#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ZFAND1	79752	genome.wustl.edu	37	8	82626245	82626245	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr8:82626245G>A	ENST00000220669.5	-	6	406	c.388C>T	c.(388-390)Cga>Tga	p.R130*	ZFAND1_ENST00000523096.1_Nonsense_Mutation_p.R130*|ZFAND1_ENST00000517588.1_Nonsense_Mutation_p.R23*|ZFAND1_ENST00000521895.1_Nonsense_Mutation_p.R23*|ZFAND1_ENST00000522520.1_Nonsense_Mutation_p.R23*|ZFAND1_ENST00000519523.1_Nonsense_Mutation_p.R130*|ZFAND1_ENST00000521287.1_Nonsense_Mutation_p.R23*	NM_024699.2	NP_078975.2	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	130							zinc ion binding (GO:0008270)	p.R130*(3)		kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						CCTTTCCATCGTTTACTTGCT	0.343													ENSG00000104231																																					3	Substitution - Nonsense(3)	lung(1)|ovary(1)|prostate(1)											187.0	158.0	168.0					8																	82626245		2203	4299	6502	SO:0001587	stop_gained	0			-		CCDS6232.1, CCDS55250.1, CCDS55251.1	8q21.13	2006-07-07						"""Zinc fingers, AN1-type domain containing"""	25858	protein-coding gene	gene with protein product						12477932	Standard	NM_024699		Approved	FLJ14007	uc003ycj.2	Q8TCF1		ENST00000220669.5:c.388C>T	8.37:g.82626245G>A	ENSP00000220669:p.Arg130*		E5RIG0|E5RJ99|Q658R7|Q6IA32|Q6PGQ6|Q9H810	Nonsense_Mutation	SNP	pfam_Znf_AN1,smart_Znf_AN1,pfscan_Znf_AN1	p.R130*	ENST00000220669.5	37	c.388	CCDS6232.1	8	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970302	0.92919	.	.	ENSG00000104231	ENST00000523096;ENST00000220669;ENST00000522520;ENST00000521895;ENST00000521287;ENST00000520635;ENST00000517588;ENST00000519523;ENST00000520604;ENST00000523361;ENST00000517450;ENST00000521742;ENST00000518419;ENST00000520076	.	.	.	5.78	2.72	0.32119	.	0.330492	0.31495	N	0.007556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	11.0672	0.47982	0.0:0.4208:0.4368:0.1425	.	.	.	.	X	130;130;23;23;23;23;23;130;23;23;23;23;23;23	.	ENSP00000220669:R130X	R	-	1	2	ZFAND1	82788800	1.000000	0.71417	0.984000	0.44739	0.995000	0.86356	2.483000	0.45233	0.725000	0.32318	0.650000	0.86243	CGA	-	ZFAND1	-	NULL		0.343	ZFAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND1	HGNC	protein_coding	OTTHUMT00000379739.1	0	0	0	58	58	74	0.00	0.00	G	NM_024699		82626245	-1	21	29	30	70	tier1	no_errors	ENST00000220669	ensembl	human	known	74_37	nonsense	41.18	29.29	SNP	1.000	A	21	30
ZNF77	58492	genome.wustl.edu	37	19	2933833	2933833	+	Missense_Mutation	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:2933833G>A	ENST00000314531.4	-	4	1384	c.1292C>T	c.(1291-1293)aCt>aTt	p.T431I		NM_021217.2	NP_067040.1	Q15935	ZNF77_HUMAN	zinc finger protein 77	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCTCTCCAGTATGCGTCCT	0.517													ENSG00000175691																																					0													96.0	80.0	86.0					19																	2933833		2203	4300	6503	SO:0001583	missense	0			-	X65230	CCDS12099.1	19p13.3	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13150	protein-coding gene	gene with protein product		194551	"""zinc finger protein 77 (pT1)"""			8478004	Standard	NM_021217		Approved	pT1	uc002lws.4	Q15935		ENST00000314531.4:c.1292C>T	19.37:g.2933833G>A	ENSP00000319053:p.Thr431Ile		Q86XJ3|Q9NPP0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T431I	ENST00000314531.4	37	c.1292	CCDS12099.1	19	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217712	0.79352	.	.	ENSG00000175691	ENST00000341064;ENST00000314531	T	0.25749	1.78	2.97	0.53	0.17102	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40094	0.1103	M	0.68728	2.09	0.25255	N	0.989646	D	0.58620	0.983	P	0.56751	0.805	T	0.26258	-1.0108	9	0.87932	D	0	.	10.0037	0.41944	0.0:0.4006:0.5994:0.0	.	431	Q15935	ZNF77_HUMAN	I	225;431	ENSP00000319053:T431I	ENSP00000319053:T431I	T	-	2	0	ZNF77	2884833	0.954000	0.32549	0.001000	0.08648	0.940000	0.58332	1.486000	0.35530	0.077000	0.16863	0.484000	0.47621	ACT	-	ZNF77	-	pfscan_Znf_C2H2		0.517	ZNF77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF77	HGNC	protein_coding	OTTHUMT00000451924.1	0	0	1	63	63	66	0.00	1.49	G	NM_021217		2933833	-1	13	28	36	57	tier1	no_errors	ENST00000314531	ensembl	human	known	74_37	missense	26.53	32.94	SNP	0.988	A	13	36
SLCO4C1	353189	genome.wustl.edu	37	5	101631937	101631937	+	Missense_Mutation	SNP	C	C	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr5:101631937C>A	ENST00000310954.6	-	1	316	c.30G>T	c.(28-30)ttG>ttT	p.L10F		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		GGACAAAAGCCAAGTTCTCAA	0.577													ENSG00000173930																																					0													71.0	82.0	78.0					5																	101631937		2203	4300	6503	SO:0001583	missense	0			-	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.30G>T	5.37:g.101631937C>A	ENSP00000309741:p.Leu10Phe			Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.L10F	ENST00000310954.6	37	c.30	CCDS34205.1	5	.	.	.	.	.	.	.	.	.	.	C	7.606	0.673814	0.14841	.	.	ENSG00000173930	ENST00000310954	T	0.38887	1.11	4.11	2.25	0.28309	.	1.998710	0.02794	N	0.122407	T	0.31606	0.0802	L	0.36672	1.1	0.23449	N	0.997653	P	0.39576	0.679	B	0.32289	0.143	T	0.22382	-1.0218	10	0.44086	T	0.13	.	5.4578	0.16600	0.1986:0.695:0.0:0.1065	.	10	Q6ZQN7	SO4C1_HUMAN	F	10	ENSP00000309741:L10F	ENSP00000309741:L10F	L	-	3	2	SLCO4C1	101659836	1.000000	0.71417	1.000000	0.80357	0.058000	0.15608	0.658000	0.24979	0.342000	0.23796	0.591000	0.81541	TTG	-	SLCO4C1	-	NULL		0.577	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	0	0	0	70	70	58	0.00	0.00	C	NM_180991		101631937	-1	23	29	39	48	tier1	no_errors	ENST00000310954	ensembl	human	known	74_37	missense	37.10	37.66	SNP	1.000	A	23	39
PRG4	10216	genome.wustl.edu	37	1	186277602	186277602	+	Silent	SNP	C	C	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr1:186277602C>T	ENST00000445192.2	+	7	2796	c.2751C>T	c.(2749-2751)gaC>gaT	p.D917D	PRG4_ENST00000367485.4_Silent_p.D824D|PRG4_ENST00000367486.3_Silent_p.D874D|PRG4_ENST00000367484.3_Silent_p.D446D|PRG4_ENST00000367483.4_Silent_p.D876D	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	917					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CAGCTAAAGACAAGACAACAG	0.423													ENSG00000116690																																					0													202.0	207.0	206.0					1																	186277602		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2751C>T	1.37:g.186277602C>T			Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Somatomedin_B_dom,smart_Hemopexin-like_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.D917	ENST00000445192.2	37	c.2751	CCDS1369.1	1																																																																																			-	PRG4	-	NULL		0.423	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	0	0	1	54	54	81	0.00	1.22	C	NM_005807		186277602	+1	20	69	26	59	tier1	no_errors	ENST00000445192	ensembl	human	known	74_37	silent	43.48	53.91	SNP	0.002	T	20	26
OR2V2	285659	genome.wustl.edu	37	5	180582465	180582465	+	Missense_Mutation	SNP	G	G	T	rs147476494		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr5:180582465G>T	ENST00000328275.1	+	1	523	c.523G>T	c.(523-525)Gtg>Ttg	p.V175L		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTGAGGAAGGTGAACCATTT	0.473													ENSG00000182613	g|||	1	0.000199681	0.0008	0.0	5008	,	,		21435	0.0		0.0	False		,,,				2504	0.0																0													304.0	293.0	297.0					5																	180582465		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.523G>T	5.37:g.180582465G>T	ENSP00000332185:p.Val175Leu		Q6IFL6|Q8NGV1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V175L	ENST00000328275.1	37	c.523	CCDS4461.1	5	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	.	10.07	1.249558	0.22880	.	.	ENSG00000182613	ENST00000328275	T	0.00107	8.72	3.38	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.296488	0.19003	N	0.125282	T	0.00109	0.0003	N	0.16567	0.415	0.09310	N	1	P	0.43826	0.818	P	0.48089	0.566	T	0.47005	-0.9150	10	0.87932	D	0	.	4.6851	0.12754	0.2628:0.0:0.7372:0.0	.	175	Q96R30	OR2V2_HUMAN	L	175	ENSP00000332185:V175L	ENSP00000332185:V175L	V	+	1	0	OR2V2	180515071	0.000000	0.05858	0.719000	0.30619	0.073000	0.16967	0.156000	0.16382	1.882000	0.54519	0.305000	0.20034	GTG	rs147476494	OR2V2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.473	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V2	HGNC	protein_coding	OTTHUMT00000253529.1	0	0	0	141	141	118	0.00	0.00	G			180582465	+1	30	32	71	64	tier1	no_errors	ENST00000328275	ensembl	human	known	74_37	missense	29.70	33.33	SNP	0.071	T	30	71
RYR1	6261	genome.wustl.edu	37	19	38954158	38954158	+	Silent	SNP	C	C	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:38954158C>T	ENST00000359596.3	+	21	2673	c.2673C>T	c.(2671-2673)acC>acT	p.T891T	RYR1_ENST00000360985.3_Silent_p.T891T|RYR1_ENST00000355481.4_Silent_p.T891T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	891	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGGGCTGGACCTACGGCCCGG	0.682													ENSG00000196218																																					0													23.0	24.0	23.0					19																	38954158		2203	4300	6503	SO:0001819	synonymous_variant	0			-	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2673C>T	19.37:g.38954158C>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.T891	ENST00000359596.3	37	c.2673	CCDS33011.1	19																																																																																			-	RYR1	-	pfam_Ryanodine_rcpt,prints_Ryan_recept		0.682	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	0	0	0	87	87	7	0.00	0.00	C			38954158	+1	20	3	47	10	tier1	no_errors	ENST00000359596	ensembl	human	known	74_37	silent	29.85	23.08	SNP	0.999	T	20	47
MUC2	4583	genome.wustl.edu	37	11	1085815	1085815	+	Silent	SNP	G	G	T	rs551062642		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr11:1085815G>T	ENST00000441003.2	+	21	2763	c.2736G>T	c.(2734-2736)acG>acT	p.T912T	MUC2_ENST00000359061.5_Silent_p.T912T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	912	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GTGGCACTACGGGCGTCACCT	0.642													ENSG00000198788																																					0													92.0	99.0	96.0					11																	1085815		2118	4228	6346	SO:0001819	synonymous_variant	0			-	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2736G>T	11.37:g.1085815G>T			Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T912	ENST00000441003.2	37	c.2736		11																																																																																			-	MUC2	-	pfam_VWF_type-D,smart_VWF_type-D		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	0	0	0	53	53	27	0.00	0.00	G	NM_002457		1085815	+1	20	10	32	21	tier1	no_errors	ENST00000441003	ensembl	human	known	74_37	silent	38.46	32.26	SNP	0.025	T	20	32
