#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
HRNR	388697	genome.wustl.edu	37	1	152186100	152186100	+	Missense_Mutation	SNP	C	C	T	rs142956706	byFrequency	TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:152186100C>T	ENST00000368801.2	-	3	8080	c.8005G>A	c.(8005-8007)Ggc>Agc	p.G2669S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2669					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGTTGGCCGTGGCTGGAG	0.627													ENSG00000197915	C|||	20	0.00399361	0.0083	0.0043	5008	,	,		22763	0.001		0.004	False		,,,				2504	0.001																0													6.0	7.0	7.0					1																	152186100		1222	2624	3846	SO:0001583	missense	0			-	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8005G>A	1.37:g.152186100C>T	ENSP00000357791:p.Gly2669Ser		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.G2669S	ENST00000368801.2	37	c.8005	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	8.439	0.850337	0.17034	.	.	ENSG00000197915	ENST00000368801	T	0.01272	5.07	3.32	-4.18	0.03846	.	.	.	.	.	T	0.00300	0.0009	N	0.11201	0.11	0.09310	N	1	B	0.17667	0.023	B	0.06405	0.002	T	0.34551	-0.9824	9	0.26408	T	0.33	.	9.3155	0.37932	0.0:0.4731:0.0:0.5269	.	2669	Q86YZ3	HORN_HUMAN	S	2669	ENSP00000357791:G2669S	ENSP00000357791:G2669S	G	-	1	0	HRNR	150452724	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.529000	0.02223	-1.050000	0.03230	-1.301000	0.01330	GGC	rs142956706	HRNR	-	NULL		0.627	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	0	0		73	73		0.00		C	XM_373868		152186100	-1	29		42		tier1	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	40.85		SNP	0.000	T	29	42
CHD3	1107	genome.wustl.edu	37	17	7793747	7793748	+	Intron	INS	-	-	A	rs554325814		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr17:7793747_7793748insA	ENST00000330494.7	+	3	363				CHD3_ENST00000358181.4_Intron|CHD3_ENST00000570758.1_Intron|CHD3_ENST00000380358.4_Intron	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3						centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				actccatctccaaaaaaaaaaa	0.446													ENSG00000170004																																					0																																										SO:0001627	intron_variant	0				U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.214-141->A	17.37:g.7793758_7793758dupA			D3DTQ9|E9PG89|Q9Y4I0	R	INS	-	NULL	ENST00000330494.7	37	NULL	CCDS32554.1	17																																																																																				CHD3	-	-		0.446	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	0	0		12	12		0.00		-	NM_001005273		7793748	+1	3		5		tier1	no_errors	ENST00000574022	ensembl	human	known	74_37	rna	37.50		INS	0.217:0.454	A	3	5
HRNR	388697	genome.wustl.edu	37	1	152185905	152185905	+	Missense_Mutation	SNP	C	C	G			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:152185905C>G	ENST00000368801.2	-	3	8275	c.8200G>C	c.(8200-8202)Gac>Cac	p.D2734H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2734					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCTCCTGGTCAAAGGTTGAT	0.557													ENSG00000197915																																					0													29.0	18.0	22.0					1																	152185905		2112	4092	6204	SO:0001583	missense	0			-	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8200G>C	1.37:g.152185905C>G	ENSP00000357791:p.Asp2734His		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.D2734H	ENST00000368801.2	37	c.8200	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	3.228	-0.157972	0.06544	.	.	ENSG00000197915	ENST00000368801	T	0.01767	4.65	3.02	-1.42	0.08913	.	.	.	.	.	T	0.00328	0.0010	N	0.11427	0.14	0.09310	N	1	P	0.36944	0.574	B	0.28784	0.094	T	0.45352	-0.9267	9	0.41790	T	0.15	.	6.3475	0.21357	0.0:0.4651:0.0:0.5349	.	2734	Q86YZ3	HORN_HUMAN	H	2734	ENSP00000357791:D2734H	ENSP00000357791:D2734H	D	-	1	0	HRNR	150452529	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.848000	0.04326	-0.163000	0.10946	0.407000	0.27541	GAC	-	HRNR	-	NULL		0.557	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	0	0		11	11		0.00		C	XM_373868		152185905	-1	8		7		tier1	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	53.33		SNP	0.000	G	8	7
OGDHL	55753	genome.wustl.edu	37	10	50944187	50944187	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr10:50944187C>T	ENST00000374103.4	-	22	2876	c.2791G>A	c.(2791-2793)Gca>Aca	p.A931T	OGDHL_ENST00000490844.1_5'UTR|OGDHL_ENST00000419399.1_Missense_Mutation_p.A874T|OGDHL_ENST00000432695.1_Missense_Mutation_p.A722T	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	931					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						TACTTCTCTGCCTCCTGCTTG	0.582													ENSG00000197444																																					0													72.0	60.0	64.0					10																	50944187		2203	4300	6503	SO:0001583	missense	0			-	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2791G>A	10.37:g.50944187C>T	ENSP00000363216:p.Ala931Thr		A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.A931T	ENST00000374103.4	37	c.2791	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881701	0.51908	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;T	0.12569	2.67;2.67;2.67	4.56	3.62	0.41486	.	0.278989	0.33753	N	0.004590	T	0.13756	0.0333	L	0.58810	1.83	0.39343	D	0.965622	B;B;B	0.11235	0.004;0.0;0.002	B;B;B	0.12837	0.008;0.005;0.006	T	0.07385	-1.0775	10	0.66056	D	0.02	.	7.223	0.25999	0.0:0.6813:0.1617:0.157	.	874;722;931	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	T	931;874;722	ENSP00000363216:A931T;ENSP00000401356:A874T;ENSP00000390240:A722T	ENSP00000363216:A931T	A	-	1	0	OGDHL	50614193	0.212000	0.23540	1.000000	0.80357	0.936000	0.57629	0.859000	0.27858	2.352000	0.79861	0.462000	0.41574	GCA	-	OGDHL	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1		0.582	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	0	0		25	25		0.00		C	NM_018245		50944187	-1	9		12		tier1	no_errors	ENST00000374103	ensembl	human	known	74_37	missense	42.86		SNP	1.000	T	9	12
TACC2	10579	genome.wustl.edu	37	10	123970007	123970007	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr10:123970007G>A	ENST00000369005.1	+	9	6407	c.6067G>A	c.(6067-6069)Gtc>Atc	p.V2023I	TACC2_ENST00000515273.1_Missense_Mutation_p.V2027I|TACC2_ENST00000369004.3_Missense_Mutation_p.V101I|TACC2_ENST00000334433.3_Missense_Mutation_p.V2023I|TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000453444.2_Missense_Mutation_p.V2027I|TACC2_ENST00000260733.3_Missense_Mutation_p.V101I|TACC2_ENST00000493951.1_3'UTR|TACC2_ENST00000513429.1_Missense_Mutation_p.V169I|TACC2_ENST00000360561.3_Missense_Mutation_p.V101I|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000515603.1_Missense_Mutation_p.V1978I|TACC2_ENST00000368999.1_Missense_Mutation_p.V101I|TACC2_ENST00000358010.1_Missense_Mutation_p.V169I	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2023					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CTTCTCTGCCGTCTTCGATGA	0.562													ENSG00000138162																																					0													106.0	91.0	96.0					10																	123970007		2203	4300	6503	SO:0001583	missense	0			-	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.6067G>A	10.37:g.123970007G>A	ENSP00000358001:p.Val2023Ile		Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	pfam_TACC	p.V2023I	ENST00000369005.1	37	c.6067	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	G	17.38	3.373963	0.61735	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539	T;T;T;T;T;T;T;T;T;T;T;T	0.09073	3.92;3.53;3.97;3.96;3.92;3.53;3.97;3.39;3.42;3.4;3.41;3.02	5.64	5.64	0.86602	.	0.000000	0.33534	N	0.004810	T	0.27933	0.0688	M	0.65975	2.015	0.35159	D	0.770476	D;D;P;D;D;D;D;D;D	0.89917	0.957;0.997;0.879;0.997;0.997;0.957;0.957;0.957;1.0	P;P;B;P;P;P;P;P;D	0.63877	0.454;0.876;0.266;0.876;0.876;0.454;0.454;0.454;0.919	T	0.07252	-1.0782	10	0.54805	T	0.06	-14.224	19.7154	0.96115	0.0:0.0:1.0:0.0	.	118;2027;101;1978;2027;101;101;169;2023	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	I	2023;169;2027;1978;2023;169;2027;2013;101;101;101;101;118	ENSP00000358001:V2023I;ENSP00000425062:V169I;ENSP00000424467:V2027I;ENSP00000427618:V1978I;ENSP00000334280:V2023I;ENSP00000350701:V169I;ENSP00000395048:V2027I;ENSP00000353763:V101I;ENSP00000357995:V101I;ENSP00000422815:V101I;ENSP00000260733:V101I;ENSP00000420967:V118I	ENSP00000260733:V101I	V	+	1	0	TACC2	123959997	1.000000	0.71417	0.998000	0.56505	0.927000	0.56198	7.293000	0.78740	2.664000	0.90586	0.655000	0.94253	GTC	-	TACC2	-	NULL		0.562	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	0	0		23	23		0.00		G			123970007	+1	13		21		tier1	no_errors	ENST00000334433	ensembl	human	known	74_37	missense	37.14		SNP	1.000	A	13	21
CDH4	1002	genome.wustl.edu	37	20	60294111	60294112	+	Intron	DEL	CT	CT	-			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr20:60294111_60294112delCT	ENST00000360469.5	+	3	257				CDH4_ENST00000543233.1_Intron|RP11-429E11.3_ENST00000317652.1_Frame_Shift_Del_p.S39fs	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CCTGGCCACACTCGTGCTAATA	0.54													ENSG00000179253																																					0																																										SO:0001627	intron_variant	0				L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.170-24507CT>-	20.37:g.60294111_60294112delCT			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Frame_Shift_Del	DEL	NULL	p.S39fs	ENST00000360469.5	37	c.116_115	CCDS13488.1	20																																																																																				RP11-429E11.3	-	NULL		0.540	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000179253	Clone_based_vega_gene	protein_coding	OTTHUMT00000079965.2	0	0		46	46		0.00		CT	NM_001794		60294112	-1	24		12		tier1	no_errors	ENST00000317652	ensembl	human	known	74_37	frame_shift_del	66.67		DEL	0.000:0.000	-	24	12
LINC00461	645323	genome.wustl.edu	37	5	87963196	87963197	+	lincRNA	INS	-	-	A	rs147719390	byFrequency	TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr5:87963196_87963197insA	ENST00000384838.1	-	0	0					NR_030741.1				long intergenic non-protein coding RNA 461																		AAGGAGGAAGGAAAAAAAAATC	0.426													ENSG00000245526																																					0																																												0						5q14.3	2014-01-14			ENSG00000245526	ENSG00000245526		"""Long non-coding RNAs"""	42810	non-coding RNA	RNA, long non-coding							Standard	NR_015436		Approved	EyeLinc1, Visc-1a, Visc-1b	uc003kjg.3		OTTHUMG00000162632		5.37:g.87963205_87963205dupA				R	INS	-	NULL	ENST00000384838.1	37	NULL		5																																																																																				LINC00461	-	-		0.426	LINC00461-201	KNOWN	basic	miRNA	LINC00461	HGNC	lincRNA		0	0		37	37		0.00		-			87963197	-1	3		27		tier1	no_errors	ENST00000500197	ensembl	human	known	74_37	rna	10.00		INS	0.454:0.030	A	3	27
OR2AT4	341152	genome.wustl.edu	37	11	74799812	74799812	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr11:74799812C>T	ENST00000305159.3	-	1	987	c.947G>A	c.(946-948)tGt>tAt	p.C316Y		NM_001005285.1	NP_001005285.1	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT, member 4	316						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	12						GCTCCTGTCACAGCCTGGGTC	0.438													ENSG00000171561																																					0													137.0	117.0	124.0					11																	74799812		2200	4293	6493	SO:0001583	missense	0			-	BK004820	CCDS31639.1	11q13.4	2012-08-09			ENSG00000171561	ENSG00000171561		"""GPCR / Class A : Olfactory receptors"""	19620	protein-coding gene	gene with protein product							Standard	NM_001005285		Approved		uc010rro.2	A6NND4	OTTHUMG00000165370	ENST00000305159.3:c.947G>A	11.37:g.74799812C>T	ENSP00000304846:p.Cys316Tyr		B9EGZ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Olfact_rcpt	p.C316Y	ENST00000305159.3	37	c.947	CCDS31639.1	11	.	.	.	.	.	.	.	.	.	.	C	2.280	-0.364899	0.05103	.	.	ENSG00000171561	ENST00000305159	T	0.01998	4.51	3.52	-0.677	0.11357	.	.	.	.	.	T	0.00967	0.0032	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47459	-0.9116	9	0.02654	T	1	.	2.8999	0.05702	0.3802:0.3966:0.0:0.2232	.	316	A6NND4	O2AT4_HUMAN	Y	316	ENSP00000304846:C316Y	ENSP00000304846:C316Y	C	-	2	0	OR2AT4	74477460	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.047000	0.03521	-0.131000	0.11578	-0.895000	0.02911	TGT	-	OR2AT4	-	NULL		0.438	OR2AT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AT4	HGNC	protein_coding	OTTHUMT00000383734.1	0	0		63	63		0.00		C	NM_001005285		74799812	-1	29		55		tier1	no_errors	ENST00000305159	ensembl	human	known	74_37	missense	34.52		SNP	0.000	T	29	55
