#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
C1QTNF5	114902	genome.wustl.edu	37	11	119210232	119210232	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:119210232A>T	ENST00000528368.1	-	3	772	c.541T>A	c.(541-543)Ttt>Att	p.F181I	MFRP_ENST00000555262.1_3'UTR|MFRP_ENST00000530681.1_3'UTR|C1QTNF5_ENST00000525657.1_5'UTR|C1QTNF5_ENST00000445041.2_Missense_Mutation_p.F181I|RP11-334E6.10_ENST00000501918.2_RNA	NM_001278431.1	NP_001265360.1	Q9BXJ0	C1QT5_HUMAN	C1q and tumor necrosis factor related protein 5	181	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(2)	3		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCCCCGAAAAACTGGAAGAAA	0.617													ENSG00000223953																																					0													66.0	60.0	62.0					11																	119210232		2199	4295	6494	SO:0001583	missense	0			-	AF329841	CCDS8420.1	11q23.3	2013-05-10				ENSG00000223953			14344	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 5"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 3"""	608752				12944416	Standard	NM_015645		Approved	CTRP5, DKFZp586B0621, LORD		Q9BXJ0	OTTHUMG00000166198	ENST00000528368.1:c.541T>A	11.37:g.119210232A>T	ENSP00000431140:p.Phe181Ile		A6NDD3|B0YJ35|Q335M2|Q8N6P2|Q9UFX4	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.F181I	ENST00000528368.1	37	c.541	CCDS8420.1	11	.	.	.	.	.	.	.	.	.	.	A	13.04	2.118101	0.37339	.	.	ENSG00000223953	ENST00000528368;ENST00000445041	T;T	0.74632	-0.86;-0.86	4.24	4.24	0.50183	.	0.297259	0.31279	U	0.007929	T	0.59018	0.2163	N	0.15975	0.35	0.80722	D	1	.	.	.	.	.	.	T	0.55147	-0.8186	8	0.22706	T	0.39	.	8.2761	0.31873	0.9109:0.0:0.0891:0.0	.	.	.	.	I	181	ENSP00000431140:F181I;ENSP00000402389:F181I	ENSP00000402389:F181I	F	-	1	0	C1QTNF5	118715442	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.580000	0.60942	1.773000	0.52216	0.533000	0.62120	TTT	-	C1QTNF5	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q		0.617	C1QTNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF5	HGNC	protein_coding	OTTHUMT00000388354.1	0	0	0	53	53	45	0.00	0.00	A	NM_015645		119210232	-1	6	2	33	18	tier1	no_errors	ENST00000445041	ensembl	human	known	74_37	missense	15.38	10.00	SNP	1.000	T	6	33
XIST	7503	genome.wustl.edu	37	X	73071079	73071079	+	lincRNA	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:73071079C>A	ENST00000429829.1	-	0	1509					NR_001564.2				X inactive specific transcript (non-protein coding)																		CCATGATGTCCACGTGACAAA	0.537													ENSG00000229807																																					0													111.0	108.0	109.0					X																	73071079		876	1991	2867			0			-	M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73071079C>A				R	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			-	XIST	-	-		0.537	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	0	0	0	26	26	50	0.00	0.00	C	NR_001564		73071079	-1	9	15	38	39	tier1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	19.15	27.78	SNP	0.006	A	9	38
POTEH	23784	genome.wustl.edu	37	22	16287369	16287369	+	Missense_Mutation	SNP	G	G	A	rs371550897		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:16287369G>A	ENST00000343518.6	-	1	568	c.517C>T	c.(517-519)Cgt>Tgt	p.R173C		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	173										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TCTTCTCGACGGACGTGGTAC	0.572													ENSG00000198062																																					0								G	CYS/ARG	0,3944		0,0,1972	36.0	42.0	40.0		517	-0.1	0.0	22		40	3,7471		0,3,3734	no	missense	POTEH	NM_001136213.1	180	0,3,5706	AA,AG,GG		0.0401,0.0,0.0263	benign	173/546	16287369	3,11415	1972	3737	5709	SO:0001583	missense	0			-	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.517C>T	22.37:g.16287369G>A	ENSP00000340610:p.Arg173Cys		A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R173C	ENST00000343518.6	37	c.517	CCDS46658.1	22	.	.	.	.	.	.	.	.	.	.	.	6.286	0.420827	0.11928	0.0	4.01E-4	ENSG00000198062	ENST00000359587;ENST00000343518;ENST00000355872	T	0.53423	0.62	1.38	-0.111	0.13576	.	.	.	.	.	T	0.34424	0.0897	L	0.40543	1.245	0.09310	N	1	B	0.15930	0.015	B	0.14023	0.01	T	0.27297	-1.0078	9	0.46703	T	0.11	.	5.7857	0.18333	0.0:0.4917:0.5082:0.0	.	173	Q6S545	POTEH_HUMAN	C	136;173;173	ENSP00000340610:R173C	ENSP00000340610:R173C	R	-	1	0	POTEH	14667369	0.005000	0.15991	0.001000	0.08648	0.117000	0.20001	0.161000	0.16481	0.048000	0.15891	0.152000	0.16155	CGT	-	POTEH	-	NULL		0.572	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	HGNC	protein_coding	OTTHUMT00000276918.4	0	0	0	117	117	32	0.00	0.00	G	NM_001136213		16287369	-1	39	11	229	29	tier1	no_errors	ENST00000343518	ensembl	human	known	74_37	missense	14.55	27.50	SNP	0.001	A	39	229
CELSR3	1951	genome.wustl.edu	37	3	48687949	48687949	+	Missense_Mutation	SNP	C	C	T	rs199670636	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:48687949C>T	ENST00000164024.4	-	16	6716	c.6436G>A	c.(6436-6438)Gtc>Atc	p.V2146I	CELSR3_ENST00000544264.1_Missense_Mutation_p.V2146I	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2146					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTGGCCAGGACGCCAAACTTT	0.607													ENSG00000008300	C|||	3	0.000599042	0.0	0.0	5008	,	,		14070	0.002		0.0	False		,,,				2504	0.001																0								C	ILE/VAL	1,4403		0,1,2201	57.0	52.0	54.0		6436	-8.1	0.0	3		54	0,8598		0,0,4299	no	missense	CELSR3	NM_001407.2	29	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	benign	2146/3313	48687949	1,13001	2202	4299	6501	SO:0001583	missense	0			GMAF=0.0005	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.6436G>A	3.37:g.48687949C>T	ENSP00000164024:p.Val2146Ile		O75092	Missense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V2146I	ENST00000164024.4	37	c.6436	CCDS2775.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	7.133	0.580303	0.13686	2.27E-4	0.0	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.52754	0.65;0.65	5.42	-8.12	0.01078	GPCR, family 2, extracellular hormone receptor domain (3);	.	.	.	.	T	0.19644	0.0472	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.08055	0.003;0.001	T	0.16247	-1.0409	9	0.36615	T	0.2	.	4.8782	0.13667	0.1008:0.1248:0.1321:0.6422	.	2146;2216	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	I	2146	ENSP00000164024:V2146I;ENSP00000445694:V2146I	ENSP00000164024:V2146I	V	-	1	0	CELSR3	48662953	0.000000	0.05858	0.000000	0.03702	0.755000	0.42902	-0.476000	0.06591	-1.442000	0.01955	-0.769000	0.03391	GTC	rs199670636	CELSR3	-	smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom		0.607	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	0	0	0	51	51	34	0.00	0.00	C	NM_001407		48687949	-1	22	13	36	29	tier1	no_errors	ENST00000544264	ensembl	human	known	74_37	missense	37.93	30.95	SNP	0.001	T	22	36
MYO18B	84700	genome.wustl.edu	37	22	26164343	26164343	+	Silent	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:26164343T>C	ENST00000407587.2	+	4	629	c.460T>C	c.(460-462)Ttg>Ctg	p.L154L	MYO18B_ENST00000536101.1_Silent_p.L154L|MYO18B_ENST00000335473.7_Silent_p.L154L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	154						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GGGTGATGTGTTGTTGATGGT	0.597													ENSG00000133454																																					0													34.0	41.0	38.0					22																	26164343		2048	4197	6245	SO:0001819	synonymous_variant	0			-	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.460T>C	22.37:g.26164343T>C			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tR-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L154	ENST00000407587.2	37	c.460		22																																																																																			-	MYO18B	-	superfamily_Ribosomal_zn-bd		0.597	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	0	0	0	52	52	86	0.00	0.00	T	NM_032608		26164343	+1	9	14	70	70	tier1	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	11.39	16.67	SNP	0.007	C	9	70
DENND4B	9909	genome.wustl.edu	37	1	153908534	153908534	+	Splice_Site	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:153908534A>G	ENST00000361217.4	-	17	2987		c.e17+1			NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B						positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAAAGTAGGTACCTTATTGTA	0.587													ENSG00000198837																																					0													63.0	72.0	69.0					1																	153908534		2140	4248	6388	SO:0001630	splice_region_variant	0			-	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2568+1T>C	1.37:g.153908534A>G			Q5T4K0	Splice_Site	SNP	-	e16+2	ENST00000361217.4	37	c.2568+2	CCDS44228.1	1	.	.	.	.	.	.	.	.	.	.	a	21.1	4.094661	0.76870	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3047	0.66377	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DENND4B	152175158	1.000000	0.71417	0.945000	0.38365	0.888000	0.51559	8.944000	0.92980	2.216000	0.71823	0.459000	0.35465	.	-	DENND4B	-	-		0.587	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	0	0	0	42	42	77	0.00	0.00	A	XM_375806	Intron	153908534	-1	11	23	48	96	tier1	no_errors	ENST00000361217	ensembl	human	known	74_37	splice_site	18.64	19.33	SNP	0.998	G	11	48
SLC22A1	6580	genome.wustl.edu	37	6	160575836	160575836	+	Silent	SNP	C	C	T	rs536418062	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:160575836C>T	ENST00000366963.4	+	9	1539	c.1392C>T	c.(1390-1392)ctC>ctT	p.L464L	SLC22A1_ENST00000457470.2_Intron|SLC22A1_ENST00000324965.4_Intron	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	464					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	TCAGGAACCTCGGAGTGATGG	0.438													ENSG00000175003	C|||	2	0.000399361	0.0008	0.0	5008	,	,		22831	0.001		0.0	False		,,,				2504	0.0																0													171.0	149.0	156.0					6																	160575836		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1392C>T	6.37:g.160575836C>T			A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L464	ENST00000366963.4	37	c.1392	CCDS5274.1	6																																																																																			-	SLC22A1	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.438	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A1	HGNC	protein_coding	OTTHUMT00000042938.2	0	0	1	53	53	122	0.00	0.81	C			160575836	+1	41	111	52	62	tier1	no_errors	ENST00000366963	ensembl	human	known	74_37	silent	44.09	63.79	SNP	0.235	T	41	52
FBN3	84467	genome.wustl.edu	37	19	8194143	8194143	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:8194143G>A	ENST00000600128.1	-	17	2565	c.2151C>T	c.(2149-2151)gcC>gcT	p.A717A	FBN3_ENST00000601739.1_Silent_p.A717A|FBN3_ENST00000270509.2_Silent_p.A717A			Q75N90	FBN3_HUMAN	fibrillin 3	717	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CCTTGCCTGAGGCACCTGCCT	0.637													ENSG00000142449																																					0													49.0	46.0	47.0					19																	8194143		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2151C>T	19.37:g.8194143G>A			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.A717	ENST00000600128.1	37	c.2151	CCDS12196.1	19																																																																																			-	FBN3	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.637	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	0	0	0	50	50	19	0.00	0.00	G	NM_032447		8194143	-1	23	7	50	20	tier1	no_errors	ENST00000270509	ensembl	human	known	74_37	silent	31.51	25.93	SNP	0.000	A	23	50
ADAMTS20	80070	genome.wustl.edu	37	12	43925909	43925909	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr12:43925909C>T	ENST00000389420.3	-	3	542	c.543G>A	c.(541-543)aaG>aaA	p.K181K	ADAMTS20_ENST00000553158.1_Silent_p.K181K	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	181					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TAAGATGTGGCTTGTTGTGAC	0.358													ENSG00000173157																																					0													138.0	133.0	135.0					12																	43925909		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.543G>A	12.37:g.43925909C>T			A6NNC9|J3QT00	Silent	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.K181	ENST00000389420.3	37	c.543	CCDS31778.2	12																																																																																			-	ADAMTS20	-	pfam_Peptidase_M12B_N		0.358	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	0	0	0	37	37	86	0.00	0.00	C	NM_025003		43925909	-1	19	22	36	46	tier1	no_errors	ENST00000389420	ensembl	human	known	74_37	silent	34.55	32.35	SNP	1.000	T	19	36
ZNF565	147929	genome.wustl.edu	37	19	36685966	36685966	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:36685966C>T	ENST00000355114.5	-	3	948	c.222G>A	c.(220-222)gtG>gtA	p.V74V	ZNF565_ENST00000304116.5_Silent_p.V34V|ZNF565_ENST00000392173.2_Silent_p.V34V			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			TCTCCAGAGTCACCTCCCTGT	0.532													ENSG00000196357																																					0													160.0	128.0	139.0					19																	36685966		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.222G>A	19.37:g.36685966C>T			B3KQ35|Q6NUS2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V34	ENST00000355114.5	37	c.102		19																																																																																			-	ZNF565	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.532	ZNF565-003	PUTATIVE	basic	protein_coding	ZNF565	HGNC	protein_coding	OTTHUMT00000451697.1	0	0	0	40	40	102	0.00	0.00	C	NM_152477		36685966	-1	19	31	133	193	tier1	no_errors	ENST00000304116	ensembl	human	known	74_37	silent	12.50	13.84	SNP	1.000	T	19	133
ACTRT3	84517	genome.wustl.edu	37	3	169485726	169485726	+	Silent	SNP	T	T	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:169485726T>G	ENST00000330368.2	-	2	987	c.613A>C	c.(613-615)Aga>Cga	p.R205R	RP11-816J6.3_ENST00000602879.1_RNA|TERC_ENST00000602385.1_lincRNA	NM_032487.4	NP_115876.3	Q9BYD9	ACTT3_HUMAN	actin-related protein T3	205						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)											ACAATCTTTCTGTCTGAAGCA	0.448													ENSG00000184378																																					0													156.0	148.0	151.0					3																	169485726		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK055346	CCDS3206.1	3q26.2	2012-04-10			ENSG00000184378	ENSG00000184378			24022	protein-coding gene	gene with protein product	"""actin related protein M1"""	608534				11750065, 18692047	Standard	NM_032487		Approved	ARPM1	uc003ffs.2	Q9BYD9		ENST00000330368.2:c.613A>C	3.37:g.169485726T>G			Q96IS0|Q96NJ0	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R205	ENST00000330368.2	37	c.613	CCDS3206.1	3																																																																																			-	ACTRT3	-	pfam_Actin-related,smart_Actin-related		0.448	ACTRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT3	HGNC	protein_coding	OTTHUMT00000467797.1	0	0	0	34	34	93	0.00	0.00	T	NM_032487		169485726	-1	15	17	12	23	tier1	no_errors	ENST00000330368	ensembl	human	known	74_37	silent	55.56	42.50	SNP	0.999	G	15	12
MAG	4099	genome.wustl.edu	37	19	35801001	35801001	+	Missense_Mutation	SNP	G	G	A	rs142036180		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:35801001G>A	ENST00000392213.3	+	8	1615	c.1456G>A	c.(1456-1458)Gtc>Atc	p.V486I	MAG_ENST00000593348.1_3'UTR|MAG_ENST00000537831.2_Missense_Mutation_p.V461I|MAG_ENST00000361922.4_Missense_Mutation_p.V486I	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	486	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCCGCCCCGCGTCATCTGCAC	0.697													ENSG00000105695																																					0								G	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	34.0	34.0	34.0		1381,1456,1456	4.7	1.0	19	dbSNP_134	34	2,8592		0,2,4295	no	missense,missense,missense	MAG	NM_001199216.1,NM_002361.3,NM_080600.2	29,29,29	0,2,6498	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	461/602,486/627,486/583	35801001	2,12998	2203	4297	6500	SO:0001583	missense	0			-	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1456G>A	19.37:g.35801001G>A	ENSP00000376048:p.Val486Ile		B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V486I	ENST00000392213.3	37	c.1456	CCDS12455.1	19	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333059	0.41297	0.0	2.33E-4	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.13778	2.56;2.56;2.56	4.68	4.68	0.58851	.	0.063541	0.64402	D	0.000007	T	0.06234	0.0161	N	0.14661	0.345	0.43412	D	0.995558	B;P;P	0.37688	0.336;0.605;0.605	B;B;B	0.24155	0.051;0.033;0.033	T	0.29761	-1.0001	10	0.45353	T	0.12	.	8.6702	0.34145	0.1022:0.0:0.8978:0.0	.	523;486;486	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	I	523;486;486;461	ENSP00000355234:V486I;ENSP00000376048:V486I;ENSP00000440695:V461I	ENSP00000262624:V523I	V	+	1	0	MAG	40492841	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	2.884000	0.48562	2.431000	0.82371	0.462000	0.41574	GTC	rs142036180	MAG	-	NULL		0.697	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	HGNC	protein_coding	OTTHUMT00000466071.1	0	0	0	20	20	7	0.00	0.00	G	NM_080600		35801001	+1	29	2	66	14	tier1	no_errors	ENST00000392213	ensembl	human	known	74_37	missense	30.53	12.50	SNP	0.999	A	29	66
ACO1	48	genome.wustl.edu	37	9	32407428	32407428	+	Splice_Site	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:32407428G>A	ENST00000309951.6	+	3	404		c.e3+1		ACO1_ENST00000379923.1_Splice_Site|ACO1_ENST00000541043.1_Splice_Site	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble						cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.?(3)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		AGGACTTTACGTGAGCCTAAT	0.388													ENSG00000122729																																					3	Unknown(3)	lung(2)|ovary(1)											113.0	85.0	95.0					9																	32407428		2203	4300	6503	SO:0001630	splice_region_variant	0			-	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.266+1G>A	9.37:g.32407428G>A			D3DRK7|Q14652|Q5VZA7	Splice_Site	SNP	-	e2+1	ENST00000309951.6	37	c.266+1	CCDS6525.1	9	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512926	0.85389	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1904	0.89805	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACO1	32397428	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.614000	0.98353	2.673000	0.90976	0.650000	0.86243	.	-	ACO1	-	-		0.388	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO1	HGNC	protein_coding	OTTHUMT00000051998.3	0	0	0	23	23	91	0.00	0.00	G	NM_002197	Intron	32407428	+1	10	69	13	47	tier1	no_errors	ENST00000309951	ensembl	human	known	74_37	splice_site	43.48	59.48	SNP	1.000	A	10	13
KCNT1	57582	genome.wustl.edu	37	9	138651572	138651572	+	Missense_Mutation	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:138651572T>C	ENST00000263604.3	+	11	845	c.845T>C	c.(844-846)cTc>cCc	p.L282P	KCNT1_ENST00000371757.2_Missense_Mutation_p.L301P|KCNT1_ENST00000486577.2_Missense_Mutation_p.L262P|KCNT1_ENST00000490355.2_Missense_Mutation_p.L282P|KCNT1_ENST00000491806.2_Missense_Mutation_p.L268P|KCNT1_ENST00000487664.1_Missense_Mutation_p.L256P|KCNT1_ENST00000488444.2_Missense_Mutation_p.L282P|KCNT1_ENST00000298480.5_Missense_Mutation_p.L301P			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	282					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AACCTGTCCCTCCTGACCTCC	0.667													ENSG00000107147																																					0													159.0	122.0	135.0					9																	138651572		2203	4300	6503	SO:0001583	missense	0			-	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.845T>C	9.37:g.138651572T>C	ENSP00000263604:p.Leu282Pro		B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.L301P	ENST00000263604.3	37	c.902		9	.	.	.	.	.	.	.	.	.	.	T	22.1	4.244096	0.79912	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000473941;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T;T	0.33438	1.76;1.76;1.76;1.41;1.76	5.05	5.05	0.67936	Ion transport 2 (1);	0.000000	0.64402	D	0.000005	T	0.56108	0.1963	M	0.77616	2.38	0.80722	D	1	D;D;D;P	0.63880	0.985;0.993;0.991;0.56	D;D;D;P	0.72075	0.956;0.976;0.967;0.593	T	0.62053	-0.6935	10	0.87932	D	0	-29.8082	13.9756	0.64271	0.0:0.0:0.0:1.0	.	268;301;256;282	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	P	256;301;301;248;262;268;282;282;282	ENSP00000417851:L256P;ENSP00000298480:L301P;ENSP00000360822:L301P;ENSP00000420764:L248P;ENSP00000263604:L282P	ENSP00000263604:L282P	L	+	2	0	KCNT1	137791393	1.000000	0.71417	0.999000	0.59377	0.955000	0.61496	7.747000	0.85070	1.907000	0.55213	0.482000	0.46254	CTC	-	KCNT1	-	pfam_2pore_dom_K_chnl_dom		0.667	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	HGNC	protein_coding		0	0	0	27	27	42	0.00	0.00	T	NM_020822		138651572	+1	6	7	32	30	tier1	no_errors	ENST00000298480	ensembl	human	known	74_37	missense	15.79	18.92	SNP	1.000	C	6	32
CCNA1	8900	genome.wustl.edu	37	13	37011865	37011865	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:37011865C>A	ENST00000255465.4	+	3	661	c.397C>A	c.(397-399)Caa>Aaa	p.Q133K	CCNA1_ENST00000418263.1_Missense_Mutation_p.Q132K|CCNA1_ENST00000440264.1_Missense_Mutation_p.Q89K|CCNA1_ENST00000449823.1_Missense_Mutation_p.Q89K			P78396	CCNA1_HUMAN	cyclin A1	133					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		GCCCCCCAAGCAAGGGTTTGA	0.517													ENSG00000133101																																					0													82.0	88.0	86.0					13																	37011865		2203	4300	6503	SO:0001583	missense	0			-	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.397C>A	13.37:g.37011865C>A	ENSP00000255465:p.Gln133Lys		B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.Q133K	ENST00000255465.4	37	c.397	CCDS9357.1	13	.	.	.	.	.	.	.	.	.	.	C	10.45	1.352761	0.24512	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.15372	2.47;2.47;2.43;2.43	5.76	5.76	0.90799	.	0.757322	0.12090	N	0.500548	T	0.23806	0.0576	L	0.56769	1.78	0.33236	D	0.556554	B;B	0.23128	0.08;0.048	B;B	0.19946	0.027;0.012	T	0.20505	-1.0273	9	.	.	.	.	19.9731	0.97292	0.0:1.0:0.0:0.0	.	132;133	P78396-2;P78396	.;CCNA1_HUMAN	K	89;89;132;133	ENSP00000400666:Q89K;ENSP00000409873:Q89K;ENSP00000396479:Q132K;ENSP00000255465:Q133K	.	Q	+	1	0	CCNA1	35909865	1.000000	0.71417	0.839000	0.33178	0.169000	0.22640	5.033000	0.64146	2.715000	0.92844	0.563000	0.77884	CAA	-	CC1	-	pirsf_Cyclin_A/B/D/E		0.517	CCNA1-001	KNOWN	basic|CCDS	protein_coding	CC1	HGNC	protein_coding	OTTHUMT00000044514.2	0	0	0	26	26	96	0.00	0.00	C	NM_003914		37011865	+1	14	17	19	38	tier1	no_errors	ENST00000255465	ensembl	human	known	74_37	missense	42.42	30.91	SNP	0.989	A	14	19
