638G	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	654						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		TTCCTCGCAGCTCTTCCTGGT	0.592													ENSG00000106012																																					0													65.0	72.0	70.0					7																	2646853		1934	4135	6069	SO:0001583	missense	0			-	AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1961C>G	7.37:g.2646853C>G	ENSP00000385597:p.Ala654Gly		Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.A654G	ENST00000402050.2	37	c.1961	CCDS43542.1	7	.	.	.	.	.	.	.	.	.	.	C	16.12	3.031960	0.54790	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000423196	T;T;T;T;T	0.35789	2.64;2.62;2.63;2.63;1.29	4.85	3.96	0.45880	.	1.397010	0.05079	N	0.483112	T	0.39835	0.1093	L	0.59436	1.845	0.80722	D	1	P;P;P;P;P	0.50156	0.888;0.888;0.888;0.888;0.932	B;B;B;B;B	0.42692	0.221;0.221;0.221;0.221;0.395	T	0.20042	-1.0287	10	0.35671	T	0.21	-4.353	9.2634	0.37625	0.0:0.8987:0.0:0.1013	.	589;638;654;654;638	B4DXN1;B4DDX4;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;IQCE_HUMAN;.;.	G	654;603;638;589;234	ENSP00000385597:A654G;ENSP00000385945:A603G;ENSP00000396178:A638G;ENSP00000313772:A589G;ENSP00000405982:A234G	ENSP00000313772:A589G	A	+	2	0	IQCE	2613379	0.086000	0.21541	0.003000	0.11579	0.568000	0.35870	3.365000	0.52335	1.169000	0.42739	0.655000	0.94253	GCT	-	IQCE	-	NULL		0.592	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	0	0	0	42	42	39	0.00	0.00	C	NM_152558		2646853	+1	17	18	47	52	tier1	no_errors	ENST00000402050	ensembl	human	known	74_37	missense	26.15	25.71	SNP	0.004	G	17	47
TNPO3	23534	genome.wustl.edu	37	7	128619071	128619071	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr7:128619071C>T	ENST00000265388.5	-	16	2170	c.2027G>A	c.(2026-2028)gGa>gAa	p.G676E	TNPO3_ENST00000482320.1_Missense_Mutation_p.G610E|TNPO3_ENST00000393245.1_Missense_Mutation_p.G710E|TNPO3_ENST00000471234.1_Missense_Mutation_p.G612E|TNPO3_ENST00000471166.1_Missense_Mutation_p.G710E			Q9Y5L0	TNPO3_HUMAN	transportin 3	676					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						TGCTGCAGATCCTTTGCCTAC	0.507													ENSG00000064419																									Pancreas(147;583 2585 39696 52331)												0													178.0	170.0	172.0					7																	128619071		2203	4300	6503	SO:0001583	missense	0			-	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.2027G>A	7.37:g.128619071C>T	ENSP00000265388:p.Gly676Glu		A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.G710E	ENST00000265388.5	37	c.2129	CCDS5809.1	7	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214381	0.58452	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;0.07;-0.09	5.73	5.73	0.89815	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47192	0.1432	L	0.34521	1.04	0.80722	D	1	P;P;B;B	0.36282	0.498;0.546;0.406;0.284	B;B;B;B	0.32465	0.115;0.146;0.139;0.066	T	0.49163	-0.8968	10	0.02654	T	1	-13.824	17.4008	0.87459	0.0:1.0:0.0:0.0	.	612;710;676;676	C9IZM0;C9J7E5;Q9Y5L0-3;Q9Y5L0	.;.;.;TNPO3_HUMAN	E	710;676;610;612;710	ENSP00000376936:G710E;ENSP00000265388:G676E;ENSP00000420089:G610E;ENSP00000418646:G612E;ENSP00000418267:G710E	ENSP00000265388:G676E	G	-	2	0	TNPO3	128406307	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.458000	0.80787	2.718000	0.92993	0.585000	0.79938	GGA	-	TNPO3	-	superfamily_ARM-type_fold		0.507	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	HGNC	protein_coding	OTTHUMT00000350929.1	0	0	0	28	28	36	0.00	0.00	C	NM_012470		128619071	-1	11	14	14	59	tier1	no_errors	ENST00000393245	ensembl	human	known	74_37	missense	44.00	19.18	SNP	1.000	T	11	14
SEC16A	9919	genome.wustl.edu	37	9	139347902	139347902	+	Missense_Mutation	SNP	A	A	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr9:139347902A>C	ENST00000371706.3	-	20	5636	c.5603T>G	c.(5602-5604)tTt>tGt	p.F1868C	SEC16A_ENST00000431893.2_Missense_Mutation_p.F1868C|SEC16A_ENST00000290037.6_Missense_Mutation_p.F1868C|SEC16A_ENST00000313050.7_Missense_Mutation_p.F2046C|SEC16A_ENST00000398335.1_5'Flank			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1868	Pro-rich.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TTTTCCATCAAAATTTTCTTC	0.438													ENSG00000148396																																					0													78.0	81.0	80.0					9																	139347902		1867	4108	5975	SO:0001583	missense	0			-	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.5603T>G	9.37:g.139347902A>C	ENSP00000360771:p.Phe1868Cys		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.F2046C	ENST00000371706.3	37	c.6137		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.33|14.33	2.503428|2.503428	0.44558|0.44558	.|.	.|.	ENSG00000148396|ENSG00000148396	ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925;ENST00000398348|ENST00000433860	T;T;T;T;T;T|.	0.51325|.	1.64;0.71;1.33;1.65;1.63;1.63|.	4.84|4.84	2.45|2.45	0.29901|0.29901	.|.	0.490203|0.490203	0.21671|0.21671	N|N	0.070868|0.070868	T|T	0.45337|0.45337	0.1337|0.1337	M|M	0.66939|0.66939	2.045|2.045	0.09310|0.09310	N|N	0.999999|0.999999	D;D;D;D;D|.	0.89917|.	0.999;1.0;0.995;0.983;0.997|.	D;D;P;P;P|.	0.83275|.	0.973;0.996;0.847;0.635;0.808|.	T|T	0.31280|0.31280	-0.9949|-0.9949	10|6	0.66056|.	D|.	0.02|.	-1.3395|-1.3395	7.5218|7.5218	0.27633|0.27633	0.8337:0.0:0.1663:0.0|0.8337:0.0:0.1663:0.0	.|.	2046;1868;1868;1436;1868|.	F1T0I1;O15027-5;O15027-4;A4QN19;O15027|.	.;.;.;.;SC16A_HUMAN|.	C|L	2046;440;768;1868;1868;1868;1436;404|175	ENSP00000325827:F2046C;ENSP00000277537:F440C;ENSP00000403525:F768C;ENSP00000360771:F1868C;ENSP00000290037:F1868C;ENSP00000387583:F1868C|.	ENSP00000277537:F440C|.	F|F	-|-	2|3	0|2	SEC16A|SEC16A	138467723|138467723	0.075000|0.075000	0.21258|0.21258	0.000000|0.000000	0.03702|0.03702	0.017000|0.017000	0.09413|0.09413	2.998000|2.998000	0.49465|0.49465	0.295000|0.295000	0.22570|0.22570	0.459000|0.459000	0.35465|0.35465	TTT|TTT	-	SEC16A	-	NULL		0.438	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	0	0	0	48	48	115	0.00	0.00	A	XM_088459		139347902	-1	6	12	37	65	tier1	no_errors	ENST00000313050	ensembl	human	known	74_37	missense	13.95	15.58	SNP	0.002	C	6	37
EPHA7	2045	genome.wustl.edu	37	6	93964495	93964495	+	Missense_Mutation	SNP	C	C	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr6:93964495C>A	ENST00000369303.4	-	14	2586	c.2402G>T	c.(2401-2403)aGg>aTg	p.R801M		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	801	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TGCTGTCCACCTTACTGGAAT	0.353													ENSG00000135333																																					0													96.0	82.0	87.0					6																	93964495		2203	4300	6503	SO:0001583	missense	0			-	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2402G>T	6.37:g.93964495C>A	ENSP00000358309:p.Arg801Met		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.R801M	ENST00000369303.4	37	c.2402	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803497	0.90623	.	.	ENSG00000135333	ENST00000369303	D	0.83755	-1.76	5.39	5.39	0.77823	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92087	0.7492	M	0.89414	3.03	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.951;0.971	D	0.93137	0.6538	10	0.87932	D	0	.	19.1563	0.93511	0.0:1.0:0.0:0.0	.	797;796;801	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	M	801	ENSP00000358309:R801M	ENSP00000358309:R801M	R	-	2	0	EPHA7	94021216	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.715000	0.84713	2.542000	0.85734	0.655000	0.94253	AGG	-	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.353	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	0	0	0	32	32	69	0.00	0.00	C			93964495	-1	20	61	27	67	tier1	no_errors	ENST00000369303	ensembl	human	known	74_37	missense	42.55	47.66	SNP	1.000	A	20	27
DNAI2	64446	genome.wustl.edu	37	17	72285741	72285741	+	Missense_Mutation	SNP	A	A	G			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr17:72285741A>G	ENST00000311014.6	+	5	543	c.476A>G	c.(475-477)cAg>cGg	p.Q159R	DNAI2_ENST00000307504.5_Missense_Mutation_p.Q16R|DNAI2_ENST00000446837.2_Missense_Mutation_p.Q159R|DNAI2_ENST00000579490.1_Missense_Mutation_p.Q216R|DNAI2_ENST00000582036.1_Missense_Mutation_p.Q159R			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	159					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGGGACCCCCAGGAAATCAAG	0.547									Kartagener syndrome				ENSG00000171595																																					0													43.0	45.0	44.0					17																	72285741		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.476A>G	17.37:g.72285741A>G	ENSP00000308312:p.Gln159Arg		C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.Q159R	ENST00000311014.6	37	c.476	CCDS11697.1	17	.	.	.	.	.	.	.	.	.	.	A	13.47	2.246730	0.39697	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	T;T;T	0.14516	2.5;2.5;2.5	5.14	4.05	0.47172	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.191070	0.53938	D	0.000054	T	0.11024	0.0269	L	0.40543	1.245	0.33135	D	0.543598	B	0.20368	0.044	B	0.23275	0.045	T	0.18023	-1.0350	10	0.10111	T	0.7	-39.7616	11.3368	0.49509	0.8638:0.0:0.0:0.1362	.	159	Q9GZS0	DNAI2_HUMAN	R	159;16;159	ENSP00000308312:Q159R;ENSP00000302929:Q16R;ENSP00000400252:Q159R	ENSP00000302929:Q16R	Q	+	2	0	DNAI2	69797336	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	6.691000	0.74573	0.780000	0.33566	0.260000	0.18958	CAG	-	DI2	-	superfamily_WD40_repeat_dom		0.547	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DI2	HGNC	protein_coding	OTTHUMT00000442537.1	0	0	0	27	27	50	0.00	0.00	A	NM_023036		72285741	+1	9	20	15	52	tier1	no_errors	ENST00000311014	ensembl	human	known	74_37	missense	37.50	27.78	SNP	1.000	G	9	15
MFI2	4241	genome.wustl.edu	37	3	196751255	196751255	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr3:196751255G>A	ENST00000296350.5	-	4	519	c.406C>T	c.(406-408)Cgc>Tgc	p.R136C	MFI2_ENST00000296351.4_Missense_Mutation_p.R136C	NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	136	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CCCACTGTGCGATTGATGCCC	0.622													ENSG00000163975																																					0													82.0	76.0	78.0					3																	196751255		2203	4300	6503	SO:0001583	missense	0			-		CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.406C>T	3.37:g.196751255G>A	ENSP00000296350:p.Arg136Cys		Q9BQE2	Missense_Mutation	SNP	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.R136C	ENST00000296350.5	37	c.406	CCDS3325.1	3	.	.	.	.	.	.	.	.	.	.	G	18.57	3.653019	0.67472	.	.	ENSG00000163975	ENST00000296350;ENST00000296351;ENST00000439320	T;T;T	0.42131	0.98;0.98;0.98	5.23	2.31	0.28768	.	0.061204	0.64402	D	0.000005	T	0.71239	0.3316	M	0.93150	3.385	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.99;0.994;0.984	T	0.78018	-0.2368	10	0.87932	D	0	-27.6872	14.1975	0.65682	0.0:0.0:0.3214:0.6786	.	136;136;136	P08582-2;Q53XS6;P08582	.;.;TRFM_HUMAN	C	136	ENSP00000296350:R136C;ENSP00000296351:R136C;ENSP00000393439:R136C	ENSP00000296350:R136C	R	-	1	0	MFI2	198235652	1.000000	0.71417	0.996000	0.52242	0.935000	0.57460	1.282000	0.33226	0.142000	0.18901	0.655000	0.94253	CGC	-	MFI2	-	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam		0.622	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MFI2	HGNC	protein_coding	OTTHUMT00000340458.1	0	0	0	55	55	10	0.00	0.00	G			196751255	-1	12	6	39	23	tier1	no_errors	ENST00000296350	ensembl	human	known	74_37	missense	23.08	20.69	SNP	1.000	A	12	39
EFCAB3	146779	genome.wustl.edu	37	17	60472473	60472473	+	Missense_Mutation	SNP	A	A	G			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr17:60472473A>G	ENST00000305286.3	+	6	490	c.412A>G	c.(412-414)Atc>Gtc	p.I138V	EFCAB3_ENST00000450662.2_Missense_Mutation_p.I190V	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	138							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			CAACCCAGGAATCCTATTGTT	0.368													ENSG00000172421																																					0													117.0	124.0	121.0					17																	60472473		2203	4300	6503	SO:0001583	missense	0			-	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.412A>G	17.37:g.60472473A>G	ENSP00000302649:p.Ile138Val		J3KQM8	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.I190V	ENST00000305286.3	37	c.568	CCDS11632.1	17	.	.	.	.	.	.	.	.	.	.	A	8.812	0.935585	0.18206	.	.	ENSG00000172421	ENST00000450662;ENST00000305286;ENST00000520404;ENST00000518576	T;T;T;T	0.60920	0.15;0.18;0.36;0.37	5.98	4.89	0.63831	.	0.096592	0.45126	D	0.000394	T	0.54111	0.1838	M	0.64997	1.995	0.28015	N	0.934763	P;B	0.48089	0.905;0.243	B;B	0.43536	0.423;0.079	T	0.52533	-0.8563	10	0.33141	T	0.24	.	9.3828	0.38325	0.841:0.0:0.0:0.159	.	138;138	E5RJB7;Q8N7B9	.;EFCB3_HUMAN	V	190;138;138;138	ENSP00000403932:I190V;ENSP00000302649:I138V;ENSP00000429124:I138V;ENSP00000428626:I138V	ENSP00000302649:I138V	I	+	1	0	EFCAB3	57826205	0.975000	0.34042	0.970000	0.41538	0.013000	0.08279	2.321000	0.43805	1.056000	0.40484	-0.480000	0.04831	ATC	-	EFCAB3	-	NULL		0.368	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB3	HGNC	protein_coding	OTTHUMT00000379114.1	0	0	0	60	60	128	0.00	0.00	A	NM_173503		60472473	+1	37	87	19	61	tier1	no_errors	ENST00000450662	ensembl	human	known	74_37	missense	66.07	58.78	SNP	0.997	G	37	19
