#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
MX1	4599	genome.wustl.edu	37	21	42804053	42804053	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr21:42804053C>T	ENST00000398600.2	+	7	1081	c.56C>T	c.(55-57)cCt>cTt	p.P19L	MX1_ENST00000455164.2_Missense_Mutation_p.P19L|MX1_ENST00000398598.3_Missense_Mutation_p.P19L|MX1_ENST00000288383.6_Missense_Mutation_p.P19L	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	19					apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GCATCCCACCCTCTATTACTG	0.458													ENSG00000157601																																					0													102.0	100.0	101.0					21																	42804053		2203	4300	6503	SO:0001583	missense	0			-		CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.56C>T	21.37:g.42804053C>T	ENSP00000381601:p.Pro19Leu		B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_GED,prints_Dynamin_SF	p.P19L	ENST00000398600.2	37	c.56	CCDS13673.1	21	.	.	.	.	.	.	.	.	.	.	C	9.328	1.059864	0.19987	.	.	ENSG00000157601	ENST00000398600;ENST00000413778;ENST00000419044;ENST00000398598;ENST00000455164;ENST00000424365;ENST00000417963;ENST00000441677;ENST00000427464;ENST00000288383	D;D;D;D;D;D	0.92752	-2.55;-2.55;-2.55;-3.1;-3.1;-2.48	3.19	-5.7	0.02421	.	7739.210000	0.00166	N	0.000000	T	0.80613	0.4656	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.70350	-0.4896	10	0.39692	T	0.17	8.165	4.5711	0.12210	0.2044:0.2738:0.0:0.5218	.	19	P20591	MX1_HUMAN	L	19	ENSP00000381601:P19L;ENSP00000381599:P19L;ENSP00000410523:P19L;ENSP00000400923:P19L;ENSP00000402215:P19L;ENSP00000288383:P19L	ENSP00000288383:P19L	P	+	2	0	MX1	41725923	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.105000	0.03323	-1.056000	0.03205	-1.394000	0.01149	CCT	-	MX1	-	NULL		0.458	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX1	HGNC	protein_coding	OTTHUMT00000195161.2	0	0	0	41	41	86	0.00	0.00	C			42804053	+1	28	13	64	41	tier1	no_errors	ENST00000398598	ensembl	human	known	74_37	missense	30.43	24.07	SNP	0.000	T	28	64
SH2D5	400745	genome.wustl.edu	37	1	21053559	21053559	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr1:21053559G>A	ENST00000444387.2	-	4	575	c.178C>T	c.(178-180)Cga>Tga	p.R60*	SH2D5_ENST00000460804.1_Intron|SH2D5_ENST00000375031.1_5'UTR	NM_001103161.1	NP_001096631.1	Q6ZV89	SH2D5_HUMAN	SH2 domain containing 5	60										lung(4)|prostate(1)|upper_aerodigestive_tract(1)	6		Colorectal(325;3.46e-05)|all_lung(284;5.32e-05)|Lung NSC(340;5.51e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|GBM - Glioblastoma multiforme(114;0.000465)|Kidney(64;0.000476)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(64;0.00634)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCCCGGCGTCGGGGACAGTCC	0.622													ENSG00000189410																																					0													50.0	59.0	56.0					1																	21053559		1984	4150	6134	SO:0001587	stop_gained	0			-	AK124869, AK123236	CCDS41280.1, CCDS44080.1	1p36.12	2008-02-05			ENSG00000189410	ENSG00000189410			28819	protein-coding gene	gene with protein product							Standard	NM_001103161		Approved		uc009vpy.1	Q6ZV89	OTTHUMG00000002620	ENST00000444387.2:c.178C>T	1.37:g.21053559G>A	ENSP00000406026:p.Arg60*		B7Z3W3|Q5SSJ2	Nonsense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_SH2	p.R60*	ENST00000444387.2	37	c.178	CCDS44080.1	1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669345	0.29693	.	.	ENSG00000189410	ENST00000444387;ENST00000518294;ENST00000517430;ENST00000519434	.	.	.	3.78	0.219	0.15274	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7895	0.23692	0.0:0.1317:0.2726:0.5957	.	.	.	.	X	60	.	ENSP00000406026:R60X	R	-	1	2	SH2D5	20926146	0.982000	0.34865	0.908000	0.35775	0.255000	0.26057	1.052000	0.30429	-0.026000	0.13895	0.462000	0.41574	CGA	-	SH2D5	-	smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.622	SH2D5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D5	HGNC	protein_coding	OTTHUMT00000007455.2	0	0	0	60	60	87	0.00	0.00	G	XM_375698		21053559	-1	44	18	57	21	tier1	no_errors	ENST00000444387	ensembl	human	known	74_37	nonsense	43.56	46.15	SNP	0.990	A	44	57
TMX2	51075	genome.wustl.edu	37	11	57505881	57505881	+	Nonsense_Mutation	SNP	C	C	G			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr11:57505881C>G	ENST00000278422.4	+	4	432	c.420C>G	c.(418-420)taC>taG	p.Y140*	C11orf31_ENST00000534355.1_5'Flank|TMX2-CTNND1_ENST00000528395.1_Intron|TMX2_ENST00000378312.4_Nonsense_Mutation_p.Y102*	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2	140	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						ATATCAAGTACTTCAATGATA	0.423													ENSG00000213593																																					0													246.0	228.0	234.0					11																	57505881		2201	4296	6497	SO:0001587	stop_gained	0			-	AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200	ENST00000278422.4:c.420C>G	11.37:g.57505881C>G	ENSP00000278422:p.Tyr140*		B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	Nonsense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.Y140*	ENST00000278422.4	37	c.420	CCDS7967.1	11	.	.	.	.	.	.	.	.	.	.	C	13.40	2.227373	0.39399	.	.	ENSG00000213593	ENST00000378312;ENST00000278422	.	.	.	6.17	5.26	0.73747	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.2763	8.9949	0.36045	0.0:0.7972:0.0:0.2028	.	.	.	.	X	102;140	.	ENSP00000278422:Y140X	Y	+	3	2	TMX2	57262457	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.563000	0.23547	2.941000	0.99782	0.655000	0.94253	TAC	-	TMX2	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold		0.423	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMX2	HGNC	protein_coding	OTTHUMT00000393708.1	0	0	0	66	66	81	0.00	0.00	C	NM_015959		57505881	+1	31	25	49	20	tier1	no_errors	ENST00000278422	ensembl	human	known	74_37	nonsense	38.75	55.56	SNP	1.000	G	31	49