UNC13C	440279	genome.wustl.edu	37	15	54307904	54307904	+	Nonsense_Mutation	SNP	T	T	G			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr15:54307904T>G	ENST00000260323.11	+	1	2804	c.2804T>G	c.(2803-2805)tTa>tGa	p.L935*	UNC13C_ENST00000545554.1_Nonsense_Mutation_p.L935*|UNC13C_ENST00000537900.1_Nonsense_Mutation_p.L935*	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	935					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAAGAGGGGTTAGAACCCTTA	0.398													ENSG00000137766																																					0													81.0	78.0	79.0					15																	54307904		1856	4108	5964	SO:0001587	stop_gained	0			-	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2804T>G	15.37:g.54307904T>G	ENSP00000260323:p.Leu935*		Q0P613|Q8ND48|Q96NP3	Nonsense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.L935*	ENST00000260323.11	37	c.2804	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	T	40	8.013729	0.98610	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	.	.	.	5.69	3.42	0.39159	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.8091	0.34956	0.0:0.1517:0.0:0.8483	.	.	.	.	X	935	.	ENSP00000260323:L935X	L	+	2	0	UNC13C	52095196	0.929000	0.31497	0.949000	0.38748	0.774000	0.43823	1.569000	0.36428	0.995000	0.38917	0.528000	0.53228	TTA	-	UNC13C	-	NULL		0.398	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	0	0	0	59	59	88	0.00	0.00	T	NM_173166		54307904	+1	6	28	34	64	tier1	no_errors	ENST00000260323	ensembl	human	known	74_37	nonsense	15.00	30.43	SNP	0.900	G	6	34
CES1	1066	genome.wustl.edu	37	16	55844440	55844440	+	Missense_Mutation	SNP	C	C	T	rs145088728		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr16:55844440C>T	ENST00000361503.4	-	11	1434	c.1304G>A	c.(1303-1305)cGg>cAg	p.R435Q	CES1_ENST00000422046.2_Missense_Mutation_p.R434Q|CES1_ENST00000360526.3_Missense_Mutation_p.R436Q			P23141	EST1_HUMAN	carboxylesterase 1	435					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	TCTGTGGTTCCGGGCCACAAT	0.507													ENSG00000198848	.|||	1	0.000199681	0.0008	0.0	5008	,	,		21666	0.0		0.0	False		,,,				2504	0.0				NSCLC(162;1801 2756 42904 52896)												0								C	GLN/ARG,GLN/ARG,GLN/ARG	0,4396		0,0,2198	144.0	149.0	147.0		1304,1307,1301	3.7	0.1	16	dbSNP_134	147	1,8599		0,1,4299	no	missense,missense,missense	CES1	NM_001025194.1,NM_001025195.1,NM_001266.4	43,43,43	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	435/568,436/569,434/567	55844440	1,12995	2198	4300	6498	SO:0001583	missense	0			-	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.1304G>A	16.37:g.55844440C>T	ENSP00000355193:p.Arg435Gln		A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.R436Q	ENST00000361503.4	37	c.1307	CCDS45488.1	16	.	.	.	.	.	.	.	.	.	.	.	17.85	3.490249	0.64074	0.0	1.16E-4	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046;ENST00000426667	T;T;T	0.09445	3.16;3.16;2.98	4.69	3.72	0.42706	Carboxylesterase, type B (1);	0.222939	0.29924	N	0.010855	T	0.22975	0.0555	L	0.60012	1.86	0.09310	N	1	D;D;D	0.89917	0.995;1.0;0.994	P;D;P	0.64321	0.583;0.924;0.447	T	0.01468	-1.1347	10	0.51188	T	0.08	.	9.3205	0.37962	0.0:0.8949:0.0:0.1051	.	434;435;436	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	Q	436;435;434;300	ENSP00000353720:R436Q;ENSP00000355193:R435Q;ENSP00000390492:R434Q	ENSP00000353720:R436Q	R	-	2	0	CES1	54401941	0.179000	0.23135	0.112000	0.21494	0.209000	0.24338	1.146000	0.31589	2.182000	0.69389	0.456000	0.33151	CGG	rs145088728	CES1	-	pfam_CarbesteraseB		0.507	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CES1	HGNC	protein_coding	OTTHUMT00000433285.1	0	0	0	238	238	111	0.00	0.00	C	NM_001266		55844440	-1	42	29	134	80	tier1	no_errors	ENST00000360526	ensembl	human	known	74_37	missense	23.86	26.61	SNP	0.044	T	42	134
DOCK2	1794	genome.wustl.edu	37	5	169435513	169435513	+	Missense_Mutation	SNP	T	T	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr5:169435513T>A	ENST00000256935.8	+	31	3165	c.3085T>A	c.(3085-3087)Tat>Aat	p.Y1029N	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.Y90N|DOCK2_ENST00000520908.1_Missense_Mutation_p.Y521N	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1029	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTGGAACAACTATTTTCATCT	0.433													ENSG00000134516																																					0													103.0	98.0	100.0					5																	169435513		2203	4300	6503	SO:0001583	missense	0			-	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3085T>A	5.37:g.169435513T>A	ENSP00000256935:p.Tyr1029Asn		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.Y1029N	ENST00000256935.8	37	c.3085	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	T	26.0	4.695392	0.88830	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.55234	0.53;0.53;0.53	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.76905	0.4053	M	0.88906	2.99	0.58432	D	0.999999	D;D	0.76494	0.996;0.999	P;D	0.80764	0.862;0.994	T	0.82141	-0.0604	10	0.87932	D	0	.	15.622	0.76813	0.0:0.0:0.0:1.0	.	521;1029	E7ERW7;Q92608	.;DOCK2_HUMAN	N	1029;521;90	ENSP00000256935:Y1029N;ENSP00000429283:Y521N;ENSP00000438827:Y90N	ENSP00000256935:Y1029N	Y	+	1	0	DOCK2	169368091	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.102000	0.63906	0.533000	0.62120	TAT	-	DOCK2	-	superfamily_ARM-type_fold,superfamily_Ferritin-like_SF		0.433	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	0	0	0	64	64	50	0.00	0.00	T	NM_004946		169435513	+1	14	25	45	47	tier1	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	23.73	34.72	SNP	1.000	A	14	45
CCDC60	160777	genome.wustl.edu	37	12	119968845	119968845	+	Missense_Mutation	SNP	C	C	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr12:119968845C>A	ENST00000327554.2	+	13	1993	c.1528C>A	c.(1528-1530)Cct>Act	p.P510T	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	510										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		ACTGTGCTCCCCTGACATCGC	0.512													ENSG00000183273																																					0													142.0	115.0	124.0					12																	119968845		2203	4300	6503	SO:0001583	missense	0			-	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1528C>A	12.37:g.119968845C>A	ENSP00000333374:p.Pro510Thr			Missense_Mutation	SNP	NULL	p.P510T	ENST00000327554.2	37	c.1528	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	C	16.98	3.272362	0.59649	.	.	ENSG00000183273	ENST00000327554	T	0.72942	-0.7	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000005	D	0.83626	0.5295	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83764	0.0216	9	.	.	.	-18.0489	16.4195	0.83753	0.0:1.0:0.0:0.0	.	510	Q8IWA6	CCD60_HUMAN	T	510	ENSP00000333374:P510T	.	P	+	1	0	CCDC60	118453228	0.993000	0.37304	0.980000	0.43619	0.377000	0.30045	4.349000	0.59385	2.601000	0.87937	0.655000	0.94253	CCT	-	CCDC60	-	NULL		0.512	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	0	0	0	76	76	99	0.00	0.00	C	NM_178499		119968845	+1	160	331	49	85	tier1	no_errors	ENST00000327554	ensembl	human	known	74_37	missense	76.19	79.57	SNP	0.999	A	160	49
ACSM2A	123876	genome.wustl.edu	37	16	20482862	20482862	+	Missense_Mutation	SNP	A	A	G			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr16:20482862A>G	ENST00000573854.1	+	6	859	c.745A>G	c.(745-747)Aca>Gca	p.T249A	ACSM2A_ENST00000575690.1_Missense_Mutation_p.T249A|ACSM2A_ENST00000219054.6_Missense_Mutation_p.T249A|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000536134.1_Missense_Mutation_p.T21A|ACSM2A_ENST00000417235.2_Missense_Mutation_p.T170A|ACSM2A_ENST00000396104.2_Missense_Mutation_p.T249A	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	249					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						TTTCAGTTGGACAGGCCTGCA	0.478													ENSG00000183747																																					0													128.0	121.0	123.0					16																	20482862		2203	4297	6500	SO:0001583	missense	0			-	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.745A>G	16.37:g.20482862A>G	ENSP00000459451:p.Thr249Ala		B3KTT9|O75202	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.T249A	ENST00000573854.1	37	c.745	CCDS32401.1	16	.	.	.	.	.	.	.	.	.	.	A	8.539	0.872750	0.17322	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	3.51	0.956	0.19608	AMP-dependent synthetase/ligase (1);	0.325827	0.22370	N	0.060957	T	0.28433	0.0703	L	0.27053	0.805	0.26424	N	0.976044	B;B	0.14012	0.008;0.009	B;B	0.19391	0.02;0.025	T	0.11060	-1.0603	10	0.33940	T	0.23	-6.6483	4.5845	0.12275	0.3976:0.1567:0.0:0.4457	.	170;249	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	A	170;249;21;249	ENSP00000392169:T170A;ENSP00000219054:T249A;ENSP00000445082:T21A;ENSP00000379411:T249A	ENSP00000219054:T249A	T	+	1	0	ACSM2A	20390363	0.000000	0.05858	0.479000	0.27329	0.189000	0.23516	-0.645000	0.05409	0.417000	0.25871	-1.078000	0.02229	ACA	-	ACSM2A	-	pfam_AMP-dep_Synth/Lig		0.478	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2A	HGNC	protein_coding	OTTHUMT00000436764.1	0	0	0	120	120	44	0.00	0.00	A	NM_001010845		20482862	+1	11	11	85	42	tier1	no_errors	ENST00000219054	ensembl	human	known	74_37	missense	11.46	20.75	SNP	0.138	G	11	85
ABCA7	10347	genome.wustl.edu	37	19	1063802	1063802	+	Missense_Mutation	SNP	T	T	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:1063802T>A	ENST00000263094.6	+	44	6122	c.5891T>A	c.(5890-5892)cTt>cAt	p.L1964H	ABCA7_ENST00000433129.1_Missense_Mutation_p.L1964H|ABCA7_ENST00000435683.2_Missense_Mutation_p.L1826H|HMHA1_ENST00000539243.2_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1964	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCGCTTCCTTTGGAACAGC	0.667													ENSG00000064687																																					0													26.0	25.0	25.0					19																	1063802		2086	4114	6200	SO:0001583	missense	0			-	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5891T>A	19.37:g.1063802T>A	ENSP00000263094:p.Leu1964His		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L1964H	ENST00000263094.6	37	c.5891	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	T	15.75	2.926586	0.52759	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.89415	-2.51;-2.51	3.39	3.39	0.38822	ATPase, AAA+ type, core (1);ABC transporter-like (1);	.	.	.	.	D	0.95178	0.8437	M	0.93507	3.425	0.42286	D	0.992114	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	D	0.95521	0.8594	9	0.87932	D	0	.	10.7647	0.46286	0.0:0.0:0.0:1.0	.	1089;1964	D6W5Y0;Q8IZY2	.;ABCA7_HUMAN	H	1964	ENSP00000263094:L1964H;ENSP00000414062:L1964H	ENSP00000263094:L1964H	L	+	2	0	ABCA7	1014802	0.999000	0.42202	0.969000	0.41365	0.108000	0.19459	7.488000	0.81441	1.426000	0.47256	0.260000	0.18958	CTT	-	ABCA7	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.667	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	0	0	0	147	147	19	0.00	0.00	T	NM_019112		1063802	+1	28	4	101	19	tier1	no_errors	ENST00000263094	ensembl	human	known	74_37	missense	21.71	17.39	SNP	1.000	A	28	101