ZNF681	148213	genome.wustl.edu	37	19	23927876	23927876	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr19:23927876C>T	ENST00000402377.3	-	4	617	c.476G>A	c.(475-477)gGa>gAa	p.G159E	ZNF681_ENST00000395385.3_Missense_Mutation_p.G90E	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TACCTTATGTCCATTTAAATT	0.259													ENSG00000196172																																					0													20.0	21.0	21.0					19																	23927876		2186	4280	6466	SO:0001583	missense	0			-	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.476G>A	19.37:g.23927876C>T	ENSP00000384000:p.Gly159Glu		B3KVF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G159E	ENST00000402377.3	37	c.476	CCDS12414.2	19	.	.	.	.	.	.	.	.	.	.	.	4.313	0.057323	0.08339	.	.	ENSG00000196172	ENST00000402377;ENST00000395385;ENST00000528059;ENST00000531570	T;T;T;T	0.27256	1.68;1.68;2.52;1.68	1.27	-2.54	0.06307	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.	.	.	.	T	0.07818	0.0196	N	0.03903	-0.33	0.09310	N	1	B	0.19073	0.033	B	0.14578	0.011	T	0.35773	-0.9775	9	0.16896	T	0.51	.	2.2928	0.04143	0.4325:0.3429:0.0:0.2246	.	159	Q96N22	ZN681_HUMAN	E	159;90;90;90	ENSP00000384000:G159E;ENSP00000378783:G90E;ENSP00000433806:G90E;ENSP00000435824:G90E	ENSP00000378783:G90E	G	-	2	0	ZNF681	23719716	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.390000	0.00487	-0.194000	0.10399	-0.671000	0.03813	GGA	-	ZNF681	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.259	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	0	0	0	19	19	59	0.00	0.00	C	NM_138286		23927876	-1	14	27	18	42	tier1	no_errors	ENST00000402377	ensembl	human	known	74_37	missense	43.75	39.13	SNP	0.001	T	14	18
CACNB4	785	genome.wustl.edu	37	2	152727108	152727108	+	Silent	SNP	A	A	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr2:152727108A>C	ENST00000539935.1	-	8	703	c.636T>G	c.(634-636)ccT>ccG	p.P212P	CACNB4_ENST00000427385.1_Silent_p.P194P|CACNB4_ENST00000360283.6_Silent_p.P179P|CACNB4_ENST00000201943.5_Silent_p.P212P|CACNB4_ENST00000397327.2_Silent_p.P165P|CACNB4_ENST00000534999.1_Silent_p.P178P	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit	212					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CAACATCGTAAGGAGGAATGT	0.463													ENSG00000182389																																					0													85.0	85.0	85.0					2																	152727108		2127	4235	6362	SO:0001819	synonymous_variant	0			-	AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.636T>G	2.37:g.152727108A>C			A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Silent	SNP	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_SH3_domain,prints_VDCC_L_bsu	p.P212	ENST00000539935.1	37	c.636	CCDS46426.1	2																																																																																			-	CACNB4	-	superfamily_SH3_domain,prints_VDCC_L_bsu		0.463	CACNB4-001	KNOWN	basic|CCDS	protein_coding	CACNB4	HGNC	protein_coding	OTTHUMT00000338385.4	0	0	0	20	20	105	0.00	0.00	A	NM_000726.3		152727108	-1	10	63	11	30	tier1	no_errors	ENST00000539935	ensembl	human	known	74_37	silent	47.62	67.74	SNP	0.985	C	10	11
GTPBP8	29083	genome.wustl.edu	37	3	112714066	112714066	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr3:112714066G>C	ENST00000383678.2	+	3	602	c.520G>C	c.(520-522)Gaa>Caa	p.E174Q	GTPBP8_ENST00000473129.1_Missense_Mutation_p.E24Q|GTPBP8_ENST00000467752.1_Missense_Mutation_p.E63Q|GTPBP8_ENST00000383677.3_Missense_Mutation_p.E141Q	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	174	EngB-type G.				barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						TAGAGCACCTGAAGATTTTGT	0.333													ENSG00000163607																																					0													73.0	78.0	76.0					3																	112714066		2203	4299	6502	SO:0001583	missense	0			-	BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.520G>C	3.37:g.112714066G>C	ENSP00000373176:p.Glu174Gln		A6NE99|A6NN11|A8K0P6|Q5I0Y4	Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_EF_GTP-bd_dom,pfam_Fe2_transport_prot_B_N,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,tigrfam_GTP-bd_ribosome_bio_YsxC	p.E174Q	ENST00000383678.2	37	c.520	CCDS33820.1	3	.	.	.	.	.	.	.	.	.	.	G	13.10	2.134888	0.37728	.	.	ENSG00000163607	ENST00000383678;ENST00000383677;ENST00000305485;ENST00000467752;ENST00000473129	T;T;T;T	0.71817	2.27;2.58;2.27;-0.6	5.81	2.64	0.31445	GTP-binding domain, HSR1-related (1);	0.268450	0.42172	D	0.000751	T	0.54565	0.1866	L	0.32530	0.975	0.33411	D	0.578683	P;B	0.35401	0.499;0.238	B;B	0.31191	0.112;0.125	T	0.63769	-0.6562	10	0.45353	T	0.12	-21.274	9.8602	0.41109	0.305:0.0:0.695:0.0	.	141;174	Q8N3Z3-2;Q8N3Z3	.;GTPB8_HUMAN	Q	174;141;197;63;24	ENSP00000373176:E174Q;ENSP00000373175:E141Q;ENSP00000417632:E63Q;ENSP00000418514:E24Q	ENSP00000303802:E197Q	E	+	1	0	GTPBP8	114196756	0.398000	0.25279	1.000000	0.80357	0.970000	0.65996	0.832000	0.27490	0.814000	0.34374	-0.150000	0.13652	GAA	-	GTPBP8	-	pfam_GTP_binding_domain,pfam_EF_GTP-bd_dom,pfam_Fe2_transport_prot_B_N,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,tigrfam_GTP-bd_ribosome_bio_YsxC		0.333	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP8	HGNC	protein_coding	OTTHUMT00000354260.2	0	0	0	46	46	129	0.00	0.00	G	NM_014170		112714066	+1	4	30	45	164	tier1	no_errors	ENST00000383678	ensembl	human	known	74_37	missense	8.16	15.46	SNP	0.978	C	4	45
ALG6	29929	genome.wustl.edu	37	1	63872024	63872024	+	Missense_Mutation	SNP	T	T	C	rs188679061		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:63872024T>C	ENST00000371108.4	+	6	688	c.383T>C	c.(382-384)gTg>gCg	p.V128A	ALG6_ENST00000263440.4_Missense_Mutation_p.V128A	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	128					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						ATACCTGCAGTGGTTTTGTAC	0.348													ENSG00000088035																																					0													182.0	164.0	170.0					1																	63872024		2203	4300	6503	SO:0001583	missense	0			-	AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.383T>C	1.37:g.63872024T>C	ENSP00000360149:p.Val128Ala		B3KMU2|Q5SXR9|Q9H3I0	Missense_Mutation	SNP	pfam_Glyco_trans_ALG6/ALG8	p.V128A	ENST00000371108.4	37	c.383	CCDS30735.1	1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.820448	0.90873	.	.	ENSG00000088035	ENST00000371108;ENST00000263440	D;D	0.85773	-2.03;-2.03	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.82337	0.5015	L	0.57536	1.79	0.80722	D	1	B	0.29188	0.236	B	0.41135	0.348	T	0.81163	-0.1058	10	0.36615	T	0.2	-2.0698	16.2853	0.82717	0.0:0.0:0.0:1.0	.	128	A2A2G4	.	A	128	ENSP00000360149:V128A;ENSP00000263440:V128A	ENSP00000263440:V128A	V	+	2	0	ALG6	63644612	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.019000	0.64060	2.236000	0.73375	0.528000	0.53228	GTG	rs188679061	ALG6	-	pfam_Glyco_trans_ALG6/ALG8		0.348	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	ALG6	HGNC	protein_coding	OTTHUMT00000025330.2	0	0	0	62	62	142	0.00	0.00	T	NM_013339		63872024	+1	9	18	94	161	tier1	no_errors	ENST00000371108	ensembl	human	known	74_37	missense	8.65	10.06	SNP	1.000	C	9	94
FAM26D	221301	genome.wustl.edu	37	6	116875020	116875020	+	Silent	SNP	T	T	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr6:116875020T>C	ENST00000368596.3	+	1	108	c.64T>C	c.(64-66)Tta>Cta	p.L22L	FAM26D_ENST00000416171.2_Intron|FAM26D_ENST00000405399.1_Intron|FAM26D_ENST00000368597.2_Intron			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	22					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		TATCAATTCTTTAATTGCAGC	0.398													ENSG00000164451																																					0																																										SO:0001819	synonymous_variant	0			-	AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.64T>C	6.37:g.116875020T>C			B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Silent	SNP	NULL	p.L22	ENST00000368596.3	37	c.64		6																																																																																			-	FAM26D	-	NULL		0.398	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	0	0	0	37	37	70	0.00	0.00	T	NM_153036		116875020	+1	36	32	35	49	tier1	no_errors	ENST00000368596	ensembl	human	known	74_37	silent	50.70	39.51	SNP	0.988	C	36	35
TGFBR3	7049	genome.wustl.edu	37	1	92187646	92187646	+	Missense_Mutation	SNP	T	T	G			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:92187646T>G	ENST00000525962.1	-	7	1002	c.941A>C	c.(940-942)aAa>aCa	p.K314T	TGFBR3_ENST00000370399.2_Missense_Mutation_p.K314T|TGFBR3_ENST00000212355.4_Missense_Mutation_p.K314T			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	314					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TCTTATTGATTTGGTCATTGT	0.383													ENSG00000069702																																					0													135.0	121.0	125.0					1																	92187646		2203	4300	6503	SO:0001583	missense	0			-	L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.941A>C	1.37:g.92187646T>G	ENSP00000436127:p.Lys314Thr		A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.K314T	ENST00000525962.1	37	c.941	CCDS30770.1	1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.199999	0.38905	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.22	2.81	0.32909	.	0.088881	0.85682	N	0.000000	T	0.16428	0.0395	L	0.54323	1.7	0.58432	D	0.999999	B;B;B	0.23735	0.003;0.026;0.09	B;B;B	0.25405	0.024;0.027;0.06	T	0.03739	-1.1008	10	0.45353	T	0.12	-13.786	8.1503	0.31137	0.0:0.0706:0.1347:0.7946	.	314;314;314	A8K5N0;Q03167-2;Q03167	.;.;TGBR3_HUMAN	T	314	ENSP00000212355:K314T;ENSP00000359426:K314T;ENSP00000436127:K314T;ENSP00000432638:K314T	ENSP00000212355:K314T	K	-	2	0	TGFBR3	91960234	1.000000	0.71417	0.725000	0.30721	0.989000	0.77384	3.972000	0.56838	0.366000	0.24427	0.379000	0.24179	AAA	-	TGFBR3	-	NULL		0.383	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TGFBR3	HGNC	protein_coding	OTTHUMT00000382308.1	0	0	0	41	41	80	0.00	0.00	T	NM_003243		92187646	-1	5	25	52	140	tier1	no_errors	ENST00000212355	ensembl	human	known	74_37	missense	8.62	15.15	SNP	0.998	G	5	52
C2orf16	84226	genome.wustl.edu	37	2	27801965	27801965	+	Silent	SNP	A	A	C	rs375613150		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr2:27801965A>C	ENST00000408964.2	+	1	2577	c.2526A>C	c.(2524-2526)ctA>ctC	p.L842L	AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	842						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					AGAGACATCTACCACAAAGCT	0.458													ENSG00000221843																																					0													71.0	73.0	72.0					2																	27801965		1975	4181	6156	SO:0001819	synonymous_variant	0			-	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.2526A>C	2.37:g.27801965A>C			B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	NULL	p.L842	ENST00000408964.2	37	c.2526	CCDS42666.1	2																																																																																			-	C2orf16	-	NULL		0.458	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	0	0	0	38	38	98	0.00	0.00	A	NM_032266		27801965	+1	9	13	18	76	tier1	no_errors	ENST00000408964	ensembl	human	known	74_37	silent	33.33	14.61	SNP	0.000	C	9	18
UBE3B	89910	genome.wustl.edu	37	12	109948259	109948259	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr12:109948259C>T	ENST00000342494.3	+	17	2447	c.1852C>T	c.(1852-1854)Cga>Tga	p.R618*	UBE3B_ENST00000434735.2_Nonsense_Mutation_p.R618*|UBE3B_ENST00000280774.5_Nonsense_Mutation_p.R618*|UBE3B_ENST00000535900.1_3'UTR	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	618					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						CCACTGGCTGCGAAAGTGAGC	0.642													ENSG00000151148																																					0													25.0	23.0	24.0					12																	109948259		2203	4300	6503	SO:0001587	stop_gained	0			-	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.1852C>T	12.37:g.109948259C>T	ENSP00000340596:p.Arg618*		A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Nonsense_Mutation	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.R618*	ENST00000342494.3	37	c.1852	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	C	45	11.635960	0.99585	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494;ENST00000539584	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-17.441	17.4677	0.87638	0.0:1.0:0.0:0.0	.	.	.	.	X	618;618;618;618;45	.	ENSP00000280774:R618X	R	+	1	2	UBE3B	108432642	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.624000	0.54231	2.370000	0.80446	0.462000	0.41574	CGA	-	UBE3B	-	NULL		0.642	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	0	0	0	33	33	14	0.00	0.00	C	NM_183415		109948259	+1	9	4	25	30	tier1	no_errors	ENST00000342494	ensembl	human	known	74_37	nonsense	26.47	11.76	SNP	1.000	T	9	25