SMG5	23381	genome.wustl.edu	37	1	156231177	156231177	+	Missense_Mutation	SNP	C	C	A	rs200255563|rs147273481	byFrequency	TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:156231177C>A	ENST00000361813.5	-	14	2198	c.2054G>T	c.(2053-2055)cGc>cTc	p.R685L	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	685					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CACAGACAGGCGGTTCCACAG	0.552													ENSG00000198952																																					0													85.0	80.0	82.0					1																	156231177		2203	4300	6503	SO:0001583	missense	0			-	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2054G>T	1.37:g.156231177C>A	ENSP00000355261:p.Arg685Leu		D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	pfam_EST1,smart_PIN_dom	p.R685L	ENST00000361813.5	37	c.2054	CCDS1137.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.215287	0.95104	.	.	ENSG00000198952	ENST00000361813	T	0.24538	1.85	5.82	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	L	0.59436	1.845	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	T	0.05818	-1.0862	10	0.66056	D	0.02	-16.5894	13.0876	0.59151	0.0:0.9224:0.0:0.0776	.	685	Q9UPR3	SMG5_HUMAN	L	685	ENSP00000355261:R685L	ENSP00000355261:R685L	R	-	2	0	SMG5	154497801	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.010000	0.70753	2.757000	0.94681	0.561000	0.74099	CGC	-	SMG5	-	NULL		0.552	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1	0	0		52	52		0.00		C	NM_015327		156231177	-1	36		38		tier1	no_errors	ENST00000361813	ensembl	human	known	74_37	missense	47.37		SNP	1.000	A	36	38
KCNC2	3747	genome.wustl.edu	37	12	75435986	75435987	+	3'UTR	INS	-	-	T	rs537467144		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr12:75435986_75435987insT	ENST00000549446.1	-	0	3495_3496				RP11-81K13.1_ENST00000547040.1_RNA|RP11-81K13.1_ENST00000549762.1_RNA|KCNC2_ENST00000341669.3_Intron|KCNC2_ENST00000550433.1_Intron|KCNC2_ENST00000548513.1_Intron|KCNC2_ENST00000350228.2_Intron|RP11-81K13.1_ENST00000550049.1_RNA|KCNC2_ENST00000298972.1_Intron	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2						action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	AACCCTGGGTATTTTTTTTTTT	0.371													ENSG00000257434																																					0																																										SO:0001624	3_prime_UTR_variant	0				AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.*899->A	12.37:g.75435997_75435997dupT			B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	R	INS	-	NULL	ENST00000549446.1	37	NULL	CCDS9007.1	12																																																																																				RP11-81K13.1	-	-		0.371	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000257434	Clone_based_vega_gene	protein_coding	OTTHUMT00000405581.2	0	0		22	22		0.00		-	NM_153748		75435987	+1	3		21		tier1	no_errors	ENST00000547040	ensembl	human	known	74_37	rna	12.50		INS	0.003:0.005	T	3	21
ZNF521	25925	genome.wustl.edu	37	18	22805728	22805728	+	Silent	SNP	G	G	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr18:22805728G>T	ENST00000361524.3	-	4	2302	c.2154C>A	c.(2152-2154)acC>acA	p.T718T	ZNF521_ENST00000538137.2_Silent_p.T718T|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Silent_p.T498T	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	718					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AGAAGACAAAGGTGTGCATGT	0.438			T	PAX5	ALL								ENSG00000198795																												Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													100.0	99.0	100.0					18																	22805728		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2154C>A	18.37:g.22805728G>T			A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T718	ENST00000361524.3	37	c.2154	CCDS32806.1	18																																																																																			-	ZNF521	-	pfscan_Znf_C2H2		0.438	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	0	0		43	43		0.00		G	NM_015461		22805728	-1	4		43		tier1	no_errors	ENST00000361524	ensembl	human	known	74_37	silent	8.51		SNP	1.000	T	4	43
HRNR	388697	genome.wustl.edu	37	1	152188496	152188496	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:152188496C>T	ENST00000368801.2	-	3	5684	c.5609G>A	c.(5608-5610)gGa>gAa	p.G1870E	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1870					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGACCAAATCCAGAAGACTG	0.577													ENSG00000197915																																					0													502.0	793.0	695.0					1																	152188496		2171	4298	6469	SO:0001583	missense	0			-	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5609G>A	1.37:g.152188496C>T	ENSP00000357791:p.Gly1870Glu		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.G1870E	ENST00000368801.2	37	c.5609	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	6.780	0.512944	0.12944	.	.	ENSG00000197915	ENST00000368801	T	0.06294	3.32	3.93	1.94	0.25998	.	.	.	.	.	T	0.02119	0.0066	M	0.62723	1.935	0.09310	N	1	B	0.33694	0.421	B	0.27500	0.08	T	0.43130	-0.9410	9	0.17832	T	0.49	.	10.1414	0.42738	0.0:0.5832:0.4168:0.0	.	1870	Q86YZ3	HORN_HUMAN	E	1870	ENSP00000357791:G1870E	ENSP00000357791:G1870E	G	-	2	0	HRNR	150455120	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.284000	0.18864	0.392000	0.25172	0.558000	0.71614	GGA	-	HRNR	-	NULL		0.577	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	1	1		589	589		0.17		C	XM_373868		152188496	-1	62		588		tier1	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	9.54		SNP	0.001	T	62	588
TNRC18	84629	genome.wustl.edu	37	7	5417646	5417646	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr7:5417646C>A	ENST00000430969.1	-	6	2510	c.2162G>T	c.(2161-2163)cGa>cTa	p.R721L	TNRC18_ENST00000399537.4_Missense_Mutation_p.R721L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	721							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CTCATCTGCTCGGCCGTGCCC	0.706													ENSG00000182095																																					0													33.0	39.0	37.0					7																	5417646		2080	4195	6275	SO:0001583	missense	0			-	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2162G>T	7.37:g.5417646C>A	ENSP00000395538:p.Arg721Leu		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.R721L	ENST00000430969.1	37	c.2162	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	C	10.04	1.242635	0.22796	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000413081	T;T	0.14266	2.52;2.52	4.38	4.38	0.52667	.	.	.	.	.	T	0.28067	0.0692	M	0.62723	1.935	0.27159	N	0.961201	D	0.60575	0.988	P	0.58873	0.847	T	0.03875	-1.0996	9	0.42905	T	0.14	.	10.6146	0.45443	0.0:0.9085:0.0:0.0915	.	721	O15417	TNC18_HUMAN	L	721;721;123	ENSP00000382452:R721L;ENSP00000395538:R721L	ENSP00000382452:R721L	R	-	2	0	TNRC18	5384172	0.990000	0.36364	0.270000	0.24601	0.391000	0.30476	3.175000	0.50855	2.129000	0.65627	0.561000	0.74099	CGA	-	TNRC18	-	NULL		0.706	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		0	0		20	20		0.00		C			5417646	-1	10		16		tier1	no_errors	ENST00000399537	ensembl	human	known	74_37	missense	37.04		SNP	0.726	A	10	16
RPLP2	6181	genome.wustl.edu	37	11	810010	810018	+	5'UTR	DEL	CTCCGCCGC	CTCCGCCGC	-	rs11540443|rs17155725|rs542687757	byFrequency	TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	CTCCGCCGC	CTCCGCCGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr11:810010_810018delCTCCGCCGC	ENST00000321153.4	+	0	364_372				SNORA52_ENST00000362915.1_RNA|PIDD_ENST00000534649.1_5'Flank|RPLP2_ENST00000532004.1_3'UTR|RPLP2_ENST00000530797.1_5'UTR	NM_001004.3	NP_000995.1	P05387	RLA2_HUMAN	ribosomal protein, large, P2						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGTGAGACTTCTCCGCCGCCTCCGCCGCA	0.713													ENSG00000177600		1438	0.287141	0.0877	0.2017	5008	,	,		15128	0.4018		0.3161	False		,,,				2504	0.4693																0																																										SO:0001623	5_prime_UTR_variant	0				M17887	CCDS7717.1	11p15.5	2011-07-29			ENSG00000177600	ENSG00000177600		"""L ribosomal proteins"""	10377	protein-coding gene	gene with protein product	"""60S acidic ribosomal protein P2"", ""acidic ribosomal phosphoprotein P2"""	180530		D11S2243E		3323886	Standard	NM_001004		Approved	P2, RPP2, MGC71408, LP2	uc001lrq.1	P05387	OTTHUMG00000133317	ENST00000321153.4:c.-23CTCCGCCGC>-	11.37:g.810019_810027delCTCCGCCGC			Q6FG96	R	DEL	-	NULL	ENST00000321153.4	37	NULL	CCDS7717.1	11																																																																																				RPLP2	-	-		0.713	RPLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPLP2	HGNC	protein_coding	OTTHUMT00000257115.2									CTCCGCCGC	NM_001004		810018	+1					tier1	no_errors	ENST00000532004	ensembl	human	known	74_37	rna			DEL	0.000:0.000:0.006:0.006:0.009:0.013:0.013:0.025:0.024	-		
NLRP13	126204	genome.wustl.edu	37	19	56416319	56416319	+	Silent	SNP	T	T	C			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr19:56416319T>C	ENST00000342929.3	-	8	2606	c.2607A>G	c.(2605-2607)ttA>ttG	p.L869L	NLRP13_ENST00000588751.1_Silent_p.L869L	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	869							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CCAGTCTCTCTAAGGCACACT	0.423													ENSG00000173572																																					0													91.0	78.0	82.0					19																	56416319		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2607A>G	19.37:g.56416319T>C			Q7RTR5	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.L869	ENST00000342929.3	37	c.2607	CCDS33119.1	19																																																																																			-	NLRP13	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.423	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	0	0		52	52		0.00		T	NM_176810		56416319	-1	16		30		tier1	no_errors	ENST00000342929	ensembl	human	known	74_37	silent	34.78		SNP	0.000	C	16	30
CCDC54	84692	genome.wustl.edu	37	3	107097189	107097189	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr3:107097189C>A	ENST00000261058.1	+	1	1002	c.755C>A	c.(754-756)aCt>aAt	p.T252N		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	252										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						ATCAAGCTAACTTTTGTTCAT	0.388													ENSG00000138483																																					0													95.0	103.0	100.0					3																	107097189		2203	4300	6503	SO:0001583	missense	0			-	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.755C>A	3.37:g.107097189C>A	ENSP00000261058:p.Thr252Asn		Q96A43	Missense_Mutation	SNP	NULL	p.T252N	ENST00000261058.1	37	c.755	CCDS2949.1	3	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316335	0.60524	.	.	ENSG00000138483	ENST00000261058	T	0.54866	0.55	4.85	4.85	0.62838	.	0.138126	0.33144	N	0.005234	T	0.68421	0.2999	M	0.64997	1.995	0.32392	N	0.553095	D	0.89917	1.0	D	0.77004	0.989	T	0.76377	-0.2981	10	0.72032	D	0.01	-11.2633	13.4648	0.61247	0.0:1.0:0.0:0.0	.	252	Q8NEL0	CCD54_HUMAN	N	252	ENSP00000261058:T252N	ENSP00000261058:T252N	T	+	2	0	CCDC54	108579879	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	3.488000	0.53229	2.243000	0.73865	0.460000	0.39030	ACT	-	CCDC54	-	NULL		0.388	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC54	HGNC	protein_coding	OTTHUMT00000353651.1	0	0		63	63		0.00		C	NM_032600		107097189	+1	6		66		tier1	no_errors	ENST00000261058	ensembl	human	known	74_37	missense	8.33		SNP	1.000	A	6	66
MAML3	55534	genome.wustl.edu	37	4	140812037	140812037	+	Missense_Mutation	SNP	A	A	G			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr4:140812037A>G	ENST00000509479.2	-	2	1409	c.553T>C	c.(553-555)Ttt>Ctt	p.F185L	MAML3_ENST00000327122.5_Missense_Mutation_p.F29L|MAML3_ENST00000398940.1_5'Flank	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GTCGGAGAAAAATTCCCATCA	0.468													ENSG00000196782																																					0													74.0	69.0	70.0					4																	140812037		1955	4151	6106	SO:0001583	missense	0			-	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.553T>C	4.37:g.140812037A>G	ENSP00000421180:p.Phe185Leu			Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.F185L	ENST00000509479.2	37	c.553	CCDS54805.1	4	.	.	.	.	.	.	.	.	.	.	A	11.22	1.575261	0.28092	.	.	ENSG00000196782	ENST00000509479;ENST00000327122	T	0.24151	1.87	5.3	5.3	0.74995	.	0.059344	0.64402	D	0.000002	T	0.21267	0.0512	L	0.31065	0.9	0.80722	D	1	P	0.48089	0.905	B	0.44224	0.444	T	0.02909	-1.1095	10	0.11794	T	0.64	.	15.263	0.73640	1.0:0.0:0.0:0.0	.	185	Q96JK9	MAML3_HUMAN	L	185;29	ENSP00000421180:F185L	ENSP00000313316:F29L	F	-	1	0	MAML3	141031487	1.000000	0.71417	0.992000	0.48379	0.941000	0.58515	8.905000	0.92613	1.999000	0.58509	0.477000	0.44152	TTT	-	MAML3	-	NULL		0.468	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	0	0		47	47		0.00		A			140812037	-1	23		35		tier1	no_errors	ENST00000509479	ensembl	human	known	74_37	missense	39.66		SNP	1.000	G	23	35