KLK13	26085	genome.wustl.edu	37	19	51563252	51563252	+	Missense_Mutation	SNP	C	C	T	rs369228780		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:51563252C>T	ENST00000595793.1	-	3	380	c.338G>A	c.(337-339)cGg>cAg	p.R113Q	KLK13_ENST00000595547.1_Intron|KLK13_ENST00000335422.3_Intron|KLK13_ENST00000596955.1_Missense_Mutation_p.R113Q	NM_015596.1	NP_056411.1	Q9UKR3	KLK13_HUMAN	kallikrein-related peptidase 13	113	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				protein processing (GO:0016485)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)	hydrolase activity (GO:0016787)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	16		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		GGGGCTTCTCCGGTATTCAGG	0.592													ENSG00000167759	C|||	1	0.000199681	0.0008	0.0	5008	,	,		11641	0.0		0.0	False		,,,				2504	0.0																0								C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	91.0	88.0	89.0		338	-2.1	0.9	19		89	0,8600		0,0,4300	no	missense	KLK13	NM_015596.1	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	113/278	51563252	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS12822.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167759		"""Kallikreins"""	6361	protein-coding gene	gene with protein product		605505	"""kallikrein 13"""			16800724, 16800723	Standard	NM_015596		Approved	KLK-L4	uc002pvn.3	Q9UKR3		ENST00000595793.1:c.338G>A	19.37:g.51563252C>T	ENSP00000470555:p.Arg113Gln		A7UNK6|Q86VI8|Q9Y433	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R113Q	ENST00000595793.1	37	c.338	CCDS12822.1	19	.	.	.	.	.	.	.	.	.	.	C	4.284	0.051855	0.08291	2.27E-4	0.0	ENSG00000167759	ENST00000156476	.	.	.	3.91	-2.09	0.07232	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.652897	0.13325	N	0.396356	T	0.30696	0.0773	N	0.22421	0.69	0.80722	D	1	B;B	0.12630	0.006;0.006	B;B	0.09377	0.004;0.004	T	0.03728	-1.1009	9	0.45353	T	0.12	.	4.3789	0.11284	0.1819:0.4569:0.0:0.3612	.	113;113	B5BUM9;Q9UKR3	.;KLK13_HUMAN	Q	113	.	ENSP00000156476:R113Q	R	-	2	0	KLK13	56255064	0.968000	0.33430	0.947000	0.38551	0.017000	0.09413	0.114000	0.15520	-0.364000	0.08088	-0.806000	0.03193	CGG	-	KLK13	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.592	KLK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK13	HGNC	protein_coding	OTTHUMT00000464298.2	0	0	0	50	50	53	0.00	0.00	C	NM_015596		51563252	-1	5	8	22	47	tier1	no_errors	ENST00000595793	ensembl	human	known	74_37	missense	18.52	14.55	SNP	0.925	T	5	22
THSD7A	221981	genome.wustl.edu	37	7	11457208	11457208	+	Missense_Mutation	SNP	C	C	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr7:11457208C>T	ENST00000423059.4	-	17	3657	c.3406G>A	c.(3406-3408)Ggc>Agc	p.G1136S	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1136	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCAGAAGGGCCATCTGCTGTA	0.408										HNSCC(18;0.044)			ENSG00000005108																																					0													105.0	100.0	102.0					7																	11457208		1891	4109	6000	SO:0001583	missense	0			-		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.3406G>A	7.37:g.11457208C>T	ENSP00000406482:p.Gly1136Ser			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G1136S	ENST00000423059.4	37	c.3406	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631769	0.87660	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.61980	0.06	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.62768	0.2455	L	0.52206	1.635	0.80722	D	1	P	0.37500	0.597	B	0.42882	0.401	T	0.57225	-0.7848	10	0.16896	T	0.51	.	19.0873	0.93209	0.0:1.0:0.0:0.0	.	1136	Q9UPZ6	THS7A_HUMAN	S	1136	ENSP00000406482:G1136S	ENSP00000262042:G1136S	G	-	1	0	THSD7A	11423733	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.809000	0.86057	2.519000	0.84933	0.655000	0.94253	GGC	-	THSD7A	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.408	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	0	0	0	31	31	62	0.00	0.00	C	XM_928187.2		11457208	-1	6	10	28	29	tier1	no_errors	ENST00000423059	ensembl	human	known	74_37	missense	17.65	25.64	SNP	1.000	T	6	28
MYT1L	23040	genome.wustl.edu	37	2	2328430	2328430	+	Intron	SNP	C	C	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr2:2328430C>T	ENST00000399161.2	-	1	228				MYT1L_ENST00000428368.2_Intron|AC009232.2_ENST00000448106.1_lincRNA	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		AGGCAGCAGACAGACAGCGCC	0.592													ENSG00000225619																																					0																																										SO:0001627	intron_variant	0			-	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.520+6308G>A	2.37:g.2328430C>T			A7E2C7|B2RP54|Q6IQ17|Q9UPP6	R	SNP	-	NULL	ENST00000399161.2	37	NULL		2																																																																																			-	AC009232.2	-	-		0.592	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	LOC730811	Clone_based_vega_gene	protein_coding	OTTHUMT00000322493.1	0	0	0	60	60	19	0.00	0.00	C	NM_015025		2328430	+1	24	5	33	14	tier1	no_errors	ENST00000422175	ensembl	human	known	74_37	rna	42.11	26.32	SNP	0.004	T	24	33
MAGI3	260425	genome.wustl.edu	37	1	114184712	114184712	+	Missense_Mutation	SNP	A	A	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr1:114184712A>T	ENST00000307546.9	+	10	1615	c.1540A>T	c.(1540-1542)Atc>Ttc	p.I514F	MAGI3_ENST00000369617.4_Missense_Mutation_p.I539F|MAGI3_ENST00000369611.4_Missense_Mutation_p.I514F|MAGI3_ENST00000369615.1_Missense_Mutation_p.I514F	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	539	Interaction with PTEN.|PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACCCCTGTCATCAATGGACA	0.453													ENSG00000081026																																					0													184.0	166.0	172.0					1																	114184712		2203	4300	6503	SO:0001583	missense	0			-	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.1540A>T	1.37:g.114184712A>T	ENSP00000304604:p.Ile514Phe		Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.I514F	ENST00000307546.9	37	c.1540	CCDS44196.1	1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.754151	0.49362	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.15256	2.6;2.44;2.6;2.6	5.37	4.25	0.50352	.	0.043832	0.85682	D	0.000000	T	0.10508	0.0257	L	0.53249	1.67	0.53688	D	0.999975	P;P;P	0.51537	0.946;0.682;0.721	P;B;B	0.46253	0.509;0.22;0.373	T	0.02966	-1.1088	10	0.87932	D	0	-10.5386	7.1295	0.25493	0.7975:0.0:0.0717:0.1308	.	514;514;539	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	F	539;514;514;514	ENSP00000358630:I539F;ENSP00000304604:I514F;ENSP00000358628:I514F;ENSP00000358624:I514F	ENSP00000304604:I514F	I	+	1	0	MAGI3	113986235	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	4.283000	0.58977	0.992000	0.38840	0.528000	0.53228	ATC	-	MAGI3	-	NULL		0.453	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	MAGI3	HGNC	protein_coding	OTTHUMT00000032429.1	0	0	0	151	151	78	0.00	0.00	A	NM_152900		114184712	+1	32	26	92	42	tier1	no_errors	ENST00000369611	ensembl	human	known	74_37	missense	25.81	38.24	SNP	0.997	T	32	92
KLK3	354	genome.wustl.edu	37	19	51361292	51361292	+	Missense_Mutation	SNP	G	G	A	rs148892721		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:51361292G>A	ENST00000326003.2	+	3	255	c.214G>A	c.(214-216)Gtg>Atg	p.V72M	KLK3_ENST00000597483.1_Intron|KLK3_ENST00000595952.1_Intron|KLK3_ENST00000360617.3_Missense_Mutation_p.V72M|KLK3_ENST00000593997.1_Missense_Mutation_p.V72M	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	72	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		CAGCAAAAGCGTGATCTTGCT	0.537													ENSG00000142515																									Colon(185;1767 2023 13025 30120 37630)												0								G	MET/VAL,,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	54.0	48.0	50.0		214,,214	-4.2	0.0	19	dbSNP_134	50	0,8600		0,0,4300	no	missense,intron,missense	KLK3	NM_001030047.1,NM_001030048.1,NM_001648.2	21,,21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,,possibly-damaging	72/239,,72/262	51361292	1,13005	2203	4300	6503	SO:0001583	missense	0			-	X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.214G>A	19.37:g.51361292G>A	ENSP00000314151:p.Val72Met		C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.V72M	ENST00000326003.2	37	c.214	CCDS12807.1	19	.	.	.	.	.	.	.	.	.	.	G	6.827	0.521817	0.13005	2.27E-4	0.0	ENSG00000142515	ENST00000326003;ENST00000360617;ENST00000326052	D;D	0.89681	-2.55;-2.55	2.09	-4.18	0.03846	.	0.695351	0.11885	N	0.520147	T	0.81356	0.4805	N	0.16368	0.405	0.09310	N	1	P;D	0.53151	0.939;0.958	P;B	0.51324	0.666;0.367	T	0.73864	-0.3848	10	0.87932	D	0	.	5.5939	0.17317	0.3263:0.3509:0.3228:0.0	.	72;72	Q8NCW4;G3XAE3	.;.	M	72	ENSP00000314151:V72M;ENSP00000353829:V72M	ENSP00000314151:V72M	V	+	1	0	KLK3	56053104	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.314000	0.08092	-1.019000	0.03358	-1.321000	0.01291	GTG	rs148892721	KLK3	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.537	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK3	HGNC	protein_coding	OTTHUMT00000464067.1	0	0	0	50	50	37	0.00	0.00	G	NM_145864		51361292	+1	11	9	20	35	tier1	no_errors	ENST00000326003	ensembl	human	known	74_37	missense	35.48	20.45	SNP	0.000	A	11	20
CTSL	1514	genome.wustl.edu	37	9	90343553	90343553	+	Silent	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr9:90343553G>A	ENST00000343150.5	+	5	1340	c.450G>A	c.(448-450)caG>caA	p.Q150Q	CTSL_ENST00000495822.1_Intron|CTSL_ENST00000342020.5_Silent_p.Q150Q|CTSL_ENST00000340342.6_Silent_p.Q150Q			P07711	CATL1_HUMAN	cathepsin L	150					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										TTGAAGGACAGATGTTCCGGA	0.453													ENSG00000135047																																					0													152.0	155.0	154.0					9																	90343553		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.450G>A	9.37:g.90343553G>A			Q6IAV1|Q96QJ0	Silent	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.Q150	ENST00000343150.5	37	c.450	CCDS6675.1	9																																																																																			-	CTSL	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C		0.453	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSL	HGNC	protein_coding	OTTHUMT00000052936.1	0	0	0	109	109	59	0.00	0.00	G	NM_001912		90343553	+1	44	12	59	39	tier1	no_errors	ENST00000340342	ensembl	human	known	74_37	silent	42.72	23.53	SNP	1.000	A	44	59
CDA	978	genome.wustl.edu	37	1	20915751	20915751	+	Silent	SNP	C	C	T	rs149177918	byFrequency	TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr1:20915751C>T	ENST00000375071.3	+	1	311	c.129C>T	c.(127-129)ctC>ctT	p.L43L	CDA_ENST00000461985.1_3'UTR	NM_001785.2	NP_001776.1	P32320	CDD_HUMAN	cytidine deaminase	43	CMP/dCMP deaminase zinc-binding.				cell surface receptor signaling pathway (GO:0007166)|cytidine deamination (GO:0009972)|cytosine metabolic process (GO:0019858)|negative regulation of cell growth (GO:0030308)|negative regulation of nucleotide metabolic process (GO:0045980)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine-containing compound salvage (GO:0008655)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	cytidine deaminase activity (GO:0004126)|nucleoside binding (GO:0001882)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	7		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	CTGCCCTGCTCACCCAGGAGG	0.607													ENSG00000158825																									Pancreas(74;49 1356 2772 27818 40529)												0								C		2,4404	4.2+/-10.8	0,2,2201	39.0	39.0	39.0		129	4.2	1.0	1	dbSNP_134	39	0,8600		0,0,4300	no	coding-synonymous	CDA	NM_001785.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		43/147	20915751	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC054036	CCDS210.1	1p36.2-p35	2008-02-05			ENSG00000158825	ENSG00000158825	3.5.4.5		1712	protein-coding gene	gene with protein product		123920				8422236, 9878810	Standard	NM_001785		Approved	CDD	uc001bdk.3	P32320	OTTHUMG00000002845	ENST00000375071.3:c.129C>T	1.37:g.20915751C>T				Silent	SNP	pfam_CMP_dCMP_Zn-bd,pfam_Cyd/dCyd_deaminase_Zn-bd,superfamily_Cytidine_deaminase-like,tigrfam_Cyt_deam_tetra	p.L43	ENST00000375071.3	37	c.129	CCDS210.1	1																																																																																			rs149177918	CDA	-	pfam_CMP_dCMP_Zn-bd,pfam_Cyd/dCyd_deaminase_Zn-bd,superfamily_Cytidine_deaminase-like,tigrfam_Cyt_deam_tetra		0.607	CDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDA	HGNC	protein_coding	OTTHUMT00000007965.1	0	0	0	61	61	43	0.00	0.00	C	NM_001785		20915751	+1	17	23	21	17	tier1	no_errors	ENST00000375071	ensembl	human	known	74_37	silent	44.74	57.50	SNP	1.000	T	17	21