PLEKHB2	55041	genome.wustl.edu	37	2	131890578	131890578	+	Intron	SNP	T	T	C			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr2:131890578T>C	ENST00000403716.1	+	6	983				PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000409279.1_Intron|PLEKHB2_ENST00000409612.1_Intron|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.L146P|PLEKHB2_ENST00000234115.6_Intron|PLEKHB2_ENST00000438882.2_Intron|PLEKHB2_ENST00000538982.1_Intron|PLEKHB2_ENST00000439822.2_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2							endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		GGGAGAACCCTGAGCCTCCAG	0.488													ENSG00000115762																																					0													65.0	57.0	60.0					2																	131890578		2203	4300	6503	SO:0001627	intron_variant	0			-		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.423+14T>C	2.37:g.131890578T>C			B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L146P	ENST00000403716.1	37	c.437	CCDS46413.1	2	.	.	.	.	.	.	.	.	.	.	T	8.679	0.904728	0.17760	.	.	ENSG00000115762	ENST00000409158	.	.	.	4.29	1.88	0.25563	.	.	.	.	.	T	0.25232	0.0613	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19877	-1.0292	7	0.28530	T	0.3	.	5.7677	0.18235	0.0:0.2203:0.0:0.7797	.	146	B8ZZN1	.	P	146	.	ENSP00000386410:L146P	L	+	2	0	PLEKHB2	131607048	0.001000	0.12720	0.000000	0.03702	0.334000	0.28698	0.534000	0.23098	0.299000	0.22661	0.402000	0.26972	CTG	-	PLEKHB2	-	NULL		0.488	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHB2	HGNC	protein_coding	OTTHUMT00000331304.2	0	0	0	31	31	146	0.00	0.00	T	NM_017958		131890578	+1	14	22	18	32	tier1	no_errors	ENST00000409158	ensembl	human	novel	74_37	missense	43.75	40.74	SNP	0.000	C	14	18
CFAP54	144535	genome.wustl.edu	37	12	96894645	96894645	+	Silent	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr12:96894645C>T	ENST00000524981.4	+	2	374	c.351C>T	c.(349-351)taC>taT	p.Y117Y	C12orf55_ENST00000298953.3_Silent_p.Y117Y			Q96N23	CL055_HUMAN		117																	GGACTAAATACGCCCCCAGGC	0.403													ENSG00000188596																																					0																																										SO:0001819	synonymous_variant	0			-																												ENST00000524981.4:c.351C>T	12.37:g.96894645C>T				Silent	SNP	superfamily_Fibronectin_type3	p.Y117	ENST00000524981.4	37	c.351		12																																																																																			-	C12orf55	-	NULL		0.403	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	0	0	0	43	43	128	0.00	0.00	C			96894645	+1	31	26	28	28	tier1	no_errors	ENST00000524981	ensembl	human	putative	74_37	silent	52.54	48.15	SNP	0.786	T	31	28
KCNK17	89822	genome.wustl.edu	37	6	39267321	39267321	+	Missense_Mutation	SNP	G	G	C			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr6:39267321G>C	ENST00000373231.4	-	5	1113	c.881C>G	c.(880-882)cCt>cGt	p.P294R	KCNK17_ENST00000453413.2_3'UTR	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	294					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						CTCCCGGTCAGGTCCCTGTCT	0.577													ENSG00000124780																																					0													93.0	80.0	84.0					6																	39267321		2203	4300	6503	SO:0001583	missense	0			-	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.881C>G	6.37:g.39267321G>C	ENSP00000362328:p.Pro294Arg		E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.P294R	ENST00000373231.4	37	c.881	CCDS4842.1	6	.	.	.	.	.	.	.	.	.	.	G	9.431	1.085446	0.20390	.	.	ENSG00000124780	ENST00000373231	T	0.15952	2.38	4.57	1.4	0.22301	.	.	.	.	.	T	0.02455	0.0075	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.47341	-0.9125	9	0.22109	T	0.4	.	2.4856	0.04598	0.1138:0.1732:0.5206:0.1924	.	294	Q96T54	KCNKH_HUMAN	R	294	ENSP00000362328:P294R	ENSP00000362328:P294R	P	-	2	0	KCNK17	39375299	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.311000	0.19380	-0.047000	0.13423	0.655000	0.94253	CCT	-	KCNK17	-	pirsf_2pore_dom_K_chnl_TASK		0.577	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK17	HGNC	protein_coding	OTTHUMT00000040453.2	0	0	0	68	68	138	0.00	0.00	G	NM_031460		39267321	-1	30	22	31	37	tier1	no_errors	ENST00000373231	ensembl	human	known	74_37	missense	49.18	37.29	SNP	0.000	C	30	31
ZCWPW1	55063	genome.wustl.edu	37	7	100014754	100014754	+	Silent	SNP	T	T	C			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr7:100014754T>C	ENST00000398027.2	-	6	661	c.414A>G	c.(412-414)gtA>gtG	p.V138V	ZCWPW1_ENST00000490721.1_Silent_p.V17V|ZCWPW1_ENST00000324725.6_Silent_p.V17V|ZCWPW1_ENST00000360951.4_Silent_p.V138V	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	138							zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATTGGGTAGATACTACGGGCT	0.423													ENSG00000078487																																					0													136.0	128.0	130.0					7																	100014754		1895	4112	6007	SO:0001819	synonymous_variant	0			-	AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.414A>G	7.37:g.100014754T>C			A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Silent	SNP	pfam_Znf_CW,pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_CW	p.V138	ENST00000398027.2	37	c.414	CCDS43623.1	7																																																																																			-	ZCWPW1	-	NULL		0.423	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZCWPW1	HGNC	protein_coding	OTTHUMT00000356083.1	0	0	0	38	38	140	0.00	0.00	T	NM_017984		100014754	-1	14	23	25	33	tier1	no_errors	ENST00000398027	ensembl	human	known	74_37	silent	35.90	41.07	SNP	0.000	C	14	25
