#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ELTD1	64123	genome.wustl.edu	37	1	79402057	79402057	+	Missense_Mutation	SNP	T	T	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr1:79402057T>C	ENST00000370742.3	-	7	863	c.800A>G	c.(799-801)cAt>cGt	p.H267R		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	267					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		AGGATGAATATGTTTCATGTT	0.264													ENSG00000162618																																					0													63.0	65.0	64.0					1																	79402057		1789	4014	5803	SO:0001583	missense	0			-	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.800A>G	1.37:g.79402057T>C	ENSP00000359778:p.His267Arg		B1AR71|Q5KU34	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.H267R	ENST00000370742.3	37	c.800	CCDS41352.1	1	.	.	.	.	.	.	.	.	.	.	C	4.736	0.136844	0.09032	.	.	ENSG00000162618	ENST00000370742	T	0.09350	2.99	5.86	2.26	0.28386	Domain of unknown function DUF3497 (1);	0.376693	0.29932	N	0.010823	T	0.03348	0.0097	L	0.55481	1.735	0.25284	N	0.989416	B	0.30870	0.298	B	0.30495	0.116	T	0.41822	-0.9487	9	.	.	.	.	7.683	0.28524	0.0:0.137:0.115:0.748	.	267	Q9HBW9	ELTD1_HUMAN	R	267	ENSP00000359778:H267R	.	H	-	2	0	ELTD1	79174645	0.998000	0.40836	0.032000	0.17829	0.150000	0.21749	1.332000	0.33805	-0.078000	0.12730	-1.042000	0.02369	CAT	-	ELTD1	-	pfam_DUF3497		0.264	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELTD1	HGNC	protein_coding	OTTHUMT00000026859.1	0	0	0	53	53	42	0.00	0.00	T	NM_022159		79402057	-1	9	18	10	18	tier1	no_errors	ENST00000370742	ensembl	human	known	74_37	missense	47.37	50.00	SNP	0.976	C	9	10
DNAH17	8632	genome.wustl.edu	37	17	76567092	76567092	+	Missense_Mutation	SNP	C	C	T			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr17:76567092C>T	ENST00000585328.1	-	6	980	c.856G>A	c.(856-858)Gtg>Atg	p.V286M	DNAH17_ENST00000389840.5_Missense_Mutation_p.V286M	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	286	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AAATAGAGCACGATGTCGTTG	0.572													ENSG00000187775																																					0													51.0	31.0	38.0					17																	76567092		2203	4298	6501	SO:0001583	missense	0			-	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.856G>A	17.37:g.76567092C>T	ENSP00000465516:p.Val286Met		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.V286M	ENST00000585328.1	37	c.856		17	.	.	.	.	.	.	.	.	.	.	C	4.160	0.028120	0.08054	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.57907	0.37	4.85	4.85	0.62838	.	.	.	.	.	T	0.45915	0.1366	L	0.34521	1.04	0.09310	N	1	.	.	.	.	.	.	T	0.35276	-0.9795	7	0.33141	T	0.24	.	9.2254	0.37402	0.0:0.8997:0.0:0.1003	.	.	.	.	M	286	ENSP00000374490:V286M	ENSP00000300671:V286M	V	-	1	0	DNAH17	74078687	0.005000	0.15991	0.028000	0.17463	0.039000	0.13416	1.512000	0.35812	2.244000	0.73946	0.655000	0.94253	GTG	-	DH17	-	pfam_Dynein_heavy_dom-1		0.572	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DH17	HGNC	protein_coding	OTTHUMT00000318962.2	0	0	0	53	53	37	0.00	0.00	C	NM_173628		76567092	-1	15	10	30	76	tier1	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	33.33	11.63	SNP	0.019	T	15	30
PRX	57716	genome.wustl.edu	37	19	40902642	40902642	+	Silent	SNP	C	C	T	rs546393524		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr19:40902642C>T	ENST00000324001.7	-	7	1887	c.1617G>A	c.(1615-1617)ccG>ccA	p.P539P	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	539	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCCGCACCTCCGGCACAGCCA	0.597													ENSG00000105227	c|||	1	0.000199681	0.0	0.0014	5008	,	,		17209	0.0		0.0	False		,,,				2504	0.0																0													77.0	90.0	86.0					19																	40902642		2197	4290	6487	SO:0001819	synonymous_variant	0			-	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1617G>A	19.37:g.40902642C>T			Q9BXL9|Q9HCF2	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P539	ENST00000324001.7	37	c.1617	CCDS33028.1	19																																																																																			-	PRX	-	NULL		0.597	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	0	0	0	59	59	43	0.00	0.00	C	NM_020956		40902642	-1	25	17	47	45	tier1	no_errors	ENST00000324001	ensembl	human	known	74_37	silent	34.25	27.42	SNP	0.000	T	25	47
CNGA3	1261	genome.wustl.edu	37	2	99012463	99012463	+	Missense_Mutation	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr2:99012463G>A	ENST00000272602.2	+	7	869	c.830G>A	c.(829-831)cGc>cAc	p.R277H	CNGA3_ENST00000393504.1_Missense_Mutation_p.R277H|CNGA3_ENST00000409937.1_Missense_Mutation_p.R281H|CNGA3_ENST00000436404.2_Missense_Mutation_p.R259H			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	277			R -> C (in ACHM2; also found in patients with cone-rod dystrophy). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:15712225, ECO:0000269|PubMed:18521937, ECO:0000269|PubMed:24903488}.|R -> H (in ACHM2; also found in patients with cone-rod dystrophy; does not form functional homomeric or heteromeric channels). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:24903488}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						AGGTTCAACCGCCTACTGAAG	0.498													ENSG00000144191																																					0			GRCh37	CM014539	CNGA3	M							89.0	81.0	84.0					2																	99012463		2203	4300	6503	SO:0001583	missense	0			-	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.830G>A	2.37:g.99012463G>A	ENSP00000272602:p.Arg277His		E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.R277H	ENST00000272602.2	37	c.830	CCDS2034.1	2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577406	0.86645	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.99353	-5.77;-5.77;-5.77;-5.77	5.15	5.15	0.70609	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99645	0.9869	H	0.96777	3.88	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.97631	1.0142	10	0.87932	D	0	.	17.5731	0.87940	0.0:0.0:1.0:0.0	.	281;259;277	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	H	277;259;277;281	ENSP00000377140:R277H;ENSP00000410070:R259H;ENSP00000272602:R277H;ENSP00000386761:R281H	ENSP00000272602:R277H	R	+	2	0	CNGA3	98378895	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.487000	0.81328	2.677000	0.91161	0.563000	0.77884	CGC	-	CNGA3	-	pfam_Ion_trans_dom		0.498	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	HGNC	protein_coding	OTTHUMT00000252986.1	0	0	1	47	47	87	0.00	1.14	G	NM_001298		99012463	+1	21	73	26	84	tier1	no_errors	ENST00000272602	ensembl	human	known	74_37	missense	44.68	46.50	SNP	1.000	A	21	26
USP32P2	220594	genome.wustl.edu	37	17	18414858	18414858	+	RNA	SNP	A	A	T			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr17:18414858A>T	ENST00000425211.1	-	0	4411				USP32P2_ENST00000412260.1_RNA																							TAACAAACACAGATCAAACAA	0.279													ENSG00000233327																																					0																																												0			-																													17.37:g.18414858A>T				R	SNP	-	NULL	ENST00000425211.1	37	NULL		17																																																																																			-	USP32P2	-	-		0.279	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	USP32P2	HGNC	processed_transcript	OTTHUMT00000473021.1	0	0	0	55	55	15	0.00	0.00	A			18414858	-1	8	2	29	10	tier1	no_errors	ENST00000412260	ensembl	human	known	74_37	rna	21.62	16.67	SNP	0.899	T	8	29
CASP4	837	genome.wustl.edu	37	11	104819368	104819368	+	Missense_Mutation	SNP	C	C	T			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr11:104819368C>T	ENST00000444739.2	-	6	1727	c.817G>A	c.(817-819)Gca>Aca	p.A273T	CASP4_ENST00000531333.1_5'Flank|CASP4_ENST00000393150.3_Missense_Mutation_p.A217T	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	273					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TCCAAGGATGCTGGAGAGTCT	0.507													ENSG00000196954																																					0													156.0	121.0	133.0					11																	104819368		2202	4299	6501	SO:0001583	missense	0			-	U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.817G>A	11.37:g.104819368C>T	ENSP00000388566:p.Ala273Thr		A2NHL8|A2NHM0	Missense_Mutation	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.A273T	ENST00000444739.2	37	c.817	CCDS8327.1	11	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216512	0.39201	.	.	ENSG00000196954	ENST00000444739;ENST00000393150;ENST00000355546	T;T	0.20598	2.06;2.06	4.56	-3.09	0.05331	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);	2.968610	0.01232	N	0.008378	T	0.30135	0.0755	M	0.67953	2.075	0.09310	N	1	P	0.45768	0.866	P	0.53809	0.735	T	0.32561	-0.9902	10	0.23891	T	0.37	.	1.3335	0.02140	0.1367:0.3132:0.154:0.396	.	273	P49662	CASP4_HUMAN	T	273;217;226	ENSP00000388566:A273T;ENSP00000376857:A217T	ENSP00000347741:A226T	A	-	1	0	CASP4	104324578	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.128000	0.10531	-0.470000	0.06901	0.484000	0.47621	GCA	-	CASP4	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta		0.507	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP4	HGNC	protein_coding	OTTHUMT00000387751.1	0	0	0	51	51	77	0.00	0.00	C	NM_001225		104819368	-1	7	21	18	44	tier1	no_errors	ENST00000444739	ensembl	human	known	74_37	missense	28.00	32.31	SNP	0.000	T	7	18
HNRNPR	10236	genome.wustl.edu	37	1	23636715	23636715	+	3'UTR	SNP	T	T	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr1:23636715T>C	ENST00000374612.1	-	0	2257				HNRNPR_ENST00000476660.1_5'UTR|HNRNPR_ENST00000302271.6_3'UTR|HNRNPR_ENST00000478691.1_3'UTR|HNRNPR_ENST00000374616.3_3'UTR|HNRNPR_ENST00000427764.2_3'UTR	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		AAAAGCATTGTAATCCCCAGA	0.353													ENSG00000125944																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.*232A>G	1.37:g.23636715T>C			Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	R	SNP	-	NULL	ENST00000374612.1	37	NULL	CCDS232.1	1																																																																																			-	HNRNPR	-	-		0.353	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	HGNC	protein_coding	OTTHUMT00000008889.1	0	0	0	18	18	68	0.00	0.00	T	NM_005826		23636715	-1	4	35	5	34	tier1	no_errors	ENST00000476660	ensembl	human	known	74_37	rna	44.44	50.72	SNP	1.000	C	4	5