TMEM168	64418	genome.wustl.edu	37	7	112415372	112415372	+	Splice_Site	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr7:112415372G>A	ENST00000312814.6	-	3	1690	c.1130C>T	c.(1129-1131)cCa>cTa	p.P377L	TMEM168_ENST00000454074.1_Splice_Site_p.P377L|TMEM168_ENST00000480969.1_5'UTR	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	377						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						TCCATTTGTTGGCTAAAAGAA	0.343													ENSG00000146802																																					0													60.0	55.0	57.0					7																	112415372		2203	4300	6503	SO:0001630	splice_region_variant	0			-		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.1129-1C>T	7.37:g.112415372G>A			A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Missense_Mutation	SNP	superfamily_ConA-like_lec_gl_sf	p.P377L	ENST00000312814.6	37	c.1130	CCDS5757.1	7	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991471	0.35131	.	.	ENSG00000146802	ENST00000312814;ENST00000454074;ENST00000418785;ENST00000441474	.	.	.	5.31	2.31	0.28768	.	0.343466	0.36932	N	0.002339	T	0.52435	0.1734	L	0.40543	1.245	0.80722	D	1	B	0.19200	0.034	B	0.19946	0.027	T	0.42965	-0.9420	9	0.33141	T	0.24	-11.7837	14.4204	0.67180	0.0:0.0:0.495:0.505	.	377	Q9H0V1	TM168_HUMAN	L	377;377;17;29	.	ENSP00000323068:P377L	P	-	2	0	TMEM168	112202608	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	2.778000	0.47726	0.246000	0.21394	0.655000	0.94253	CCA	-	TMEM168	-	NULL		0.343	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM168	HGNC	protein_coding	OTTHUMT00000338696.4	0	0	0	43	43	54	0.00	0.00	G	NM_022484	Missense_Mutation	112415372	-1	7	16	17	60	tier1	no_errors	ENST00000312814	ensembl	human	known	74_37	missense	29.17	20.78	SNP	1.000	A	7	17
OR5M10	390167	genome.wustl.edu	37	11	56344717	56344717	+	Missense_Mutation	SNP	G	G	C			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr11:56344717G>C	ENST00000526812.2	-	1	546	c.481C>G	c.(481-483)Ctg>Gtg	p.L161V		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						AAGGTCAGCAGTGTCTGAGAG	0.478													ENSG00000254834																																					0													147.0	143.0	144.0					11																	56344717		2018	4190	6208	SO:0001583	missense	0			-	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.481C>G	11.37:g.56344717G>C	ENSP00000436004:p.Leu161Val		B9EIL9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L161V	ENST00000526812.2	37	c.481	CCDS53630.1	11	.	.	.	.	.	.	.	.	.	.	G	1.927	-0.446993	0.04572	.	.	ENSG00000254834	ENST00000526812	T	0.38722	1.12	4.04	-5.77	0.02369	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.22513	0.0543	N	0.25332	0.735	0.09310	N	1	B	0.06786	0.001	B	0.17979	0.02	T	0.40251	-0.9573	9	0.08599	T	0.76	.	9.3903	0.38370	0.0:0.2122:0.1537:0.6341	.	161	Q6IEU7	OR5MA_HUMAN	V	161	ENSP00000436004:L161V	ENSP00000436004:L161V	L	-	1	2	OR5M10	56101293	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.908000	0.00700	-0.728000	0.04882	-0.210000	0.12710	CTG	-	OR5M10	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.478	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M10	HGNC	protein_coding	OTTHUMT00000391609.1	0	0	0	53	53	79	0.00	0.00	G	NM_001004741		56344717	-1	4	7	42	56	tier1	no_errors	ENST00000526812	ensembl	human	known	74_37	missense	8.70	11.11	SNP	0.000	C	4	42
ATRX	546	genome.wustl.edu	37	X	76875866	76875866	+	Missense_Mutation	SNP	C	C	G			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chrX:76875866C>G	ENST00000373344.5	-	20	5483	c.5269G>C	c.(5269-5271)Gag>Cag	p.E1757Q	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.E1719Q	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1757	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.E1757*(1)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AACTCACACTCAATTAGGTTA	0.308			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	2	Substitution - Nonsense(1)|Unknown(1)	central_nervous_system(1)|bone(1)											79.0	68.0	72.0					X																	76875866		2201	4293	6494	SO:0001583	missense	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5269G>C	X.37:g.76875866C>G	ENSP00000362441:p.Glu1757Gln		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1757Q	ENST00000373344.5	37	c.5269	CCDS14434.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.6|23.6	4.438989|4.438989	0.83885|0.83885	.|.	.|.	ENSG00000085224|ENSG00000085224	ENST00000373344;ENST00000395603|ENST00000400866	D;D|.	0.94828|.	-3.53;-3.53|.	4.57|4.57	4.57|4.57	0.56435|0.56435	DEAD-like helicase (2);SNF2-related (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91005|0.91005	0.7171|0.7171	H|H	0.99336|0.99336	4.52|4.52	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.998;1.0|.	D;D|.	0.91635|.	0.994;0.999|.	D|D	0.95168|0.95168	0.8287|0.8287	10|5	0.87932|.	D|.	0|.	.|.	16.6124|16.6124	0.84886|0.84886	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1719;1757|.	P46100-4;P46100|.	.;ATRX_HUMAN|.	Q|F	1757;1719|45	ENSP00000362441:E1757Q;ENSP00000378967:E1719Q|.	ENSP00000362441:E1757Q|.	E|L	-|-	1|3	0|2	ATRX|ATRX	76762522|76762522	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.459000|7.459000	0.80802|0.80802	1.833000|1.833000	0.53350|0.53350	0.600000|0.600000	0.82982|0.82982	GAG|TTG	-	ATRX	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.308	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	153	153	45	0.00	0.00	C	NM_000489		76875866	-1	27	28	58	58	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	31.40	32.56	SNP	1.000	G	27	58
TRPC1	7220	genome.wustl.edu	37	3	142511714	142511714	+	Missense_Mutation	SNP	C	C	G	rs371483638		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr3:142511714C>G	ENST00000476941.1	+	9	1972	c.1486C>G	c.(1486-1488)Ctg>Gtg	p.L496V	TRPC1_ENST00000273482.6_Missense_Mutation_p.L462V	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	496					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						CCATCCTACACTGGTGGCAGA	0.383													ENSG00000144935																																					0													167.0	150.0	156.0					3																	142511714		2203	4300	6503	SO:0001583	missense	0			-	X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1486C>G	3.37:g.142511714C>G	ENSP00000419313:p.Leu496Val		Q14CE4	Missense_Mutation	SNP	pfam_TRP_dom,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC1_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.L496V	ENST00000476941.1	37	c.1486	CCDS58856.1	3	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676223	0.47886	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	T;D	0.82893	-1.32;-1.66	5.28	4.39	0.52855	Ion transport (1);	0.068152	0.64402	D	0.000011	D	0.85301	0.5665	M	0.78916	2.43	0.80722	D	1	B;B	0.28512	0.006;0.214	B;B	0.36989	0.019;0.238	D	0.86130	0.1574	10	0.72032	D	0.01	-21.6413	14.808	0.69971	0.0:0.9268:0.0:0.0732	.	496;462	P48995;P48995-2	TRPC1_HUMAN;.	V	496;462	ENSP00000419313:L496V;ENSP00000273482:L462V	ENSP00000273482:L462V	L	+	1	2	TRPC1	143994404	0.796000	0.28864	0.998000	0.56505	0.998000	0.95712	1.287000	0.33284	2.622000	0.88805	0.557000	0.71058	CTG	-	TRPC1	-	pfam_Ion_trans_dom,tigrfam_TRP_channel		0.383	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	HGNC	protein_coding	OTTHUMT00000354520.1	0	0	0	107	107	60	0.00	0.00	C	NM_003304		142511714	+1	31	14	74	42	tier1	no_errors	ENST00000476941	ensembl	human	known	74_37	missense	29.52	25.00	SNP	0.996	G	31	74
WDFY3	23001	genome.wustl.edu	37	4	85742335	85742335	+	Missense_Mutation	SNP	T	T	C			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr4:85742335T>C	ENST00000295888.4	-	11	1900	c.1493A>G	c.(1492-1494)gAc>gGc	p.D498G	WDFY3_ENST00000322366.6_Missense_Mutation_p.D498G	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	498					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCTGAACACGTCTTTAAATAT	0.383													ENSG00000163625																																					0													83.0	84.0	84.0					4																	85742335		2203	4299	6502	SO:0001583	missense	0			-	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.1493A>G	4.37:g.85742335T>C	ENSP00000295888:p.Asp498Gly		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D498G	ENST00000295888.4	37	c.1493	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	T	24.0	4.488018	0.84854	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.51574	0.7;0.7	5.81	5.81	0.92471	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.71065	0.3296	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75039	-0.3458	10	0.66056	D	0.02	.	16.1773	0.81862	0.0:0.0:0.0:1.0	.	498;498	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	G	498	ENSP00000318466:D498G;ENSP00000295888:D498G	ENSP00000295888:D498G	D	-	2	0	WDFY3	85961359	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.642000	0.83385	2.217000	0.71921	0.482000	0.46254	GAC	-	WDFY3	-	superfamily_ARM-type_fold		0.383	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	0	0	0	57	57	100	0.00	0.00	T	NM_014991		85742335	-1	13	24	31	78	tier1	no_errors	ENST00000295888	ensembl	human	known	74_37	missense	29.55	23.53	SNP	1.000	C	13	31
CCR1	1230	genome.wustl.edu	37	3	46245242	46245242	+	Missense_Mutation	SNP	G	G	C	rs201517958		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr3:46245242G>C	ENST00000296140.3	-	2	688	c.563C>G	c.(562-564)cCt>cGt	p.P188R	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	188					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)			autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GCTTTCGTGAGGAAAGTGAAG	0.498													ENSG00000163823																																					0													82.0	81.0	82.0					3																	46245242		2203	4300	6503	SO:0001583	missense	0			-		CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.563C>G	3.37:g.46245242G>C	ENSP00000296140:p.Pro188Arg		Q86VA9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR5,prints_NPY_rcpt,prints_ATII_rcpt	p.P188R	ENST00000296140.3	37	c.563	CCDS2737.1	3	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175720	0.38413	.	.	ENSG00000163823	ENST00000296140	T	0.38887	1.11	5.31	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	U	0.000477	T	0.76579	0.4007	H	0.97465	4.01	0.49582	D	0.999804	D	0.89917	1.0	D	0.97110	1.0	D	0.85478	0.1177	10	0.59425	D	0.04	.	15.5644	0.76277	0.0:0.0:0.8608:0.1392	.	188	P32246	CCR1_HUMAN	R	188	ENSP00000296140:P188R	ENSP00000296140:P188R	P	-	2	0	CCR1	46220246	1.000000	0.71417	0.648000	0.29521	0.025000	0.11179	4.965000	0.63708	1.354000	0.45846	0.643000	0.83706	CCT	-	CCR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR1,prints_Chemokine_CCR5		0.498	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR1	HGNC	protein_coding	OTTHUMT00000257325.2	0	0	0	53	53	89	0.00	0.00	G	NM_001295		46245242	-1	8	28	33	67	tier1	no_errors	ENST00000296140	ensembl	human	known	74_37	missense	19.51	29.47	SNP	1.000	C	8	33