C1QTNF9	338872	genome.wustl.edu	37	13	24895530	24895530	+	Missense_Mutation	SNP	C	C	T	rs557592254		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr13:24895530C>T	ENST00000382071.2	+	4	711	c.626C>T	c.(625-627)aCg>aTg	p.T209M	C1QTNF9_ENST00000332018.4_Missense_Mutation_p.T209M|C1QTNF9-AS1_ENST00000449656.1_RNA|AL359736.1_ENST00000422229.2_Missense_Mutation_p.V13M			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	209	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GTGGGGCTCACGGTGCTGAGC	0.458													ENSG00000240654	C|||	1	0.000199681	0.0	0.0	5008	,	,		17715	0.001		0.0	False		,,,				2504	0.0																0													67.0	48.0	54.0					13																	24895530		2203	4291	6494	SO:0001583	missense	0			-	BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.626C>T	13.37:g.24895530C>T	ENSP00000371503:p.Thr209Met		A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.T209M	ENST00000382071.2	37	c.626	CCDS9306.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	17.23|17.23	3.337860|3.337860	0.60963|0.60963	.|.	.|.	ENSG00000240654|ENSG00000205850	ENST00000382071;ENST00000332018|ENST00000422229	D;D|.	0.93488|.	-3.23;-3.23|.	3.96|3.96	3.96|3.96	0.45880|0.45880	Tumour necrosis factor-like (2);Complement C1q protein (3);|.	0.158069|.	0.56097|.	D|.	0.000033|.	T|T	0.73434|0.73434	0.3586|0.3586	M|M	0.82056|0.82056	2.57|2.57	0.80722|0.80722	D|D	1|1	D|.	0.65815|.	0.995|.	P|.	0.60345|.	0.873|.	T|T	0.76537|0.76537	-0.2923|-0.2923	10|6	0.66056|0.72032	D|D	0.02|0.01	.|.	9.372|9.372	0.38258|0.38258	0.0:0.8994:0.0:0.1006|0.0:0.8994:0.0:0.1006	.|.	209|.	P0C862|.	C1T9A_HUMAN|.	M|M	209|13	ENSP00000371503:T209M;ENSP00000333737:T209M|.	ENSP00000333737:T209M|ENSP00000396192:V13M	T|V	+|-	2|1	0|0	C1QTNF9|AL359736.1	23793530|23793530	1.000000|1.000000	0.71417|0.71417	0.896000|0.896000	0.35187|0.35187	0.947000|0.947000	0.59692|0.59692	5.215000|5.215000	0.65241|0.65241	2.180000|2.180000	0.69256|0.69256	0.430000|0.430000	0.28490|0.28490	ACG|GTG	-	C1QTNF9	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q		0.458	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF9	HGNC	protein_coding	OTTHUMT00000044177.1	0	0	0	23	23	53	0.00	0.00	C	NM_178540		24895530	+1	5	14	11	43	tier1	no_errors	ENST00000332018	ensembl	human	known	74_37	missense	31.25	24.56	SNP	0.876	T	5	11
URB2	9816	genome.wustl.edu	37	1	229779403	229779403	+	Missense_Mutation	SNP	G	G	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:229779403G>C	ENST00000258243.2	+	5	3894	c.3758G>C	c.(3757-3759)gGa>gCa	p.G1253A		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1253						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						ATTCTCCAGGGACTGGATGTC	0.517													ENSG00000135763																																					0													180.0	157.0	165.0					1																	229779403		2203	4300	6503	SO:0001583	missense	0			-	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3758G>C	1.37:g.229779403G>C	ENSP00000258243:p.Gly1253Ala		Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.G1253A	ENST00000258243.2	37	c.3758	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885946	0.51908	.	.	ENSG00000135763	ENST00000258243	T	0.31769	1.48	5.36	5.36	0.76844	.	0.110121	0.64402	D	0.000008	T	0.45175	0.1329	L	0.34521	1.04	0.50632	D	0.999889	D	0.89917	1.0	D	0.75020	0.985	T	0.15263	-1.0443	9	.	.	.	-23.848	18.0013	0.89198	0.0:0.0:1.0:0.0	.	1253	Q14146	URB2_HUMAN	A	1253	ENSP00000258243:G1253A	.	G	+	2	0	URB2	227846026	1.000000	0.71417	0.584000	0.28653	0.424000	0.31475	4.881000	0.63114	2.666000	0.90696	0.650000	0.86243	GGA	-	URB2	-	NULL		0.517	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	0	0	0	84	84	118	0.00	0.00	G	NM_014777		229779403	+1	15	15	88	98	tier1	no_errors	ENST00000258243	ensembl	human	known	74_37	missense	14.56	13.16	SNP	0.974	C	15	88
ADH7	131	genome.wustl.edu	37	4	100341929	100341929	+	Missense_Mutation	SNP	C	C	T	rs376821544		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr4:100341929C>T	ENST00000209665.4	-	6	862	c.622G>A	c.(622-624)Gtc>Atc	p.V208I	ADH7_ENST00000476959.1_Missense_Mutation_p.V216I|ADH7_ENST00000482593.1_Missense_Mutation_p.V139I|ADH7_ENST00000437033.2_Missense_Mutation_p.V196I	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	208					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		CCAAAGACGACGCAAGTGGAA	0.468													ENSG00000196344																																					0								C	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	77.0	67.0	70.0		646,622	0.1	0.0	4		70	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADH7	NM_001166504.1,NM_000673.4	29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign	216/395,208/387	100341929	2,13004	2203	4300	6503	SO:0001583	missense	0			-	X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.622G>A	4.37:g.100341929C>T	ENSP00000209665:p.Val208Ile		A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like	p.V208I	ENST00000209665.4	37	c.622	CCDS34034.1	4	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183377	0.38511	2.27E-4	1.16E-4	ENSG00000196344	ENST00000437033;ENST00000209665;ENST00000482593;ENST00000476959	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	3.8	0.117	0.14652	GroES-like (1);NAD(P)-binding domain (1);	0.328672	0.30969	N	0.008503	T	0.26011	0.0634	M	0.80332	2.49	0.23519	N	0.997506	B	0.30542	0.284	B	0.21917	0.037	T	0.18903	-1.0322	10	0.87932	D	0	-10.9301	8.2206	0.31539	0.0:0.6626:0.0:0.3374	.	208	P40394	ADH7_HUMAN	I	196;208;139;216	ENSP00000414254:V196I;ENSP00000209665:V208I;ENSP00000420613:V139I;ENSP00000420269:V216I	ENSP00000209665:V208I	V	-	1	0	ADH7	100560952	1.000000	0.71417	0.000000	0.03702	0.757000	0.42996	4.110000	0.57831	-0.248000	0.09583	-0.219000	0.12488	GTC	-	ADH7	-	superfamily_GroES-like		0.468	ADH7-201	KNOWN	basic|CCDS	protein_coding	ADH7	HGNC	protein_coding		0	0	0	25	25	114	0.00	0.00	C	NM_000673		100341929	-1	8	10	33	85	tier1	no_errors	ENST00000209665	ensembl	human	known	74_37	missense	19.51	10.53	SNP	0.920	T	8	33
OR13G1	441933	genome.wustl.edu	37	1	247835651	247835651	+	Silent	SNP	C	C	T	rs61995673	byFrequency	TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:247835651C>T	ENST00000359688.2	-	1	714	c.693G>A	c.(691-693)aaG>aaA	p.K231K	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGGCCTTCCTCTTGCCTTCTA	0.448													ENSG00000197437																																					0													147.0	125.0	132.0					1																	247835651		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.693G>A	1.37:g.247835651C>T			B2RN80|Q5T2T2|Q6IF86	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.K231	ENST00000359688.2	37	c.693	CCDS31094.1	1																																																																																			-	OR13G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.448	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	HGNC	protein_coding	OTTHUMT00000096869.1	0	0	0	54	54	65	0.00	0.00	C	NM_001005487		247835651	-1	11	18	47	69	tier1	no_errors	ENST00000359688	ensembl	human	known	74_37	silent	18.64	20.69	SNP	0.000	T	11	47
HELQ	113510	genome.wustl.edu	37	4	84350703	84350703	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr4:84350703G>A	ENST00000295488.3	-	12	2654	c.2492C>T	c.(2491-2493)aCa>aTa	p.T831I	HELQ_ENST00000510985.1_Missense_Mutation_p.T764I	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	831					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						TCCCAACTTTGTAATATGAAA	0.294								Other identified genes with known or suspected DNA repair function					ENSG00000163312																																					0													71.0	75.0	74.0					4																	84350703		2202	4297	6499	SO:0001583	missense	0			-	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.2492C>T	4.37:g.84350703G>A	ENSP00000295488:p.Thr831Ile		Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_D_repair_Rad51/TF_NusA_a-hlx,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T831I	ENST00000295488.3	37	c.2492	CCDS3603.1	4	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085163	0.76642	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.63744	-0.06;-0.06	5.51	5.51	0.81932	.	0.051832	0.85682	D	0.000000	T	0.82121	0.4968	M	0.86268	2.805	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.98	D	0.84702	0.0729	10	0.87932	D	0	-7.6323	19.4095	0.94665	0.0:0.0:1.0:0.0	.	764;831	E3W980;Q8TDG4	.;HELQ_HUMAN	I	831;764	ENSP00000295488:T831I;ENSP00000424539:T764I	ENSP00000295488:T831I	T	-	2	0	HELQ	84569727	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.052000	0.76634	2.600000	0.87896	0.467000	0.42956	ACA	-	HELQ	-	NULL		0.294	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELQ	HGNC	protein_coding	OTTHUMT00000252810.1	0	0	0	54	54	104	0.00	0.00	G	NM_133636		84350703	-1	24	78	36	82	tier1	no_errors	ENST00000295488	ensembl	human	known	74_37	missense	40.00	48.45	SNP	1.000	A	24	36
DNAH2	146754	genome.wustl.edu	37	17	7724577	7724577	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr17:7724577C>T	ENST00000572933.1	+	73	12492	c.11032C>T	c.(11032-11034)Ctt>Ttt	p.L3678F	DNAH2_ENST00000389173.2_Missense_Mutation_p.L3678F			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3678					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGCCGTACCCTTTTCGAACG	0.483													ENSG00000183914																																					0													164.0	145.0	151.0					17																	7724577		2203	4300	6503	SO:0001583	missense	0			-	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11032C>T	17.37:g.7724577C>T	ENSP00000458355:p.Leu3678Phe		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L3678F	ENST00000572933.1	37	c.11032	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236793	0.79800	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.79352	-1.26	4.83	4.83	0.62350	.	0.000000	0.64402	D	0.000002	D	0.92146	0.7510	H	0.96889	3.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94717	0.7897	10	0.72032	D	0.01	.	17.0513	0.86519	0.0:1.0:0.0:0.0	.	3639;3678	Q9P225-2;Q9P225	.;DYH2_HUMAN	F	3639;3678	ENSP00000373825:L3678F	ENSP00000353818:L3639F	L	+	1	0	DNAH2	7665302	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.278000	0.65592	2.393000	0.81446	0.655000	0.94253	CTT	-	DH2	-	NULL		0.483	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH2	HGNC	protein_coding	OTTHUMT00000440241.1	0	0	0	39	39	95	0.00	0.00	C	NM_020877		7724577	+1	17	29	50	120	tier1	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	25.37	19.46	SNP	1.000	T	17	50
FAR2P2	100216479	genome.wustl.edu	37	2	131175634	131175634	+	RNA	SNP	A	A	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr2:131175634A>T	ENST00000424873.1	-	0	763					NR_046260.1																						gagaaagaagatgtcctatgt	0.433													ENSG00000178162																																					0																																												0			-																													2.37:g.131175634A>T				R	SNP	-	NULL	ENST00000424873.1	37	NULL		2																																																																																			-	AC140481.1	-	-		0.433	AC140481.1-001	KNOWN	basic	processed_transcript	LOC100288897	Clone_based_vega_gene	pseudogene	OTTHUMT00000333044.1	0	0	0	26	26	17	0.00	0.00	A			131175634	-1	7	20	17	17	tier1	no_errors	ENST00000424873	ensembl	human	known	74_37	rna	29.17	54.05	SNP	0.030	T	7	17
TLN2	83660	genome.wustl.edu	37	15	62986578	62986578	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr15:62986578G>A	ENST00000561311.1	+	13	1509	c.1279G>A	c.(1279-1281)Gtt>Att	p.V427I	TLN2_ENST00000306829.6_Missense_Mutation_p.V427I			Q9Y4G6	TLN2_HUMAN	talin 2	427					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AGAAGAGTCCGTTTCCCCAAA	0.413													ENSG00000171914																																					0													117.0	110.0	112.0					15																	62986578		2203	4300	6503	SO:0001583	missense	0			-	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.1279G>A	15.37:g.62986578G>A	ENSP00000453508:p.Val427Ile		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.V427I	ENST00000561311.1	37	c.1279	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690799	0.88735	.	.	ENSG00000171914	ENST00000306829	T	0.73047	-0.71	5.74	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.85396	0.5687	M	0.84948	2.725	0.58432	D	0.999999	D	0.76494	0.999	D	0.79784	0.993	D	0.86638	0.1890	10	0.42905	T	0.14	-17.7157	17.1596	0.86800	0.0:0.1263:0.8737:0.0	.	427	Q9Y4G6	TLN2_HUMAN	I	427	ENSP00000303476:V427I	ENSP00000303476:V427I	V	+	1	0	TLN2	60773870	1.000000	0.71417	0.756000	0.31282	0.947000	0.59692	9.758000	0.98927	1.552000	0.49463	0.561000	0.74099	GTT	-	TLN2	-	NULL		0.413	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	0	0	1	45	45	142	0.00	0.70	G			62986578	+1	16	30	24	97	tier1	no_errors	ENST00000306829	ensembl	human	known	74_37	missense	40.00	23.62	SNP	0.999	A	16	24
UMPS	7372	genome.wustl.edu	37	3	124456888	124456888	+	Silent	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr3:124456888C>T	ENST00000232607.2	+	3	890	c.784C>T	c.(784-786)Ctg>Ttg	p.L262L	UMPS_ENST00000413078.2_Silent_p.L84L|UMPS_ENST00000498715.1_3'UTR|UMPS_ENST00000538242.1_Silent_p.L84L|UMPS_ENST00000536109.1_Silent_p.L170L	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	262	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	TGATGTTTCACTGGCCAGAGA	0.463													ENSG00000114491																																					0													140.0	126.0	131.0					3																	124456888		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.784C>T	3.37:g.124456888C>T			B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Silent	SNP	pfam_OMPdeCOase_dom,pfam_PRibTrfase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase,tigrfam_Or_phspho_trans_dom	p.L262	ENST00000232607.2	37	c.784	CCDS3029.1	3																																																																																			-	UMPS	-	pfam_OMPdeCOase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase		0.463	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UMPS	HGNC	protein_coding	OTTHUMT00000355271.1	0	0	0	32	32	70	0.00	0.00	C	NM_000373		124456888	+1	6	24	24	82	tier1	no_errors	ENST00000232607	ensembl	human	known	74_37	silent	20.00	22.64	SNP	0.051	T	6	24
