#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PPP2R5D	5528	genome.wustl.edu	37	6	42974819	42974819	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr6:42974819G>T	ENST00000485511.1	+	4	672	c.493G>T	c.(493-495)Gag>Tag	p.E165*	PPP2R5D_ENST00000461010.1_Nonsense_Mutation_p.E59*|PPP2R5D_ENST00000394110.3_Nonsense_Mutation_p.E133*|PPP2R5D_ENST00000472118.1_Nonsense_Mutation_p.E157*	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	165					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGTTGTCACTGAGGCCATTTA	0.572													ENSG00000112640																									Melanoma(63;587 1613 29742 31770)												0													111.0	102.0	105.0					6																	42974819		2203	4300	6503	SO:0001587	stop_gained	0			-	L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.493G>T	6.37:g.42974819G>T	ENSP00000417963:p.Glu165*		A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Nonsense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.E165*	ENST00000485511.1	37	c.493	CCDS4878.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.061686|5.061686	0.93846|0.93846	.|.	.|.	ENSG00000112640|ENSG00000112640	ENST00000485511;ENST00000394110;ENST00000472118;ENST00000541610;ENST00000461010|ENST00000470467	.|.	.|.	.|.	5.22|5.22	4.35|4.35	0.52113|0.52113	.|.	0.051441|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.87932|.	D|.	0|.	-19.4345|-19.4345	13.9416|13.9416	0.64059|0.64059	0.0728:0.0:0.9272:0.0|0.0728:0.0:0.9272:0.0	.|.	.|.	.|.	.|.	X|L	165;133;157;165;59|84	.|.	ENSP00000377669:E133X|.	E|X	+|+	1|2	0|2	PPP2R5D|PPP2R5D	43082797|43082797	1.000000|1.000000	0.71417|0.71417	0.930000|0.930000	0.37139|0.37139	0.900000|0.900000	0.52787|0.52787	9.657000|9.657000	0.98554|0.98554	1.436000|1.436000	0.47453|0.47453	-0.140000|-0.140000	0.14226|0.14226	GAG|TGA	-	PPP2R5D	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56		0.572	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP2R5D	HGNC	protein_coding	OTTHUMT00000040573.3	0	0		42	42		0.00		G	NM_006245		42974819	+1	3		14		tier1	no_errors	ENST00000485511	ensembl	human	known	74_37	nonsense	17.65		SNP	0.999	T	3	14
DHX35	60625	genome.wustl.edu	37	20	37617497	37617497	+	Silent	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr20:37617497C>T	ENST00000252011.3	+	5	420	c.387C>T	c.(385-387)ggC>ggT	p.G129G	DHX35_ENST00000373323.4_Silent_p.G98G|DHX35_ENST00000373325.2_Silent_p.G129G	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	129	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				CAGTGCTGGGCCACGAGGTGG	0.493													ENSG00000101452																																					0													110.0	104.0	106.0					20																	37617497		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.387C>T	20.37:g.37617497C>T			A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Silent	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G129	ENST00000252011.3	37	c.387	CCDS13310.1	20																																																																																			-	DHX35	-	pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.493	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX35	HGNC	protein_coding	OTTHUMT00000079212.2	0	0		28	28		0.00		C	NM_021931		37617497	+1	3		15		tier1	no_errors	ENST00000252011	ensembl	human	known	74_37	silent	16.67		SNP	1.000	T	3	15
ANKFN1	162282	genome.wustl.edu	37	17	54400786	54400786	+	Intron	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr17:54400786C>T	ENST00000318698.2	+	3	97				ANKFN1_ENST00000566473.2_Intron	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1											NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						CAAATAATTGCAGGCTTATGC	0.403													ENSG00000153930																																					0																																										SO:0001627	intron_variant	0			-	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.63-2796C>T	17.37:g.54400786C>T				R	SNP	-	NULL	ENST00000318698.2	37	NULL	CCDS32686.1	17																																																																																			-	ANKFN1	-	-		0.403	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKFN1	HGNC	protein_coding	OTTHUMT00000338043.1	0	0		22	22		0.00		C	NM_153228		54400786	+1	3		16		tier1	no_errors	ENST00000572312	ensembl	human	putative	74_37	rna	15.79		SNP	0.823	T	3	16
C9orf78	51759	genome.wustl.edu	37	9	132595850	132595850	+	Intron	DEL	T	T	-	rs147726772		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr9:132595850delT	ENST00000372447.3	-	4	249				USP20_ENST00000372429.3_5'Flank|C9orf78_ENST00000461762.1_5'UTR|USP20_ENST00000315480.4_5'Flank|USP20_ENST00000358355.1_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				GGTAGTGGAATTTTTTTTTTT	0.443													ENSG00000136819																																					0													93.0	74.0	80.0					9																	132595850		692	1591	2283	SO:0001627	intron_variant	0				BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.196-54A>-	9.37:g.132595850delT			B3KPX8|Q8WVU6|Q9NT39	R	DEL	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																				C9orf78	-	-		0.443	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	HGNC	protein_coding	OTTHUMT00000054625.1	0	0		32	32		0.00		T	NM_016520		132595850	-1	4		29		tier1	no_errors	ENST00000461762	ensembl	human	known	74_37	rna	12.12		DEL	0.032	-	4	29
SLK	9748	genome.wustl.edu	37	10	105762924	105762924	+	Missense_Mutation	SNP	A	A	G			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr10:105762924A>G	ENST00000369755.3	+	9	2533	c.1988A>G	c.(1987-1989)aAg>aGg	p.K663R	SLK_ENST00000335753.4_Missense_Mutation_p.K663R	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	663					apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		ACTGACCAAAAGGCTTTAGGA	0.393													ENSG00000065613																									NSCLC(111;540 1651 1927 4474 17706)												0													124.0	112.0	116.0					10																	105762924		2203	4300	6503	SO:0001583	missense	0			-		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.1988A>G	10.37:g.105762924A>G	ENSP00000358770:p.Lys663Arg		D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UVR_dom,pfscan_Prot_kinase_dom	p.K663R	ENST00000369755.3	37	c.1988	CCDS7553.1	10	.	.	.	.	.	.	.	.	.	.	A	2.745	-0.261374	0.05791	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.69435	-0.4;-0.4	5.6	4.43	0.53597	Protein kinase-like domain (1);	0.578287	0.18636	N	0.135438	T	0.46908	0.1417	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.27434	-1.0074	10	0.23891	T	0.37	.	6.9717	0.24652	0.7967:0.0:0.0712:0.132	.	663;663	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	R	663	ENSP00000336824:K663R;ENSP00000358770:K663R	ENSP00000336824:K663R	K	+	2	0	SLK	105752914	0.000000	0.05858	0.004000	0.12327	0.085000	0.17905	0.429000	0.21412	0.906000	0.36621	0.454000	0.30748	AAG	-	SLK	-	superfamily_Kinase-like_dom		0.393	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLK	HGNC	protein_coding	OTTHUMT00000050188.1	0	0		45	45		0.00		A	NM_014720		105762924	+1	3		27		tier1	no_errors	ENST00000369755	ensembl	human	known	74_37	missense	10.00		SNP	0.000	G	3	27
NBPF14	25832	genome.wustl.edu	37	1	148024804	148024804	+	Missense_Mutation	SNP	C	C	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:148024804C>A	ENST00000369219.1	-	2	209	c.193G>T	c.(193-195)Gat>Tat	p.D65Y				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	65						cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					TCCGGCTCATCCGGAGTGAGG	0.592													ENSG00000122497																																					0													10.0	16.0	14.0					1																	148024804		520	1872	2392	SO:0001583	missense	0			-	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.193G>T	1.37:g.148024804C>A	ENSP00000358221:p.Asp65Tyr		Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	pfam_NBPF_dom	p.D65Y	ENST00000369219.1	37	c.193		1	.	.	.	.	.	.	.	.	.	.	c	1.180	-0.638294	0.03557	.	.	ENSG00000122497	ENST00000369219	T	0.04119	3.7	.	.	.	.	.	.	.	.	T	0.05410	0.0143	M	0.76838	2.35	0.09310	N	1	D	0.67145	0.996	P	0.56700	0.804	T	0.24261	-1.0165	8	0.72032	D	0.01	.	2.8389	0.05523	0.0:0.5938:0.0:0.4062	.	65	Q5TI25	NBPFE_HUMAN	Y	65	ENSP00000358221:D65Y	ENSP00000358221:D65Y	D	-	1	0	NBPF14	146491428	0.002000	0.14202	0.010000	0.14722	0.334000	0.28698	0.466000	0.22019	0.429000	0.26202	0.064000	0.15345	GAT	-	NBPF14	-	NULL		0.592	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	NBPF14	HGNC	protein_coding		0	0		26	26		0.00		C	NM_015383		148024804	-1	14		78		tier1	no_errors	ENST00000369219	ensembl	human	known	74_37	missense	15.22		SNP	0.011	A	14	78
CABS1	85438	genome.wustl.edu	37	4	71201610	71201610	+	Missense_Mutation	SNP	T	T	C			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr4:71201610T>C	ENST00000273936.5	+	1	928	c.854T>C	c.(853-855)cTg>cCg	p.L285P		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	285					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GAAGATACTCTGCTAACTGAT	0.418													ENSG00000145309																																					0													103.0	97.0	99.0					4																	71201610		2203	4300	6503	SO:0001583	missense	0			-	AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.854T>C	4.37:g.71201610T>C	ENSP00000273936:p.Leu285Pro		B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.L285P	ENST00000273936.5	37	c.854	CCDS3539.1	4	.	.	.	.	.	.	.	.	.	.	T	6.897	0.535112	0.13188	.	.	ENSG00000145309	ENST00000273936	T	0.25085	1.82	3.92	-1.99	0.07457	.	1.478610	0.04506	N	0.382162	T	0.15998	0.0385	N	0.17082	0.46	0.18873	N	0.999983	B	0.11235	0.004	B	0.13407	0.009	T	0.31052	-0.9957	10	0.33940	T	0.23	-19.8969	8.2259	0.31568	0.0:0.3562:0.0:0.6438	.	285	Q96KC9	CABS1_HUMAN	P	285	ENSP00000273936:L285P	ENSP00000273936:L285P	L	+	2	0	CABS1	71236199	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.262000	0.08682	-0.280000	0.09154	-0.912000	0.02778	CTG	-	CABS1	-	NULL		0.418	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	CABS1	HGNC	protein_coding	OTTHUMT00000251561.3	0	0		49	49		0.00		T	NM_033122		71201610	+1	18		14		tier1	no_errors	ENST00000273936	ensembl	human	known	74_37	missense	56.25		SNP	0.000	C	18	14
SERHL2	253190	genome.wustl.edu	37	22	42970772	42970772	+	IGR	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr22:42970772C>T	ENST00000327678.5	+	0	1374				RRP7B_ENST00000357802.2_RNA	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2								hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						GGGCCCGCAGCAGCTCGATCC	0.662													ENSG00000182841																																					0																																										SO:0001628	intergenic_variant	0			-		CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892		22.37:g.42970772C>T			Q5JZ95|Q9UH21	R	SNP	-	NULL	ENST00000327678.5	37	NULL	CCDS14037.1	22																																																																																			-	RRP7B	-	-		0.662	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7B	HGNC	protein_coding	OTTHUMT00000320454.1	0	0		61	61		0.00		C	NM_014509		42970772	-1	4		21		tier1	no_errors	ENST00000357802	ensembl	human	known	74_37	rna	16.00		SNP	1.000	T	4	21
RP11-79P5.3	0	genome.wustl.edu	37	5	72706210	72706210	+	RNA	DEL	A	A	-			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr5:72706210delA	ENST00000505955.1	+	0	755																											TGGAGATGCCAAAACAGACCA	0.473													ENSG00000249149																																					0																																												0																																5.37:g.72706210delA				R	DEL	-	NULL	ENST00000505955.1	37	NULL		5																																																																																				RP11-79P5.3	-	-		0.473	RP11-79P5.3-002	KNOWN	basic	processed_transcript	ENSG00000249149	Clone_based_vega_gene	pseudogene	OTTHUMT00000471005.1	0	0		13	13		0.00		A			72706210	+1	2		11		tier1	no_errors	ENST00000505955	ensembl	human	known	74_37	rna	15.38		DEL	1.000	-	2	11