ZNF285	26974	genome.wustl.edu	37	19	44892206	44892206	+	Silent	SNP	C	C	A	rs73557001		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr19:44892206C>A	ENST00000330997.4	-	4	265	c.201G>T	c.(199-201)tcG>tcT	p.S67S	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Silent_p.S74S|ZNF285_ENST00000544719.2_Silent_p.S67S	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	67	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GCACTTCTTGCGAAAGGTAAC	0.413													ENSG00000267508																																					0													87.0	91.0	89.0					19																	44892206		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.201G>T	19.37:g.44892206C>A			Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S67	ENST00000330997.4	37	c.201	CCDS12638.1	19																																																																																			rs73557001	ZNF285	-	pfscan_Krueppel-associated_box		0.413	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	0	0		34	34		0.00		C	NM_152354		44892206	-1	8		49		tier1	no_errors	ENST00000330997	ensembl	human	known	74_37	silent	14.04		SNP	0.000	A	8	49
SMPDL3B	27293	genome.wustl.edu	37	1	28285146	28285146	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:28285146C>A	ENST00000373894.3	+	8	1356	c.1165C>A	c.(1165-1167)Ctg>Atg	p.L389M	RP11-460I13.2_ENST00000448015.1_RNA|XKR8_ENST00000373884.5_5'Flank|SMPDL3B_ENST00000549094.1_Missense_Mutation_p.L341M	NM_014474.2	NP_055289.2	Q92485	ASM3B_HUMAN	sphingomyelin phosphodiesterase, acid-like 3B	389					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	16		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		CCAGAGCACACTGCAGCGCTA	0.632													ENSG00000130768																																					0													87.0	77.0	81.0					1																	28285146		2203	4300	6503	SO:0001583	missense	0			-	Y08134	CCDS30655.1, CCDS30656.1	1p35.3	2008-02-05			ENSG00000130768	ENSG00000130768			21416	protein-coding gene	gene with protein product							Standard	NM_014474		Approved	ASML3B	uc001bpg.3	Q92485	OTTHUMG00000003910	ENST00000373894.3:c.1165C>A	1.37:g.28285146C>A	ENSP00000363001:p.Leu389Met		B7ZB35|Q5T0Z0|Q96CB7	Missense_Mutation	SNP	pfam_PEstase_dom,pirsf_ASM-like_Pdiesterase_prd	p.L389M	ENST00000373894.3	37	c.1165	CCDS30655.1	1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885145	0.33255	.	.	ENSG00000130768	ENST00000373894;ENST00000549094;ENST00000412515	D;D	0.89415	-2.51;-2.51	5.09	2.19	0.27852	.	0.158718	0.44097	D	0.000494	D	0.93910	0.8051	M	0.88105	2.93	0.30424	N	0.777829	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.959	D	0.90285	0.4318	10	0.45353	T	0.12	-5.1793	10.1345	0.42697	0.0:0.7787:0.0:0.2213	.	341;389	F8VWW8;Q92485	.;ASM3B_HUMAN	M	389;341;315	ENSP00000363001:L389M;ENSP00000449450:L341M	ENSP00000363001:L389M	L	+	1	2	SMPDL3B	28157733	0.115000	0.22152	0.018000	0.16275	0.001000	0.01503	0.705000	0.25675	0.269000	0.21961	-0.258000	0.10820	CTG	-	SMPDL3B	-	pirsf_ASM-like_Pdiesterase_prd		0.632	SMPDL3B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMPDL3B	HGNC	protein_coding	OTTHUMT00000011170.1	0	0		20	20		0.00		C	NM_014474		28285146	+1	12		10		tier1	no_errors	ENST00000373894	ensembl	human	known	74_37	missense	54.55		SNP	0.782	A	12	10
CHODL	140578	genome.wustl.edu	37	21	19629315	19629315	+	Missense_Mutation	SNP	G	G	A	rs202176979		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr21:19629315G>A	ENST00000299295.2	+	3	809	c.418G>A	c.(418-420)Gga>Aga	p.G140R	CHODL_ENST00000400135.1_Missense_Mutation_p.G99R|CHODL_ENST00000543733.1_Missense_Mutation_p.G121R|CHODL_ENST00000400127.1_Missense_Mutation_p.G99R|CHODL_ENST00000400128.1_Missense_Mutation_p.G99R|CHODL_ENST00000338326.3_Missense_Mutation_p.G99R|CHODL_ENST00000400131.1_Missense_Mutation_p.G99R	NM_001204175.1|NM_024944.2	NP_001191104.1|NP_079220.2	Q9H9P2	CHODL_HUMAN	chondrolectin	140	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)			kidney(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		ACCTTCCTGCGGAAGTGAAAA	0.453													ENSG00000154645	G|||	1	0.000199681	0.0	0.0	5008	,	,		18703	0.001		0.0	False		,,,				2504	0.0																0													86.0	79.0	82.0					21																	19629315		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AF257472	CCDS13570.1, CCDS56208.1, CCDS56209.1, CCDS56210.1	21q11.2	2006-04-03	2002-07-04		ENSG00000154645	ENSG00000154645			17807	protein-coding gene	gene with protein product		607247	"""chromosome 21 open reading frame 68"""	C21orf68		12079284	Standard	NM_024944		Approved	FLJ12627, PRED12, MT75	uc021whs.1	Q9H9P2	OTTHUMG00000074519	ENST00000299295.2:c.418G>A	21.37:g.19629315G>A	ENSP00000299295:p.Gly140Arg		B2R9C0|B4DJB8|Q7Z798|Q7Z799|Q7Z7A0|Q9HCY3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G140R	ENST00000299295.2	37	c.418	CCDS13570.1	21	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	33	5.286362	0.95517	.	.	ENSG00000154645	ENST00000400128;ENST00000400131;ENST00000400135;ENST00000400127;ENST00000299295;ENST00000338326;ENST00000543733	T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16	5.57	5.57	0.84162	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.54208	0.1844	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.59037	-0.7529	9	.	.	.	-16.4756	18.5511	0.91065	0.0:0.0:1.0:0.0	.	140;121;99	Q9H9P2;B4DJB8;Q9H9P2-3	CHODL_HUMAN;.;.	R	99;99;99;99;140;99;121	ENSP00000382993:G99R;ENSP00000382996:G99R;ENSP00000383001:G99R;ENSP00000382992:G99R;ENSP00000299295:G140R;ENSP00000339975:G99R;ENSP00000443566:G121R	.	G	+	1	0	CHODL	18551186	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.619000	0.88677	0.650000	0.86243	GGA	rs202176979	CHODL	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.453	CHODL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHODL	HGNC	protein_coding	OTTHUMT00000158232.1	0	0		72	72		0.00		G	NM_024944		19629315	+1	42		38		tier1	no_errors	ENST00000299295	ensembl	human	known	74_37	missense	52.50		SNP	1.000	A	42	38
BRD8	10902	genome.wustl.edu	37	5	137501727	137501727	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr5:137501727G>T	ENST00000254900.5	-	11	1439	c.1068C>A	c.(1066-1068)gaC>gaA	p.D356E	BRD8_ENST00000411594.2_Missense_Mutation_p.D359E|BRD8_ENST00000455658.2_Missense_Mutation_p.D315E|BRD8_ENST00000230901.5_Missense_Mutation_p.D429E|BRD8_ENST00000515014.1_5'Flank|BRD8_ENST00000402931.1_Missense_Mutation_p.D356E	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	356					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTTCACTGCTGTCCATGGAAA	0.468													ENSG00000112983																																					0													147.0	140.0	142.0					5																	137501727		2203	4300	6503	SO:0001583	missense	0			-	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.1068C>A	5.37:g.137501727G>T	ENSP00000254900:p.Asp356Glu		O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,superfamily_Peptidase_M20_dimer,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.D356E	ENST00000254900.5	37	c.1068	CCDS4198.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.58|17.58	3.424303|3.424303	0.62733|0.62733	.|.	.|.	ENSG00000112983|ENSG00000112983	ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658;ENST00000453824|ENST00000441656	T;T;T;T;T;T;T|.	0.34667|.	1.85;1.35;1.44;1.41;1.63;1.44;1.61|.	5.64|5.64	3.25|3.25	0.37280|0.37280	.|.	0.302902|.	0.37857|.	N|.	0.001910|.	T|T	0.39200|0.39200	0.1069|0.1069	N|N	0.24115|0.24115	0.695|0.695	0.45914|0.45914	D|D	0.998755|0.998755	D;D;D;D;P;D;D;D|.	0.76494|.	0.999;0.998;0.994;0.994;0.94;0.998;0.996;0.998|.	D;D;D;D;P;P;D;D|.	0.81914|.	0.995;0.99;0.978;0.978;0.647;0.875;0.99;0.99|.	T|T	0.11641|0.11641	-1.0579|-1.0579	10|5	0.37606|.	T|.	0.19|.	-15.8322|-15.8322	6.4968|6.4968	0.22146|0.22146	0.6652:0.0:0.3348:0.0|0.6652:0.0:0.3348:0.0	.|.	315;340;135;429;359;250;429;356|.	F8W820;B4DN43;B4DMS9;A8K1N6;Q9H0E9-4;Q9H0E9-3;Q9H0E9-2;Q9H0E9|.	.;.;.;.;.;.;.;BRD8_HUMAN|.	E|K	356;385;354;429;356;359;250;315;174|350	ENSP00000254900:D356E;ENSP00000398067:D385E;ENSP00000398873:D354E;ENSP00000230901:D429E;ENSP00000384845:D356E;ENSP00000394330:D359E;ENSP00000408396:D315E|.	ENSP00000230901:D429E|.	D|T	-|-	3|2	2|0	BRD8|BRD8	137529626|137529626	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.499000|1.499000	0.35671|0.35671	1.160000|1.160000	0.42584|0.42584	-0.312000|-0.312000	0.09012|0.09012	GAC|ACA	-	BRD8	-	NULL		0.468	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	0	0		67	67		0.00		G	NM_006696		137501727	-1	4		45		tier1	no_errors	ENST00000254900	ensembl	human	known	74_37	missense	8.16		SNP	1.000	T	4	45
FAM157A	728262	genome.wustl.edu	37	3	197880164	197880164	+	lincRNA	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr3:197880164G>A	ENST00000437428.2	+	0	44							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcagcaAC	0.527													ENSG00000236438																																					0													3.0	6.0	5.0					3																	197880164		474	1113	1587			0			-			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880164G>A				R	SNP	-	NULL	ENST00000437428.2	37	NULL		3																																																																																			-	FAM157A	-	-		0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	FAM157A	HGNC	lincRNA	OTTHUMT00000340078.2	0	0		35	35		0.00		G	NM_001145248		197880164	+1	8		31		tier1	no_errors	ENST00000431569	ensembl	human	known	74_37	rna	20.51		SNP	0.002	A	8	31
TP53	7157	genome.wustl.edu	37	17	7577095	7577095	+	Missense_Mutation	SNP	G	G	C			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr17:7577095G>C	ENST00000269305.4	-	8	1032	c.843C>G	c.(841-843)gaC>gaG	p.D281E	TP53_ENST00000359597.4_Missense_Mutation_p.D281E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.D281E|TP53_ENST00000455263.2_Missense_Mutation_p.D281E|TP53_ENST00000445888.2_Missense_Mutation_p.D281E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	281	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D281E(28)|p.R282W(10)|p.0?(8)|p.D281D(5)|p.?(2)|p.D281fs*63(2)|p.R280_D281delRD(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282fs*24(1)|p.D281R(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGTGCGCCGGTCTCTCCCAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	72	Substitution - Missense(39)|Deletion - In frame(8)|Whole gene deletion(8)|Substitution - coding silent(5)|Deletion - Frameshift(4)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - Frameshift(1)|Insertion - In frame(1)	skin(12)|upper_aerodigestive_tract(8)|ovary(8)|haematopoietic_and_lymphoid_tissue(7)|breast(6)|lung(5)|central_nervous_system(4)|bone(4)|urinary_tract(3)|oesophagus(3)|liver(3)|stomach(2)|endometrium(2)|large_intestine(1)|vulva(1)|genital_tract(1)|pancreas(1)|prostate(1)											82.0	70.0	74.0					17																	7577095		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.843C>G	17.37:g.7577095G>C	ENSP00000269305:p.Asp281Glu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.D281E	ENST00000269305.4	37	c.843	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105939	0.77096	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99861	-7.26;-7.26;-7.26;-7.26;-7.26;-7.26	4.99	0.696	0.18075	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	M	0.92649	3.33	0.53005	D	0.999961	D;D;D;P	0.71674	0.993;0.998;0.995;0.916	D;D;D;D	0.91635	0.965;0.999;0.951;0.943	D	0.98567	1.0644	10	0.87932	D	0	-25.6697	7.6418	0.28298	0.4422:0.0:0.5578:0.0	.	281;281;281;281	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	E	281;281;281;281;281;270;149	ENSP00000352610:D281E;ENSP00000269305:D281E;ENSP00000398846:D281E;ENSP00000391127:D281E;ENSP00000391478:D281E;ENSP00000425104:D149E	ENSP00000269305:D281E	D	-	3	2	TP53	7517820	1.000000	0.71417	0.915000	0.36163	0.964000	0.63967	1.949000	0.40313	0.286000	0.22352	0.462000	0.41574	GAC	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0		47	47		0.00		G	NM_000546		7577095	-1	22		24		tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	47.83		SNP	0.993	C	22	24