KLHL1	57626	genome.wustl.edu	37	13	70456450	70456450	+	Missense_Mutation	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:70456450G>C	ENST00000377844.4	-	5	1951	c.1192C>G	c.(1192-1194)Ctt>Gtt	p.L398V	KLHL1_ENST00000545028.1_Missense_Mutation_p.L205V	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	398					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ATAAAGGCAAGAAGCATGCTC	0.393													ENSG00000150361																																					0													169.0	139.0	149.0					13																	70456450		2203	4300	6503	SO:0001583	missense	0			-	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1192C>G	13.37:g.70456450G>C	ENSP00000367075:p.Leu398Val		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.L398V	ENST00000377844.4	37	c.1192	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	G	18.62	3.664219	0.67700	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.77098	-1.07;-1.07	4.89	4.89	0.63831	BTB/Kelch-associated (2);	0.000000	0.56097	D	0.000031	D	0.90638	0.7064	M	0.91920	3.255	0.45747	D	0.998648	D;D	0.76494	0.999;0.999	D;D	0.78314	0.986;0.991	D	0.92851	0.6297	10	0.87932	D	0	.	18.403	0.90523	0.0:0.0:1.0:0.0	.	398;398	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	V	398;205	ENSP00000367075:L398V;ENSP00000439602:L205V	ENSP00000367075:L398V	L	-	1	0	KLHL1	69354451	1.000000	0.71417	0.993000	0.49108	0.927000	0.56198	7.930000	0.87610	2.406000	0.81754	0.591000	0.81541	CTT	-	KLHL1	-	pfam_BACK,smart_BACK		0.393	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	0	0	0	28	28	58	0.00	0.00	G	NM_020866		70456450	-1	14	22	16	22	tier1	no_errors	ENST00000377844	ensembl	human	known	74_37	missense	46.67	50.00	SNP	1.000	C	14	16
PCDHA12	56137	genome.wustl.edu	37	5	140257091	140257091	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:140257091G>A	ENST00000398631.2	+	1	2034	c.2034G>A	c.(2032-2034)acG>acA	p.T678T	PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	678	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCAAAGACGTCGTCGCGGG	0.657													ENSG00000251664																									Pancreas(113;759 1672 13322 24104 50104)												0													42.0	47.0	45.0					5																	140257091		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2034G>A	5.37:g.140257091G>A			O75278|Q2M1N8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T678	ENST00000398631.2	37	c.2034	CCDS47285.1	5																																																																																			-	PCDHA12	-	pfscan_Cadherin		0.657	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	0	0	0	55	55	11	0.00	0.00	G	NM_018903		140257091	+1	24	5	33	15	tier1	no_errors	ENST00000398631	ensembl	human	known	74_37	silent	42.11	25.00	SNP	0.000	A	24	33
MECOM	2122	genome.wustl.edu	37	3	168813010	168813010	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:168813010A>T	ENST00000464456.1	-	11	3482	c.2282T>A	c.(2281-2283)tTt>tAt	p.F761Y	MECOM_ENST00000460814.1_Missense_Mutation_p.F761Y|MECOM_ENST00000494292.1_Missense_Mutation_p.F949Y|MECOM_ENST00000433243.2_Missense_Mutation_p.F771Y|MECOM_ENST00000264674.3_Missense_Mutation_p.F835Y|MECOM_ENST00000392736.3_Missense_Mutation_p.F770Y|MECOM_ENST00000472280.1_Missense_Mutation_p.F771Y|MECOM_ENST00000468789.1_Missense_Mutation_p.F770Y	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						AGATATGCTAAATGATCTGTC	0.343													ENSG00000085276																																					0													102.0	90.0	94.0					3																	168813010		2202	4300	6502	SO:0001583	missense	0			-	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2282T>A	3.37:g.168813010A>T	ENSP00000419770:p.Phe761Tyr		Q13466|Q6FH90	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.F949Y	ENST00000464456.1	37	c.2846	CCDS54669.1	3	.	.	.	.	.	.	.	.	.	.	A	31	5.090433	0.94149	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.64	5.64	0.86602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.60560	0.2278	M	0.70903	2.155	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.91635	0.998;0.979;0.999;0.996;0.999	T	0.64512	-0.6390	10	0.87932	D	0	-10.2458	15.8679	0.79080	1.0:0.0:0.0:0.0	.	958;762;949;835;770	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	Y	835;770;761;771;949;770;761;771	ENSP00000264674:F835Y;ENSP00000376493:F770Y;ENSP00000419770:F761Y;ENSP00000420048:F771Y;ENSP00000417899:F949Y;ENSP00000419995:F770Y;ENSP00000420466:F761Y;ENSP00000394302:F771Y	ENSP00000264674:F835Y	F	-	2	0	MECOM	170295704	1.000000	0.71417	0.826000	0.32828	0.896000	0.52359	9.281000	0.95811	2.166000	0.68216	0.459000	0.35465	TTT	-	MECOM	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.343	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351519.1	0	0	0	35	35	92	0.00	0.00	A	NM_005241, NM_004991		168813010	-1	10	19	20	25	tier1	no_errors	ENST00000494292	ensembl	human	known	74_37	missense	33.33	43.18	SNP	1.000	T	10	20
ASH1L	55870	genome.wustl.edu	37	1	155429652	155429652	+	Silent	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:155429652T>C	ENST00000368346.3	-	4	5661	c.5022A>G	c.(5020-5022)ccA>ccG	p.P1674P	ASH1L_ENST00000392403.3_Silent_p.P1674P			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1674	Ser-rich.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TGCTCTCTGATGGCCGCTGGG	0.408													ENSG00000116539																																					0													79.0	79.0	79.0					1																	155429652		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.5022A>G	1.37:g.155429652T>C			Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_D-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.P1674	ENST00000368346.3	37	c.5022		1																																																																																			-	ASH1L	-	NULL		0.408	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	0	0	0	19	19	101	0.00	0.00	T	NM_018489		155429652	-1	15	18	49	86	tier1	no_errors	ENST00000368346	ensembl	human	known	74_37	silent	23.44	17.31	SNP	0.596	C	15	49
LAMTOR1	55004	genome.wustl.edu	37	11	71817090	71817090	+	5'Flank	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:71817090C>G	ENST00000278671.5	-	0	0				snoU13_ENST00000459046.1_RNA|LAMTOR1_ENST00000538404.1_5'Flank|LRTOMT_ENST00000419228.1_Intron|LRTOMT_ENST00000435085.1_Silent_p.V64V|LRTOMT_ENST00000307198.7_Silent_p.V64V|LAMTOR1_ENST00000545249.1_5'Flank|LRTOMT_ENST00000439209.1_Intron|LAMTOR1_ENST00000535107.1_5'Flank	NM_017907.2	NP_060377.1	Q6IAA8	LTOR1_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1						cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|cholesterol homeostasis (GO:0042632)|endosome localization (GO:0032439)|endosome organization (GO:0007032)|lysosome localization (GO:0032418)|lysosome organization (GO:0007040)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of TOR signaling (GO:0032008)|regulation of cholesterol efflux (GO:0010874)|regulation of cholesterol esterification (GO:0010872)|regulation of cholesterol import (GO:0060620)|regulation of receptor recycling (GO:0001919)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|Ragulator complex (GO:0071986)				cervix(1)	1						TGCGCACGGTCTTGCTGCGAA	0.627													ENSG00000184154																																					0													55.0	51.0	52.0					11																	71817090		692	1591	2283	SO:0001631	upstream_gene_variant	0			-	AK000632	CCDS8209.1	11q13.4	2011-05-18	2011-02-15	2011-02-15	ENSG00000149357	ENSG00000149357			26068	protein-coding gene	gene with protein product	"""p27kip1 releasing factor from RhoA"", ""protein associated with DRMs and endosomes"""	613510	"""chromosome 11 open reading frame 59"""	C11orf59		12358155	Standard	NM_017907		Approved	FLJ20625, p18, p27RF-Rho, Pdro, Ragulator1	uc001ort.3	Q6IAA8	OTTHUMG00000167869		11.37:g.71817090C>G	Exception_encountered		Q8WZ09|Q9NWT0	Missense_Mutation	SNP	NULL	p.L199V	ENST00000278671.5	37	c.595	CCDS8209.1	11																																																																																			-	LRTOMT	-	NULL		0.627	LAMTOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTOMT	HGNC	protein_coding	OTTHUMT00000396733.1	0	0	0	27	27	57	0.00	0.00	C	NM_017907		71817090	+1	7	12	32	52	tier1	no_errors	ENST00000427369	ensembl	human	known	74_37	missense	17.95	18.75	SNP	1.000	G	7	32
MAD1L1	8379	genome.wustl.edu	37	7	1938010	1938010	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:1938010C>T	ENST00000406869.1	-	18	2381	c.1824G>A	c.(1822-1824)gtG>gtA	p.V608V	MAD1L1_ENST00000265854.7_Silent_p.V608V|MAD1L1_ENST00000402746.1_Silent_p.V516V|MAD1L1_ENST00000399654.2_Silent_p.V608V			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)	608					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CGGCACTCTCCACCTGCTTCT	0.647													ENSG00000002822																																					0													106.0	116.0	113.0					7																	1938010		2089	4205	6294	SO:0001819	synonymous_variant	0			-	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1824G>A	7.37:g.1938010C>T			B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Silent	SNP	pfam_Mad1	p.V608	ENST00000406869.1	37	c.1824	CCDS43539.1	7																																																																																			-	MAD1L1	-	pfam_Mad1		0.647	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAD1L1	HGNC	protein_coding	OTTHUMT00000322871.1	0	0	0	16	16	74	0.00	0.00	C	NM_003550		1938010	-1	24	42	6	16	tier1	no_errors	ENST00000265854	ensembl	human	known	74_37	silent	80.00	72.41	SNP	1.000	T	24	6
OR51I2	390064	genome.wustl.edu	37	11	5475397	5475397	+	Missense_Mutation	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:5475397G>C	ENST00000341449.2	+	1	760	c.679G>C	c.(679-681)Gcc>Ccc	p.A227P	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	227					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCTGTCATGGCCACTGCTTC	0.463													ENSG00000187918																																					0													322.0	273.0	290.0					11																	5475397		2201	4297	6498	SO:0001583	missense	0			-	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.679G>C	11.37:g.5475397G>C	ENSP00000341987:p.Ala227Pro		Q6IF81	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A227P	ENST00000341449.2	37	c.679	CCDS31383.1	11	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890368	0.33348	.	.	ENSG00000187918	ENST00000341449	T	0.00123	8.7	5.58	1.68	0.24146	GPCR, rhodopsin-like superfamily (1);	0.553738	0.17868	N	0.159296	T	0.00356	0.0011	M	0.88775	2.98	0.25715	N	0.985433	D	0.55385	0.971	P	0.55785	0.784	T	0.40608	-0.9554	10	0.54805	T	0.06	.	5.3082	0.15815	0.29:0.0:0.5764:0.1336	.	227	Q9H344	O51I2_HUMAN	P	227	ENSP00000341987:A227P	ENSP00000341987:A227P	A	+	1	0	OR51I2	5431973	0.000000	0.05858	0.797000	0.32132	0.012000	0.07955	0.021000	0.13489	0.162000	0.19483	-0.140000	0.14226	GCC	-	OR51I2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.463	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51I2	HGNC	protein_coding	OTTHUMT00000143385.1	0	0	0	35	35	39	0.00	0.00	G	NM_001004754		5475397	+1	13	7	20	13	tier1	no_errors	ENST00000341449	ensembl	human	known	74_37	missense	39.39	35.00	SNP	0.675	C	13	20
FBXO36	130888	genome.wustl.edu	37	2	230861515	230861515	+	Missense_Mutation	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:230861515A>G	ENST00000283946.3	+	3	272	c.254A>G	c.(253-255)aAt>aGt	p.N85S	FBXO36_ENST00000373652.3_Missense_Mutation_p.N54S|FBXO36_ENST00000409992.1_Intron	NM_174899.4	NP_777559.3	Q8NEA4	FBX36_HUMAN	F-box protein 36	85										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	7		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		TATGTCATCAATTTGTGCAAA	0.353													ENSG00000153832																																					0													171.0	165.0	167.0					2																	230861515		2203	4300	6503	SO:0001583	missense	0			-	BC033935	CCDS2472.1	2q37.1	2008-02-05	2004-06-15		ENSG00000153832	ENSG00000153832		"""F-boxes /  ""other"""""	27020	protein-coding gene	gene with protein product		609105	"""F-box only protein 36"""			12477932	Standard	NM_174899		Approved	Fbx36, FLJ37592	uc002vqa.3	Q8NEA4	OTTHUMG00000133206	ENST00000283946.3:c.254A>G	2.37:g.230861515A>G	ENSP00000283946:p.Asn85Ser		B3KVQ6|Q53TE6|Q8WWD4	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.N85S	ENST00000283946.3	37	c.254	CCDS2472.1	2	.	.	.	.	.	.	.	.	.	.	A	5.483	0.274154	0.10403	.	.	ENSG00000153832	ENST00000373652;ENST00000283946	T;T	0.44881	0.91;0.92	5.37	5.37	0.77165	.	0.124564	0.50627	D	0.000105	T	0.52256	0.1723	L	0.38838	1.175	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.987	T	0.43669	-0.9377	10	0.22706	T	0.39	-3.8363	14.3573	0.66745	1.0:0.0:0.0:0.0	.	54;85	B3KVQ6;Q8NEA4	.;FBX36_HUMAN	S	54;85	ENSP00000362756:N54S;ENSP00000283946:N85S	ENSP00000283946:N85S	N	+	2	0	FBXO36	230569759	1.000000	0.71417	0.996000	0.52242	0.066000	0.16364	2.993000	0.49425	2.038000	0.60285	0.459000	0.35465	AAT	-	FBXO36	-	NULL		0.353	FBXO36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO36	HGNC	protein_coding	OTTHUMT00000256919.2	0	0	0	28	28	84	0.00	0.00	A	NM_174899		230861515	+1	16	19	31	35	tier1	no_errors	ENST00000283946	ensembl	human	known	74_37	missense	34.04	35.19	SNP	1.000	G	16	31
NWD1	284434	genome.wustl.edu	37	19	16918668	16918668	+	Silent	SNP	C	C	T	rs376902807		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:16918668C>T	ENST00000552788.1	+	16	4008	c.4008C>T	c.(4006-4008)atC>atT	p.I1336I	NWD1_ENST00000523826.1_Silent_p.I1130I|NWD1_ENST00000339803.6_Silent_p.I1201I|NWD1_ENST00000379808.3_Silent_p.I1336I|NWD1_ENST00000524140.2_Silent_p.I1336I|NWD1_ENST00000549814.1_Silent_p.I1294I			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1336							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCCCGGTCATCGATGGGCCAA	0.607													ENSG00000188039	C|||	1	0.000199681	0.0	0.0014	5008	,	,		19202	0.0		0.0	False		,,,				2504	0.0																0								C		0,4406		0,0,2203	109.0	94.0	99.0		4008	-2.3	0.0	19		99	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NWD1	NM_001007525.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1336/1433	16918668	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.4008C>T	19.37:g.16918668C>T			C9J021|Q68CT3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I1336	ENST00000552788.1	37	c.4008		19																																																																																			-	NWD1	-	superfamily_WD40_repeat_dom		0.607	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	0	0	0	26	26	81	0.00	0.00	C	NM_001007525		16918668	+1	14	37	38	79	tier1	no_errors	ENST00000379808	ensembl	human	known	74_37	silent	26.92	31.90	SNP	0.088	T	14	38
GIMAP8	155038	genome.wustl.edu	37	7	150174540	150174540	+	Missense_Mutation	SNP	C	C	T	rs148200096	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:150174540C>T	ENST00000307271.3	+	5	2244	c.1670C>T	c.(1669-1671)aCg>aTg	p.T557M		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	557	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.T557R(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GCAGACTTTACGAAATACGCG	0.498													ENSG00000171115																																					1	Substitution - Missense(1)	lung(1)											90.0	90.0	90.0					7																	150174540		2203	4300	6503	SO:0001583	missense	0			-	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1670C>T	7.37:g.150174540C>T	ENSP00000305107:p.Thr557Met			Missense_Mutation	SNP	pfam_AIG1,superfamily_P-loop_NTPase	p.T557M	ENST00000307271.3	37	c.1670	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.485511	0.01027	.	.	ENSG00000171115	ENST00000307271	T	0.05199	3.48	4.44	0.229	0.15368	AIG1 (1);	1.090880	0.07111	N	0.842194	T	0.01287	0.0042	N	0.00337	-1.62	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46119	-0.9214	10	0.02654	T	1	.	2.8718	0.05619	0.2307:0.2112:0.0:0.5581	.	557	Q8ND71	GIMA8_HUMAN	M	557	ENSP00000305107:T557M	ENSP00000305107:T557M	T	+	2	0	GIMAP8	149805473	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.601000	0.05687	0.151000	0.19162	-0.294000	0.09567	ACG	-	GIMAP8	-	pfam_AIG1,superfamily_P-loop_NTPase		0.498	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	0	0	0	34	34	136	0.00	0.00	C	NM_175571		150174540	+1	19	97	14	52	tier1	no_errors	ENST00000307271	ensembl	human	known	74_37	missense	57.58	65.10	SNP	0.000	T	19	14
RAP1A	5906	genome.wustl.edu	37	1	112240076	112240076	+	Missense_Mutation	SNP	A	A	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:112240076A>C	ENST00000369709.3	+	4	319	c.140A>C	c.(139-141)gAt>gCt	p.D47A	RAP1A_ENST00000494982.1_3'UTR|RAP1A_ENST00000436150.2_Missense_Mutation_p.D47A|RAP1A_ENST00000356415.1_Missense_Mutation_p.D47A|RAP1A_ENST00000545460.1_Missense_Mutation_p.D47A	NM_002884.2	NP_002875.1	P62834	RAP1A_HUMAN	RAP1A, member of RAS oncogene family	47					activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of vasculogenesis (GO:2001214)|protein transport (GO:0015031)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|guanyl-nucleotide exchange factor complex (GO:0032045)|late endosome (GO:0005770)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(81;6.79e-06)|all_epithelial(167;2.42e-05)|all_lung(203;0.000105)|Lung NSC(277;0.00021)		Lung(183;0.0183)|Colorectal(144;0.0418)|LUSC - Lung squamous cell carcinoma(189;0.0966)|all cancers(265;0.098)|Epithelial(280;0.0981)|COAD - Colon adenocarcinoma(174;0.141)		GTTGAAGTCGATTGCCAACAG	0.368													ENSG00000116473																																					0													161.0	165.0	164.0					1																	112240076		2203	4300	6503	SO:0001583	missense	0			-	BC014086	CCDS840.1	1p13.3	2014-05-09			ENSG00000116473	ENSG00000116473			9855	protein-coding gene	gene with protein product		179520				3143720	Standard	XM_006710803		Approved	KREV-1, SMGP21	uc001ebl.3	P62834	OTTHUMG00000011959	ENST00000369709.3:c.140A>C	1.37:g.112240076A>C	ENSP00000358723:p.Asp47Ala		P10113	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D47A	ENST00000369709.3	37	c.140	CCDS840.1	1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.817153	0.70912	.	.	ENSG00000116473	ENST00000356415;ENST00000433097;ENST00000369709;ENST00000436150;ENST00000545460	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	5.33	5.33	0.75918	Small GTP-binding protein domain (1);	0.049050	0.85682	D	0.000000	T	0.71298	0.3323	M	0.88181	2.935	0.80722	D	1	B	0.23377	0.084	B	0.32465	0.146	T	0.75972	-0.3129	10	0.87932	D	0	.	15.2735	0.73723	1.0:0.0:0.0:0.0	.	47	P62834	RAP1A_HUMAN	A	47	ENSP00000348786:D47A;ENSP00000396741:D47A;ENSP00000358723:D47A;ENSP00000394318:D47A;ENSP00000443009:D47A	ENSP00000348786:D47A	D	+	2	0	RAP1A	112041599	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.143000	0.66587	0.528000	0.53228	GAT	-	RAP1A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.368	RAP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP1A	HGNC	protein_coding	OTTHUMT00000033071.1	0	0	0	26	26	34	0.00	0.00	A	NM_002884		112240076	+1	13	8	31	38	tier1	no_errors	ENST00000356415	ensembl	human	known	74_37	missense	29.55	17.02	SNP	1.000	C	13	31
ITGA4	3676	genome.wustl.edu	37	2	182339711	182339711	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:182339711G>T	ENST00000397033.2	+	3	774	c.344G>T	c.(343-345)gGa>gTa	p.G115V	ITGA4_ENST00000478440.1_3'UTR|ITGA4_ENST00000339307.4_Missense_Mutation_p.G115V	NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	115					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GAACCTTGTGGAAAGACTTGT	0.413													ENSG00000115232																																					0													99.0	95.0	96.0					2																	182339711		1870	4106	5976	SO:0001583	missense	0			-		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.344G>T	2.37:g.182339711G>T	ENSP00000380227:p.Gly115Val		D3DPG4|Q7Z4L6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G115V	ENST00000397033.2	37	c.344	CCDS42788.1	2	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706244	0.89018	.	.	ENSG00000115232	ENST00000425522;ENST00000339307;ENST00000397033;ENST00000233573	T;T;T	0.57107	0.42;0.42;0.42	5.28	5.28	0.74379	.	0.051361	0.85682	D	0.000000	T	0.73202	0.3557	M	0.82823	2.61	0.80722	D	1	D;D	0.64830	0.994;0.993	P;P	0.59825	0.831;0.864	T	0.77566	-0.2540	10	0.72032	D	0.01	.	19.2608	0.93967	0.0:0.0:1.0:0.0	.	115;115	E7EP60;P13612	.;ITA4_HUMAN	V	115	ENSP00000340149:G115V;ENSP00000380227:G115V;ENSP00000233573:G115V	ENSP00000233573:G115V	G	+	2	0	ITGA4	182047956	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.610000	0.90902	2.623000	0.88846	0.655000	0.94253	GGA	-	ITGA4	-	NULL		0.413	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	HGNC	protein_coding	OTTHUMT00000334427.1	0	0	0	31	31	93	0.00	0.00	G			182339711	+1	21	26	31	43	tier1	no_errors	ENST00000397033	ensembl	human	known	74_37	missense	40.38	37.68	SNP	1.000	T	21	31