PLCB2	5330	genome.wustl.edu	37	15	40594507	40594507	+	Missense_Mutation	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr15:40594507G>A	ENST00000260402.3	-	5	665	c.416C>T	c.(415-417)aCg>aTg	p.T139M	PLCB2_ENST00000456256.2_Missense_Mutation_p.T139M|PLCB2_ENST00000543785.2_Missense_Mutation_p.T139M|PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000557821.1_Missense_Mutation_p.T139M	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	139					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GGCGTTGGCCGTCAGCGGATG	0.667													ENSG00000137841																																					0													40.0	47.0	45.0					15																	40594507		2134	4234	6368	SO:0001583	missense	0			-		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.416C>T	15.37:g.40594507G>A	ENSP00000260402:p.Thr139Met		A8K6J2|B9EGH5	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLC-beta_C,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.T139M	ENST00000260402.3	37	c.416	CCDS42020.1	15	.	.	.	.	.	.	.	.	.	.	G	10.85	1.465822	0.26335	.	.	ENSG00000137841	ENST00000260402;ENST00000456256;ENST00000543785	T;T;T	0.43294	0.95;0.95;0.95	4.46	2.58	0.30949	.	1.224140	0.05280	N	0.519228	T	0.36717	0.0977	L	0.40543	1.245	0.09310	N	0.999997	P;B;D;B	0.60575	0.848;0.181;0.988;0.017	B;B;B;B	0.41894	0.355;0.079;0.369;0.056	T	0.29579	-1.0007	10	0.49607	T	0.09	.	8.5092	0.33206	0.2397:0.0:0.7603:0.0	.	139;139;139;139	B9EGH5;Q00722-2;Q9BVT6;Q00722	.;.;.;PLCB2_HUMAN	M	139	ENSP00000260402:T139M;ENSP00000411991:T139M;ENSP00000444652:T139M	ENSP00000260402:T139M	T	-	2	0	PLCB2	38381799	0.969000	0.33509	0.243000	0.24186	0.138000	0.21146	1.911000	0.39937	0.631000	0.30412	-0.258000	0.10820	ACG	-	PLCB2	-	pirsf_PLC-beta		0.667	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCB2	HGNC	protein_coding	OTTHUMT00000418430.1	0	0		26	26		0.00		G			40594507	-1	12		14		tier1	no_errors	ENST00000260402	ensembl	human	known	74_37	missense	46.15		SNP	0.155	A	12	14
DMRT2	10655	genome.wustl.edu	37	9	1056545	1056545	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr9:1056545G>T	ENST00000358146.2	+	3	958	c.958G>T	c.(958-960)Gaa>Taa	p.E320*	DMRT2_ENST00000382255.3_3'UTR|DMRT2_ENST00000382251.3_Nonsense_Mutation_p.E320*|DMRT2_ENST00000302441.6_Nonsense_Mutation_p.E320*|DMRT2_ENST00000259622.6_3'UTR			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	320					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		TGGGAATATGGAACTAATTTC	0.468													ENSG00000173253																																					0													92.0	96.0	95.0					9																	1056545		2203	4300	6503	SO:0001587	stop_gained	0			-	AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.958G>T	9.37:g.1056545G>T	ENSP00000350865:p.Glu320*		B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Nonsense_Mutation	SNP	pfam_DM_D-bd,superfamily_DM_D-bd,smart_DM_D-bd,pfscan_DM_D-bd	p.E320*	ENST00000358146.2	37	c.958	CCDS6444.1	9	.	.	.	.	.	.	.	.	.	.	G	38	6.788311	0.97837	.	.	ENSG00000173253	ENST00000382251;ENST00000302441;ENST00000358146	.	.	.	5.62	5.62	0.85841	.	0.104696	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-20.041	19.2806	0.94051	0.0:0.0:1.0:0.0	.	.	.	.	X	320	.	ENSP00000305785:E320X	E	+	1	0	DMRT2	1046545	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.230000	0.95299	2.665000	0.90641	0.650000	0.86243	GAA	-	DMRT2	-	NULL		0.468	DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT2	HGNC	protein_coding	OTTHUMT00000051492.1	0	0		39	39		0.00		G	NM_006557		1056545	+1	4		34		tier1	no_errors	ENST00000302441	ensembl	human	known	74_37	nonsense	10.53		SNP	1.000	T	4	34
GPR143	4935	genome.wustl.edu	37	X	9711677	9711677	+	Missense_Mutation	SNP	G	G	A	rs137852297		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chrX:9711677G>A	ENST00000467482.1	-	6	841	c.695C>T	c.(694-696)aCg>aTg	p.T232M	GPR143_ENST00000380929.2_Missense_Mutation_p.T252M			P51810	GP143_HUMAN	G protein-coupled receptor 143	232	Necessary for its G protein-activation ability and normal distribution of melanosomes.		T -> K (in OA1; abnormal distribution of melanosomes; Not delivered at the cell surface of melanocytic and non- melanocytic cells). {ECO:0000269|PubMed:9529334}.		calcium-mediated signaling using intracellular calcium source (GO:0035584)|eye pigment biosynthetic process (GO:0006726)|G-protein coupled receptor signaling pathway (GO:0007186)|melanosome localization (GO:0032400)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuropeptide signaling pathway (GO:0007218)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of calcium-mediated signaling (GO:0050848)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|G-protein coupled receptor activity (GO:0004930)|L-DOPA binding (GO:0072544)|L-DOPA receptor activity (GO:0035643)|tyrosine binding (GO:0072545)			endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Hepatocellular(5;0.000888)				CTCGTTCTCCGTGTAAATGCC	0.383													ENSG00000101850																																					0			GRCh37	CM981400	GPR143	M	rs137852297						154.0	131.0	139.0					X																	9711677		2203	4300	6503	SO:0001583	missense	0			-	Z48804	CCDS14134.1, CCDS14134.2	Xp22.3	2013-09-27	2003-12-01		ENSG00000101850	ENSG00000101850		"""GPCR / Unclassified : 7TM orphan receptors"""	20145	protein-coding gene	gene with protein product	"""ocular albinism 1"""	300808	"""ocular albinism 1 (Nettleship-Falls)"""	OA1		7647783, 10471510	Standard	NM_000273		Approved		uc004cst.2	P51810	OTTHUMG00000021118	ENST00000467482.1:c.695C>T	X.37:g.9711677G>A	ENSP00000417161:p.Thr232Met		Q6NTI7	Missense_Mutation	SNP	pfam_Ocular_alb1,pfam_GPCR_2_secretin-like,prints_Ocular_alb1	p.T252M	ENST00000467482.1	37	c.755	CCDS14134.2	X	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263348	0.80358	.	.	ENSG00000101850	ENST00000467482;ENST00000380929;ENST00000431126	D;D;D	0.99329	-5.75;-5.75;-5.75	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.99375	0.9780	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98948	1.0793	10	0.72032	D	0.01	-10.3298	16.3904	0.83533	0.0:0.0:1.0:0.0	.	232	P51810	GP143_HUMAN	M	232;252;148	ENSP00000417161:T232M;ENSP00000370316:T252M;ENSP00000406138:T148M	ENSP00000370316:T252M	T	-	2	0	GPR143	9671677	1.000000	0.71417	0.657000	0.29651	0.834000	0.47266	8.316000	0.89985	2.124000	0.65301	0.513000	0.50165	ACG	-	GPR143	-	pfam_Ocular_alb1,pfam_GPCR_2_secretin-like		0.383	GPR143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR143	HGNC	protein_coding	OTTHUMT00000055714.2	0	0		47	47		0.00		G	NM_000273		9711677	-1	4		44		tier1	no_errors	ENST00000380929	ensembl	human	known	74_37	missense	8.33		SNP	1.000	A	4	44
NEXN	91624	genome.wustl.edu	37	1	78408542	78408543	+	3'UTR	INS	-	-	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:78408542_78408543insT	ENST00000334785.7	+	0	2240_2241				NEXN_ENST00000457030.1_Intron|NEXN_ENST00000330010.8_3'UTR|NEXN_ENST00000480732.2_3'UTR|FUBP1_ENST00000489495.1_5'Flank	NM_144573.3	NP_653174.3			nexilin (F actin binding protein)											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				Colorectal(170;0.114)		TATTCTATTAATTTTTTTTTCC	0.337													ENSG00000162614																																					0									,	10,3384		1,8,1688					,	4.1	0.0			21	37,7579		1,35,3772	no	utr-3,utr-3	NEXN	NM_144573.3,NM_001172309.1	,	2,43,5460	A1A1,A1R,RR		0.4858,0.2946,0.4269	,	,		47,10963				SO:0001624	3_prime_UTR_variant	0				AK057954	CCDS41351.1, CCDS53335.1	1p31.1	2014-09-17			ENSG00000162614	ENSG00000162614		"""Immunoglobulin superfamily / I-set domain containing"""	29557	protein-coding gene	gene with protein product		613121				12053183, 8227983	Standard	NM_144573		Approved	nexilin, NELIN	uc001dic.4	Q0ZGT2	OTTHUMG00000040533	ENST00000334785.7:c.*29->T	1.37:g.78408551_78408551dupT				R	INS	-	NULL	ENST00000334785.7	37	NULL	CCDS41351.1	1																																																																																				NEXN	-	-		0.337	NEXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEXN	HGNC	protein_coding	OTTHUMT00000097549.1	0	0		44	44		0.00		-	NM_144573		78408543	+1	3		13		tier1	no_errors	ENST00000480732	ensembl	human	known	74_37	rna	18.75		INS	0.007:0.000	T	3	13
ZNF285	26974	genome.wustl.edu	37	19	44892206	44892206	+	Silent	SNP	C	C	A	rs73557001		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr19:44892206C>A	ENST00000330997.4	-	4	265	c.201G>T	c.(199-201)tcG>tcT	p.S67S	ZNF285_ENST00000544719.2_Silent_p.S67S|ZNF285_ENST00000591679.1_Silent_p.S74S|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	67	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GCACTTCTTGCGAAAGGTAAC	0.413													ENSG00000267508																																					0													87.0	91.0	89.0					19																	44892206		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.201G>T	19.37:g.44892206C>A			Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S67	ENST00000330997.4	37	c.201	CCDS12638.1	19																																																																																			rs73557001	ZNF285	-	pfscan_Krueppel-associated_box		0.413	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	0	0		31	31		0.00		C	NM_152354		44892206	-1	6		19		tier1	no_errors	ENST00000330997	ensembl	human	known	74_37	silent	24.00		SNP	0.000	A	6	19
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000382968.5_Intron|RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619													ENSG00000178222																																					0																																										SO:0001627	intron_variant	0				AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC			C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																				RNF212	-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	HGNC	protein_coding	OTTHUMT00000359124.2									-	NM_194439		1087328	-1					tier1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins			INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC		
ENO1	2023	genome.wustl.edu	37	1	8925473	8925473	+	Missense_Mutation	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:8925473C>T	ENST00000234590.4	-	8	855	c.736G>A	c.(736-738)Gta>Ata	p.V246I		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	246					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GAGGCCGCTACGTCCATGCCG	0.552													ENSG00000074800																									Esophageal Squamous(21;302 608 19946 22210 33560)												0													108.0	96.0	100.0					1																	8925473		2203	4300	6503	SO:0001583	missense	0			-	BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.736G>A	1.37:g.8925473C>T	ENSP00000234590:p.Val246Ile		B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.V246I	ENST00000234590.4	37	c.736	CCDS97.1	1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.216459	0.58452	.	.	ENSG00000074800	ENST00000234590	T	0.55760	0.5	5.8	5.8	0.92144	Enolase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.59445	0.2194	M	0.73962	2.25	0.53005	D	0.999967	B;B;B;B	0.23249	0.048;0.048;0.039;0.082	B;B;B;B	0.27262	0.078;0.058;0.046;0.058	T	0.58792	-0.7574	10	0.66056	D	0.02	-20.2255	19.0419	0.93004	0.0:1.0:0.0:0.0	.	150;84;153;246	E2DRY6;Q9BT62;P06733-2;P06733	.;.;.;ENOA_HUMAN	I	246	ENSP00000234590:V246I	ENSP00000234590:V246I	V	-	1	0	ENO1	8848060	1.000000	0.71417	0.596000	0.28811	0.275000	0.26752	7.747000	0.85070	2.758000	0.94735	0.561000	0.74099	GTA	-	ENO1	-	pfam_Enolase_C,pirsf_Enolase,tigrfam_Enolase		0.552	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO1	HGNC	protein_coding	OTTHUMT00000004945.1	0	0		27	27		0.00		C	NM_001428		8925473	-1	3		9		tier1	no_errors	ENST00000234590	ensembl	human	known	74_37	missense	25.00		SNP	1.000	T	3	9