PDZD2	23037	genome.wustl.edu	37	5	32089879	32089879	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr5:32089879C>T	ENST00000438447.1	+	20	6713	c.6325C>T	c.(6325-6327)Cca>Tca	p.P2109S	PDZD2_ENST00000282493.3_Missense_Mutation_p.P2109S			O15018	PDZD2_HUMAN	PDZ domain containing 2	2109					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TGGTAACAAGCCAGCTGAAAG	0.522													ENSG00000133401																																					0													82.0	86.0	85.0					5																	32089879		2203	4300	6503	SO:0001583	missense	0			-	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.6325C>T	5.37:g.32089879C>T	ENSP00000402033:p.Pro2109Ser		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P2109S	ENST00000438447.1	37	c.6325	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	C	9.955	1.221212	0.22457	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.07444	3.19;3.19	5.42	1.02	0.19986	.	0.976695	0.08379	N	0.954782	T	0.05364	0.0142	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.45234	-0.9275	10	0.25751	T	0.34	.	5.7311	0.18040	0.0:0.5789:0.1466:0.2745	.	2109	O15018	PDZD2_HUMAN	S	2109;1910;2109	ENSP00000402033:P2109S;ENSP00000282493:P2109S	ENSP00000282493:P2109S	P	+	1	0	PDZD2	32125636	0.000000	0.05858	0.069000	0.20011	0.042000	0.13812	-0.049000	0.11924	0.255000	0.21593	-0.137000	0.14449	CCA	-	PDZD2	-	NULL		0.522	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	0	0		41	41		0.00		C			32089879	+1	3		20		tier1	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	13.04		SNP	0.004	T	3	20
RP11-782C8.2	0	genome.wustl.edu	37	1	143210651	143210651	+	lincRNA	SNP	A	A	G			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:143210651A>G	ENST00000412204.2	-	0	419				RP11-782C8.1_ENST00000438000.1_lincRNA																							AACAAACTCAAAAGCATAAAT	0.284													ENSG00000232274																																					0																																												0			-																													1.37:g.143210651A>G				R	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	RP11-782C8.2	-	-		0.284	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	0	0		17	17		0.00		A			143210651	-1	6		15		tier1	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	28.57		SNP	0.001	G	6	15
SLC30A5	64924	genome.wustl.edu	37	5	68411962	68411962	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr5:68411962G>T	ENST00000396591.3	+	9	1603	c.993G>T	c.(991-993)atG>atT	p.M331I	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	331					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TTCGGGCTATGAACAAAGCAG	0.428													ENSG00000145740																																					0													114.0	118.0	117.0					5																	68411962		2203	4300	6503	SO:0001583	missense	0			-	AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.993G>T	5.37:g.68411962G>T	ENSP00000379836:p.Met331Ile		B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.M331I	ENST00000396591.3	37	c.993	CCDS3996.1	5	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772817	0.31411	.	.	ENSG00000145740	ENST00000396591	T	0.62941	-0.01	5.68	2.77	0.32553	.	0.139230	0.85682	D	0.000000	T	0.42245	0.1194	N	0.16307	0.4	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.25222	-1.0138	10	0.42905	T	0.14	.	8.7987	0.34896	0.1384:0.1238:0.7378:0.0	.	160;160;331	Q9H9X0;Q8TAD4-2;Q8TAD4	.;.;ZNT5_HUMAN	I	331	ENSP00000379836:M331I	ENSP00000379836:M331I	M	+	3	0	SLC30A5	68447718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.041000	0.49807	0.876000	0.35872	0.585000	0.79938	ATG	-	SLC30A5	-	NULL		0.428	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	0	0		24	24		0.00		G			68411962	+1	4		21		tier1	no_errors	ENST00000396591	ensembl	human	known	74_37	missense	16.00		SNP	1.000	T	4	21
FDXACB1	91893	genome.wustl.edu	37	11	111745984	111745984	+	Missense_Mutation	SNP	G	G	A	rs374516075		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr11:111745984G>A	ENST00000260257.4	-	5	1584	c.1537C>T	c.(1537-1539)Cgt>Tgt	p.R513C	ALG9_ENST00000524880.1_Intron|FDXACB1_ENST00000542429.1_Missense_Mutation_p.R364C|ALG9_ENST00000527377.1_Intron	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	513					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						TTCAGGAAACGGTTATCAAAC	0.378													ENSG00000255561	G|||	1	0.000199681	0.0008	0.0	5008	,	,		22200	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/ARG	1,3723		0,1,1861	51.0	50.0	50.0		1537	6.1	1.0	11		50	0,8214		0,0,4107	no	missense	FDXACB1	NM_138378.2	180	0,1,5968	AA,AG,GG		0.0,0.0269,0.0084	probably-damaging	513/625	111745984	1,11937	1862	4107	5969	SO:0001583	missense	0			-		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.1537C>T	11.37:g.111745984G>A	ENSP00000260257:p.Arg513Cys		A0PJW7|B4DUU2	Missense_Mutation	SNP	pfam_DUF2431,pfam_PheS_beta_Fdx_antiC-bd,superfamily_PheS_beta_Fdx_antiC-bd,smart_PheS_beta_Fdx_antiC-bd	p.R513C	ENST00000260257.4	37	c.1537	CCDS44729.1	11	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730556	0.69074	2.69E-4	0.0	ENSG00000255561	ENST00000260257;ENST00000542429	T;D	0.83419	-0.73;-1.72	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.90741	0.7094	M	0.83012	2.62	0.80722	D	1	D	0.76494	0.999	P	0.62885	0.908	D	0.91426	0.5162	10	0.87932	D	0	.	15.3709	0.74564	0.0:0.0:0.8606:0.1393	.	513	Q9BRP7	FDXA1_HUMAN	C	513;364	ENSP00000260257:R513C;ENSP00000441304:R364C	ENSP00000260257:R513C	R	-	1	0	FDXACB1	111251194	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.868000	0.63021	2.884000	0.98904	0.655000	0.94253	CGT	-	FDXACB1	-	NULL		0.378	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDXACB1	HGNC	protein_coding	OTTHUMT00000391497.1	0	0		55	55		0.00		G	NM_138378		111745984	-1	20		52		tier1	no_errors	ENST00000260257	ensembl	human	known	74_37	missense	27.78		SNP	0.998	A	20	52
FAM109A	144717	genome.wustl.edu	37	12	111801137	111801137	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr12:111801137G>A	ENST00000547838.2	-	2	192	c.95C>T	c.(94-96)gCg>gTg	p.A32V	FAM109A_ENST00000548163.1_Missense_Mutation_p.A32V|FAM109A_ENST00000392658.5_Missense_Mutation_p.A32V|FAM109A_ENST00000450786.2_Missense_Mutation_p.R13W|FAM109A_ENST00000361483.3_Missense_Mutation_p.A45V			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	32	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|lung(1)|ovary(1)	4						GTGGTAGGCCGCGTGCCGCCC	0.657													ENSG00000198324																																					0													24.0	26.0	25.0					12																	111801137		2197	4297	6494	SO:0001583	missense	0			-	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.95C>T	12.37:g.111801137G>A	ENSP00000447353:p.Ala32Val		J3KP50|Q6PJL9|Q96MH8	Missense_Mutation	SNP	NULL	p.R13W	ENST00000547838.2	37	c.37	CCDS9152.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.019238|4.019238	0.75275|0.75275	.|.	.|.	ENSG00000198324|ENSG00000198324	ENST00000547838;ENST00000361483;ENST00000392658;ENST00000425655;ENST00000548163;ENST00000547710;ENST00000551863;ENST00000549321|ENST00000450786	T;T;T;T;T;T;T|.	0.30981|.	1.51;1.51;1.51;1.51;1.51;1.51;1.51|.	4.59|4.59	4.59|4.59	0.56863|0.56863	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	.|.	.|.	.|.	.|.	T|T	0.54481|0.54481	0.1861|0.1861	N|N	0.17800|0.17800	0.525|0.525	0.36895|0.36895	D|D	0.890096|0.890096	D;D|D	0.61697|0.76494	0.99;0.99|0.999	P;P|P	0.45639|0.56916	0.488;0.488|0.809	T|T	0.67126|0.67126	-0.5749|-0.5749	9|8	0.51188|0.87932	T|D	0.08|0	.|.	17.4068|17.4068	0.87475|0.87475	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	32;32|13	Q8N4B1;B4DRN3|G3V0F1	SESQ1_HUMAN;.|.	V|W	32;45;32;32;32;32;32;32|13	ENSP00000447353:A32V;ENSP00000354461:A45V;ENSP00000376426:A32V;ENSP00000449994:A32V;ENSP00000447349:A32V;ENSP00000448625:A32V;ENSP00000447539:A32V|.	ENSP00000354461:A45V|ENSP00000390552:R13W	A|R	-|-	2|1	0|2	FAM109A|FAM109A	110285520|110285520	1.000000|1.000000	0.71417|0.71417	0.012000|0.012000	0.15200|0.15200	0.611000|0.611000	0.37282|0.37282	9.543000|9.543000	0.98089|0.98089	2.095000|2.095000	0.63458|0.63458	0.561000|0.561000	0.74099|0.74099	GCG|CGG	-	FAM109A	-	NULL		0.657	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM109A	HGNC	protein_coding	OTTHUMT00000404768.2	0	0		48	48		0.00		G	NM_144671		111801137	-1	24		31		tier1	no_errors	ENST00000450786	ensembl	human	known	74_37	missense	43.64		SNP	0.999	A	24	31
ZBTB4	57659	genome.wustl.edu	37	17	7366451	7366451	+	Missense_Mutation	SNP	C	C	T	rs200881841		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr17:7366451C>T	ENST00000311403.4	-	4	2189	c.1850G>A	c.(1849-1851)cGc>cAc	p.R617H	ZBTB4_ENST00000380599.4_Missense_Mutation_p.R617H	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	617	Glu-rich.				cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		CTCTGAGATGCGGCGCTTGAC	0.647													ENSG00000174282																																					0													48.0	32.0	38.0					17																	7366451		2201	4300	6501	SO:0001583	missense	0			-	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.1850G>A	17.37:g.7366451C>T	ENSP00000307858:p.Arg617His		B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R617H	ENST00000311403.4	37	c.1850	CCDS11107.1	17	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924187	0.34002	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.03663	3.85;3.85	4.87	4.87	0.63330	.	0.144593	0.45606	D	0.000346	T	0.02193	0.0068	N	0.12569	0.235	0.33128	D	0.542739	P	0.49358	0.923	B	0.41332	0.354	T	0.41251	-0.9519	10	0.07990	T	0.79	-14.3087	10.5261	0.44950	0.0:0.9099:0.0:0.0901	.	617	Q9P1Z0	ZBTB4_HUMAN	H	617	ENSP00000307858:R617H;ENSP00000369973:R617H	ENSP00000307858:R617H	R	-	2	0	ZBTB4	7307175	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.420000	0.52735	2.533000	0.85409	0.462000	0.41574	CGC	rs200881841	ZBTB4	-	NULL		0.647	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB4	HGNC	protein_coding	OTTHUMT00000226940.2	0	0		42	42		0.00		C	NM_020899		7366451	-1	19		20		tier1	no_errors	ENST00000311403	ensembl	human	known	74_37	missense	48.72		SNP	1.000	T	19	20
FAM157A	728262	genome.wustl.edu	37	3	197880166	197880166	+	lincRNA	SNP	A	A	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr3:197880166A>T	ENST00000437428.2	+	0	46							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						cagcagcagcagcagcaACTG	0.532													ENSG00000236438																																					0													2.0	6.0	5.0					3																	197880166		422	1075	1497			0			-			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880166A>T				R	SNP	-	NULL	ENST00000437428.2	37	NULL		3	.	.	.	.	.	.	.	.	.	.	.	0.065	-1.214570	0.01555	.	.	ENSG00000236438	ENST00000431569	.	.	.	.	.	.	.	.	.	.	.	T	0.15305	0.0369	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29243	-1.0018	5	.	.	.	.	.	.	.	.	82	C9JC47	F157A_HUMAN	L	82	.	.	Q	+	2	0	FAM157A	199364563	0.006000	0.16342	0.003000	0.11579	0.003000	0.03518	0.140000	0.16056	0.056000	0.16144	0.055000	0.15244	CAG	-	FAM157A	-	-		0.532	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	FAM157A	HGNC	lincRNA	OTTHUMT00000340078.2	0	0		34	34		0.00		A	NM_001145248		197880166	+1	8		31		tier1	no_errors	ENST00000431569	ensembl	human	known	74_37	rna	20.51		SNP	0.003	T	8	31
MT-ND6	4541	genome.wustl.edu	37	M	14362	14362	+	Silent	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chrM:14362C>T	ENST00000361681.2	-	1	311	c.312G>A	c.(310-312)ctG>ctA	p.L104L	MT-TT_ENST00000387460.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	104					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						TCTTTCACCCACAGCACCAAT	0.493													ENSG00000198695																																					0																																										SO:0001819	synonymous_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.312G>A	M.37:g.14362C>T			Q34774|Q8HG30	Silent	SNP	pfam_DH_UbQ/plastoQ_OxRdtase_su6	p.L104	ENST00000361681.2	37	c.312		MT																																																																																			-	MT-ND6	-	pfam_DH_UbQ/plastoQ_OxRdtase_su6		0.493	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	MT-ND6	HGNC	protein_coding		0	0		220	220		0.00		C	YP_003024037		14362	-1	2		13		tier1	no_errors	ENST00000361681	ensembl	human	known	74_37	silent	13.33		SNP	NULL	T	2	13