NCKAP5	344148	genome.wustl.edu	37	2	133554264	133554264	+	Silent	SNP	A	A	G			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr2:133554264A>G	ENST00000409261.1	-	12	1219	c.846T>C	c.(844-846)gaT>gaC	p.D282D	NCKAP5_ENST00000405974.3_Silent_p.D282D|NCKAP5_ENST00000409213.1_Silent_p.D282D|NCKAP5_ENST00000317721.6_Silent_p.D282D	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	282										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTGAAAGCAAATCTCCAGATG	0.413													ENSG00000176771																																					0													69.0	68.0	69.0					2																	133554264		1882	4111	5993	SO:0001819	synonymous_variant	0			-	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.846T>C	2.37:g.133554264A>G			B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	NULL	p.D282	ENST00000409261.1	37	c.846	CCDS46418.1	2																																																																																			-	NCKAP5	-	NULL		0.413	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	0	0	0	29	29	125	0.00	0.00	A	NM_207481		133554264	-1	8	12	28	55	tier1	no_errors	ENST00000317721	ensembl	human	known	74_37	silent	22.22	17.91	SNP	1.000	G	8	28
DMXL2	23312	genome.wustl.edu	37	15	51828631	51828631	+	Silent	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr15:51828631C>T	ENST00000251076.5	-	12	2333	c.2046G>A	c.(2044-2046)caG>caA	p.Q682Q	DMXL2_ENST00000449909.3_Silent_p.Q682Q|DMXL2_ENST00000543779.2_Silent_p.Q682Q	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	682						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CTGAGTCCCACTGACAATCTA	0.373													ENSG00000104093																																					0													104.0	105.0	105.0					15																	51828631		2195	4293	6488	SO:0001819	synonymous_variant	0			-	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.2046G>A	15.37:g.51828631C>T			B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q682	ENST00000251076.5	37	c.2046	CCDS10141.1	15																																																																																			rs150462519	DMXL2	-	NULL		0.373	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	0	0	0	29	29	168	0.00	0.00	C	NM_015263		51828631	-1	10	26	27	52	tier1	no_errors	ENST00000543779	ensembl	human	known	74_37	silent	27.03	33.33	SNP	0.001	T	10	27
TMEM132E	124842	genome.wustl.edu	37	17	32955593	32955593	+	Missense_Mutation	SNP	A	A	G			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr17:32955593A>G	ENST00000321639.5	+	4	1068	c.740A>G	c.(739-741)aAg>aGg	p.K247R		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	247						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTGAAGGCCAAGAAGGGTGTG	0.587													ENSG00000181291																																					0													61.0	53.0	56.0					17																	32955593		2203	4300	6503	SO:0001583	missense	0			-	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.740A>G	17.37:g.32955593A>G	ENSP00000316532:p.Lys247Arg		Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.K247R	ENST00000321639.5	37	c.740	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	a	20.5	4.008385	0.75046	.	.	ENSG00000181291	ENST00000321639	T	0.19669	2.13	4.86	4.86	0.63082	.	0.101246	0.64402	D	0.000004	T	0.44074	0.1276	M	0.67625	2.065	0.54753	D	0.999987	D	0.67145	0.996	D	0.76071	0.987	T	0.39722	-0.9600	10	0.59425	D	0.04	-37.2233	13.9455	0.64082	1.0:0.0:0.0:0.0	.	247	Q6IEE7	T132E_HUMAN	R	247	ENSP00000316532:K247R	ENSP00000316532:K247R	K	+	2	0	TMEM132E	29979706	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	3.383000	0.52471	1.951000	0.56629	0.241000	0.17934	AAG	-	TMEM132E	-	NULL		0.587	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	0	0	0	55	55	111	0.00	0.00	A	NM_207313		32955593	+1	22	29	33	28	tier1	no_errors	ENST00000321639	ensembl	human	known	74_37	missense	40.00	50.88	SNP	1.000	G	22	33
CATSPER2P1	440278	genome.wustl.edu	37	15	44019275	44019275	+	IGR	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr15:44019275C>T								STRC (8817 upstream) : RNU6-354P (7101 downstream)																							TTTTAATGAACAGATATTGTT	0.418													ENSG00000205771																																					0																																										SO:0001628	intergenic_variant	0			-																													15.37:g.44019275C>T				R	SNP	-	NULL		37	NULL		15																																																																																			-	CATSPER2P1	-	-	0	0.418					CATSPER2P1	HGNC			0	0	0	28	28	47	0.00	0.00	C			44019275	-1	13	7	13	13	tier1	no_errors	ENST00000446479	ensembl	human	putative	74_37	rna	50.00	35.00	SNP	0.005	T	13	13
TBC1D9B	23061	genome.wustl.edu	37	5	179290867	179290867	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr5:179290867C>T	ENST00000356834.3	-	22	3371	c.3334G>A	c.(3334-3336)Ggc>Agc	p.G1112S	TBC1D9B_ENST00000518085.1_5'UTR|TBC1D9B_ENST00000444477.2_Missense_Mutation_p.G253S|TBC1D9B_ENST00000519746.1_Missense_Mutation_p.G271S|TBC1D9B_ENST00000355235.3_Missense_Mutation_p.G1095S	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	1112						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGTCTCCGCCTGCTTTGGCT	0.667													ENSG00000197226																																					0													69.0	73.0	71.0					5																	179290867		2203	4300	6503	SO:0001583	missense	0			-	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.3334G>A	5.37:g.179290867C>T	ENSP00000349291:p.Gly1112Ser		D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.G1112S	ENST00000356834.3	37	c.3334	CCDS43408.1	5	.	.	.	.	.	.	.	.	.	.	C	1.834	-0.469172	0.04445	.	.	ENSG00000197226	ENST00000356834;ENST00000355235;ENST00000519746;ENST00000444477;ENST00000544438	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	5.37	4.49	0.54785	.	0.498104	0.20305	N	0.094948	T	0.17450	0.0419	L	0.32530	0.975	0.09310	N	1	B;B;B;B;B	0.26081	0.0;0.001;0.0;0.003;0.141	B;B;B;B;B	0.22753	0.002;0.003;0.001;0.005;0.041	T	0.28713	-1.0035	10	0.06757	T	0.87	-17.6068	5.9657	0.19325	0.2196:0.6217:0.0:0.1587	.	1094;1095;1112;311;186	A1L3A9;Q66K14-2;Q66K14;B3KM54;F5H5B8	.;.;TBC9B_HUMAN;.;.	S	1112;1095;271;253;186	ENSP00000349291:G1112S;ENSP00000347375:G1095S;ENSP00000430293:G271S;ENSP00000401585:G253S	ENSP00000347375:G1095S	G	-	1	0	TBC1D9B	179223473	0.000000	0.05858	0.048000	0.18961	0.126000	0.20510	-0.048000	0.11944	1.227000	0.43598	0.561000	0.74099	GGC	-	TBC1D9B	-	NULL		0.667	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D9B	HGNC	protein_coding	OTTHUMT00000253501.3	0	0	0	30	30	38	0.00	0.00	C	NM_015043		179290867	-1	19	7	35	12	tier1	no_errors	ENST00000356834	ensembl	human	known	74_37	missense	35.19	36.84	SNP	0.036	T	19	35