POGK	57645	genome.wustl.edu	37	1	166810314	166810314	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:166810314G>T	ENST00000367875.1	+	2	481	c.121G>T	c.(121-123)Gag>Tag	p.E41*	POGK_ENST00000536514.1_5'UTR|POGK_ENST00000537173.1_5'UTR|POGK_ENST00000367876.4_Nonsense_Mutation_p.E41*			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	41					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						AATCTGCTCTGAGGGCGGATG	0.537													ENSG00000143157																									GBM(76;192 1530 30153 48742)												0													77.0	71.0	73.0					1																	166810314		2203	4300	6503	SO:0001587	stop_gained	0			-	AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.121G>T	1.37:g.166810314G>T	ENSP00000356849:p.Glu41*		Q5TIJ1|Q8TE07	Nonsense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_Brinker_D-bd,pfam_HTH_CenpB_D-bd_dom,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Homeodomain-like,smart_Krueppel-associated_box,smart_HTH_CenpB_D-bd_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.E41*	ENST00000367875.1	37	c.121	CCDS1254.1	1	.	.	.	.	.	.	.	.	.	.	G	40	7.956638	0.98580	.	.	ENSG00000143157	ENST00000449930;ENST00000367876;ENST00000367875	.	.	.	5.34	5.34	0.76211	.	0.000000	0.51477	D	0.000088	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-38.6903	14.731	0.69383	0.0:0.0:1.0:0.0	.	.	.	.	X	41	.	ENSP00000356849:E41X	E	+	1	0	POGK	165076938	0.992000	0.36948	0.997000	0.53966	0.951000	0.60555	2.510000	0.45468	2.937000	0.99478	0.650000	0.86243	GAG	-	POGK	-	superfamily_Krueppel-associated_box		0.537	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	POGK	HGNC	protein_coding	OTTHUMT00000082888.1	0	0		31	31		0.00		G	NM_017542		166810314	+1	7		58		tier1	no_errors	ENST00000367875	ensembl	human	known	74_37	nonsense	10.77		SNP	0.999	T	7	58
RP11-443P15.2	0	genome.wustl.edu	37	3	185693044	185693044	+	RNA	DEL	T	T	-			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr3:185693044delT	ENST00000423298.1	+	0	476																											TCCAGAGGAATTTTTAGGCAA	0.438													ENSG00000171658																																					0																																												0																																3.37:g.185693044delT				R	DEL	-	NULL	ENST00000423298.1	37	NULL		3																																																																																				RP11-443P15.2	-	-		0.438	RP11-443P15.2-008	KNOWN	basic	processed_transcript	ENSG00000171658	Clone_based_vega_gene	pseudogene	OTTHUMT00000344974.1	0	0		19	19		0.00		T			185693044	+1	2		18		tier1	no_errors	ENST00000423298	ensembl	human	known	74_37	rna	10.00		DEL	0.985	-	2	18
SPTBN2	6712	genome.wustl.edu	37	11	66468674	66468675	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr11:66468674_66468675insTT	ENST00000533211.1	-	17	3226_3227	c.2895_2896insAA	c.(2893-2898)ttagagfs	p.E966fs	SPTBN2_ENST00000529997.1_Frame_Shift_Ins_p.E966fs|SPTBN2_ENST00000309996.2_Frame_Shift_Ins_p.E966fs			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	966					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TCCGTGCACTCTAAGTGGTAGT	0.609													ENSG00000173898																																					0																																										SO:0001589	frameshift_variant	0				AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.2895_2896insAA	11.37:g.66468674_66468675insTT	ENSP00000432568:p.Glu966fs		O14872|O14873	Frame_Shift_Ins	INS	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E965fs	ENST00000533211.1	37	c.2896_2895	CCDS8150.1	11																																																																																				SPTBN2	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.609	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	0	0		23	23		0.00		-	NM_006946		66468675	-1	7		9		tier1	no_errors	ENST00000309996	ensembl	human	known	74_37	frame_shift_ins	43.75		INS	1.000:0.970	TT	7	9
BICD1	636	genome.wustl.edu	37	12	32520618	32520618	+	Missense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr12:32520618G>T	ENST00000281474.5	+	9	2882	c.2779G>T	c.(2779-2781)Gct>Tct	p.A927S	BICD1_ENST00000548411.1_Silent_p.L825L	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	927					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TCAGCAGCCTGCTGCCTCCGT	0.493													ENSG00000151746																																					0													104.0	94.0	97.0					12																	32520618		2203	4300	6503	SO:0001583	missense	0			-	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2779G>T	12.37:g.32520618G>T	ENSP00000281474:p.Ala927Ser		A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc,superfamily_SPOC_like_C_dom	p.A927S	ENST00000281474.5	37	c.2779	CCDS8726.1	12	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688858	0.68271	.	.	ENSG00000151746	ENST00000281474	T	0.50813	0.73	5.34	5.34	0.76211	.	0.000000	0.45126	D	0.000396	T	0.51109	0.1655	N	0.08118	0	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.61098	-0.7131	10	0.51188	T	0.08	.	19.0644	0.93104	0.0:0.0:1.0:0.0	.	927	Q96G01	BICD1_HUMAN	S	927	ENSP00000281474:A927S	ENSP00000281474:A927S	A	+	1	0	BICD1	32411885	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.920000	0.75799	2.496000	0.84212	0.655000	0.94253	GCT	-	BICD1	-	NULL		0.493	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICD1	HGNC	protein_coding	OTTHUMT00000403380.1	0	0		28	28		0.00		G	NM_001714		32520618	+1	4		34		tier1	no_errors	ENST00000281474	ensembl	human	known	74_37	missense	10.53		SNP	1.000	T	4	34
XPNPEP3	63929	genome.wustl.edu	37	22	41278171	41278171	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr22:41278171delA	ENST00000357137.4	+	3	663	c.579delA	c.(577-579)ccafs	p.P193fs	XPNPEP3_ENST00000541156.1_Frame_Shift_Del_p.P193fs|XPNPEP3_ENST00000414396.1_Frame_Shift_Del_p.P193fs|XPNPEP3_ENST00000544094.1_Frame_Shift_Del_p.P170fs	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	193					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						ATCTTCTACCAAAAATGAAAG	0.408													ENSG00000196236																									Ovarian(145;306 1841 7037 21878 30110)												0													52.0	53.0	53.0					22																	41278171		2201	4298	6499	SO:0001589	frameshift_variant	0					CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.579delA	22.37:g.41278171delA	ENSP00000349658:p.Pro193fs		B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Frame_Shift_Del	DEL	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.M195fs	ENST00000357137.4	37	c.579	CCDS14007.1	22																																																																																				XPNPEP3	-	pfam_Aminopep_P_N		0.408	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP3	HGNC	protein_coding	OTTHUMT00000322201.2	0	0		17	17		0.00		A	NM_022098		41278171	+1	3		14		tier1	no_errors	ENST00000357137	ensembl	human	known	74_37	frame_shift_del	17.65		DEL	0.003	-	3	14
GALNT6	11226	genome.wustl.edu	37	12	51785401	51785402	+	5'Flank	INS	-	-	AGCCGC	rs143011477	byFrequency	TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr12:51785401_51785402insAGCCGC	ENST00000356317.3	-	0	0				GALNT6_ENST00000603203.1_5'UTR|SLC4A8_ENST00000535225.2_Intron	NM_007210.3	NP_009141.2	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGCCGAGGCAAAGCCGCAGCCG	0.757													ENSG00000139629		1258	0.251198	0.0234	0.245	5008	,	,		9662	0.2897		0.4155	False		,,,				2504	0.3548																0																																										SO:0001631	upstream_gene_variant	0				Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4			12.37:g.51785402_51785407dupAGCCGC	Exception_encountered		Q8IYH4|Q9H6G2|Q9UIV5	R	INS	-	NULL	ENST00000356317.3	37	NULL	CCDS8813.1	12																																																																																				GALNT6	-	-		0.757	GALNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT6	HGNC	protein_coding	OTTHUMT00000469736.1									-	NM_007210		51785402	-1					tier1	no_errors	ENST00000603203	ensembl	human	known	74_37	rna			INS	0.021:0.127	AGCCGC		
NLRC3	197358	genome.wustl.edu	37	16	3604283	3604283	+	RNA	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr16:3604283C>T	ENST00000301749.7	-	0	2632				NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AAGGCCTCAGCCATGGACCTG	0.602													ENSG00000167984																																					0													101.0	111.0	108.0					16																	3604283		2054	4196	6250			0			-	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3604283C>T			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase	p.A790T	ENST00000301749.7	37	c.2368		16	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700522	0.88924	.	.	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.55588	0.51;0.51;0.51	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.69052	0.3068	.	.	.	0.29887	N	0.825543	D	0.64830	0.994	D	0.66351	0.943	T	0.67428	-0.5673	9	0.42905	T	0.14	.	16.3245	0.82970	0.0:1.0:0.0:0.0	.	790	C9JLH9	.	T	743;743;790	ENSP00000301749:A743T;ENSP00000352039:A743T;ENSP00000414415:A790T	ENSP00000301749:A743T	A	-	1	0	NLRC3	3544284	1.000000	0.71417	0.985000	0.45067	0.989000	0.77384	4.841000	0.62824	2.450000	0.82876	0.650000	0.86243	GCT	-	NLRC3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.602	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene		0	0		52	52		0.00		C	NM_178844		3604283	-1	4		39		tier1	no_errors	ENST00000448023	ensembl	human	known	74_37	missense	9.30		SNP	1.000	T	4	39
NEB	4703	genome.wustl.edu	37	2	152521285	152521285	+	Silent	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr2:152521285G>A	ENST00000172853.10	-	43	5478	c.5331C>T	c.(5329-5331)atC>atT	p.I1777I	NEB_ENST00000409198.1_Silent_p.I1777I|NEB_ENST00000427231.2_Silent_p.I1777I|NEB_ENST00000397345.3_Silent_p.I1777I|NEB_ENST00000604864.1_Silent_p.I1777I|NEB_ENST00000603639.1_Silent_p.I1777I			P20929	NEBU_HUMAN	nebulin	1777					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CACTCATGGTGATTTGGTTTA	0.418													ENSG00000183091																																					0													115.0	101.0	105.0					2																	152521285		1893	4121	6014	SO:0001819	synonymous_variant	0			-	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.5331C>T	2.37:g.152521285G>A			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.I1777	ENST00000172853.10	37	c.5331		2																																																																																			-	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif		0.418	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		0	0		48	48		0.00		G	NM_004543		152521285	-1	22		32		tier1	no_errors	ENST00000397345	ensembl	human	known	74_37	silent	40.74		SNP	0.564	A	22	32
MAP2K3	5606	genome.wustl.edu	37	17	21206524	21206524	+	Missense_Mutation	SNP	C	C	G			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr17:21206524C>G	ENST00000342679.4	+	7	795	c.546C>G	c.(544-546)agC>agG	p.S182R	MAP2K3_ENST00000316920.6_Missense_Mutation_p.S153R|MAP2K3_ENST00000361818.5_Missense_Mutation_p.S153R	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	182	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		ATCTGCACAGCAAGCTGTCGG	0.632													ENSG00000034152																																					0													51.0	43.0	46.0					17																	21206524		2203	4300	6503	SO:0001583	missense	0			-	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.546C>G	17.37:g.21206524C>G	ENSP00000345083:p.Ser182Arg		B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S182R	ENST00000342679.4	37	c.546	CCDS11217.1	17	.	.	.	.	.	.	.	.	.	.	C	12.34	1.908276	0.33721	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000316920	T;T	0.45276	0.9;0.9	5.45	4.39	0.52855	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43322	0.1242	L	0.41710	1.295	0.58432	D	0.999995	D	0.57571	0.98	P	0.58266	0.836	T	0.42172	-0.9467	10	0.52906	T	0.07	-46.9621	3.5549	0.07861	0.0:0.6392:0.0:0.3608	.	182	P46734	MP2K3_HUMAN	R	182;153;153;186	ENSP00000345083:S182R;ENSP00000355081:S153R	ENSP00000319139:S186R	S	+	3	2	MAP2K3	21147117	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.734000	0.38166	2.569000	0.86673	0.561000	0.74099	AGC	-	MAP2K3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.632	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K3	HGNC	protein_coding	OTTHUMT00000259374.2	0	0		53	53		0.00		C	NM_145109		21206524	+1	15		52		tier1	no_errors	ENST00000342679	ensembl	human	known	74_37	missense	22.39		SNP	1.000	G	15	52