ZKSCAN8	7745	genome.wustl.edu	37	6	28121130	28121130	+	Missense_Mutation	SNP	G	G	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr6:28121130G>T	ENST00000330236.6	+	6	1256	c.1072G>T	c.(1072-1074)Gcc>Tcc	p.A358S	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.A358S	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	358					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTGTGGTAAAGCCTTCAGTTA	0.468													ENSG00000198315																																					0													275.0	269.0	271.0					6																	28121130		2203	4300	6503	SO:0001583	missense	0			-		CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.1072G>T	6.37:g.28121130G>T	ENSP00000332750:p.Ala358Ser		A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.A358S	ENST00000330236.6	37	c.1072	CCDS4645.1	6	.	.	.	.	.	.	.	.	.	.	G	9.235	1.036918	0.19669	.	.	ENSG00000198315	ENST00000330236;ENST00000457389	T;T	0.35973	1.28;1.28	5.99	5.99	0.97316	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.216541	0.32901	N	0.005506	T	0.23965	0.0580	N	0.16037	0.36	0.80722	D	1	P	0.48162	0.906	P	0.56563	0.801	T	0.03739	-1.1008	10	0.20519	T	0.43	.	14.1308	0.65253	0.0:0.0:0.8497:0.1503	.	358	Q15776	ZN192_HUMAN	S	358	ENSP00000332750:A358S;ENSP00000402948:A358S	ENSP00000332750:A358S	A	+	1	0	ZNF192	28229109	.	.	1.000000	0.80357	0.991000	0.79684	.	.	2.853000	0.98044	0.655000	0.94253	GCC	-	ZKSCAN8	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.468	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN8	HGNC	protein_coding	OTTHUMT00000040178.2	0	0	0	64	64	119	0.00	0.00	G			28121130	+1	10	37	35	91	tier1	no_errors	ENST00000330236	ensembl	human	known	74_37	missense	22.22	28.68	SNP	1.000	T	10	35
LRRTM4	80059	genome.wustl.edu	37	2	77745759	77745759	+	Silent	SNP	G	G	A	rs546452040		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr2:77745759G>A	ENST00000409093.1	-	3	1572	c.1236C>T	c.(1234-1236)ggC>ggT	p.G412G	LRRTM4_ENST00000409088.3_Silent_p.G412G|LRRTM4_ENST00000409282.1_Silent_p.G413G|LRRTM4_ENST00000409911.1_Silent_p.G413G|LRRTM4_ENST00000409884.1_Silent_p.G412G			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	412					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CTTGCTCTGCGCCAGGAATCT	0.473													ENSG00000176204	G|||	1	0.000199681	0.0	0.0	5008	,	,		17981	0.0		0.0	False		,,,				2504	0.001																0													108.0	106.0	106.0					2																	77745759		1895	4120	6015	SO:0001819	synonymous_variant	0			-	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1236C>T	2.37:g.77745759G>A			Q4FZ98|Q6UXJ7	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.G413	ENST00000409093.1	37	c.1239	CCDS46346.1	2																																																																																			-	LRRTM4	-	NULL		0.473	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	HGNC	protein_coding	OTTHUMT00000328225.1	0	0	1	52	52	101	0.00	0.98	G	NM_024993		77745759	-1	12	26	45	65	tier1	no_errors	ENST00000409911	ensembl	human	known	74_37	silent	21.05	28.57	SNP	0.977	A	12	45
RORC	6097	genome.wustl.edu	37	1	151785408	151785408	+	Intron	SNP	C	C	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr1:151785408C>T	ENST00000318247.6	-	9	1393				RORC_ENST00000480719.1_5'UTR|RORC_ENST00000392697.3_Intron|RORC_ENST00000356728.6_Intron	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C						adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTCACCCAAGCCCAGCAACAC	0.478													ENSG00000143365																																					0													59.0	53.0	55.0					1																	151785408		2203	4300	6503	SO:0001627	intron_variant	0			-	U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.1285+14G>A	1.37:g.151785408C>T			Q5SZR9|Q8N5V7|Q8NCY8	R	SNP	-	NULL	ENST00000318247.6	37	NULL	CCDS1004.1	1																																																																																			-	RORC	-	-		0.478	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RORC	HGNC	protein_coding	OTTHUMT00000036626.1	0	0	0	45	45	62	0.00	0.00	C			151785408	-1	18	20	28	65	tier1	no_errors	ENST00000480719	ensembl	human	known	74_37	rna	39.13	23.53	SNP	0.979	T	18	28
CNR1	1268	genome.wustl.edu	37	6	88854824	88854824	+	Missense_Mutation	SNP	G	G	C			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr6:88854824G>C	ENST00000537554.1	-	2	3732	c.170C>G	c.(169-171)cCc>cGc	p.P57R	CNR1_ENST00000369501.2_Missense_Mutation_p.P57R|CNR1_ENST00000428600.2_Missense_Mutation_p.P57R|CNR1_ENST00000535130.1_Missense_Mutation_p.P57R|CNR1_ENST00000549890.1_Missense_Mutation_p.P57R|CNR1_ENST00000369499.2_Missense_Mutation_p.P57R|CNR1_ENST00000549716.1_Intron|CNR1_ENST00000468898.1_Missense_Mutation_p.P24R|CNR1_ENST00000362094.5_Intron	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	57					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	CTCTTGGAAGGGACTTCCCCT	0.463													ENSG00000118432																																					0													82.0	81.0	81.0					6																	88854824		2203	4300	6503	SO:0001583	missense	0			-	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.170C>G	6.37:g.88854824G>C	ENSP00000441046:p.Pro57Arg		B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Canbinoid_rcpt_1,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.P57R	ENST00000537554.1	37	c.170	CCDS5015.1	6	.	.	.	.	.	.	.	.	.	.	G	11.80	1.745460	0.30955	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000551417	T;T;T;T;T;T;T	0.76316	-0.88;-0.88;-0.88;-0.88;-0.88;-1.01;-0.88	5.77	5.77	0.91146	.	0.244269	0.36374	N	0.002631	T	0.62454	0.2429	L	0.34521	1.04	0.80722	D	1	P;B	0.36837	0.571;0.18	B;B	0.34452	0.183;0.055	T	0.70274	-0.4917	10	0.87932	D	0	.	18.9897	0.92786	0.0:0.0:1.0:0.0	.	24;57	P21554-3;P21554	.;CNR1_HUMAN	R	57;57;57;57;57;24;57;57	ENSP00000358513:P57R;ENSP00000442689:P57R;ENSP00000441046:P57R;ENSP00000358511:P57R;ENSP00000446819:P57R;ENSP00000420188:P24R;ENSP00000412192:P57R	ENSP00000358511:P57R	P	-	2	0	CNR1	88911543	1.000000	0.71417	1.000000	0.80357	0.541000	0.35023	9.056000	0.93881	2.732000	0.93576	0.563000	0.77884	CCC	-	CNR1	-	pirsf_Canbinoid_rcpt_1,prints_Canbinoid_rcpt_1		0.463	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	HGNC	protein_coding	OTTHUMT00000354204.2	0	0	0	114	114	83	0.00	0.00	G			88854824	-1	25	29	46	56	tier1	no_errors	ENST00000369499	ensembl	human	known	74_37	missense	35.21	33.72	SNP	1.000	C	25	46
ROCK1	6093	genome.wustl.edu	37	18	18566975	18566975	+	Missense_Mutation	SNP	T	T	C			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr18:18566975T>C	ENST00000399799.2	-	19	3180	c.2240A>G	c.(2239-2241)gAt>gGt	p.D747G		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	747	Glu-rich.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TTGCTTCAGATCAACGTCTAG	0.378													ENSG00000067900																																					0													148.0	135.0	139.0					18																	18566975		2203	4300	6503	SO:0001583	missense	0			-		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.2240A>G	18.37:g.18566975T>C	ENSP00000382697:p.Asp747Gly		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rho-bd_dom,pfam_HR1_rho-bd,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.D747G	ENST00000399799.2	37	c.2240	CCDS11870.2	18	.	.	.	.	.	.	.	.	.	.	T	27.6	4.844963	0.91197	.	.	ENSG00000067900	ENST00000399799	T	0.69040	-0.37	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.83367	0.5239	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.86381	0.1729	10	0.87932	D	0	.	15.4144	0.74952	0.0:0.0:0.0:1.0	.	747	Q13464	ROCK1_HUMAN	G	747	ENSP00000382697:D747G	ENSP00000382697:D747G	D	-	2	0	ROCK1	16820973	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.301000	0.78850	2.217000	0.71921	0.477000	0.44152	GAT	-	ROCK1	-	pirsf_Rho-assoc_coiled-coil_kin		0.378	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK1	HGNC	protein_coding	OTTHUMT00000254641.2	0	0	0	86	86	78	0.00	0.00	T	NM_005406		18566975	-1	17	26	39	68	tier1	no_errors	ENST00000399799	ensembl	human	known	74_37	missense	30.36	27.66	SNP	1.000	C	17	39
SNHG14	104472715	genome.wustl.edu	37	15	25299398	25299398	+	RNA	SNP	G	G	C			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr15:25299398G>C	ENST00000549804.2	+	0	98				SNHG14_ENST00000547292.1_RNA|SNORD116-2_ENST00000384274.1_RNA|SNORD116-3_ENST00000384287.1_RNA|RP11-701H24.10_ENST00000552781.1_RNA|SNORD116-1_ENST00000384335.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		CCTTGGAAAAGCTGAACAAAA	0.502													ENSG00000207001																																					0													234.0	216.0	221.0					15																	25299398		876	1991	2867			0			-			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25299398G>C				R	SNP	-	NULL	ENST00000549804.2	37	NULL		15																																																																																			-	SNORD116-2	-	-		0.502	SNHG14-012	KNOWN	non_canonical_other|basic	antisense	SNORD116-2	HGNC	processed_transcript	OTTHUMT00000408278.2	0	0	0	142	142	24	0.00	0.00	G			25299398	+1	18	11	67	23	tier1	no_errors	ENST00000384274	ensembl	human	known	74_37	rna	21.18	32.35	SNP	1.000	C	18	67
SH3RF2	153769	genome.wustl.edu	37	5	145428732	145428732	+	Missense_Mutation	SNP	G	G	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr5:145428732G>T	ENST00000511217.1	+	6	1298	c.1246G>T	c.(1246-1248)Ggc>Tgc	p.G416C	SH3RF2_ENST00000359120.4_Missense_Mutation_p.G416C			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	416	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTGCCAGGACGGCTGGCTCAG	0.597											OREG0016895	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000156463																																					0													65.0	66.0	65.0					5																	145428732		2203	4300	6503	SO:0001583	missense	0			-	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1246G>T	5.37:g.145428732G>T	ENSP00000424497:p.Gly416Cys	1694	A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_SH3_domain	p.G416C	ENST00000511217.1	37	c.1246	CCDS4280.1	5	.	.	.	.	.	.	.	.	.	.	G	31	5.061270	0.93846	.	.	ENSG00000156463	ENST00000359120;ENST00000511217	T;T	0.43688	0.94;0.94	5.51	5.51	0.81932	Src homology-3 domain (4);	0.070489	0.64402	D	0.000018	T	0.77246	0.4102	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.85244	0.1040	10	0.87932	D	0	-25.1307	18.1751	0.89759	0.0:0.0:1.0:0.0	.	416	Q8TEC5	SH3R2_HUMAN	C	416	ENSP00000352028:G416C;ENSP00000424497:G416C	ENSP00000352028:G416C	G	+	1	0	SH3RF2	145408925	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.687000	0.98667	2.587000	0.87381	0.484000	0.47621	GGC	-	SH3RF2	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.597	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SH3RF2	HGNC	protein_coding	OTTHUMT00000372804.1	0	0	0	73	73	35	0.00	0.00	G	NM_152550		145428732	+1	28	7	46	31	tier1	no_errors	ENST00000359120	ensembl	human	known	74_37	missense	37.84	18.42	SNP	1.000	T	28	46