IL5RA	3568	genome.wustl.edu	37	3	3111914	3111914	+	Missense_Mutation	SNP	A	A	C			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr3:3111914A>C	ENST00000446632.2	-	12	1832	c.1258T>G	c.(1258-1260)Ttt>Gtt	p.F420V	IL5RA_ENST00000445864.2_Missense_Mutation_p.F211V|IL5RA_ENST00000438560.1_3'UTR|IL5RA_ENST00000256452.3_Missense_Mutation_p.F420V|IL5RA_ENST00000418488.2_Missense_Mutation_p.F325V	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	420					cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)			cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		GACAGTCAAAACACAGAATCC	0.458													ENSG00000091181																									GBM(169;430 2801 24955 28528)												0													193.0	194.0	194.0					3																	3111914		2203	4300	6503	SO:0001583	missense	0			-	M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.1258T>G	3.37:g.3111914A>C	ENSP00000412209:p.Phe420Val		B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.F420V	ENST00000446632.2	37	c.1258	CCDS2559.1	3	.	.	.	.	.	.	.	.	.	.	A	19.65	3.868095	0.72065	.	.	ENSG00000091181	ENST00000446632;ENST00000353055;ENST00000256452;ENST00000418488;ENST00000445864	D;D;T;T	0.89343	-2.5;-2.5;0.55;0.93	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000020	D	0.93844	0.8031	M	0.81802	2.56	0.29419	N	0.860695	D;D;D;D	0.89917	0.975;1.0;1.0;0.973	P;D;D;P	0.87578	0.685;0.998;0.994;0.73	D	0.90501	0.4474	10	0.66056	D	0.02	.	11.4662	0.50241	1.0:0.0:0.0:0.0	.	420;211;325;140	Q01344;B3IU77;E7ERY4;Q14632	IL5RA_HUMAN;.;.;.	V	420;150;420;325;211	ENSP00000412209:F420V;ENSP00000256452:F420V;ENSP00000388858:F325V;ENSP00000402598:F211V	ENSP00000256452:F420V	F	-	1	0	IL5RA	3086914	0.973000	0.33851	1.000000	0.80357	0.885000	0.51271	2.593000	0.46180	1.942000	0.56320	0.533000	0.62120	TTT	-	IL5RA	-	NULL		0.458	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL5RA	HGNC	protein_coding	OTTHUMT00000337537.2	0	0	0	48	48	118	0.00	0.00	A			3111914	-1	7	8	23	50	tier1	no_errors	ENST00000256452	ensembl	human	known	74_37	missense	23.33	13.79	SNP	1.000	C	7	23
RAD54L2	23132	genome.wustl.edu	37	3	51680404	51680404	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr3:51680404C>T	ENST00000409535.2	+	18	3058	c.2933C>T	c.(2932-2934)aCa>aTa	p.T978I	RAD54L2_ENST00000296477.3_Missense_Mutation_p.T672I	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	978						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GACAAACGCACATCAGTCCCC	0.507													ENSG00000164080																																					0													163.0	133.0	144.0					3																	51680404		2203	4300	6503	SO:0001583	missense	0			-	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.2933C>T	3.37:g.51680404C>T	ENSP00000386520:p.Thr978Ile		Q8TB57|Q9BV54	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T978I	ENST00000409535.2	37	c.2933	CCDS33765.2	3	.	.	.	.	.	.	.	.	.	.	C	17.19	3.326172	0.60743	.	.	ENSG00000164080	ENST00000409535;ENST00000296477	D;D	0.93189	-3.07;-3.18	5.6	5.6	0.85130	.	0.048377	0.85682	D	0.000000	D	0.87529	0.6200	N	0.14661	0.345	0.46376	D	0.999015	B;B	0.20459	0.045;0.001	B;B	0.14023	0.01;0.0	T	0.82343	-0.0504	10	0.27785	T	0.31	-9.378	18.6053	0.91264	0.0:1.0:0.0:0.0	.	978;567	Q9Y4B4;B3KV54	ARIP4_HUMAN;.	I	978;672	ENSP00000386520:T978I;ENSP00000296477:T672I	ENSP00000296477:T672I	T	+	2	0	RAD54L2	51655444	1.000000	0.71417	0.940000	0.37924	0.965000	0.64279	7.441000	0.80485	2.638000	0.89438	0.462000	0.41574	ACA	-	RAD54L2	-	NULL		0.507	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	0	0	0	19	19	128	0.00	0.00	C	NM_015106		51680404	+1	8	21	3	34	tier1	no_errors	ENST00000409535	ensembl	human	known	74_37	missense	72.73	38.18	SNP	1.000	T	8	3
GRID2	2895	genome.wustl.edu	37	4	94006200	94006200	+	Missense_Mutation	SNP	C	C	T	rs200490934		TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr4:94006200C>T	ENST00000282020.4	+	3	557	c.299C>T	c.(298-300)aCg>aTg	p.T100M	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Intron	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	100					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		ATTGGCTGCACGTCAGCAGGA	0.522													ENSG00000152208																																					0													106.0	85.0	92.0					4																	94006200		2203	4300	6503	SO:0001583	missense	0			-	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.299C>T	4.37:g.94006200C>T	ENSP00000282020:p.Thr100Met		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T100M	ENST00000282020.4	37	c.299	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319233	0.41096	.	.	ENSG00000152208	ENST00000282020	D	0.82984	-1.67	5.12	5.12	0.69794	Extracellular ligand-binding receptor (1);	0.049364	0.85682	D	0.000000	T	0.64011	0.2560	N	0.01352	-0.895	0.80722	D	1	B;B	0.20368	0.008;0.044	B;B	0.14578	0.002;0.011	T	0.62163	-0.6912	10	0.42905	T	0.14	.	18.9145	0.92499	0.0:1.0:0.0:0.0	.	100;41	O43424;B4DYB9	GRID2_HUMAN;.	M	100	ENSP00000282020:T100M	ENSP00000282020:T100M	T	+	2	0	GRID2	94225223	0.987000	0.35691	0.963000	0.40424	0.980000	0.70556	2.566000	0.45948	2.553000	0.86117	0.655000	0.94253	ACG	-	GRID2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.522	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	0	0	0	33	33	76	0.00	0.00	C			94006200	+1	15	11	16	19	tier1	no_errors	ENST00000282020	ensembl	human	known	74_37	missense	48.39	36.67	SNP	0.994	T	15	16