FAM200B	285550	genome.wustl.edu	37	4	15690018	15690018	+	Missense_Mutation	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr4:15690018G>A	ENST00000422728.2	+	2	2256	c.1418G>A	c.(1417-1419)aGa>aAa	p.R473K	FAM200B_ENST00000504137.1_Intron	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	473							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						tggcaagtaagacttaaaagt	0.299													ENSG00000237765																																					0													82.0	67.0	71.0					4																	15690018		692	1589	2281	SO:0001583	missense	0			-	BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.1418G>A	4.37:g.15690018G>A	ENSP00000393017:p.Arg473Lys			Missense_Mutation	SNP	superfamily_RNaseH-like_dom,superfamily_PAH	p.R473K	ENST00000422728.2	37	c.1418	CCDS47028.1	4	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600501	0.28534	.	.	ENSG00000237765	ENST00000422728	T	0.39997	1.05	2.68	1.82	0.25136	.	.	.	.	.	T	0.22820	0.0551	N	0.11313	0.125	0.09310	N	0.999992	P	0.51933	0.949	B	0.44224	0.444	T	0.05550	-1.0878	8	.	.	.	.	5.7624	0.18207	0.1545:0.0:0.8455:0.0	.	473	P0CF97	F200B_HUMAN	K	473	ENSP00000393017:R473K	.	R	+	2	0	FAM200B	15299116	0.553000	0.26513	0.646000	0.29493	0.675000	0.39556	0.969000	0.29370	0.701000	0.31803	0.555000	0.69702	AGA	-	FAM200B	-	superfamily_PAH		0.299	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM200B	HGNC	protein_coding	OTTHUMT00000360100.1	0	0	0	24	24	96	0.00	0.00	G	NM_001145191		15690018	+1	5	40	8	39	tier1	no_errors	ENST00000422728	ensembl	human	putative	74_37	missense	38.46	50.63	SNP	0.704	A	5	8
PHLDB2	90102	genome.wustl.edu	37	3	111681011	111681011	+	Missense_Mutation	SNP	C	C	T	rs367905377		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr3:111681011C>T	ENST00000431670.2	+	13	3340	c.2929C>T	c.(2929-2931)Cgc>Tgc	p.R977C	PHLDB2_ENST00000393923.3_Missense_Mutation_p.R961C|PHLDB2_ENST00000495180.1_Missense_Mutation_p.R468C|PHLDB2_ENST00000481953.1_Missense_Mutation_p.R934C|PHLDB2_ENST00000412622.1_Missense_Mutation_p.R934C|PHLDB2_ENST00000393925.3_Missense_Mutation_p.R977C|PHLDB2_ENST00000470699.2_3'UTR	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	977						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						ATTTTATAACCGCACAGCATC	0.403													ENSG00000144824																																					0								C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	122.0	120.0	121.0		2881,2929,2929,2800	6.0	1.0	3		121	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	PHLDB2	NM_001134437.1,NM_001134438.1,NM_001134439.1,NM_145753.2	180,180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	961/1238,977/1254,977/1254,934/1211	111681011	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2929C>T	3.37:g.111681011C>T	ENSP00000405405:p.Arg977Cys		A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R977C	ENST00000431670.2	37	c.2929	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011763	0.75046	0.0	1.16E-4	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47;0.47;0.47	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.69566	0.3125	M	0.68593	2.085	0.80722	D	1	D;D;D;D;D	0.89917	0.995;1.0;1.0;1.0;1.0	P;D;D;D;D	0.79784	0.482;0.982;0.987;0.993;0.993	T	0.71310	-0.4631	10	0.87932	D	0	.	12.8909	0.58071	0.1622:0.8378:0.0:0.0	.	96;468;977;934;961	Q658P8;E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;.;PHLB2_HUMAN;.;.	C	961;977;934;934;977;934;468	ENSP00000377500:R961C;ENSP00000405405:R977C;ENSP00000405292:R934C;ENSP00000418296:R934C;ENSP00000377502:R977C;ENSP00000418319:R934C;ENSP00000420303:R468C	ENSP00000377500:R961C	R	+	1	0	PHLDB2	113163701	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.052000	0.30429	2.840000	0.97914	0.655000	0.94253	CGC	-	PHLDB2	-	NULL		0.403	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1	0	0	0	50	50	70	0.00	0.00	C	NM_145753		111681011	+1	10	20	12	29	tier1	no_errors	ENST00000393925	ensembl	human	known	74_37	missense	45.45	40.82	SNP	1.000	T	10	12
DCLRE1B	64858	genome.wustl.edu	37	1	114455666	114455666	+	3'UTR	SNP	T	T	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr1:114455666T>C	ENST00000369563.3	+	0	2898				DCLRE1B_ENST00000466480.1_3'UTR	NM_022836.3	NP_073747.1	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B						cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|protection from non-homologous end joining at telomere (GO:0031848)|telomere maintenance (GO:0000723)|telomeric 3' overhang formation (GO:0031860)|telomeric loop formation (GO:0031627)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(6)|stomach(1)	18	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCACATAGCTGGGATATTTG	0.473								Other identified genes with known or suspected DNA repair function					ENSG00000118655																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BC029687	CCDS866.1	1p11.1	2010-06-24	2010-06-24		ENSG00000118655	ENSG00000118655			17641	protein-coding gene	gene with protein product	"""APOLLO"", ""PSO2 homolog (S. cerevisiae)"""	609683	"""DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)"""				Standard	NM_022836		Approved	SNM1B, FLJ12810, FLJ13998	uc001eeg.3	Q9H816	OTTHUMG00000011937	ENST00000369563.3:c.*853T>C	1.37:g.114455666T>C			Q9H9E5	R	SNP	-	NULL	ENST00000369563.3	37	NULL	CCDS866.1	1																																																																																			-	DCLRE1B	-	-		0.473	DCLRE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1B	HGNC	protein_coding	OTTHUMT00000033020.2	0	0	0	49	49	86	0.00	0.00	T	NM_022836		114455666	+1	12	30	47	84	tier1	no_errors	ENST00000466480	ensembl	human	known	74_37	rna	20.34	26.09	SNP	1.000	C	12	47
ENTHD1	150350	genome.wustl.edu	37	22	40139965	40139965	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr22:40139965C>A	ENST00000325157.6	-	7	1793	c.1543G>T	c.(1543-1545)Gag>Tag	p.E515*		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	515										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					GTGGAAAACTCCCCCCAGTGA	0.413													ENSG00000176177																																					0													52.0	52.0	52.0					22																	40139965		2203	4300	6503	SO:0001587	stop_gained	0			-	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.1543G>T	22.37:g.40139965C>A	ENSP00000317431:p.Glu515*		B0QYD5|Q5H9F7|Q96LK3	Nonsense_Mutation	SNP	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.E515*	ENST00000325157.6	37	c.1543	CCDS13998.1	22	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494157	0.85069	.	.	ENSG00000176177	ENST00000325157	.	.	.	5.75	4.55	0.56014	.	1.012140	0.07919	N	0.975663	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-4.0954	10.5424	0.45041	0.0:0.8995:0.0:0.1005	.	.	.	.	X	515	.	ENSP00000317431:E515X	E	-	1	0	ENTHD1	38469911	0.002000	0.14202	0.044000	0.18714	0.370000	0.29829	1.516000	0.35856	2.701000	0.92244	0.650000	0.86243	GAG	-	ENTHD1	-	NULL		0.413	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD1	HGNC	protein_coding	OTTHUMT00000321302.1	0	0	0	41	41	105	0.00	0.00	C	NM_152512		40139965	-1	14	32	21	100	tier1	no_errors	ENST00000325157	ensembl	human	known	74_37	nonsense	40.00	24.06	SNP	0.002	A	14	21
FAM91A1	157769	genome.wustl.edu	37	8	124796721	124796721	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr8:124796721G>T	ENST00000334705.7	+	9	961	c.715G>T	c.(715-717)Gaa>Taa	p.E239*	FAM91A1_ENST00000521166.1_Nonsense_Mutation_p.E239*	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	239										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			TCCACCTCTTGAAGGTTTTGT	0.299													ENSG00000176853																																					0													83.0	75.0	78.0					8																	124796721		1800	4065	5865	SO:0001587	stop_gained	0			-	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.715G>T	8.37:g.124796721G>T	ENSP00000335082:p.Glu239*		B6YY23|Q658T5|Q8TE89	Nonsense_Mutation	SNP	NULL	p.E239*	ENST00000334705.7	37	c.715	CCDS6346.2	8	.	.	.	.	.	.	.	.	.	.	G	39	7.508963	0.98329	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.2211	0.98325	0.0:0.0:1.0:0.0	.	.	.	.	X	239	.	ENSP00000335082:E239X	E	+	1	0	FAM91A1	124865902	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.701000	0.98710	2.853000	0.98044	0.644000	0.83932	GAA	-	FAM91A1	-	NULL		0.299	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM91A1	HGNC	protein_coding	OTTHUMT00000256607.1	0	0	0	51	51	46	0.00	0.00	G	NM_144963		124796721	+1	11	25	47	66	tier1	no_errors	ENST00000334705	ensembl	human	known	74_37	nonsense	18.97	27.47	SNP	1.000	T	11	47
ASXL2	55252	genome.wustl.edu	37	2	25966595	25966595	+	Missense_Mutation	SNP	A	A	T			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr2:25966595A>T	ENST00000435504.4	-	13	2904	c.2611T>A	c.(2611-2613)Tca>Aca	p.S871T	ASXL2_ENST00000272341.4_Intron|ASXL2_ENST00000336112.4_Missense_Mutation_p.S843T|ASXL2_ENST00000404843.1_Intron			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	871					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCTTTGATGAGGCTGAAGGG	0.478													ENSG00000143970																																					0													116.0	117.0	117.0					2																	25966595		2039	4188	6227	SO:0001583	missense	0			-			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2611T>A	2.37:g.25966595A>T	ENSP00000391447:p.Ser871Thr		Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.S871T	ENST00000435504.4	37	c.2611		2	.	.	.	.	.	.	.	.	.	.	A	8.823	0.938146	0.18206	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	T;T	0.21361	2.01;2.01	5.57	4.47	0.54385	.	0.999489	0.08097	N	0.998477	T	0.21145	0.0509	L	0.51422	1.61	0.09310	N	0.999999	B	0.29716	0.255	B	0.27262	0.078	T	0.18429	-1.0337	10	0.87932	D	0	-3.1847	6.8945	0.24249	0.7205:0.1914:0.088:0.0	.	871	Q76L83	ASXL2_HUMAN	T	871;843	ENSP00000391447:S871T;ENSP00000337250:S843T	ENSP00000337250:S843T	S	-	1	0	ASXL2	25820099	0.993000	0.37304	0.165000	0.22776	0.270000	0.26580	0.804000	0.27098	2.117000	0.64856	0.460000	0.39030	TCA	-	ASXL2	-	NULL		0.478	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	0	0	0	45	45	57	0.00	0.00	A	NM_018263		25966595	-1	19	23	70	84	tier1	no_errors	ENST00000435504	ensembl	human	known	74_37	missense	21.35	21.50	SNP	0.004	T	19	70