HCK	3055	genome.wustl.edu	37	20	30662496	30662496	+	Missense_Mutation	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr20:30662496G>A	ENST00000520553.1	+	5	583	c.337G>A	c.(337-339)Gcc>Acc	p.A113T	HCK_ENST00000534862.1_Missense_Mutation_p.A114T|HCK_ENST00000538448.1_Missense_Mutation_p.A113T|HCK_ENST00000518730.1_Missense_Mutation_p.A112T|HCK_ENST00000375862.2_Missense_Mutation_p.A133T|HCK_ENST00000375852.2_Missense_Mutation_p.A134T	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	134	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	CAACTATGTCGCCCGCGTTGA	0.547													ENSG00000101336																																					0													108.0	104.0	105.0					20																	30662496		2203	4300	6503	SO:0001583	missense	0			-	AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.337G>A	20.37:g.30662496G>A	ENSP00000429848:p.Ala113Thr		A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.A134T	ENST00000520553.1	37	c.400	CCDS54455.1	20	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777384	0.90195	.	.	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98	4.98	4.01	0.46588	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.28699	0.0711	L	0.48935	1.535	0.52099	D	0.999944	D;D	0.64830	0.994;0.981	P;P	0.52189	0.692;0.549	T	0.02150	-1.1205	10	0.72032	D	0.01	.	12.902	0.58130	0.0801:0.0:0.9199:0.0	.	112;134	P08631-3;P08631	.;HCK_HUMAN	T	114;113;133;113;112;134	ENSP00000444986:A114T;ENSP00000441169:A113T;ENSP00000365022:A133T;ENSP00000429848:A113T;ENSP00000427757:A112T;ENSP00000365012:A134T	ENSP00000365012:A134T	A	+	1	0	HCK	30126157	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.807000	0.86032	2.584000	0.87258	0.563000	0.77884	GCC	-	HCK	-	pfam_SH3_2,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain		0.547	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	HCK	HGNC	protein_coding	OTTHUMT00000375751.1	0	0	0	77	77	83	0.00	0.00	G			30662496	+1	15	22	45	42	tier1	no_errors	ENST00000375852	ensembl	human	known	74_37	missense	25.00	34.38	SNP	1.000	A	15	45
CNTD2	79935	genome.wustl.edu	37	19	40729532	40729532	+	Intron	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:40729532G>A	ENST00000430325.2	-	4	562				CNTD2_ENST00000513948.1_Intron|CNTD2_ENST00000433940.1_Silent_p.N147N	NM_024877.3	NP_079153.2	Q9H8S5	CNTD2_HUMAN	cyclin N-terminal domain containing 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					lung(1)|prostate(1)	2						aaggccccaagttccggacct	0.592													ENSG00000105219																																					0													77.0	76.0	77.0					19																	40729532		2203	4300	6503	SO:0001627	intron_variant	0			-	AK023327	CCDS12551.1, CCDS12551.2	19q13.2	2014-07-03				ENSG00000105219			25805	protein-coding gene	gene with protein product	"""cyclin P"""					11237006	Standard	NM_024877		Approved	FLJ13265, CCNP	uc010xvi.2	Q9H8S5		ENST00000430325.2:c.514-79C>T	19.37:g.40729532G>A			B4DX65	Silent	SNP	pfam_Cyclin_N,superfamily_Cyclin-like	p.N147	ENST00000430325.2	37	c.441	CCDS12551.2	19																																																																																			-	CNTD2	-	NULL		0.592	CNTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTD2	HGNC	protein_coding	OTTHUMT00000360785.1	0	0	0	49	49	97	0.00	0.00	G	NM_024877		40729532	-1	11	24	14	43	tier1	no_errors	ENST00000221818	ensembl	human	known	74_37	silent	44.00	35.82	SNP	0.000	A	11	14
ASPN	54829	genome.wustl.edu	37	9	95236911	95236911	+	Missense_Mutation	SNP	T	T	G			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr9:95236911T>G	ENST00000375544.3	-	2	512	c.269A>C	c.(268-270)gAt>gCt	p.D90A	ASPN_ENST00000450139.2_Missense_Mutation_p.D62A|ASPN_ENST00000375543.1_Missense_Mutation_p.D90A|ASPN_ENST00000395538.3_Missense_Mutation_p.D90A|CENPP_ENST00000375587.3_Intron	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	90	Cys-rich.|LRRNT.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						CTTACCTAAATCTGAGCAATG	0.323													ENSG00000106819																																					0													93.0	86.0	89.0					9																	95236911		2203	4300	6503	SO:0001583	missense	0			-	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.269A>C	9.37:g.95236911T>G	ENSP00000364694:p.Asp90Ala		Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pirsf_SLRP_I_decor/aspor/byglycan	p.D90A	ENST00000375544.3	37	c.269		9	.	.	.	.	.	.	.	.	.	.	T	23.5	4.421685	0.83559	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538;ENST00000450139	D;D;D;D	0.96716	-4.1;-4.1;-4.1;-4.1	5.3	5.3	0.74995	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97028	0.9029	L	0.42529	1.33	0.45490	D	0.998452	D;D	0.89917	0.999;1.0	D;D	0.91635	0.986;0.999	D	0.97945	1.0328	10	0.87932	D	0	.	15.5593	0.76229	0.0:0.0:0.0:1.0	.	90;90	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	A	90;90;90;62	ENSP00000364694:D90A;ENSP00000364693:D90A;ENSP00000378909:D90A;ENSP00000389902:D62A	ENSP00000364693:D90A	D	-	2	0	ASPN	94276732	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	6.810000	0.75216	2.153000	0.67306	0.528000	0.53228	GAT	-	ASPN	-	pfam_LRR-contain_N,smart_LRR-contain_N,pirsf_SLRP_I_decor/aspor/byglycan		0.323	ASPN-001	KNOWN	basic|appris_principal	protein_coding	ASPN	HGNC	protein_coding	OTTHUMT00000053094.1	0	0	0	36	36	77	0.00	0.00	T	NM_017680		95236911	-1	13	22	23	53	tier1	no_errors	ENST00000375544	ensembl	human	known	74_37	missense	36.11	29.33	SNP	1.000	G	13	23
PTH2R	5746	genome.wustl.edu	37	2	209302606	209302606	+	Splice_Site	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr2:209302606G>A	ENST00000272847.2	+	4	624	c.411G>A	c.(409-411)aaG>aaA	p.K137K	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	137					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	GCATAGGAAAGGTAATGGAAT	0.363													ENSG00000144407																																					0													82.0	80.0	81.0					2																	209302606		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.411+1G>A	2.37:g.209302606G>A			Q8N429	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.K137	ENST00000272847.2	37	c.411	CCDS2383.1	2																																																																																			-	PTH2R	-	NULL		0.363	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2R	HGNC	protein_coding	OTTHUMT00000256519.2	0	0	0	40	40	62	0.00	0.00	G	NM_005048	Silent	209302606	+1	7	12	12	33	tier1	no_errors	ENST00000272847	ensembl	human	known	74_37	silent	36.84	26.67	SNP	1.000	A	7	12
SUSD1	64420	genome.wustl.edu	37	9	114919796	114919797	+	Frame_Shift_Ins	INS	-	-	GAGG			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	-	-	-	GAGG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr9:114919796_114919797insGAGG	ENST00000374270.3	-	2	372_373	c.200_201insCCTC	c.(199-201)gggfs	p.-67fs	SUSD1_ENST00000374263.3_Frame_Shift_Ins_p.-67fs|SUSD1_ENST00000374264.2_Frame_Shift_Ins_p.-67fs	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1							integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						ACTGAGTCCTCCCGTTCCCTAC	0.436													ENSG00000106868																																					0																																										SO:0001589	frameshift_variant	0				AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.200_201insCCTC	9.37:g.114919796_114919797insGAGG	ENSP00000363388:p.Gly67fs		A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Frame_Shift_Ins	INS	pfam_EGF-like_Ca-bd_dom,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP	p.R68fs	ENST00000374270.3	37	c.201_200	CCDS6783.1	9																																																																																				SUSD1	-	smart_EG-like_dom,pfscan_EG-like_dom		0.436	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD1	HGNC	protein_coding	OTTHUMT00000053668.3	0	0	0	80	80	97	0.00	0.00	-	NM_022486		114919797	-1	13	23	42	84	tier1	no_errors	ENST00000374264	ensembl	human	known	74_37	frame_shift_ins	23.64	21.50	INS	1.000:1.000	GAGG	13	42
AGTR1	185	genome.wustl.edu	37	3	148459421	148459422	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	AT	AT	AT	-	AT	AT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr3:148459421_148459422delAT	ENST00000497524.1	+	2	990_991	c.599_600delAT	c.(598-600)aatfs	p.N200fs	AGTR1_ENST00000542281.1_Frame_Shift_Del_p.N200fs|AGTR1_ENST00000402260.1_Frame_Shift_Del_p.N200fs|AGTR1_ENST00000461609.1_Frame_Shift_Del_p.N200fs|AGTR1_ENST00000349243.3_Frame_Shift_Del_p.N200fs|AGTR1_ENST00000404754.2_Frame_Shift_Del_p.N200fs|AGTR1_ENST00000474935.1_Frame_Shift_Del_p.N200fs|AGTR1_ENST00000418473.2_Frame_Shift_Del_p.N200fs|AGTR1_ENST00000475347.1_Frame_Shift_Del_p.N200fs	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	200					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)			breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	CTGACCAAAAATATACTGGGTT	0.376													ENSG00000144891																																					0																																										SO:0001589	frameshift_variant	0				M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.599_600delAT	3.37:g.148459423_148459424delAT	ENSP00000419422:p.Asn200fs		Q13725|Q8TBK4	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ATII_AT1_rcpt,prints_ATII_rcpt,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Formyl_pep_rcpt,prints_Brdyknn_rcpt	p.I201fs	ENST00000497524.1	37	c.599_600	CCDS3137.1	3																																																																																				AGTR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ATII_rcpt,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt		0.376	AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGTR1	HGNC	protein_coding	OTTHUMT00000355807.1	0	0	0	24	24	102	0.00	0.00	AT			148459422	+1	7	21	27	83	tier1	no_errors	ENST00000349243	ensembl	human	known	74_37	frame_shift_del	20.59	20.19	DEL	1.000:0.996	-	7	27
GATAD2A	54815	genome.wustl.edu	37	19	19576217	19576218	+	In_Frame_Ins	INS	-	-	GAC			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	-	-	-	GAC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:19576217_19576218insGAC	ENST00000360315.3	+	2	375_376	c.63_64insGAC	c.(64-66)gac>GACgac	p.22_22D>DD	GATAD2A_ENST00000404158.1_In_Frame_Ins_p.22_22D>DD|GATAD2A_ENST00000429563.2_5'Flank|GATAD2A_ENST00000358713.3_In_Frame_Ins_p.22_22D>DD|GATAD2A_ENST00000252577.5_In_Frame_Ins_p.22_22D>DD|GATAD2A_ENST00000537887.1_5'UTR	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	22					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						ACCCAACAGAGGACGATGTGGA	0.495													ENSG00000167491																																					0																																										SO:0001652	inframe_insertion	0				AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.64_66dupGAC	19.37:g.19576218_19576220dupGAC	ENSP00000353463:p.Asp23dup		B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	In_Frame_Ins	INS	pfam_Znf_GATA,pfscan_Znf_GATA	p.23in_frame_insD	ENST00000360315.3	37	c.63_64	CCDS12402.2	19																																																																																				GATAD2A	-	NULL		0.495	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATAD2A	HGNC	protein_coding	OTTHUMT00000326671.4	0	0	0	60	60	71	0.00	0.00	-	NM_017660		19576218	+1	6	23	22	66	tier1	no_errors	ENST00000358713	ensembl	human	known	74_37	in_frame_ins	21.43	25.84	INS	0.001:0.346	GAC	6	22