COLGALT2	23127	genome.wustl.edu	37	1	183933060	183933060	+	Silent	SNP	G	G	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:183933060G>T	ENST00000361927.4	-	6	1298	c.927C>A	c.(925-927)ctC>ctA	p.L309L	COLGALT2_ENST00000546159.1_Silent_p.L309L|COLGALT2_ENST00000367520.3_Silent_p.L46L	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	309					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GCACATGGATGAGGTTCTCGA	0.552													ENSG00000198756																																					0													184.0	131.0	149.0					1																	183933060		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.927C>A	1.37:g.183933060G>T			O60327|Q9BZR0	Silent	SNP	pfam_Glyco_trans_25	p.L309	ENST00000361927.4	37	c.927	CCDS1360.1	1																																																																																			-	COLGALT2	-	NULL		0.552	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT2	HGNC	protein_coding	OTTHUMT00000086128.1	0	0		42	42		0.00		G	NM_015101		183933060	-1	4		46		tier1	no_errors	ENST00000361927	ensembl	human	known	74_37	silent	8.00		SNP	0.998	T	4	46
TP53	7157	genome.wustl.edu	37	17	7577124	7577124	+	Missense_Mutation	SNP	C	C	T	rs121912657		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr17:7577124C>T	ENST00000269305.4	-	8	1003	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	TP53_ENST00000359597.4_Missense_Mutation_p.V272M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V272M|TP53_ENST00000455263.2_Missense_Mutation_p.V272M|TP53_ENST00000445888.2_Missense_Mutation_p.V272M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	272	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1737852}.|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V272M(82)|p.V272L(26)|p.0?(8)|p.V272fs*73(4)|p.?(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.V272fs*34(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.G266_E271delGRNSFE(1)|p.V272fs*74(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACACGCACCTCAAAGCTG	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	133	Substitution - Missense(108)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	large_intestine(23)|ovary(16)|lung(14)|breast(14)|oesophagus(11)|upper_aerodigestive_tract(9)|haematopoietic_and_lymphoid_tissue(9)|central_nervous_system(7)|bone(5)|stomach(4)|pancreas(4)|liver(4)|kidney(3)|urinary_tract(3)|endometrium(2)|thyroid(1)|vulva(1)|soft_tissue(1)|testis(1)|skin(1)	GRCh37	CM920676	TP53	M	rs121912657						62.0	54.0	57.0					17																	7577124		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.814G>A	17.37:g.7577124C>T	ENSP00000269305:p.Val272Met		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V272M	ENST00000269305.4	37	c.814	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318455	0.81469	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057604	0.64402	D	0.000002	D	0.99843	0.9928	M	0.90309	3.105	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.96721	0.9532	10	0.87932	D	0	-27.8222	16.1198	0.81342	0.0:1.0:0.0:0.0	.	272;272;272;272	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	M	272;272;272;272;272;261;140	ENSP00000352610:V272M;ENSP00000269305:V272M;ENSP00000398846:V272M;ENSP00000391127:V272M;ENSP00000391478:V272M;ENSP00000425104:V140M	ENSP00000269305:V272M	V	-	1	0	TP53	7517849	1.000000	0.71417	0.986000	0.45419	0.849000	0.48306	5.871000	0.69628	2.667000	0.90743	0.462000	0.41574	GTG	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0		42	42		0.00		C	NM_000546		7577124	-1	18		23		tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	43.90		SNP	1.000	T	18	23
LINC01257	116437	genome.wustl.edu	37	12	131692260	131692260	+	lincRNA	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr12:131692260G>A	ENST00000376678.2	+	0	413					NR_026670.2																						TGTCACCTGCGTTGTCCAGTG	0.567													ENSG00000204603																																					0																																												0			-																													12.37:g.131692260G>A				R	SNP	-	NULL	ENST00000376678.2	37	NULL		12																																																																																			-	RP11-638F5.1	-	-		0.567	RP11-638F5.1-001	KNOWN	basic	lincRNA	LOC101929974	Clone_based_vega_gene	lincRNA	OTTHUMT00000399382.1	0	0		58	58		0.00		G			131692260	+1	25		30		tier1	no_errors	ENST00000376678	ensembl	human	known	74_37	rna	45.45		SNP	0.000	A	25	30
ENPP3	5169	genome.wustl.edu	37	6	132014684	132014684	+	Silent	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr6:132014684G>A	ENST00000414305.1	+	16	1660	c.1332G>A	c.(1330-1332)ttG>ttA	p.L444L	ENPP3_ENST00000358229.5_Silent_p.L444L|ENPP3_ENST00000357639.3_Silent_p.L444L			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	444	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		CTCCTGATTTGCCAAAGCGAC	0.383													ENSG00000154269																																					0													180.0	161.0	167.0					6																	132014684		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1332G>A	6.37:g.132014684G>A			Q5JTL3	Silent	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_D/R_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_D/R_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom	p.L444	ENST00000414305.1	37	c.1332	CCDS5148.1	6																																																																																			-	ENPP3	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core		0.383	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	HGNC	protein_coding	OTTHUMT00000043627.2	0	0		81	81		0.00		G			132014684	+1	18		43		tier1	no_errors	ENST00000357639	ensembl	human	known	74_37	silent	29.51		SNP	1.000	A	18	43
TIMP2	7077	genome.wustl.edu	37	17	76851730	76851730	+	3'UTR	SNP	A	A	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr17:76851730A>T	ENST00000262768.7	-	0	980				TIMP2_ENST00000536189.2_3'UTR|TIMP2_ENST00000586057.1_3'UTR|RP11-323N12.5_ENST00000587434.1_RNA|TIMP2_ENST00000585421.1_3'UTR	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			AGTTGGCCACAGGGGCGTTGG	0.577													ENSG00000267601																																					0													23.0	24.0	23.0					17																	76851730		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.*19T>A	17.37:g.76851730A>T			Q16121|Q93006|Q9UDF7	R	SNP	-	NULL	ENST00000262768.7	37	NULL	CCDS11758.1	17																																																																																			-	RP11-323N12.5	-	-		0.577	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267601	Clone_based_vega_gene	protein_coding	OTTHUMT00000335662.1	0	0		58	58		0.00		A	NM_003255		76851730	+1	4		44		tier1	no_errors	ENST00000587434	ensembl	human	known	74_37	rna	8.33		SNP	0.000	T	4	44
DGCR5	26220	genome.wustl.edu	37	22	18979573	18979573	+	RNA	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr22:18979573G>A	ENST00000421572.1	+	0	1136				DGCR5_ENST00000440005.2_RNA|DGCR5_ENST00000537283.1_RNA|DGCR5_ENST00000438934.1_RNA					DiGeorge syndrome critical region gene 5 (non-protein coding)																		AGGGTTGTTGGCTCAGCGGCA	0.587													ENSG00000237517																																					0																																												0			-	X91348		22q11	2012-10-16	2008-08-13		ENSG00000237517	ENSG00000237517		"""Long non-coding RNAs"""	16757	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 37"", ""long intergenic non-protein coding RNA 37"""					8659529	Standard	NR_002733		Approved	NCRNA00037, LINC00037	uc021wku.1		OTTHUMG00000149977		22.37:g.18979573G>A				R	SNP	-	NULL	ENST00000421572.1	37	NULL		22																																																																																			-	DGCR5	-	-		0.587	DGCR5-004	KNOWN	basic|exp_conf	antisense	DGCR5	HGNC	antisense	OTTHUMT00000316630.1	0	0		19	19		0.00		G	NR_002733		18979573	+1	4		15		tier1	no_errors	ENST00000438934	ensembl	human	known	74_37	rna	21.05		SNP	0.000	A	4	15
MAS1L	116511	genome.wustl.edu	37	6	29454663	29454663	+	Missense_Mutation	SNP	A	A	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr6:29454663A>T	ENST00000377127.3	-	1	1075	c.1017T>A	c.(1015-1017)gaT>gaA	p.D339E		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	339					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						CCTCTGGCTTATCTGCTAACG	0.512													ENSG00000204687																									NSCLC(153;755 1987 3859 11251 32945)												0													148.0	147.0	147.0					6																	29454663		2203	4300	6503	SO:0001583	missense	0			-	S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.1017T>A	6.37:g.29454663A>T	ENSP00000366331:p.Asp339Glu		Q5SUN5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.D339E	ENST00000377127.3	37	c.1017	CCDS4661.1	6	.	.	.	.	.	.	.	.	.	.	A	6.600	0.479121	0.12581	.	.	ENSG00000204687	ENST00000377127	T	0.02944	4.1	2.1	-4.19	0.03835	.	.	.	.	.	T	0.00695	0.0023	N	0.17764	0.52	0.09310	N	1	B	0.31790	0.34	B	0.44163	0.443	T	0.40270	-0.9572	9	0.10636	T	0.68	.	3.7626	0.08610	0.5436:0.0:0.2934:0.1629	.	339	P35410	MAS1L_HUMAN	E	339	ENSP00000366331:D339E	ENSP00000366331:D339E	D	-	3	2	MAS1L	29562642	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.268000	0.00263	-1.563000	0.01680	-0.569000	0.04157	GAT	-	MAS1L	-	NULL		0.512	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1L	HGNC	protein_coding	OTTHUMT00000076126.2	0	0		75	75		0.00		A	NM_052967		29454663	-1	33		35		tier1	no_errors	ENST00000377127	ensembl	human	known	74_37	missense	48.53		SNP	0.001	T	33	35
C12orf10	60314	genome.wustl.edu	37	12	53699735	53699735	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr12:53699735G>A	ENST00000267103.5	+	4	585	c.533G>A	c.(532-534)gGg>gAg	p.G178E	C12orf10_ENST00000548632.1_Intron|C12orf10_ENST00000549488.1_Missense_Mutation_p.G15E	NM_021640.3	NP_067653	Q9HB07	MYG1_HUMAN	chromosome 12 open reading frame 10	178					locomotory exploration behavior (GO:0035641)|pigmentation (GO:0043473)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|kidney(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	20						GTGGACAATGGGATCTCCCAG	0.527													ENSG00000139637																																					0													200.0	182.0	188.0					12																	53699735		2203	4300	6503	SO:0001583	missense	0			-	AF289485	CCDS31810.1	12q13.13	2014-05-29			ENSG00000139637	ENSG00000139637			17590	protein-coding gene	gene with protein product	"""melanocyte related gene"", ""melanocyte proliferating gene 1"""	611366					Standard	NM_021640		Approved	MYG, MYG1, Gamm1	uc001scp.4	Q9HB07	OTTHUMG00000170030	ENST00000267103.5:c.533G>A	12.37:g.53699735G>A	ENSP00000267103:p.Gly178Glu			Missense_Mutation	SNP	pfam_Met-dep_prot_hydro	p.G15E	ENST00000267103.5	37	c.44	CCDS31810.1	12	.	.	.	.	.	.	.	.	.	.	G	28.7	4.940443	0.92526	.	.	ENSG00000139637	ENST00000267103;ENST00000548845;ENST00000549488	D;D	0.82433	-1.61;-1.61	4.9	4.9	0.64082	.	0.103430	0.64402	D	0.000003	D	0.92619	0.7655	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93723	0.7034	10	0.87932	D	0	-14.9501	13.7942	0.63160	0.0:0.0:1.0:0.0	.	178	Q9HB07	MYG1_HUMAN	E	178;63;15	ENSP00000267103:G178E;ENSP00000448433:G15E	ENSP00000267103:G178E	G	+	2	0	C12orf10	51986002	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.231000	0.95317	2.736000	0.93811	0.655000	0.94253	GGG	-	C12orf10	-	pfam_Met-dep_prot_hydro		0.527	C12orf10-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C12orf10	HGNC	protein_coding	OTTHUMT00000406906.1	0	0		47	47		0.00		G	NM_021640		53699735	+1	3		25		tier1	no_errors	ENST00000549488	ensembl	human	putative	74_37	missense	10.71		SNP	1.000	A	3	25
TNRC18	84629	genome.wustl.edu	37	7	5353375	5353375	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr7:5353375G>A	ENST00000430969.1	-	27	7495	c.7147C>T	c.(7147-7149)Cga>Tga	p.R2383*	TNRC18_ENST00000399537.4_Nonsense_Mutation_p.R2383*	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2383	Pro-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCCTTGGCTCGCTTGTCCACA	0.697													ENSG00000182095																																					0													12.0	14.0	13.0					7																	5353375		1537	3533	5070	SO:0001587	stop_gained	0			-	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7147C>T	7.37:g.5353375G>A	ENSP00000395538:p.Arg2383*		A8MX41|Q96JH1|Q96K91	Nonsense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.R2383*	ENST00000430969.1	37	c.7147	CCDS47534.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	15.59|15.59	2.879051|2.879051	0.51801|0.51801	.|.	.|.	ENSG00000182095|ENSG00000182095	ENST00000328270|ENST00000399537;ENST00000430969	.|.	.|.	.|.	4.73|4.73	4.73|4.73	0.59995|0.59995	.|.	.|0.000000	.|0.31772	.|N	.|0.007090	T|.	0.52256|.	0.1723|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.53535|.	-0.8425|.	3|.	.|0.11485	.|T	.|0.65	.|.	15.4814|15.4814	0.75530|0.75530	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|X	196|2383	.|.	.|ENSP00000382452:R2383X	A|R	-|-	2|1	0|2	TNRC18|TNRC18	5319901|5319901	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.281000|0.281000	0.26958|0.26958	3.999000|3.999000	0.57031|0.57031	2.172000|2.172000	0.68678|0.68678	0.561000|0.561000	0.74099|0.74099	GCG|CGA	-	TNRC18	-	NULL		0.697	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		0	0		23	23		0.00		G			5353375	-1	10		9		tier1	no_errors	ENST00000399537	ensembl	human	known	74_37	nonsense	52.63		SNP	0.998	A	10	9