LHX8	431707	genome.wustl.edu	37	1	75609535	75609535	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:75609535G>T	ENST00000294638.5	+	7	1280	c.616G>T	c.(616-618)Ggg>Tgg	p.G206W	LHX8_ENST00000356261.3_Missense_Mutation_p.G196W	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	206					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						TGCAGGGAATGGGATTAGTGT	0.408													ENSG00000162624																																					0													98.0	97.0	97.0					1																	75609535		2203	4300	6503	SO:0001583	missense	0			-	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.616G>T	1.37:g.75609535G>T	ENSP00000294638:p.Gly206Trp		E9PGE3	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.G206W	ENST00000294638.5	37	c.616	CCDS30756.1	1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954375	0.53293	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.87491	-2.26;-2.24	5.63	5.63	0.86233	.	0.203454	0.52532	D	0.000073	D	0.83087	0.5178	L	0.27053	0.805	0.58432	D	0.99999	P	0.52463	0.953	P	0.53006	0.715	D	0.85980	0.1482	10	0.87932	D	0	.	15.5162	0.75826	0.0:0.1377:0.8623:0.0	.	206	Q68G74	LHX8_HUMAN	W	206;196	ENSP00000294638:G206W;ENSP00000348597:G196W	ENSP00000294638:G206W	G	+	1	0	LHX8	75382123	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	3.985000	0.56930	2.805000	0.96524	0.655000	0.94253	GGG	-	LHX8	-	NULL		0.408	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LHX8	HGNC	protein_coding	OTTHUMT00000026700.1	0	0	0	47	47	127	0.00	0.00	G	NM_001001933		75609535	+1	13	42	66	158	tier1	no_errors	ENST00000294638	ensembl	human	known	74_37	missense	16.46	21.00	SNP	1.000	T	13	66
OR2AG2	338755	genome.wustl.edu	37	11	6789507	6789507	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr11:6789507T>C	ENST00000338569.2	-	1	779	c.682A>G	c.(682-684)Atg>Gtg	p.M228V		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTTGATGGCATACGAAGCACA	0.478													ENSG00000188124																																					0													101.0	87.0	92.0					11																	6789507		2201	4296	6497	SO:0001583	missense	0			-	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.682A>G	11.37:g.6789507T>C	ENSP00000342697:p.Met228Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M228V	ENST00000338569.2	37	c.682	CCDS31413.1	11	.	.	.	.	.	.	.	.	.	.	T	4.040	0.004954	0.07866	.	.	ENSG00000188124	ENST00000338569	T	0.00152	8.66	4.47	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.193258	0.36932	N	0.002331	T	0.00210	0.0006	L	0.46741	1.465	0.09310	N	1	B	0.25272	0.122	B	0.39152	0.292	T	0.15093	-1.0449	10	0.87932	D	0	.	9.1431	0.36917	0.1631:0.0:0.0:0.8369	.	228	A6NM03	O2AG2_HUMAN	V	228	ENSP00000342697:M228V	ENSP00000342697:M228V	M	-	1	0	OR2AG2	6746083	0.010000	0.17322	0.187000	0.23214	0.062000	0.15995	1.050000	0.30404	1.025000	0.39708	0.533000	0.62120	ATG	-	OR2AG2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.478	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AG2	HGNC	protein_coding	OTTHUMT00000386775.1	0	0	0	85	85	82	0.00	0.00	T	NM_001004490		6789507	-1	32	79	23	43	tier1	no_errors	ENST00000338569	ensembl	human	known	74_37	missense	58.18	64.75	SNP	0.008	C	32	23
OR8S1	341568	genome.wustl.edu	37	12	48919809	48919809	+	Missense_Mutation	SNP	A	A	G			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr12:48919809A>G	ENST00000310194.1	+	1	395	c.395A>G	c.(394-396)tAt>tGt	p.Y132C	OR8S1_ENST00000551654.1_Intron	NM_001005203.2	NP_001005203.2	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S, member 1	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|skin(4)	22						CCACTACTTTATGGACAGATC	0.532													ENSG00000197376																																					0													145.0	131.0	136.0					12																	48919809		2203	4300	6503	SO:0001583	missense	0			-		CCDS31789.1	12q13.2	2012-08-09				ENSG00000197376		"""GPCR / Class A : Olfactory receptors"""	19628	protein-coding gene	gene with protein product							Standard	NM_001005203		Approved		uc010slu.2	Q8NH09		ENST00000310194.1:c.395A>G	12.37:g.48919809A>G	ENSP00000310632:p.Tyr132Cys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y132C	ENST00000310194.1	37	c.395	CCDS31789.1	12	.	.	.	.	.	.	.	.	.	.	A	17.64	3.439418	0.63067	.	.	ENSG00000197376	ENST00000310194	T	0.02032	4.49	5.03	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37261	N	0.002178	T	0.17789	0.0427	H	0.96111	3.77	0.35938	D	0.833049	D	0.89917	1.0	D	0.91635	0.999	T	0.18840	-1.0324	10	0.87932	D	0	-61.4103	8.8967	0.35470	0.9115:0.0:0.0885:0.0	.	132	Q8NH09	OR8S1_HUMAN	C	132	ENSP00000310632:Y132C	ENSP00000310632:Y132C	Y	+	2	0	OR8S1	47206076	1.000000	0.71417	0.991000	0.47740	0.876000	0.50452	8.400000	0.90200	0.937000	0.37394	-0.256000	0.11100	TAT	-	OR8S1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.532	OR8S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8S1	HGNC	protein_coding	OTTHUMT00000406881.1	0	0	0	65	65	41	0.00	0.00	A			48919809	+1	29	22	30	13	tier1	no_errors	ENST00000310194	ensembl	human	known	74_37	missense	49.15	62.86	SNP	0.999	G	29	30
KIAA1217	56243	genome.wustl.edu	37	10	24762620	24762620	+	Missense_Mutation	SNP	A	A	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr10:24762620A>T	ENST00000376454.3	+	6	1340	c.1310A>T	c.(1309-1311)aAc>aTc	p.N437I	KIAA1217_ENST00000376452.3_Missense_Mutation_p.N437I|KIAA1217_ENST00000376451.2_Missense_Mutation_p.N155I|KIAA1217_ENST00000430453.2_Missense_Mutation_p.N358I|KIAA1217_ENST00000396445.1_Missense_Mutation_p.N155I|KIAA1217_ENST00000307544.6_Missense_Mutation_p.N155I|KIAA1217_ENST00000396446.1_Missense_Mutation_p.N155I|KIAA1217_ENST00000458595.1_Missense_Mutation_p.N437I|KIAA1217_ENST00000376462.1_Missense_Mutation_p.N357I	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	437					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GCTTATTGTAACCCCTCAATG	0.498													ENSG00000120549																																					0													80.0	68.0	72.0					10																	24762620		2203	4300	6503	SO:0001583	missense	0			-	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1310A>T	10.37:g.24762620A>T	ENSP00000365637:p.Asn437Ile		A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	pfam_AIP3_C	p.N437I	ENST00000376454.3	37	c.1310	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	A	14.92	2.677921	0.47886	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.55	2.02	0.26589	.	0.260189	0.46145	D	0.000317	T	0.57636	0.2067	L	0.56769	1.78	0.36917	D	0.891188	D;P;D;D;D;D;D;P	0.69078	0.976;0.734;0.987;0.959;0.997;0.987;0.987;0.874	P;B;P;P;D;P;P;P	0.64776	0.812;0.319;0.89;0.812;0.929;0.89;0.812;0.592	T	0.62393	-0.6864	10	0.62326	D	0.03	.	8.7369	0.34534	0.7838:0.0:0.2162:0.0	.	437;437;155;155;155;155;437;437	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	I	357;437;437;155;437;437;287;358;155;155;155;155;155	ENSP00000365645:N357I;ENSP00000365639:N437I;ENSP00000392625:N437I;ENSP00000365637:N437I;ENSP00000365635:N437I;ENSP00000404798:N287I;ENSP00000389680:N358I;ENSP00000302343:N155I;ENSP00000379722:N155I;ENSP00000365634:N155I;ENSP00000379723:N155I	ENSP00000302343:N155I	N	+	2	0	KIAA1217	24802626	0.372000	0.25064	0.998000	0.56505	0.341000	0.28922	-0.023000	0.12456	0.414000	0.25790	0.533000	0.62120	AAC	-	KIAA1217	-	NULL		0.498	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	0	0	0	37	37	84	0.00	0.00	A	NM_019590		24762620	+1	12	73	0	11	tier1	no_errors	ENST00000376454	ensembl	human	known	74_37	missense	100.00	86.90	SNP	1.000	T	12	0
WRAP53	55135	genome.wustl.edu	37	17	7592062	7592062	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr17:7592062G>A	ENST00000316024.5	+	1	2444	c.96G>A	c.(94-96)atG>atA	p.M32I	RP11-199F11.2_ENST00000571370.1_RNA|WRAP53_ENST00000457584.2_Missense_Mutation_p.M32I|WRAP53_ENST00000396463.2_Missense_Mutation_p.M32I|TP53_ENST00000455263.2_5'Flank|WRAP53_ENST00000534050.1_Missense_Mutation_p.M32I|TP53_ENST00000420246.2_5'Flank|TP53_ENST00000445888.2_5'Flank|WRAP53_ENST00000431639.2_Missense_Mutation_p.M32I|TP53_ENST00000269305.4_5'Flank			Q9BUR4	WAP53_HUMAN	WD repeat containing, antisense to TP53	32	Pro-rich.				positive regulation of telomerase activity (GO:0051973)|telomere formation via telomerase (GO:0032203)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(2)	18						CTTCCCCGATGAATAAAAATG	0.597													ENSG00000141499																																					0													63.0	72.0	69.0					17																	7592062		2203	4300	6503	SO:0001583	missense	0			-	AK001247, DQ431240	CCDS11119.1	17p13.1	2014-09-17	2009-02-16	2009-02-16	ENSG00000141499	ENSG00000141499		"""WD repeat domain containing"""	25522	protein-coding gene	gene with protein product	"""telomerase cajal body protein 1"", ""WD-encoding RNA antisense to p53"""	612661	"""WD repeat domain 79"""	WDR79		19179534, 19250907, 19571673, 19342896, 20494116, 21441950	Standard	NM_018081		Approved	FLJ10385, TCAB1	uc010vuh.2	Q9BUR4	OTTHUMG00000134323	ENST00000316024.5:c.96G>A	17.37:g.7592062G>A	ENSP00000324203:p.Met32Ile		B3KPR9|D3DTQ4|Q08ET9|Q9NW09	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M32I	ENST00000316024.5	37	c.96	CCDS11119.1	17	.	.	.	.	.	.	.	.	.	.	G	9.077	0.998267	0.19043	.	.	ENSG00000141499	ENST00000431639;ENST00000316024;ENST00000457584;ENST00000396463;ENST00000534050	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.69	5.41	2.27	0.28462	.	0.627975	0.15067	N	0.282449	T	0.27731	0.0682	N	0.24115	0.695	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.06405	0.002;0.002	T	0.08472	-1.0720	10	0.25751	T	0.34	0.2706	4.9498	0.14008	0.1838:0.1749:0.6413:0.0	.	32;32	E9PMG4;Q9BUR4	.;WAP53_HUMAN	I	32	ENSP00000397219:M32I;ENSP00000324203:M32I;ENSP00000411061:M32I;ENSP00000379727:M32I;ENSP00000434999:M32I	ENSP00000324203:M32I	M	+	3	0	WRAP53	7532787	0.250000	0.23951	0.004000	0.12327	0.035000	0.12851	1.916000	0.39986	1.524000	0.49035	0.563000	0.77884	ATG	-	WRAP53	-	NULL		0.597	WRAP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRAP53	HGNC	protein_coding	OTTHUMT00000259385.2	0	0	0	25	25	70	0.00	0.00	G	NM_018081		7592062	+1	33	73	11	23	tier1	no_errors	ENST00000316024	ensembl	human	known	74_37	missense	75.00	76.04	SNP	0.000	A	33	11
FCHSD1	89848	genome.wustl.edu	37	5	141025697	141025697	+	Missense_Mutation	SNP	T	T	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr5:141025697T>C	ENST00000435817.2	-	12	1156	c.1106A>G	c.(1105-1107)gAa>gGa	p.E369G	FCHSD1_ENST00000522783.1_Intron|FCHSD1_ENST00000523856.1_5'UTR|FCHSD1_ENST00000522126.1_Missense_Mutation_p.E293G	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	369									FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAACCTCTGTTCTATGCTTGG	0.602													ENSG00000197948																																					0													56.0	53.0	54.0					5																	141025697		2040	4180	6220	SO:0001583	missense	0			-	AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.1106A>G	5.37:g.141025697T>C	ENSP00000399259:p.Glu369Gly		Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_FCH_dom,superfamily_SH3_domain,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain	p.E369G	ENST00000435817.2	37	c.1106	CCDS47295.1	5	.	.	.	.	.	.	.	.	.	.	T	22.5	4.291709	0.80914	.	.	ENSG00000197948	ENST00000435817;ENST00000522126;ENST00000518499	T;T	0.58210	1.08;0.35	5.6	5.6	0.85130	.	0.056722	0.64402	D	0.000003	T	0.71375	0.3332	M	0.69823	2.125	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.72625	0.978;0.954	T	0.75079	-0.3444	10	0.87932	D	0	-19.3993	15.4331	0.75121	0.0:0.0:0.0:1.0	.	49;369	Q86WN1-2;Q86WN1	.;FCSD1_HUMAN	G	369;293;52	ENSP00000399259:E369G;ENSP00000427796:E293G	ENSP00000399259:E369G	E	-	2	0	FCHSD1	141005881	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	5.635000	0.67841	2.130000	0.65690	0.374000	0.22700	GAA	-	FCHSD1	-	NULL		0.602	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD1	HGNC	protein_coding	OTTHUMT00000375282.2	0	0	0	58	58	60	0.00	0.00	T	NM_033449		141025697	-1	5	6	17	51	tier1	no_errors	ENST00000435817	ensembl	human	known	74_37	missense	22.73	10.53	SNP	1.000	C	5	17
C14orf39	317761	genome.wustl.edu	37	14	60938375	60938375	+	Missense_Mutation	SNP	G	G	A	rs34082126		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr14:60938375G>A	ENST00000321731.3	-	6	565	c.406C>T	c.(406-408)Cgt>Tgt	p.R136C		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	136					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TAATATTCACGTGAAAAGGGT	0.274													ENSG00000179008																																					0													81.0	83.0	82.0					14																	60938375		2202	4288	6490	SO:0001583	missense	0			-	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.406C>T	14.37:g.60938375G>A	ENSP00000324920:p.Arg136Cys		Q08AQ4	Missense_Mutation	SNP	NULL	p.R136C	ENST00000321731.3	37	c.406	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	G	4.010	-0.000864	0.07819	.	.	ENSG00000179008	ENST00000321731;ENST00000555476	T;T	0.46451	1.89;0.87	5.61	2.58	0.30949	.	1.289070	0.04955	N	0.461072	T	0.28067	0.0692	N	0.16478	0.41	0.19945	N	0.999947	B	0.06786	0.001	B	0.06405	0.002	T	0.21143	-1.0254	10	0.32370	T	0.25	3.5506	6.0938	0.20008	0.1657:0.0:0.6088:0.2256	rs34082126	136	Q8N1H7	S6OS1_HUMAN	C	136;107	ENSP00000324920:R136C;ENSP00000451665:R107C	ENSP00000324920:R136C	R	-	1	0	C14orf39	60008128	0.880000	0.30214	0.355000	0.25773	0.154000	0.21943	1.124000	0.31320	0.312000	0.23038	-0.797000	0.03246	CGT	rs34082126	C14orf39	-	NULL		0.274	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	HGNC	protein_coding	OTTHUMT00000276948.1	0	0	0	33	33	78	0.00	0.00	G	NM_174978		60938375	-1	5	9	20	71	tier1	no_errors	ENST00000321731	ensembl	human	known	74_37	missense	20.00	11.11	SNP	0.351	A	5	20