PLGRKT	55848	genome.wustl.edu	37	9	5361821	5361822	+	In_Frame_Ins	INS	-	-	ACC	rs371386035		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	-	-	-	ACC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr9:5361821_5361822insACC	ENST00000223864.2	-	4	369_370	c.148_149insGGT	c.(148-150)tct>tGGTct	p.49_50insW	PLGRKT_ENST00000482696.1_5'UTR	NM_018465.3	NP_060935.2	Q9HBL7	PLRKT_HUMAN	plasminogen receptor, C-terminal lysine transmembrane protein	49					chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of plasminogen activation (GO:0010756)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)											GAATTCCCGAGACCACGCAATC	0.396													ENSG00000107020																																					0																																										SO:0001652	inframe_insertion	0				AF225420	CCDS6463.1	9p24.1	2012-04-12	2012-04-12	2012-04-12	ENSG00000107020	ENSG00000107020			23633	protein-coding gene	gene with protein product	"""uncharacterized hematopoietic stem/progenitor cells protein MDS030"", ""plasminogen receptor with a C-terminal lysine"""		"""chromosome 9 open reading frame 46"""	C9orf46		12477932	Standard	NM_018465		Approved	MDS030, FLJ14688, AD025, Plg-RKT	uc003zjc.3	Q9HBL7	OTTHUMG00000019501	ENST00000223864.2:c.146_148dupGGT	9.37:g.5361822_5361824dupACC	ENSP00000223864:p.Trp49_Trp49dup		B2R6W0|Q9NZ44	In_Frame_Ins	INS	pfam_DUF2368	p.50in_frame_insW	ENST00000223864.2	37	c.149_148	CCDS6463.1	9																																																																																				PLGRKT	-	pfam_DUF2368		0.396	PLGRKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLGRKT	HGNC	protein_coding	OTTHUMT00000051626.1	0	0	0	75	75	72	0.00	0.00	-	NM_018465		5361822	-1	10	10	47	56	tier1	no_errors	ENST00000223864	ensembl	human	known	74_37	in_frame_ins	17.54	15.15	INS	1.000:1.000	ACC	10	47
PCDHB17	54661	genome.wustl.edu	37	5	140536810	140536813	+	Frame_Shift_Del	DEL	AGAG	AGAG	-			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	AGAG	AGAG	AGAG	-	AGAG	AGAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr5:140536810_140536813delAGAG	ENST00000539533.1	+	1	1234_1237	c.1234_1237delAGAG	c.(1234-1239)agagagfs	p.RE412fs						protocadherin beta 17 pseudogene																		AGCGCTAGACAGAGAGAGCAGGGC	0.466													ENSG00000255622																																					0																																										SO:0001589	frameshift_variant	0				AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.1234_1237delAGAG	5.37:g.140536814_140536817delAGAG	ENSP00000438685:p.Arg412fs			Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E413fs	ENST00000539533.1	37	c.1234_1237		5																																																																																				PCDHB17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.466	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000255622	Uniprot_gn	protein_coding		0	0	0	91	91	52	0.00	0.00	AGAG			140536813	+1	18	18	54	50	tier1	no_errors	ENST00000539533	ensembl	human	known	74_37	frame_shift_del	25.00	26.47	DEL	1.000:1.000:1.000:1.000	-	18	54
APOB	338	genome.wustl.edu	37	2	21234572	21234572	+	Missense_Mutation	SNP	C	C	A	rs570383610		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr2:21234572C>A	ENST00000233242.1	-	26	5295	c.5168G>T	c.(5167-5169)aGc>aTc	p.S1723I		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1723					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATGTTTTTGCTGTCGACACC	0.438													ENSG00000084674	C|||	1	0.000199681	0.0	0.0	5008	,	,		22494	0.0		0.0	False		,,,				2504	0.001																0													216.0	204.0	208.0					2																	21234572		2203	4300	6503	SO:0001583	missense	0			-	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5168G>T	2.37:g.21234572C>A	ENSP00000233242:p.Ser1723Ile		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.S1723I	ENST00000233242.1	37	c.5168	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	17.53	3.412940	0.62511	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00922	5.54	5.97	5.97	0.96955	.	0.077165	0.56097	D	0.000037	T	0.04182	0.0116	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.29088	-1.0023	10	0.72032	D	0.01	.	14.0212	0.64555	0.0:0.9226:0.0:0.0774	.	1723	P04114	APOB_HUMAN	I	1723	ENSP00000233242:S1723I	ENSP00000233242:S1723I	S	-	2	0	APOB	21088077	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.993000	0.29680	2.834000	0.97654	0.650000	0.86243	AGC	-	APOB	-	NULL		0.438	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	0	0	0	90	90	67	0.00	0.00	C			21234572	-1	6	4	59	53	tier1	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	9.23	7.02	SNP	1.000	A	6	59
SCN11A	11280	genome.wustl.edu	37	3	38950624	38950624	+	Missense_Mutation	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr3:38950624G>A	ENST00000302328.3	-	9	1361	c.1163C>T	c.(1162-1164)tCc>tTc	p.S388F	SCN11A_ENST00000456224.3_Missense_Mutation_p.S388F|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000450244.1_Missense_Mutation_p.S388F|SCN11A_ENST00000444237.2_Missense_Mutation_p.S388F	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	388					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGGTAGAAGGAGCCCAGGAA	0.448													ENSG00000168356																																					0													165.0	160.0	162.0					3																	38950624		2203	4300	6503	SO:0001583	missense	0			-	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1163C>T	3.37:g.38950624G>A	ENSP00000307599:p.Ser388Phe		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.S388F	ENST00000302328.3	37	c.1163	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890241	0.91889	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.97620	-4.46;-4.46;-4.46;-4.46	5.2	5.2	0.72013	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99036	0.9670	H	0.96175	3.78	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.99399	1.0927	10	0.87932	D	0	.	18.7324	0.91739	0.0:0.0:1.0:0.0	.	388	Q9UI33	SCNBA_HUMAN	F	388	ENSP00000307599:S388F;ENSP00000400945:S388F;ENSP00000416757:S388F;ENSP00000408028:S388F	ENSP00000307599:S388F	S	-	2	0	SCN11A	38925628	1.000000	0.71417	0.988000	0.46212	0.964000	0.63967	9.869000	0.99810	2.431000	0.82371	0.460000	0.39030	TCC	-	SCN11A	-	pfam_Ion_trans_dom		0.448	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	0	0	0	62	62	114	0.00	0.00	G	NM_014139		38950624	-1	7	9	53	82	tier1	no_errors	ENST00000302328	ensembl	human	known	74_37	missense	11.67	9.89	SNP	1.000	A	7	53
FCGBP	8857	genome.wustl.edu	37	19	40363158	40363158	+	Missense_Mutation	SNP	A	A	G			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:40363158A>G	ENST00000221347.6	-	32	14919	c.14912T>C	c.(14911-14913)cTc>cCc	p.L4971P		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4971	VWFD 12. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GATGGACATGAGGAGGTGGGC	0.627													ENSG00000090920																																					0													40.0	45.0	44.0					19																	40363158		2203	4300	6503	SO:0001583	missense	0			-	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14912T>C	19.37:g.40363158A>G	ENSP00000221347:p.Leu4971Pro		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.L4971P	ENST00000221347.6	37	c.14912	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	A	8.872	0.949466	0.18356	.	.	ENSG00000090920	ENST00000221347	T	0.59224	0.28	4.9	4.9	0.64082	von Willebrand factor, type D domain (3);	0.328024	0.24479	U	0.038176	T	0.71333	0.3327	M	0.78456	2.415	0.40552	D	0.981124	P	0.45827	0.867	P	0.58820	0.846	T	0.72944	-0.4138	10	0.42905	T	0.14	.	10.8302	0.46656	1.0:0.0:0.0:0.0	.	4971	Q9Y6R7	FCGBP_HUMAN	P	4971	ENSP00000221347:L4971P	ENSP00000221347:L4971P	L	-	2	0	FCGBP	45054998	0.000000	0.05858	0.968000	0.41197	0.080000	0.17528	0.156000	0.16382	2.069000	0.61940	0.260000	0.18958	CTC	-	FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D		0.627	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	0	0	0	97	97	39	0.00	0.00	A	NM_003890		40363158	-1	11	4	77	44	tier1	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	12.50	8.33	SNP	0.519	G	11	77
NUAK1	9891	genome.wustl.edu	37	12	106460789	106460789	+	Missense_Mutation	SNP	G	G	A			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr12:106460789G>A	ENST00000261402.2	-	7	3156	c.1777C>T	c.(1777-1779)Cct>Tct	p.P593S		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	593					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						TGGCGGGCAGGGCGATTCTCC	0.617													ENSG00000074590																																					0													28.0	35.0	33.0					12																	106460789		2203	4300	6503	SO:0001583	missense	0			-	AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.1777C>T	12.37:g.106460789G>A	ENSP00000261402:p.Pro593Ser		A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P593S	ENST00000261402.2	37	c.1777	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402191	0.42613	.	.	ENSG00000074590	ENST00000261402	T	0.74842	-0.88	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000012	T	0.63686	0.2532	L	0.35644	1.08	0.45567	D	0.99851	B	0.31077	0.307	B	0.29176	0.099	T	0.59263	-0.7487	10	0.20519	T	0.43	.	13.5245	0.61586	0.071:0.0:0.929:0.0	.	593	O60285	NUAK1_HUMAN	S	593	ENSP00000261402:P593S	ENSP00000261402:P593S	P	-	1	0	NUAK1	104984919	1.000000	0.71417	0.093000	0.20910	0.962000	0.63368	3.389000	0.52516	2.814000	0.96858	0.563000	0.77884	CCT	-	NUAK1	-	NULL		0.617	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	0	0	0	46	46	26	0.00	0.00	G	NM_014840		106460789	-1	10	7	112	83	tier1	no_errors	ENST00000261402	ensembl	human	known	74_37	missense	8.20	7.78	SNP	0.910	A	10	112