STRIP1	85369	genome.wustl.edu	37	1	110580694	110580703	+	Intron	DEL	ATATATATAT	ATATATATAT	-	rs200695359|rs200288144|rs372322579|rs576249701|rs58967128|rs2021518|rs58974854		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	ATATATATAT	ATATATATAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:110580694_110580703delATATATATAT	ENST00000369795.3	+	2	272				STRIP1_ENST00000369794.2_Intron|STRIP1_ENST00000369796.1_Intron	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1						cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											GTTCTATCAAatatatatatatatatatat	0.238													ENSG00000143093																																					0																																										SO:0001627	intron_variant	0				AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.250+112ATATATATAT>-	1.37:g.110580704_110580713delATATATATAT			Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	R	DEL	-	NULL	ENST00000369795.3	37	NULL	CCDS30798.1	1																																																																																				STRIP1	-	-		0.238	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRIP1	HGNC	protein_coding	OTTHUMT00000032213.1									ATATATATAT	NM_033088		110580703	+1					tier1	no_errors	ENST00000489059	ensembl	human	known	74_37	rna			DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.001	-		
CABIN1	23523	genome.wustl.edu	37	22	24573619	24573619	+	Missense_Mutation	SNP	A	A	C			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr22:24573619A>C	ENST00000398319.2	+	36	6738	c.6353A>C	c.(6352-6354)aAg>aCg	p.K2118T	CABIN1_ENST00000337989.7_Missense_Mutation_p.K488T|CABIN1_ENST00000405822.2_Missense_Mutation_p.K2039T|CABIN1_ENST00000263119.5_Missense_Mutation_p.K2118T	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	2118	Required for interaction with calcineurin. {ECO:0000250}.				cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CACCCAGGCAAGCCTGAGCCC	0.677													ENSG00000099991																																					0													59.0	54.0	55.0					22																	24573619		2203	4300	6503	SO:0001583	missense	0			-	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.6353A>C	22.37:g.24573619A>C	ENSP00000381364:p.Lys2118Thr		G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K2118T	ENST00000398319.2	37	c.6353	CCDS13823.1	22	.	.	.	.	.	.	.	.	.	.	A	17.06	3.291373	0.59976	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319;ENST00000337989;ENST00000403176	T;T;T;T	0.20200	2.09;2.09;2.09;2.19	4.62	4.62	0.57501	.	0.222101	0.39341	N	0.001394	T	0.30479	0.0766	L	0.27053	0.805	0.44048	D	0.996782	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	T	0.02691	-1.1123	10	0.27785	T	0.31	.	12.5223	0.56067	1.0:0.0:0.0:0.0	.	2039;2118	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	T	2118;2039;2118;488;487	ENSP00000263119:K2118T;ENSP00000384694:K2039T;ENSP00000381364:K2118T;ENSP00000336991:K488T	ENSP00000263119:K2118T	K	+	2	0	CABIN1	22903619	1.000000	0.71417	0.105000	0.21289	0.409000	0.31022	5.907000	0.69908	2.042000	0.60477	0.529000	0.55759	AAG	-	CABIN1	-	NULL		0.677	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	0	0		72	72		0.00		A	NM_012295		24573619	+1	27		58		tier1	no_errors	ENST00000263119	ensembl	human	known	74_37	missense	31.76		SNP	0.996	C	27	58
ZNF207	7756	genome.wustl.edu	37	17	30700337	30700338	+	IGR	INS	-	-	A	rs561324841|rs191933623	byFrequency	TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr17:30700337_30700338insA	ENST00000321233.6	+	0	2283				ZNF207_ENST00000584416.1_3'UTR|ZNF207_ENST00000394670.4_3'UTR|ZNF207_ENST00000577908.1_Intron	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207						attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TTGGGatttttaaaaaaaaaaa	0.337													ENSG00000010244																																					0																																										SO:0001628	intergenic_variant	0				AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810		17.37:g.30700348_30700348dupA			A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	R	INS	-	NULL	ENST00000321233.6	37	NULL	CCDS11271.1	17																																																																																				ZNF207	-	-		0.337	ZNF207-003	KNOWN	basic|CCDS	protein_coding	ZNF207	HGNC	protein_coding	OTTHUMT00000256251.2	0	0		24	24		0.00		-			30700338	+1	3		24		tier1	no_errors	ENST00000584416	ensembl	human	putative	74_37	rna	11.11		INS	0.001:0.001	A	3	24
NPAP1	23742	genome.wustl.edu	37	15	24923769	24923769	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr15:24923769C>T	ENST00000329468.2	+	1	3229	c.2755C>T	c.(2755-2757)Cca>Tca	p.P919S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	919					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TCTGGGGAATCCAGCAACCCC	0.473													ENSG00000185823																																					0													106.0	112.0	110.0					15																	24923769		2203	4300	6503	SO:0001583	missense	0			-	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2755C>T	15.37:g.24923769C>T	ENSP00000333735:p.Pro919Ser			Missense_Mutation	SNP	NULL	p.P919S	ENST00000329468.2	37	c.2755	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	10.25	1.299659	0.23650	.	.	ENSG00000185823	ENST00000329468	T	0.05319	3.46	2.32	-2.32	0.06745	.	3.181850	0.01382	N	0.012946	T	0.04227	0.0117	N	0.14661	0.345	0.09310	N	1	P	0.40282	0.711	P	0.45276	0.475	T	0.33317	-0.9873	10	0.02654	T	1	.	2.6462	0.04985	0.2177:0.3392:0.0:0.4431	.	919	Q9NZP6	CO002_HUMAN	S	919	ENSP00000333735:P919S	ENSP00000333735:P919S	P	+	1	0	C15orf2	22474862	0.004000	0.15560	0.000000	0.03702	0.767000	0.43475	-0.052000	0.11865	-0.609000	0.05724	0.313000	0.20887	CCA	-	NPAP1	-	NULL		0.473	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	0	0		26	26		0.00		C	NM_018958		24923769	+1	21		20		tier1	no_errors	ENST00000329468	ensembl	human	known	74_37	missense	51.22		SNP	0.000	T	21	20
FGFR4	2264	genome.wustl.edu	37	5	176524315	176524315	+	Missense_Mutation	SNP	T	T	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr5:176524315T>A	ENST00000292408.4	+	17	2421	c.2176T>A	c.(2176-2178)Tgg>Agg	p.W726R	FGFR4_ENST00000393648.2_Missense_Mutation_p.W658R|FGFR4_ENST00000393637.1_Missense_Mutation_p.W686R|FGFR4_ENST00000292410.3_Missense_Mutation_p.W686R|FGFR4_ENST00000502906.1_Missense_Mutation_p.W726R	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	726	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	GCGTGAGTGCTGGCACGCAGC	0.677										TSP Lung(9;0.080)			ENSG00000160867																																					0													30.0	30.0	30.0					5																	176524315		2203	4300	6503	SO:0001583	missense	0			-	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.2176T>A	5.37:g.176524315T>A	ENSP00000292408:p.Trp726Arg		G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.W726R	ENST00000292408.4	37	c.2176	CCDS4410.1	5	.	.	.	.	.	.	.	.	.	.	T	16.24	3.067873	0.55539	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14	4.59	4.59	0.56863	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95017	0.8387	H	0.94264	3.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96165	0.9118	10	0.87932	D	0	.	13.7106	0.62665	0.0:0.0:0.0:1.0	.	658;686;726	B4DVP5;P22455-2;P22455	.;.;FGFR4_HUMAN	R	726;658;726;686;686;954	ENSP00000292408:W726R;ENSP00000377259:W658R;ENSP00000424960:W726R;ENSP00000292410:W686R;ENSP00000377254:W686R	ENSP00000292408:W726R	W	+	1	0	FGFR4	176456921	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	8.037000	0.88933	1.723000	0.51488	0.254000	0.18369	TGG	-	FGFR4	-	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.677	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1	0	0		51	51		0.00		T			176524315	+1	4		21		tier1	no_errors	ENST00000292408	ensembl	human	known	74_37	missense	16.00		SNP	1.000	A	4	21
ADI1	55256	genome.wustl.edu	37	2	3502846	3502846	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr2:3502846G>A	ENST00000327435.6	-	4	676	c.428C>T	c.(427-429)aCg>aTg	p.T143M	RP11-1293J14.1_ENST00000607415.1_lincRNA|ADI1_ENST00000382093.5_Missense_Mutation_p.T137M	NM_018269.3	NP_060739.2			acireductone dioxygenase 1											breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		CATGGCCTTCGTGTAGTTCTG	0.478													ENSG00000182551																																					0													43.0	43.0	43.0					2																	3502846		2203	4300	6503	SO:0001583	missense	0			-		CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.428C>T	2.37:g.3502846G>A	ENSP00000333666:p.Thr143Met			Missense_Mutation	SNP	pfam_Acireductn_dOase_family,pfam_Cupin_2,pfam_AraC-bd,superfamily_RmlC_Cupin	p.T143M	ENST00000327435.6	37	c.428	CCDS1653.1	2	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401983	0.25291	.	.	ENSG00000182551	ENST00000327435;ENST00000382093	.	.	.	4.59	3.35	0.38373	Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);	0.292715	0.38326	N	0.001723	T	0.39145	0.1067	L	0.47716	1.5	0.22762	N	0.998761	B	0.17038	0.02	B	0.20184	0.028	T	0.38243	-0.9670	9	0.66056	D	0.02	-25.4666	8.136	0.31054	0.8873:0.0:0.1127:0.0	.	143	Q9BV57	MTND_HUMAN	M	143;137	.	ENSP00000333666:T143M	T	-	2	0	ADI1	3481853	0.991000	0.36638	0.884000	0.34674	0.136000	0.21042	4.048000	0.57390	0.795000	0.33922	-0.345000	0.07892	ACG	-	ADI1	-	pfam_Acireductn_dOase_family,pfam_AraC-bd,superfamily_RmlC_Cupin		0.478	ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADI1	HGNC	protein_coding	OTTHUMT00000231914.6	0	0		58	58		0.00		G	NM_018269		3502846	-1	55		47		tier1	no_errors	ENST00000327435	ensembl	human	known	74_37	missense	53.92		SNP	1.000	A	55	47
IKZF2	22807	genome.wustl.edu	37	2	213914541	213914541	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr2:213914541C>A	ENST00000434687.1	-	6	779	c.470G>T	c.(469-471)aGa>aTa	p.R157I	IKZF2_ENST00000374319.4_Missense_Mutation_p.R131I|IKZF2_ENST00000374327.4_Intron|IKZF2_ENST00000451136.2_Missense_Mutation_p.R131I|IKZF2_ENST00000421754.2_Missense_Mutation_p.R131I|IKZF2_ENST00000457361.1_Missense_Mutation_p.R157I|IKZF2_ENST00000342002.2_Missense_Mutation_p.R163I|IKZF2_ENST00000413091.3_Missense_Mutation_p.R157I			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	157					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		CTTTATGTGTCTCAGAAGGTT	0.493													ENSG00000030419																																					0													66.0	60.0	62.0					2																	213914541		2203	4300	6503	SO:0001583	missense	0			-	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.470G>T	2.37:g.213914541C>A	ENSP00000412869:p.Arg157Ile		Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R157I	ENST00000434687.1	37	c.470	CCDS2395.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.762983	0.96906	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000413091	T;T;T;T;T;T;T	0.39406	1.75;1.75;1.75;1.75;1.08;1.75;1.75	6.03	6.03	0.97812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000003	T	0.65270	0.2675	M	0.64080	1.96	0.80722	D	1	D;D;D;D	0.89917	0.997;0.997;1.0;0.999	D;D;D;D	0.91635	0.994;0.994;0.999;0.998	T	0.62329	-0.6877	10	0.54805	T	0.06	-2.8649	20.5568	0.99304	0.0:1.0:0.0:0.0	.	131;131;131;157	C9JCG7;C9JTM9;Q9UKS7-2;Q9UKS7	.;.;.;IKZF2_HUMAN	I	157;163;157;131;131;131;157	ENSP00000410447:R157I;ENSP00000342876:R163I;ENSP00000412869:R157I;ENSP00000363439:R131I;ENSP00000395203:R131I;ENSP00000399574:R131I;ENSP00000402334:R157I	ENSP00000342876:R163I	R	-	2	0	IKZF2	213622786	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.757000	0.85209	2.861000	0.98227	0.655000	0.94253	AGA	-	IKZF2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.493	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF2	HGNC	protein_coding	OTTHUMT00000256593.3	0	0		83	83		0.00		C	NM_016260		213914541	-1	42		46		tier1	no_errors	ENST00000434687	ensembl	human	known	74_37	missense	47.73		SNP	1.000	A	42	46