KLK11	11012	genome.wustl.edu	37	19	51525868	51525868	+	Missense_Mutation	SNP	T	T	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr19:51525868T>A	ENST00000594768.1	-	6	967	c.782A>T	c.(781-783)aAg>aTg	p.K261M	KLK11_ENST00000600362.1_Missense_Mutation_p.K88M|KLK10_ENST00000391805.1_5'Flank|KLK10_ENST00000309958.3_5'Flank|KLK11_ENST00000391804.3_Missense_Mutation_p.K254M|KLK10_ENST00000358789.3_5'Flank|KLK11_ENST00000453757.3_Missense_Mutation_p.K229M|KLK11_ENST00000319720.7_Missense_Mutation_p.K229M|KLK11_ENST00000594458.1_5'Flank	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	261	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		GACACCAGGCTTTCGGGTGAT	0.572													ENSG00000167757																																					0													166.0	154.0	158.0					19																	51525868		2203	4300	6503	SO:0001583	missense	0			-	AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.782A>T	19.37:g.51525868T>A	ENSP00000473047:p.Lys261Met		O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.K261M	ENST00000594768.1	37	c.782	CCDS12818.1	19	.	.	.	.	.	.	.	.	.	.	t	18.51	3.638683	0.67130	.	.	ENSG00000167757	ENST00000391804;ENST00000319720;ENST00000453757;ENST00000319756	D;D;D	0.89617	-2.54;-2.54;-2.54	4.42	4.42	0.53409	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.38436	U	0.001694	D	0.91885	0.7431	L	0.55481	1.735	0.39610	D	0.969865	D;D	0.89917	1.0;1.0	D;D	0.80764	0.993;0.994	D	0.92019	0.5624	10	0.48119	T	0.1	.	11.6586	0.51332	0.0:0.0:0.0:1.0	.	261;254	Q9UBX7;Q8IXD7	KLK11_HUMAN;.	M	254;229;229;261	ENSP00000375680:K254M;ENSP00000324269:K229M;ENSP00000413958:K229M	ENSP00000324269:K229M	K	-	2	0	KLK11	56217680	1.000000	0.71417	0.969000	0.41365	0.605000	0.37080	3.805000	0.55575	1.869000	0.54173	0.254000	0.18369	AAG	-	KLK11	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.572	KLK11-002	KNOWN	basic|CCDS	protein_coding	KLK11	HGNC	protein_coding	OTTHUMT00000464314.2	0	0	0	26	26	65	0.00	0.00	T	NM_006853		51525868	-1	5	11	14	54	tier1	no_errors	ENST00000594768	ensembl	human	known	74_37	missense	26.32	16.92	SNP	0.998	A	5	14
DOCK8	81704	genome.wustl.edu	37	9	432324	432324	+	Splice_Site	SNP	G	G	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr9:432324G>T	ENST00000453981.1	+	37	4897	c.4785G>T	c.(4783-4785)caG>caT	p.Q1595H	DOCK8_ENST00000469391.1_Splice_Site_p.Q1495H|DOCK8_ENST00000432829.2_Splice_Site_p.Q1527H|DOCK8_ENST00000382329.1_Splice_Site_p.Q1062H			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1595					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TTCCCACCCAGGTACACCGAA	0.403													ENSG00000107099																																					0													125.0	112.0	117.0					9																	432324		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.4785+1G>T	9.37:g.432324G>T			A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.Q1595H	ENST00000453981.1	37	c.4785	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855432	0.71719	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.68181	4.52;-0.31;-0.31;-0.31	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.84092	0.5396	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	D	0.86544	0.1830	10	0.72032	D	0.01	.	13.4281	0.61037	0.0746:0.0:0.9254:0.0	.	1495;1062;1595	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	H	1595;1563;1527;1495;1062	ENSP00000408464:Q1595H;ENSP00000394888:Q1527H;ENSP00000419438:Q1495H;ENSP00000371766:Q1062H	ENSP00000287364:Q1563H	Q	+	3	2	DOCK8	422324	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	6.309000	0.72825	2.756000	0.94617	0.655000	0.94253	CAG	-	DOCK8	-	NULL		0.403	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	0	0	0	19	19	101	0.00	0.00	G	XM_036307	Missense_Mutation	432324	+1	5	11	15	90	tier1	no_errors	ENST00000453981	ensembl	human	known	74_37	missense	25.00	10.89	SNP	1.000	T	5	15
KLF4	9314	genome.wustl.edu	37	9	110249601	110249601	+	Silent	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr9:110249601C>T	ENST00000374672.4	-	3	1547	c.1074G>A	c.(1072-1074)ccG>ccA	p.P358P		NM_004235.4	NP_004226.3	O43474	KLF4_HUMAN	Kruppel-like factor 4 (gut)	358	Pro-rich.				cellular response to cycloheximide (GO:0071409)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|epidermal cell differentiation (GO:0009913)|epidermis morphogenesis (GO:0048730)|fat cell differentiation (GO:0045444)|mesodermal cell fate determination (GO:0007500)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of muscle hyperplasia (GO:0014740)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic camera-type eye development (GO:0031077)|post-embryonic hemopoiesis (GO:0035166)|regulation of cell differentiation (GO:0045595)|response to retinoic acid (GO:0032526)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001010)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(5)|large_intestine(1)|lung(3)|pancreas(1)|prostate(2)	16						GCGGGACTTGCGGCTGCATCT	0.652													ENSG00000136826																																					0													25.0	23.0	24.0					9																	110249601		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF022184	CCDS6770.2	9q31	2013-01-08			ENSG00000136826	ENSG00000136826		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6348	protein-coding gene	gene with protein product		602253				9422764, 16372018	Standard	NM_004235		Approved	EZF, GKLF	uc004bdg.3	O43474	OTTHUMG00000020449	ENST00000374672.4:c.1074G>A	9.37:g.110249601C>T			B2R8S4|B3KT79|L0R3I6|L0R4N5|P78338|Q5T3J8|Q5T3J9|Q8N717|Q9UNP3	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P358	ENST00000374672.4	37	c.1074	CCDS6770.2	9																																																																																			-	KLF4	-	NULL		0.652	KLF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF4	HGNC	protein_coding	OTTHUMT00000053556.2	0	0	0	23	23	60	0.00	0.00	C	NM_004235		110249601	-1	7	12	11	44	tier1	no_errors	ENST00000374672	ensembl	human	known	74_37	silent	38.89	21.43	SNP	0.065	T	7	11
SETX	23064	genome.wustl.edu	37	9	135140048	135140048	+	Missense_Mutation	SNP	C	C	G			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr9:135140048C>G	ENST00000224140.5	-	26	7794	c.7612G>C	c.(7612-7614)Gac>Cac	p.D2538H	SETX_ENST00000393220.1_Missense_Mutation_p.D2505H|SETX_ENST00000372169.2_Missense_Mutation_p.D2567H|SETX_ENST00000477049.1_5'UTR	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2538					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AGTCGTGGGTCCTGAAGTTGG	0.507													ENSG00000107290																																					0													106.0	106.0	106.0					9																	135140048		2203	4300	6503	SO:0001583	missense	0			-	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.7612G>C	9.37:g.135140048C>G	ENSP00000224140:p.Asp2538His		A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.D2567H	ENST00000224140.5	37	c.7699	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785735	0.49997	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.96830	-2.52;-4.14;-3.54;-2.22	4.94	4.94	0.65067	.	0.162186	0.37577	N	0.002031	D	0.97782	0.9272	M	0.72118	2.19	0.49213	D	0.999765	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.98483	1.0606	10	0.66056	D	0.02	.	17.1177	0.86694	0.0:1.0:0.0:0.0	.	2505;2538;2567	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	H	2538;809;2567;2505	ENSP00000224140:D2538H;ENSP00000409143:D809H;ENSP00000361242:D2567H;ENSP00000376913:D2505H	ENSP00000224140:D2538H	D	-	1	0	SETX	134129869	1.000000	0.71417	0.995000	0.50966	0.104000	0.19210	4.743000	0.62110	2.445000	0.82738	0.561000	0.74099	GAC	-	SETX	-	NULL		0.507	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	0	0	0	102	102	150	0.00	0.00	C	NM_015046		135140048	-1	11	30	72	96	tier1	no_errors	ENST00000372169	ensembl	human	known	74_37	missense	13.25	23.62	SNP	1.000	G	11	72
TOPBP1	11073	genome.wustl.edu	37	3	133342943	133342943	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr3:133342943C>T	ENST00000260810.5	-	17	3012	c.2881G>A	c.(2881-2883)Gta>Ata	p.V961I		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	961	BRCT 6. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						CTTTCTTTTACAGATTTATAC	0.378								Other conserved DNA damage response genes					ENSG00000163781																									Ovarian(21;193 658 4424 15423 17362)												0													124.0	119.0	121.0					3																	133342943		1849	4079	5928	SO:0001583	missense	0			-	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.2881G>A	3.37:g.133342943C>T	ENSP00000260810:p.Val961Ile		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.V961I	ENST00000260810.5	37	c.2881	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	C	15.41	2.825388	0.50739	.	.	ENSG00000163781	ENST00000260810	T	0.43688	0.94	5.61	1.81	0.25067	BRCT (4);	0.284322	0.38605	N	0.001625	T	0.35248	0.0925	L	0.49455	1.56	0.37608	D	0.92084	B	0.17667	0.023	B	0.23574	0.047	T	0.22277	-1.0221	10	0.30854	T	0.27	.	10.6176	0.45460	0.0:0.742:0.0:0.258	.	961	Q92547	TOPB1_HUMAN	I	961	ENSP00000260810:V961I	ENSP00000260810:V961I	V	-	1	0	TOPBP1	134825633	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	3.632000	0.54287	0.323000	0.23307	0.585000	0.79938	GTA	-	TOPBP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom		0.378	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	0	0	0	11	11	94	0.00	0.00	C	NM_007027		133342943	-1	13	71	21	96	tier1	no_errors	ENST00000260810	ensembl	human	known	74_37	missense	37.14	42.51	SNP	1.000	T	13	21
COL19A1	1310	genome.wustl.edu	37	6	70916680	70916680	+	Missense_Mutation	SNP	C	C	T	rs148400214		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr6:70916680C>T	ENST00000322773.4	+	50	3401	c.3299C>T	c.(3298-3300)tCa>tTa	p.S1100L	COL19A1_ENST00000393344.1_Missense_Mutation_p.S722L	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	1100	Triple-helical region 6 (COL6).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CCTGGGACTTCAGGTAAGTGG	0.453													ENSG00000082293																																					0								C	LEU/SER	0,4406		0,0,2203	76.0	72.0	73.0		3299	5.8	1.0	6	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL19A1	NM_001858.4	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	1100/1143	70916680	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.3299C>T	6.37:g.70916680C>T	ENSP00000316030:p.Ser1100Leu		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.S1100L	ENST00000322773.4	37	c.3299	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610433	0.46527	0.0	1.16E-4	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.94046	-3.34;-3.34	5.77	5.77	0.91146	.	0.284212	0.28889	N	0.013816	D	0.88588	0.6477	L	0.52905	1.665	0.40064	D	0.975932	P	0.35745	0.518	B	0.33890	0.172	D	0.87684	0.2549	10	0.32370	T	0.25	.	18.1731	0.89753	0.0:1.0:0.0:0.0	.	1100	Q14993	COJA1_HUMAN	L	1100;722	ENSP00000316030:S1100L;ENSP00000377013:S722L	ENSP00000316030:S1100L	S	+	2	0	COL19A1	70973401	1.000000	0.71417	0.995000	0.50966	0.444000	0.32077	5.028000	0.64115	2.729000	0.93468	0.467000	0.42956	TCA	rs148400214	COL19A1	-	NULL		0.453	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	0	0	0	56	56	133	0.00	0.00	C			70916680	+1	43	79	46	89	tier1	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	48.31	47.02	SNP	1.000	T	43	46
SLC44A3	126969	genome.wustl.edu	37	1	95290119	95290119	+	Missense_Mutation	SNP	G	G	A	rs148935541		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:95290119G>A	ENST00000271227.6	+	3	308	c.206G>A	c.(205-207)gGc>gAc	p.G69D	SLC44A3_ENST00000467909.1_Missense_Mutation_p.G21D|SLC44A3_ENST00000527077.1_Missense_Mutation_p.G33D|SLC44A3_ENST00000446120.2_Missense_Mutation_p.G33D|SLC44A3_ENST00000529450.1_Missense_Mutation_p.G69D|SLC44A3_ENST00000532427.1_Missense_Mutation_p.G21D	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	69					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	GACAGCTTTGGCAACATGTGT	0.532													ENSG00000143036	G|||	1	0.000199681	0.0	0.0	5008	,	,		17106	0.0		0.001	False		,,,				2504	0.0																0								G	ASP/GLY,ASP/GLY	2,4404	4.2+/-10.8	0,2,2201	90.0	97.0	95.0		206,62	5.7	1.0	1	dbSNP_134	95	9,8591	7.1+/-27.0	0,9,4291	yes	missense,missense	SLC44A3	NM_001114106.1,NM_152369.3	94,94	0,11,6492	AA,AG,GG		0.1047,0.0454,0.0846	probably-damaging,probably-damaging	69/654,21/606	95290119	11,12995	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.206G>A	1.37:g.95290119G>A	ENSP00000271227:p.Gly69Asp		B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.G69D	ENST00000271227.6	37	c.206	CCDS44176.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	27.5	4.834858	0.91036	4.54E-4	0.001047	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000422520;ENST00000532427	D;D;T;D;T;D;T	0.81499	-1.5;-1.5;1.01;-1.5;0.61;-1.5;1.17	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000004	D	0.90734	0.7092	M	0.88842	2.985	0.58432	D	0.999996	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	D	0.91802	0.5452	10	0.87932	D	0	-16.6834	18.624	0.91331	0.0:0.0:1.0:0.0	.	21;33;33;69;69	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	D	33;69;33;69;21;21;21	ENSP00000389143:G33D;ENSP00000271227:G69D;ENSP00000433641:G33D;ENSP00000431836:G69D;ENSP00000432789:G21D;ENSP00000410832:G21D;ENSP00000436661:G21D	ENSP00000271227:G69D	G	+	2	0	SLC44A3	95062707	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	7.755000	0.85180	2.681000	0.91329	0.655000	0.94253	GGC	rs148935541	SLC44A3	-	NULL		0.532	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A3	HGNC	protein_coding	OTTHUMT00000029544.3	0	0	0	49	49	102	0.00	0.00	G	NM_152369		95290119	+1	12	33	39	132	tier1	no_errors	ENST00000271227	ensembl	human	known	74_37	missense	23.53	20.00	SNP	1.000	A	12	39