SLC25A25	114789	genome.wustl.edu	37	9	130871537	130871537	+	IGR	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:130871537T>A	ENST00000373064.5	+	0	3474				RP11-395P17.11_ENST00000602939.1_RNA|RP11-395P17.3_ENST00000418747.1_RNA	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25						adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						ATGGAGCCAGTATTTTTCTGA	0.478													ENSG00000269988																																					0																																										SO:0001628	intergenic_variant	0			-	AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736		9.37:g.130871537T>A			Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	R	SNP	-	NULL	ENST00000373064.5	37	NULL	CCDS6890.1	9																																																																																			-	RP11-395P17.11	-	-		0.478	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269988	Clone_based_vega_gene	protein_coding	OTTHUMT00000054407.1	0	0	0	9	9	123	0.00	0.00	T	NM_052901		130871537	-1	4	15	13	68	tier1	no_errors	ENST00000602939	ensembl	human	known	74_37	rna	23.53	18.07	SNP	0.000	A	4	13
ATM	472	genome.wustl.edu	37	11	108164194	108164194	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:108164194C>T	ENST00000452508.2	+	32	4955	c.4766C>T	c.(4765-4767)tCa>tTa	p.S1589L	ATM_ENST00000278616.4_Missense_Mutation_p.S1589L			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1589					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGACCCTTTTCACTCTTGGAG	0.303			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)			ENSG00000149311																											yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													85.0	97.0	93.0					11																	108164194		2200	4293	6493	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	-	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4766C>T	11.37:g.108164194C>T	ENSP00000388058:p.Ser1589Leu		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S1589L	ENST00000452508.2	37	c.4766	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610329	0.66558	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.72051	-0.62;-0.62	5.31	4.4	0.53042	Armadillo-type fold (1);	0.231260	0.45126	N	0.000394	T	0.68091	0.2963	M	0.63428	1.95	0.37750	D	0.925958	B	0.30021	0.265	B	0.31245	0.126	T	0.70178	-0.4943	10	0.39692	T	0.17	.	14.001	0.64433	0.0:0.9268:0.0:0.0732	.	1589	Q13315	ATM_HUMAN	L	1589	ENSP00000278616:S1589L;ENSP00000388058:S1589L	ENSP00000278616:S1589L	S	+	2	0	ATM	107669404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.937000	0.56575	1.367000	0.46095	0.655000	0.94253	TCA	-	ATM	-	superfamily_ARM-type_fold		0.303	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	0	0	0	27	27	115	0.00	0.00	C	NM_000051		108164194	+1	76	170	20	45	tier1	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	79.17	79.07	SNP	1.000	T	76	20
TUBA4B	80086	genome.wustl.edu	37	2	220136525	220136525	+	RNA	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:220136525G>T	ENST00000490341.1	+	0	995					NR_003063.1		Q9H853	TBA4B_HUMAN	tubulin, alpha 4b (pseudogene)						microtubule-based process (GO:0007017)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|structural constituent of cytoskeleton (GO:0005200)										TCAAGACCAAGTGCAGCATTC	0.552													ENSG00000243910																																					0																																												0			-	AK024002		2q35	2014-03-20	2007-03-16	2007-02-12	ENSG00000243910	ENSG00000243910		"""Tubulins"""	18637	pseudogene	pseudogene			"""tubulin, alpha 4"", ""tubulin, alpha 4b"""	TUBA4		3785200	Standard	NR_003063		Approved	FLJ13940	uc002vkv.1	Q9H853	OTTHUMG00000154516		2.37:g.220136525G>T				R	SNP	-	NULL	ENST00000490341.1	37	NULL		2																																																																																			-	TUBA4B	-	-		0.552	TUBA4B-001	KNOWN	basic	processed_transcript	TUBA4B	HGNC	pseudogene	OTTHUMT00000335637.1	0	0	0	46	46	48	0.00	0.00	G	NR_003063		220136525	+1	11	13	28	49	tier1	no_errors	ENST00000473885	ensembl	human	known	74_37	rna	28.21	20.97	SNP	1.000	T	11	28
UBQLN2	29978	genome.wustl.edu	37	X	56590841	56590841	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:56590841C>A	ENST00000338222.5	+	1	816	c.535C>A	c.(535-537)Cct>Act	p.P179T		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	179					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TATGGCCAGCCCTGAGATGAT	0.527													ENSG00000188021																									Esophageal Squamous(104;218 1492 6022 10838 28884)												0													67.0	67.0	67.0					X																	56590841		2203	4300	6503	SO:0001583	missense	0			-	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.535C>A	X.37:g.56590841C>A	ENSP00000345195:p.Pro179Thr		O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.P179T	ENST00000338222.5	37	c.535	CCDS14374.1	X	.	.	.	.	.	.	.	.	.	.	C	12.78	2.039889	0.35989	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	D	0.84800	-1.9	4.79	4.79	0.61399	Heat shock chaperonin-binding (1);	0.000000	0.64402	D	0.000003	D	0.92776	0.7703	M	0.87971	2.92	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93455	0.6805	10	0.56958	D	0.05	-5.8075	14.4648	0.67477	0.0:1.0:0.0:0.0	.	179;179	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	T	179	ENSP00000345195:P179T	ENSP00000345195:P179T	P	+	1	0	UBQLN2	56607566	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	7.604000	0.82830	2.384000	0.81235	0.600000	0.82982	CCT	-	UBQLN2	-	smart_STI1_HS-bd		0.527	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN2	HGNC	protein_coding	OTTHUMT00000056891.1	0	0	0	20	20	60	0.00	0.00	C	NM_013444		56590841	+1	12	10	6	15	tier1	no_errors	ENST00000338222	ensembl	human	known	74_37	missense	66.67	40.00	SNP	1.000	A	12	6
H6PD	9563	genome.wustl.edu	37	1	9324533	9324533	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:9324533C>T	ENST00000377403.2	+	5	2283	c.1981C>T	c.(1981-1983)Cgg>Tgg	p.R661W	H6PD_ENST00000602477.1_Missense_Mutation_p.R672W	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	661	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CCTGCAGCAGCGGCTCTGCGC	0.657													ENSG00000049239																																					0													48.0	51.0	50.0					1																	9324533		2203	4296	6499	SO:0001583	missense	0			-	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.1981C>T	1.37:g.9324533C>T	ENSP00000366620:p.Arg661Trp		Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	pfam_G6P_DH_C,pfam_G6P_DH_D-bd,prints_G6P_DH,tigrfam_6-phosphogluconolactonase_DevB	p.R661W	ENST00000377403.2	37	c.1981	CCDS101.1	1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413668	0.62511	.	.	ENSG00000049239	ENST00000377403	D	0.98362	-4.89	5.72	1.16	0.20824	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.053786	0.64402	D	0.000001	D	0.97835	0.9289	M	0.66939	2.045	0.58432	D	0.999993	D	0.76494	0.999	D	0.63033	0.91	D	0.96214	0.9155	10	0.72032	D	0.01	-35.2963	5.8458	0.18665	0.3298:0.4973:0.1031:0.0699	.	661	O95479	G6PE_HUMAN	W	661	ENSP00000366620:R661W	ENSP00000366620:R661W	R	+	1	2	H6PD	9247120	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	1.675000	0.37555	0.330000	0.23485	0.561000	0.74099	CGG	-	H6PD	-	tigrfam_6-phosphogluconolactonase_DevB		0.657	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H6PD	HGNC	protein_coding	OTTHUMT00000004928.2	0	0	0	29	29	16	0.00	0.00	C	NM_004285		9324533	+1	8	4	23	17	tier1	no_errors	ENST00000377403	ensembl	human	known	74_37	missense	25.81	19.05	SNP	1.000	T	8	23
RAD23A	5886	genome.wustl.edu	37	19	13060159	13060159	+	Missense_Mutation	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:13060159G>C	ENST00000586534.1	+	7	811	c.750G>C	c.(748-750)caG>caC	p.Q250H	RAD23A_ENST00000541222.1_Missense_Mutation_p.Q85H|RAD23A_ENST00000588826.2_3'UTR|RAD23A_ENST00000316856.3_Missense_Mutation_p.Q249H|RAD23A_ENST00000592268.1_Missense_Mutation_p.Q250H			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	250					nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						TGATTCAGCAGAACCCTGCGC	0.632								Nucleotide excision repair (NER)					ENSG00000179262																																					0													60.0	64.0	63.0					19																	13060159		2203	4300	6503	SO:0001583	missense	0			-		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.750G>C	19.37:g.13060159G>C	ENSP00000467024:p.Gln250His		K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	pfam_XPC-bd,pfam_UBA/Ts_N,pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,superfamily_XPC-bd,superfamily_UBA-like,smart_Ubiquitin_dom,smart_UBA/transl_elong_EF1B_N_euk,smart_STI1_HS-bd,prints_Rad23,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup,tigrfam_Rad23	p.Q250H	ENST00000586534.1	37	c.750	CCDS12289.1	19	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817658	0.50633	.	.	ENSG00000179262	ENST00000316856;ENST00000541222	T	0.26223	1.75	5.03	3.97	0.46021	XPC-binding domain (3);Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.58736	0.2143	M	0.93898	3.47	0.58432	D	0.99999	P;B;D	0.71674	0.95;0.059;0.998	D;B;D	0.75484	0.916;0.232;0.986	T	0.68085	-0.5502	10	0.72032	D	0.01	-22.5976	11.5358	0.50636	0.0936:0.0:0.9064:0.0	.	249;266;250	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	H	250;85	ENSP00000438741:Q85H	ENSP00000321365:Q250H	Q	+	3	2	RAD23A	12921159	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.259000	0.58828	1.076000	0.40961	0.655000	0.94253	CAG	-	RAD23A	-	pfam_XPC-bd,superfamily_XPC-bd,smart_STI1_HS-bd,tigrfam_Rad23		0.632	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAD23A	HGNC	protein_coding	OTTHUMT00000452752.1	0	0	0	32	32	43	0.00	0.00	G	NM_005053		13060159	+1	8	13	40	36	tier1	no_errors	ENST00000586534	ensembl	human	known	74_37	missense	16.67	26.53	SNP	1.000	C	8	40
KIF21B	23046	genome.wustl.edu	37	1	200956187	200956187	+	Missense_Mutation	SNP	C	C	T	rs371053876		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:200956187C>T	ENST00000422435.2	-	25	3867	c.3551G>A	c.(3550-3552)cGa>cAa	p.R1184Q	KIF21B_ENST00000461742.2_Missense_Mutation_p.R1184Q|KIF21B_ENST00000332129.2_Missense_Mutation_p.R1184Q|KIF21B_ENST00000360529.5_Missense_Mutation_p.R1184Q	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1184					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						ATAGGGGTCTCGGACAGAGAA	0.602													ENSG00000116852	C|||	1	0.000199681	0.0	0.0	5008	,	,		17308	0.0		0.0	False		,,,				2504	0.001																0								C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	94.0	96.0	95.0		3551	5.2	0.9	1		95	0,8600		0,0,4300	no	missense	KIF21B	NM_017596.2	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1184/1625	200956187	1,13005	2203	4300	6503	SO:0001583	missense	0			-	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3551G>A	1.37:g.200956187C>T	ENSP00000411831:p.Arg1184Gln		B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.R1184Q	ENST00000422435.2	37	c.3551	CCDS58056.1	1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478771	0.44044	2.27E-4	0.0	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.71579	-0.24;-0.55;-0.58;-0.27	5.17	5.17	0.71159	.	0.083005	0.49305	D	0.000152	T	0.62048	0.2396	L	0.44542	1.39	0.44976	D	0.997999	P;P;P;P	0.51791	0.913;0.824;0.905;0.948	B;B;B;B	0.39660	0.227;0.084;0.111;0.306	T	0.61292	-0.7092	10	0.14656	T	0.56	.	18.2598	0.90031	0.0:1.0:0.0:0.0	.	1184;1184;1184;1184	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	Q	1184	ENSP00000328494:R1184Q;ENSP00000353724:R1184Q;ENSP00000433808:R1184Q;ENSP00000411831:R1184Q	ENSP00000328494:R1184Q	R	-	2	0	KIF21B	199222810	1.000000	0.71417	0.929000	0.37066	0.522000	0.34438	4.558000	0.60789	2.420000	0.82092	0.655000	0.94253	CGA	-	KIF21B	-	NULL		0.602	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	HGNC	protein_coding	OTTHUMT00000382635.1	0	0	0	32	32	52	0.00	0.00	C	XM_371332		200956187	-1	9	14	5	17	tier1	no_errors	ENST00000422435	ensembl	human	known	74_37	missense	64.29	45.16	SNP	1.000	T	9	5
PFKFB4	5210	genome.wustl.edu	37	3	48563039	48563039	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:48563039G>A	ENST00000232375.3	-	10	1163	c.1051C>T	c.(1051-1053)Cgg>Tgg	p.R351W	PFKFB4_ENST00000536104.1_Missense_Mutation_p.R340W|PFKFB4_ENST00000545984.1_3'UTR|PFKFB4_ENST00000383734.2_Intron|PFKFB4_ENST00000416568.1_Missense_Mutation_p.R344W|PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000541519.1_Missense_Mutation_p.R317W	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	351	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		TCCTGGTCCCGCAGGGCGAAC	0.567													ENSG00000114268																																					0													72.0	61.0	65.0					3																	48563039		2203	4300	6503	SO:0001583	missense	0			-	BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.1051C>T	3.37:g.48563039G>A	ENSP00000232375:p.Arg351Trp		Q5S3G5|Q5XLC2|Q64EX5	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.R351W	ENST00000232375.3	37	c.1051	CCDS2771.1	3	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699573	0.68501	.	.	ENSG00000114268	ENST00000232375;ENST00000536104;ENST00000416568;ENST00000541519	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	4.1	2.21	0.28008	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	T	0.73016	0.3533	L	0.42487	1.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.72766	-0.4194	10	0.87932	D	0	-17.215	10.7359	0.46124	0.0:0.0:0.6571:0.3429	.	340;344;351	B7Z5C3;Q66S35;Q16877	.;.;F264_HUMAN	W	351;340;344;317	ENSP00000232375:R351W;ENSP00000438908:R340W;ENSP00000388394:R344W;ENSP00000437446:R317W	ENSP00000232375:R351W	R	-	1	2	PFKFB4	48538043	0.199000	0.23386	1.000000	0.80357	0.997000	0.91878	0.151000	0.16283	0.435000	0.26365	0.467000	0.42956	CGG	-	PFKFB4	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase		0.567	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB4	HGNC	protein_coding	OTTHUMT00000257503.2	0	0	0	11	11	83	0.00	0.00	G	NM_004567		48563039	-1	8	28	16	51	tier1	no_errors	ENST00000232375	ensembl	human	known	74_37	missense	33.33	35.44	SNP	1.000	A	8	16
P2RY12	64805	genome.wustl.edu	37	3	151056330	151056330	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:151056330C>T	ENST00000302632.3	-	3	603	c.304G>A	c.(304-306)Gtc>Atc	p.V102I	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	102					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	TAAAATATGACGGAGGTAACT	0.393													ENSG00000169313																																					0													65.0	70.0	68.0					3																	151056330		2202	4300	6502	SO:0001583	missense	0			-	AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.304G>A	3.37:g.151056330C>T	ENSP00000307259:p.Val102Ile		D3DNJ5|Q546J7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y12_rcpt,prints_GPCR_Rhodpsn,prints_P2Y13_rcpt,prints_P2Y14_rcpt	p.V102I	ENST00000302632.3	37	c.304	CCDS3159.1	3	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089970	0.76756	.	.	ENSG00000169313	ENST00000302632	T	0.37058	1.22	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.58935	0.2157	M	0.72624	2.21	0.80722	D	1	D	0.89917	1.0	D	0.67900	0.954	T	0.54576	-0.8273	10	0.30854	T	0.27	-28.1525	19.0551	0.93059	0.0:1.0:0.0:0.0	.	102	Q9H244	P2Y12_HUMAN	I	102	ENSP00000307259:V102I	ENSP00000307259:V102I	V	-	1	0	P2RY12	152539020	1.000000	0.71417	0.065000	0.19835	0.646000	0.38490	7.445000	0.80570	2.571000	0.86741	0.650000	0.86243	GTC	-	P2RY12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.393	P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY12	HGNC	protein_coding	OTTHUMT00000357796.1	0	0	0	8	8	92	0.00	0.00	C			151056330	-1	14	19	9	17	tier1	no_errors	ENST00000302632	ensembl	human	known	74_37	missense	60.87	52.78	SNP	0.994	T	14	9
TTC23L	153657	genome.wustl.edu	37	5	34880291	34880291	+	Missense_Mutation	SNP	G	G	C	rs535984245		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:34880291G>C	ENST00000505624.1	+	9	1058	c.955G>C	c.(955-957)Gtt>Ctt	p.V319L	TTC23L_ENST00000514080.1_3'UTR	NM_144725.3	NP_653326.3	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like	319										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(9)|prostate(2)|stomach(1)|urinary_tract(1)	22						TCCAGATGCTGTTGAGATATA	0.348													ENSG00000205838																																					0													90.0	87.0	88.0					5																	34880291		1824	4090	5914	SO:0001583	missense	0			-		CCDS54840.1	5p13.2	2008-07-14			ENSG00000205838	ENSG00000205838			26355	protein-coding gene	gene with protein product						12477932	Standard	NM_144725		Approved	FLJ25439	uc003jiu.3	Q6PF05	OTTHUMG00000162020	ENST00000505624.1:c.955G>C	5.37:g.34880291G>C	ENSP00000422188:p.Val319Leu		Q6RGS4|Q8N7R3|Q96LJ2	Missense_Mutation	SNP	NULL	p.V319L	ENST00000505624.1	37	c.955	CCDS54840.1	5	.	.	.	.	.	.	.	.	.	.	g	10.29	1.308269	0.23821	.	.	ENSG00000205838	ENST00000505624;ENST00000535797	T	0.11385	2.78	4.5	3.58	0.41010	Tetratricopeptide-like helical (1);	0.085601	0.44285	U	0.000465	T	0.10981	0.0268	L	0.57536	1.79	0.23156	N	0.998203	B	0.22683	0.073	B	0.23716	0.048	T	0.19943	-1.0290	9	.	.	.	-19.4344	7.3221	0.26533	0.1317:0.0:0.8683:0.0	.	319	Q6PF05	TT23L_HUMAN	L	319	ENSP00000422188:V319L	.	V	+	1	0	TTC23L	34916048	0.995000	0.38212	0.951000	0.38953	0.275000	0.26752	3.161000	0.50747	1.159000	0.42565	0.580000	0.79431	GTT	-	TTC23L	-	NULL		0.348	TTC23L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23L	HGNC	protein_coding	OTTHUMT00000366819.1	0	0	0	19	19	72	0.00	0.00	G	NM_144725		34880291	+1	9	18	22	58	tier1	no_errors	ENST00000505624	ensembl	human	known	74_37	missense	29.03	23.68	SNP	0.971	C	9	22
FAXC	84553	genome.wustl.edu	37	6	99729131	99729131	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:99729131G>A	ENST00000389677.5	-	6	1421	c.1139C>T	c.(1138-1140)tCc>tTc	p.S380F	FAXC_ENST00000461803.1_5'UTR|FAXC_ENST00000538471.1_Missense_Mutation_p.S100F	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)	380						integral component of membrane (GO:0016021)											TGGGGTTCTGGAAAAACTGTT	0.488													ENSG00000146267																																					0													140.0	144.0	143.0					6																	99729131		2203	4300	6503	SO:0001583	missense	0			-	BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.1139C>T	6.37:g.99729131G>A	ENSP00000374328:p.Ser380Phe		B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like	p.S380F	ENST00000389677.5	37	c.1139	CCDS34500.1	6	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895567	0.52121	.	.	ENSG00000146267	ENST00000389677;ENST00000538471	.	.	.	5.13	5.13	0.70059	.	0.138539	0.51477	D	0.000100	T	0.50803	0.1637	L	0.44542	1.39	0.48830	D	0.99971	D	0.54207	0.965	P	0.48141	0.568	T	0.58668	-0.7596	9	0.87932	D	0	-24.2005	18.6087	0.91276	0.0:0.0:1.0:0.0	.	380	Q5TGI0	CF168_HUMAN	F	380;100	.	ENSP00000374328:S380F	S	-	2	0	C6orf168	99835852	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.768000	0.68858	2.384000	0.81235	0.655000	0.94253	TCC	-	FAXC	-	NULL		0.488	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAXC	HGNC	protein_coding	OTTHUMT00000041589.4	0	0	0	30	30	123	0.00	0.00	G	NM_032511		99729131	-1	10	17	57	84	tier1	no_errors	ENST00000389677	ensembl	human	known	74_37	missense	14.93	16.83	SNP	1.000	A	10	57
SSPO	23145	genome.wustl.edu	37	7	149482730	149482730	+	RNA	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:149482730C>G	ENST00000378016.2	+	0	3146							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGCCTATTCACAGTCTCTGCC	0.622													ENSG00000197558																																					0													21.0	26.0	24.0					7																	149482730		2087	4204	6291			0			-	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149482730C>G			Q76B61	R	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	SSPO	-	-		0.622	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		0	0	0	29	29	29	0.00	0.00	C			149482730	+1	7	14	14	21	tier1	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	33.33	40.00	SNP	0.477	G	7	14
TCERG1L	256536	genome.wustl.edu	37	10	132944799	132944799	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:132944799G>A	ENST00000368642.4	-	7	1244	c.1159C>T	c.(1159-1161)Ccc>Tcc	p.P387S		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	387										cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CGTTTGTGGGGCGGGTCCTCA	0.502													ENSG00000176769																																					0													110.0	104.0	106.0					10																	132944799		2203	4300	6503	SO:0001583	missense	0			-	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1159C>T	10.37:g.132944799G>A	ENSP00000357631:p.Pro387Ser		Q5VWI2|Q86XM8	Missense_Mutation	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.P387S	ENST00000368642.4	37	c.1159	CCDS7662.2	10	.	.	.	.	.	.	.	.	.	.	G	24.1	4.489014	0.84962	.	.	ENSG00000176769	ENST00000368642	T	0.27557	1.66	4.83	4.83	0.62350	.	0.000000	0.64402	D	0.000001	T	0.57946	0.2088	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.63712	-0.6575	10	0.72032	D	0.01	-8.1756	17.2993	0.87177	0.0:0.0:1.0:0.0	.	387	Q5VWI1	TCRGL_HUMAN	S	387	ENSP00000357631:P387S	ENSP00000357631:P387S	P	-	1	0	TCERG1L	132834789	1.000000	0.71417	0.934000	0.37439	0.841000	0.47740	9.117000	0.94347	2.392000	0.81423	0.467000	0.42956	CCC	-	TCERG1L	-	NULL		0.502	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCERG1L	HGNC	protein_coding	OTTHUMT00000091619.2	0	0	0	39	39	111	0.00	0.00	G	NM_174937		132944799	-1	21	28	15	50	tier1	no_errors	ENST00000368642	ensembl	human	known	74_37	missense	58.33	35.90	SNP	1.000	A	21	15
SUDS3	64426	genome.wustl.edu	37	12	118852390	118852390	+	3'UTR	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr12:118852390C>A	ENST00000543473.1	+	0	1451				SUDS3_ENST00000397564.2_3'UTR	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)						apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTTTAGGGCACTTTTGTGGCC	0.423													ENSG00000111707																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.*152C>A	12.37:g.118852390C>A			Q4KMQ5|Q8N6H0|Q9H8D2	R	SNP	-	NULL	ENST00000543473.1	37	NULL	CCDS44993.1	12																																																																																			-	SUDS3	-	-		0.423	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SUDS3	HGNC	protein_coding	OTTHUMT00000401504.1	0	0	0	60	60	65	0.00	0.00	C	NM_022491		118852390	+1	30	23	40	50	tier1	no_errors	ENST00000541591	ensembl	human	known	74_37	rna	42.86	31.51	SNP	0.017	A	30	40