KIAA0430	9665	genome.wustl.edu	37	16	15702432	15702432	+	Intron	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr16:15702432G>A	ENST00000396368.3	-	21	4161				KIAA0430_ENST00000540441.2_Intron|CTB-193M12.1_ENST00000549756.1_RNA|KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000344181.3_Intron|KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000547936.1_5'Flank	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GGTGTTTACAGAATAGCAAAA	0.373													ENSG00000257769																																					0																																										SO:0001627	intron_variant	0			-	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.3955-57C>T	16.37:g.15702432G>A			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	R	SNP	-	NULL	ENST00000396368.3	37	NULL	CCDS10562.2	16																																																																																			-	CTB-193M12.1	-	-		0.373	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000257769	Clone_based_vega_gene	protein_coding	OTTHUMT00000252131.2	0	0		9	9		0.00		G	NM_014647		15702432	+1	6		6		tier1	no_errors	ENST00000549756	ensembl	human	known	74_37	rna	50.00		SNP	0.002	A	6	6
FBLN2	2199	genome.wustl.edu	37	3	13613042	13613042	+	Missense_Mutation	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr3:13613042C>T	ENST00000295760.7	+	2	1256	c.1187C>T	c.(1186-1188)gCa>gTa	p.A396V	FBLN2_ENST00000492059.1_Missense_Mutation_p.A396V|FBLN2_ENST00000404922.3_Missense_Mutation_p.A396V|FBLN2_ENST00000535798.1_Missense_Mutation_p.A422V	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	396	N.|Subdomain NB (Cys-free).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CTGCCTGATGCAGCCTGGATC	0.622													ENSG00000163520																																					0													33.0	44.0	40.0					3																	13613042		2119	4213	6332	SO:0001583	missense	0			-	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1187C>T	3.37:g.13613042C>T	ENSP00000295760:p.Ala396Val		B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_comp_syst,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd_dom,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.A396V	ENST00000295760.7	37	c.1187	CCDS46762.1	3	.	.	.	.	.	.	.	.	.	.	C	11.16	1.556853	0.27827	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.79940	-1.32;-1.26;-1.23;-1.26	4.67	-1.21	0.09524	.	2.111370	0.01606	N	0.022276	T	0.66446	0.2790	N	0.24115	0.695	0.09310	N	1	B;B;B	0.11235	0.002;0.004;0.003	B;B;B	0.11329	0.003;0.006;0.004	T	0.51616	-0.8683	10	0.56958	D	0.05	.	0.5213	0.00613	0.3256:0.235:0.2459:0.1935	.	396;396;422	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	V	422;396;396;396	ENSP00000445705:A422V;ENSP00000384169:A396V;ENSP00000295760:A396V;ENSP00000420042:A396V	ENSP00000295760:A396V	A	+	2	0	FBLN2	13588043	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.530000	0.23036	-0.125000	0.11703	0.650000	0.86243	GCA	-	FBLN2	-	NULL		0.622	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	HGNC	protein_coding	OTTHUMT00000340083.3	0	0		35	35		0.00		C	NM_001004019		13613042	+1	4		32		tier1	no_errors	ENST00000404922	ensembl	human	known	74_37	missense	11.11		SNP	0.000	T	4	32
JAKMIP3	282973	genome.wustl.edu	37	10	133930998	133930998	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr10:133930998G>T	ENST00000298622.4	+	2	691	c.553G>T	c.(553-555)Gag>Tag	p.E185*		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	185						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CAAGGCCGCAGAGATCCGCAG	0.632													ENSG00000188385																																					0													36.0	44.0	41.0					10																	133930998		2135	4234	6369	SO:0001587	stop_gained	0			-	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.553G>T	10.37:g.133930998G>T	ENSP00000298622:p.Glu185*		A6PW00|Q69YM6|Q6ZT29	Nonsense_Mutation	SNP	NULL	p.E185*	ENST00000298622.4	37	c.553	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	38	7.075129	0.98044	.	.	ENSG00000188385	ENST00000298622	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-34.8462	17.7631	0.88470	0.0:0.0:1.0:0.0	.	.	.	.	X	185	.	ENSP00000298622:E185X	E	+	1	0	JAKMIP3	133780988	1.000000	0.71417	0.942000	0.38095	0.753000	0.42808	9.079000	0.94032	2.419000	0.82065	0.591000	0.81541	GAG	-	JAKMIP3	-	NULL		0.632	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	0	0		29	29		0.00		G	NM_194303		133930998	+1	3		12		tier1	no_errors	ENST00000298622	ensembl	human	known	74_37	nonsense	20.00		SNP	1.000	T	3	12
RAPGEF4	11069	genome.wustl.edu	37	2	173782548	173782548	+	Missense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr2:173782548G>T	ENST00000397081.3	+	5	606	c.463G>T	c.(463-465)Gca>Tca	p.A155S	RAPGEF4_ENST00000397087.3_Missense_Mutation_p.A11S|RAPGEF4_ENST00000540783.1_Missense_Mutation_p.A2S|RAPGEF4_ENST00000264111.6_Missense_Mutation_p.A155S|RAPGEF4_ENST00000409036.1_Missense_Mutation_p.A155S|RAPGEF4_ENST00000538974.1_Missense_Mutation_p.A2S|RAPGEF4_ENST00000539331.1_Missense_Mutation_p.A2S|RAPGEF4_ENST00000473043.1_3'UTR	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	155					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			ACAGTATATGGCAGGACTTCT	0.348													ENSG00000091428																																					0													181.0	171.0	174.0					2																	173782548		1873	4109	5982	SO:0001583	missense	0			-	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.463G>T	2.37:g.173782548G>T	ENSP00000380271:p.Ala155Ser		B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_cNMP-bd_dom,pfam_DEP_dom,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_DEP_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_DEP_dom,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_cAMP/cGMP_kin	p.A155S	ENST00000397081.3	37	c.463	CCDS42775.1	2	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033947	0.54896	.	.	ENSG00000091428	ENST00000264111;ENST00000397081;ENST00000409036;ENST00000397087;ENST00000538974;ENST00000540783;ENST00000539331	T;T;T;T;T;T;T	0.65549	0.97;0.97;0.97;-0.14;-0.16;-0.01;-0.01	5.82	5.82	0.92795	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (1);	0.050074	0.85682	D	0.000000	T	0.43656	0.1257	N	0.17082	0.46	0.80722	D	1	B;B;B;B	0.10296	0.001;0.003;0.0;0.001	B;B;B;B	0.09377	0.002;0.004;0.0;0.001	T	0.35624	-0.9781	10	0.08599	T	0.76	.	14.3982	0.67025	0.0:0.0:0.8517:0.1483	.	2;11;155;155	B7Z2R0;Q8WZA2-3;Q8WZA2;E9PB94	.;.;RPGF4_HUMAN;.	S	155;155;155;11;2;2;2	ENSP00000264111:A155S;ENSP00000380271:A155S;ENSP00000387104:A155S;ENSP00000380276:A11S;ENSP00000440135:A2S;ENSP00000440250:A2S;ENSP00000437384:A2S	ENSP00000264111:A155S	A	+	1	0	RAPGEF4	173490794	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.683000	0.68189	2.765000	0.95021	0.650000	0.86243	GCA	-	RAPGEF4	-	superfamily_cNMP-bd-like,smart_cNMP-bd_dom		0.348	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	HGNC	protein_coding	OTTHUMT00000257864.2	0	0		35	35		0.00		G	NM_007023		173782548	+1	4		36		tier1	no_errors	ENST00000397081	ensembl	human	known	74_37	missense	10.00		SNP	1.000	T	4	36
TCEB3C	162699	genome.wustl.edu	37	18	44554838	44554838	+	Missense_Mutation	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr18:44554838G>A	ENST00000330682.2	-	1	1611	c.1376C>T	c.(1375-1377)cCt>cTt	p.P459L	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron	NM_145653.3	NP_663628.2	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide 3C (elongin A3)	459	Activation domain. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(16)|skin(2)	30						AGCATCATAAGGCGTCTTGGC	0.577													ENSG00000183791																																					0													3.0	3.0	3.0					18																	44554838		653	1412	2065	SO:0001583	missense	0			-	AB076840	CCDS11931.1	18q21.1	2008-08-13			ENSG00000183791	ENSG00000183791			24617	protein-coding gene	gene with protein product	"""elongin A3"""					11932239, 11994304	Standard	NM_145653		Approved	HsT829, TCEB3L2	uc010xdb.2	Q8NG57	OTTHUMG00000132651	ENST00000330682.2:c.1376C>T	18.37:g.44554838G>A	ENSP00000328232:p.Pro459Leu			Missense_Mutation	SNP	pfam_R_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.P459L	ENST00000330682.2	37	c.1376	CCDS11931.1	18	.	.	.	.	.	.	.	.	.	.	g	14.08	2.428377	0.43122	.	.	ENSG00000183791	ENST00000330682	T	0.35048	1.33	1.37	1.37	0.22104	.	0.146689	0.31246	U	0.007986	T	0.48642	0.1511	M	0.62723	1.935	0.31560	N	0.65761	D	0.76494	0.999	D	0.71184	0.972	T	0.52675	-0.8544	10	0.66056	D	0.02	-0.3081	6.2213	0.20683	0.0:0.0:1.0:0.0	.	459	Q8NG57	ELOA3_HUMAN	L	459	ENSP00000328232:P459L	ENSP00000328232:P459L	P	-	2	0	TCEB3C	42808836	0.053000	0.20554	0.005000	0.12908	0.012000	0.07955	1.499000	0.35671	1.095000	0.41419	0.485000	0.47835	CCT	-	TCEB3C	-	NULL		0.577	TCEB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3C	HGNC	protein_coding	OTTHUMT00000255902.1	0	0		26	26		0.00		G	NM_145653		44554838	-1	5		31		tier1	no_errors	ENST00000330682	ensembl	human	known	74_37	missense	13.89		SNP	0.023	A	5	31
WLS	79971	genome.wustl.edu	37	1	68564403	68564403	+	Missense_Mutation	SNP	C	C	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:68564403C>A	ENST00000354777.2	-	12	1789	c.1544G>T	c.(1543-1545)tGt>tTt	p.C515F	GNG12-AS1_ENST00000413628.1_RNA|GNG12-AS1_ENST00000420587.1_RNA|WLS_ENST00000540432.1_Missense_Mutation_p.C517F	NM_001002292.3	NP_001002292.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	516					anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						aaacaaagcacaatcttccct	0.348													ENSG00000116729																																					0													113.0	106.0	108.0					1																	68564403		2203	4300	6503	SO:0001583	missense	0			-	BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000354777.2:c.1544G>T	1.37:g.68564403C>A	ENSP00000346829:p.Cys515Phe		B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	NULL	p.C517F	ENST00000354777.2	37	c.1550	CCDS30750.1	1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.192953	0.38707	.	.	ENSG00000116729	ENST00000540432;ENST00000354777	T;T	0.42131	0.98;0.98	2.25	1.2	0.21068	.	4.349970	0.02665	N	0.107958	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.14172	-1.0482	10	0.20519	T	0.43	-9.6844	6.2997	0.21105	0.328:0.672:0.0:0.0	.	515	Q5T9L3-2	.	F	517;515	ENSP00000446112:C517F;ENSP00000346829:C515F	ENSP00000346829:C515F	C	-	2	0	WLS	68336991	0.001000	0.12720	0.001000	0.08648	0.756000	0.42949	0.868000	0.27982	0.395000	0.25257	0.563000	0.77884	TGT	-	WLS	-	NULL		0.348	WLS-003	KNOWN	basic|CCDS	protein_coding	WLS	HGNC	protein_coding	OTTHUMT00000025370.1	0	0		26	26		0.00		C	NM_024911		68564403	-1	17		0		tier1	no_errors	ENST00000540432	ensembl	human	known	74_37	missense	100.00		SNP	0.001	A	17	0
BOD1L1	259282	genome.wustl.edu	37	4	13616072	13616072	+	Missense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr4:13616072G>T	ENST00000040738.5	-	4	1057	c.922C>A	c.(922-924)Caa>Aaa	p.Q308K		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	308						nucleus (GO:0005634)	DNA binding (GO:0003677)										CTTTCCTGTTGAACATCCTTA	0.358													ENSG00000038219																																					0													73.0	67.0	69.0					4																	13616072		2203	4300	6503	SO:0001583	missense	0			-	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.922C>A	4.37:g.13616072G>T	ENSP00000040738:p.Gln308Lys		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.Q308K	ENST00000040738.5	37	c.922	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	15.65	2.896213	0.52121	.	.	ENSG00000038219	ENST00000040738	T	0.06933	3.24	5.75	4.86	0.63082	.	0.167508	0.28635	N	0.014650	T	0.09069	0.0224	L	0.59436	1.845	0.09310	N	1	B	0.22276	0.067	B	0.19391	0.025	T	0.33189	-0.9878	10	0.09843	T	0.71	-8.0255	11.7715	0.51962	0.0:0.132:0.7317:0.1364	.	308	Q8NFC6	BOD1L_HUMAN	K	308	ENSP00000040738:Q308K	ENSP00000040738:Q308K	Q	-	1	0	BOD1L	13225170	0.880000	0.30214	0.984000	0.44739	0.933000	0.57130	2.922000	0.48860	2.709000	0.92574	0.591000	0.81541	CAA	-	BOD1L1	-	NULL		0.358	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	0	0		43	43		0.00		G	NM_148894		13616072	-1	4		45		tier1	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	8.00		SNP	0.023	T	4	45