HEBP1	50865	genome.wustl.edu	37	12	13128328	13128328	+	Missense_Mutation	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr12:13128328G>A	ENST00000014930.4	-	4	642	c.484C>T	c.(484-486)Cgg>Tgg	p.R162W	RP11-392P7.6_ENST00000543515.2_RNA|HEBP1_ENST00000540916.1_5'UTR|RP11-392P7.6_ENST00000545914.1_RNA|RP11-392P7.6_ENST00000536029.1_RNA|RP11-392P7.6_ENST00000542078.1_RNA	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1	162					circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		ATGTCCCCCCGGTAGGTGGCT	0.582													ENSG00000013583																																					0													113.0	91.0	98.0					12																	13128328		2203	4300	6503	SO:0001583	missense	0			-	AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771	ENST00000014930.4:c.484C>T	12.37:g.13128328G>A	ENSP00000014930:p.Arg162Trp		A8K1G2|Q9Y5Z5	Missense_Mutation	SNP	pfam_SOUL_haem-bd,superfamily_Reg_factor_effector_dom	p.R162W	ENST00000014930.4	37	c.484	CCDS31749.1	12	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807848	0.50421	.	.	ENSG00000013583	ENST00000014930	T	0.23147	1.92	4.76	3.87	0.44632	Regulatory factor, effector, bacterial (1);	0.755390	0.13390	N	0.391492	T	0.35393	0.0930	L	0.50333	1.59	0.80722	D	1	D	0.61697	0.99	P	0.51101	0.659	T	0.17899	-1.0354	10	0.66056	D	0.02	-21.1915	13.7507	0.62906	0.0:0.0:0.8448:0.1552	.	162	Q9NRV9	HEBP1_HUMAN	W	162	ENSP00000014930:R162W	ENSP00000014930:R162W	R	-	1	2	HEBP1	13019595	1.000000	0.71417	0.123000	0.21794	0.029000	0.11900	3.725000	0.54970	1.355000	0.45865	-0.152000	0.13540	CGG	-	HEBP1	-	pfam_SOUL_haem-bd,superfamily_Reg_factor_effector_dom		0.582	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEBP1	HGNC	protein_coding	OTTHUMT00000401001.1	0	0	0	42	42	23	0.00	0.00	G			13128328	-1	14	16	53	64	tier1	no_errors	ENST00000014930	ensembl	human	known	74_37	missense	20.90	20.00	SNP	0.935	A	14	53
CIITA	4261	genome.wustl.edu	37	16	11016348	11016348	+	Splice_Site	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr16:11016348G>A	ENST00000324288.8	+	18	3450		c.e18+1		CIITA_ENST00000381835.5_Splice_Site	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator						aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						AGACGCTGGCGTAAGTCCAGG	0.607			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """								ENSG00000179583																												Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	0			GRCh37	CS971796	CIITA	S							30.0	32.0	31.0					16																	11016348		2197	4300	6497	SO:0001630	splice_region_variant	0			-	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.3317+1G>A	16.37:g.11016348G>A			A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Splice_Site	SNP	-	e18+1	ENST00000324288.8	37	c.3317+1	CCDS10544.1	16	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521641	0.64747	.	.	ENSG00000179583	ENST00000324288;ENST00000381835	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3515	0.66705	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CIITA	10923849	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	4.974000	0.63771	2.445000	0.82738	0.561000	0.74099	.	-	CIITA	-	-		0.607	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIITA	HGNC	protein_coding	OTTHUMT00000251966.2	0	0	0	63	63	41	0.00	0.00	G	NM_000246	Intron	11016348	+1	28	30	74	44	tier1	no_errors	ENST00000324288	ensembl	human	known	74_37	splice_site	27.45	40.54	SNP	1.000	A	28	74
SF3B3	23450	genome.wustl.edu	37	16	70595541	70595541	+	Silent	SNP	C	C	G			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr16:70595541C>G	ENST00000302516.5	+	17	2353	c.2142C>G	c.(2140-2142)gcC>gcG	p.A714A		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	714					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				AGGTATTGGCCATGTCAAGCC	0.448													ENSG00000189091																																					0													122.0	115.0	118.0					16																	70595541		2198	4300	6498	SO:0001819	synonymous_variant	0			-	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2142C>G	16.37:g.70595541C>G			Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C,superfamily_WD40_repeat_dom	p.A714	ENST00000302516.5	37	c.2142	CCDS10894.1	16																																																																																			-	SF3B3	-	superfamily_WD40_repeat_dom		0.448	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B3	HGNC	protein_coding	OTTHUMT00000268972.1	0	0	0	45	45	61	0.00	0.00	C	NM_012426		70595541	+1	11	36	10	29	tier1	no_errors	ENST00000302516	ensembl	human	known	74_37	silent	52.38	54.55	SNP	1.000	G	11	10
INTS9	55756	genome.wustl.edu	37	8	28651360	28651360	+	Missense_Mutation	SNP	T	T	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr8:28651360T>C	ENST00000521022.1	-	10	1082	c.1001A>G	c.(1000-1002)aAc>aGc	p.N334S	INTS9_ENST00000397363.4_Missense_Mutation_p.N228S|INTS9_ENST00000416984.2_Missense_Mutation_p.N313S|INTS9_ENST00000521777.1_Missense_Mutation_p.N310S	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	334					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		CAGTGAACTGTTGGCCACAGG	0.458													ENSG00000104299																																					0													77.0	76.0	77.0					8																	28651360		2203	4300	6503	SO:0001583	missense	0			-	BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.1001A>G	8.37:g.28651360T>C	ENSP00000429065:p.Asn334Ser		B7Z560|B7Z6M5|O00224|Q8TB16	Missense_Mutation	SNP	pfam_Beta_Casp	p.N334S	ENST00000521022.1	37	c.1001	CCDS34873.1	8	.	.	.	.	.	.	.	.	.	.	T	15.81	2.941974	0.53079	.	.	ENSG00000104299	ENST00000521022;ENST00000416984;ENST00000541706;ENST00000521777;ENST00000397363;ENST00000523436	T;T;T;T;T	0.41758	1.0;1.0;1.0;1.0;0.99	5.87	5.87	0.94306	Beta-Casp domain (1);	0.000000	0.85682	D	0.000000	T	0.33000	0.0848	L	0.29908	0.895	0.58432	D	0.999998	P;B;B	0.39094	0.659;0.059;0.073	B;B;B	0.37091	0.241;0.03;0.105	T	0.09250	-1.0683	10	0.34782	T	0.22	-38.0009	14.8516	0.70300	0.0:0.0:0.0:1.0	.	313;334;334	B7Z6M5;G3XAN1;Q9NV88	.;.;INT9_HUMAN	S	334;313;178;310;228;289	ENSP00000429065:N334S;ENSP00000398208:N313S;ENSP00000430943:N310S;ENSP00000380520:N228S;ENSP00000427789:N289S	ENSP00000380520:N228S	N	-	2	0	INTS9	28707279	1.000000	0.71417	0.999000	0.59377	0.636000	0.38137	6.289000	0.72696	2.248000	0.74166	0.533000	0.62120	AAC	-	INTS9	-	pfam_Beta_Casp		0.458	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS9	HGNC	protein_coding	OTTHUMT00000376846.1	0	0	0	20	20	56	0.00	0.00	T	NM_018250		28651360	-1	9	24	18	62	tier1	no_errors	ENST00000521022	ensembl	human	known	74_37	missense	33.33	26.37	SNP	1.000	C	9	18
NUP205	23165	genome.wustl.edu	37	7	135302372	135302372	+	Missense_Mutation	SNP	C	C	T			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr7:135302372C>T	ENST00000285968.6	+	27	3739	c.3713C>T	c.(3712-3714)gCt>gTt	p.A1238V		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1238					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						GTTCTTGTAGCTGAAGTAAAT	0.383													ENSG00000155561																																					0													82.0	79.0	80.0					7																	135302372		2203	4300	6503	SO:0001583	missense	0			-	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3713C>T	7.37:g.135302372C>T	ENSP00000285968:p.Ala1238Val		A6H8X3|Q86YC1	Missense_Mutation	SNP	pfam_Nup186/Nup192/Nup205	p.A1238V	ENST00000285968.6	37	c.3713	CCDS34759.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.619156	0.96649	.	.	ENSG00000155561	ENST00000285968	T	0.30714	1.52	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.44222	0.1283	L	0.47716	1.5	0.80722	D	1	D	0.63880	0.993	P	0.54759	0.76	T	0.03306	-1.1050	10	0.30854	T	0.27	-16.2792	20.3409	0.98764	0.0:1.0:0.0:0.0	.	1238	Q92621	NU205_HUMAN	V	1238	ENSP00000285968:A1238V	ENSP00000285968:A1238V	A	+	2	0	NUP205	134952912	1.000000	0.71417	0.814000	0.32528	0.987000	0.75469	7.487000	0.81328	2.814000	0.96858	0.655000	0.94253	GCT	-	NUP205	-	pfam_Nup186/Nup192/Nup205		0.383	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	HGNC	protein_coding	OTTHUMT00000340358.1	0	0	0	46	46	58	0.00	0.00	C			135302372	+1	11	9	41	54	tier1	no_errors	ENST00000285968	ensembl	human	known	74_37	missense	21.15	14.29	SNP	1.000	T	11	41
ASPRV1	151516	genome.wustl.edu	37	2	70188027	70188027	+	Missense_Mutation	SNP	T	T	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr2:70188027T>C	ENST00000320256.4	-	1	1370	c.794A>G	c.(793-795)aAg>aGg	p.K265R	PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						CAGCTTCAGCTTGCCTAGGGA	0.537													ENSG00000244617																																					0													114.0	97.0	103.0					2																	70188027		2203	4300	6503	SO:0001583	missense	0			-	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.794A>G	2.37:g.70188027T>C	ENSP00000315383:p.Lys265Arg			Missense_Mutation	SNP	pfam_Peptidase_aspartic_DDI1-type,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic_dom,pfscan_Peptidase_A2_cat	p.K265R	ENST00000320256.4	37	c.794	CCDS1897.1	2	.	.	.	.	.	.	.	.	.	.	T	17.25	3.341310	0.60963	.	.	ENSG00000244617	ENST00000320256	T	0.48201	0.82	5.09	3.93	0.45458	Peptidase aspartic (1);Peptidase A2A, retrovirus, catalytic (1);Peptidase aspartic, eukaryotic predicted (1);	0.122355	0.33772	N	0.004564	T	0.40670	0.1126	N	0.14661	0.345	0.29285	N	0.869747	P	0.51240	0.943	P	0.54060	0.741	T	0.30119	-0.9989	10	0.49607	T	0.09	-20.1711	8.9965	0.36055	0.0:0.0:0.1864:0.8136	.	265	Q53RT3	APRV1_HUMAN	R	265	ENSP00000315383:K265R	ENSP00000315383:K265R	K	-	2	0	ASPRV1	70041531	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	1.655000	0.37345	0.950000	0.37743	0.533000	0.62120	AAG	-	ASPRV1	-	pfam_Peptidase_aspartic_DDI1-type,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic_dom,pfscan_Peptidase_A2_cat		0.537	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPRV1	HGNC	protein_coding	OTTHUMT00000334161.1	0	0	0	36	36	86	0.00	0.00	T	NM_152792		70188027	-1	14	26	47	105	tier1	no_errors	ENST00000320256	ensembl	human	known	74_37	missense	22.58	19.85	SNP	0.999	C	14	47