TOM1L1	10040	genome.wustl.edu	37	17	52992048	52992048	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:52992048G>T	ENST00000575882.1	+	6	900	c.547G>T	c.(547-549)Gct>Tct	p.A183S	TOM1L1_ENST00000572405.1_Missense_Mutation_p.A148S|TOM1L1_ENST00000536554.1_Missense_Mutation_p.A106S|TOM1L1_ENST00000570371.1_Missense_Mutation_p.A183S|TOM1L1_ENST00000540336.1_Intron|TOM1L1_ENST00000572158.1_Missense_Mutation_p.A176S|TOM1L1_ENST00000445275.2_Missense_Mutation_p.A183S|TOM1L1_ENST00000575333.1_Missense_Mutation_p.A183S|TOM1L1_ENST00000348161.4_Missense_Mutation_p.A106S	NM_005486.2	NP_005477.2	O75674	TM1L1_HUMAN	target of myb1 (chicken)-like 1	183					activation of protein kinase activity (GO:0032147)|intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|positive regulation of protein autophosphorylation (GO:0031954)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	clathrin binding (GO:0030276)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|ubiquitin binding (GO:0043130)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	15						TACTGCACCAGCTCTTTCTTC	0.378													ENSG00000141198																																					0													290.0	266.0	274.0					17																	52992048		2203	4300	6503	SO:0001583	missense	0			-	AJ010071	CCDS11582.1	17q23.2	2008-01-03	2007-01-12			ENSG00000141198			11983	protein-coding gene	gene with protein product		604701	"""target of myb1 (chicken) homolog-like 1"""			10329004, 15611048, 17977829	Standard	NM_005486		Approved	SRCASM	uc002iud.2	O75674		ENST00000575882.1:c.547G>T	17.37:g.52992048G>T	ENSP00000460823:p.Ala183Ser		Q53G06|Q8N749	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.A183S	ENST00000575882.1	37	c.547	CCDS11582.1	17	.	.	.	.	.	.	.	.	.	.	G	8.694	0.908139	0.17833	.	.	ENSG00000141198	ENST00000445275;ENST00000348161;ENST00000536554	T;T;T	0.41758	0.99;0.99;0.99	5.55	4.57	0.56435	.	0.508887	0.17949	N	0.156580	T	0.21631	0.0521	N	0.24115	0.695	0.37623	D	0.921363	P;P;P;B;P	0.44734	0.842;0.842;0.704;0.255;0.842	B;B;B;B;B	0.33750	0.169;0.169;0.169;0.053;0.169	T	0.08371	-1.0725	10	0.09338	T	0.73	-8.4267	10.6953	0.45894	0.0903:0.0:0.9097:0.0	.	176;106;183;183;106	B4E1N0;B7Z9E2;O75674;Q8N749;B4E1M9	.;.;TM1L1_HUMAN;.;.	S	183;106;106	ENSP00000408958:A183S;ENSP00000343901:A106S;ENSP00000443099:A106S	ENSP00000343901:A106S	A	+	1	0	TOM1L1	50347047	0.928000	0.31464	0.994000	0.49952	0.662000	0.39071	2.982000	0.49337	2.606000	0.88127	0.655000	0.94253	GCT	-	TOM1L1	-	pirsf_TOM1		0.378	TOM1L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOM1L1	HGNC	protein_coding	OTTHUMT00000439029.2	0	0	0	36	36	108	0.00	0.00	G	NM_005486		52992048	+1	12	16	42	82	tier1	no_errors	ENST00000575882	ensembl	human	known	74_37	missense	22.22	16.33	SNP	0.368	T	12	42
CD46	4179	genome.wustl.edu	37	1	207940949	207940949	+	Intron	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:207940949T>C	ENST00000358170.2	+	7	1012				CD46_ENST00000367047.1_Intron|CD46_ENST00000357714.1_Intron|CD46_ENST00000367041.1_Intron|CD46_ENST00000322918.5_Intron|CD46_ENST00000322875.4_Intron|CD46_ENST00000441839.2_Intron|CD46_ENST00000367042.1_Intron|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000480003.1_Intron|CD46_ENST00000360212.2_Intron|CD46_ENST00000354848.1_Intron|CD46_ENST00000361067.1_Intron	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein						adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						TTTTGTTTCCTAGTGCTGCCT	0.338													ENSG00000117335																																					0													184.0	185.0	185.0					1																	207940949		2203	4300	6503	SO:0001627	intron_variant	0			-	BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.857-3T>C	1.37:g.207940949T>C			A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	R	SNP	-	NULL	ENST00000358170.2	37	NULL	CCDS1485.1	1																																																																																			-	CD46	-	-		0.338	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	HGNC	protein_coding	OTTHUMT00000088588.3	0	0	0	18	18	120	0.00	0.00	T	NM_172361		207940949	+1	11	23	15	34	tier1	no_errors	ENST00000469535	ensembl	human	known	74_37	rna	42.31	40.35	SNP	0.000	C	11	15
GP6	51206	genome.wustl.edu	37	19	55525954	55525954	+	3'UTR	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:55525954T>C	ENST00000417454.1	-	0	1382				GP6_ENST00000333884.2_3'UTR|CTC-550B14.7_ENST00000593060.1_RNA|CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000310373.3_Silent_p.G453G	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		ACCTTAGAGATCCGTCTGGAG	0.542													ENSG00000088053																																					0													84.0	90.0	88.0					19																	55525954		1951	4132	6083	SO:0001624	3_prime_UTR_variant	0			-	AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*335A>G	19.37:g.55525954T>C			Q9HCN7|Q9UIF2	Silent	SNP	smart_Ig_sub,smart_Ig_sub2	p.G453	ENST00000417454.1	37	c.1359	CCDS46184.1	19																																																																																			-	GP6	-	NULL		0.542	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	HGNC	protein_coding	OTTHUMT00000357006.1	0	0	0	25	25	118	0.00	0.00	T			55525954	-1	8	35	6	34	tier1	no_errors	ENST00000310373	ensembl	human	known	74_37	silent	57.14	50.72	SNP	0.000	C	8	6
NPTXR	23467	genome.wustl.edu	37	22	39222606	39222606	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:39222606C>T	ENST00000333039.2	-	3	1120	c.997G>A	c.(997-999)Ggc>Agc	p.G333S		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	333	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					GTGCCCTGGCCGGTGCCGCTG	0.632													ENSG00000221890																									Pancreas(139;2521 3281 36965)												0													70.0	67.0	68.0					22																	39222606		2203	4300	6503	SO:0001583	missense	0			-	AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.997G>A	22.37:g.39222606C>T	ENSP00000327545:p.Gly333Ser			Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.G333S	ENST00000333039.2	37	c.997	CCDS33647.1	22	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229168	0.79688	.	.	ENSG00000221890	ENST00000333039	T	0.06768	3.26	4.64	4.64	0.57946	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.22044	0.0531	L	0.60957	1.885	0.45822	D	0.998690	D	0.76494	0.999	D	0.68039	0.955	T	0.03641	-1.1017	9	0.72032	D	0.01	-54.3521	11.8698	0.52513	0.135:0.7342:0.1308:0.0	.	333	O95502	NPTXR_HUMAN	S	333	ENSP00000327545:G333S	ENSP00000327545:G333S	G	-	1	0	NPTXR	37552552	1.000000	0.71417	0.971000	0.41717	0.525000	0.34531	4.604000	0.61112	2.861000	0.98227	0.655000	0.94253	GGC	-	NPTXR	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.632	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	HGNC	protein_coding	OTTHUMT00000318194.2	0	0	0	33	33	20	0.00	0.00	C	NM_014293		39222606	-1	14	9	55	26	tier1	no_errors	ENST00000333039	ensembl	human	known	74_37	missense	20.29	25.71	SNP	0.996	T	14	55
MUC16	94025	genome.wustl.edu	37	19	9084743	9084743	+	Missense_Mutation	SNP	G	G	A	rs372186047		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:9084743G>A	ENST00000397910.4	-	1	7275	c.7072C>T	c.(7072-7074)Cgg>Tgg	p.R2358W		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2358	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTGTTTTCCGTGCGTCAAGG	0.433													ENSG00000181143																																					0								G	TRP/ARG	0,3876		0,0,1938	154.0	151.0	152.0		7072	-0.4	0.0	19		152	1,8283		0,1,4141	no	missense	MUC16	NM_024690.2	101	0,1,6079	AA,AG,GG		0.0121,0.0,0.0082	benign	2358/14508	9084743	1,12159	1938	4142	6080	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7072C>T	19.37:g.9084743G>A	ENSP00000381008:p.Arg2358Trp		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.R2358W	ENST00000397910.4	37	c.7072	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.134	-1.110164	0.01813	0.0	1.21E-4	ENSG00000181143	ENST00000397910	T	0.03004	4.08	0.225	-0.451	0.12214	.	.	.	.	.	T	0.01940	0.0061	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.43032	-0.9416	7	0.87932	D	0	.	.	.	.	.	2358	B5ME49	.	W	2358	ENSP00000381008:R2358W	ENSP00000381008:R2358W	R	-	1	2	MUC16	8945743	0.013000	0.17824	0.008000	0.14137	0.008000	0.06430	-0.931000	0.03967	-0.694000	0.05113	-0.680000	0.03767	CGG	-	MUC16	-	NULL		0.433	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	36	36	122	0.00	0.00	G	NM_024690		9084743	-1	14	32	45	102	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	23.73	23.70	SNP	0.010	A	14	45
TRPC3	7222	genome.wustl.edu	37	4	122853434	122853434	+	Missense_Mutation	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr4:122853434C>G	ENST00000379645.3	-	2	1052	c.979G>C	c.(979-981)Gag>Cag	p.E327Q	TRPC3_ENST00000264811.5_Missense_Mutation_p.E254Q|TRPC3_ENST00000513531.1_Missense_Mutation_p.E254Q	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	242					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						ACCTTGAACTCCTTCTCTATG	0.617													ENSG00000138741																																					0													48.0	39.0	42.0					4																	122853434		2203	4300	6503	SO:0001583	missense	0			-	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.979G>C	4.37:g.122853434C>G	ENSP00000368966:p.Glu327Gln		A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPC3_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.E327Q	ENST00000379645.3	37	c.979	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725960	0.89298	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.88509	-2.39;-2.39;-2.39	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.94588	0.8256	M	0.79614	2.46	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.79108	0.964;0.992	D	0.95012	0.8152	10	0.87932	D	0	-18.6823	19.0581	0.93074	0.0:1.0:0.0:0.0	.	254;327	E9PCJ9;Q5G1L5	.;.	Q	254;327;254	ENSP00000264811:E254Q;ENSP00000368966:E327Q;ENSP00000426899:E254Q	ENSP00000264811:E254Q	E	-	1	0	TRPC3	123072884	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.662000	0.83803	2.488000	0.83962	0.655000	0.94253	GAG	-	TRPC3	-	pfam_TRP_dom,tigrfam_TRP_channel		0.617	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	HGNC	protein_coding	OTTHUMT00000364252.1	0	0	0	15	15	71	0.00	0.00	C	NM_003305		122853434	-1	15	26	8	25	tier1	no_errors	ENST00000379645	ensembl	human	known	74_37	missense	65.22	50.98	SNP	1.000	G	15	8
RALGPS2	55103	genome.wustl.edu	37	1	178875998	178875998	+	Missense_Mutation	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:178875998A>G	ENST00000367635.3	+	19	2056	c.1718A>G	c.(1717-1719)cAa>cGa	p.Q573R	RALGPS2_ENST00000367634.2_Missense_Mutation_p.Q547R	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	573	Required for stimulation of nucleotide exchange by RALA. {ECO:0000250}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						AGTAACAAACAACAGGTAAGC	0.343													ENSG00000116191																																					0													88.0	84.0	86.0					1																	178875998		2203	4300	6503	SO:0001583	missense	0			-	AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.1718A>G	1.37:g.178875998A>G	ENSP00000356607:p.Gln573Arg		B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Missense_Mutation	SNP	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.Q573R	ENST00000367635.3	37	c.1718	CCDS1325.1	1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163951	0.57476	.	.	ENSG00000116191	ENST00000367635;ENST00000367634;ENST00000324778;ENST00000535251	T;T;T	0.78816	-1.21;-1.21;-1.21	5.87	5.87	0.94306	Pleckstrin homology-type (1);	0.199408	0.45606	D	0.000346	T	0.71829	0.3386	L	0.44542	1.39	0.80722	D	1	B;B	0.31581	0.3;0.329	B;B	0.29942	0.109;0.109	T	0.70223	-0.4931	10	0.39692	T	0.17	.	15.9315	0.79663	1.0:0.0:0.0:0.0	.	547;573	B7Z7B1;Q86X27	.;RGPS2_HUMAN	R	573;547;538;222	ENSP00000356607:Q573R;ENSP00000356606:Q547R;ENSP00000313613:Q538R	ENSP00000313613:Q538R	Q	+	2	0	RALGPS2	177142621	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.707000	0.91367	2.248000	0.74166	0.533000	0.62120	CAA	-	RALGPS2	-	NULL		0.343	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS2	HGNC	protein_coding	OTTHUMT00000084926.2	0	0	0	37	37	118	0.00	0.00	A	NM_152663		178875998	+1	10	24	44	110	tier1	no_errors	ENST00000367635	ensembl	human	known	74_37	missense	18.52	17.91	SNP	1.000	G	10	44
CYBB	1536	genome.wustl.edu	37	X	37663304	37663304	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:37663304G>A	ENST00000378588.4	+	9	1139	c.1072G>A	c.(1072-1074)Gtt>Att	p.V358I	CYBB_ENST00000492288.1_3'UTR|CYBB_ENST00000545017.1_Missense_Mutation_p.V326I|CYBB_ENST00000536160.1_Missense_Mutation_p.V91I|TM4SF2_ENST00000465127.1_Intron	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	358	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)	p.V358L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	TATCCGCATCGTTGGGGACTG	0.468													ENSG00000165168																																					1	Substitution - Missense(1)	lung(1)											79.0	75.0	76.0					X																	37663304		2202	4300	6502	SO:0001583	missense	0			-	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.1072G>A	X.37:g.37663304G>A	ENSP00000367851:p.Val358Ile		A8K138|Q2PP16	Missense_Mutation	SNP	pfam_Fe_red_D-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.V358I	ENST00000378588.4	37	c.1072	CCDS14242.1	X	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006382	0.93287	.	.	ENSG00000165168	ENST00000378588;ENST00000545017;ENST00000536160	D;D;D	0.94457	-3.43;-3.43;-3.43	5.77	5.77	0.91146	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.97442	0.9163	M	0.88775	2.98	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.60886	0.85;0.88	D	0.97936	1.0323	10	0.72032	D	0.01	.	18.9785	0.92747	0.0:0.0:1.0:0.0	.	326;358	F5GWD2;P04839	.;CY24B_HUMAN	I	358;326;91	ENSP00000367851:V358I;ENSP00000441896:V326I;ENSP00000441958:V91I	ENSP00000367851:V358I	V	+	1	0	CYBB	37548248	1.000000	0.71417	0.870000	0.34147	0.876000	0.50452	9.476000	0.97823	2.430000	0.82344	0.544000	0.68410	GTT	-	CYBB	-	pfam_FAD-bd_8,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl		0.468	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBB	HGNC	protein_coding	OTTHUMT00000080881.1	0	0	0	60	60	142	0.00	0.00	G			37663304	+1	24	29	34	33	tier1	no_errors	ENST00000378588	ensembl	human	known	74_37	missense	41.38	46.77	SNP	0.997	A	24	34
DNAH14	127602	genome.wustl.edu	37	1	225328548	225328548	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:225328548G>A	ENST00000445597.2	+	17	3130	c.3130G>A	c.(3130-3132)Gct>Act	p.A1044T	DNAH14_ENST00000439375.2_Missense_Mutation_p.A1428T|DNAH14_ENST00000430092.1_Missense_Mutation_p.A1428T			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1044					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AAAAGTCCACGCTGGTCTGAT	0.363													ENSG00000185842																																					0													98.0	92.0	94.0					1																	225328548		692	1591	2283	SO:0001583	missense	0			-	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3130G>A	1.37:g.225328548G>A	ENSP00000409472:p.Ala1044Thr		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.A1428T	ENST00000445597.2	37	c.4282		1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292031	0.23564	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.31247	2.54;1.5;1.5;1.72	5.46	1.32	0.21799	.	.	.	.	.	T	0.22126	0.0533	L	0.46157	1.445	0.09310	N	1	B	0.27498	0.18	B	0.20384	0.029	T	0.18808	-1.0325	9	0.33141	T	0.24	.	5.0763	0.14632	0.2092:0.0:0.5373:0.2534	.	1428	Q0VDD8-4	.	T	1044;1428;1428;523	ENSP00000409472:A1044T;ENSP00000414402:A1428T;ENSP00000392061:A1428T;ENSP00000332424:A523T	ENSP00000332424:A523T	A	+	1	0	DNAH14	223395171	0.000000	0.05858	0.000000	0.03702	0.352000	0.29268	0.449000	0.21744	0.249000	0.21456	0.603000	0.83216	GCT	-	DH14	-	NULL		0.363	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DH14	HGNC	protein_coding	OTTHUMT00000331217.3	0	0	0	35	35	82	0.00	0.00	G	XM_059166		225328548	+1	14	16	11	29	tier1	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	56.00	35.56	SNP	0.000	A	14	11
LINC01020	340094	genome.wustl.edu	37	5	5034574	5034574	+	lincRNA	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:5034574G>C	ENST00000508201.1	+	0	103				CTD-2247C11.1_ENST00000509057.1_lincRNA					long intergenic non-protein coding RNA 1020																		ttgtgaccaagttgGAGCAGC	0.468													ENSG00000215231																																					0																																												0			-			5p15.32	2013-07-26			ENSG00000215231	ENSG00000215231		"""Long non-coding RNAs"""	27968	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026994		Approved				OTTHUMG00000161653		5.37:g.5034574G>C				R	SNP	-	NULL	ENST00000508201.1	37	NULL		5																																																																																			-	LINC01020	-	-		0.468	LINC01020-001	KNOWN	basic	lincRNA	LINC01020	HGNC	lincRNA	OTTHUMT00000365595.1	0	0	0	26	26	71	0.00	0.00	G			5034574	+1	14	18	45	76	tier1	no_errors	ENST00000508201	ensembl	human	known	74_37	rna	23.73	19.15	SNP	0.001	C	14	45
MUC12	10071	genome.wustl.edu	37	7	100646158	100646158	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:100646158C>A	ENST00000379442.3	+	5	12743	c.12743C>A	c.(12742-12744)aCa>aAa	p.T4248K	MUC12_ENST00000536621.1_Missense_Mutation_p.T4105K			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4248	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GAAGTATCCACAACCTACCAC	0.537													ENSG00000205277																																					0													23.0	25.0	25.0					7																	100646158		520	1083	1603	SO:0001583	missense	0			-	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12743C>A	7.37:g.100646158C>A	ENSP00000368755:p.Thr4248Lys		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.T4105K	ENST00000379442.3	37	c.12314		7	.	.	.	.	.	.	.	.	.	.	C	2.384	-0.341377	0.05243	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11821	2.74;2.74	0.53	0.53	0.17102	.	.	.	.	.	T	0.06645	0.0170	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.41610	-0.9499	7	0.30078	T	0.28	.	6.8033	0.23764	0.0:0.9998:0.0:2.0E-4	.	.	.	.	K	4248;4105	ENSP00000368755:T4248K;ENSP00000441929:T4105K	ENSP00000368755:T4248K	T	+	2	0	MUC12	100432878	0.002000	0.14202	0.002000	0.10522	0.002000	0.02628	1.639000	0.37176	0.519000	0.28406	0.195000	0.17529	ACA	-	MUC12	-	NULL		0.537	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	0	0	0	77	77	70	0.00	0.00	C	XM_379904		100646158	+1	61	32	80	42	tier1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	43.26	43.24	SNP	0.005	A	61	80
MYO15A	51168	genome.wustl.edu	37	17	18025157	18025157	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:18025157G>T	ENST00000205890.5	+	2	3381	c.3043G>T	c.(3043-3045)Gag>Tag	p.E1015*		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1015					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCCTGAAGAAGAGGCCACCCT	0.622													ENSG00000091536																																					0													33.0	38.0	37.0					17																	18025157		1914	4123	6037	SO:0001587	stop_gained	0			-	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.3043G>T	17.37:g.18025157G>T	ENSP00000205890:p.Glu1015*		B4DFC7	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.E1015*	ENST00000205890.5	37	c.3043	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	g	44	10.635156	0.99441	.	.	ENSG00000091536	ENST00000205890	.	.	.	4.83	3.86	0.44501	.	.	.	.	.	.	.	.	.	.	.	0.38678	D	0.952462	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	8.8792	0.35365	0.105:0.0:0.895:0.0	.	.	.	.	X	1015	.	ENSP00000205890:E1015X	E	+	1	0	MYO15A	17965882	0.312000	0.24545	0.480000	0.27341	0.479000	0.33129	1.723000	0.38053	1.028000	0.39785	0.555000	0.69702	GAG	-	MYO15A	-	NULL		0.622	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	0	0	0	41	41	35	0.00	0.00	G	NM_016239		18025157	+1	20	12	66	61	tier1	no_errors	ENST00000205890	ensembl	human	known	74_37	nonsense	23.26	16.44	SNP	0.545	T	20	66
LAMTOR1	55004	genome.wustl.edu	37	11	71817014	71817014	+	5'Flank	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:71817014C>T	ENST00000278671.5	-	0	0				snoU13_ENST00000459046.1_RNA|LAMTOR1_ENST00000538404.1_5'Flank|LRTOMT_ENST00000419228.1_Intron|LRTOMT_ENST00000435085.1_Missense_Mutation_p.A39V|LRTOMT_ENST00000307198.7_Missense_Mutation_p.A39V|LAMTOR1_ENST00000545249.1_5'Flank|LRTOMT_ENST00000439209.1_Intron|LAMTOR1_ENST00000535107.1_5'Flank	NM_017907.2	NP_060377.1	Q6IAA8	LTOR1_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1						cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|cholesterol homeostasis (GO:0042632)|endosome localization (GO:0032439)|endosome organization (GO:0007032)|lysosome localization (GO:0032418)|lysosome organization (GO:0007040)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of TOR signaling (GO:0032008)|regulation of cholesterol efflux (GO:0010874)|regulation of cholesterol esterification (GO:0010872)|regulation of cholesterol import (GO:0060620)|regulation of receptor recycling (GO:0001919)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|Ragulator complex (GO:0071986)				cervix(1)	1						CCTGCCATTGCATTGGCCTTC	0.587													ENSG00000184154																																					0													55.0	55.0	55.0					11																	71817014		692	1591	2283	SO:0001631	upstream_gene_variant	0			-	AK000632	CCDS8209.1	11q13.4	2011-05-18	2011-02-15	2011-02-15	ENSG00000149357	ENSG00000149357			26068	protein-coding gene	gene with protein product	"""p27kip1 releasing factor from RhoA"", ""protein associated with DRMs and endosomes"""	613510	"""chromosome 11 open reading frame 59"""	C11orf59		12358155	Standard	NM_017907		Approved	FLJ20625, p18, p27RF-Rho, Pdro, Ragulator1	uc001ort.3	Q6IAA8	OTTHUMG00000167869		11.37:g.71817014C>T	Exception_encountered		Q8WZ09|Q9NWT0	Missense_Mutation	SNP	pfam_O-MeTrfase_3	p.A39V	ENST00000278671.5	37	c.116	CCDS8209.1	11	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715174	0.89112	.	.	ENSG00000184154	ENST00000435085;ENST00000307198	D;D	0.91237	-2.81;-2.81	4.27	4.27	0.50696	.	.	.	.	.	D	0.91379	0.7280	N	0.24115	0.695	0.41583	D	0.988752	D	0.89917	1.0	D	0.80764	0.994	D	0.91641	0.5327	9	0.41790	T	0.15	-4.7738	16.8442	0.85976	0.0:1.0:0.0:0.0	.	39	Q8WZ04	TOMT_HUMAN	V	39	ENSP00000409789:A39V;ENSP00000305742:A39V	ENSP00000409789:A39V	A	+	2	0	LRTOMT	71494662	1.000000	0.71417	0.973000	0.42090	0.787000	0.44495	5.026000	0.64103	2.372000	0.80975	0.462000	0.41574	GCA	-	LRTOMT	-	NULL		0.587	LAMTOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTOMT	HGNC	protein_coding	OTTHUMT00000396733.1	0	0	0	43	43	76	0.00	0.00	C	NM_017907		71817014	+1	12	17	45	68	tier1	no_errors	ENST00000307198	ensembl	human	known	74_37	missense	21.05	20.00	SNP	0.998	T	12	45