PSMG2	56984	genome.wustl.edu	37	18	12658668	12658668	+	3'UTR	SNP	T	T	C			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr18:12658668T>C	ENST00000400514.2	+	0	247				SPIRE1_ENST00000453447.2_5'Flank|SPIRE1_ENST00000383356.2_5'Flank|PSMG2_ENST00000585331.2_5'Flank|SPIRE1_ENST00000410092.3_5'Flank|SPIRE1_ENST00000409402.4_5'Flank|SPIRE1_ENST00000309836.5_5'Flank|AP005482.1_ENST00000585853.2_3'UTR																							CGCCGGGCCCTGGGCCCTGAA	0.622													ENSG00000215527																																					0																																										SO:0001624	3_prime_UTR_variant	0			-																												ENST00000400514.2:c.*38T>C	18.37:g.12658668T>C				R	SNP	-	NULL	ENST00000400514.2	37	NULL		18																																																																																			-	AP005482.1	-	-		0.622	AP005482.1-002	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000215527	Clone_based_vega_gene	protein_coding	OTTHUMT00000156288.2	0	0		31	31		0.00		T			12658668	+1	4		35		tier1	no_errors	ENST00000585853	ensembl	human	known	74_37	rna	10.26		SNP	0.002	C	4	35
CCDC24	149473	genome.wustl.edu	37	1	44458252	44458252	+	Frame_Shift_Del	DEL	G	G	-			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:44458252delG	ENST00000372318.3	+	4	531	c.360delG	c.(358-360)gagfs	p.E121fs	SLC6A9_ENST00000372306.3_Intron|SLC6A9_ENST00000372307.3_Intron|CCDC24_ENST00000479055.1_3'UTR	NM_152499.1	NP_689712.1	Q8N4L8	CCD24_HUMAN	coiled-coil domain containing 24	121										endometrium(3)|large_intestine(2)|lung(3)|stomach(1)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TTGCCTTGGAGGAGCCCAGGT	0.577													ENSG00000159214																																					0													104.0	94.0	98.0					1																	44458252		2203	4300	6503	SO:0001589	frameshift_variant	0					CCDS507.1	1p34.1	2008-02-05			ENSG00000159214	ENSG00000159214			28688	protein-coding gene	gene with protein product						12477932	Standard	NM_152499		Approved	MGC45441	uc001clj.3	Q8N4L8	OTTHUMG00000008299	ENST00000372318.3:c.360delG	1.37:g.44458252delG	ENSP00000361392:p.Glu121fs		Q6RWT2	Frame_Shift_Del	DEL	NULL	p.E121fs	ENST00000372318.3	37	c.360	CCDS507.1	1																																																																																				CCDC24	-	NULL		0.577	CCDC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC24	HGNC	protein_coding	OTTHUMT00000022865.1	0	0		52	52		0.00		G	NM_152499		44458252	+1	2		16		tier1	no_errors	ENST00000372318	ensembl	human	known	74_37	frame_shift_del	11.11		DEL	0.998	-	2	16
KCNB2	9312	genome.wustl.edu	37	8	73480540	73480540	+	Missense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr8:73480540G>T	ENST00000523207.1	+	2	1159	c.571G>T	c.(571-573)Gct>Tct	p.A191S		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	191					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CTCATCAGTGGCTGCAAAGGT	0.423													ENSG00000182674																																					0													60.0	64.0	63.0					8																	73480540		2195	4296	6491	SO:0001583	missense	0			-	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.571G>T	8.37:g.73480540G>T	ENSP00000430846:p.Ala191Ser		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.A191S	ENST00000523207.1	37	c.571	CCDS6209.1	8	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726601	0.48833	.	.	ENSG00000182674	ENST00000523207	D	0.97455	-4.39	5.77	3.96	0.45880	.	0.680971	0.12129	N	0.496972	D	0.95124	0.8420	L	0.54965	1.715	0.58432	D	0.999996	B	0.17268	0.021	B	0.19946	0.027	D	0.91178	0.4974	10	0.38643	T	0.18	.	10.9793	0.47483	0.0677:0.0:0.8023:0.13	.	191	Q92953	KCNB2_HUMAN	S	191	ENSP00000430846:A191S	ENSP00000430846:A191S	A	+	1	0	KCNB2	73643094	1.000000	0.71417	0.996000	0.52242	0.948000	0.59901	9.813000	0.99286	0.875000	0.35847	0.655000	0.94253	GCT	-	KCNB2	-	prints_K_chnl		0.423	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	0	0		31	31		0.00		G	NM_004770		73480540	+1	4		37		tier1	no_errors	ENST00000523207	ensembl	human	known	74_37	missense	9.76		SNP	1.000	T	4	37
KLHDC3	116138	genome.wustl.edu	37	6	42986655	42986655	+	Missense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr6:42986655G>T	ENST00000326974.4	+	8	1070	c.875G>T	c.(874-876)cGg>cTg	p.R292L	RRP36_ENST00000244496.5_5'Flank|KLHDC3_ENST00000244670.8_Missense_Mutation_p.R158L|KLHDC3_ENST00000332245.8_Missense_Mutation_p.R233L	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	292					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGTCCCCGCCGGCGCCAGTGC	0.512													ENSG00000124702																																					0													64.0	76.0	72.0					6																	42986655		2202	4299	6501	SO:0001583	missense	0			-	AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.875G>T	6.37:g.42986655G>T	ENSP00000313995:p.Arg292Leu		A8K2W9	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1	p.R292L	ENST00000326974.4	37	c.875	CCDS4880.1	6	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175562	0.78564	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000244670;ENST00000394096;ENST00000426116;ENST00000332245	T;T;T	0.65732	-0.17;-0.17;-0.17	5.31	3.53	0.40419	.	0.000000	0.85682	D	0.000000	T	0.74053	0.3666	M	0.88377	2.95	0.80722	D	1	D;D;D;D	0.71674	0.991;0.997;0.979;0.998	D;D;P;D	0.68039	0.946;0.955;0.696;0.955	T	0.79458	-0.1795	10	0.87932	D	0	-5.8557	11.9157	0.52763	0.1422:0.0:0.8578:0.0	.	292;233;158;292	E7ENU0;E7ERR0;F8W6A4;Q9BQ90	.;.;.;KLDC3_HUMAN	L	292;292;158;292;265;233	ENSP00000313995:R292L;ENSP00000244670:R158L;ENSP00000331562:R233L	ENSP00000244670:R158L	R	+	2	0	KLHDC3	43094633	1.000000	0.71417	0.990000	0.47175	0.923000	0.55619	9.132000	0.94455	0.743000	0.32719	0.205000	0.17691	CGG	-	KLHDC3	-	NULL		0.512	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC3	HGNC	protein_coding	OTTHUMT00000040570.1	0	0		44	44		0.00		G	NM_057161		42986655	+1	4		26		tier1	no_errors	ENST00000326974	ensembl	human	known	74_37	missense	13.33		SNP	0.999	T	4	26
ARID1B	57492	genome.wustl.edu	37	6	157520041	157520041	+	Splice_Site	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr6:157520041G>A	ENST00000350026.5	+	16	4072	c.4071G>A	c.(4069-4071)ccG>ccA	p.P1357P	ARID1B_ENST00000367148.1_Splice_Site_p.P1410P|ARID1B_ENST00000346085.5_Splice_Site_p.P1370P|ARID1B_ENST00000275248.4_Splice_Site_p.P1352P	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1357					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.P1352P(1)|p.P1370P(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CACAGCAGCCGGTGAGTTGGC	0.567													ENSG00000049618																																					2	Substitution - coding silent(2)	kidney(2)											14.0	17.0	16.0					6																	157520041		2199	4292	6491	SO:0001630	splice_region_variant	0			-	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4071+1G>A	6.37:g.157520041G>A			Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_D-bd,superfamily_ARID/BRIGHT_D-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_D-bd,pfscan_ARID/BRIGHT_D-bd	p.P1410	ENST00000350026.5	37	c.4230	CCDS5251.2	6																																																																																			-	ARID1B	-	NULL		0.567	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	0	0		81	81		0.00		G	NM_020732	Silent	157520041	+1	40		57		tier1	no_errors	ENST00000367148	ensembl	human	known	74_37	silent	41.24		SNP	1.000	A	40	57
C5orf27	202299	genome.wustl.edu	37	5	95194703	95194703	+	Silent	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr5:95194703C>T	ENST00000436592.1	+	4	918	c.270C>T	c.(268-270)agC>agT	p.S90S	C5orf27_ENST00000357880.3_Silent_p.S90S|AC008592.5_ENST00000503091.1_RNA					chromosome 5 open reading frame 27																		CCCGCTGCAGCTGTGGCAAAC	0.627											OREG0016708	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000236882																																					0													11.0	11.0	11.0					5																	95194703		692	1590	2282	SO:0001819	synonymous_variant	0			-	AY168789		5q15	2014-04-16			ENSG00000236882	ENSG00000236882			24687	other	unknown							Standard	NR_026936		Approved	FLJ38821, FIS	uc003klp.3	Q52M75	OTTHUMG00000122084	ENST00000436592.1:c.270C>T	5.37:g.95194703C>T		1311		Silent	SNP	NULL	p.S90	ENST00000436592.1	37	c.270		5																																																																																			-	C5orf27	-	NULL		0.627	C5orf27-001	KNOWN	basic|appris_principal	protein_coding	C5orf27	HGNC	protein_coding	OTTHUMT00000242845.3	0	0		22	22		0.00		C	NM_175616		95194703	+1	4		24		tier1	no_errors	ENST00000357880	ensembl	human	known	74_37	silent	14.29		SNP	0.229	T	4	24
OS9	10956	genome.wustl.edu	37	12	58109574	58109574	+	Missense_Mutation	SNP	G	G	C			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr12:58109574G>C	ENST00000315970.7	+	6	652	c.611G>C	c.(610-612)gGg>gCg	p.G204A	OS9_ENST00000389142.5_Missense_Mutation_p.G204A|OS9_ENST00000551035.1_Missense_Mutation_p.G171A|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000413095.2_Intron|OS9_ENST00000257966.8_Missense_Mutation_p.G204A|OS9_ENST00000435406.2_Missense_Mutation_p.G152A|OS9_ENST00000439210.2_Missense_Mutation_p.G145A|OS9_ENST00000552285.1_Missense_Mutation_p.G204A|OS9_ENST00000389146.6_Missense_Mutation_p.G204A	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	204					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGTATCTCTGGGGACTACATC	0.542													ENSG00000135506																																					0													95.0	91.0	93.0					12																	58109574		2203	4300	6503	SO:0001583	missense	0			-	AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.611G>C	12.37:g.58109574G>C	ENSP00000318165:p.Gly204Ala		A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.G204A	ENST00000315970.7	37	c.611	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	G	16.91	3.251888	0.59212	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000439210;ENST00000389146;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000550372;ENST00000389142	T;T;T;T;T;T;T;T;T	0.04317	3.87;3.87;3.87;3.87;3.65;3.87;3.65;3.65;3.87	6.04	6.04	0.98038	Mannose-6-phosphate receptor, binding (1);	0.228496	0.45361	D	0.000371	T	0.13114	0.0318	L	0.35793	1.09	0.44611	D	0.997586	D;D;B;D;B;B;D	0.76494	0.999;0.999;0.095;0.997;0.058;0.058;0.999	D;D;B;D;B;B;D	0.83275	0.994;0.965;0.156;0.978;0.074;0.05;0.996	T	0.26430	-1.0103	10	0.16896	T	0.51	.	16.0793	0.80989	0.0:0.0:1.0:0.0	.	145;171;204;204;204;204;204	E7EW91;F8VUH2;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;OS9_HUMAN	A	204;204;145;204;171;204;152;144;204	ENSP00000450010:G204A;ENSP00000318165:G204A;ENSP00000407360:G145A;ENSP00000373798:G204A;ENSP00000447866:G171A;ENSP00000257966:G204A;ENSP00000389632:G152A;ENSP00000447719:G144A;ENSP00000373794:G204A	ENSP00000257966:G204A	G	+	2	0	OS9	56395841	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.412000	0.59787	2.873000	0.98535	0.561000	0.74099	GGG	-	OS9	-	superfamily_Man6P_isomerase_rcpt-bd_dom		0.542	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	HGNC	protein_coding	OTTHUMT00000408344.1	0	0		22	22		0.00		G	NM_006812		58109574	+1	9		29		tier1	no_errors	ENST00000315970	ensembl	human	known	74_37	missense	23.68		SNP	1.000	C	9	29