MED16	10025	genome.wustl.edu	37	19	871225	871225	+	Silent	SNP	C	C	T	rs376670615		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr19:871225C>T	ENST00000589119.1	-	12	2126	c.2127G>A	c.(2125-2127)ccG>ccA	p.P709P	MED16_ENST00000325464.1_Silent_p.P709P|MED16_ENST00000269814.4_Missense_Mutation_p.R645Q|MED16_ENST00000312090.6_Silent_p.P728P|MED16_ENST00000606828.1_5'Flank|MED16_ENST00000395808.3_Silent_p.P709P			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	709					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCCTCGTCCGGCTCGCTCG	0.711													ENSG00000175221																																					0										0,4176		0,0,2088	9.0	9.0	9.0		2127	-8.2	0.1	19		9	4,8320		0,4,4158	no	coding-synonymous	MED16	NM_005481.2		0,4,6246	TT,TC,CC		0.0481,0.0,0.032		709/878	871225	4,12496	2088	4162	6250	SO:0001819	synonymous_variant	0			-	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.2127G>A	19.37:g.871225C>T			Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	pfam_Mediator_Med16,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R645Q	ENST00000589119.1	37	c.1934	CCDS12047.1	19	.	.	.	.	.	.	.	.	.	.	c	9.607	1.130305	0.21041	0.0	4.81E-4	ENSG00000175221	ENST00000269814	.	.	.	4.13	-8.25	0.01025	.	.	.	.	.	T	0.19565	0.0470	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.11842	-1.0571	7	0.27082	T	0.32	-21.481	3.2061	0.06666	0.1236:0.1749:0.1902:0.5113	.	645	Q9Y2X0-4	.	Q	645	.	ENSP00000269814:R645Q	R	-	2	0	MED16	822225	0.000000	0.05858	0.106000	0.21319	0.082000	0.17680	-8.420000	0.00020	-2.655000	0.00422	-2.184000	0.00315	CGG	-	MED16	-	NULL		0.711	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MED16	HGNC	protein_coding	OTTHUMT00000457902.3	0	0		13	13		0.00		C	NM_005481		871225	-1	9		11		tier1	no_errors	ENST00000269814	ensembl	human	known	74_37	missense	45.00		SNP	0.017	T	9	11
PRKCZ	5590	genome.wustl.edu	37	1	2077516	2077516	+	Silent	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:2077516C>T	ENST00000400921.2	+	4	737	c.54C>T	c.(52-54)gaC>gaT	p.D18D	PRKCZ_ENST00000479263.1_3'UTR|RP5-892K4.1_ENST00000606533.1_RNA|PRKCZ_ENST00000400920.1_Silent_p.D18D	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	201	OPR.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.D201D(2)		breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	AGAACGAGGACGCCGACCTTC	0.582													ENSG00000067606																																					2	Substitution - coding silent(2)	lung(2)											99.0	77.0	84.0					1																	2077516		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.54C>T	1.37:g.2077516C>T			A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_PKC_zeta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.D201	ENST00000400921.2	37	c.603	CCDS41229.1	1																																																																																			-	PRKCZ	-	pirsf_PKC_zeta		0.582	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	PRKCZ	HGNC	protein_coding	OTTHUMT00000098533.3	0	0		35	35		0.00		C	NM_002744		2077516	+1	16		19		tier1	no_errors	ENST00000378567	ensembl	human	known	74_37	silent	45.71		SNP	1.000	T	16	19
CAT	847	genome.wustl.edu	37	11	34490058	34490058	+	Intron	DEL	A	A	-	rs534253738		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr11:34490058delA	ENST00000241052.4	+	11	1523					NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase						aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	AAGAGAACTTAAAAAAAAAAA	0.393													ENSG00000121691																																					0																																										SO:0001627	intron_variant	0				AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1434+116A>-	11.37:g.34490058delA			A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	R	DEL	-	NULL	ENST00000241052.4	37	NULL	CCDS7891.1	11																																																																																				CAT	-	-		0.393	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAT	HGNC	protein_coding	OTTHUMT00000103197.2	0	0		18	18		0.00		A	NM_001752		34490058	+1	4		28		tier1	no_errors	ENST00000525707	ensembl	human	putative	74_37	rna	12.50		DEL	0.000	-	4	28
FLG	2312	genome.wustl.edu	37	1	152280704	152280704	+	Missense_Mutation	SNP	A	A	G			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:152280704A>G	ENST00000368799.1	-	3	6693	c.6658T>C	c.(6658-6660)Tct>Cct	p.S2220P	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2220	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGTGTCTAGAGCTGTCGGCC	0.552									Ichthyosis				ENSG00000143631																																					0													301.0	283.0	289.0					1																	152280704		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	-	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6658T>C	1.37:g.152280704A>G	ENSP00000357789:p.Ser2220Pro		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S2220P	ENST00000368799.1	37	c.6658	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	a	4.499	0.092541	0.08632	.	.	ENSG00000143631	ENST00000368799	T	0.09163	3.01	1.91	-1.3	0.09259	.	.	.	.	.	T	0.04048	0.0113	M	0.83312	2.635	0.09310	N	1	P	0.49185	0.92	B	0.36464	0.225	T	0.24905	-1.0147	9	0.48119	T	0.1	.	3.0119	0.06047	0.3244:0.4652:0.0:0.2104	.	2220	P20930	FILA_HUMAN	P	2220	ENSP00000357789:S2220P	ENSP00000357789:S2220P	S	-	1	0	FLG	150547328	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.494000	0.22467	-0.272000	0.09259	0.352000	0.21897	TCT	-	FLG	-	pfam_Filaggrin		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	0	0		107	107		0.00		A	NM_002016		152280704	-1	14		150		tier1	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	8.54		SNP	0.000	G	14	150
ANKRD26	22852	genome.wustl.edu	37	10	27352964	27352964	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr10:27352964C>A	ENST00000376087.4	-	12	1481	c.1316G>T	c.(1315-1317)gGg>gTg	p.G439V	ANKRD26_ENST00000436985.2_Missense_Mutation_p.G488V	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	439					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						GTCTGCAGCCCCAGCTAAAGG	0.308													ENSG00000107890																																					0													92.0	82.0	85.0					10																	27352964		1791	4063	5854	SO:0001583	missense	0			-	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1316G>T	10.37:g.27352964C>A	ENSP00000365255:p.Gly439Val		A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G488V	ENST00000376087.4	37	c.1463	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	C	8.728	0.915936	0.17907	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.35421	1.42;1.31	4.16	-4.61	0.03380	.	.	.	.	.	T	0.25938	0.0632	M	0.71036	2.16	0.09310	N	0.999998	P;B;B	0.35107	0.484;0.352;0.352	B;B;B	0.30179	0.112;0.052;0.077	T	0.18461	-1.0336	9	0.32370	T	0.25	.	1.8087	0.03086	0.1439:0.2385:0.1417:0.4759	.	439;439;488	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	V	439;488	ENSP00000365255:G439V;ENSP00000405112:G488V	ENSP00000365255:G439V	G	-	2	0	ANKRD26	27392970	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.957000	0.03861	-0.741000	0.04797	-0.258000	0.10820	GGG	-	ANKRD26	-	NULL		0.308	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	0	0		108	108		0.00		C			27352964	-1	17		73		tier1	no_errors	ENST00000436985	ensembl	human	known	74_37	missense	18.89		SNP	0.001	A	17	73
ITGAM	3684	genome.wustl.edu	37	16	31338251	31338251	+	Silent	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr16:31338251G>A	ENST00000287497.8	+	22	2778	c.2703G>A	c.(2701-2703)gtG>gtA	p.V901V	ITGAM_ENST00000544665.3_Silent_p.V902V			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	901					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						AGGCCAATGTGACCAGGTGCT	0.547													ENSG00000169896																																					0													164.0	157.0	159.0					16																	31338251		1970	4150	6120	SO:0001819	synonymous_variant	0			-	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2703G>A	16.37:g.31338251G>A			Q4VAK0|Q4VAK1|Q4VAK2	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.V902	ENST00000287497.8	37	c.2706	CCDS45470.1	16																																																																																			-	ITGAM	-	pfam_Integrin_alpha-2		0.547	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	0	0		36	36		0.00		G	NM_000632		31338251	+1	70		18		tier1	no_errors	ENST00000544665	ensembl	human	known	74_37	silent	79.55		SNP	0.999	A	70	18
DACH1	1602	genome.wustl.edu	37	13	72440659	72440664	+	In_Frame_Del	DEL	GCCGCC	GCCGCC	-	rs202136379		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	GCCGCC	GCCGCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr13:72440659_72440664delGCCGCC	ENST00000359684.2	-	1	243_248	c.244_249delGGCGGC	c.(244-249)ggcggcdel	p.GG82del	DACH1_ENST00000305425.4_In_Frame_Del_p.GG82del|DACH1_ENST00000354591.4_In_Frame_Del_p.GG82del|DACH1_ENST00000313174.7_In_Frame_Del_p.GG82del			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	82	Poly-Gly.			Missing (in Ref. 1; AAF01351 and 2; AAL08487). {ECO:0000305}.	cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		cgcctccgctgccgccgccgccgccg	0.791													ENSG00000165659																																					0																																										SO:0001651	inframe_deletion	0				AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.244_249delGGCGGC	13.37:g.72440665_72440670delGCCGCC	ENSP00000352712:p.Gly82_Gly83del		D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	In_Frame_Del	DEL	pfam_Transform_Ski,superfamily_D-bd_dom_put	p.GG82in_frame_del	ENST00000359684.2	37	c.249_244		13																																																																																				DACH1	-	NULL		0.791	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	DACH1	HGNC	protein_coding	OTTHUMT00000045240.1									GCCGCC	NM_004392		72440664	-1					tier1	no_errors	ENST00000359684	ensembl	human	known	74_37	in_frame_del			DEL	0.750:0.744:0.739:0.734:0.729:0.725	-		
CLRN2	645104	genome.wustl.edu	37	4	17524516	17524516	+	Missense_Mutation	SNP	G	G	A	rs201748212		TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr4:17524516G>A	ENST00000511148.2	+	2	385	c.283G>A	c.(283-285)Gca>Aca	p.A95T		NM_001079827.2	NP_001073296.1	A0PK11	CLRN2_HUMAN	clarin 2	95						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|upper_aerodigestive_tract(1)	15						GGAGCTCAACGCAGGCCTTCA	0.517													ENSG00000249581																																					0													148.0	155.0	152.0					4																	17524516		2112	4227	6339	SO:0001583	missense	0			-		CCDS47032.1	4p15.32	2008-01-17			ENSG00000249581	ENSG00000249581			33939	protein-coding gene	gene with protein product						12080385	Standard	NM_001079827		Approved		uc003gpg.1	A0PK11	OTTHUMG00000160273	ENST00000511148.2:c.283G>A	4.37:g.17524516G>A	ENSP00000424711:p.Ala95Thr			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin	p.A95T	ENST00000511148.2	37	c.283	CCDS47032.1	4	.	.	.	.	.	.	.	.	.	.	G	7.104	0.574732	0.13623	.	.	ENSG00000249581	ENST00000511148	D	0.91740	-2.9	4.94	-4.58	0.03410	.	0.696652	0.14101	N	0.341390	T	0.74794	0.3763	N	0.03154	-0.405	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.65915	-0.6052	10	0.11182	T	0.66	-4.0E-4	9.3012	0.37847	0.7307:0.0:0.1481:0.1212	.	95	A0PK11	CLRN2_HUMAN	T	95	ENSP00000424711:A95T	ENSP00000424711:A95T	A	+	1	0	CLRN2	17133614	0.001000	0.12720	0.061000	0.19648	0.900000	0.52787	0.009000	0.13219	-0.658000	0.05366	-0.444000	0.05651	GCA	-	CLRN2	-	pfam_PMP22/EMP/MP20/Claudin		0.517	CLRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLRN2	HGNC	protein_coding	OTTHUMT00000359990.2	0	0		35	35		0.00		G	NM_001079827		17524516	+1	30		28		tier1	no_errors	ENST00000511148	ensembl	human	known	74_37	missense	51.72		SNP	0.061	A	30	28
SMCO2	341346	genome.wustl.edu	37	12	27627847	27627848	+	Splice_Site	INS	-	-	T	rs368074264	byFrequency	TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr12:27627847_27627848insT	ENST00000535986.1	+	3	362		c.e3+1		SMCO2_ENST00000298876.4_Splice_Site|SMCO2_ENST00000416383.1_Splice_Site|SMCO2_ENST00000538647.1_Splice_Site			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2							integral component of membrane (GO:0016021)											TCCTTGAACTGTAAGTCTTGAC	0.396													ENSG00000165935																																					0																																										SO:0001630	splice_region_variant	0					CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.362+1->T	12.37:g.27627848_27627848dupT				Splice_Site	INS	-	e3+1	ENST00000535986.1	37	c.362+1_362+1	CCDS44852.1	12																																																																																				SMCO2	-	-		0.396	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCO2	HGNC	protein_coding	OTTHUMT00000402867.1	0	0		49	49		0.00		-	NM_001145010	Intron	27627848	+1	67		62		tier1	no_errors	ENST00000416383	ensembl	human	known	74_37	splice_site_ins	51.94		INS	0.816:0.976	T	67	62