TMEM87A	25963	genome.wustl.edu	37	15	42553434	42553434	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:42553434T>A	ENST00000389834.4	-	5	683	c.419A>T	c.(418-420)gAt>gTt	p.D140V	TMEM87A_ENST00000307216.6_Missense_Mutation_p.D140V|TMEM87A_ENST00000448392.1_Missense_Mutation_p.D79V|TMEM87A_ENST00000568432.1_5'UTR	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	140						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		ATGCATAAAATCTCCAGAAAA	0.328													ENSG00000103978																																					0													37.0	38.0	38.0					15																	42553434		2201	4299	6500	SO:0001583	missense	0			-	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.419A>T	15.37:g.42553434T>A	ENSP00000374484:p.Asp140Val		Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	pfam_TM_rcpt_euk	p.D140V	ENST00000389834.4	37	c.419	CCDS32205.1	15	.	.	.	.	.	.	.	.	.	.	T	19.20	3.781337	0.70222	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305;ENST00000307216	.	.	.	4.64	4.64	0.57946	.	0.312241	0.33515	N	0.004831	T	0.51449	0.1675	N	0.24115	0.695	0.80722	D	1	B;B;D	0.63046	0.068;0.098;0.992	B;B;P	0.59546	0.014;0.031;0.859	T	0.48317	-0.9046	9	0.34782	T	0.22	-2.3058	10.6149	0.45445	0.0:0.0:0.0:1.0	.	140;79;140	Q8NBN3;Q8NBN3-3;Q8NBN3-2	TM87A_HUMAN;.;.	V	140;79;116;140	.	ENSP00000305894:D140V	D	-	2	0	TMEM87A	40340726	0.988000	0.35896	0.885000	0.34714	0.961000	0.63080	3.634000	0.54302	2.084000	0.62774	0.383000	0.25322	GAT	-	TMEM87A	-	NULL		0.328	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TMEM87A	HGNC	protein_coding	OTTHUMT00000420482.2	0	0	0	36	36	47	0.00	0.00	T	NM_015497		42553434	-1	18	7	86	22	tier1	no_errors	ENST00000389834	ensembl	human	known	74_37	missense	17.31	24.14	SNP	0.934	A	18	86
RHCG	51458	genome.wustl.edu	37	15	90023597	90023597	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:90023597C>T	ENST00000268122.4	-	4	633	c.565G>A	c.(565-567)Gcc>Acc	p.A189T	RHCG_ENST00000544600.1_Missense_Mutation_p.A189T	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	189					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					CCAAAGTAGGCGCCAAATGTG	0.572													ENSG00000140519																																					0													214.0	197.0	203.0					15																	90023597		2200	4299	6499	SO:0001583	missense	0			-	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.565G>A	15.37:g.90023597C>T	ENSP00000268122:p.Ala189Thr		A8K4D4|Q6X3Y4	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.A189T	ENST00000268122.4	37	c.565	CCDS10351.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.391862	0.95988	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.29655	1.56;1.56	5.21	5.21	0.72293	Ammonium transporter AmtB-like (3);	0.099800	0.64402	D	0.000002	T	0.66509	0.2796	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.75676	-0.3235	9	.	.	.	-22.2471	18.8117	0.92059	0.0:1.0:0.0:0.0	.	189;189	A8K4D4;Q9UBD6	.;RHCG_HUMAN	T	189;189;180	ENSP00000438123:A189T;ENSP00000268122:A189T	.	A	-	1	0	RHCG	87824601	1.000000	0.71417	0.984000	0.44739	0.932000	0.56968	7.788000	0.85771	2.462000	0.83206	0.456000	0.33151	GCC	-	RHCG	-	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD		0.572	RHCG-001	KNOWN	basic|CCDS	protein_coding	RHCG	HGNC	protein_coding	OTTHUMT00000312855.2	0	0	0	23	23	47	0.00	0.00	C	NM_016321		90023597	-1	14	19	22	31	tier1	no_errors	ENST00000268122	ensembl	human	known	74_37	missense	38.89	38.00	SNP	1.000	T	14	22
DOCK6	57572	genome.wustl.edu	37	19	11347064	11347064	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:11347064C>T	ENST00000294618.7	-	20	2361	c.2350G>A	c.(2350-2352)Gtg>Atg	p.V784M	RN7SL298P_ENST00000581369.1_RNA|C19orf80_ENST00000591200.1_5'Flank|DOCK6_ENST00000319867.7_Missense_Mutation_p.V88M	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	784					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						ACCAGACGCACGAGCTTGTCC	0.622													ENSG00000130158																																					0													20.0	25.0	24.0					19																	11347064		2057	4195	6252	SO:0001583	missense	0			-		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2350G>A	19.37:g.11347064C>T	ENSP00000294618:p.Val784Met		A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N	p.V784M	ENST00000294618.7	37	c.2350	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670557	0.67814	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.33438	1.41;1.41	5.11	4.01	0.46588	.	0.063201	0.64402	D	0.000014	T	0.22085	0.0532	N	0.12182	0.205	0.44619	D	0.997598	P;D	0.54964	0.936;0.969	P;P	0.51974	0.686;0.557	T	0.02893	-1.1097	10	0.72032	D	0.01	-27.8771	3.9881	0.09525	0.0:0.6638:0.0:0.3362	.	88;784	C9IZV6;Q96HP0	.;DOCK6_HUMAN	M	784;88	ENSP00000294618:V784M;ENSP00000321556:V88M	ENSP00000294618:V784M	V	-	1	0	DOCK6	11208064	0.744000	0.28250	0.628000	0.29241	0.506000	0.33950	1.112000	0.31172	2.378000	0.81104	0.561000	0.74099	GTG	-	DOCK6	-	NULL		0.622	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	0	0	0	39	39	22	0.00	0.00	C	NM_020812		11347064	-1	11	9	40	15	tier1	no_errors	ENST00000294618	ensembl	human	known	74_37	missense	21.57	37.50	SNP	1.000	T	11	40
KIF19	124602	genome.wustl.edu	37	17	72339230	72339230	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:72339230C>T	ENST00000389916.4	+	5	525	c.387C>T	c.(385-387)aaC>aaT	p.N129N		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	129	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						AGACCCTCAACGACCTCTTCC	0.592													ENSG00000196169																																					0													97.0	75.0	82.0					17																	72339230		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.387C>T	17.37:g.72339230C>T			A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.N129	ENST00000389916.4	37	c.387	CCDS32718.2	17																																																																																			-	KIF19	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.592	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2	0	0	0	32	32	66	0.00	0.00	C	NM_153209		72339230	+1	19	13	47	47	tier1	no_errors	ENST00000389916	ensembl	human	known	74_37	silent	28.79	21.67	SNP	0.903	T	19	47
IRS4	8471	genome.wustl.edu	37	X	107977403	107977403	+	Missense_Mutation	SNP	A	A	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:107977403A>C	ENST00000372129.2	-	1	2248	c.2172T>G	c.(2170-2172)aaT>aaG	p.N724K	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	724	CRK-binding.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AAGCAGAGACATTTTGAGGAG	0.502													ENSG00000133124																																					0													78.0	80.0	79.0					X																	107977403		2203	4300	6503	SO:0001583	missense	0			-	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2172T>G	X.37:g.107977403A>C	ENSP00000361202:p.Asn724Lys			Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.N724K	ENST00000372129.2	37	c.2172	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	A	13.34	2.206707	0.39003	.	.	ENSG00000133124	ENST00000372129	T	0.16073	2.37	5.33	1.27	0.21489	.	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	L	0.57536	1.79	0.09310	N	0.999998	P	0.34462	0.454	B	0.21917	0.037	T	0.10660	-1.0620	10	0.54805	T	0.06	-9.756	9.304	0.37863	0.6639:0.0:0.3361:0.0	.	724	O14654	IRS4_HUMAN	K	724	ENSP00000361202:N724K	ENSP00000361202:N724K	N	-	3	2	IRS4	107864059	0.944000	0.32072	0.097000	0.21041	0.966000	0.64601	1.632000	0.37102	-0.035000	0.13691	0.486000	0.48141	AAT	-	IRS4	-	NULL		0.502	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	0	0	0	35	35	85	0.00	0.00	A	NM_003604		107977403	-1	4	14	22	35	tier1	no_errors	ENST00000372129	ensembl	human	known	74_37	missense	15.38	28.57	SNP	0.100	C	4	22
MYH11	4629	genome.wustl.edu	37	16	15844065	15844065	+	Missense_Mutation	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr16:15844065T>C	ENST00000300036.5	-	16	2097	c.1988A>G	c.(1987-1989)aAg>aGg	p.K663R	MYH11_ENST00000576790.2_Missense_Mutation_p.K663R|MYH11_ENST00000396324.3_Missense_Mutation_p.K670R|MYH11_ENST00000452625.2_Missense_Mutation_p.K670R	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	663	Actin-binding. {ECO:0000250}.|Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGTCATCAGCTTGCCCAGCTG	0.637			T	CBFB	AML								ENSG00000133392																												Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													162.0	122.0	135.0					16																	15844065		2197	4300	6497	SO:0001583	missense	0			-	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1988A>G	16.37:g.15844065T>C	ENSP00000300036:p.Lys663Arg		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SRE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.K670R	ENST00000300036.5	37	c.2009	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	T	22.3	4.274725	0.80580	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	5.47	5.47	0.80525	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.82204	0.4986	L	0.31207	0.915	0.80722	D	1	B;B;B;B;B;B	0.15141	0.012;0.001;0.001;0.001;0.007;0.001	B;B;B;B;B;B	0.23852	0.049;0.033;0.033;0.033;0.033;0.02	T	0.79220	-0.1893	10	0.87932	D	0	.	14.7231	0.69323	0.0:0.0:0.0:1.0	.	670;663;663;670;663;670	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	R	663;663;670;670;670	ENSP00000300036:K663R;ENSP00000345136:K663R;ENSP00000379616:K670R;ENSP00000407821:K670R	ENSP00000300036:K663R	K	-	2	0	MYH11	15751566	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.078000	0.62432	0.459000	0.35465	AAG	-	MYH11	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.637	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	0	0	0	37	37	53	0.00	0.00	T	NM_001040113		15844065	-1	13	11	39	35	tier1	no_errors	ENST00000396324	ensembl	human	known	74_37	missense	25.00	23.91	SNP	1.000	C	13	39
OR11G2	390439	genome.wustl.edu	37	14	20665795	20665795	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr14:20665795C>T	ENST00000357366.3	+	1	301	c.301C>T	c.(301-303)Ctc>Ttc	p.L101F		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		GTACATCCTGCTCGCCAACTT	0.527													ENSG00000196832																																					0													117.0	95.0	102.0					14																	20665795		2203	4300	6503	SO:0001583	missense	0			-		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.301C>T	14.37:g.20665795C>T	ENSP00000349930:p.Leu101Phe		Q6IF09|Q96R33	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L101F	ENST00000357366.3	37	c.301	CCDS32032.1	14	.	.	.	.	.	.	.	.	.	.	c	16.36	3.102201	0.56183	.	.	ENSG00000196832	ENST00000357366	T	0.14391	2.51	4.67	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35870	U	0.002923	T	0.46132	0.1377	H	0.98980	4.39	0.27082	N	0.963065	P	0.51653	0.947	P	0.54431	0.752	T	0.58918	-0.7551	10	0.72032	D	0.01	.	11.8774	0.52554	0.0:0.899:0.0:0.101	.	101	Q8NGC1	O11G2_HUMAN	F	101	ENSP00000349930:L101F	ENSP00000349930:L101F	L	+	1	0	OR11G2	19735635	0.648000	0.27313	1.000000	0.80357	0.995000	0.86356	0.436000	0.21526	2.414000	0.81942	0.650000	0.86243	CTC	-	OR11G2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.527	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR11G2	HGNC	protein_coding	OTTHUMT00000395722.1	0	0	0	36	36	64	0.00	0.00	C			20665795	+1	22	16	26	10	tier1	no_errors	ENST00000357366	ensembl	human	known	74_37	missense	45.83	61.54	SNP	1.000	T	22	26
OR2M5	127059	genome.wustl.edu	37	1	248308470	248308470	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:248308470C>T	ENST00000366476.1	+	1	21	c.21C>T	c.(19-21)acC>acT	p.T7T		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			AGAATCAGACCTTCAACTCTG	0.433													ENSG00000162727																																					0													214.0	211.0	212.0					1																	248308470		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.21C>T	1.37:g.248308470C>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T7	ENST00000366476.1	37	c.21	CCDS31105.1	1																																																																																			-	OR2M5	-	NULL		0.433	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M5	HGNC	protein_coding	OTTHUMT00000097343.1	0	0	0	56	56	41	0.00	0.00	C	NM_001004690		248308470	+1	28	16	25	22	tier1	no_errors	ENST00000366476	ensembl	human	known	74_37	silent	52.83	41.03	SNP	0.000	T	28	25
MAP3K7	6885	genome.wustl.edu	37	6	91269900	91269900	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:91269900G>T	ENST00000369329.3	-	5	538	c.377C>A	c.(376-378)aCt>aAt	p.T126N	MAP3K7_ENST00000369332.3_Missense_Mutation_p.T126N|MAP3K7_ENST00000369327.3_Missense_Mutation_p.T126N|MAP3K7_ENST00000369325.3_Missense_Mutation_p.T126N	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	126	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		GTGGGCAGCAGTATAATATGG	0.433													ENSG00000135341																																					0													192.0	163.0	173.0					6																	91269900		2203	4300	6503	SO:0001583	missense	0			-	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.377C>A	6.37:g.91269900G>T	ENSP00000358335:p.Thr126Asn		B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T126N	ENST00000369329.3	37	c.377	CCDS5028.1	6	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699285	0.88830	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.25	5.25	0.73442	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.32675	0.0837	L	0.38175	1.15	0.80722	D	1	P;P;D;P	0.58970	0.855;0.855;0.984;0.881	P;P;P;P	0.55391	0.57;0.465;0.775;0.601	T	0.01452	-1.1351	10	0.19147	T	0.46	.	19.2089	0.93746	0.0:0.0:1.0:0.0	.	126;126;126;126	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	N	126	ENSP00000358338:T126N;ENSP00000358335:T126N;ENSP00000358331:T126N;ENSP00000358333:T126N	ENSP00000358331:T126N	T	-	2	0	MAP3K7	91326621	1.000000	0.71417	0.999000	0.59377	0.892000	0.51952	9.813000	0.99286	2.611000	0.88343	0.585000	0.79938	ACT	-	MAP3K7	-	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.433	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	HGNC	protein_coding	OTTHUMT00000041530.1	0	0	0	24	24	82	0.00	0.00	G	NM_145331		91269900	-1	5	32	26	107	tier1	no_errors	ENST00000369329	ensembl	human	known	74_37	missense	16.13	23.02	SNP	1.000	T	5	26
TTN	7273	genome.wustl.edu	37	2	179426447	179426447	+	Missense_Mutation	SNP	T	T	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:179426447T>G	ENST00000591111.1	-	276	79713	c.79489A>C	c.(79489-79491)Agc>Cgc	p.S26497R	TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S19073R|TTN_ENST00000359218.5_Missense_Mutation_p.S19198R|TTN_ENST00000342175.6_Missense_Mutation_p.S19265R|TTN_ENST00000342992.6_Missense_Mutation_p.S25570R|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S28138R|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26497	Fibronectin type-III 92. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTAGGAGCTCTTTCCATAG	0.448													ENSG00000155657																																					0													89.0	91.0	90.0					2																	179426447		1901	4116	6017	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.79489A>C	2.37:g.179426447T>G	ENSP00000465570:p.Ser26497Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S25570R	ENST00000591111.1	37	c.76708		2	.	.	.	.	.	.	.	.	.	.	T	14.39	2.522269	0.44866	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	6.1	6.1	0.99115	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84543	0.5495	H	0.97186	3.955	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.89663	0.3878	9	0.87932	D	0	.	16.686	0.85306	0.0:0.0:0.0:1.0	.	19073;19198;19265;26497	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	25570;19073;19265;19198;19071	ENSP00000343764:S25570R;ENSP00000434586:S19073R;ENSP00000340554:S19265R;ENSP00000352154:S19198R	ENSP00000340554:S19265R	S	-	1	0	TTN	179134693	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.040000	0.89188	2.340000	0.79590	0.528000	0.53228	AGC	-	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.448	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	16	16	115	0.00	0.00	T	NM_133378		179426447	-1	5	24	20	55	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	20.00	30.38	SNP	1.000	G	5	20
PRLHR	2834	genome.wustl.edu	37	10	120353729	120353729	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:120353729C>T	ENST00000369169.1	-	1	1027	c.1028G>A	c.(1027-1029)cGc>cAc	p.R343H	PRLHR_ENST00000239032.2_Missense_Mutation_p.R343H			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	343					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		CAGCTCCTCGCGGAAGCTGTC	0.612													ENSG00000119973																																					0													52.0	50.0	51.0					10																	120353729		2203	4300	6503	SO:0001583	missense	0			-	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.1028G>A	10.37:g.120353729C>T	ENSP00000358167:p.Arg343His		O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.R343H	ENST00000369169.1	37	c.1028	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442595	0.83993	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.70749	-0.51;-0.51	4.53	3.54	0.40534	.	0.000000	0.85682	D	0.000000	T	0.80486	0.4632	L	0.61218	1.895	0.48696	D	0.999693	D	0.89917	1.0	D	0.80764	0.994	T	0.82420	-0.0466	10	0.72032	D	0.01	.	13.0823	0.59121	0.0:0.9087:0.0:0.0913	.	343	P49683	PRLHR_HUMAN	H	343	ENSP00000239032:R343H;ENSP00000358167:R343H	ENSP00000239032:R343H	R	-	2	0	PRLHR	120343719	1.000000	0.71417	0.982000	0.44146	0.987000	0.75469	5.884000	0.69729	2.337000	0.79520	0.561000	0.74099	CGC	-	PRLHR	-	pfam_7TM_GPCR_olfarory/Srsx,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt		0.612	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	HGNC	protein_coding	OTTHUMT00000050610.1	0	0	0	27	27	34	0.00	0.00	C	NM_004248		120353729	-1	16	5	8	14	tier1	no_errors	ENST00000239032	ensembl	human	known	74_37	missense	66.67	26.32	SNP	0.994	T	16	8
ADORA2A	135	genome.wustl.edu	37	22	24827477	24827477	+	Intron	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:24827477G>C	ENST00000337539.7	+	2	185				SPECC1L-ADORA2A_ENST00000358654.2_Intron|ADORA2A_ENST00000496497.1_Intron|ADORA2A-AS1_ENST00000543438.1_RNA|ADORA2A-AS1_ENST00000326341.4_RNA	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	ACAGGGCTCAGGACCAGGAGT	0.572													ENSG00000178803																																					0																																										SO:0001627	intron_variant	0			-	X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.-274-1622G>C	22.37:g.24827477G>C			B2R7E0	R	SNP	-	NULL	ENST00000337539.7	37	NULL	CCDS13826.1	22	.	.	.	.	.	.	.	.	.	.	G	4.403	0.074424	0.08485	.	.	ENSG00000178803	ENST00000326341;ENST00000543438	.	.	.	2.59	1.18	0.20946	.	.	.	.	.	T	0.53158	0.1779	.	.	.	0.09310	N	1	D	0.65815	0.995	D	0.63877	0.919	T	0.38585	-0.9654	7	0.87932	D	0	.	3.9165	0.09225	0.3213:0.0:0.6787:0.0	.	15	P86434	CV045_HUMAN	R	15	.	ENSP00000426996:P15R	P	-	2	0	C22orf45	23157477	0.001000	0.12720	0.013000	0.15412	0.141000	0.21300	0.044000	0.13992	0.383000	0.24910	0.561000	0.74099	CCT	-	ADORA2A-AS1	-	-		0.572	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A-AS1	HGNC	protein_coding	OTTHUMT00000319971.2	0	0	0	31	31	104	0.00	0.00	G	NM_000675		24827477	-1	8	15	38	94	tier1	no_errors	ENST00000326341	ensembl	human	known	74_37	rna	17.39	13.64	SNP	0.013	C	8	38
IL2RB	3560	genome.wustl.edu	37	22	37532384	37532384	+	Missense_Mutation	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:37532384T>C	ENST00000216223.5	-	7	785	c.587A>G	c.(586-588)gAg>gGg	p.E196G	AL022314.1_ENST00000516333.1_RNA	NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	196	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GGTGAGCGTCTCCAGGCAGAT	0.642													ENSG00000100385																																					0													36.0	37.0	37.0					22																	37532384		2203	4300	6503	SO:0001583	missense	0			-	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.587A>G	22.37:g.37532384T>C	ENSP00000216223:p.Glu196Gly		B2R765	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E196G	ENST00000216223.5	37	c.587	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	T	15.65	2.896063	0.52121	.	.	ENSG00000100385	ENST00000216223	D	0.96992	-4.2	4.74	3.65	0.41850	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.525534	0.20502	N	0.091061	D	0.96806	0.8957	M	0.68593	2.085	0.23693	N	0.997093	D	0.76494	0.999	D	0.68943	0.961	D	0.91083	0.4901	10	0.27082	T	0.32	-19.6258	9.2851	0.37753	0.0:0.0:0.1805:0.8195	.	196	P14784	IL2RB_HUMAN	G	196	ENSP00000216223:E196G	ENSP00000216223:E196G	E	-	2	0	IL2RB	35862330	0.988000	0.35896	0.990000	0.47175	0.315000	0.28087	2.286000	0.43496	1.756000	0.51951	0.379000	0.24179	GAG	-	IL2RB	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	HGNC	protein_coding	OTTHUMT00000318792.1	0	0	0	48	48	48	0.00	0.00	T			37532384	-1	12	13	73	39	tier1	no_errors	ENST00000216223	ensembl	human	known	74_37	missense	14.12	25.00	SNP	0.432	C	12	73