MUC5B	727897	genome.wustl.edu	37	11	1266537	1266537	+	Silent	SNP	G	G	T	rs199659189	byFrequency	TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr11:1266537G>T	ENST00000529681.1	+	31	8485	c.8427G>T	c.(8425-8427)ctG>ctT	p.L2809L	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.L2812L	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2809	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTCCAGCCCTGTCCAGCCCTC	0.682													ENSG00000117983	-|||	290	0.0579073	0.0401	0.1167	5008	,	,		17295	0.0387		0.0706	False		,,,				2504	0.047																0																																										SO:0001819	synonymous_variant	0			-	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8427G>T	11.37:g.1266537G>T			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.L2812	ENST00000529681.1	37	c.8436	CCDS44515.2	11																																																																																			rs199659189	MUC5B	-	NULL		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	0	0		30	30		0.00		G	XM_001126093		1266537	+1	7		39		tier1	no_errors	ENST00000447027	ensembl	human	known	74_37	silent	15.22		SNP	0.000	T	7	39
PARP1	142	genome.wustl.edu	37	1	226549885	226549886	+	Intron	INS	-	-	T	rs368063214		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:226549885_226549886insT	ENST00000366794.5	-	22	2992				PARP1_ENST00000490921.1_Intron	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1						base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		TGTGGTCtttcttttttttttt	0.47								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA					ENSG00000143799																																					0																																										SO:0001627	intron_variant	0				BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2849-101->A	1.37:g.226549896_226549896dupT			B1ANJ4|Q8IUZ9	R	INS	-	NULL	ENST00000366794.5	37	NULL	CCDS1554.1	1																																																																																				PARP1	-	-		0.470	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	0	0		14	14		0.00		-	NM_001618		226549886	-1	4		27		tier1	no_errors	ENST00000491816	ensembl	human	known	74_37	rna	12.90		INS	0.002:0.004	T	4	27
CABP1	9478	genome.wustl.edu	37	12	121094036	121094036	+	Intron	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr12:121094036C>T	ENST00000316803.3	+	2	788				CABP1_ENST00000288616.3_Silent_p.C62C|CABP1_ENST00000453000.1_Silent_p.C141C|CABP1_ENST00000351200.2_Intron	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1						negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCCCTGCCTGCATTTTCCTGC	0.652													ENSG00000157782																																					0													26.0	24.0	25.0					12																	121094036		2203	4300	6503	SO:0001627	intron_variant	0			-	AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.655-3645C>T	12.37:g.121094036C>T			O95663|Q8N6H5|Q9NZU8	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.C62	ENST00000316803.3	37	c.186	CCDS31913.1	12																																																																																			-	CABP1	-	NULL		0.652	CABP1-001	KNOWN	basic|CCDS	protein_coding	CABP1	HGNC	protein_coding	OTTHUMT00000345822.1	0	0		33	33		0.00		C	NM_001033677		121094036	+1	12		48		tier1	no_errors	ENST00000288616	ensembl	human	known	74_37	silent	19.67		SNP	1.000	T	12	48
ITPRIPL2	162073	genome.wustl.edu	37	16	19132369	19132369	+	3'UTR	SNP	G	G	T	rs538351286|rs75467685		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr16:19132369G>T	ENST00000381440.3	+	0	7116				RP11-626G11.3_ENST00000567236.1_RNA|CTD-2349B8.1_ENST00000564808.2_Intron	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2							integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GCATTCGTTAGTTTTTTTTTT	0.373													ENSG00000261759																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.*4978G>T	16.37:g.19132369G>T				R	SNP	-	NULL	ENST00000381440.3	37	NULL	CCDS32395.1	16																																																																																			-	RP11-626G11.3	-	-		0.373	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261759	Clone_based_vega_gene	protein_coding	OTTHUMT00000435827.3	0	0		32	32		0.00		G	NM_001034841		19132369	-1	5		33		tier1	no_errors	ENST00000567236	ensembl	human	known	74_37	rna	13.16		SNP	0.783	T	5	33
ITGAM	3684	genome.wustl.edu	37	16	31339499	31339499	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr16:31339499G>T	ENST00000287497.8	+	23	2815	c.2740G>T	c.(2740-2742)Gaa>Taa	p.E914*	ITGAM_ENST00000544665.3_Nonsense_Mutation_p.E915*			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	914					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CAACAAAACCGAATTCCAACT	0.532													ENSG00000169896																																					0													124.0	121.0	122.0					16																	31339499		1992	4171	6163	SO:0001587	stop_gained	0			-	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2740G>T	16.37:g.31339499G>T	ENSP00000287497:p.Glu914*		Q4VAK0|Q4VAK1|Q4VAK2	Nonsense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.E915*	ENST00000287497.8	37	c.2743	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.111386	0.97291	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	.	.	.	5.18	0.236	0.15471	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	0.6805	0.00874	0.2991:0.1347:0.3668:0.1994	.	.	.	.	X	915;914	.	ENSP00000287497:E914X	E	+	1	0	ITGAM	31247000	0.000000	0.05858	0.002000	0.10522	0.466000	0.32739	0.027000	0.13621	0.158000	0.19367	0.555000	0.69702	GAA	-	ITGAM	-	pfam_Integrin_alpha-2		0.532	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	0	0		49	49		0.00		G	NM_000632		31339499	+1	4		42		tier1	no_errors	ENST00000544665	ensembl	human	known	74_37	nonsense	8.70		SNP	0.000	T	4	42
NAA25	80018	genome.wustl.edu	37	12	112491457	112491457	+	Missense_Mutation	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr12:112491457G>T	ENST00000261745.4	-	15	1881	c.1633C>A	c.(1633-1635)Ctt>Att	p.L545I		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	545						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						CGGGTCAAAAGATAACTAGAT	0.373													ENSG00000111300																																					0													48.0	45.0	46.0					12																	112491457		2203	4300	6503	SO:0001583	missense	0			-	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.1633C>A	12.37:g.112491457G>T	ENSP00000261745:p.Leu545Ile		A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	pfam_N-acetylTrfase_B_cplx_non-cat,pfscan_TPR-contain_dom	p.L545I	ENST00000261745.4	37	c.1633	CCDS9159.1	12	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200804	0.58234	.	.	ENSG00000111300	ENST00000261745	T	0.53206	0.63	5.99	5.99	0.97316	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.46927	0.1418	L	0.56340	1.77	0.80722	D	1	P;P	0.39352	0.669;0.669	B;B	0.39840	0.311;0.311	T	0.42015	-0.9476	10	0.44086	T	0.13	-12.9876	14.6024	0.68450	0.069:0.0:0.931:0.0	.	545;545	A8K8X0;Q14CX7	.;NAA25_HUMAN	I	545	ENSP00000261745:L545I	ENSP00000261745:L545I	L	-	1	0	NAA25	110975840	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.038000	0.70964	2.840000	0.97914	0.655000	0.94253	CTT	-	A25	-	pfam_N-acetylTrfase_B_cplx_non-cat		0.373	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A25	HGNC	protein_coding	OTTHUMT00000405205.1	0	0		13	13		0.00		G	NM_024953		112491457	-1	9		15		tier1	no_errors	ENST00000261745	ensembl	human	known	74_37	missense	37.50		SNP	1.000	T	9	15
ACOX3	8310	genome.wustl.edu	37	4	8396467	8396467	+	Silent	SNP	T	T	C			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr4:8396467T>C	ENST00000356406.5	-	10	1136	c.1059A>G	c.(1057-1059)caA>caG	p.Q353Q	ACOX3_ENST00000413009.2_Silent_p.Q353Q|RNA5SP152_ENST00000365184.1_RNA|ACOX3_ENST00000503233.1_Silent_p.Q353Q	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	353					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						GCAAGCGCCATTGCTAGAACA	0.572													ENSG00000087008																																					0													60.0	55.0	57.0					4																	8396467		2203	4300	6503	SO:0001819	synonymous_variant	0			-	Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.1059A>G	4.37:g.8396467T>C			Q96AJ8	Silent	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_AcylCo_DH/oxidase_C,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase_NM_dom,pirsf_Acyl-CoA_oxidase	p.Q353	ENST00000356406.5	37	c.1059	CCDS3401.1	4																																																																																			-	ACOX3	-	pfam_AcylCo_DH/oxidase_C,superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase		0.572	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOX3	HGNC	protein_coding	OTTHUMT00000206997.4	0	0		9	9		0.00		T			8396467	-1	6		8		tier1	no_errors	ENST00000356406	ensembl	human	known	74_37	silent	42.86		SNP	1.000	C	6	8
SH2D2A	9047	genome.wustl.edu	37	1	156777009	156777009	+	Silent	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:156777009G>A	ENST00000368199.3	-	8	1284	c.1131C>T	c.(1129-1131)gaC>gaT	p.D377D	SH2D2A_ENST00000392306.2_Silent_p.D387D|SH2D2A_ENST00000368198.3_Silent_p.D359D	NM_001161443.1|NM_001161444.1|NM_003975.3	NP_001154915.1|NP_001154916.1|NP_003966.2	Q9NP31	SH22A_HUMAN	SH2 domain containing 2A	377	Pro-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|large_intestine(2)|lung(15)	18	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCTGTCCTCTGTCCTGAAGCA	0.592													ENSG00000027869																																					0													84.0	84.0	84.0					1																	156777009		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ000553	CCDS1159.1, CCDS53380.1, CCDS53381.1	1q21	2013-02-14	2010-04-21		ENSG00000027869	ENSG00000027869		"""SH2 domain containing"""	10821	protein-coding gene	gene with protein product	"""T lymphocyte specific adaptor protein"", ""T cell specific adapter protein TSAd"", ""T cell specific adpater protein TSAd"""	604514	"""SH2 domain protein 2A"""			9468509	Standard	NM_003975		Approved	TSAd, F2771	uc009wsh.2	Q9NP31	OTTHUMG00000041305	ENST00000368199.3:c.1131C>T	1.37:g.156777009G>A			O43817|Q5UBZ1|Q5VZS4|Q5VZS5|Q9UPA7	Silent	SNP	pfam_SH2,smart_SH2,pfscan_SH2	p.D387	ENST00000368199.3	37	c.1161	CCDS1159.1	1																																																																																			-	SH2D2A	-	NULL		0.592	SH2D2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SH2D2A	HGNC	protein_coding	OTTHUMT00000098982.1	0	0		26	26		0.00		G	NM_003975		156777009	-1	15		43		tier1	no_errors	ENST00000392306	ensembl	human	known	74_37	silent	25.86		SNP	0.938	A	15	43
NLRP10	338322	genome.wustl.edu	37	11	7981533	7981533	+	Silent	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr11:7981533C>T	ENST00000328600.2	-	2	1787	c.1626G>A	c.(1624-1626)gcG>gcA	p.A542A		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	542					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCAGATCCTGCGCTAAACAGG	0.413													ENSG00000182261																																					0													61.0	61.0	61.0					11																	7981533		2201	4296	6497	SO:0001819	synonymous_variant	0			-	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1626G>A	11.37:g.7981533C>T			Q2M3C4|Q6JGT0	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,pfscan_CHT_NTPase,pfscan_DAPIN	p.A542	ENST00000328600.2	37	c.1626	CCDS7784.1	11																																																																																			-	NLRP10	-	NULL		0.413	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP10	HGNC	protein_coding	OTTHUMT00000385705.1	0	0		27	27		0.00		C	NM_176821		7981533	-1	16		20		tier1	no_errors	ENST00000328600	ensembl	human	known	74_37	silent	44.44		SNP	0.271	T	16	20