COX10	1352	genome.wustl.edu	37	17	14110294	14110294	+	Missense_Mutation	SNP	G	G	C	rs111541535	byFrequency	TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr17:14110294G>C	ENST00000261643.3	+	7	1173	c.1096G>C	c.(1096-1098)Gtg>Ctg	p.V366L	COX10_ENST00000536205.1_Missense_Mutation_p.V174L|COX10_ENST00000537334.1_Missense_Mutation_p.V149L	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	366					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GGCCCTGCTCGTGCTGTCCGC	0.657													ENSG00000006695																																					0													96.0	80.0	86.0					17																	14110294		2203	4300	6503	SO:0001583	missense	0			-	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.1096G>C	17.37:g.14110294G>C	ENSP00000261643:p.Val366Leu		B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase	p.V366L	ENST00000261643.3	37	c.1096	CCDS11166.1	17	.	.	.	.	.	.	.	.	.	.	G	0.541	-0.853485	0.02630	.	.	ENSG00000006695	ENST00000261643;ENST00000536205;ENST00000537334	D;D;D	0.92495	-3.05;-3.05;-3.05	4.79	4.79	0.61399	.	0.522967	0.21277	N	0.077210	T	0.78065	0.4225	N	0.01473	-0.845	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.0	T	0.52881	-0.8516	10	0.02654	T	1	-18.4084	18.2004	0.89836	0.0:0.0:1.0:0.0	.	174;366	B4DJ50;Q12887	.;COX10_HUMAN	L	366;174;149	ENSP00000261643:V366L;ENSP00000439494:V174L;ENSP00000443354:V149L	ENSP00000261643:V366L	V	+	1	0	COX10	14051019	0.987000	0.35691	0.004000	0.12327	0.031000	0.12232	6.076000	0.71267	2.386000	0.81285	0.561000	0.74099	GTG	-	COX10	-	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase		0.657	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX10	HGNC	protein_coding	OTTHUMT00000130003.1	0	0	0	46	46	12	0.00	0.00	G	NM_001303		14110294	+1	15	8	49	15	tier1	no_errors	ENST00000261643	ensembl	human	known	74_37	missense	23.44	34.78	SNP	0.063	C	15	49
PDE4D	5144	genome.wustl.edu	37	5	59284463	59284463	+	Missense_Mutation	SNP	A	A	G			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr5:59284463A>G	ENST00000502484.2	-	3	347	c.124T>C	c.(124-126)Tca>Cca	p.S42P	PDE4D_ENST00000546160.1_Missense_Mutation_p.S42P	NM_001165899.1	NP_001159371.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	0	Pro-rich.				adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	TTGCGACATGAAAGTCTCCGG	0.473													ENSG00000113448																																					0													168.0	153.0	158.0					5																	59284463		1568	3582	5150	SO:0001583	missense	0			-		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000502484.2:c.124T>C	5.37:g.59284463A>G	ENSP00000423094:p.Ser42Pro		O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,prints_PDEase	p.S42P	ENST00000502484.2	37	c.124	CCDS54859.1	5	.	.	.	.	.	.	.	.	.	.	A	19.81	3.896670	0.72639	.	.	ENSG00000113448	ENST00000502484;ENST00000546160;ENST00000505507;ENST00000514552	T;T	0.67523	-0.27;-0.27	5.71	5.71	0.89125	.	.	.	.	.	T	0.81240	0.4781	.	.	.	0.39844	D	0.973153	D;D	0.89917	1.0;0.981	D;D	0.87578	0.998;0.959	T	0.81953	-0.0697	8	0.39692	T	0.17	.	15.9722	0.80027	1.0:0.0:0.0:0.0	.	42;42	D6RIG1;Q08499-11	.;.	P	42	ENSP00000423094:S42P;ENSP00000442734:S42P	ENSP00000423094:S42P	S	-	1	0	PDE4D	59320220	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.912000	0.87465	2.176000	0.68965	0.477000	0.44152	TCA	-	PDE4D	-	NULL		0.473	PDE4D-003	KNOWN	basic|CCDS	protein_coding	PDE4D	HGNC	protein_coding	OTTHUMT00000368094.3	0	0	0	87	87	73	0.00	0.00	A			59284463	-1	34	34	101	105	tier1	no_errors	ENST00000502484	ensembl	human	known	74_37	missense	25.19	24.46	SNP	1.000	G	34	101
ANO4	121601	genome.wustl.edu	37	12	101295493	101295493	+	5'UTR	SNP	G	G	A	rs573437877		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr12:101295493G>A	ENST00000392977.3	+	0	140				ANO4_ENST00000538618.1_Missense_Mutation_p.R143H|ANO4_ENST00000392979.3_5'UTR|ANO4_ENST00000299222.9_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						GTGGCAAGCCGCCCAGCGTCA	0.493										HNSCC(74;0.22)			ENSG00000151572	G|||	1	0.000199681	0.0008	0.0	5008	,	,		19461	0.0		0.0	False		,,,				2504	0.0																0													35.0	30.0	32.0					12																	101295493		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			-	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.-71G>A	12.37:g.101295493G>A			Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	NULL	p.R143H	ENST00000392977.3	37	c.428		12	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785528	0.70337	.	.	ENSG00000151572	ENST00000538618	T	0.74526	-0.85	5.64	1.84	0.25277	.	.	.	.	.	T	0.76442	0.3988	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73711	-0.3897	6	0.66056	D	0.02	.	6.8623	0.24074	0.469:0.0:0.531:0.0	.	.	.	.	H	143	ENSP00000443751:R143H	ENSP00000443751:R143H	R	+	2	0	ANO4	99819624	0.985000	0.35326	0.999000	0.59377	0.757000	0.42996	0.096000	0.15147	0.347000	0.23924	-0.123000	0.14984	CGC	-	ANO4	-	NULL		0.493	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	0	0	0	32	32	42	0.00	0.00	G	NM_178826		101295493	+1	6	20	39	47	tier1	no_errors	ENST00000538618	ensembl	human	known	74_37	missense	13.33	29.85	SNP	0.993	A	6	39
PIK3CA	5290	genome.wustl.edu	37	3	178947119	178947119	+	Missense_Mutation	SNP	G	G	A	rs199943173		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr3:178947119G>A	ENST00000263967.3	+	18	2712	c.2555G>A	c.(2554-2556)cGa>cAa	p.R852Q		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	852	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAGGTGGTGCGAAATTCTCAC	0.423		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)			ENSG00000121879																									Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													151.0	142.0	145.0					3																	178947119		1936	4153	6089	SO:0001583	missense	0			-		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2555G>A	3.37:g.178947119G>A	ENSP00000263967:p.Arg852Gln		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.R852Q	ENST00000263967.3	37	c.2555	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569100	0.65765	.	.	ENSG00000121879	ENST00000263967	T	0.75589	-0.95	5.38	5.38	0.77491	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	T	0.59702	0.2213	N	0.12527	0.23	0.80722	D	1	B	0.21753	0.06	B	0.21708	0.036	T	0.55082	-0.8196	10	0.17369	T	0.5	-17.0035	19.1149	0.93334	0.0:0.0:1.0:0.0	.	852	P42336	PK3CA_HUMAN	Q	852	ENSP00000263967:R852Q	ENSP00000263967:R852Q	R	+	2	0	PIK3CA	180429813	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.367000	0.97148	2.523000	0.85059	0.446000	0.29264	CGA	rs199943173	PIK3CA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.423	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	0	0	0	75	75	69	0.00	0.00	G			178947119	+1	17	40	23	31	tier1	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	42.50	56.34	SNP	1.000	A	17	23
NEB	4703	genome.wustl.edu	37	2	152581369	152581369	+	Splice_Site	SNP	A	A	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr2:152581369A>C	ENST00000172853.10	-	7	655		c.e7+1		NEB_ENST00000409198.1_Splice_Site|NEB_ENST00000604864.1_Splice_Site|NEB_ENST00000397345.3_Splice_Site|NEB_ENST00000427231.2_Splice_Site|NEB_ENST00000603639.1_Splice_Site			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCATTGCCTTACCTTACTGAC	0.443													ENSG00000183091																																					0													221.0	197.0	205.0					2																	152581369		2052	4215	6267	SO:0001630	splice_region_variant	0			-	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.507+1T>G	2.37:g.152581369A>C			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Splice_Site	SNP	-	e5+2	ENST00000172853.10	37	c.507+2		2	.	.	.	.	.	.	.	.	.	.	A	18.38	3.610296	0.66558	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000439291	.	.	.	5.41	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.844	0.52374	0.8686:0.0:0.0:0.1314	.	.	.	.	.	-1	.	.	.	-	.	.	NEB	152289615	1.000000	0.71417	0.992000	0.48379	0.881000	0.50899	7.903000	0.87398	0.960000	0.38005	0.533000	0.62120	.	-	NEB	-	-		0.443	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		0	0	0	101	101	59	0.00	0.00	A	NM_004543	Intron	152581369	-1	63	54	83	47	tier1	no_errors	ENST00000397345	ensembl	human	known	74_37	splice_site	42.86	53.47	SNP	1.000	C	63	83
SOX9	6662	genome.wustl.edu	37	17	70119794	70119794	+	Missense_Mutation	SNP	C	C	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr17:70119794C>A	ENST00000245479.2	+	3	1168	c.796C>A	c.(796-798)Ccc>Acc	p.P266T		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	266					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			GGGCAGACAGCCCCCTATCGA	0.652													ENSG00000125398																									Pancreas(42;83 1041 2320 35205 39456)												0													60.0	70.0	67.0					17																	70119794		2203	4300	6503	SO:0001583	missense	0			-	S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.796C>A	17.37:g.70119794C>A	ENSP00000245479:p.Pro266Thr		Q53Y80	Missense_Mutation	SNP	pfam_Sox_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.P266T	ENST00000245479.2	37	c.796	CCDS11689.1	17	.	.	.	.	.	.	.	.	.	.	C	15.64	2.892754	0.52121	.	.	ENSG00000125398	ENST00000245479;ENST00000455872	D	0.81821	-1.54	4.53	3.54	0.40534	.	0.255159	0.33364	N	0.004997	D	0.88317	0.6404	M	0.87180	2.865	0.50632	D	0.999886	D	0.60575	0.988	P	0.60068	0.868	D	0.87290	0.2298	10	0.27082	T	0.32	.	14.0688	0.64849	0.0:0.8474:0.1526:0.0	.	266	P48436	SOX9_HUMAN	T	266	ENSP00000245479:P266T	ENSP00000245479:P266T	P	+	1	0	SOX9	67631389	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	7.443000	0.80521	0.875000	0.35847	-0.502000	0.04539	CCC	-	SOX9	-	NULL		0.652	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX9	HGNC	protein_coding	OTTHUMT00000389032.1	0	0	0	40	40	10	0.00	0.00	C	NM_000346		70119794	+1	5	3	50	13	tier1	no_errors	ENST00000245479	ensembl	human	known	74_37	missense	9.09	18.75	SNP	1.000	A	5	50