DCHS2	54798	genome.wustl.edu	37	4	155156309	155156309	+	Silent	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr4:155156309C>T	ENST00000357232.4	-	25	8129	c.8130G>A	c.(8128-8130)ggG>ggA	p.G2710G		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2710					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GATCTCCTTCCCCAAATGTTT	0.532													ENSG00000197410																																					0													96.0	80.0	86.0					4																	155156309		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8130G>A	4.37:g.155156309C>T			B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_D-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G2710	ENST00000357232.4	37	c.8130	CCDS3785.1	4																																																																																			-	DCHS2	-	NULL		0.532	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	0	0	0	39	39	62	0.00	0.00	C	NM_001142552		155156309	-1	17	10	29	22	tier1	no_errors	ENST00000357232	ensembl	human	known	74_37	silent	36.96	31.25	SNP	0.041	T	17	29
LOC90768	90768	genome.wustl.edu	37	4	183064420	183064420	+	RNA	SNP	A	A	G			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr4:183064420A>G	ENST00000315302.2	-	0	642				AC108142.1_ENST00000508968.1_RNA|AC108142.1_ENST00000511052.1_RNA|AC108142.1_ENST00000513752.1_RNA|AC108142.1_ENST00000509012.1_RNA|AC108142.1_ENST00000505873.1_RNA|RP11-402C9.1_ENST00000505389.1_RNA	NR_027107.1																						TGGGGGGCAGACAATTGTTCT	0.602													ENSG00000177822																																					0																																												0			-																													4.37:g.183064420A>G				R	SNP	-	NULL	ENST00000315302.2	37	NULL		4																																																																																			-	AC108142.1	-	-		0.602	AC108142.1-001	KNOWN	basic	antisense	LOC101928703	Clone_based_vega_gene	antisense	OTTHUMT00000257786.2	0	0	0	18	18	62	0.00	0.00	A			183064420	-1	8	15	15	13	tier1	no_errors	ENST00000315302	ensembl	human	known	74_37	rna	34.78	53.57	SNP	0.043	G	8	15
OR10J5	127385	genome.wustl.edu	37	1	159504982	159504982	+	Silent	SNP	A	A	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr1:159504982A>T	ENST00000334857.2	-	1	860	c.816T>A	c.(814-816)gtT>gtA	p.V272V		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					TCACTGAGAGAACAAGGTCTT	0.488													ENSG00000184155																																					0													89.0	86.0	87.0					1																	159504982		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.816T>A	1.37:g.159504982A>T			B9EH35|Q6IFH2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V272	ENST00000334857.2	37	c.816	CCDS30910.1	1																																																																																			-	OR10J5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.488	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	HGNC	protein_coding	OTTHUMT00000059021.1	0	0	0	57	57	128	0.00	0.00	A	NM_001004469		159504982	-1	27	15	48	27	tier1	no_errors	ENST00000334857	ensembl	human	known	74_37	silent	35.53	35.71	SNP	0.155	T	27	48
ARHGAP33	115703	genome.wustl.edu	37	19	36275201	36275201	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr19:36275201G>A	ENST00000007510.4	+	16	1693	c.1549G>A	c.(1549-1551)Gcc>Acc	p.A517T	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.A517T|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.A381T			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	517					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CTTCACCTCCGCCGGCCTCGA	0.682													ENSG00000004777																																					0													224.0	181.0	196.0					19																	36275201		2203	4300	6503	SO:0001583	missense	0			-	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.1549G>A	19.37:g.36275201G>A	ENSP00000007510:p.Ala517Thr		O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.A517T	ENST00000007510.4	37	c.1549		19	.	.	.	.	.	.	.	.	.	.	g	12.47	1.946537	0.34377	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.11712	3.11;2.75;3.14	4.9	4.9	0.64082	.	0.218710	0.31279	N	0.007933	T	0.10465	0.0256	N	0.24115	0.695	0.33717	D	0.616532	B;B;D	0.56521	0.165;0.255;0.976	B;B;P	0.48840	0.056;0.119;0.592	T	0.16689	-1.0394	10	0.33940	T	0.23	.	10.5291	0.44967	0.0917:0.0:0.9083:0.0	.	517;381;517	O14559;O14559-10;O14559-11	RHG33_HUMAN;.;.	T	517;517;381	ENSP00000007510:A517T;ENSP00000320038:A517T;ENSP00000368227:A381T	ENSP00000007510:A517T	A	+	1	0	ARHGAP33	40967041	0.994000	0.37717	1.000000	0.80357	0.395000	0.30598	2.900000	0.48687	2.262000	0.75019	0.457000	0.33378	GCC	-	ARHGAP33	-	NULL		0.682	ARHGAP33-201	KNOWN	basic	protein_coding	ARHGAP33	HGNC	protein_coding		0	0	0	57	57	58	0.00	0.00	G	NM_052948		36275201	+1	30	11	53	18	tier1	no_errors	ENST00000007510	ensembl	human	known	74_37	missense	36.14	37.93	SNP	1.000	A	30	53