CNTN5	53942	genome.wustl.edu	37	11	100170065	100170065	+	Missense_Mutation	SNP	G	G	A	rs202207695		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr11:100170065G>A	ENST00000524871.1	+	20	2847	c.2557G>A	c.(2557-2559)Gtt>Att	p.V853I	CNTN5_ENST00000418526.2_Missense_Mutation_p.V779I|CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000528682.1_Missense_Mutation_p.V853I|CNTN5_ENST00000279463.3_Missense_Mutation_p.V853I|CNTN5_ENST00000527185.1_Missense_Mutation_p.V853I	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	853	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GAAAGTTGGCGTTTATAACAA	0.368													ENSG00000149972																																					0								G	ILE/VAL,ILE/VAL	2,3680		0,2,1839	101.0	97.0	98.0		2557,2335	5.6	1.0	11		98	1,8157		0,1,4078	yes	missense,missense	CNTN5	NM_014361.3,NM_175566.2	29,29	0,3,5917	AA,AG,GG		0.0123,0.0543,0.0253	probably-damaging,probably-damaging	853/1101,779/1027	100170065	3,11837	1841	4079	5920	SO:0001583	missense	0			-	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2557G>A	11.37:g.100170065G>A	ENSP00000435637:p.Val853Ile		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V853I	ENST00000524871.1	37	c.2557	CCDS53696.1	11	.	.	.	.	.	.	.	.	.	.	G	31	5.060340	0.93846	5.43E-4	1.23E-4	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.62	5.62	0.85841	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.76688	0.4022	M	0.85710	2.77	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.991;0.995	T	0.79850	-0.1629	10	0.72032	D	0.01	.	18.6488	0.91421	0.0:0.0:1.0:0.0	.	779;853	O94779-2;O94779	.;CNTN5_HUMAN	I	853;853;853;779;853	ENSP00000433575:V853I;ENSP00000436185:V853I;ENSP00000435637:V853I;ENSP00000393229:V779I;ENSP00000279463:V853I	ENSP00000279463:V853I	V	+	1	0	CNTN5	99675275	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.910000	0.87451	2.660000	0.90430	0.650000	0.86243	GTT	rs202207695	CNTN5	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.368	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	HGNC	protein_coding	OTTHUMT00000395148.2	0	0		39	39		0.00		G	NM_014361		100170065	+1	17		22		tier1	no_errors	ENST00000279463	ensembl	human	known	74_37	missense	43.59		SNP	1.000	A	17	22
BCKDHA	593	genome.wustl.edu	37	19	41916828	41916828	+	Splice_Site	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr19:41916828C>T	ENST00000269980.2	+	3	657	c.289C>T	c.(289-291)Ctg>Ttg	p.L97L	BCKDHA_ENST00000457836.2_Splice_Site_p.L75L|CTC-435M10.3_ENST00000540732.1_Splice_Site_p.L131L|BCKDHA_ENST00000595085.1_Splice_Site_p.L131L	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide	97					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						CCACCCGCAGCTGCCGAAGGA	0.637													ENSG00000248098																																					0													159.0	153.0	155.0					19																	41916828		2203	4300	6503	SO:0001630	splice_region_variant	0			-	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128	ENST00000269980.2:c.289-1C>T	19.37:g.41916828C>T			B4DP47|E7EW46|Q16034|Q16472	Silent	SNP	pfam_DH_E1,pfam_Transketolase_N	p.L131	ENST00000269980.2	37	c.391	CCDS12581.1	19																																																																																			-	BCKDHA	-	NULL		0.637	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCKDHA	HGNC	protein_coding	OTTHUMT00000398313.3	0	0		60	60		0.00		C	NM_000709	Silent	41916828	+1	4		36		tier1	no_errors	ENST00000595085	ensembl	human	known	74_37	silent	10.00		SNP	1.000	T	4	36
ASZ1	136991	genome.wustl.edu	37	7	117020090	117020090	+	Silent	SNP	G	G	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr7:117020090G>T	ENST00000284629.2	-	10	1019	c.957C>A	c.(955-957)acC>acA	p.T319T		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			GGTCTTTACTGGTAATTCCAT	0.323													ENSG00000154438																																					0													61.0	64.0	63.0					7																	117020090		2202	4290	6492	SO:0001819	synonymous_variant	0			-	AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.957C>A	7.37:g.117020090G>T				Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T319	ENST00000284629.2	37	c.957	CCDS5772.1	7																																																																																			-	ASZ1	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed		0.323	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASZ1	HGNC	protein_coding	OTTHUMT00000138907.7	0	0		32	32		0.00		G	NM_130768		117020090	-1	3		21		tier1	no_errors	ENST00000284629	ensembl	human	known	74_37	silent	12.50		SNP	0.003	T	3	21
CDH13	1012	genome.wustl.edu	37	16	83813649	83813649	+	Silent	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr16:83813649C>T	ENST00000566620.1	+	12	2048	c.1758C>T	c.(1756-1758)taC>taT	p.Y586Y	CDH13_ENST00000428848.3_Silent_p.Y547Y|CDH13_ENST00000268613.10_Silent_p.Y633Y	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	586	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CGTTCATTTACCCCACAGTAG	0.483													ENSG00000140945																																					0													103.0	96.0	98.0					16																	83813649		1927	4175	6102	SO:0001819	synonymous_variant	0			-	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1758C>T	16.37:g.83813649C>T			A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y586	ENST00000566620.1	37	c.1758	CCDS58486.1	16																																																																																			-	CDH13	-	superfamily_Cadherin-like,pfscan_Cadherin		0.483	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH13	HGNC	protein_coding	OTTHUMT00000432917.1	0	0		33	33		0.00		C	NM_001257		83813649	+1	4		31		tier1	no_errors	ENST00000566620	ensembl	human	known	74_37	silent	11.43		SNP	0.998	T	4	31
DNAH11	8701	genome.wustl.edu	37	7	21757493	21757493	+	Silent	SNP	A	A	C			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr7:21757493A>C	ENST00000409508.3	+	43	7115	c.7084A>C	c.(7084-7086)Aga>Cga	p.R2362R	DNAH11_ENST00000328843.6_Silent_p.R2369R	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2369	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GGATAAACTGAGAACAAGCTT	0.423									Kartagener syndrome				ENSG00000105877																																					0													159.0	152.0	154.0					7																	21757493		1895	4113	6008	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.7084A>C	7.37:g.21757493A>C			Q9UJ82	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R2369	ENST00000409508.3	37	c.7105		7																																																																																			-	DH11	-	NULL		0.423	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DH11	HGNC	protein_coding	OTTHUMT00000326582.6	0	0		45	45		0.00		A	NM_003777		21757493	+1	6		34		tier1	no_errors	ENST00000328843	ensembl	human	known	74_37	silent	15.00		SNP	1.000	C	6	34
TTN	7273	genome.wustl.edu	37	2	179510603	179510603	+	Intron	SNP	A	A	G			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr2:179510603A>G	ENST00000591111.1	-	167	35710				TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000342175.6_Intron|RP11-171I2.3_ENST00000605021.1_lincRNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTGGATAGAAGTTTGAAGCA	0.388													ENSG00000237298																																					0													66.0	62.0	63.0					2																	179510603		1820	4078	5898	SO:0001627	intron_variant	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35485+43T>C	2.37:g.179510603A>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	R	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			-	TTN-AS1	-	-		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1	0	0		42	42		0.00		A	NM_133378		179510603	+1	24		11		tier1	no_errors	ENST00000418062	ensembl	human	known	74_37	rna	68.57		SNP	0.000	G	24	11
MALAT1	378938	genome.wustl.edu	37	11	65271779	65271780	+	lincRNA	INS	-	-	T	rs113635851|rs36002528		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr11:65271779_65271780insT	ENST00000534336.1	+	0	6547_6548					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CTTGTTGTAGCTTTTTTTTTTT	0.431													ENSG00000251562																																					0																																												0				AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271790_65271790dupT				R	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																				MALAT1	-	-		0.431	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	0	0		30	30		0.00		-	NR_002819		65271780	+1	5		30		tier1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	14.29		INS	0.994:0.994	T	5	30
GYS2	2998	genome.wustl.edu	37	12	21716178	21716178	+	Nonsense_Mutation	SNP	G	G	A	rs267603422		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr12:21716178G>A	ENST00000261195.2	-	6	1179	c.925C>T	c.(925-927)Cga>Tga	p.R309*		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	309					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AAATGACCTCGAACAAAATCT	0.323													ENSG00000111713																									Colon(149;9 1820 3690 10544 50424)												0													81.0	85.0	83.0					12																	21716178		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.925C>T	12.37:g.21716178G>A	ENSP00000261195:p.Arg309*		A0AVD8	Nonsense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1	p.R309*	ENST00000261195.2	37	c.925	CCDS8690.1	12	.	.	.	.	.	.	.	.	.	.	G	39	7.590206	0.98378	.	.	ENSG00000111713	ENST00000261195	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.799	13.6703	0.62420	0.0:0.0:0.8457:0.1543	.	.	.	.	X	309	.	ENSP00000261195:R309X	R	-	1	2	GYS2	21607445	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.069000	0.57541	2.650000	0.89964	0.655000	0.94253	CGA	-	GYS2	-	pfam_Glycogen_synth		0.323	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS2	HGNC	protein_coding	OTTHUMT00000402396.1	0	0		33	33		0.00		G	NM_021957		21716178	-1	14		28		tier1	no_errors	ENST00000261195	ensembl	human	known	74_37	nonsense	33.33		SNP	1.000	A	14	28
ABCC2	1244	genome.wustl.edu	37	10	101590148	101590148	+	Missense_Mutation	SNP	C	C	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr10:101590148C>A	ENST00000370449.4	+	20	2818	c.2705C>A	c.(2704-2706)aCc>aAc	p.T902N		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	902					cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	GCCTCCATAACCATGAGAAGA	0.483													ENSG00000023839																																					0													138.0	135.0	136.0					10																	101590148		2203	4300	6503	SO:0001583	missense	0			-	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.2705C>A	10.37:g.101590148C>A	ENSP00000359478:p.Thr902Asn		B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.T902N	ENST00000370449.4	37	c.2705	CCDS7484.1	10	.	.	.	.	.	.	.	.	.	.	C	12.33	1.905188	0.33628	.	.	ENSG00000023839	ENST00000370449	D	0.89196	-2.48	5.28	2.43	0.29744	.	0.148253	0.64402	D	0.000012	D	0.83903	0.5355	M	0.62723	1.935	0.80722	D	1	B	0.25772	0.134	B	0.23018	0.043	T	0.74893	-0.3509	10	0.37606	T	0.19	-11.815	5.9048	0.18986	0.1406:0.6505:0.1354:0.0735	.	902	Q92887	MRP2_HUMAN	N	902	ENSP00000359478:T902N	ENSP00000359478:T902N	T	+	2	0	ABCC2	101580138	1.000000	0.71417	0.984000	0.44739	0.816000	0.46133	1.354000	0.34056	0.233000	0.21120	-0.254000	0.11334	ACC	-	ABCC2	-	tigrfam_Multidrug-R_assoc		0.483	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	HGNC	protein_coding	OTTHUMT00000049825.1	0	0		58	58		0.00		C	NM_000392		101590148	+1	4		37		tier1	no_errors	ENST00000370449	ensembl	human	known	74_37	missense	9.76		SNP	1.000	A	4	37
RP1-29C18.10	0	genome.wustl.edu	37	22	49947411	49947411	+	RNA	SNP	A	A	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr22:49947411A>T	ENST00000391625.2	+	0	1184																											TCCTAGGAACACGCAGCATCC	0.607													ENSG00000212939																																					0																																												0			-																													22.37:g.49947411A>T				R	SNP	-	NULL	ENST00000391625.2	37	NULL		22																																																																																			-	RP1-29C18.10	-	-		0.607	RP1-29C18.10-001	KNOWN	basic	antisense	ENSG00000212939	Clone_based_vega_gene	antisense	OTTHUMT00000317431.1	0	0		31	31		0.00		A			49947411	+1	13		1		tier1	no_errors	ENST00000391625	ensembl	human	known	74_37	rna	92.86		SNP	0.000	T	13	1