TRAPPC9	83696	genome.wustl.edu	37	8	140998965	140998965	+	Missense_Mutation	SNP	C	C	G			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr8:140998965C>G	ENST00000438773.2	-	19	2912	c.2779G>C	c.(2779-2781)Gca>Cca	p.A927P	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.A1025P|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.A918P	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	927					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						AGGATGAGTGCCTCGCTGCTC	0.612													ENSG00000167632																																					0													27.0	24.0	25.0					8																	140998965		1951	3728	5679	SO:0001583	missense	0			-	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2779G>C	8.37:g.140998965C>G	ENSP00000405060:p.Ala927Pro		Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	pfam_TRAPP_II_complex_Trs120	p.A1025P	ENST00000438773.2	37	c.3073	CCDS55278.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.10|13.10	2.135263|2.135263	0.37728|0.37728	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773|ENST00000520857	.|.	.|.	.|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	0.173961|.	0.48286|.	D|.	0.000198|.	T|T	0.36054|0.36054	0.0953|0.0953	N|N	0.08118|0.08118	0|0	0.32185|0.32185	N|N	0.57981|0.57981	B;B;B;B|.	0.30937|.	0.301;0.003;0.013;0.256|.	B;B;B;B|.	0.29440|.	0.102;0.002;0.004;0.099|.	T|T	0.39121|0.39121	-0.9629|-0.9629	9|5	0.29301|.	T|.	0.29|.	.|.	17.92|17.92	0.88963|0.88963	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1025;927;918;1025|.	A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2|.	.;TPPC9_HUMAN;.;.|.	P|A	1025;918;927|770	.|.	ENSP00000373978:A918P|.	A|G	-|-	1|2	0|0	TRAPPC9|TRAPPC9	141068147|141068147	1.000000|1.000000	0.71417|0.71417	0.441000|0.441000	0.26858|0.26858	0.028000|0.028000	0.11728|0.11728	6.960000|6.960000	0.76036|0.76036	2.574000|2.574000	0.86865|0.86865	0.655000|0.655000	0.94253|0.94253	GCA|GGC	-	TRAPPC9	-	NULL		0.612	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	0	0	0	78	78	7	0.00	0.00	C	NM_031466		140998965	-1	6	0	51	6	tier1	no_errors	ENST00000389328	ensembl	human	known	74_37	missense	10.53	0.00	SNP	0.997	G	6	51
ACRC	93953	genome.wustl.edu	37	X	70823836	70823836	+	Missense_Mutation	SNP	G	G	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chrX:70823836G>T	ENST00000373695.1	+	7	1246	c.709G>T	c.(709-711)Gac>Tac	p.D237Y	ACRC_ENST00000373696.3_Missense_Mutation_p.D237Y			Q96QF7	ACRC_HUMAN	acidic repeat containing	237	Asp/Ser-rich.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					TGTTCCCGACGACAGCAGTGA	0.537													ENSG00000147174																																					0													234.0	201.0	212.0					X																	70823836		2203	4299	6502	SO:0001583	missense	0			-	AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.709G>T	X.37:g.70823836G>T	ENSP00000362799:p.Asp237Tyr		B9EG62	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain	p.D237Y	ENST00000373695.1	37	c.709	CCDS35326.1	X	.	.	.	.	.	.	.	.	.	.	-	5.231	0.228193	0.09916	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.42513	0.97;0.97	0.131	0.131	0.14755	.	.	.	.	.	T	0.23249	0.0562	N	0.19112	0.55	0.09310	N	1	B	0.21688	0.059	B	0.14578	0.011	T	0.22626	-1.0211	9	0.87932	D	0	.	2.9116	0.05739	2.0E-4:2.0E-4:0.5072:0.4923	.	237	Q96QF7	ACRC_HUMAN	Y	237	ENSP00000362800:D237Y;ENSP00000362799:D237Y	ENSP00000362799:D237Y	D	+	1	0	ACRC	70740561	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	-1.040000	0.03546	0.157000	0.19338	0.158000	0.16466	GAC	-	ACRC	-	NULL		0.537	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACRC	HGNC	protein_coding	OTTHUMT00000081856.1	0	0	0	95	95	0	0.00	0.00	G			70823836	+1	28	0	53	0	tier1	no_errors	ENST00000373695	ensembl	human	known	74_37	missense	34.57	0.00	SNP	0.014	T	28	53
TNFSF15	9966	genome.wustl.edu	37	9	117554505	117554510	+	Intron	DEL	ACACAC	ACACAC	-	rs112858578|rs142936750|rs370583345|rs113508621		TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	ACACAC	ACACAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr9:117554505_117554510delACACAC	ENST00000374045.4	-	3	415				TNFSF15_ENST00000374044.1_5'Flank|AL390240.1_ENST00000408807.1_RNA	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						ataTGTGTGTacacacacacacacac	0.383													ENSG00000221734																																					0																																										SO:0001627	intron_variant	0				AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.301+176GTGTGT>-	9.37:g.117554511_117554516delACACAC			Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	R	DEL	-	NULL	ENST00000374045.4	37	NULL	CCDS6809.1	9																																																																																				AL390240.1	-	-		0.383	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221734	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000055424.2	0	0	0	0	0	0	0.00	0.00	ACACAC	NM_005118		117554510	+1	0	0	0	0	tier1	no_errors	ENST00000408807	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.007:0.007:0.010:0.012:0.014:0.015	-	0	0
RP11-989E6.10	0	genome.wustl.edu	37	16	33347801	33347817	+	lincRNA	DEL	GGCCAGGGCAAAGGTAT	GGCCAGGGCAAAGGTAT	-	rs551665044|rs375995085|rs192005071|rs60989965	byFrequency	TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	GGCCAGGGCAAAGGTAT	GGCCAGGGCAAAGGTAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr16:33347801_33347817delGGCCAGGGCAAAGGTAT	ENST00000568752.1	-	0	462_478				RP11-23E10.2_ENST00000568893.1_lincRNA																							ccggggtccaggccagggcaaaggtatggccagggca	0.677													ENSG00000261200																																					0																																												0																																16.37:g.33347801_33347817delGGCCAGGGCAAAGGTAT				R	DEL	-	NULL	ENST00000568752.1	37	NULL		16																																																																																				RP11-989E6.10	-	-		0.677	RP11-989E6.10-001	KNOWN	basic	lincRNA	ENSG00000261200	Clone_based_vega_gene	lincRNA	OTTHUMT00000432131.1	0	0	0	0	0	0	0.00	0.00	GGCCAGGGCAAAGGTAT			33347817	-1	0	0	0	0	tier1	no_errors	ENST00000568752	ensembl	human	known	74_37	rna	0.00	0.00	DEL	1.000:1.000:0.994:0.992:0.993:0.994:0.989:0.989:0.979:0.981:0.984:0.980:0.974:0.965:0.953:0.941:0.945	-	0	0
MIR3156-3	100423018	genome.wustl.edu	37	21	14778717	14778717	+	RNA	SNP	G	G	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr21:14778717G>T	ENST00000580304.1	-	0	64					NR_036164.1				microRNA 3156-3																		CAGAGAGAAAGATCAGGAAGT	0.383													ENSG00000266211																																					0																																												0			-			21	2011-09-12				ENSG00000266211		"""ncRNAs / Micro RNAs"""	38229	non-coding RNA	RNA, micro							Standard	NR_036164		Approved	hsa-mir-3156-3	uc021whb.1				21.37:g.14778717G>T				R	SNP	-	NULL	ENST00000580304.1	37	NULL		21																																																																																			-	MIR3156-3	-	-		0.383	MIR3156-3-201	KNOWN	basic	miRNA	MIR3156-3	HGNC	miRNA		0	0	0	42	42	1	0.00	0.00	G	NR_036164		14778717	-1	10	1	9	1	tier1	no_errors	ENST00000580304	ensembl	human	known	74_37	rna	52.63	50.00	SNP	0.006	T	10	9
MNX1	3110	genome.wustl.edu	37	7	156803795	156803795	+	5'Flank	SNP	G	G	T			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr7:156803795G>T	ENST00000252971.6	-	0	0				MNX1_ENST00000469500.1_5'Flank|MNX1_ENST00000543409.1_5'Flank|MNX1-AS1_ENST00000480284.1_RNA	NM_005515.3	NP_005506.3	P50219	MNX1_HUMAN	motor neuron and pancreas homeobox 1						anatomical structure morphogenesis (GO:0009653)|diaphragm development (GO:0060539)|dorsal/ventral neural tube patterning (GO:0021904)|endocrine pancreas development (GO:0031018)|humoral immune response (GO:0006959)|motor neuron axon guidance (GO:0008045)|nerve development (GO:0021675)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGCCTTGCGGAGCGCGGTGG	0.706													ENSG00000243479																																					0																																										SO:0001631	upstream_gene_variant	0			-	AF107457	CCDS34788.1, CCDS55187.1	7q36	2012-03-09	2007-08-09	2007-08-09	ENSG00000130675	ENSG00000130675		"""Homeoboxes / ANTP class : HOXL subclass"""	4979	protein-coding gene	gene with protein product		142994	"""homeo box HB9"", ""homeobox HB9"""	HLXB9		9843207	Standard	NM_001165255		Approved	HB9, HOXHB9, SCRA1	uc003wmz.4	P50219	OTTHUMG00000157181		7.37:g.156803795G>T	Exception_encountered		F5H401|Q9Y648	R	SNP	-	NULL	ENST00000252971.6	37	NULL	CCDS34788.1	7																																																																																			-	MNX1-AS1	-	-		0.706	MNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNX1-AS1	HGNC	protein_coding	OTTHUMT00000347796.3	0	0	0	42	42	0	0.00	0.00	G			156803795	+1	6	0	42	3	tier1	no_errors	ENST00000480284	ensembl	human	known	74_37	rna	12.50	0.00	SNP	0.002	T	6	42
NUMBL	9253	genome.wustl.edu	37	19	41173893	41173898	+	In_Frame_Del	DEL	TGCTGT	TGCTGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	TGCTGT	TGCTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr19:41173893_41173898delTGCTGT	ENST00000252891.4	-	10	1472_1477	c.1305_1310delACAGCA	c.(1303-1311)caacagcag>cag	p.435_437QQQ>Q	NUMBL_ENST00000598779.1_In_Frame_Del_p.394_396QQQ>Q|NUMBL_ENST00000540131.1_In_Frame_Del_p.394_396QQQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgctgttgctgttgct	0.66													ENSG00000105245		2856	0.570288	0.7821	0.428	5008	,	,		15157	0.4653		0.5149	False		,,,				2504	0.5501																0																																										SO:0001651	inframe_deletion	0				AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1310delACAGCA	19.37:g.41173899_41173904delTGCTGT	ENSP00000252891:p.Gln445_Gln446del		Q7Z4J9	In_Frame_Del	DEL	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.QQ439in_frame_del	ENST00000252891.4	37	c.1310_1305	CCDS12561.1	19																																																																																				NUMBL	-	pirsf_Numb/numb-like		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2	0	0	0	0	0	0	0.00	0.00	TGCTGT	NM_004756		41173898	-1	1	1	0	0	tier1	no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	100.00	100.00	DEL	1.000:1.000:1.000:1.000:1.000:0.998	-	1	0
KMT2D	8085	genome.wustl.edu	37	12	49425667	49425667	+	Missense_Mutation	SNP	A	A	G			TCGA-PC-A5DN-01A-12D-A27P-09	TCGA-PC-A5DN-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	60581c5a-e89b-4e0e-bb80-20a3b14f4638	680014f0-e224-4d25-9929-02de0f4b2f44	g.chr12:49425667A>G	ENST00000301067.7	-	39	12820	c.12821T>C	c.(12820-12822)cTc>cCc	p.L4274P		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4274	Gln-rich.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TAGCTCCTGGAGGGGGCCTGT	0.687													ENSG00000167548																																					0													31.0	35.0	33.0					12																	49425667		1894	4108	6002	SO:0001583	missense	0			-	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.12821T>C	12.37:g.49425667A>G	ENSP00000301067:p.Leu4274Pro		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.L4274P	ENST00000301067.7	37	c.12821	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	A	3.288	-0.145563	0.06627	.	.	ENSG00000167548	ENST00000301067	T	0.79749	-1.3	4.93	1.36	0.22044	.	0.257566	0.20727	N	0.086800	T	0.56819	0.2011	N	0.08118	0	0.34435	D	0.698926	B	0.02656	0.0	B	0.04013	0.001	T	0.53892	-0.8374	10	0.87932	D	0	.	2.6079	0.04883	0.4799:0.0:0.3215:0.1986	.	4274	O14686	MLL2_HUMAN	P	4274	ENSP00000301067:L4274P	ENSP00000301067:L4274P	L	-	2	0	MLL2	47711934	0.998000	0.40836	0.800000	0.32199	0.891000	0.51852	0.950000	0.29122	0.433000	0.26313	-0.259000	0.10710	CTC	-	KMT2D	-	NULL		0.687	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	0	0	0	127	127	13	0.00	0.00	A			49425667	-1	22	2	76	21	tier1	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	22.45	8.70	SNP	0.378	G	22	76