PLOD2	5352	genome.wustl.edu	37	3	145828222	145828222	+	Missense_Mutation	SNP	A	A	G			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr3:145828222A>G	ENST00000360060.3	-	4	529	c.352T>C	c.(352-354)Ttt>Ctt	p.F118L	PLOD2_ENST00000282903.5_Missense_Mutation_p.F118L|PLOD2_ENST00000494950.1_Missense_Mutation_p.F63L	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	118					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	CCACCAGCAAATATGACATCA	0.363													ENSG00000152952																																					0													85.0	86.0	86.0					3																	145828222		2202	4300	6502	SO:0001583	missense	0			-	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.352T>C	3.37:g.145828222A>G	ENSP00000353170:p.Phe118Leu		B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.F118L	ENST00000360060.3	37	c.352	CCDS3131.1	3	.	.	.	.	.	.	.	.	.	.	A	16.86	3.240000	0.58995	.	.	ENSG00000152952	ENST00000282903;ENST00000360060;ENST00000494950;ENST00000469350	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.33323	0.0859	N	0.20807	0.61	0.80722	D	1	D;B;B	0.59767	0.986;0.004;0.034	D;B;B	0.69654	0.965;0.009;0.109	T	0.08106	-1.0738	10	0.23302	T	0.38	-30.7197	15.0002	0.71466	1.0:0.0:0.0:0.0	.	63;118;118	E7ETU9;O00469;O00469-2	.;PLOD2_HUMAN;.	L	118;118;63;90	ENSP00000282903:F118L;ENSP00000353170:F118L;ENSP00000420094:F63L;ENSP00000419963:F90L	ENSP00000282903:F118L	F	-	1	0	PLOD2	147310912	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.870000	0.69620	1.940000	0.56252	0.477000	0.44152	TTT	-	PLOD2	-	NULL		0.363	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD2	HGNC	protein_coding	OTTHUMT00000355185.1	0	0	0	34	34	121	0.00	0.00	A	NM_000935		145828222	-1	16	25	28	34	tier1	no_errors	ENST00000282903	ensembl	human	known	74_37	missense	36.36	42.37	SNP	1.000	G	16	28
SHANK2	22941	genome.wustl.edu	37	11	70332818	70332818	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr11:70332818C>T	ENST00000423696.2	-	15	2479	c.2443G>A	c.(2443-2445)Ggc>Agc	p.G815S	SHANK2_ENST00000449833.2_Missense_Mutation_p.G599S|SHANK2_ENST00000338508.4_Missense_Mutation_p.G1195S|SHANK2_ENST00000409161.1_Missense_Mutation_p.G598S			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	815					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCGGCTGTGCCGCTGCTCGCG	0.701													ENSG00000162105																																					0													21.0	27.0	25.0					11																	70332818		2192	4292	6484	SO:0001583	missense	0			-	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2443G>A	11.37:g.70332818C>T	ENSP00000394536:p.Gly815Ser		C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.G1195S	ENST00000423696.2	37	c.3583		11	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.324453	0.00229	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08	3.79	1.2	0.21068	.	6.068490	0.01202	N	0.007619	T	0.09379	0.0231	N	0.00128	-2.045	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.08055	0.0;0.001;0.003	T	0.50242	-0.8851	10	0.02654	T	1	.	3.9314	0.09286	0.0:0.2276:0.182:0.5904	.	815;1194;599	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	S	599;598;473;1195;815;833;818	ENSP00000399423:G599S;ENSP00000386491:G598S;ENSP00000402944:G473S;ENSP00000345193:G1195S;ENSP00000394536:G815S;ENSP00000294018:G818S	ENSP00000294018:G818S	G	-	1	0	SHANK2	70010466	0.000000	0.05858	0.011000	0.14972	0.037000	0.13140	0.455000	0.21843	0.372000	0.24591	0.561000	0.74099	GGC	-	SHANK2	-	NULL		0.701	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding		0	0	0	47	47	22	0.00	0.00	C	NM_012309		70332818	-1	23	6	29	6	tier1	no_errors	ENST00000338508	ensembl	human	known	74_37	missense	44.23	50.00	SNP	0.002	T	23	29
GABRA5	2558	genome.wustl.edu	37	15	27193366	27193366	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr15:27193366G>A	ENST00000335625.5	+	11	2263	c.1375G>A	c.(1375-1377)Gcc>Acc	p.A459T	GABRA5_ENST00000355395.5_Missense_Mutation_p.A459T|GABRA5_ENST00000400081.3_Missense_Mutation_p.A459T	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	459					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.A459T(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	AAAAGGAGCCGCCTCTCCAAA	0.483													ENSG00000186297																																					1	Substitution - Missense(1)	endometrium(1)											15.0	16.0	16.0					15																	27193366		1775	3933	5708	SO:0001583	missense	0			-		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.1375G>A	15.37:g.27193366G>A	ENSP00000335592:p.Ala459Thr		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa5_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.A459T	ENST00000335625.5	37	c.1375	CCDS45194.1	15	.	.	.	.	.	.	.	.	.	.	G	1.622	-0.521227	0.04171	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	T;T;T	0.70869	-0.52;-0.52;-0.52	5.06	-1.98	0.07480	.	0.625964	0.15791	N	0.244425	T	0.39809	0.1092	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.36768	-0.9734	10	0.02654	T	1	.	10.8797	0.46931	0.8007:0.0:0.1993:0.0	.	459	P31644	GBRA5_HUMAN	T	459	ENSP00000335592:A459T;ENSP00000347557:A459T;ENSP00000382953:A459T	ENSP00000335592:A459T	A	+	1	0	GABRA5	24776112	0.030000	0.19436	0.065000	0.19835	0.718000	0.41266	0.749000	0.26320	-0.158000	0.11040	0.655000	0.94253	GCC	-	GABRA5	-	prints_GABBAa5_rcpt		0.483	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA5	HGNC	protein_coding	OTTHUMT00000415234.1	0	0	0	27	27	120	0.00	0.00	G			27193366	+1	4	4	33	64	tier1	no_errors	ENST00000335625	ensembl	human	known	74_37	missense	10.81	5.88	SNP	0.001	A	4	33
DOCK10	55619	genome.wustl.edu	37	2	225739435	225739435	+	Missense_Mutation	SNP	G	G	A	rs147869852		TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr2:225739435G>A	ENST00000258390.7	-	9	1032	c.965C>T	c.(964-966)aCg>aTg	p.T322M	DOCK10_ENST00000409592.3_Missense_Mutation_p.T316M	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	322					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TTCCTCTGGCGTGCATTCACA	0.363													ENSG00000135905																																					0													156.0	148.0	150.0					2																	225739435		1879	4107	5986	SO:0001583	missense	0			GMAF=0.0005	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.965C>T	2.37:g.225739435G>A	ENSP00000258390:p.Thr322Met		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T322M	ENST00000258390.7	37	c.965	CCDS46528.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	10.12	1.261811	0.23051	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.03330	3.97;3.97	5.4	3.61	0.41365	.	0.649821	0.15714	N	0.248232	T	0.04048	0.0113	N	0.14661	0.345	0.25908	N	0.983269	P;D;P	0.56968	0.935;0.978;0.935	B;P;B	0.48166	0.222;0.569;0.222	T	0.40021	-0.9585	10	0.59425	D	0.04	.	10.6662	0.45732	0.1497:0.0:0.8503:0.0	.	322;322;316	Q96BY6;Q96BY6-2;B3FL70	DOC10_HUMAN;.;.	M	316;322	ENSP00000386694:T316M;ENSP00000258390:T322M	ENSP00000258390:T322M	T	-	2	0	DOCK10	225447679	0.973000	0.33851	0.425000	0.26659	0.077000	0.17291	1.904000	0.39868	0.675000	0.31264	-0.232000	0.12228	ACG	rs147869852	DOCK10	-	NULL		0.363	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	0	0	2	71	71	138	0.00	1.43	G			225739435	-1	24	9	86	38	tier1	no_errors	ENST00000258390	ensembl	human	known	74_37	missense	21.82	19.15	SNP	0.843	A	24	86