UGT1A6	54578	genome.wustl.edu	37	2	234681041	234681041	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:234681041G>A	ENST00000305139.6	+	5	1574	c.1435G>A	c.(1435-1437)Gac>Aac	p.D479N	UGT1A9_ENST00000354728.4_Missense_Mutation_p.D477N|UGT1A1_ENST00000609637.1_Missense_Mutation_p.D477N|UGT1A6_ENST00000373424.1_Missense_Mutation_p.D212N|UGT1A1_ENST00000609767.1_Missense_Mutation_p.D481N|UGT1A8_ENST00000305208.5_Missense_Mutation_p.D480N|UGT1A1_ENST00000608381.1_Missense_Mutation_p.D481N|UGT1A3_ENST00000482026.1_Missense_Mutation_p.D481N|UGT1A5_ENST00000373414.3_Missense_Mutation_p.D481N|UGT1A7_ENST00000373426.3_Missense_Mutation_p.D477N|UGT1A1_ENST00000373450.4_Missense_Mutation_p.D477N|UGT1A4_ENST00000373409.3_Missense_Mutation_p.D481N|UGT1A10_ENST00000344644.5_Missense_Mutation_p.D477N|UGT1A1_ENST00000608383.1_Missense_Mutation_p.D480N	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	479					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	CGCAGCCCACGACCTCACCTG	0.597													ENSG00000244474																																					0													155.0	128.0	137.0					2																	234681041		2203	4300	6503	SO:0001583	missense	0			-	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.1435G>A	2.37:g.234681041G>A	ENSP00000303174:p.Asp479Asn		A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D481N	ENST00000305139.6	37	c.1441	CCDS2507.1	2	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701229	0.88924	.	.	ENSG00000242366;ENSG00000242515;ENSG00000241119;ENSG00000244122;ENSG00000167165;ENSG00000167165;ENSG00000240224;ENSG00000244474;ENSG00000243135;ENSG00000241635	ENST00000373450;ENST00000344644;ENST00000354728;ENST00000373426;ENST00000373424;ENST00000305139;ENST00000373414;ENST00000373409;ENST00000482026;ENST00000305208	T;T;T;T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.83	4.95	0.65309	.	0.103647	0.64402	D	0.000005	T	0.76040	0.3932	L	0.60067	1.865	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D;D	0.97110	0.988;0.98;0.999;1.0;0.997;0.991;0.999;0.999;0.938	T	0.75578	-0.3269	10	0.38643	T	0.18	.	16.9581	0.86265	0.0:0.1277:0.8723:0.0	.	480;481;481;481;479;477;477;477;477	P22309;P35503;P22310;P35504;P19224;Q9HAW7;O60656;Q9HAW8;Q9HAW9	UD11_HUMAN;UD13_HUMAN;UD14_HUMAN;UD15_HUMAN;UD16_HUMAN;UD17_HUMAN;UD19_HUMAN;UD110_HUMAN;UD18_HUMAN	N	477;477;477;477;212;479;481;481;481;480	ENSP00000362549:D477N;ENSP00000343838:D477N;ENSP00000346768:D477N;ENSP00000362525:D477N;ENSP00000362523:D212N;ENSP00000303174:D479N;ENSP00000362513:D481N;ENSP00000362508:D481N;ENSP00000418532:D481N;ENSP00000304845:D480N	ENSP00000343838:D477N	D	+	1	0	UGT1A7;UGT1A6;UGT1A10;UGT1A9;UGT1A8;UGT1A3;UGT1A5;UGT1A4;UGT1A1	234345780	1.000000	0.71417	0.972000	0.41901	0.982000	0.71751	3.779000	0.55379	1.451000	0.47736	0.655000	0.94253	GAC	-	UGT1A4	-	pfam_UDP_glucos_trans		0.597	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A4	HGNC	protein_coding	OTTHUMT00000130988.1	0	0	0	27	27	56	0.00	0.00	G	NM_205862		234681041	+1	11	17	19	20	tier1	no_errors	ENST00000373409	ensembl	human	known	74_37	missense	35.48	45.95	SNP	0.991	A	11	19
BEST4	266675	genome.wustl.edu	37	1	45250616	45250616	+	Silent	SNP	G	G	A	rs369088764		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:45250616G>A	ENST00000372207.3	-	7	953	c.954C>T	c.(952-954)gaC>gaT	p.D318D		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	318						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					TCTCAAAGTCGTCATCATCCT	0.537													ENSG00000142959																																					0								G		0,4406		0,0,2203	77.0	80.0	79.0		954	-6.1	0.8	1		79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BEST4	NM_153274.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		318/474	45250616	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.954C>T	1.37:g.45250616G>A			Q5JR93	Silent	SNP	pfam_Bestrophin/UPF0187	p.D318	ENST00000372207.3	37	c.954	CCDS514.1	1																																																																																			-	BEST4	-	pfam_Bestrophin/UPF0187		0.537	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST4	HGNC	protein_coding	OTTHUMT00000023425.1	0	0	0	18	18	67	0.00	0.00	G	NM_153274		45250616	-1	8	15	28	39	tier1	no_errors	ENST00000372207	ensembl	human	known	74_37	silent	22.22	27.78	SNP	0.919	A	8	28
GPT2	84706	genome.wustl.edu	37	16	46943701	46943701	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr16:46943701G>A	ENST00000340124.4	+	6	794	c.682G>A	c.(682-684)Gcc>Acc	p.A228T	GPT2_ENST00000440783.2_Missense_Mutation_p.A128T	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	228					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	TGAGCTCGACGCCATCCAGGT	0.582													ENSG00000166123																																					0													90.0	85.0	86.0					16																	46943701		2203	4300	6503	SO:0001583	missense	0			-		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.682G>A	16.37:g.46943701G>A	ENSP00000345282:p.Ala228Thr		Q8N9E2	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.A228T	ENST00000340124.4	37	c.682	CCDS10725.1	16	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865021	0.91511	.	.	ENSG00000166123	ENST00000340124;ENST00000440783	T;D	0.91237	1.98;-2.81	5.15	5.15	0.70609	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.95357	0.8493	M	0.90483	3.12	0.80722	D	1	D	0.65815	0.995	P	0.56612	0.802	D	0.95663	0.8717	10	0.56958	D	0.05	.	18.8172	0.92081	0.0:0.0:1.0:0.0	.	228	Q8TD30	ALAT2_HUMAN	T	228;128	ENSP00000345282:A228T;ENSP00000413804:A128T	ENSP00000345282:A228T	A	+	1	0	GPT2	45501202	1.000000	0.71417	0.805000	0.32314	0.937000	0.57800	9.137000	0.94496	2.677000	0.91161	0.561000	0.74099	GCC	-	GPT2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.582	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT2	HGNC	protein_coding	OTTHUMT00000255741.2	0	0	0	31	31	97	0.00	0.00	G			46943701	+1	10	20	15	14	tier1	no_errors	ENST00000340124	ensembl	human	known	74_37	missense	40.00	58.82	SNP	1.000	A	10	15
MYOCD	93649	genome.wustl.edu	37	17	12626248	12626248	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:12626248C>T	ENST00000343344.4	+	5	338	c.338C>T	c.(337-339)gCt>gTt	p.A113V	MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_Missense_Mutation_p.A17V|MYOCD_ENST00000425538.1_Missense_Mutation_p.A113V			Q8IZQ8	MYCD_HUMAN	myocardin	113					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GAAAAAATTGCTCTACGACCA	0.463													ENSG00000141052																																					0													136.0	140.0	139.0					17																	12626248		2203	4300	6503	SO:0001583	missense	0			-	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.338C>T	17.37:g.12626248C>T	ENSP00000341835:p.Ala113Val		Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.A113V	ENST00000343344.4	37	c.338	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	C	20.4	3.991945	0.74703	.	.	ENSG00000141052	ENST00000425538;ENST00000343344;ENST00000395988	T	0.52295	0.67	5.46	5.46	0.80206	.	0.190106	0.44902	D	0.000411	T	0.54143	0.1840	M	0.81942	2.565	0.80722	D	1	B;B;B	0.34103	0.437;0.314;0.301	B;B;B	0.32583	0.148;0.029;0.054	T	0.60762	-0.7199	10	0.72032	D	0.01	-22.9684	18.2528	0.90009	0.0:1.0:0.0:0.0	.	17;113;113	Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	V	113;113;17	ENSP00000341835:A113V	ENSP00000341835:A113V	A	+	2	0	MYOCD	12566973	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.823000	0.69272	2.840000	0.97914	0.655000	0.94253	GCT	-	MYOCD	-	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat		0.463	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1	0	0	0	14	14	118	0.00	0.00	C	NM_153604		12626248	+1	45	118	31	109	tier1	no_errors	ENST00000425538	ensembl	human	known	74_37	missense	59.21	51.98	SNP	1.000	T	45	31
COL4A1	1282	genome.wustl.edu	37	13	110839583	110839583	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:110839583C>A	ENST00000375820.4	-	25	1751	c.1630G>T	c.(1630-1632)Gga>Tga	p.G544*		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	544	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCTGGGTCTCCTTTGTCACCT	0.612													ENSG00000187498																																					0													68.0	70.0	69.0					13																	110839583		2203	4300	6503	SO:0001587	stop_gained	0			-	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1630G>T	13.37:g.110839583C>A	ENSP00000364979:p.Gly544*		A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G544*	ENST00000375820.4	37	c.1630	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	C	40	8.400451	0.98794	.	.	ENSG00000187498	ENST00000375820	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9388	0.89021	0.0:1.0:0.0:0.0	.	.	.	.	X	544	.	ENSP00000364979:G544X	G	-	1	0	COL4A1	109637584	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.119000	0.77145	2.308000	0.77769	0.563000	0.77884	GGA	-	COL4A1	-	pfam_Collagen		0.612	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	HGNC	protein_coding	OTTHUMT00000045759.3	0	0	0	23	23	139	0.00	0.00	C			110839583	-1	7	24	38	129	tier1	no_errors	ENST00000375820	ensembl	human	known	74_37	nonsense	15.56	15.58	SNP	1.000	A	7	38
AMY2B	280	genome.wustl.edu	37	1	104115688	104115688	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:104115688C>T	ENST00000361355.4	+	5	935	c.319C>T	c.(319-321)Cgt>Tgt	p.R107C	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	107					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TTTCTAGGTTCGTATTTATGT	0.363													ENSG00000240038																																					0													357.0	349.0	352.0					1																	104115688		2203	4300	6503	SO:0001583	missense	0			-	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.319C>T	1.37:g.104115688C>T	ENSP00000354610:p.Arg107Cys		B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.R107C	ENST00000361355.4	37	c.319	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.702392	0.48307	.	.	ENSG00000240038	ENST00000361355	D	0.98493	-4.96	4.58	3.62	0.41486	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.465814	0.25590	N	0.029626	D	0.98880	0.9621	H	0.96015	3.755	0.23070	N	0.998348	D	0.89917	1.0	D	0.71656	0.974	D	0.95215	0.8329	10	0.87932	D	0	.	8.1505	0.31137	0.2716:0.6505:0.0:0.078	.	107	P19961	AMY2B_HUMAN	C	107	ENSP00000354610:R107C	ENSP00000354610:R107C	R	+	1	0	AMY2B	103917211	0.002000	0.14202	0.928000	0.36995	0.677000	0.39632	1.495000	0.35627	2.104000	0.64026	0.644000	0.83932	CGT	-	AMY2B	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,prints_Alpha_amylase		0.363	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	0	0	0	110	110	35	0.00	0.00	C	NM_020978		104115688	+1	37	7	97	17	tier1	no_errors	ENST00000361355	ensembl	human	known	74_37	missense	27.61	29.17	SNP	0.095	T	37	97
TAAR6	319100	genome.wustl.edu	37	6	132892363	132892363	+	Silent	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:132892363T>C	ENST00000275198.1	+	1	903	c.903T>C	c.(901-903)taT>taC	p.Y301Y		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	301					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		GGTGTGCTTATTATAACTCAG	0.333													ENSG00000146383																																					0													116.0	118.0	117.0					6																	132892363		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.903T>C	6.37:g.132892363T>C			Q5VUQ4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_TAAR_fam	p.Y301	ENST00000275198.1	37	c.903	CCDS5155.1	6																																																																																			-	TAAR6	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.333	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR6	HGNC	protein_coding	OTTHUMT00000042255.1	0	0	0	37	37	100	0.00	0.00	T	NM_175067		132892363	+1	50	61	37	53	tier1	no_errors	ENST00000275198	ensembl	human	known	74_37	silent	57.47	53.51	SNP	0.992	C	50	37
MYO16	23026	genome.wustl.edu	37	13	109858995	109858995	+	Silent	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:109858995G>T	ENST00000357550.2	+	34	5429	c.5388G>T	c.(5386-5388)gtG>gtT	p.V1796V	MYO16_ENST00000356711.2_Silent_p.V1796V	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ATGAAAGTGTGGCCCTGCAGG	0.532													ENSG00000041515																																					0													82.0	78.0	79.0					13																	109858995		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.5388G>T	13.37:g.109858995G>T				Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1796	ENST00000357550.2	37	c.5388	CCDS32008.1	13																																																																																			-	MYO16	-	NULL		0.532	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	0	0	0	24	24	52	0.00	0.00	G	NM_015011		109858995	+1	24	47	17	17	tier1	no_errors	ENST00000356711	ensembl	human	known	74_37	silent	58.54	73.44	SNP	0.979	T	24	17
LINS	55180	genome.wustl.edu	37	15	101113917	101113917	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:101113917T>A	ENST00000314742.8	-	5	1383	c.1161A>T	c.(1159-1161)ttA>ttT	p.L387F	LINS_ENST00000559149.1_5'UTR|LINS_ENST00000560133.1_Missense_Mutation_p.L268F|LINS_ENST00000561308.1_Missense_Mutation_p.L387F	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	387										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						TCATTATAACTAAGCTTGCTG	0.338													ENSG00000140471																																					0													71.0	68.0	69.0					15																	101113917		2203	4300	6503	SO:0001583	missense	0			-	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1161A>T	15.37:g.101113917T>A	ENSP00000318423:p.Leu387Phe		Q96FW2|Q9NVQ3	Missense_Mutation	SNP	NULL	p.L387F	ENST00000314742.8	37	c.1161	CCDS10385.1	15	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396480	0.62177	.	.	ENSG00000140471	ENST00000314742	T	0.38401	1.14	6.07	-1.06	0.10002	.	0.000000	0.64402	D	0.000002	T	0.49236	0.1545	M	0.77103	2.36	0.22446	N	0.999096	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.39375	-0.9617	10	0.87932	D	0	-10.3722	1.4943	0.02463	0.1263:0.3047:0.2574:0.3116	.	268;387;387	B4DQT3;Q8NG48-2;Q8NG48	.;.;LINES_HUMAN	F	387	ENSP00000318423:L387F	ENSP00000318423:L387F	L	-	3	2	LINS	98931440	0.014000	0.17966	0.020000	0.16555	0.971000	0.66376	-0.399000	0.07250	-0.082000	0.12640	-0.250000	0.11733	TTA	-	LINS	-	NULL		0.338	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINS	HGNC	protein_coding	OTTHUMT00000313592.1	0	0	0	24	24	91	0.00	0.00	T	NM_018148		101113917	-1	22	27	38	86	tier1	no_errors	ENST00000314742	ensembl	human	known	74_37	missense	36.67	23.89	SNP	0.313	A	22	38
TNIK	23043	genome.wustl.edu	37	3	170841407	170841407	+	Missense_Mutation	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:170841407C>G	ENST00000436636.2	-	18	2442	c.2098G>C	c.(2098-2100)Gga>Cga	p.G700R	TNIK_ENST00000538048.1_Missense_Mutation_p.G645R|TNIK_ENST00000369326.5_Missense_Mutation_p.G671R|TNIK_ENST00000475336.1_Missense_Mutation_p.G616R|TNIK_ENST00000341852.6_Missense_Mutation_p.G616R|TNIK_ENST00000460047.1_Missense_Mutation_p.G645R|TNIK_ENST00000488470.1_Missense_Mutation_p.G645R|TNIK_ENST00000284483.8_Missense_Mutation_p.G700R|TNIK_ENST00000357327.5_Missense_Mutation_p.G671R|TNIK_ENST00000470834.1_Missense_Mutation_p.G671R	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	700	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GGTTGAGATCCTAGTCTGGGT	0.448													ENSG00000154310																																					0													115.0	102.0	106.0					3																	170841407		1860	4097	5957	SO:0001583	missense	0			-	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.2098G>C	3.37:g.170841407C>G	ENSP00000399511:p.Gly700Arg		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.G700R	ENST00000436636.2	37	c.2098	CCDS46956.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.130126	0.94473	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.73047	-0.7;-0.67;-0.69;-0.71;-0.7;-0.69;-0.68;-0.71;-0.7;-0.69	6.17	6.17	0.99709	.	0.055823	0.64402	D	0.000001	T	0.78489	0.4291	L	0.33485	1.01	0.80722	D	1	P;D;P;P;D;D;P;D	0.61697	0.846;0.978;0.846;0.846;0.99;0.99;0.846;0.983	P;D;P;P;D;D;P;P	0.66847	0.714;0.923;0.714;0.714;0.947;0.923;0.714;0.84	T	0.75431	-0.3320	10	0.41790	T	0.15	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	616;671;645;616;700;671;645;700	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	R	700;671;645;616;700;616;671;645;645;671	ENSP00000399511:G700R;ENSP00000358332:G671R;ENSP00000443278:G645R;ENSP00000345352:G616R;ENSP00000284483:G700R;ENSP00000418156:G616R;ENSP00000349880:G671R;ENSP00000418916:G645R;ENSP00000418378:G645R;ENSP00000419990:G671R	ENSP00000284483:G700R	G	-	1	0	TNIK	172324101	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.206000	0.77891	2.941000	0.99782	0.655000	0.94253	GGA	-	TNIK	-	NULL		0.448	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	HGNC	protein_coding	OTTHUMT00000352973.2	0	0	0	64	64	121	0.00	0.00	C	XM_039796		170841407	-1	22	51	40	50	tier1	no_errors	ENST00000436636	ensembl	human	known	74_37	missense	35.48	50.50	SNP	1.000	G	22	40
CRLF3	51379	genome.wustl.edu	37	17	29119617	29119617	+	Intron	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:29119617C>G	ENST00000324238.6	-	6	951				CTD-2349P21.9_ENST00000580085.1_lincRNA|CRLF3_ENST00000577725.1_Intron|CRLF3_ENST00000544695.1_Intron	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3						G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				ATATTGAAAACTGTTAGAATC	0.383													ENSG00000266490																									Pancreas(30;346 881 29244 33464 41299)												0													81.0	81.0	81.0					17																	29119617		2203	4300	6503	SO:0001627	intron_variant	0			-	AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.827-27G>C	17.37:g.29119617C>G			A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	R	SNP	-	NULL	ENST00000324238.6	37	NULL	CCDS32607.1	17																																																																																			-	CTD-2349P21.9	-	-		0.383	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266490	Clone_based_vega_gene	protein_coding	OTTHUMT00000444354.1	0	0	0	27	27	111	0.00	0.00	C			29119617	+1	14	22	83	182	tier1	no_errors	ENST00000580085	ensembl	human	known	74_37	rna	14.43	10.78	SNP	0.005	G	14	83
TXNRD1	7296	genome.wustl.edu	37	12	104720164	104720164	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr12:104720164A>T	ENST00000529546.1	+	9	1009	c.784A>T	c.(784-786)Att>Ttt	p.I262F	TXNRD1_ENST00000542918.1_Missense_Mutation_p.I350F|TXNRD1_ENST00000540716.1_Missense_Mutation_p.I262F|TXNRD1_ENST00000503506.2_Missense_Mutation_p.I300F|TXNRD1_ENST00000429002.2_Missense_Mutation_p.I450F|TXNRD1_ENST00000526691.1_Missense_Mutation_p.I352F|TXNRD1_ENST00000397736.2_Missense_Mutation_p.I344F|TXNRD1_ENST00000526390.1_Missense_Mutation_p.I344F|TXNRD1_ENST00000427956.1_Missense_Mutation_p.I415F|TXNRD1_ENST00000354940.6_Missense_Mutation_p.I300F|TXNRD1_ENST00000525566.1_Missense_Mutation_p.I450F|TXNRD1_ENST00000526950.1_Missense_Mutation_p.I369F|TXNRD1_ENST00000524698.1_Missense_Mutation_p.I300F|TXNRD1_ENST00000378070.4_Missense_Mutation_p.I399F|TXNRD1_ENST00000388854.3_Missense_Mutation_p.I352F			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	450					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	CACAAGAAAAATTGGCTTAGA	0.274													ENSG00000198431																									Ovarian(139;555 1836 9186 9946 10884)												0													33.0	34.0	34.0					12																	104720164		1797	4057	5854	SO:0001583	missense	0			-		CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.784A>T	12.37:g.104720164A>T	ENSP00000434919:p.Ile262Phe		B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/D,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_D-bd_dom,pfam_FAD_bind_dom,pfam_Glutaredoxin,superfamily_FAD/D-linked_Rdtase_dimer,superfamily_Thioredoxin-like_fold,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Thioredoxin/glutathione_Rdtase	p.I450F	ENST00000529546.1	37	c.1348	CCDS58274.1	12	.	.	.	.	.	.	.	.	.	.	A	23.8	4.456516	0.84317	.	.	ENSG00000198431	ENST00000525566;ENST00000429002;ENST00000503506;ENST00000526691;ENST00000388854;ENST00000354940;ENST00000526390;ENST00000529546;ENST00000529751;ENST00000540716;ENST00000524698;ENST00000542918;ENST00000378070;ENST00000397736;ENST00000427956;ENST00000526950	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;0.88;0.94;0.88;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.93	3.49	0.39957	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.090690	0.85682	D	0.000000	T	0.80237	0.4586	M	0.83953	2.67	0.58432	D	0.999992	D;B;D;P;P;D;P	0.59767	0.962;0.241;0.986;0.907;0.73;0.972;0.476	P;B;P;P;P;P;B	0.62184	0.782;0.284;0.899;0.576;0.702;0.854;0.41	T	0.81697	-0.0815	10	0.72032	D	0.01	-18.5887	12.9921	0.58625	0.7458:0.2542:0.0:0.0	.	350;344;450;352;300;450;415	B7Z2S5;E2QRB9;B7Z904;Q16881-4;B2R5P6;Q16881;E7EW10	.;.;.;.;.;TRXR1_HUMAN;.	F	450;450;300;352;352;300;344;262;13;262;300;350;399;344;415;369	ENSP00000434516:I450F;ENSP00000412045:I450F;ENSP00000421934:I300F;ENSP00000435929:I352F;ENSP00000373506:I352F;ENSP00000347020:I300F;ENSP00000435123:I344F;ENSP00000434919:I262F;ENSP00000432273:I13F;ENSP00000442709:I262F;ENSP00000433425:I300F;ENSP00000440978:I350F;ENSP00000367310:I399F;ENSP00000380844:I344F;ENSP00000393328:I415F;ENSP00000432812:I369F	ENSP00000347020:I300F	I	+	1	0	TXNRD1	103244294	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	2.975000	0.49281	0.455000	0.26910	0.514000	0.50259	ATT	-	TXNRD1	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/D,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Thioredoxin/glutathione_Rdtase		0.274	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	TXNRD1	HGNC	protein_coding	OTTHUMT00000389969.1	0	0	0	63	63	66	0.00	0.00	A	NM_003330		104720164	+1	43	11	67	40	tier1	no_errors	ENST00000429002	ensembl	human	known	74_37	missense	39.09	21.57	SNP	1.000	T	43	67