MICAL3	57553	genome.wustl.edu	37	22	18310466	18310466	+	Missense_Mutation	SNP	C	C	A	rs200328549		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr22:18310466C>A	ENST00000441493.2	-	22	3489	c.3137G>T	c.(3136-3138)cGt>cTt	p.R1046L		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1046	Glu-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CTCTCTCTCACGGATATGAGT	0.637													ENSG00000243156																																					0													22.0	25.0	24.0					22																	18310466		1968	4143	6111	SO:0001583	missense	0			-	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3137G>T	22.37:g.18310466C>A	ENSP00000416015:p.Arg1046Leu		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.R1046L	ENST00000441493.2	37	c.3137	CCDS46659.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.091820|4.091820	0.76756|0.76756	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000441493|ENST00000252134	T|.	0.63744|.	-0.06|.	4.95|4.95	1.7|1.7	0.24286|0.24286	.|.	.|.	.|.	.|.	.|.	T|T	0.51176|0.51176	0.1659|0.1659	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	B|.	0.32160|.	0.358|.	B|.	0.31101|.	0.124|.	T|T	0.38585|0.38585	-0.9654|-0.9654	8|5	.|.	.|.	.|.	.|.	9.8375|9.8375	0.40977|0.40977	0.0:0.7759:0.0:0.2241|0.0:0.7759:0.0:0.2241	.|.	1046|.	Q7RTP6|.	MICA3_HUMAN|.	L|L	1046|28	ENSP00000416015:R1046L|.	.|.	R|V	-|-	2|1	0|0	XXbac-B461K10.4|XXbac-B461K10.4	16690466|16690466	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.968000|0.968000	0.65278|0.65278	2.324000|2.324000	0.43831|0.43831	0.608000|0.608000	0.30000|0.30000	0.549000|0.549000	0.68633|0.68633	CGT|GTG	-	MICAL3	-	NULL		0.637	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	HGNC	protein_coding	OTTHUMT00000447351.1	0	0	0	120	120	35	0.00	0.00	C			18310466	-1	29	10	86	37	tier1	no_errors	ENST00000441493	ensembl	human	known	74_37	missense	25.22	21.28	SNP	1.000	A	29	86
CTC1	80169	genome.wustl.edu	37	17	8134669	8134669	+	Missense_Mutation	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr17:8134669G>A	ENST00000315684.8	-	15	2601	c.2594C>T	c.(2593-2595)tCc>tTc	p.S865F		NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	865					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						GATATCCTGGGAGCTTTCAAG	0.532													ENSG00000178971																																					0													58.0	58.0	58.0					17																	8134669		1978	4166	6144	SO:0001583	missense	0			-	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.2594C>T	17.37:g.8134669G>A	ENSP00000313759:p.Ser865Phe		B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	NULL	p.S865F	ENST00000315684.8	37	c.2594	CCDS42259.1	17	.	.	.	.	.	.	.	.	.	.	G	7.079	0.569898	0.13560	.	.	ENSG00000178971	ENST00000315684;ENST00000449476	D;D	0.83673	-1.75;-1.75	5.38	3.38	0.38709	.	0.431890	0.24940	N	0.034384	D	0.84995	0.5596	L	0.57536	1.79	0.09310	N	1	P	0.52061	0.95	P	0.53062	0.717	T	0.77603	-0.2526	10	0.62326	D	0.03	-8.5291	12.3208	0.54983	0.0:0.3498:0.6502:0.0	.	865	Q2NKJ3	CTC1_HUMAN	F	865;830	ENSP00000313759:S865F;ENSP00000396018:S830F	ENSP00000313759:S865F	S	-	2	0	CTC1	8075394	0.365000	0.25006	0.005000	0.12908	0.042000	0.13812	1.457000	0.35212	0.830000	0.34757	0.655000	0.94253	TCC	-	CTC1	-	NULL		0.532	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CTC1	HGNC	protein_coding	OTTHUMT00000442012.1	0	0	0	41	41	57	0.00	0.00	G	NM_025099		8134669	-1	14	21	29	31	tier1	no_errors	ENST00000315684	ensembl	human	known	74_37	missense	32.56	40.38	SNP	0.011	A	14	29
COA3	28958	genome.wustl.edu	37	17	40950489	40950489	+	Missense_Mutation	SNP	T	T	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr17:40950489T>C	ENST00000328434.7	-	1	233	c.211A>G	c.(211-213)Att>Gtt	p.I71V	CNTD1_ENST00000588527.1_5'Flank|CNTD1_ENST00000588408.1_5'Flank	NM_001040431.1	NP_001035521.1	Q9Y2R0	COA3_HUMAN	cytochrome c oxidase assembly factor 3	71					mitochondrial respiratory chain complex IV assembly (GO:0033617)|positive regulation of mitochondrial translation (GO:0070131)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrion (GO:0005739)											CGGATACAAATAGCCAACACC	0.592													ENSG00000183978																																					0													64.0	66.0	65.0					17																	40950489		2203	4299	6502	SO:0001583	missense	0			-	AF070665	CCDS32660.1	17q21.31	2014-01-28	2012-10-15	2012-08-07				"""Mitochondrial respiratory chain complex assembly factors"""	24990	protein-coding gene	gene with protein product		614775	"""coiled-coil domain containing 56"""	CCDC56		22356826, 22610097	Standard	NM_001040431		Approved	HSPC009, MITRAC12	uc010wgz.2	Q9Y2R0		ENST00000328434.7:c.211A>G	17.37:g.40950489T>C	ENSP00000354762:p.Ile71Val		A8K498	Missense_Mutation	SNP	pfam_Coiled-coil_56	p.I71V	ENST00000328434.7	37	c.211	CCDS32660.1	17	.	.	.	.	.	.	.	.	.	.	T	21.9	4.218637	0.79464	.	.	ENSG00000183978	ENST00000328434	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.77432	0.4129	M	0.65498	2.005	0.80722	D	1	D	0.69078	0.997	D	0.85130	0.997	T	0.79811	-0.1646	9	0.72032	D	0.01	.	15.2055	0.73175	0.0:0.0:0.0:1.0	.	71	Q9Y2R0	CCD56_HUMAN	V	71	.	ENSP00000354762:I71V	I	-	1	0	CCDC56	38204015	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.336000	0.79245	2.257000	0.74773	0.528000	0.53228	ATT	-	COA3	-	pfam_Coiled-coil_56		0.592	COA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COA3	HGNC	protein_coding	OTTHUMT00000452397.1	0	0	0	52	52	61	0.00	0.00	T	NM_014019		40950489	-1	13	20	36	89	tier1	no_errors	ENST00000328434	ensembl	human	known	74_37	missense	26.53	18.35	SNP	1.000	C	13	36
DCHS2	54798	genome.wustl.edu	37	4	155219572	155219572	+	Missense_Mutation	SNP	T	T	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr4:155219572T>C	ENST00000357232.4	-	18	4528	c.4529A>G	c.(4528-4530)aAt>aGt	p.N1510S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1510	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGTTTGCCCATTCAGGCCTTC	0.468													ENSG00000197410																																					0													136.0	132.0	133.0					4																	155219572		2203	4300	6503	SO:0001583	missense	0			-	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4529A>G	4.37:g.155219572T>C	ENSP00000349768:p.Asn1510Ser		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_D-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N1510S	ENST00000357232.4	37	c.4529	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	20.0	3.930573	0.73327	.	.	ENSG00000197410	ENST00000357232	T	0.60040	0.22	5.76	3.34	0.38264	Cadherin (4);Cadherin-like (1);	0.134513	0.49916	N	0.000139	T	0.69097	0.3073	M	0.86343	2.81	0.80722	D	1	P	0.51933	0.949	P	0.52189	0.692	T	0.70230	-0.4929	10	0.48119	T	0.1	.	10.0819	0.42395	0.0:0.1356:0.0:0.8644	.	1510	Q6V1P9	PCD23_HUMAN	S	1510	ENSP00000349768:N1510S	ENSP00000349768:N1510S	N	-	2	0	DCHS2	155439022	1.000000	0.71417	0.979000	0.43373	0.976000	0.68499	4.634000	0.61325	0.541000	0.28827	0.528000	0.53228	AAT	-	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.468	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	0	0	0	75	75	54	0.00	0.00	T	NM_001142552		155219572	-1	31	35	62	76	tier1	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	33.33	31.53	SNP	1.000	C	31	62
OR52L1	338751	genome.wustl.edu	37	11	6007874	6007874	+	Missense_Mutation	SNP	G	G	T	rs72484715		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr11:6007874G>T	ENST00000332249.4	-	1	341	c.287C>A	c.(286-288)gCa>gAa	p.A96E		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCTTTGGGTGCAGTGGAGGA	0.527													ENSG00000183313																									Melanoma(121;653 1666 10547 22796 51255)												0													64.0	68.0	67.0					11																	6007874		2113	4239	6352	SO:0001583	missense	0			-	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.287C>A	11.37:g.6007874G>T	ENSP00000330338:p.Ala96Glu		B2RPA6|Q6IFK9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A96E	ENST00000332249.4	37	c.287	CCDS44529.1	11	.	.	.	.	.	.	.	.	.	.	G	15.60	2.882329	0.51908	.	.	ENSG00000183313	ENST00000332249	T	0.03094	4.05	3.64	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.191457	0.25503	N	0.030225	T	0.04770	0.0129	M	0.64630	1.985	0.25189	N	0.990148	P	0.46706	0.883	B	0.41135	0.348	T	0.32402	-0.9908	10	0.87932	D	0	.	4.6677	0.12673	0.3413:0.0:0.6587:0.0	.	96	Q8NGH7	O52L1_HUMAN	E	96	ENSP00000330338:A96E	ENSP00000330338:A96E	A	-	2	0	OR52L1	5964450	0.000000	0.05858	1.000000	0.80357	0.951000	0.60555	-0.062000	0.11674	1.747000	0.51819	0.313000	0.20887	GCA	-	OR52L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.527	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52L1	HGNC	protein_coding	OTTHUMT00000383754.1	0	0	0	86	86	22	0.00	0.00	G	NM_001005173		6007874	-1	32	8	73	20	tier1	no_errors	ENST00000332249	ensembl	human	known	74_37	missense	30.48	28.57	SNP	0.821	T	32	73
TUBA3C	7278	genome.wustl.edu	37	13	19753654	19753654	+	Missense_Mutation	SNP	T	T	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr13:19753654T>C	ENST00000400113.3	-	2	157	c.53A>G	c.(52-54)aAt>aGt	p.N18S	RP11-408E5.4_ENST00000382988.2_5'Flank	NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	18					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCAGCAGGCATTGCCGATCTG	0.507													ENSG00000198033																																					0													174.0	145.0	155.0					13																	19753654		2203	4300	6503	SO:0001583	missense	0			-	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.53A>G	13.37:g.19753654T>C	ENSP00000382982:p.Asn18Ser		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.N18S	ENST00000400113.3	37	c.53	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	t	8.853	0.945152	0.18356	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.70869	-0.52	1.37	1.37	0.22104	.	0.000000	0.49916	U	0.000126	T	0.71533	0.3351	.	.	.	0.35830	D	0.825224	.	.	.	.	.	.	T	0.76160	-0.3061	7	0.87932	D	0	.	6.8515	0.24018	0.0:0.0:0.0:1.0	.	.	.	.	S	18	ENSP00000382982:N18S	ENSP00000354037:N18S	N	-	2	0	TUBA3C	18651654	1.000000	0.71417	0.998000	0.56505	0.746000	0.42486	3.906000	0.56340	0.885000	0.36088	0.163000	0.16589	AAT	-	TUBA3C	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Tubulin		0.507	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	0	0	0	93	93	28	0.00	0.00	T	NM_006001		19753654	-1	31	12	34	25	tier1	no_errors	ENST00000400113	ensembl	human	known	74_37	missense	47.69	32.43	SNP	1.000	C	31	34