FAM178A	55719	genome.wustl.edu	37	10	102684152	102684152	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr10:102684152C>T	ENST00000238961.4	+	5	1936	c.1394C>T	c.(1393-1395)aCg>aTg	p.T465M	FAM178A_ENST00000370271.3_Missense_Mutation_p.T465M|FAM178A_ENST00000370269.3_Missense_Mutation_p.T465M	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	465						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											GCTAGCTCCACGACAAAGGAG	0.403													ENSG00000119906																																					0													80.0	91.0	87.0					10																	102684152		2203	4300	6503	SO:0001583	missense	0			-	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.1394C>T	10.37:g.102684152C>T	ENSP00000238961:p.Thr465Met		A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.T465M	ENST00000238961.4	37	c.1394	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	T	0.031	-1.331184	0.01298	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.45668	0.89;1.5;1.5	5.95	2.08	0.27032	.	0.972670	0.08421	N	0.948265	T	0.21267	0.0512	N	0.08118	0	0.09310	N	1	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.22800	-1.0206	10	0.51188	T	0.08	0.302	2.8993	0.05700	0.1338:0.0751:0.2783:0.5128	.	114;465;465;465	Q96LW0;Q8IX21;B1AL17;B1AL16	.;F178A_HUMAN;.;.	M	465	ENSP00000359294:T465M;ENSP00000238961:T465M;ENSP00000359292:T465M	ENSP00000238961:T465M	T	+	2	0	FAM178A	102674142	0.005000	0.15991	0.983000	0.44433	0.005000	0.04900	-0.008000	0.12788	0.125000	0.18397	-0.269000	0.10298	ACG	-	FAM178A	-	NULL		0.403	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3	0	0	0	20	20	115	0.00	0.00	C			102684152	+1	4	40	6	61	tier1	no_errors	ENST00000370269	ensembl	human	known	74_37	missense	40.00	39.60	SNP	0.249	T	4	6
IFI44L	10964	genome.wustl.edu	37	1	79102851	79102851	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:79102851delA	ENST00000370751.5	+	6	1190	c.1011delA	c.(1009-1011)gcafs	p.A337fs	IFI44L_ENST00000476521.1_3'UTR|IFI44L_ENST00000342282.3_Frame_Shift_Del_p.A79fs	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	337					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						AAATGTTGGCAAAAGTGAAGC	0.338													ENSG00000137959																																					0													116.0	117.0	116.0					1																	79102851		2203	4300	6503	SO:0001589	frameshift_variant	0				AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.1011delA	1.37:g.79102851delA	ENSP00000359787:p.Ala337fs		Q86TE1|Q96B64|Q99984	Frame_Shift_Del	DEL	superfamily_P-loop_NTPase	p.V339fs	ENST00000370751.5	37	c.1011	CCDS687.2	1																																																																																				IFI44L	-	superfamily_P-loop_NTPase		0.338	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI44L	HGNC	protein_coding	OTTHUMT00000026834.3	0	0	0	51	51	81	0.00	0.00	A	NM_006820		79102851	+1	31	64	42	93	tier1	no_errors	ENST00000370751	ensembl	human	known	74_37	frame_shift_del	42.47	40.76	DEL	0.003	-	31	42
IFI44L	10964	genome.wustl.edu	37	1	79102855	79102855	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:79102855G>T	ENST00000370751.5	+	6	1194	c.1015G>T	c.(1015-1017)Gtg>Ttg	p.V339L	IFI44L_ENST00000476521.1_3'UTR|IFI44L_ENST00000342282.3_Missense_Mutation_p.V81L	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	339					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						GTTGGCAAAAGTGAAGCAAGT	0.333													ENSG00000137959																																					0													118.0	118.0	118.0					1																	79102855		2203	4300	6503	SO:0001583	missense	0			-	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.1015G>T	1.37:g.79102855G>T	ENSP00000359787:p.Val339Leu		Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.V339L	ENST00000370751.5	37	c.1015	CCDS687.2	1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.323031	0.01320	.	.	ENSG00000137959	ENST00000370751;ENST00000342282	T;T	0.25085	3.11;1.82	4.08	-8.16	0.01061	.	0.931070	0.08952	N	0.869922	T	0.00580	0.0019	N	0.00075	-2.25	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29027	-1.0025	10	0.02654	T	1	1.8436	2.5485	0.04742	0.1029:0.2318:0.2043:0.461	.	339	Q53G44	IF44L_HUMAN	L	339;81	ENSP00000359787:V339L;ENSP00000342833:V81L	ENSP00000342833:V81L	V	+	1	0	IFI44L	78875443	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.983000	0.01488	-2.911000	0.00308	-0.560000	0.04181	GTG	-	IFI44L	-	superfamily_P-loop_NTPase		0.333	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI44L	HGNC	protein_coding	OTTHUMT00000026834.3	0	0	1	50	50	79	0.00	1.25	G	NM_006820		79102855	+1	36	68	36	87	tier1	no_errors	ENST00000370751	ensembl	human	known	74_37	missense	49.32	43.87	SNP	0.000	T	36	36
PPAP2A	8611	genome.wustl.edu	37	5	54721120	54721125	+	In_Frame_Del	DEL	TAAAAG	TAAAAG	-	rs370639768		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	TAAAAG	TAAAAG	TAAAAG	-	TAAAAG	TAAAAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr5:54721120_54721125delTAAAAG	ENST00000307259.8	-	6	1184_1189	c.764_769delCTTTTA	c.(763-771)tcttttaaa>taa	p.255_257SFK>*	PPAP2A_ENST00000264775.5_In_Frame_Del_p.256_258SFK>*|SKIV2L2_ENST00000230640.5_3'UTR	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A	255					androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				TTTCTTTCTTTAAAAGAAGTTCTTTC	0.369													ENSG00000067113																																					0																																										SO:0001651	inframe_deletion	0				AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.764_769delCTTTTA	5.37:g.54721120_54721125delTAAAAG	ENSP00000302229:p.Ser255_Lys257delins*		B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	In_Frame_Del	DEL	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.SFKERK256in_frame_del*	ENST00000307259.8	37	c.772_767	CCDS34159.1	5																																																																																				PPAP2A	-	superfamily_P_Acid_Pase_2/haloperoxidase		0.369	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2A	HGNC	protein_coding	OTTHUMT00000368073.1	0	0	0	91	91	91	0.00	0.00	TAAAAG			54721125	-1	21	21	53	53	tier1	no_errors	ENST00000264775	ensembl	human	known	74_37	in_frame_del	28.38	28.38	DEL	1.000:0.996:0.992:0.978:0.060:0.072	-	21	53
LPAR5	57121	genome.wustl.edu	37	12	6729465	6729465	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr12:6729465G>T	ENST00000329858.4	-	2	1706	c.950C>A	c.(949-951)gCc>gAc	p.A317D	LPAR5_ENST00000431922.1_Missense_Mutation_p.A317D|LPAR5_ENST00000540335.1_5'Flank	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						CGAGGTCCTGGCCCGGTGCGG	0.726													ENSG00000184574																									NSCLC(74;891 2312 37538)												0													13.0	16.0	15.0					12																	6729465		2195	4282	6477	SO:0001583	missense	0			-	AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0		ENST00000329858.4:c.950C>A	12.37:g.6729465G>T	ENSP00000327875:p.Ala317Asp			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A317D	ENST00000329858.4	37	c.950	CCDS8553.1	12	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705597	0.30232	.	.	ENSG00000184574	ENST00000329858;ENST00000431922;ENST00000435659	T;T	0.37584	1.19;1.19	4.84	1.7	0.24286	.	0.919029	0.08951	N	0.870093	T	0.15132	0.0365	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32428	-0.9907	10	0.15952	T	0.53	.	6.7507	0.23485	0.1654:0.0:0.5843:0.2503	.	317	Q9H1C0	LPAR5_HUMAN	D	317	ENSP00000327875:A317D;ENSP00000393098:A317D	ENSP00000327875:A317D	A	-	2	0	LPAR5	6599726	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.268000	0.08607	0.238000	0.21222	-1.579000	0.00862	GCC	-	LPAR5	-	NULL		0.726	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR5	HGNC	protein_coding	OTTHUMT00000400699.1	0	0	0	28	28	6	0.00	0.00	G	NM_020400		6729465	-1	6	2	9	3	tier1	no_errors	ENST00000329858	ensembl	human	known	74_37	missense	40.00	40.00	SNP	0.000	T	6	9
MYRF	745	genome.wustl.edu	37	11	61547653	61547653	+	Intron	SNP	G	G	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr11:61547653G>T	ENST00000278836.5	+	18	2432				MYRF_ENST00000389602.4_Intron|TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000327797.1_Missense_Mutation_p.G448V|MYRF_ENST00000265460.5_Intron	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor						central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCACTGGATGGTGGCTCCAGC	0.597													ENSG00000124920																																					0													48.0	46.0	47.0					11																	61547653		2202	4299	6501	SO:0001627	intron_variant	0			-		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.2337-41G>T	11.37:g.61547653G>T			O43582|Q9P1Q6	Missense_Mutation	SNP	pfam_NDT80_D-bd_dom,superfamily_p53-like_TF_D-bd	p.G448V	ENST00000278836.5	37	c.1343	CCDS44622.1	11	.	.	.	.	.	.	.	.	.	.	G	6.554	0.470452	0.12461	.	.	ENSG00000124920	ENST00000327797	T	0.43688	0.94	4.67	2.76	0.32466	.	.	.	.	.	T	0.39226	0.1070	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.36407	-0.9749	6	0.87932	D	0	.	4.6891	0.12772	0.0844:0.1491:0.6124:0.154	.	.	.	.	V	448	ENSP00000333261:G448V	ENSP00000333261:G448V	G	+	2	0	C11orf9	61304229	0.000000	0.05858	0.004000	0.12327	0.057000	0.15508	0.100000	0.15231	0.497000	0.27926	-0.314000	0.08810	GGT	-	MYRF	-	NULL		0.597	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYRF	HGNC	protein_coding	OTTHUMT00000398519.2	0	0	0	51	51	78	0.00	0.00	G	NM_013279		61547653	+1	31	37	3	5	tier1	no_errors	ENST00000327797	ensembl	human	known	74_37	missense	91.18	88.10	SNP	0.009	T	31	3
N4BP2L1	90634	genome.wustl.edu	37	13	32976895	32976895	+	3'UTR	SNP	C	C	G			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr13:32976895C>G	ENST00000380130.2	-	0	1011				N4BP2L1_ENST00000380139.4_3'UTR|N4BP2L1_ENST00000380133.2_Intron|N4BP2L1_ENST00000459716.1_5'UTR|N4BP2L1_ENST00000530622.2_3'UTR	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1											large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		agcatcagaccatgcatatag	0.353													ENSG00000139597																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697	ENST00000380130.2:c.*184G>C	13.37:g.32976895C>G			A4QN21|Q5TBK0	R	SNP	-	NULL	ENST00000380130.2	37	NULL	CCDS9345.2	13																																																																																			-	N4BP2L1	-	-		0.353	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2L1	HGNC	protein_coding		0	0	0	32	32	149	0.00	0.00	C	NM_052818		32976895	-1	36	49	3	9	tier1	no_errors	ENST00000459716	ensembl	human	known	74_37	rna	92.31	84.48	SNP	0.662	G	36	3
NUFIP1	26747	genome.wustl.edu	37	13	45517719	45517719	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr13:45517719G>A	ENST00000379161.4	-	9	1275	c.1229C>T	c.(1228-1230)gCa>gTa	p.A410V		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	410					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TCTAACAGTTGCTTTAACATC	0.383													ENSG00000083635																																					0													94.0	95.0	95.0					13																	45517719		2203	4300	6503	SO:0001583	missense	0			-	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.1229C>T	13.37:g.45517719G>A	ENSP00000368459:p.Ala410Val		Q8WVM5|Q96SG1	Missense_Mutation	SNP	pfam_NUFIP1_cons_dom,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A410V	ENST00000379161.4	37	c.1229	CCDS9393.1	13	.	.	.	.	.	.	.	.	.	.	G	11.77	1.736507	0.30774	.	.	ENSG00000083635	ENST00000379161	T	0.45276	0.9	5.97	-1.0	0.10196	.	0.863990	0.10516	N	0.665587	T	0.20047	0.0482	N	0.17674	0.51	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.19192	-1.0313	10	0.25751	T	0.34	.	0.6442	0.00815	0.2438:0.1201:0.3148:0.3213	.	410	Q9UHK0	NUFP1_HUMAN	V	410	ENSP00000368459:A410V	ENSP00000368459:A410V	A	-	2	0	NUFIP1	44415719	0.000000	0.05858	0.472000	0.27241	0.989000	0.77384	-0.828000	0.04419	-0.103000	0.12175	0.537000	0.68136	GCA	-	NUFIP1	-	NULL		0.383	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	HGNC	protein_coding	OTTHUMT00000044755.2	0	0	0	81	81	19	0.00	0.00	G	NM_012345		45517719	-1	56	15	12	0	tier1	no_errors	ENST00000379161	ensembl	human	known	74_37	missense	82.35	100.00	SNP	0.002	A	56	12