ECE2	9718	genome.wustl.edu	37	3	184009904	184009904	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr3:184009904C>T	ENST00000402825.3	+	19	2530	c.2530C>T	c.(2530-2532)Ccc>Tcc	p.P844S	EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000359140.4_Missense_Mutation_p.P697S|ECE2_ENST00000404464.3_Missense_Mutation_p.P726S|ECE2_ENST00000357474.5_Missense_Mutation_p.P772S	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	844	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGTGACCGACCCCCACAGCCC	0.667													ENSG00000145194																																					0													38.0	40.0	40.0					3																	184009904		2203	4300	6503	SO:0001583	missense	0			-	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.2530C>T	3.37:g.184009904C>T	ENSP00000384223:p.Pro844Ser		A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.P844S	ENST00000402825.3	37	c.2530	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	C	17.75	3.467362	0.63625	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474	D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73	5.38	5.38	0.77491	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.065029	0.64402	D	0.000009	D	0.92153	0.7512	L	0.41906	1.305	0.80722	D	1	P;D;D;D	0.76494	0.477;0.995;0.995;0.999	B;P;P;P	0.62382	0.221;0.871;0.871;0.901	D	0.91662	0.5343	10	0.41790	T	0.15	-22.1825	16.6246	0.84952	0.0:1.0:0.0:0.0	.	726;772;697;844	O60344-2;O60344-5;O60344-3;O60344	.;.;.;ECE2_HUMAN	S	844;697;726;772	ENSP00000384223:P844S;ENSP00000352052:P697S;ENSP00000385846:P726S;ENSP00000350066:P772S	ENSP00000350066:P772S	P	+	1	0	ECE2	185492598	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	3.890000	0.56220	2.515000	0.84797	0.491000	0.48974	CCC	-	ECE2	-	pfam_Peptidase_M13_C		0.667	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	0	0	0	41	41	14	0.00	0.00	C	NM_014693		184009904	+1	20	0	31	2	tier1	no_errors	ENST00000402825	ensembl	human	known	74_37	missense	39.22	0.00	SNP	1.000	T	20	31
KRTAP10-9	386676	genome.wustl.edu	37	21	46048196	46048197	+	3'UTR	INS	-	-	CGCTGGT	rs181355860|rs587633163|rs61263042	byFrequency	TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr21:46048196_46048197insCGCTGGT	ENST00000397911.3	+	0	1157_1158				TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCACAACCCTCCGCTGGTCGCT	0.693													ENSG00000221837		1171	0.233826	0.2458	0.2536	5008	,	,		10044	0.1855		0.2952	False		,,,				2504	0.1902																0																																										SO:0001624	3_prime_UTR_variant	0				AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*230->CGCTGGT	21.37:g.46048197_46048203dupCGCTGGT			A2RRG1|A6NIR9|Q70LJ1	R	INS	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																				KRTAP10-9	-	-		0.693	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	0	0	0	6	6	6	0.00	0.00	-			46048197	+1	0	0	0	0	tier1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.001:0.001	CGCTGGT	0	0
SLC6A8	6535	genome.wustl.edu	37	X	152960301	152960302	+	In_Frame_Ins	INS	-	-	CCTCCTGGGCTGCCT			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chrX:152960301_152960302insCCTCCTGGGCTGCCT	ENST00000253122.5	+	12	2200_2201	c.1724_1725insCCTCCTGGGCTGCCT	c.(1723-1728)cacctc>caCCTCCTGGGCTGCCTcctc	p.581_582insLGCLL	SLC6A8_ENST00000430077.2_In_Frame_Ins_p.466_467insLGCLL|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	581					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	GTGCCGCTGCACCTCCTGGGCT	0.668													ENSG00000130821																																					0																																										SO:0001652	inframe_insertion	0					CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.1725_1739dupCCTCCTGGGCTGCCT	X.37:g.152960301_152960302insCCTCCTGGGCTGCCT	ENSP00000253122:p.Leu577_Leu581dup		B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	In_Frame_Ins	INS	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_creatine	p.579in_frame_insCLLLG	ENST00000253122.5	37	c.1724_1725	CCDS14726.1	X																																																																																				SLC6A8	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.668	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A8	HGNC	protein_coding	OTTHUMT00000061003.1	0	0	0	15	15	15	0.00	0.00	-			152960302	+1	0	0	8	8	tier1	no_errors	ENST00000253122	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.372:0.372	CCTCCTGGGCTGCCT	0	8