FLG	2312	genome.wustl.edu	37	1	152281987	152281987	+	Missense_Mutation	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr1:152281987G>A	ENST00000368799.1	-	3	5410	c.5375C>T	c.(5374-5376)tCc>tTc	p.S1792F	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1792	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCGTGGCGGGATCTTTGTCT	0.602									Ichthyosis				ENSG00000143631																																					0													240.0	248.0	245.0					1																	152281987		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	-	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5375C>T	1.37:g.152281987G>A	ENSP00000357789:p.Ser1792Phe		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S1792F	ENST00000368799.1	37	c.5375	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477417	0.26511	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.03801	3.8	4.33	-0.424	0.12321	.	.	.	.	.	T	0.08537	0.0212	M	0.80982	2.52	0.09310	N	1	D	0.61697	0.99	D	0.71656	0.974	T	0.07028	-1.0794	9	0.87932	D	0	.	7.3343	0.26601	0.0:0.3224:0.4067:0.2709	.	1792	P20930	FILA_HUMAN	F	1792;27	ENSP00000357789:S1792F	ENSP00000271820:S27F	S	-	2	0	FLG	150548611	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.187000	0.03067	-0.132000	0.11557	0.558000	0.71614	TCC	-	FLG	-	NULL		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	1	1	0	188	188	11	0.53	0.00	G	NM_002016		152281987	-1	57	3	142	11	tier1	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	28.36	21.43	SNP	0.000	A	57	142
KMT2E	55904	genome.wustl.edu	37	7	104747888	104747889	+	Frame_Shift_Ins	INS	-	-	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr7:104747888_104747889insA	ENST00000311117.3	+	22	3529_3530	c.2984_2985insA	c.(2983-2988)ataaagfs	p.IK995fs	KMT2E_ENST00000334877.4_Frame_Shift_Ins_p.IK995fs|KMT2E_ENST00000257745.4_Frame_Shift_Ins_p.IK995fs|KMT2E_ENST00000334914.7_Frame_Shift_Ins_p.IK50fs|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	995					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CTGCAAGAAATAAAGACTATTG	0.401													ENSG00000005483																																					0																																										SO:0001589	frameshift_variant	0				AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2987dupA	7.37:g.104747891_104747891dupA	ENSP00000312379:p.Ile995fs		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Frame_Shift_Ins	INS	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.T997fs	ENST00000311117.3	37	c.2984_2985	CCDS34723.1	7																																																																																				KMT2E	-	NULL		0.401	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1	0	0	0	34	34	88	0.00	0.00	-			104747889	+1	9	24	21	108	tier1	no_errors	ENST00000257745	ensembl	human	known	74_37	frame_shift_ins	30.00	18.18	INS	1.000:1.000	A	9	21
KIT	3815	genome.wustl.edu	37	4	55593603	55593616	+	Frame_Shift_Del	DEL	TGGAAGGTTGTTGA	TGGAAGGTTGTTGA	-	rs121913517|rs200375589|rs121913511|rs121913510|rs121913685|rs121913234|rs121913235|rs121913520|rs121913521		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	TGGAAGGTTGTTGA	TGGAAGGTTGTTGA	TGGAAGGTTGTTGA	-	TGGAAGGTTGTTGA	TGGAAGGTTGTTGA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr4:55593603_55593616delTGGAAGGTTGTTGA	ENST00000288135.5	+	11	1766_1779	c.1669_1682delTGGAAGGTTGTTGA	c.(1669-1683)tggaaggttgttgagfs	p.WKVVE557fs		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	557			Missing (in GIST; somatic mutation). {ECO:0000269|PubMed:15824741, ECO:0000269|PubMed:9438854}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.W557_K558del(120)|p.V559D(58)|p.V560D(52)|p.W557R(28)|p.W557G(23)|p.V559del(18)|p.W557_V559>F(18)|p.W557_E561del(17)|p.V560del(16)|p.V559A(16)|p.V559G(12)|p.K558_E562del(10)|p.V560G(9)|p.W557_V559>C(9)|p.Y553_K558>(8)|p.E554_K558del(8)|p.V559_E561del(8)|p.M552_W557del(8)|p.K558>NP(8)|p.K550_K558del(7)|p.W557_V559del(7)|p.V559_V560del(6)|p.V560E(6)|p.Q556_V560del(6)|p.K558_V560del(5)|p.E561K(5)|p.V560_L576del(4)|p.W557del(4)|p.Y553_K558del(4)|p.V559I(4)|p.W557_V560>C(3)|p.Y553_W557del(3)|p.V555_K558del(3)|p.W557_K558>CP(3)|p.V555_P573del(3)|p.V555_I571del(3)|p.Y553_T574>S(3)|p.V559_G565del(3)|p.K558K(3)|p.W557S(3)|p.V555_V559del(3)|p.K558R(3)|p.K558N(3)|p.K558_V559del(3)|p.Q556_V560>H(3)|p.V555_V560del(3)|p.V555_E562del(2)|p.W557_P573>S(2)|p.V560_I571del(2)|p.W557_K558>E(2)|p.W557_V560del(2)|p.Q556_L576del(2)|p.K558_V559>SS(2)|p.K558E(2)|p.W557_Q575del(2)|p.Q556_V559del(2)|p.K558_V560>I(2)|p.K558_V560>N(2)|p.V560V(2)|p.K558_V559>N(2)|p.K550fs*6(2)|p.K550_V559del(2)|p.E561del(2)|p.K558_N564del(2)|p.Q556_K558del(2)|p.P551_K558del(1)|p.W557_V560>F(1)|p.M552_E561>K(1)|p.E561_P577del(1)|p.Q556_K558>HPCR(1)|p.K558_Q575del(1)|p.V555_Y570del(1)|p.M552_T574>TESA(1)|p.Q556_D572>PS(1)|p.W557_K558>CT(1)|p.Q556_V559>H(1)|p.V559_P573>A(1)|p.Q556_W557>R(1)|p.V559_L576del(1)|p.K550_W557del(1)|p.Q556_D572>H(1)|p.E554_E562del(1)|p.Q556_N566>SNNLQLY(1)|p.W557_K558>C(1)|p.Q556_W557del(1)|p.W557_K558>S(1)|p.E554_I571del(1)|p.V555_V560>V(1)|p.K558_G565>R(1)|p.K558*(1)|p.V559K(1)|p.W557_E562del(1)|p.W557*(1)|p.Q556_P573del(1)|p.M552_K558del(1)|p.Q556_D572del(1)|p.Q556_E561>HH(1)|p.K558_L576>NV(1)|p.W557_K558>SS(1)|p.W557C(1)|p.M552_D572del(1)|p.Q556_T574del(1)|p.P551_V559del>L(1)|p.E554_D572del(1)|p.Q556_V559>HT(1)|p.Y553_V559del(1)|p.M552_W557>R(1)|p.V560A(1)|p.V555_N566>D(1)|p.V559_N564del(1)|p.Q556_V560>TTF(1)|p.Q556_V560>HNLQLY(1)|p.W557_V559>I(1)|p.Q556_K558>R(1)|p.K558_V560>M(1)|p.W557_K558>FP(1)|p.V555_G565del(1)|p.V555_I563del(1)|p.K558_G565del(1)|p.Q556_V560>F(1)|p.V559_E562del(1)|p.V559_I571del(1)|p.Q556_K558>H(1)|p.Q556_E561del(1)|p.W557_I571del(1)|p.E554_N564del(1)|p.K558_D572del(1)|p.K558_Y570>N(1)|p.Y553_V559>E(1)|p.E561G(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGAAGTACAGTGGAAGGTTGTTGAGGAGATAAAT	0.383		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors				ENSG00000157404																											yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	655	Deletion - In frame(320)|Substitution - Missense(228)|Complex - deletion inframe(79)|Complex - insertion inframe(11)|Complex - compound substitution(8)|Substitution - coding silent(5)|Substitution - Nonsense(2)|Deletion - Frameshift(2)	soft_tissue(602)|skin(23)|haematopoietic_and_lymphoid_tissue(21)|genital_tract(3)|testis(3)|salivary_gland(1)|thymus(1)|lung(1)	GRCh37	CD982724|CM005329|CM013551|CM077194|CM950713	KIT	D|M	rs121913235|rs121913517|rs67104871																																			SO:0001589	frameshift_variant	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)		S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1669_1682delTGGAAGGTTGTTGA	4.37:g.55593603_55593616delTGGAAGGTTGTTGA	ENSP00000288135:p.Trp557fs		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.W557fs	ENST00000288135.5	37	c.1669_1682	CCDS3496.1	4																																																																																				KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,superfamily_Kinase-like_dom		0.383	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	0	0	0	130	130	130	0.00	0.00	TGGAAGGTTGTTGA			55593616	+1	52	52	62	62	tier1	no_errors	ENST00000288135	ensembl	human	known	74_37	frame_shift_del	45.61	45.61	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.959:0.999:0.998:0.001:1.000:1.000	-	52	62
BRCA2	675	genome.wustl.edu	37	13	32903601	32903601	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr13:32903601delA	ENST00000380152.3	+	8	886	c.653delA	c.(652-654)gaafs	p.E218fs	BRCA2_ENST00000544455.1_Frame_Shift_Del_p.E218fs			P51587	BRCA2_HUMAN	breast cancer 2, early onset	218					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GAAGCATCTGAAACTGTATTT	0.274			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)			ENSG00000139618																									Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													57.0	57.0	57.0					13																	32903601		2199	4284	6483	SO:0001589	frameshift_variant	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)		U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.653delA	13.37:g.32903601delA	ENSP00000369497:p.Glu218fs		O00183|O15008|Q13879|Q5TBJ7	Frame_Shift_Del	DEL	pfam_D_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_D_recomb/repair_BRCA2_hlx,superfamily_-bd_OB-fold,pirsf_BRCA2,pfscan_BRCA2_repeat	p.T219fs	ENST00000380152.3	37	c.653	CCDS9344.1	13																																																																																				BRCA2	-	pirsf_BRCA2		0.274	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	0	0	0	45	45	80	0.00	0.00	A	NM_000059		32903601	+1	10	21	17	28	tier1	no_errors	ENST00000380152	ensembl	human	known	74_37	frame_shift_del	37.04	42.86	DEL	0.012	-	10	17
KIT	3815	genome.wustl.edu	37	4	55593601	55593601	+	Frame_Shift_Del	DEL	A	A	-	rs121913234		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr4:55593601delA	ENST00000288135.5	+	11	1764	c.1667delA	c.(1666-1668)cagfs	p.Q556fs		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	556			Missing (in GIST; somatic mutation). {ECO:0000269|PubMed:15824741, ECO:0000269|PubMed:9438854}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Y553_K558>(8)|p.E554_K558del(8)|p.W557_K558del(8)|p.M552_W557del(8)|p.K550_K558del(7)|p.Q556_V560del(6)|p.Y553_Q556del(4)|p.Y553_K558del(4)|p.V555_K558del(3)|p.Y553_W557del(3)|p.Y553_T574>S(3)|p.P551_Q556del(3)|p.V555_I571del(3)|p.V555_V560del(3)|p.V555_P573del(3)|p.V555_V559del(3)|p.V555_Q556del(2)|p.W557_E561del(2)|p.Q556_L576del(2)|p.K550_V559del(2)|p.K550fs*6(2)|p.Q556_K558del(2)|p.V555_E562del(2)|p.Q556_V559del(2)|p.M552_Q556del(2)|p.V555_G565del(1)|p.M552_W557>R(1)|p.P551_K558del(1)|p.M552_E561>K(1)|p.E554_I571del(1)|p.Q556_V560>F(1)|p.V555_Y570del(1)|p.Q556_N566>SNNLQLY(1)|p.M552_T574>TESA(1)|p.Q556_D572>PS(1)|p.Q556_D572del(1)|p.Q556R(1)|p.V555_N566>D(1)|p.M552_Q556>(1)|p.V555_V560>V(1)|p.Q556_W557del(1)|p.M552_K558del(1)|p.Q556_E561del(1)|p.Q556_E561>HH(1)|p.Q556_K558>R(1)|p.K550_Q556del(1)|p.Q556_W557>R(1)|p.E554_E562del(1)|p.E554_N564del(1)|p.Q556_V560>TTF(1)|p.K550_W557del(1)|p.V555_I563del(1)|p.M552_D572del(1)|p.Y553_V559>E(1)|p.Q556_T574del(1)|p.P551_V559del>L(1)|p.K550_Q556>II(1)|p.Q556_P573del(1)|p.E554_D572del(1)|p.Y553_V559del(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TATGAAGTACAGTGGAAGGTT	0.383		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors				ENSG00000157404																											yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	130	Deletion - In frame(101)|Complex - deletion inframe(26)|Deletion - Frameshift(2)|Substitution - Missense(1)	soft_tissue(127)|skin(2)|testis(1)											80.0	82.0	82.0					4																	55593601		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)		S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1667delA	4.37:g.55593601delA	ENSP00000288135:p.Gln556fs		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Q556fs	ENST00000288135.5	37	c.1667	CCDS3496.1	4																																																																																				KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,superfamily_Kinase-like_dom		0.383	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	0	0	0	30	30	127	0.00	0.00	A			55593601	+1	13	52	24	61	tier1	no_errors	ENST00000288135	ensembl	human	known	74_37	frame_shift_del	35.14	46.02	DEL	1.000	-	13	24