RPL5	6125	genome.wustl.edu	37	1	93300445	93300445	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr1:93300445G>T	ENST00000370321.3	+	4	389	c.299G>T	c.(298-300)tGt>tTt	p.C100F	SNORD21_ENST00000383953.1_RNA	NM_000969.3	NP_000960.2	P46777	RL5_HUMAN	ribosomal protein L5	100					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	5S rRNA binding (GO:0008097)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		GCAGCATATTGTACTGGCCTG	0.463													ENSG00000122406																																					0													106.0	106.0	106.0					1																	93300445		2203	4300	6503	SO:0001583	missense	0			-	U14966	CCDS741.1	1p22.1	2014-06-13			ENSG00000122406	ENSG00000122406		"""L ribosomal proteins"""	10360	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 135"""	603634				7937132, 7772601	Standard	NM_000969		Approved	L5, PPP1R135	uc001doz.3	P46777	OTTHUMG00000010899	ENST00000370321.3:c.299G>T	1.37:g.93300445G>T	ENSP00000359345:p.Cys100Phe		Q32LZ3|Q53HH6|Q9H3F4	Missense_Mutation	SNP	pfam_Ribosomal_L18/L5,prints_Rbsml_L5_euk/L18_arc	p.C100F	ENST00000370321.3	37	c.299	CCDS741.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953544	0.73902	.	.	ENSG00000122406	ENST00000432788;ENST00000370321;ENST00000315741	T	0.76968	-1.06	5.14	4.21	0.49690	.	0.144330	0.64402	D	0.000004	T	0.82222	0.4990	H	0.94345	3.525	0.80722	D	1	P	0.38642	0.641	B	0.43386	0.418	D	0.86358	0.1715	10	0.87932	D	0	.	15.0216	0.71635	0.0:0.0:0.8567:0.1433	.	100	P46777	RL5_HUMAN	F	50;100;50	ENSP00000359345:C100F	ENSP00000359338:C50F	C	+	2	0	RPL5	93073033	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.720000	0.84759	1.151000	0.42436	0.655000	0.94253	TGT	-	RPL5	-	pfam_Ribosomal_L18/L5,prints_Rbsml_L5_euk/L18_arc		0.463	RPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL5	HGNC	protein_coding	OTTHUMT00000030058.2	0	0		49	49		0.00		G	NM_000969		93300445	+1	18		45		tier1	no_errors	ENST00000370321	ensembl	human	known	74_37	missense	28.57		SNP	1.000	T	18	45
MAP1B	4131	genome.wustl.edu	37	5	71491298	71491298	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr5:71491298C>A	ENST00000296755.7	+	5	2414	c.2116C>A	c.(2116-2118)Cca>Aca	p.P706T		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	706	Lys-rich (highly basic, contains many KKEE and KKEI/V repeats).				axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		agaaacaccgccaaaggaagt	0.363													ENSG00000131711																									Melanoma(17;367 822 11631 31730 47712)												0													29.0	33.0	32.0					5																	71491298		2202	4291	6493	SO:0001583	missense	0			-	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.2116C>A	5.37:g.71491298C>A	ENSP00000296755:p.Pro706Thr		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.P706T	ENST00000296755.7	37	c.2116	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.785256	0.00628	.	.	ENSG00000131711	ENST00000296755	T	0.20463	2.07	5.7	2.94	0.34122	.	0.320491	0.22428	N	0.060190	T	0.09730	0.0239	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.32508	-0.9904	10	0.12103	T	0.63	-0.2478	7.1746	0.25736	0.1235:0.6476:0.0:0.2289	.	580;706	A2BDK6;P46821	.;MAP1B_HUMAN	T	706	ENSP00000296755:P706T	ENSP00000296755:P706T	P	+	1	0	MAP1B	71527054	0.000000	0.05858	0.712000	0.30502	0.065000	0.16274	-0.141000	0.10327	1.410000	0.46936	0.655000	0.94253	CCA	-	MAP1B	-	NULL		0.363	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	0	0		20	20		0.00		C	NM_005909		71491298	+1	4		23		tier1	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	14.81		SNP	0.019	A	4	23
RBL2	5934	genome.wustl.edu	37	16	53525451	53525451	+	3'UTR	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr16:53525451G>A	ENST00000262133.6	+	0	4796				RBL2_ENST00000379935.4_3'UTR|AKTIP_ENST00000394657.7_3'UTR|AKTIP_ENST00000300245.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2						chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AACTTACATTGTTCAATTAGA	0.249													ENSG00000103479																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.*1239G>A	16.37:g.53525451G>A			B7Z913|Q15073|Q16084|Q8NE70|Q92812	R	SNP	-	NULL	ENST00000262133.6	37	NULL	CCDS10748.1	16																																																																																			-	RBL2	-	-		0.249	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL2	HGNC	protein_coding	OTTHUMT00000256908.3	0	0		50	50		0.00		G	NM_005611		53525451	+1	4		33		tier1	no_errors	ENST00000379935	ensembl	human	known	74_37	rna	10.81		SNP	0.994	A	4	33
EXD3	54932	genome.wustl.edu	37	9	140218215	140218215	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr9:140218215C>T	ENST00000340951.4	-	19	2341	c.2146G>A	c.(2146-2148)Gtg>Atg	p.V716M	EXD3_ENST00000342129.4_Missense_Mutation_p.V367M	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						GTGACACGCACGTTGAAATGC	0.662													ENSG00000187609																																					0													48.0	55.0	53.0					9																	140218215		2115	4237	6352	SO:0001583	missense	0			-		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.2146G>A	9.37:g.140218215C>T	ENSP00000340474:p.Val716Met		Q6P1M1|Q8IXT8	Missense_Mutation	SNP	pfam_Mut7-C_Rse_dom,pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.V716M	ENST00000340951.4	37	c.2146	CCDS48066.1	9	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012190	0.35511	.	.	ENSG00000187609	ENST00000342129;ENST00000340951	T;T	0.71698	-0.59;0.29	3.9	3.9	0.45041	.	0.074941	0.53938	D	0.000058	D	0.82674	0.5088	M	0.85945	2.785	0.28926	N	0.891822	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.76921	-0.2780	10	0.87932	D	0	.	7.4835	0.27419	0.0:0.8778:0.0:0.1222	.	367;716	Q8N9H8-3;Q8N9H8	.;MUT7_HUMAN	M	367;716	ENSP00000343705:V367M;ENSP00000340474:V716M	ENSP00000340474:V716M	V	-	1	0	EXD3	139338036	0.915000	0.31059	0.032000	0.17829	0.067000	0.16453	2.180000	0.42537	1.693000	0.51124	0.305000	0.20034	GTG	-	EXD3	-	pfam_Mut7-C_Rse_dom		0.662	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXD3	HGNC	protein_coding	OTTHUMT00000343182.1	0	0		75	75		0.00		C	NM_017820		140218215	-1	32		32		tier1	no_errors	ENST00000340951	ensembl	human	known	74_37	missense	50.00		SNP	1.000	T	32	32
LMTK2	22853	genome.wustl.edu	37	7	97788700	97788700	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr7:97788700C>T	ENST00000297293.5	+	6	913	c.620C>T	c.(619-621)gCg>gTg	p.A207V		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	207	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TGCGTAGAAGCGATTCCCTAC	0.388													ENSG00000164715																																					0													236.0	214.0	221.0					7																	97788700		2203	4300	6503	SO:0001583	missense	0			-	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.620C>T	7.37:g.97788700C>T	ENSP00000297293:p.Ala207Val		A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A207V	ENST00000297293.5	37	c.620	CCDS5654.1	7	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231563	0.58777	.	.	ENSG00000164715	ENST00000297293	T	0.62788	0.0	5.2	5.2	0.72013	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.055564	0.64402	D	0.000001	T	0.55465	0.1922	N	0.21617	0.685	0.58432	D	0.999995	P	0.51147	0.942	P	0.48030	0.564	T	0.54497	-0.8285	10	0.31617	T	0.26	.	16.2413	0.82409	0.0:1.0:0.0:0.0	.	207	Q8IWU2	LMTK2_HUMAN	V	207	ENSP00000297293:A207V	ENSP00000297293:A207V	A	+	2	0	LMTK2	97626636	1.000000	0.71417	0.955000	0.39395	0.855000	0.48748	5.159000	0.64923	2.423000	0.82170	0.655000	0.94253	GCG	-	LMTK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.388	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	0	0		105	105		0.00		C	NM_014916		97788700	+1	57		75		tier1	no_errors	ENST00000297293	ensembl	human	known	74_37	missense	43.18		SNP	1.000	T	57	75
RNF212B	100507650	genome.wustl.edu	37	14	23732145	23732145	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr14:23732145C>T	ENST00000399910.1	+	10	743	c.490C>T	c.(490-492)Cga>Tga	p.R164*	C14orf164_ENST00000399905.1_Intron|C14orf164_ENST00000430154.2_Nonsense_Mutation_p.R164*|C14orf164_ENST00000492355.1_3'UTR			A8MTL3	R212B_HUMAN		164							zinc ion binding (GO:0008270)										AGTTACCCCACGACCCAGTTT	0.398													ENSG00000215277																																					0																																										SO:0001587	stop_gained	0			-																												ENST00000399910.1:c.490C>T	14.37:g.23732145C>T	ENSP00000382794:p.Arg164*			Nonsense_Mutation	SNP	NULL	p.R164*	ENST00000399910.1	37	c.490		14	.	.	.	.	.	.	.	.	.	.	C	39	7.766942	0.98477	.	.	ENSG00000215277	ENST00000399910;ENST00000430154	.	.	.	5.87	4.02	0.46733	.	0.000000	0.30686	U	0.009096	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-7.5922	11.7135	0.51639	0.3218:0.6782:0.0:0.0	.	.	.	.	X	164	.	ENSP00000382794:R164X	R	+	1	2	C14orf164	22801985	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	0.839000	0.27586	0.786000	0.33708	0.655000	0.94253	CGA	-	C14orf164	-	NULL		0.398	C14orf164-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	C14orf164	HGNC	protein_coding	OTTHUMT00000313900.1	0	0		71	71		0.00		C			23732145	+1	76		62		tier1	no_errors	ENST00000430154	ensembl	human	known	74_37	nonsense	55.07		SNP	1.000	T	76	62
SPATA31A6	389730	genome.wustl.edu	37	9	43627364	43627364	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr9:43627364C>A	ENST00000332857.6	-	4	1351	c.1323G>T	c.(1321-1323)caG>caT	p.Q441H	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	441					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AAGGAGGAGACTGTAAAGTAT	0.512													ENSG00000185775																																					0													29.0	32.0	31.0					9																	43627364		613	1521	2134	SO:0001583	missense	0			-		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1323G>T	9.37:g.43627364C>A	ENSP00000329825:p.Gln441His			Missense_Mutation	SNP	NULL	p.Q441H	ENST00000332857.6	37	c.1323	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728547	0.30593	.	.	ENSG00000185775	ENST00000332857	T	0.07908	3.15	2.56	-2.23	0.06930	.	0.992319	0.08173	N	0.986717	T	0.08403	0.0209	L	0.57536	1.79	0.09310	N	1	P	0.40731	0.728	B	0.41666	0.363	T	0.21793	-1.0235	10	0.45353	T	0.12	-0.0466	0.2867	0.00252	0.2137:0.3128:0.193:0.2805	.	441	Q5VVP1	F75A6_HUMAN	H	441	ENSP00000329825:Q441H	ENSP00000329825:Q441H	Q	-	3	2	FAM75A6	43567360	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.141000	0.03207	-0.532000	0.06332	0.449000	0.29647	CAG	-	SPATA31A6	-	NULL		0.512	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	HGNC	protein_coding	OTTHUMT00000036987.1	0	0		184	184		0.00		C	NM_001145196		43627364	-1	86		84		tier1	no_errors	ENST00000332857	ensembl	human	known	74_37	missense	50.29		SNP	0.000	A	86	84
GORASP2	26003	genome.wustl.edu	37	2	171811195	171811195	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A8JL-01A-11D-A36J-09	TCGA-MB-A8JL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	0476440f-78db-40fe-a45e-5c5e3e44bc03	3e532fd9-8d4e-4826-8969-6d5699e774ff	g.chr2:171811195G>A	ENST00000234160.4	+	6	1417	c.602G>A	c.(601-603)cGa>cAa	p.R201Q	GORASP2_ENST00000493692.1_Intron|GORASP2_ENST00000452526.2_Missense_Mutation_p.R213Q	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	201					mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						TATTTGCATCGAATACCTACA	0.368													ENSG00000115806																																					0													113.0	107.0	109.0					2																	171811195		2203	4300	6503	SO:0001583	missense	0			-		CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.602G>A	2.37:g.171811195G>A	ENSP00000234160:p.Arg201Gln		B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	pfam_GRASP55/65_PDZ,superfamily_PDZ	p.R213Q	ENST00000234160.4	37	c.638	CCDS33325.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.794651	0.96952	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.62941	0.06;-0.01	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.84977	0.5592	M	0.94101	3.495	0.80722	D	1	D;D;D	0.89917	1.0;0.977;1.0	D;P;D	0.87578	0.991;0.888;0.998	D	0.87784	0.2614	10	0.62326	D	0.03	-7.752	18.333	0.90277	0.0:0.0:1.0:0.0	.	157;213;201	B4DNR1;B4DKT0;Q9H8Y8	.;.;GORS2_HUMAN	Q	201;213	ENSP00000234160:R201Q;ENSP00000410208:R213Q	ENSP00000234160:R201Q	R	+	2	0	GORASP2	171519441	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.572000	0.98179	2.762000	0.94881	0.551000	0.68910	CGA	-	GORASP2	-	pfam_GRASP55/65_PDZ		0.368	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GORASP2	HGNC	protein_coding	OTTHUMT00000333719.2	0	0		57	57		0.00		G			171811195	+1	37		45		tier1	no_errors	ENST00000452526	ensembl	human	known	74_37	missense	45.12		SNP	1.000	A	37	45