NUTM2F	54754	genome.wustl.edu	37	9	97088084	97088084	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr9:97088084G>A	ENST00000253262.4	-	2	169	c.149C>T	c.(148-150)cCa>cTa	p.P50L	NUTM2F_ENST00000335456.7_Missense_Mutation_p.P50L|NUTM2F_ENST00000341207.4_Missense_Mutation_p.P50L	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	50																	AGGGCCGGCTGGAGGAACCAC	0.682													ENSG00000130950																																					0													18.0	22.0	21.0					9																	97088084		1931	4112	6043	SO:0001583	missense	0			-		CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.149C>T	9.37:g.97088084G>A	ENSP00000253262:p.Pro50Leu		B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	NULL	p.P50L	ENST00000253262.4	37	c.149	CCDS47994.1	9	.	.	.	.	.	.	.	.	.	.	.	13.55	2.269669	0.40095	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207;ENST00000375347	T;T;T	0.45668	0.89;0.89;0.89	1.2	1.2	0.21068	Nuclear Testis  protein, N-terminal (1);	.	.	.	.	T	0.49795	0.1578	L	0.49640	1.575	0.09310	N	1	D	0.76494	0.999	D	0.73708	0.981	T	0.33828	-0.9853	9	0.24483	T	0.36	.	5.8356	0.18605	0.0:0.0:1.0:0.0	.	50	A1L443	FA22F_HUMAN	L	50	ENSP00000335067:P50L;ENSP00000253262:P50L;ENSP00000343865:P50L	ENSP00000253262:P50L	P	-	2	0	FAM22F	96127905	0.054000	0.20591	0.007000	0.13788	0.020000	0.10135	1.761000	0.38440	0.992000	0.38840	0.456000	0.33151	CCA	-	NUTM2F	-	NULL		0.682	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUTM2F	HGNC	protein_coding	OTTHUMT00000053173.2	0	0	0	113	113	11	0.00	0.00	G	NM_017561		97088084	-1	29	2	52	6	tier1	no_errors	ENST00000253262	ensembl	human	known	74_37	missense	35.80	25.00	SNP	0.008	A	29	52
PSG1	5669	genome.wustl.edu	37	19	43375964	43375964	+	Missense_Mutation	SNP	G	G	T	rs374973420		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr19:43375964G>T	ENST00000436291.2	-	3	780	c.664C>A	c.(664-666)Cca>Aca	p.P222T	PSG1_ENST00000244296.2_Missense_Mutation_p.P222T|PSG1_ENST00000595356.1_Missense_Mutation_p.P222T|PSG1_ENST00000312439.6_Missense_Mutation_p.P222T|PSG1_ENST00000403380.3_Intron|PSG1_ENST00000595124.1_Intron	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	222	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				GCACTCACTGGGTTCCGTATT	0.517													ENSG00000231924																																					0								G	THR/PRO,THR/PRO,THR/PRO	1,4401		0,1,2200	198.0	207.0	204.0		664,664,664	1.6	0.0	19		204	0,8592		0,0,4296	no	missense,missense,missense	PSG1	NM_001184825.1,NM_001184826.1,NM_006905.2	38,38,38	0,1,6496	TT,TG,GG		0.0,0.0227,0.0077	,,	222/420,222/418,222/427	43375964	1,12993	2201	4296	6497	SO:0001583	missense	0			-		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.664C>A	19.37:g.43375964G>T	ENSP00000413041:p.Pro222Thr		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P222T	ENST00000436291.2	37	c.664	CCDS54275.1	19	.	.	.	.	.	.	.	.	.	.	N	8.095	0.775354	0.16051	2.27E-4	0.0	ENSG00000231924	ENST00000436291;ENST00000312439;ENST00000244296	T;T;T	0.11169	2.8;2.8;2.8	1.64	1.64	0.23874	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.19805	0.0476	L	0.58428	1.81	0.09310	N	1	B;B;B;P;P;B;B;P	0.39424	0.12;0.052;0.45;0.661;0.673;0.045;0.012;0.55	B;B;P;P;B;B;B;B	0.52159	0.362;0.062;0.472;0.691;0.36;0.1;0.054;0.273	T	0.10800	-1.0614	9	0.72032	D	0.01	.	6.6584	0.23000	0.0:0.0:1.0:0.0	.	222;222;222;222;222;94;222;222	O75238;P11464-4;P11464;P11464-3;Q9UPK8;B4DTG5;O75237;P11464-2	.;.;PSG1_HUMAN;.;.;.;.;.	T	222	ENSP00000413041:P222T;ENSP00000308970:P222T;ENSP00000244296:P222T	ENSP00000244296:P222T	P	-	1	0	PSG1	48067804	0.108000	0.22018	0.007000	0.13788	0.020000	0.10135	0.992000	0.29667	0.911000	0.36747	0.184000	0.17185	CCA	-	PSG1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.517	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	0	0	0	175	175	25	0.00	0.00	G			43375964	-1	34	7	111	9	tier1	no_errors	ENST00000312439	ensembl	human	known	74_37	missense	23.45	43.75	SNP	0.006	T	34	111
RB1	5925	genome.wustl.edu	37	13	49054629	49054629	+	3'UTR	SNP	A	A	C			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr13:49054629A>C	ENST00000267163.4	+	0	3347				RB1_ENST00000484879.1_3'UTR	NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	tttaaCATGAACACCCTTAGA	0.323		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	0																																										SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database		-	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.*422A>C	13.37:g.49054629A>C			A8K5E3|P78499|Q5VW46|Q8IZL4	R	SNP	-	NULL	ENST00000267163.4	37	NULL	CCDS31973.1	13																																																																																			-	RB1	-	-		0.323	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	25	25	55	0.00	0.00	A			49054629	+1	21	41	2	4	tier1	no_errors	ENST00000484879	ensembl	human	known	74_37	rna	91.30	91.11	SNP	0.153	C	21	2
CD3EAP	10849	genome.wustl.edu	37	19	45910444	45910444	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr19:45910444G>A	ENST00000309424.3	+	2	603	c.115G>A	c.(115-117)Gat>Aat	p.D39N	PPP1R13L_ENST00000418234.2_5'Flank|ERCC1_ENST00000588738.1_5'Flank|CD3EAP_ENST00000589804.1_Missense_Mutation_p.D41N|PPP1R13L_ENST00000360957.5_5'Flank	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	39					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		GACGGGTCCAGATACGGAGCT	0.597													ENSG00000117877																																					0													66.0	65.0	66.0					19																	45910444		2203	4300	6503	SO:0001583	missense	0			-	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.115G>A	19.37:g.45910444G>A	ENSP00000310966:p.Asp39Asn		Q32N11|Q7Z5U2|Q9UPF6	Missense_Mutation	SNP	pfam_D-dir_R_pol1_su_RPA34	p.D41N	ENST00000309424.3	37	c.121	CCDS12661.1	19	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947226	0.73672	.	.	ENSG00000117877	ENST00000309424	T	0.12879	2.64	5.19	4.15	0.48705	.	0.386185	0.25578	N	0.029717	T	0.28665	0.0710	L	0.59436	1.845	0.09310	N	1	D;D	0.89917	0.999;1.0	D;D	0.75020	0.974;0.985	T	0.02352	-1.1172	10	0.54805	T	0.06	-19.5003	8.6779	0.34189	0.1017:0.0:0.8983:0.0	.	41;39	O15446-2;O15446	.;RPA34_HUMAN	N	39	ENSP00000310966:D39N	ENSP00000310966:D39N	D	+	1	0	CD3EAP	50602284	0.117000	0.22190	0.370000	0.25965	0.707000	0.40811	1.605000	0.36815	2.410000	0.81850	0.561000	0.74099	GAT	-	CD3EAP	-	pfam_D-dir_R_pol1_su_RPA34		0.597	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD3EAP	HGNC	protein_coding	OTTHUMT00000459538.1	0	0	0	55	55	84	0.00	0.00	G	NM_012099		45910444	+1	6	6	38	59	tier1	no_errors	ENST00000589804	ensembl	human	known	74_37	missense	13.64	9.23	SNP	0.022	A	6	38
REV1	51455	genome.wustl.edu	37	2	100055179	100055179	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr2:100055179C>T	ENST00000258428.3	-	6	1325	c.1097G>A	c.(1096-1098)tGt>tAt	p.C366Y	REV1_ENST00000465835.1_5'UTR|REV1_ENST00000393445.3_Missense_Mutation_p.C366Y	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	366					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGTCAATTCACACTTCCACAT	0.383								Direct reversal of damage					ENSG00000135945																																					0													105.0	108.0	107.0					2																	100055179		2203	4300	6503	SO:0001583	missense	0			-	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.1097G>A	2.37:g.100055179C>T	ENSP00000258428:p.Cys366Tyr		O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	pfam_D_repair_prot_UmuC-like,pfam_D_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_D_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_D_repair_prot_UmuC-like_N	p.C366Y	ENST00000258428.3	37	c.1097	CCDS2045.1	2	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156052	0.38021	.	.	ENSG00000135945	ENST00000393445;ENST00000258428;ENST00000450415	T;T;T	0.45276	1.67;1.67;0.9	5.99	5.99	0.97316	.	0.285739	0.45361	D	0.000375	T	0.46112	0.1376	L	0.56769	1.78	0.50313	D	0.999862	P;P;P	0.46277	0.875;0.766;0.762	B;B;B	0.43082	0.407;0.174;0.327	T	0.48258	-0.9051	10	0.72032	D	0.01	.	16.6927	0.85326	0.0:0.8708:0.1292:0.0	.	345;366;366	Q9UBZ9-3;Q9UBZ9;Q9UBZ9-2	.;REV1_HUMAN;.	Y	366;366;4	ENSP00000377091:C366Y;ENSP00000258428:C366Y;ENSP00000414875:C4Y	ENSP00000258428:C366Y	C	-	2	0	REV1	99421611	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	2.818000	0.48041	2.840000	0.97914	0.655000	0.94253	TGT	-	REV1	-	pirsf_REV1		0.383	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2	0	0	0	33	33	82	0.00	0.00	C	NM_016316		100055179	-1	4	4	27	99	tier1	no_errors	ENST00000258428	ensembl	human	known	74_37	missense	12.50	3.88	SNP	1.000	T	4	27
SYNPR	132204	genome.wustl.edu	37	3	63600972	63600972	+	Missense_Mutation	SNP	T	T	C	rs34826607		TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr3:63600972T>C	ENST00000295894.5	+	5	982	c.613T>C	c.(613-615)Tct>Cct	p.S205P	SYNPR_ENST00000478300.1_Missense_Mutation_p.S225P|SYNPR_ENST00000465156.1_Missense_Mutation_p.S141P|SYNPR_ENST00000479198.1_3'UTR|SYNPR_ENST00000460711.1_Missense_Mutation_p.S216P	NM_144642.4	NP_653243.1	Q8TBG9	SYNPR_HUMAN	synaptoporin	205						cell junction (GO:0030054)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)	transporter activity (GO:0005215)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		CGGCTGGCATTCTTCGGGACA	0.438													ENSG00000163630																									NSCLC(29;1052 1116 20025 32519)												0													50.0	47.0	48.0					3																	63600972		1869	4113	5982	SO:0001583	missense	0			-	AF411860	CCDS46859.1, CCDS46860.1	3p14.3	2011-07-28			ENSG00000163630	ENSG00000163630			16507	protein-coding gene	gene with protein product						8034131, 12974474	Standard	NM_144642		Approved	MGC26651, SPO	uc003dlp.3	Q8TBG9	OTTHUMG00000158699	ENST00000295894.5:c.613T>C	3.37:g.63600972T>C	ENSP00000295894:p.Ser205Pro		B2R675|G5E9W4	Missense_Mutation	SNP	pfam_Marvel,prints_Synaptophysin/porin	p.S225P	ENST00000295894.5	37	c.673	CCDS46860.1	3	.	.	.	.	.	.	.	.	.	.	T	11.77	1.739143	0.30774	.	.	ENSG00000163630	ENST00000478300;ENST00000295894;ENST00000460711;ENST00000465156	T;T;T;T	0.30182	1.86;1.86;1.85;1.54	5.35	5.35	0.76521	.	0.400339	0.23953	N	0.042928	T	0.31888	0.0811	L	0.54323	1.7	0.42799	D	0.993923	P;B;P	0.40476	0.596;0.442;0.718	B;B;B	0.41036	0.188;0.102;0.346	T	0.12451	-1.0547	10	0.52906	T	0.07	-24.6664	10.6818	0.45819	0.0:0.0:0.16:0.84	.	216;205;225	B3KVD8;Q8TBG9;G5E9W4	.;SYNPR_HUMAN;.	P	225;205;216;141	ENSP00000418994:S225P;ENSP00000295894:S205P;ENSP00000418701:S216P;ENSP00000418123:S141P	ENSP00000295894:S205P	S	+	1	0	SYNPR	63576012	1.000000	0.71417	0.991000	0.47740	0.516000	0.34256	3.266000	0.51569	2.027000	0.59764	0.460000	0.39030	TCT	-	SYNPR	-	NULL		0.438	SYNPR-004	KNOWN	basic|CCDS	protein_coding	SYNPR	HGNC	protein_coding	OTTHUMT00000351787.1	0	0	0	51	51	81	0.00	0.00	T			63600972	+1	7	6	60	88	tier1	no_errors	ENST00000478300	ensembl	human	known	74_37	missense	10.45	6.38	SNP	0.994	C	7	60
HLA-DOA	3111	genome.wustl.edu	37	6	32975312	32975312	+	Missense_Mutation	SNP	A	A	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr6:32975312A>T	ENST00000229829.5	-	3	464	c.389T>A	c.(388-390)aTc>aAc	p.I130N	HLA-DOA_ENST00000495532.1_5'UTR|HLA-DOA_ENST00000450833.2_Missense_Mutation_p.I100N	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	130	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						GCAGATGAGGATGTTGGGCTG	0.612													ENSG00000204252																																					0													140.0	139.0	140.0					6																	32975312		1510	2709	4219	SO:0001583	missense	0			-	M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.389T>A	6.37:g.32975312A>T	ENSP00000229829:p.Ile130Asn		Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.I130N	ENST00000229829.5	37	c.389	CCDS4763.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.54|13.54	2.268196|2.268196	0.40095|0.40095	.|.	.|.	ENSG00000204252|ENSG00000204252	ENST00000374813|ENST00000229829;ENST00000450833	.|T;T	.|0.03004	.|6.25;4.08	4.64|4.64	3.47|3.47	0.39725|0.39725	.|Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	.|0.632399	.|0.16024	.|N	.|0.233184	T|T	0.03053|0.03053	0.0090|0.0090	M|M	0.62154|0.62154	1.92|1.92	0.09310|0.09310	N|N	1|1	.|P;P	.|0.39480	.|0.491;0.675	.|B;P	.|0.46299	.|0.305;0.511	T|T	0.34329|0.34329	-0.9833|-0.9833	6|10	0.87932|0.87932	D|D	0|0	.|.	7.5162|7.5162	0.27602|0.27602	0.8889:0.0:0.1111:0.0|0.8889:0.0:0.1111:0.0	.|.	.|100;130	.|B4DW77;P06340	.|.;DOA_HUMAN	Q|N	74|130;100	.|ENSP00000229829:I130N;ENSP00000403896:I100N	ENSP00000363946:H74Q|ENSP00000229829:I130N	H|I	-|-	3|2	2|0	HLA-DOA|HLA-DOA	33083290|33083290	0.746000|0.746000	0.28272|0.28272	0.500000|0.500000	0.27589|0.27589	0.974000|0.974000	0.67602|0.67602	1.317000|1.317000	0.33631|0.33631	0.902000|0.902000	0.36520|0.36520	0.533000|0.533000	0.62120|0.62120	CAT|ATC	-	HLA-DOA	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom		0.612	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DOA	HGNC	protein_coding	OTTHUMT00000076426.2	0	0	1	46	46	29	0.00	3.33	A	NM_002119		32975312	-1	4	19	29	26	tier1	no_errors	ENST00000229829	ensembl	human	known	74_37	missense	12.12	42.22	SNP	0.303	T	4	29
CNIH2	254263	genome.wustl.edu	37	11	66045946	66045946	+	Missense_Mutation	SNP	G	G	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr11:66045946G>T	ENST00000311445.6	+	1	277	c.19G>T	c.(19-21)Gcg>Tcg	p.A7S	RP11-867G23.4_ENST00000528650.1_RNA|CNIH2_ENST00000528852.1_Missense_Mutation_p.A7S|CNIH2_ENST00000530519.1_3'UTR|RP11-867G23.3_ENST00000501708.1_lincRNA|RP11-867G23.4_ENST00000526951.1_RNA	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	7					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						CACCTTCGCCGCGTTCTGCTA	0.761													ENSG00000174871																																					0													23.0	18.0	20.0					11																	66045946		2190	4284	6474	SO:0001583	missense	0			-	BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.19G>T	11.37:g.66045946G>T	ENSP00000310003:p.Ala7Ser			Missense_Mutation	SNP	pfam_Cornichon	p.A7S	ENST00000311445.6	37	c.19	CCDS8131.1	11	.	.	.	.	.	.	.	.	.	.	g	18.46	3.629090	0.67015	.	.	ENSG00000174871	ENST00000528852;ENST00000311445	T;T	0.45668	0.89;0.89	2.33	2.33	0.28932	.	0.000000	0.64402	U	0.000003	T	0.59183	0.2175	M	0.73962	2.25	0.80722	D	1	D;D	0.71674	0.998;0.98	D;P	0.68943	0.961;0.887	T	0.61347	-0.7081	10	0.41790	T	0.15	-1.2826	11.7969	0.52104	0.0:0.0:1.0:0.0	.	7;7	Q6PI25;E9PS15	CNIH2_HUMAN;.	S	7	ENSP00000432177:A7S;ENSP00000310003:A7S	ENSP00000310003:A7S	A	+	1	0	CNIH2	65802522	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.055000	0.89453	1.308000	0.44962	0.444000	0.29173	GCG	-	CNIH2	-	pfam_Cornichon		0.761	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNIH2	HGNC	protein_coding	OTTHUMT00000391892.1	0	0	0	25	25	15	0.00	0.00	G	NM_182553		66045946	+1	4	0	10	8	tier1	no_errors	ENST00000311445	ensembl	human	known	74_37	missense	28.57	0.00	SNP	1.000	T	4	10