LINC00408	100652856	genome.wustl.edu	37	13	19480667	19480667	+	lincRNA	SNP	C	C	T			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr13:19480667C>T	ENST00000447784.1	+	0	253					NR_104118.1				long intergenic non-protein coding RNA 408																		ccagttgcttcgagccaggag	0.587													ENSG00000226250																																					0																																												0			-	BG722014		13q11	2013-08-08			ENSG00000226250	ENSG00000226250		"""Long non-coding RNAs"""	42740	non-coding RNA	RNA, long non-coding							Standard	NR_104118		Approved				OTTHUMG00000016469		13.37:g.19480667C>T				R	SNP	-	NULL	ENST00000447784.1	37	NULL		13																																																																																			-	LINC00408	-	-		0.587	LINC00408-001	KNOWN	basic	lincRNA	LINC00408	HGNC	lincRNA	OTTHUMT00000043992.1	0	0	0	14	14	28	0.00	0.00	C			19480667	+1	11	4	2	6	tier1	no_errors	ENST00000447784	ensembl	human	known	74_37	rna	84.62	40.00	SNP	0.065	T	11	2
PSG8	440533	genome.wustl.edu	37	19	43262153	43262153	+	Splice_Site	SNP	C	C	T	rs533744633		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr19:43262153C>T	ENST00000306511.4	-	3	807		c.e3+1		PSG8_ENST00000401467.2_Intron|PSG8_ENST00000404209.4_Splice_Site|PSG8_ENST00000600709.1_Splice_Site|PSG8_ENST00000406636.3_Splice_Site	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8							extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				AAAATACTCACGGAGGAGATT	0.532													ENSG00000124467	.|||	1	0.000199681	0.0	0.0	5008	,	,		19862	0.0		0.001	False		,,,				2504	0.0																0													180.0	189.0	186.0					19																	43262153		2203	4299	6502	SO:0001630	splice_region_variant	0			-	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.709+1G>A	19.37:g.43262153C>T			A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Splice_Site	SNP	-	e3+1	ENST00000306511.4	37	c.709+1	CCDS33037.1	19	.	.	.	.	.	.	.	.	.	.	C	4.192	0.034358	0.08101	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000426252;ENST00000306511	.	.	.	1.53	0.393	0.16294	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.9485	0.09358	0.0:0.7505:0.0:0.2495	.	.	.	.	.	-1	.	.	.	-	.	.	PSG8	47953993	0.054000	0.20591	0.020000	0.16555	0.010000	0.07245	-0.060000	0.11712	-0.000000	0.14550	0.298000	0.19748	.	-	PSG8	-	-		0.532	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	HGNC	protein_coding	OTTHUMT00000464526.1	0	0	0	171	171	10	0.00	0.00	C		Intron	43262153	-1	56	3	127	7	tier1	no_errors	ENST00000306511	ensembl	human	known	74_37	splice_site	30.60	30.00	SNP	0.059	T	56	127
SUMO3	6612	genome.wustl.edu	37	21	46233792	46233792	+	Missense_Mutation	SNP	C	C	G			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr21:46233792C>G	ENST00000411651.2	-	2	361	c.249G>C	c.(247-249)caG>caC	p.Q83H	SUMO3_ENST00000479153.1_Intron|SUMO3_ENST00000332859.6_Intron|SUMO3_ENST00000397893.3_Intron|SUMO3_ENST00000397898.3_Intron					small ubiquitin-like modifier 3											prostate(1)	1				Colorectal(79;0.058)		GCAGCTGCATCTGGGTCCAGC	0.647													ENSG00000184900																																					0																																										SO:0001583	missense	0			-		CCDS33587.1, CCDS68220.1	21q22.3	2013-06-05	2013-06-05	2004-05-19	ENSG00000184900	ENSG00000184900			11124	protein-coding gene	gene with protein product		602231	"""SMT3 (suppressor of mif two 3, yeast) homolog 1"", ""SMT3 suppressor of mif two 3 homolog 3 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)"""	SMT3H1		9119407	Standard	NM_006936		Approved	SMT3A	uc002zfz.1	P55854	OTTHUMG00000090256	ENST00000411651.2:c.249G>C	21.37:g.46233792C>G	ENSP00000409666:p.Gln83His			Missense_Mutation	SNP	pfam_Rad60/SUMO_like,pfscan_Ubiquitin_supergroup	p.Q83H	ENST00000411651.2	37	c.249		21	.	.	.	.	.	.	.	.	.	.	C	10.68	1.419436	0.25552	.	.	ENSG00000184900	ENST00000411651	T	0.23348	1.91	1.12	0.0608	0.14337	.	.	.	.	.	T	0.16514	0.0397	.	.	.	0.09310	N	1	P	0.38335	0.627	B	0.33392	0.163	T	0.13176	-1.0519	8	0.62326	D	0.03	.	6.317	0.21196	0.0:0.6843:0.3157:0.0	.	83	B4DUW4	.	H	83	ENSP00000409666:Q83H	ENSP00000409666:Q83H	Q	-	3	2	SUMO3	45058220	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.216000	0.17585	0.005000	0.14708	0.455000	0.32223	CAG	-	SUMO3	-	NULL		0.647	SUMO3-201	KNOWN	basic	protein_coding	SUMO3	HGNC	protein_coding		0	0	0	27	27	10	0.00	0.00	C			46233792	-1	17	2	29	8	tier1	no_errors	ENST00000411651	ensembl	human	known	74_37	missense	36.96	20.00	SNP	0.001	G	17	29
WNT9A	7483	genome.wustl.edu	37	1	228111953	228111954	+	Frame_Shift_Ins	INS	-	-	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr1:228111953_228111954insC	ENST00000272164.5	-	3	510_511	c.500_501insG	c.(499-501)ggcfs	p.G167fs		NM_003395.2	NP_003386.1	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family, member 9A	167					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal system morphogenesis (GO:0048704)|iris morphogenesis (GO:0061072)|mitotic cell cycle checkpoint (GO:0007093)|multicellular organismal development (GO:0007275)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of smoothened signaling pathway (GO:0045880)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.G167fs*38(1)|p.C168fs*6(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Prostate(94;0.0405)				TGTCTCCGCAGCCCCCCCACTG	0.629													ENSG00000143816																																					2	Deletion - Frameshift(1)|Insertion - Frameshift(1)	large_intestine(1)|pancreas(1)																																								SO:0001589	frameshift_variant	0				AB060283	CCDS31045.1	1q42	2008-02-05	2003-03-11	2003-03-14	ENSG00000143816	ENSG00000143816		"""Wingless-type MMTV integration sites"""	12778	protein-coding gene	gene with protein product		602863	"""wingless-type MMTV integration site family, member 14"""	WNT14		9441749	Standard	NM_003395		Approved		uc001hri.2	O14904	OTTHUMG00000037592	ENST00000272164.5:c.501dupG	1.37:g.228111960_228111960dupC	ENSP00000272164:p.Gly167fs		A6NLW2|Q2M2J3|Q5VWU0|Q96S50	Frame_Shift_Ins	INS	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt9a	p.C168fs	ENST00000272164.5	37	c.501_500	CCDS31045.1	1																																																																																				WNT9A	-	pfam_Wnt,smart_Wnt,prints_Wnt		0.629	WNT9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT9A	HGNC	protein_coding	OTTHUMT00000091646.1	0	0	0	69	69	66	0.00	0.00	-	NM_003395		228111954	-1	29	27	64	51	tier1	no_errors	ENST00000272164	ensembl	human	known	74_37	frame_shift_ins	31.18	34.62	INS	1.000:1.000	C	29	64
C8orf76	84933	genome.wustl.edu	37	8	124253560	124253560	+	Silent	SNP	G	G	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr8:124253560G>C	ENST00000276704.4	-	1	78	c.27C>G	c.(25-27)ggC>ggG	p.G9G	C8orf76_ENST00000521310.1_5'UTR|ZHX1-C8ORF76_ENST00000357082.4_Intron	NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	9										NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CGAACTCGCCGCCGAACAACC	0.716													ENSG00000189376																																					0													11.0	12.0	11.0					8																	124253560		2166	4259	6425	SO:0001819	synonymous_variant	0			-	AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.27C>G	8.37:g.124253560G>C			Q53HC1	Silent	SNP	NULL	p.G9	ENST00000276704.4	37	c.27	CCDS6341.1	8																																																																																			-	C8orf76	-	NULL		0.716	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf76	HGNC	protein_coding	OTTHUMT00000381748.1	0	0	0	16	16	13	0.00	0.00	G	NM_032847		124253560	-1	6	1	9	9	tier1	no_errors	ENST00000276704	ensembl	human	known	74_37	silent	40.00	10.00	SNP	0.603	C	6	9
MT-CO2	4513	genome.wustl.edu	37	M	8199	8199	+	Missense_Mutation	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chrM:8199G>A	ENST00000361739.1	+	1	614	c.614G>A	c.(613-615)aGt>aAt	p.S205N	MT-CO3_ENST00000362079.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	205					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						AGCAAACCACAGTTTCATGCC	0.483													ENSG00000198712																																					0																																										SO:0001583	missense	0			-			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.614G>A	M.37:g.8199G>A	ENSP00000354876:p.Ser205Asn		Q37526	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.S205N	ENST00000361739.1	37	c.614		MT																																																																																			-	MT-CO2	-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2		0.483	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		0	0	0	36	36	7	0.00	0.00	G	YP_003024029		8199	+1	4	0	5	0	tier1	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	44.44	0.00	SNP	NULL	A	4	5