CKS1B	1163	genome.wustl.edu	37	1	154951478	154951478	+	3'UTR	SNP	G	G	C			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr1:154951478G>C	ENST00000308987.5	+	0	512				CKS1B_ENST00000471245.1_3'UTR|CKS1B_ENST00000368439.1_3'UTR	NM_001826.2	NP_001817.1	P61024	CKS1_HUMAN	CDC28 protein kinase regulatory subunit 1B						cell division (GO:0051301)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|large_intestine(1)|lung(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCTAAGCTGAGTGTGACCCCA	0.512													ENSG00000173207																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BC007751	CCDS1077.1	1q21.2	2011-04-28	2002-10-07		ENSG00000173207	ENSG00000173207			19083	protein-coding gene	gene with protein product		116900	"""CDC28 protein kinase 1B"""			2227411	Standard	NM_001826		Approved	ckshs1, CKS1	uc001fgb.3	P61024	OTTHUMG00000037413	ENST00000308987.5:c.*225G>C	1.37:g.154951478G>C			P33551	R	SNP	-	NULL	ENST00000308987.5	37	NULL	CCDS1077.1	1																																																																																			-	CKS1B	-	-		0.512	CKS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKS1B	HGNC	protein_coding	OTTHUMT00000091078.1	0	0	0	29	29	0	0.00	0.00	G	NM_001826		154951478	+1	13	0	21	0	tier1	no_errors	ENST00000471245	ensembl	human	known	74_37	rna	38.24	0.00	SNP	0.043	C	13	21
AC026320.1	0	genome.wustl.edu	37	3	191693810	191693812	+	RNA	DEL	CCA	CCA	-	rs72266165	byFrequency	TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr3:191693810_191693812delCCA	ENST00000401201.1	+	0	68_70																											ACACACACTCCCACCATTGGGTC	0.463													ENSG00000216020		841	0.167931	0.087	0.2709	5008	,	,		19862	0.0446		0.3221	False		,,,				2504	0.1728																0																																												0																																3.37:g.191693813_191693815delCCA				R	DEL	-	NULL	ENST00000401201.1	37	NULL		3																																																																																				AC026320.1	-	-		0.463	AC026320.1-201	NOVEL	basic	miRNA	ENSG00000216020	Clone_based_ensembl_gene	miRNA		0	0	0	10	10	0	0.00	0.00	CCA			191693812	+1	7	0	14	0	tier1	no_errors	ENST00000401201	ensembl	human	novel	74_37	rna	33.33	0.00	DEL	0.001:0.001:0.001	-	7	14
IMMP2L	83943	genome.wustl.edu	37	7	110568408	110568413	+	Intron	DEL	CACACA	CACACA	-	rs13230194|rs71692948|rs202224708|rs58639346	byFrequency	TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	CACACA	CACACA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr7:110568408_110568413delCACACA	ENST00000405709.2	-	4	748				IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000331762.3_Intron|AC005161.1_ENST00000408352.1_RNA|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000415362.1_Intron	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)						ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		TATGTACCTGcacacacacacacaca	0.325													ENSG00000221279		2795	0.558107	0.4917	0.5159	5008	,	,		10746	0.6706		0.4742	False		,,,				2504	0.6483																0																																										SO:0001627	intron_variant	0				AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.305+35142TGTGTG>-	7.37:g.110568414_110568419delCACACA			Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	R	DEL	-	NULL	ENST00000405709.2	37	NULL	CCDS5753.1	7																																																																																				AC005161.1	-	-		0.325	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221279	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000338109.4	0	0	0	0	0	0	0.00	0.00	CACACA	NM_032549		110568413	+1	0	0	0	0	tier1	no_errors	ENST00000408352	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.000:0.003:0.009:0.052:0.060:0.063	-	0	0
WASH6P	653440	genome.wustl.edu	37	X	155253590	155253590	+	RNA	SNP	C	C	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chrX:155253590C>T	ENST00000461007.1	+	0	2506				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ACAGGATGCCCGCGCTCAGGT	0.637													ENSG00000182484																																					0																																												0			-	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155253590C>T			A6NGF1|Q8N305	R	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			-	WASH6P	-	-		0.637	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	0	0	0	97	97	0	0.00	0.00	C	NG_008380		155253590	+1	12	0	77	0	tier1	no_errors	ENST00000461007	ensembl	human	known	74_37	rna	13.48	0.00	SNP	0.004	T	12	77
WDR18	57418	genome.wustl.edu	37	19	985972	985972	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A5YA-01A-11D-A29N-09	TCGA-MB-A5YA-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8fdc2ffd-b882-4425-bfc3-43670326b763	d78c8041-1687-4dfc-b60b-b976c8fb311f	g.chr19:985972G>T	ENST00000251289.5	+	2	341	c.318G>T	c.(316-318)tgG>tgT	p.W106C	WDR18_ENST00000591997.1_3'UTR|WDR18_ENST00000587001.2_Missense_Mutation_p.W106C	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	106					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCACCTGTGGGAGGTAAGAG	0.592													ENSG00000065268																																					0													89.0	73.0	79.0					19																	985972		2203	4300	6503	SO:0001583	missense	0			-		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.318G>T	19.37:g.985972G>T	ENSP00000251289:p.Trp106Cys		O60390|Q9BWR2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.W106C	ENST00000251289.5	37	c.318	CCDS12051.1	19	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683663	0.68157	.	.	ENSG00000065268	ENST00000251289	T	0.35421	1.31	3.77	3.77	0.43336	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.070423	0.64402	D	0.000007	T	0.61185	0.2327	M	0.86953	2.85	0.80722	D	1	D	0.67145	0.996	P	0.61800	0.894	T	0.71715	-0.4509	10	0.87932	D	0	.	14.8369	0.70190	0.0:0.0:1.0:0.0	.	106	Q9BV38	WDR18_HUMAN	C	106	ENSP00000251289:W106C	ENSP00000251289:W106C	W	+	3	0	WDR18	936972	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	8.676000	0.91199	1.956000	0.56807	0.555000	0.69702	TGG	-	WDR18	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.592	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR18	HGNC	protein_coding	OTTHUMT00000458225.2	0	0	0	30	30	95	0.00	0.00	G			985972	+1	4	2	38	67	tier1	no_errors	ENST00000251289	ensembl	human	known	74_37	missense	9.52	2.90	SNP	1.000	T	4	38