CROCC	9696	genome.wustl.edu	37	1	17265593	17265593	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:17265593G>A	ENST00000375541.5	+	12	1633	c.1564G>A	c.(1564-1566)Gcc>Acc	p.A522T	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CTCCACGCTCGCCCTGATCCA	0.751													ENSG00000058453																																					0													6.0	6.0	6.0					1																	17265593		2018	3890	5908	SO:0001583	missense	0			-	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1564G>A	1.37:g.17265593G>A	ENSP00000364691:p.Ala522Thr			Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_t-SRE	p.A522T	ENST00000375541.5	37	c.1564	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229695	0.39399	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.08984	3.03	5.39	3.1	0.35709	.	.	.	.	.	T	0.03739	0.0106	N	0.04959	-0.14	0.28452	N	0.916292	B;B;B	0.25667	0.008;0.008;0.131	B;B;B	0.17722	0.003;0.003;0.019	T	0.43294	-0.9400	9	0.12430	T	0.62	.	9.2506	0.37554	0.2095:0.0:0.7905:0.0	.	385;385;522	A1L0S8;A1L0S9;Q5TZA2	.;.;CROCC_HUMAN	T	522;403	ENSP00000364691:A522T	ENSP00000364691:A522T	A	+	1	0	CROCC	17138180	0.143000	0.22626	0.615000	0.29064	0.993000	0.82548	1.215000	0.32431	0.517000	0.28361	0.561000	0.74099	GCC	-	CROCC	-	NULL		0.751	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	0	0	0	85	85	6	0.00	0.00	G	NM_014675		17265593	+1	13	0	34	6	tier1	no_errors	ENST00000375541	ensembl	human	known	74_37	missense	27.66	0.00	SNP	0.953	A	13	34
TMEM125	128218	genome.wustl.edu	37	1	43738733	43738733	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:43738733G>A	ENST00000432792.2	+	4	910	c.340G>A	c.(340-342)Gcc>Acc	p.A114T	TMEM125_ENST00000439858.1_Missense_Mutation_p.A114T			Q96AQ2	TM125_HUMAN	transmembrane protein 125	114						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AGGGGCCGACGCCCTCGTGGT	0.706													ENSG00000179178																																					0													27.0	28.0	28.0					1																	43738733		2203	4295	6498	SO:0001583	missense	0			-	BC016858	CCDS480.1	1p34.2	2006-02-16			ENSG00000179178	ENSG00000179178			28275	protein-coding gene	gene with protein product							Standard	NM_144626		Approved	MGC17299	uc021oml.1	Q96AQ2	OTTHUMG00000007288	ENST00000432792.2:c.340G>A	1.37:g.43738733G>A	ENSP00000429275:p.Ala114Thr		D3DPX1	Missense_Mutation	SNP	NULL	p.A114T	ENST00000432792.2	37	c.340	CCDS480.1	1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.312588	0.40895	.	.	ENSG00000179178	ENST00000439858;ENST00000432792	T;T	0.43688	0.94;0.94	5.24	4.12	0.48240	.	0.646253	0.16638	N	0.205748	T	0.15132	0.0365	N	0.03608	-0.345	0.09310	N	1	B	0.29253	0.239	B	0.15870	0.014	T	0.08391	-1.0724	10	0.19147	T	0.46	.	5.404	0.16310	0.173:0.0:0.6016:0.2254	.	114	Q96AQ2	TM125_HUMAN	T	114	ENSP00000429775:A114T;ENSP00000429275:A114T	ENSP00000429275:A114T	A	+	1	0	TMEM125	43511320	0.491000	0.26019	0.833000	0.33012	0.935000	0.57460	1.612000	0.36889	2.446000	0.82766	0.455000	0.32223	GCC	-	TMEM125	-	NULL		0.706	TMEM125-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM125	HGNC	protein_coding	OTTHUMT00000019032.2	0	0	0	86	86	5	0.00	0.00	G	NM_144626		43738733	+1	13	0	71	9	tier1	no_errors	ENST00000432792	ensembl	human	known	74_37	missense	15.48	0.00	SNP	0.133	A	13	71
AR	367	genome.wustl.edu	37	X	66765152	66765152	+	Missense_Mutation	SNP	T	T	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chrX:66765152T>A	ENST00000374690.3	+	1	688	c.164T>A	c.(163-165)cTg>cAg	p.L55Q	AR_ENST00000504326.1_Missense_Mutation_p.L55Q|AR_ENST00000396044.3_Missense_Mutation_p.L55Q|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	55	Modulating.|Poly-Leu.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GCCAGTTTGCTGCTGCTgcag	0.662									Androgen Insensitivity Syndrome				ENSG00000169083																																					0													11.0	14.0	13.0					X																	66765152		2169	4252	6421	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	-	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.164T>A	X.37:g.66765152T>A	ENSP00000363822:p.Leu55Gln		A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.L55Q	ENST00000374690.3	37	c.164	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	N	7.392	0.630975	0.14322	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.58797	0.31;0.31;0.31	.	.	.	.	0.268702	0.26919	N	0.021823	T	0.26666	0.0652	N	0.08118	0	0.09310	N	0.999996	B;B	0.17852	0.006;0.024	B;B	0.04013	0.0;0.001	T	0.17107	-1.0380	8	0.10111	T	0.7	.	.	.	.	.	55;55	E7EVX6;D3YPQ2	.;.	Q	55	ENSP00000363822:L55Q;ENSP00000421155:L55Q;ENSP00000379359:L55Q	ENSP00000363822:L55Q	L	+	2	0	AR	66681877	0.998000	0.40836	0.922000	0.36590	0.480000	0.33159	0.009000	0.13219	0.000000	0.14550	0.000000	0.15137	CTG	-	AR	-	pfam_Andrgn_rcpt		0.662	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	0	0	0	24	24	2	0.00	0.00	T	NM_000044		66765152	+1	10	0	33	3	tier1	no_errors	ENST00000374690	ensembl	human	known	74_37	missense	23.26	0.00	SNP	0.960	A	10	33
GOLGA6C	653641	genome.wustl.edu	37	15	75557687	75557687	+	Silent	SNP	A	A	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr15:75557687A>T	ENST00000300576.5	+	9	681	c.681A>T	c.(679-681)ctA>ctT	p.L227L		NM_001164404.1	NP_001157876.1	A6NDK9	GOG6C_HUMAN	golgin A6 family, member C	227						Golgi apparatus (GO:0005794)				ovary(1)	1						AAGTCCAGCTAGAGCGGGACG	0.552													ENSG00000167195																																					0																																										SO:0001819	synonymous_variant	0			-		CCDS58388.1	15q24.2	2014-02-12	2010-02-12		ENSG00000167195	ENSG00000167195			32206	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6C"""				Standard	NM_001164404		Approved		uc002azs.2	A6NDK9	OTTHUMG00000172671	ENST00000300576.5:c.681A>T	15.37:g.75557687A>T				Silent	SNP	NULL	p.L227	ENST00000300576.5	37	c.681	CCDS58388.1	15																																																																																			-	GOLGA6C	-	NULL		0.552	GOLGA6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6C	HGNC	protein_coding	OTTHUMT00000419797.1	1	1	0	181	181	2	0.54	0.00	A	NM_001164404		75557687	+1	77	0	57	0	tier1	no_errors	ENST00000300576	ensembl	human	known	74_37	silent	57.46	0.00	SNP	0.271	T	77	57
SPEG	10290	genome.wustl.edu	37	2	220330643	220330650	+	Intron	DEL	GTGCGCGC	GTGCGCGC	-	rs370532066|rs1976618|rs538792814	byFrequency	TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	GTGCGCGC	GTGCGCGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr2:220330643_220330650delGTGCGCGC	ENST00000312358.7	+	10	3013				SPEG_ENST00000396686.1_Intron|SPEG_ENST00000396689.2_Intron|SPEG_ENST00000485813.1_Intron|SPEG_ENST00000396695.2_Intron|SPEG_ENST00000396688.1_Intron|SPEG_ENST00000396698.1_Intron	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus						cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		gcgtgtgtgtgtgcgcgcgtgtgcgtgc	0.601													ENSG00000072195																																					0																																										SO:0001627	intron_variant	0				BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2882-1246GTGCGCGC>-	2.37:g.220330643_220330650delGTGCGCGC			A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	R	DEL	-	NULL	ENST00000312358.7	37	NULL	CCDS42824.1	2																																																																																				SPEG	-	-		0.601	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	0	0	0	0	0	0	0.00	0.00	GTGCGCGC	NM_005876		220330650	+1	0	0	0	0	tier1	no_errors	ENST00000462545	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.057:0.016:0.015:0.006:0.004:0.001:0.002:0.003	-	0	0
TCHH	7062	genome.wustl.edu	37	1	152084230	152084235	+	In_Frame_Del	DEL	CAACGT	CAACGT	-	rs72477385	byFrequency	TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	CAACGT	CAACGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr1:152084230_152084235delCAACGT	ENST00000368804.1	-	2	1457_1462	c.1458_1463delACGTTG	c.(1456-1464)gaacgttgg>gag	p.RW487del		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	487	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.R487S(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGCTTCAGCCAACGTTCGCGCCTct	0.67													ENSG00000159450																																					1	Substitution - Missense(1)	endometrium(1)																																								SO:0001651	inframe_deletion	0				L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1458_1463delACGTTG	1.37:g.152084230_152084235delCAACGT	ENSP00000357794:p.Arg487_Trp488del		Q5VUI3	In_Frame_Del	DEL	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.RW487in_frame_del	ENST00000368804.1	37	c.1463_1458	CCDS41396.1	1																																																																																				TCHH	-	NULL		0.670	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	0	0	0	2	2	2	0.00	0.00	CAACGT	NM_007113		152084235	-1	0	0	6	6	tier1	no_errors	ENST00000368804	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.000:0.000:0.000:0.000:0.000:0.000	-	0	6
EVPL	2125	genome.wustl.edu	37	17	74003381	74003381	+	Missense_Mutation	SNP	C	C	T			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr17:74003381C>T	ENST00000301607.3	-	22	6158	c.5905G>A	c.(5905-5907)Gcc>Acc	p.A1969T	EVPL_ENST00000586740.1_Missense_Mutation_p.A1991T|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1969	Globular 2.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						AGGAGCTGGGCCAGCTCTTCA	0.637													ENSG00000167880																																					0													73.0	72.0	72.0					17																	74003381		2203	4300	6503	SO:0001583	missense	0			-	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.5905G>A	17.37:g.74003381C>T	ENSP00000301607:p.Ala1969Thr		A0AUV5	Missense_Mutation	SNP	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.A1969T	ENST00000301607.3	37	c.5905	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491365	0.84962	.	.	ENSG00000167880	ENST00000301607	T	0.78003	-1.14	5.48	5.48	0.80851	.	0.274240	0.36234	N	0.002712	D	0.85885	0.5801	M	0.78049	2.395	0.27634	N	0.947936	D;P	0.65815	0.995;0.904	P;P	0.59424	0.857;0.583	T	0.79075	-0.1952	10	0.15499	T	0.54	-20.223	19.3612	0.94438	0.0:1.0:0.0:0.0	.	1991;1969	B7ZLH8;Q92817	.;EVPL_HUMAN	T	1969	ENSP00000301607:A1969T	ENSP00000301607:A1969T	A	-	1	0	EVPL	71514976	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	1.658000	0.37376	2.564000	0.86499	0.561000	0.74099	GCC	-	EVPL	-	pfam_Plectin_repeat,smart_Plectin_repeat		0.637	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	0	0	0	77	77	31	0.00	0.00	C	NM_001988		74003381	-1	15	2	73	28	tier1	no_errors	ENST00000301607	ensembl	human	known	74_37	missense	17.05	6.25	SNP	1.000	T	15	73
CEP131	22994	genome.wustl.edu	37	17	79163639	79163639	+	Missense_Mutation	SNP	G	G	A			TCGA-KD-A5QU-01A-11D-A27P-09	TCGA-KD-A5QU-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	20e81635-4d39-4b8f-aec6-3f96bc5d82ac	19773673-43e9-4c0d-acb8-9677ef088dcd	g.chr17:79163639G>A	ENST00000269392.4	-	26	3429	c.3182C>T	c.(3181-3183)gCg>gTg	p.A1061V	AZI1_ENST00000450824.2_Missense_Mutation_p.A1058V|AZI1_ENST00000374782.3_Missense_Mutation_p.A1022V|AZI1_ENST00000575907.1_Missense_Mutation_p.A1025V	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		1061					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCGCTTCACCGCAGCCTGCAG	0.662													ENSG00000141577																																					0													81.0	79.0	80.0					17																	79163639		2203	4299	6502	SO:0001583	missense	0			-																												ENST00000269392.4:c.3182C>T	17.37:g.79163639G>A	ENSP00000269392:p.Ala1061Val		A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	superfamily_t-SRE	p.A1061V	ENST00000269392.4	37	c.3182		17	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279425	0.59758	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.17054	2.3;2.42;2.31	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.35480	0.0933	M	0.65498	2.005	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.951;0.993;0.989	T	0.21861	-1.0233	10	0.05721	T	0.95	-24.6645	16.7932	0.85595	0.0:0.0:1.0:0.0	.	1058;1061;1022;1058	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	V	1058;1022;1061	ENSP00000393583:A1058V;ENSP00000363914:A1022V;ENSP00000269392:A1061V	ENSP00000269392:A1061V	A	-	2	0	AZI1	76778234	1.000000	0.71417	0.232000	0.24009	0.193000	0.23685	8.934000	0.92915	2.278000	0.76064	0.609000	0.83330	GCG	-	AZI1	-	NULL		0.662	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	AZI1	HGNC	protein_coding	OTTHUMT00000256070.1	0	0	0	73	73	4	0.00	0.00	G			79163639	-1	39	2	18	4	tier1	no_errors	ENST00000269392	ensembl	human	known	74_37	missense	68.42	33.33	SNP	0.988	A	39	18