ACADVL	37	genome.wustl.edu	37	17	7123240	7123241	+	5'UTR	INS	-	-	GGGCGTGCAGGACGC	rs77051465|rs550196368|rs3835013|rs6145976|rs139223575|rs421019	byFrequency	TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr17:7123240_7123241insGGGCGTGCAGGACGC	ENST00000356839.5	+	0	116_117				DLG4_ENST00000485100.1_5'Flank|DLG4_ENST00000399506.2_5'Flank|DLG4_ENST00000399510.2_5'Flank|ACADVL_ENST00000543245.2_Intron|DLG4_ENST00000302955.6_5'Flank|ACADVL_ENST00000350303.5_5'UTR	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						CGCCAGGACGTGGGCGTGCAGG	0.713													ENSG00000072778		2343	0.467851	0.2988	0.4769	5008	,	,		14818	0.4712		0.5736	False		,,,				2504	0.5777																0									,,	1193,2759		290,613,1073					,,	-1.0	0.0		dbSNP_130	8	4084,3646		1352,1380,1133	no	utr-5,utr-5,utr-5	ACADVL,DLG4	NM_001365.3,NM_001033859.1,NM_000018.2	,,	1642,1993,2206	A1A1,A1R,RR		47.1669,30.1872,45.1721	,,	,,		5277,6405				SO:0001623	5_prime_UTR_variant	0				BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.-63->GGGCGTGCAGGACGC	17.37:g.7123240_7123241insGGGCGTGCAGGACGC			B4DEB6|F5H2A9|O76056|Q8WUL0	R	INS	-	NULL	ENST00000356839.5	37	NULL	CCDS11090.1	17																																																																																				ACADVL	-	-		0.713	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	HGNC	protein_coding	OTTHUMT00000220001.5	0	0	0	2	2	2	0.00	0.00	-	NM_000018		7123241	+1	0	0	7	7	tier1	no_errors	ENST00000577857	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.000:0.000	GGGCGTGCAGGACGC	0	7
CCND1	595	genome.wustl.edu	37	11	69466030	69466030	+	Missense_Mutation	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr11:69466030G>A	ENST00000227507.2	+	5	1095	c.868G>A	c.(868-870)Gtg>Atg	p.V290M	ORAOV1_ENST00000542515.1_5'Flank	NM_053056.2	NP_444284.1	P24385	CCND1_HUMAN	cyclin D1	290					canonical Wnt signaling pathway (GO:0060070)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|lactation (GO:0007595)|Leydig cell differentiation (GO:0033327)|liver development (GO:0001889)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ regeneration (GO:0031100)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|positive regulation of protein phosphorylation (GO:0001934)|re-entry into mitotic cell cycle (GO:0000320)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to organonitrogen compound (GO:0010243)|response to UV-A (GO:0070141)|response to vitamin E (GO:0033197)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)|transcriptional repressor complex (GO:0017053)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|proline-rich region binding (GO:0070064)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			NS(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|ovary(1)|urinary_tract(1)	23	all_cancers(3;2.01e-114)|all_epithelial(3;3.59e-122)|Breast(3;5.4e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;8.22e-16)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;7.2e-57)|all cancers(3;7.75e-51)|BRCA - Breast invasive adenocarcinoma(2;4.9e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)		Arsenic trioxide(DB01169)	ACCCACCGACGTGCGGGACGT	0.716			T	"""IGH@, FSTL3"""	"""CLL, B-ALL, breast"""					Multiple Myeloma(6;0.086)			ENSG00000110092																									Pancreas(65;393 884 2788 21700 24360 27795 36895)			Dom	yes		11	11q13	595	cyclin D1		"""L, E"""	0													19.0	16.0	17.0					11																	69466030		2197	4290	6487	SO:0001583	missense	0			-	Z23022	CCDS8191.1	11q13	2008-07-18	2005-09-12		ENSG00000110092	ENSG00000110092			1582	protein-coding gene	gene with protein product	"""parathyroid adenomatosis 1"", ""B-cell CLL/lymphoma 1"", ""G1/S-specific cyclin D1"""	168461	"""cyclin D1 (PRAD1: parathyroid adenomatosis 1)"""	BCL1, D11S287E, PRAD1		1826542, 1833066	Standard	XM_006718653		Approved	U21B31	uc001opa.3	P24385	OTTHUMG00000167877	ENST00000227507.2:c.868G>A	11.37:g.69466030G>A	ENSP00000227507:p.Val290Met		Q6LEF0	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.V290M	ENST00000227507.2	37	c.868	CCDS8191.1	11	.	.	.	.	.	.	.	.	.	.	G	30	5.054483	0.93793	.	.	ENSG00000110092	ENST00000227507;ENST00000542897	T	0.12465	2.68	5.59	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.40694	0.1127	M	0.86420	2.815	0.80722	D	1	D	0.71674	0.998	D	0.65010	0.931	T	0.49532	-0.8930	10	0.87932	D	0	.	14.0665	0.64834	0.0722:0.0:0.9278:0.0	.	290	P24385	CCND1_HUMAN	M	290;156	ENSP00000227507:V290M	ENSP00000227507:V290M	V	+	1	0	CCND1	69175211	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.974000	0.93433	1.356000	0.45884	0.655000	0.94253	GTG	-	CCND1	-	NULL		0.716	CCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCND1	HGNC	protein_coding	OTTHUMT00000396775.2	0	0	0	16	16	0	0.00	0.00	G	NM_053056		69466030	+1	11	1	18	0	tier1	no_errors	ENST00000227507	ensembl	human	known	74_37	missense	37.93	100.00	SNP	1.000	A	11	18
AC021818.1	0	genome.wustl.edu	37	15	70077781	70077782	+	RNA	INS	-	-	TGTGTA	rs200810545|rs144597284		TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr15:70077781_70077782insTGTGTA	ENST00000401139.1	-	0	61_62																											gtgtgtgtgtgtgtgtatgtat	0.421													ENSG00000215958																																					0																																												0																																15.37:g.70077782_70077787dupTGTGTA				R	INS	-	NULL	ENST00000401139.1	37	NULL		15																																																																																				AC021818.1	-	-		0.421	AC021818.1-201	NOVEL	basic	miRNA	ENSG00000215958	Clone_based_ensembl_gene	miRNA		0	0	0	0	0	0	0.00	0.00	-			70077782	-1	0	0	0	0	tier1	no_errors	ENST00000401139	ensembl	human	novel	74_37	rna	0.00	0.00	INS	0.191:0.184	TGTGTA	0	0
BX088651.1	0	genome.wustl.edu	37	9	44403059	44403059	+	5'Flank	SNP	G	G	C			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr9:44403059G>C	ENST00000540551.1	-	0	0				RP11-475I24.3_ENST00000435586.1_lincRNA																							GTCCTTTCTAGATTAAATGCT	0.512													ENSG00000237357																																					0																																										SO:0001631	upstream_gene_variant	0			-																													9.37:g.44403059G>C	Exception_encountered			Splice_Site	SNP	-	NULL	ENST00000540551.1	37	c.NULL		9																																																																																			-	RP11-475I24.3	-	-		0.512	BX088651.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000237357	Clone_based_vega_gene	protein_coding		0	0	0	59	59	0	0.00	0.00	G			44403059	+1	21	0	27	0	tier1	no_errors	ENST00000425309	ensembl	human	known	74_37	splice_site	43.75	0.00	SNP	0.388	C	21	27
BX088651.1	0	genome.wustl.edu	37	9	44403067	44403067	+	5'Flank	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr9:44403067G>A	ENST00000540551.1	-	0	0				RP11-475I24.3_ENST00000435586.1_lincRNA																							TAGATTAAATGCTGTTTTCCA	0.507													ENSG00000237357																																					0																																										SO:0001631	upstream_gene_variant	0			-																													9.37:g.44403067G>A	Exception_encountered			R	SNP	-	NULL	ENST00000540551.1	37	NULL		9																																																																																			-	RP11-475I24.3	-	-		0.507	BX088651.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000237357	Clone_based_vega_gene	protein_coding		0	0	0	62	62	0	0.00	0.00	G			44403067	+1	20	0	26	0	tier1	no_errors	ENST00000425309	ensembl	human	known	74_37	rna	42.55	0.00	SNP	0.349	A	20	26
FOXD4L1	200350	genome.wustl.edu	37	2	114257443	114257443	+	Missense_Mutation	SNP	A	A	C	rs377465547	byFrequency	TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chr2:114257443A>C	ENST00000306507.5	+	1	783	c.610A>C	c.(610-612)Aag>Cag	p.K204Q		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	204					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K204Q(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						GAAGCGTTTCAAGCGCCACCA	0.682													ENSG00000184492	.|||	1167	0.233027	0.1029	0.3184	5008	,	,		11316	0.501		0.1302	False		,,,				2504	0.1779																1	Substitution - Missense(1)	breast(1)						A	GLN/LYS	1,2995		0,1,1497	16.0	22.0	20.0		610	2.6	1.0	2		20	1,6035		0,1,3017	no	missense	FOXD4L1	NM_012184.4	53	0,2,4514	CC,CA,AA		0.0166,0.0334,0.0221	benign	204/409	114257443	2,9030	1498	3018	4516	SO:0001583	missense	0			-	AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.610A>C	2.37:g.114257443A>C	ENSP00000302756:p.Lys204Gln		B3KWN1|B9EGF3	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.K204Q	ENST00000306507.5	37	c.610	CCDS2117.1	2	.	.	.	.	.	.	.	.	.	.	.	13.43	2.234654	0.39498	3.34E-4	1.66E-4	ENSG00000184492	ENST00000306507	D	0.96168	-3.93	2.57	2.57	0.30868	.	0.000000	0.35378	U	0.003255	D	0.89546	0.6746	N	0.20986	0.625	0.49798	D	0.999826	B	0.25563	0.129	B	0.25614	0.062	D	0.85812	0.1380	10	0.48119	T	0.1	.	8.6531	0.34046	1.0:0.0:0.0:0.0	.	204	Q9NU39	FX4L1_HUMAN	Q	204	ENSP00000302756:K204Q	ENSP00000302756:K204Q	K	+	1	0	FOXD4L1	113973913	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	8.525000	0.90583	1.190000	0.43042	0.155000	0.16302	AAG	-	FOXD4L1	-	NULL		0.682	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L1	HGNC	protein_coding	OTTHUMT00000254148.1	0	0	0	48	48	1	0.00	0.00	A	NM_012184		114257443	+1	8	0	64	0	tier1	no_errors	ENST00000306507	ensembl	human	known	74_37	missense	11.11	0.00	SNP	1.000	C	8	64
MT-CO1	4512	genome.wustl.edu	37	M	3063	3063	+	5'Flank	SNP	G	G	A			TCGA-MO-A47R-01A-11D-A24N-09	TCGA-MO-A47R-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7a5d3b6b-be5a-4e55-9255-32a069b8af3d	40925959-5b66-45a5-a8a2-61ee7e67b084	g.chrM:3063G>A	ENST00000361624.2	+	0	0				MT-ND2_ENST00000361453.3_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TW_ENST00000387382.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AAAGTCCTACGTGATCTGAGT	0.448													ENSG00000210082																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3063G>A	Exception_encountered		Q34770	R	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			-	MT-RNR2	-	-		0.448	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		0	0	0	79	79	2	0.00	0.00	G	YP_003024028		3063	+1	2	0	17	2	tier1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	10.53	0.00	SNP	NULL	A	2	17