LRCH2	57631	genome.wustl.edu	37	X	114347861	114347861	+	Missense_Mutation	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:114347861C>G	ENST00000317135.8	-	21	2246	c.2216G>C	c.(2215-2217)cGa>cCa	p.R739P	LRCH2_ENST00000538422.1_Missense_Mutation_p.R722P	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	739	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.									breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						CACAAGTCCTCGTTCTTCCAA	0.343													ENSG00000130224																																					0													62.0	55.0	57.0					X																	114347861		1834	4069	5903	SO:0001583	missense	0			-	AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.2216G>C	X.37:g.114347861C>G	ENSP00000325091:p.Arg739Pro		F5H2T1|Q08AD5|Q9HA88|Q9P233	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,superfamily_-bd_OB-fold,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.R739P	ENST00000317135.8	37	c.2216	CCDS48155.1	X	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715854	0.68844	.	.	ENSG00000130224	ENST00000317135;ENST00000536655;ENST00000538422	D;D	0.94650	-3.48;-3.48	5.52	5.52	0.82312	Calponin homology domain (5);	.	.	.	.	D	0.97636	0.9225	M	0.88105	2.93	0.54753	D	0.999986	D;D	0.76494	0.999;0.983	D;P	0.87578	0.998;0.854	D	0.98368	1.0552	9	0.66056	D	0.02	2.7416	16.8514	0.85995	0.0:1.0:0.0:0.0	.	739;722	Q5VUJ6;F5H2T1	LRCH2_HUMAN;.	P	739;218;722	ENSP00000325091:R739P;ENSP00000439366:R722P	ENSP00000325091:R739P	R	-	2	0	LRCH2	114254117	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.118000	0.77137	2.291000	0.77112	0.600000	0.82982	CGA	-	LRCH2	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.343	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	HGNC	protein_coding	OTTHUMT00000057971.2	0	0	0	71	71	130	0.00	0.00	C	NM_020871		114347861	-1	36	26	30	30	tier1	no_errors	ENST00000317135	ensembl	human	known	74_37	missense	54.55	46.43	SNP	1.000	G	36	30
DAOA	267012	genome.wustl.edu	37	13	106119431	106119431	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:106119431T>A	ENST00000375936.3	+	2	120	c.74T>A	c.(73-75)tTc>tAc	p.F25Y	DAOA_ENST00000329625.5_5'UTR|DAOA-AS1_ENST00000448407.1_RNA	NM_001161812.1|NM_172370.3	NP_001155284.1|NP_758958.3	P59103	DAOA_HUMAN	D-amino acid oxidase activator	25					negative regulation of D-amino-acid oxidase activity (GO:1900758)|positive regulation of catalytic activity (GO:0043085)	Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	13	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					AAAATCTACTTCATAGGTTTT	0.303													ENSG00000182346																																					0													77.0	75.0	75.0					13																	106119431		1791	4061	5852	SO:0001583	missense	0			-	AY138547	CCDS41905.1, CCDS53880.1, CCDS59242.1	13q33.2	2011-08-01			ENSG00000182346	ENSG00000182346			21191	protein-coding gene	gene with protein product	"""G72 transcript"""	607408				12364586, 15057823	Standard	NM_001161814		Approved	G72	uc010tjg.2	P59103	OTTHUMG00000041333	ENST00000375936.3:c.74T>A	13.37:g.106119431T>A	ENSP00000365103:p.Phe25Tyr		A6NKG7|Q0VAE6|Q5VX59|Q86Y17|Q8IWM4	Missense_Mutation	SNP	NULL	p.F25Y	ENST00000375936.3	37	c.74	CCDS41905.1	13	.	.	.	.	.	.	.	.	.	.	T	13.94	2.388156	0.42308	.	.	ENSG00000182346	ENST00000375936	T	0.28666	1.6	3.06	1.88	0.25563	.	.	.	.	.	T	0.32194	0.0821	N	0.19112	0.55	0.09310	N	0.999997	D	0.76494	0.999	D	0.63703	0.917	T	0.09443	-1.0674	9	0.87932	D	0	.	4.9067	0.13802	0.0:0.1429:0.0:0.8571	.	25	P59103	DAOA_HUMAN	Y	25	ENSP00000365103:F25Y	ENSP00000365103:F25Y	F	+	2	0	DAOA	104917432	0.002000	0.14202	0.006000	0.13384	0.577000	0.36160	0.472000	0.22116	0.577000	0.29470	0.528000	0.53228	TTC	-	DAOA	-	NULL		0.303	DAOA-005	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DAOA	HGNC	protein_coding	OTTHUMT00000099040.2	0	0	0	23	23	81	0.00	0.00	T	NM_172370		106119431	+1	11	41	15	28	tier1	no_errors	ENST00000375936	ensembl	human	known	74_37	missense	42.31	59.42	SNP	0.007	A	11	15
FER1L6	654463	genome.wustl.edu	37	8	124987395	124987395	+	Nonsense_Mutation	SNP	C	C	T	rs369182988		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr8:124987395C>T	ENST00000522917.1	+	8	738	c.532C>T	c.(532-534)Cag>Tag	p.Q178*	FER1L6_ENST00000399018.1_Nonsense_Mutation_p.Q178*	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	178						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CACAGGTCATCAGTTCTGCAA	0.572													ENSG00000214814																																					0								C	stop/GLN	1,4031		0,1,2015	89.0	87.0	88.0		532	5.5	1.0	8		88	0,8364		0,0,4182	no	stop-gained	FER1L6	NM_001039112.2		0,1,6197	TT,TC,CC		0.0,0.0248,0.0081		178/1858	124987395	1,12395	2016	4182	6198	SO:0001587	stop_gained	0			-	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.532C>T	8.37:g.124987395C>T	ENSP00000428280:p.Gln178*			Nonsense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.Q178*	ENST00000522917.1	37	c.532	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	C	40	8.337320	0.98767	2.48E-4	0.0	ENSG00000214814	ENST00000522917;ENST00000399018	.	.	.	5.5	5.5	0.81552	.	0.083449	0.49305	U	0.000146	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	19.7571	0.96298	0.0:1.0:0.0:0.0	.	.	.	.	X	178	.	ENSP00000381982:Q178X	Q	+	1	0	FER1L6	125056576	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.776000	0.85560	2.758000	0.94735	0.561000	0.74099	CAG	-	FER1L6	-	pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom		0.572	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	0	0	0	30	30	94	0.00	0.00	C	NM_001039112		124987395	+1	8	18	46	98	tier1	no_errors	ENST00000399018	ensembl	human	known	74_37	nonsense	14.81	15.52	SNP	1.000	T	8	46
CD68	968	genome.wustl.edu	37	17	7482543	7482544	+	5'Flank	DEL	AA	AA	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	AA	AA	AA	-	AA	AA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:7482543_7482544delAA	ENST00000250092.6	+	0	0				AC113189.5_ENST00000415124.1_RNA|SNORA67_ENST00000384423.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|SNORD10_ENST00000459579.1_RNA|AC113189.5_ENST00000417897.1_RNA|CD68_ENST00000380498.6_5'Flank|AC113189.5_ENST00000572046.1_RNA	NM_001251.2	NP_001242.2	P34810	CD68_HUMAN	CD68 molecule						cellular response to organic substance (GO:0071310)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|lung(1)|skin(1)	3						GGATGGTCACAAGCCCCTCACA	0.574													ENSG00000264772																																					0																																										SO:0001631	upstream_gene_variant	0				S57235	CCDS11114.1, CCDS58512.1	17p13	2011-11-24	2006-03-28		ENSG00000129226	ENSG00000129226		"""CD molecules"""	1693	protein-coding gene	gene with protein product	"""scavenger receptor class D, member 1"", ""CD68 antigen"", ""macrophage antigen CD68"""	153634	"""CD68 antigen"""			9790779	Standard	NM_001251		Approved	SCARD1, macrosialin, GP110, DKFZp686M18236, LAMP4	uc002ghv.3	P34810	OTTHUMG00000108146		17.37:g.7482543_7482544delAA	Exception_encountered		B4DVT4|Q53HR6|Q53XI3|Q96BI7	R	DEL	-	NULL	ENST00000250092.6	37	NULL	CCDS11114.1	17																																																																																				SNORA67	-	-		0.574	CD68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA67	HGNC	protein_coding	OTTHUMT00000226949.3	0	0	0	8	8	93	0.00	0.00	AA	NM_001251		7482544	+1	6	16	7	61	tier1	no_errors	ENST00000581621	ensembl	human	known	74_37	rna	46.15	20.78	DEL	0.000:0.000	-	6	7
PPP1R3A	5506	genome.wustl.edu	37	7	113518852	113518852	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:113518852delG	ENST00000284601.3	-	4	2363	c.2295delC	c.(2293-2295)cccfs	p.P765fs		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	765					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTACCTCGATGGGCCTGTCAC	0.403													ENSG00000154415																																					0													126.0	111.0	116.0					7																	113518852		2203	4299	6502	SO:0001589	frameshift_variant	0				AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2295delC	7.37:g.113518852delG	ENSP00000284601:p.Pro765fs		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Frame_Shift_Del	DEL	pfam_CBM_21,pfscan_CBM_21	p.I766fs	ENST00000284601.3	37	c.2295	CCDS5759.1	7																																																																																				PPP1R3A	-	NULL		0.403	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	0	0	0	16	16	97	0.00	0.00	G	NM_002711		113518852	-1	6	24	26	66	tier1	no_errors	ENST00000284601	ensembl	human	known	74_37	frame_shift_del	18.75	26.67	DEL	1.000	-	6	26
FAM133B	257415	genome.wustl.edu	37	7	92207637	92207638	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:92207637_92207638insT	ENST00000445716.1	-	4	373_374	c.271_272insA	c.(271-273)agafs	p.R91fs	FAM133B_ENST00000438306.1_Frame_Shift_Ins_p.R81fs|FAM133B_ENST00000427372.1_Frame_Shift_Ins_p.R81fs	NM_152789.2	NP_690002.2	Q5BKY9	F133B_HUMAN	family with sequence similarity 133, member B	91	Lys-rich.|Ser-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|ovary(1)|upper_aerodigestive_tract(1)	4	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TATTACCTGTCTTTTTTTGGAT	0.342													ENSG00000234545																																					0																																										SO:0001589	frameshift_variant	0					CCDS47640.1, CCDS47641.1	7q21.2	2014-02-12	2007-04-26		ENSG00000234545	ENSG00000234545			28629	protein-coding gene	gene with protein product						12477932	Standard	NM_152789		Approved	MGC40405	uc003umc.3	Q5BKY9	OTTHUMG00000155863	ENST00000445716.1:c.272dupA	7.37:g.92207644_92207644dupT	ENSP00000398401:p.Arg91fs		B2R994|Q05D67|Q6P5S6|Q8N0W8	Frame_Shift_Ins	INS	NULL	p.R91fs	ENST00000445716.1	37	c.272_271	CCDS47640.1	7																																																																																				FAM133B	-	NULL		0.342	FAM133B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM133B	HGNC	protein_coding	OTTHUMT00000342181.2	0	0	1	46	46	67	0.00	1.47	-	NM_001040057		92207638	-1	17	9	51	34	tier1	no_errors	ENST00000445716	ensembl	human	known	74_37	frame_shift_ins	25.00	20.93	INS	1.000:1.000	T	17	51
CACNA1B	774	genome.wustl.edu	37	9	140941368	140941368	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:140941368C>T	ENST00000371372.1	+	22	3571	c.3426C>T	c.(3424-3426)ttC>ttT	p.F1142F	CACNA1B_ENST00000371363.1_Silent_p.F1142F|CACNA1B_ENST00000277549.5_Silent_p.F334F|CACNA1B_ENST00000545473.1_Silent_p.F168F|CACNA1B_ENST00000371355.4_Silent_p.F1143F|CACNA1B_ENST00000371357.1_Silent_p.F1143F|CACNA1B_ENST00000277551.2_Silent_p.F1142F	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1142					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCGCCGCTTCTGCCACTACA	0.657													ENSG00000148408																																					0													54.0	57.0	56.0					9																	140941368		2129	4229	6358	SO:0001819	synonymous_variant	0			-	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.3426C>T	9.37:g.140941368C>T			B1AQK5	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.F1143	ENST00000371372.1	37	c.3429	CCDS59522.1	9																																																																																			-	CAC1B	-	NULL		0.657	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CAC1B	HGNC	protein_coding	OTTHUMT00000055380.1	0	0	0	37	37	46	0.00	0.00	C	NM_000718		140941368	+1	46	19	0	0	tier1	no_errors	ENST00000371355	ensembl	human	known	74_37	silent	100.00	100.00	SNP	0.980	T	46	0
CEP170B	283638	genome.wustl.edu	37	14	105353081	105353081	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr14:105353081C>T	ENST00000414716.3	+	12	2733	c.2505C>T	c.(2503-2505)ggC>ggT	p.G835G	CEP170B_ENST00000418279.1_Silent_p.G765G|CEP170B_ENST00000556508.1_Silent_p.G765G|CEP170B_ENST00000453495.1_Silent_p.G836G	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	835						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CACGGGATGGCGTCTATGTCA	0.642													ENSG00000099814																																					0													33.0	41.0	38.0					14																	105353081		1997	4145	6142	SO:0001819	synonymous_variant	0			-	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.2505C>T	14.37:g.105353081C>T			Q2KHR7|Q86TI7	Silent	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.G836	ENST00000414716.3	37	c.2508	CCDS45175.1	14																																																																																			-	CEP170B	-	NULL		0.642	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP170B	HGNC	protein_coding	OTTHUMT00000410289.2	0	0	0	52	52	54	0.00	0.00	C	NM_001112726		105353081	+1	54	59	0	2	tier1	no_errors	ENST00000453495	ensembl	human	known	74_37	silent	100.00	96.72	SNP	0.007	T	54	0
DIP2A	23181	genome.wustl.edu	37	21	47976337	47976337	+	Intron	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr21:47976337C>G	ENST00000417564.2	+	29	3519				DIP2A_ENST00000318711.7_Intron|DIP2A_ENST00000427143.2_Missense_Mutation_p.L1110V|DIP2A_ENST00000400274.1_Intron			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)						multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		tggctcacgcctgtaatccca	0.512													ENSG00000160305																																					0													104.0	96.0	98.0					21																	47976337		692	1591	2283	SO:0001627	intron_variant	0			-	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3498+333C>G	21.37:g.47976337C>G			A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.L1110V	ENST00000417564.2	37	c.3328	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	C	5.890	0.348238	0.11126	.	.	ENSG00000160305	ENST00000427143	T	0.22743	1.94	0.839	-0.136	0.13473	.	.	.	.	.	T	0.09992	0.0245	N	0.08118	0	0.09310	N	1	P	0.35923	0.528	B	0.41374	0.355	T	0.30736	-0.9968	9	0.21540	T	0.41	.	3.3267	0.07070	0.0:0.6833:0.0:0.3167	.	1110	E7EMA5	.	V	1110	ENSP00000400528:L1110V	ENSP00000400528:L1110V	L	+	1	2	DIP2A	46800765	0.000000	0.05858	0.004000	0.12327	0.017000	0.09413	-1.209000	0.03002	-0.057000	0.13199	-0.643000	0.03959	CTG	-	DIP2A	-	NULL		0.512	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	0	0	0	17	17	37	0.00	0.00	C	NM_015151		47976337	+1	7	10	2	4	tier1	no_errors	ENST00000427143	ensembl	human	known	74_37	missense	77.78	71.43	SNP	0.004	G	7	2
G6PD	2539	genome.wustl.edu	37	X	153763329	153763329	+	Intron	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:153763329G>A	ENST00000393564.2	-	5	598				G6PD_ENST00000369620.2_Intron|G6PD_ENST00000497281.1_5'UTR|G6PD_ENST00000393562.2_Intron	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase						carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGTGGTGGGAGCACTGCCTGG	0.652													ENSG00000160211																																					0																																										SO:0001627	intron_variant	0			-	X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.485+53C>T	X.37:g.153763329G>A			D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	R	SNP	-	NULL	ENST00000393564.2	37	NULL	CCDS44023.1	X																																																																																			-	G6PD	-	-		0.652	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	G6PD	HGNC	protein_coding	OTTHUMT00000061170.3	0	0	0	81	81	11	0.00	0.00	G	NM_000402		153763329	-1	29	3	65	5	tier1	no_errors	ENST00000497281	ensembl	human	known	74_37	rna	30.85	37.50	SNP	0.039	A	29	65
GPT	2875	genome.wustl.edu	37	8	145730243	145730243	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr8:145730243G>A	ENST00000528431.1	+	4	499	c.342G>A	c.(340-342)gcG>gcA	p.A114A	GPT_ENST00000394955.2_Silent_p.A114A			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	114					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	TCTTGCAGGCGTGTGGGGGCC	0.627													ENSG00000167701																																					0																																										SO:0001819	synonymous_variant	0			-		CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	ENST00000528431.1:c.342G>A	8.37:g.145730243G>A			B0YJ18|D3DWM7|P78398|Q93076	Silent	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.A114	ENST00000528431.1	37	c.342	CCDS6430.1	8																																																																																			-	GPT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.627	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT	HGNC	protein_coding	OTTHUMT00000382471.1	0	0	0	117	117	52	0.00	0.00	G			145730243	+1	95	23	37	9	tier1	no_errors	ENST00000394955	ensembl	human	known	74_37	silent	71.97	71.88	SNP	0.005	A	95	37
KLF6	1316	genome.wustl.edu	37	10	3827225	3827225	+	5'UTR	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:3827225G>A	ENST00000497571.1	-	0	242				KLF6_ENST00000542957.1_5'UTR|KLF6_ENST00000469435.1_5'UTR|KLF6_ENST00000173785.4_5'Flank	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6						B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		GGGTTGGACGGAGCCCGCGGT	0.677													ENSG00000067082																																					0													25.0	25.0	25.0					10																	3827225		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			-	U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.-19C>T	10.37:g.3827225G>A			B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	R	SNP	-	NULL	ENST00000497571.1	37	NULL	CCDS7060.1	10																																																																																			-	KLF6	-	-		0.677	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF6	HGNC	protein_coding	OTTHUMT00000046495.1	0	0	0	12	12	15	0.00	0.00	G			3827225	-1	8	3	20	8	tier1	no_errors	ENST00000380946	ensembl	human	known	74_37	rna	28.57	27.27	SNP	0.111	A	8	20
OSCAR	126014	genome.wustl.edu	37	19	54598486	54598486	+	3'UTR	SNP	T	T	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:54598486T>G	ENST00000284648.6	-	0	1503				OSCAR_ENST00000351806.4_Nonstop_Mutation_p.*253C|OSCAR_ENST00000359649.4_3'UTR|OSCAR_ENST00000358375.4_Nonstop_Mutation_p.*264C|OSCAR_ENST00000391761.1_3'UTR|OSCAR_ENST00000356532.3_Nonstop_Mutation_p.*268C			Q8IYS5	OSCAR_HUMAN	osteoclast associated, immunoglobulin-like receptor							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(1)|skin(1)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)					CTCCTGGGGCTCAGGGGCGGA	0.672													ENSG00000170909																																					0													19.0	22.0	21.0					19																	54598486		2203	4299	6502	SO:0001624	3_prime_UTR_variant	0			-	AK130199	CCDS12873.1, CCDS12874.1, CCDS12875.1, CCDS12876.1, CCDS62789.1, CCDS74444.1	19q13.42	2013-01-29			ENSG00000170909	ENSG00000170909		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29960	protein-coding gene	gene with protein product		606862				11805147	Standard	NM_206818		Approved		uc002qda.3	Q8IYS5	OTTHUMG00000064966	ENST00000284648.6:c.*457A>C	19.37:g.54598486T>G			B7WNS2|Q5GRG5|Q8N763|Q8NHL4|Q8WXQ0|Q8WXQ1|Q8WXQ2	Nonstop_Mutation	SNP	smart_Ig_sub	p.*268C	ENST00000284648.6	37	c.804		19	.	.	.	.	.	.	.	.	.	.	.	4.817	0.151889	0.09185	.	.	ENSG00000170909	ENST00000356532;ENST00000358375;ENST00000351806	.	.	.	1.83	1.83	0.25207	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7349	0.18061	0.0:0.0:0.0:1.0	.	.	.	.	C	268;264;253	.	.	X	-	3	0	OSCAR	59290298	0.113000	0.22115	0.814000	0.32528	0.057000	0.15508	1.858000	0.39408	1.092000	0.41356	0.374000	0.22700	TGA	-	OSCAR	-	NULL		0.672	OSCAR-001	NOVEL	basic	protein_coding	OSCAR	HGNC	protein_coding	OTTHUMT00000139493.4	0	0	0	83	83	20	0.00	0.00	T	NM_133169		54598486	-1	28	10	63	7	tier1	no_errors	ENST00000356532	ensembl	human	known	74_37	nonstop	30.77	58.82	SNP	0.889	G	28	63
PPP1R35	221908	genome.wustl.edu	37	7	100033348	100033348	+	Missense_Mutation	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:100033348A>G	ENST00000292330.2	-	3	684	c.494T>C	c.(493-495)gTg>gCg	p.V165A	RP11-758P17.3_ENST00000475250.1_RNA|PPP1R35_ENST00000476185.1_Intron|RP11-758P17.2_ENST00000492523.1_RNA	NM_145030.2	NP_659467.1	Q8TAP8	PPR35_HUMAN	protein phosphatase 1, regulatory subunit 35	165					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CTGCAGGCTCACCAGGTCCCG	0.687													ENSG00000160813																																					0													15.0	17.0	17.0					7																	100033348		2196	4297	6493	SO:0001583	missense	0			-	BC026269	CCDS5694.1	7q22.1	2012-04-17	2011-10-11	2011-10-11	ENSG00000160813	ENSG00000160813		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28320	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 47"""	C7orf47		12477932	Standard	NM_145030		Approved	MGC22793	uc003uuy.1	Q8TAP8	OTTHUMG00000159540	ENST00000292330.2:c.494T>C	7.37:g.100033348A>G	ENSP00000292330:p.Val165Ala		A4D2C5	Missense_Mutation	SNP	NULL	p.V165A	ENST00000292330.2	37	c.494	CCDS5694.1	7	.	.	.	.	.	.	.	.	.	.	A	24.5	4.543122	0.86022	.	.	ENSG00000160813	ENST00000292330	.	.	.	4.6	3.43	0.39272	.	0.000000	0.64402	D	0.000013	T	0.47637	0.1456	L	0.55481	1.735	0.35763	D	0.82035	P	0.35348	0.496	B	0.38264	0.269	T	0.58148	-0.7687	9	0.72032	D	0.01	-31.2218	8.188	0.31350	0.7966:0.2034:0.0:0.0	.	165	Q8TAP8	PPR35_HUMAN	A	165	.	ENSP00000292330:V165A	V	-	2	0	C7orf47	99871284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.132000	0.50523	0.784000	0.33661	0.459000	0.35465	GTG	-	PPP1R35	-	NULL		0.687	PPP1R35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R35	HGNC	protein_coding	OTTHUMT00000356095.2	0	0	0	42	42	10	0.00	0.00	A	NM_145030		100033348	-1	9	2	29	6	tier1	no_errors	ENST00000292330	ensembl	human	known	74_37	missense	23.68	25.00	SNP	1.000	G	9	29
SHANK1	50944	genome.wustl.edu	37	19	51165487	51165487	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:51165487C>T	ENST00000293441.1	-	23	6239	c.6221G>A	c.(6220-6222)cGc>cAc	p.R2074H	SHANK1_ENST00000359082.3_Missense_Mutation_p.R2065H|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000391814.1_Missense_Mutation_p.R2082H|SHANK1_ENST00000391813.1_Missense_Mutation_p.R1461H|SHANK1_ENST00000483981.2_5'Flank	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	2074					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		TGAGAGGGAGCGCGAGGCCCC	0.687													ENSG00000161681																																					0													31.0	32.0	31.0					19																	51165487		2203	4300	6503	SO:0001583	missense	0			-	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.6221G>A	19.37:g.51165487C>T	ENSP00000293441:p.Arg2074His		A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.R2082H	ENST00000293441.1	37	c.6245	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	c	9.657	1.143110	0.21205	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.53857	0.7;1.06;0.72;0.6	3.55	3.55	0.40652	.	0.683935	0.11773	U	0.530937	T	0.47857	0.1468	L	0.46157	1.445	0.44825	D	0.99783	B;B	0.27732	0.056;0.187	B;B	0.23150	0.005;0.044	T	0.52909	-0.8512	10	0.72032	D	0.01	.	14.4496	0.67376	0.0:1.0:0.0:0.0	.	2074;1461	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	H	2074;1461;2065;2082	ENSP00000293441:R2074H;ENSP00000375689:R1461H;ENSP00000351984:R2065H;ENSP00000375690:R2082H	ENSP00000293441:R2074H	R	-	2	0	SHANK1	55857299	0.999000	0.42202	0.993000	0.49108	0.796000	0.44982	1.149000	0.31626	2.010000	0.58986	0.450000	0.29827	CGC	-	SHANK1	-	NULL		0.687	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	0	0	0	30	30	12	0.00	0.00	C	NM_016148		51165487	-1	16	11	0	0	tier1	no_errors	ENST00000391814	ensembl	human	known	74_37	missense	100.00	100.00	SNP	1.000	T	16	0
TIAM1	7074	genome.wustl.edu	37	21	32598231	32598231	+	Silent	SNP	G	G	A	rs143707356	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr21:32598231G>A	ENST00000286827.3	-	8	2091	c.1620C>T	c.(1618-1620)acC>acT	p.T540T	TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Silent_p.T540T	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	540	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AGTGGATGGCGGTGATCCAGT	0.527													ENSG00000156299																																					0								G		8,4398	14.3+/-33.2	0,8,2195	82.0	80.0	81.0		1620	-4.0	1.0	21	dbSNP_134	81	0,8600		0,0,4300	no	coding-synonymous	TIAM1	NM_003253.2		0,8,6495	AA,AG,GG		0.0,0.1816,0.0615		540/1592	32598231	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1620C>T	21.37:g.32598231G>A			B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.T540	ENST00000286827.3	37	c.1620	CCDS13609.1	21																																																																																			rs143707356	TIAM1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.527	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	0	0	0	22	22	66	0.00	0.00	G	NM_003253		32598231	-1	26	28	0	1	tier1	no_errors	ENST00000286827	ensembl	human	known	74_37	silent	100.00	93.33	SNP	0.327	A	26	0
TP53	7157	genome.wustl.edu	37	17	7579311	7579311	+	Splice_Site	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:7579311C>T	ENST00000269305.4	-	4	565		c.e4+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(26)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAACTGACCGTGCAAGTC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(12)|breast(5)|upper_aerodigestive_tract(4)|bone(4)|ovary(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	GRCh37	CS951538	TP53	S							66.0	61.0	63.0					17																	7579311		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>A	17.37:g.7579311C>T			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e3+1	ENST00000269305.4	37	c.375+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015182	0.75161	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6586	0.68852	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520036	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.208000	0.72165	2.403000	0.81681	0.655000	0.94253	.	-	TP53	-	-		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	59	59	75	0.00	0.00	C	NM_000546	Intron	7579311	-1	99	95	1	0	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	99.00	98.96	SNP	1.000	T	99	1
WIPF2	147179	genome.wustl.edu	37	17	38375620	38375621	+	5'UTR	INS	-	-	GGCGGC	rs542122273|rs60253561|rs368567525|rs71152656		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-	-	GGCGGC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:38375620_38375621insGGCGGC	ENST00000323571.4	+	0	47_48				WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000583130.1_5'Flank|WIPF2_ENST00000394103.3_5'UTR|WIPF2_ENST00000536600.1_5'UTR|WIPF2_ENST00000585043.1_5'UTR	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						AAAGGggcggtggcggcggcgg	0.693										HNSCC(43;0.11)			ENSG00000171475																																					0																																										SO:0001623	5_prime_UTR_variant	0				BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.-193->GGCGGC	17.37:g.38375621_38375626dupGGCGGC			A8K0L3|Q658J8|Q71RE1|Q8TE44	R	INS	-	NULL	ENST00000323571.4	37	NULL	CCDS11364.1	17																																																																																				WIPF2	-	-		0.693	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WIPF2	HGNC	protein_coding	OTTHUMT00000257157.2	0	0	0	8	8	8	0.00	0.00	-	NM_133264		38375621	+1	3	3	9	9	tier1	no_errors	ENST00000494757	ensembl	human	known	74_37	rna	25.00	25.00	INS	0.994:1.000	GGCGGC	3	9
ZNF274	10782	genome.wustl.edu	37	19	58723009	58723009	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:58723009C>T	ENST00000326804.4	+	8	1392	c.933C>T	c.(931-933)taC>taT	p.Y311Y	ZNF274_ENST00000345813.3_Silent_p.Y279Y|ZNF274_ENST00000424679.2_Silent_p.Y206Y|ZNF274_ENST00000597818.1_3'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	312	KRAB 2. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		GGACCGAGTACCGCGATGTGA	0.617													ENSG00000171606																																					0													105.0	121.0	116.0					19																	58723009		2197	4300	6497	SO:0001819	synonymous_variant	0			-	AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.933C>T	19.37:g.58723009C>T			Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Silent	SNP	pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.Y311	ENST00000326804.4	37	c.933		19																																																																																			-	ZNF274	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.617	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF274	HGNC	protein_coding		0	0	0	35	35	50	0.00	0.00	C	NM_133502		58723009	+1	21	19	2	0	tier1	no_errors	ENST00000326804	ensembl	human	known	74_37	silent	91.30	95.00	SNP	0.994	T	21	2
ZDHHC11B	653082	genome.wustl.edu	37	5	766963	766963	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:766963C>A	ENST00000382776.4	-	1	71	c.72G>T	c.(70-72)ttG>ttT	p.L24F	ZDHHC11_ENST00000424784.2_Intron|ZDHHC11B_ENST00000508859.2_Missense_Mutation_p.L35F			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	24						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						TGCGGGGCGGCAAGACCAGCT	0.607													ENSG00000206077																																					0																																										SO:0001583	missense	0			-			5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.72G>T	5.37:g.766963C>A	ENSP00000445280:p.Leu24Phe		A6NHR3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.L24F	ENST00000382776.4	37	c.72		5	.	.	.	.	.	.	.	.	.	.	-	13.35	2.211256	0.39102	.	.	ENSG00000206077	ENST00000508859;ENST00000382776	T;T	0.55413	0.52;0.52	2.75	-5.5	0.02576	.	.	.	.	.	T	0.20618	0.0496	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23332	-1.0191	6	0.10111	T	0.7	-6.5271	1.4678	0.02409	0.1386:0.3531:0.1384:0.3699	.	.	.	.	F	35;24	ENSP00000442373:L35F;ENSP00000445280:L24F	ENSP00000445280:L24F	L	-	3	2	ZDHHC11B	819963	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.193000	0.01244	-1.121000	0.02949	-0.293000	0.09583	TTG	-	ZDHHC11B	-	NULL		0.607	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	HGNC	protein_coding		0	0	0	80	80	72	0.00	0.00	C	XM_926053		766963	-1	18	4	120	75	tier1	no_errors	ENST00000382776	ensembl	human	known	74_37	missense	13.04	5.00	SNP	0.000	A	18	120
ZNF366	167465	genome.wustl.edu	37	5	71756678	71756678	+	Nonsense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:71756678T>A	ENST00000318442.5	-	2	1136	c.646A>T	c.(646-648)Aaa>Taa	p.K216*		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	216					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		GGCTCGGCTTTCCGGGGCAGC	0.652													ENSG00000178175																																					0													66.0	69.0	68.0					5																	71756678		2203	4300	6503	SO:0001587	stop_gained	0			-	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.646A>T	5.37:g.71756678T>A	ENSP00000313158:p.Lys216*		Q5HYI9|Q7RTV4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K216*	ENST00000318442.5	37	c.646	CCDS4015.1	5	.	.	.	.	.	.	.	.	.	.	T	37	6.313624	0.97467	.	.	ENSG00000178175	ENST00000318442	.	.	.	5.64	1.77	0.24775	.	0.366026	0.26289	N	0.025237	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-9.2682	6.7844	0.23665	0.0:0.1363:0.1287:0.7351	.	.	.	.	X	216	.	ENSP00000313158:K216X	K	-	1	0	ZNF366	71792434	0.001000	0.12720	0.002000	0.10522	0.966000	0.64601	1.168000	0.31859	0.441000	0.26529	0.459000	0.35465	AAA	-	ZNF366	-	NULL		0.652	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF366	HGNC	protein_coding	OTTHUMT00000218574.3	0	0	0	35	35	37	0.00	0.00	T			71756678	-1	9	4	23	7	tier1	no_errors	ENST00000318442	ensembl	human	known	74_37	nonsense	28.12	36.36	SNP	0.000	A	9	23
ESPNP	284729	genome.wustl.edu	37	1	17029215	17029215	+	RNA	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:17029215G>T	ENST00000492551.1	-	0	1150					NR_026567.1				espin pseudogene																		GAGGGCCTCTGTCTCCACGTG	0.632													ENSG00000268869																																					0																																												0			-	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17029215G>T				R	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			-	ESPNP	-	-		0.632	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1	0	0	1	81	81	94	0.00	1.05	G			17029215	-1	22	9	111	121	tier1	no_errors	ENST00000492551	ensembl	human	known	74_37	rna	16.42	6.92	SNP	0.109	T	22	111
CYP26A1	1592	genome.wustl.edu	37	10	94833762	94833762	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:94833762C>T	ENST00000224356.4	+	1	116	c.71C>T	c.(70-72)gCg>gTg	p.A24V	CYP26A1_ENST00000394139.1_5'UTR|CYP26A1_ENST00000371531.1_Intron	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	24					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	TTCCTGGCTGCGATCAAGCTC	0.697													ENSG00000095596																																					0													23.0	26.0	25.0					10																	94833762		2202	4300	6502	SO:0001583	missense	0			-	AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.71C>T	10.37:g.94833762C>T	ENSP00000224356:p.Ala24Val		B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	p.A24V	ENST00000224356.4	37	c.71	CCDS7426.1	10	.	.	.	.	.	.	.	.	.	.	C	15.31	2.794915	0.50208	.	.	ENSG00000095596	ENST00000224356	T	0.72615	-0.67	4.94	4.94	0.65067	.	0.107611	0.64402	D	0.000007	T	0.47875	0.1469	N	0.08118	0	0.80722	D	1	B	0.21452	0.056	B	0.18561	0.022	T	0.44483	-0.9325	10	0.13853	T	0.58	-13.605	12.7455	0.57280	0.0:0.9215:0.0:0.0785	.	24	O43174	CP26A_HUMAN	V	24	ENSP00000224356:A24V	ENSP00000224356:A24V	A	+	2	0	CYP26A1	94823752	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	7.203000	0.77864	2.583000	0.87209	0.462000	0.41574	GCG	-	CYP26A1	-	NULL		0.697	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP26A1	HGNC	protein_coding	OTTHUMT00000049408.3	0	0	0	58	58	22	0.00	0.00	C			94833762	+1	4	0	44	4	tier1	no_errors	ENST00000224356	ensembl	human	known	74_37	missense	8.33	0.00	SNP	0.993	T	4	44
NLRP2	55655	genome.wustl.edu	37	19	55494500	55494500	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:55494500C>T	ENST00000543010.1	+	6	1577	c.1434C>T	c.(1432-1434)tcC>tcT	p.S478S	NLRP2_ENST00000263437.6_Silent_p.S475S|NLRP2_ENST00000537859.1_Silent_p.S456S|NLRP2_ENST00000538819.1_Silent_p.S454S|NLRP2_ENST00000391721.4_Silent_p.S454S|NLRP2_ENST00000448584.2_Silent_p.S478S|NLRP2_ENST00000339757.7_Silent_p.S456S|NLRP2_ENST00000427260.2_Silent_p.S455S	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	478	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGCAGGAGTCCGACCTCCGTC	0.642													ENSG00000022556																																					0													38.0	38.0	38.0					19																	55494500		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1434C>T	19.37:g.55494500C>T			B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.S478	ENST00000543010.1	37	c.1434	CCDS12913.1	19																																																																																			-	NLRP2	-	NULL		0.642	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	0	0	0	20	20	10	0.00	0.00	C	NM_017852		55494500	+1	18	0	2	0	tier1	no_errors	ENST00000448584	ensembl	human	known	74_37	silent	90.00	0.00	SNP	0.000	T	18	2
TUBA3D	113457	genome.wustl.edu	37	2	132240193	132240193	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:132240193G>A	ENST00000321253.6	+	5	1232	c.1125G>A	c.(1123-1125)gtG>gtA	p.V375V	MZT2A_ENST00000410036.2_5'Flank	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	375					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		AGCGGGCCGTGTGCATGCTGA	0.617													ENSG00000075886																									Ovarian(137;2059 2432 35543 39401)												0													46.0	46.0	46.0					2																	132240193		2203	4297	6500	SO:0001819	synonymous_variant	0			-	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.1125G>A	2.37:g.132240193G>A			A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.V375	ENST00000321253.6	37	c.1125	CCDS33290.1	2																																																																																			-	TUBA3D	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Delta_tubulin		0.617	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3D	HGNC	protein_coding	OTTHUMT00000331800.2	0	0	0	43	43	10	0.00	0.00	G	NM_080386		132240193	+1	25	0	43	4	tier1	no_errors	ENST00000321253	ensembl	human	known	74_37	silent	36.76	0.00	SNP	1.000	A	25	43
DNM1P47	100216544	genome.wustl.edu	37	15	102299958	102299958	+	RNA	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:102299958C>G	ENST00000561463.1	+	0	8004									DNM1 pseudogene 47																		CTTCTCAGAGCTGCTGTCCAA	0.587													ENSG00000259660																																					0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299958C>G				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0	0	53	53	0	0.00	0.00	C	NG_009149		102299958	+1	7	0	73	2	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	8.75	0.00	SNP	0.996	G	7	73
ERVW-1	30816	genome.wustl.edu	37	7	92099904	92099904	+	5'UTR	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:92099904G>A	ENST00000493463.2	-	0	715				ERVW-1_ENST00000604270.1_5'UTR|AC007566.10_ENST00000427458.1_RNA|ERVW-1_ENST00000603053.1_5'UTR	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1						anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						gactgggtagggtccttccca	0.473													ENSG00000242950																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.-209C>T	7.37:g.92099904G>A			B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	R	SNP	-	NULL	ENST00000493463.2	37	NULL	CCDS5626.1	7																																																																																			-	ERVW-1	-	-		0.473	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	HGNC	protein_coding	OTTHUMT00000254009.2	0	0	0	18	18	3	0.00	0.00	G	NM_014590		92099904	-1	11	1	13	2	tier1	no_errors	ENST00000604270	ensembl	human	known	74_37	rna	45.83	33.33	SNP	0.579	A	11	13
POTEM	641455	genome.wustl.edu	37	14	20012850	20012850	+	Intron	SNP	A	A	T	rs201036322		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr14:20012850A>T	ENST00000551509.1	-	4	862				RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						actgaggttgaggttggagga	0.398													ENSG00000187537																																					0																																										SO:0001627	intron_variant	0			-		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.811-1193T>A	14.37:g.20012850A>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P302	ENST00000551509.1	37	c.906	CCDS45076.1	14																																																																																			rs201036322	POTEM	-	NULL		0.398	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	0	0	0	12	12	0	0.00	0.00	A	NM_001145442		20012850	-1	12	0	34	0	tier1	no_errors	ENST00000547722	ensembl	human	known	74_37	silent	25.53	0.00	SNP	0.030	T	12	34
KIF26A	26153	genome.wustl.edu	37	14	104640600	104640600	+	Missense_Mutation	SNP	G	G	A	rs370868498		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr14:104640600G>A	ENST00000423312.2	+	11	2146	c.2146G>A	c.(2146-2148)Gtg>Atg	p.V716M	KIF26A_ENST00000315264.7_Missense_Mutation_p.V577M	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	716	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		ACTCAGCACCGTGCAGCTCGC	0.697													ENSG00000066735																																					0								G	MET/VAL	0,4292		0,0,2146	17.0	23.0	21.0		2146	1.1	0.9	14		21	2,8456		0,2,4227	no	missense	KIF26A	NM_015656.1	21	0,2,6373	AA,AG,GG		0.0236,0.0,0.0157	probably-damaging	716/1883	104640600	2,12748	2146	4229	6375	SO:0001583	missense	0			-	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2146G>A	14.37:g.104640600G>A	ENSP00000388241:p.Val716Met		Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.V716M	ENST00000423312.2	37	c.2146	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333235	0.41297	0.0	2.36E-4	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.41400	1.0;1.0	4.13	1.07	0.20283	Kinesin, motor domain (3);	.	.	.	.	T	0.41743	0.1172	L	0.39397	1.21	0.28297	N	0.923273	D	0.64830	0.994	P	0.53954	0.738	T	0.29027	-1.0025	9	0.48119	T	0.1	.	6.3148	0.21184	0.2121:0.2558:0.5321:0.0	.	716	Q9ULI4	KI26A_HUMAN	M	716;577	ENSP00000388241:V716M;ENSP00000325452:V577M	ENSP00000325452:V577M	V	+	1	0	KIF26A	103710353	0.481000	0.25941	0.928000	0.36995	0.239000	0.25481	0.941000	0.29005	-0.011000	0.14247	0.313000	0.20887	GTG	-	KIF26A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom		0.697	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	0	0	0	87	87	0	0.00	0.00	G			104640600	+1	34	0	101	4	tier1	no_errors	ENST00000423312	ensembl	human	known	74_37	missense	25.19	0.00	SNP	0.627	A	34	101
TCP11	6954	genome.wustl.edu	37	6	35109033	35109040	+	5'Flank	DEL	GCGGCCTG	GCGGCCTG	-	rs142118879|rs112303926	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	GCGGCCTG	GCGGCCTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:35109033_35109040delGCGGCCTG	ENST00000512012.1	-	0	0				TCP11_ENST00000510465.1_5'UTR|TCP11_ENST00000412155.2_5'UTR|TCP11_ENST00000373979.2_5'UTR|TCP11_ENST00000418521.2_Intron|TCP11_ENST00000244645.3_5'UTR|TCP11_ENST00000444780.2_5'UTR|TCP11_ENST00000373974.4_5'UTR|TCP11_ENST00000311875.5_5'UTR			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						GGTGGGCCTCGCGGCCTGGCGGCCTGGA	0.769													ENSG00000124678		2193	0.437899	0.1831	0.611	5008	,	,		9765	0.3085		0.6849	False		,,,				2504	0.5389																0									,	265,1133		113,39,547					,	0.6	0.0		dbSNP_130	1	1818,1276		830,158,559	no	utr-5,utr-5	TCP11	NM_018679.4,NM_001093728.1	,	943,197,1106	A1A1,A1R,RR		41.2411,18.9557,46.3713	,	,		2083,2409				SO:0001631	upstream_gene_variant	0					CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560		6.37:g.35109041_35109048delGCGGCCTG	Exception_encountered		B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	R	DEL	-	NULL	ENST00000512012.1	37	NULL		6																																																																																				TCP11	-	-		0.769	TCP11-014	PUTATIVE	basic	protein_coding	TCP11	HGNC	protein_coding	OTTHUMT00000370354.1	0	0	0	0	0	0	0.00	0.00	GCGGCCTG	NM_001093728		35109040	-1	0	0	0	0	tier1	no_errors	ENST00000394696	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.001:0.000:0.000:0.001:0.002:0.001:0.000:0.000	-	0	0
WDR75	84128	genome.wustl.edu	37	2	190327331	190327368	+	Splice_Site	DEL	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	-	rs370964637|rs568931467|rs369195954	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:190327331_190327368delTGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	ENST00000314761.4	+	9	960_997	c.900_937delTGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	c.(898-939)cctgcaggagatttattctgcacttctcactctgataataag>ccag	p.AGDLFCTSHSDNK301fs		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	301						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			CAGTCTCGCCTGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATAGTAAGTCTAA	0.382													ENSG00000115368																																					0																																										SO:0001630	splice_region_variant	0				AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.937+1TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA>-	2.37:g.190327331_190327368delTGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA			Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A301fs	ENST00000314761.4	37	c.900_937	CCDS2298.1	2																																																																																				WDR75	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.382	WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR75	HGNC	protein_coding	OTTHUMT00000255913.1	0	0	0	54	54	54	0.00	0.00	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	NM_032168	Frame_Shift_Del	190327368	+1	2	2	20	20	tier1	no_errors	ENST00000314761	ensembl	human	known	74_37	frame_shift_del	9.09	9.09	DEL	0.884:0.984:0.969:0.111:1.000:1.000:0.782:0.909:0.963:0.966:0.972:0.999:0.998:1.000:1.000:1.000:1.000:1.000:0.984:1.000:1.000:0.889:0.994:0.998:0.932:1.000:1.000:0.933:0.928:0.924:0.507:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	2	20