CBX8	57332	genome.wustl.edu	37	17	77770335	77770335	+	Missense_Mutation	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr17:77770335C>T	ENST00000269385.4	-	2	191	c.74G>A	c.(73-75)cGc>cAc	p.R25H	CBX8_ENST00000485449.1_Intron	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	25	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.				histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GTATTCCATGCGTCCCTGCGG	0.473													ENSG00000141570																																					0													142.0	125.0	131.0					17																	77770335		2203	4300	6503	SO:0001583	missense	0			-	AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.74G>A	17.37:g.77770335C>T	ENSP00000269385:p.Arg25His		Q96H39|Q9NR07	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.R25H	ENST00000269385.4	37	c.74	CCDS11765.1	17	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633558	0.87660	.	.	ENSG00000141570	ENST00000269385;ENST00000413392	T;T	0.73047	-0.71;0.91	4.6	4.6	0.57074	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.52532	D	0.000061	T	0.81240	0.4781	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81529	-0.0891	10	0.45353	T	0.12	-16.0757	17.7777	0.88514	0.0:1.0:0.0:0.0	.	25	Q9HC52	CBX8_HUMAN	H	25;15	ENSP00000269385:R25H;ENSP00000405058:R15H	ENSP00000269385:R25H	R	-	2	0	CBX8	75384930	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.418000	0.80167	2.271000	0.75665	0.491000	0.48974	CGC	-	CBX8	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow		0.473	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX8	HGNC	protein_coding	OTTHUMT00000318011.1	0	0		29	29		0.00		C	NM_020649		77770335	-1	5		28		tier1	no_errors	ENST00000269385	ensembl	human	known	74_37	missense	15.15		SNP	1.000	T	5	28
PLD1	5337	genome.wustl.edu	37	3	171452702	171452702	+	Missense_Mutation	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr3:171452702G>A	ENST00000351298.4	-	5	619	c.493C>T	c.(493-495)Cgt>Tgt	p.R165C	PLD1_ENST00000342215.6_Missense_Mutation_p.R165C|PLD1_ENST00000356327.5_Missense_Mutation_p.R165C|PLD1_ENST00000340989.4_Missense_Mutation_p.R165C	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	165	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TCAGATGAACGGGGCAAACTG	0.403													ENSG00000075651																									NSCLC(149;2174 3517 34058)												0													144.0	151.0	148.0					3																	171452702		2203	4300	6503	SO:0001583	missense	0			-	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.493C>T	3.37:g.171452702G>A	ENSP00000342793:p.Arg165Cys			Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.R165C	ENST00000351298.4	37	c.493	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735501	0.69189	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989	T;T;T;T	0.33865	3.29;3.28;1.39;3.14	5.82	2.92	0.33932	Phox homologous domain (5);	0.204873	0.50627	D	0.000114	T	0.48732	0.1516	L	0.52905	1.665	0.24603	N	0.993763	D;D	0.62365	0.991;0.965	P;P	0.58970	0.849;0.849	T	0.44236	-0.9341	10	0.54805	T	0.06	-1.6483	13.2567	0.60083	0.0:0.0:0.5829:0.4171	.	188;165	Q59EA4;Q13393	.;PLD1_HUMAN	C	165	ENSP00000348681:R165C;ENSP00000342793:R165C;ENSP00000339936:R165C;ENSP00000340326:R165C	ENSP00000340326:R165C	R	-	1	0	PLD1	172935396	0.974000	0.33945	0.159000	0.22649	0.962000	0.63368	2.226000	0.42963	0.298000	0.22638	0.655000	0.94253	CGT	-	PLD1	-	pfam_Phox,superfamily_Phox,smart_Phox,pirsf_PLipase_D_euk,pfscan_Phox		0.403	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	0	0		20	20		0.00		G	NM_002662		171452702	-1	5		10		tier1	no_errors	ENST00000351298	ensembl	human	known	74_37	missense	33.33		SNP	0.024	A	5	10
BCL6B	255877	genome.wustl.edu	37	17	6928000	6928000	+	Missense_Mutation	SNP	C	C	A	rs200357355		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr17:6928000C>A	ENST00000293805.5	+	4	774	c.682C>A	c.(682-684)Ccc>Acc	p.P228T		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	228					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						AGCCAGGCTCCCCAGTGGAGA	0.582													ENSG00000161940																																					0													27.0	34.0	31.0					17																	6928000		2081	4189	6270	SO:0001583	missense	0			-	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.682C>A	17.37:g.6928000C>A	ENSP00000293805:p.Pro228Thr		Q6PCB4	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P228T	ENST00000293805.5	37	c.682	CCDS42248.1	17	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808568	0.31961	.	.	ENSG00000161940	ENST00000293805	T	0.09255	3.0	5.54	3.47	0.39725	.	0.184523	0.49305	D	0.000159	T	0.04679	0.0127	N	0.08118	0	0.32296	N	0.565649	B	0.32160	0.358	B	0.26517	0.07	T	0.11867	-1.0570	10	0.46703	T	0.11	.	6.8417	0.23967	0.0:0.7145:0.1913:0.0942	.	228	Q8N143	BCL6B_HUMAN	T	228	ENSP00000293805:P228T	ENSP00000293805:P228T	P	+	1	0	BCL6B	6868724	0.189000	0.23263	0.998000	0.56505	0.966000	0.64601	1.231000	0.32624	1.567000	0.49668	0.655000	0.94253	CCC	-	BCL6B	-	NULL		0.582	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6B	HGNC	protein_coding	OTTHUMT00000439455.2	0	0		46	46		0.00		C	NM_181844		6928000	+1	4		39		tier1	no_errors	ENST00000293805	ensembl	human	known	74_37	missense	9.30		SNP	0.457	A	4	39
TPTE2P2	644623	genome.wustl.edu	37	13	52793775	52793776	+	RNA	INS	-	-	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr13:52793775_52793776insA	ENST00000451298.1	-	0	1229				TPTE2P2_ENST00000606973.1_RNA																							CCTAAGAATAGAAAAAAAAATT	0.292													ENSG00000272281																																					0																																												0																																13.37:g.52793784_52793784dupA				R	INS	-	NULL	ENST00000451298.1	37	NULL		13																																																																																				TPTE2P2	-	-		0.292	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	TPTE2P2	HGNC	processed_transcript	OTTHUMT00000471093.1	0	0		15	15		0.00		-			52793776	-1	3		23		tier1	no_errors	ENST00000606973	ensembl	human	known	74_37	rna	11.54		INS	0.002:0.003	A	3	23
CDK5RAP2	55755	genome.wustl.edu	37	9	123215781	123215781	+	Missense_Mutation	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr9:123215781G>A	ENST00000349780.4	-	21	2925	c.2746C>T	c.(2746-2748)Cct>Tct	p.P916S	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.P916S|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.P884S|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.P916S	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	916					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TGCCACCCAGGCACCCCGTGC	0.478													ENSG00000136861																																					0													80.0	85.0	83.0					9																	123215781		2203	4300	6503	SO:0001583	missense	0			-	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.2746C>T	9.37:g.123215781G>A	ENSP00000343818:p.Pro916Ser		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.P916S	ENST00000349780.4	37	c.2746	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735883	0.49045	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449	T;T;T;T;T	0.16597	4.0;3.81;4.02;3.92;2.33	5.42	3.58	0.41010	.	0.327733	0.26594	N	0.023505	T	0.12774	0.0310	N	0.20986	0.625	0.09310	N	1	B;P;B;B	0.45531	0.157;0.86;0.036;0.154	B;P;B;B	0.47075	0.082;0.536;0.037;0.082	T	0.07927	-1.0747	10	0.36615	T	0.2	.	4.5935	0.12319	0.1791:0.0:0.6456:0.1753	.	685;916;916;310	Q6MZT4;Q96SN8-4;Q96SN8;B1AMJ5	.;.;CK5P2_HUMAN;.	S	884;916;916;916;310	ENSP00000354065:P884S;ENSP00000352258:P916S;ENSP00000343818:P916S;ENSP00000353317:P916S;ENSP00000400395:P310S	ENSP00000343818:P916S	P	-	1	0	CDK5RAP2	122255602	0.016000	0.18221	0.006000	0.13384	0.003000	0.03518	0.796000	0.26986	1.276000	0.44395	0.650000	0.86243	CCT	-	CDK5RAP2	-	NULL		0.478	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	0	0		38	38		0.00		G	NM_018249		123215781	-1	4		35		tier1	no_errors	ENST00000349780	ensembl	human	known	74_37	missense	10.26		SNP	0.003	A	4	35
PRDM13	59336	genome.wustl.edu	37	6	100062378	100062378	+	Missense_Mutation	SNP	C	C	T			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr6:100062378C>T	ENST00000369215.4	+	4	2172	c.1867C>T	c.(1867-1869)Cac>Tac	p.H623Y		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	623					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		CATCCGGCTGCACGCCGAGGG	0.637													ENSG00000112238																																					0													32.0	36.0	35.0					6																	100062378		2063	4207	6270	SO:0001583	missense	0			-	AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.1867C>T	6.37:g.100062378C>T	ENSP00000358217:p.His623Tyr		Q5TGC1|Q5TGC2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.H623Y	ENST00000369215.4	37	c.1867	CCDS43487.1	6	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725595	0.89298	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	D;D	0.88896	-2.44;-2.44	5.44	5.44	0.79542	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43747	D	0.000528	D	0.95175	0.8436	M	0.89214	3.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.95618	0.8678	10	0.87932	D	0	-27.0114	18.8666	0.92294	0.0:1.0:0.0:0.0	.	623	Q9H4Q3	PRD13_HUMAN	Y	623;633	ENSP00000358217:H623Y;ENSP00000358216:H633Y	ENSP00000358216:H633Y	H	+	1	0	PRDM13	100169099	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.738000	0.84966	2.566000	0.86566	0.561000	0.74099	CAC	-	PRDM13	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.637	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM13	HGNC	protein_coding	OTTHUMT00000041619.2	0	0		19	19		0.00		C			100062378	+1	4		14		tier1	no_errors	ENST00000369215	ensembl	human	known	74_37	missense	22.22		SNP	1.000	T	4	14
COL4A2	1284	genome.wustl.edu	37	13	111160095	111160099	+	Intron	DEL	GAGTC	GAGTC	-	rs76428347	byFrequency	TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	GAGTC	GAGTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr13:111160095_111160099delGAGTC	ENST00000360467.5	+	47	4900				COL4A2-AS1_ENST00000417970.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			AATGCCAGTGGAGTCTGATCAAAAA	0.498													ENSG00000232814		219	0.04373	0.0053	0.0346	5008	,	,		21319	0.0754		0.0507	False		,,,				2504	0.0624																0																																										SO:0001627	intron_variant	0				AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.4595-183GAGTC>-	13.37:g.111160095_111160099delGAGTC			Q14052|Q548C3|Q5VZA9|Q66K23	Splice_Site	DEL	-	NULL	ENST00000360467.5	37	c.NULL	CCDS41907.1	13																																																																																				COL4A2-AS1	-	-		0.498	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2-AS1	HGNC	protein_coding	OTTHUMT00000045761.2									GAGTC	NM_001846		111160099	-1					tier1	no_errors	ENST00000417970	ensembl	human	known	74_37	splice_site_del			DEL	0.000:0.001:0.009:0.008:0.007	-		
RDX	5962	genome.wustl.edu	37	11	110070369	110070369	+	Missense_Mutation	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr11:110070369G>A	ENST00000528498.1	-	15	2092	c.1783C>T	c.(1783-1785)Cgc>Tgc	p.R595C	RDX_ENST00000530301.1_Missense_Mutation_p.R191C|RDX_ENST00000528900.1_Missense_Mutation_p.R248C|RDX_ENST00000405097.1_Missense_Mutation_p.R595C	NM_001260493.1	NP_001247422.1	P35241	RADI_HUMAN	radixin	0					actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		tggcaagagcgcatctggaac	0.473													ENSG00000137710																									Esophageal Squamous(55;25 1062 11040 28755 44273)												0																																										SO:0001583	missense	0			-	BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000528498.1:c.1783C>T	11.37:g.110070369G>A	ENSP00000432112:p.Arg595Cys		A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.R595C	ENST00000528498.1	37	c.1783	CCDS58174.1	11	.	.	.	.	.	.	.	.	.	.	G	16.26	3.073297	0.55646	.	.	ENSG00000137710	ENST00000528498;ENST00000405097;ENST00000528900;ENST00000530301	T;T;T;T	0.81330	-1.48;-1.48;0.9;-1.35	4.79	4.79	0.61399	.	.	.	.	.	D	0.87728	0.6250	.	.	.	0.80722	D	1	D;D	0.63046	0.976;0.992	P;D	0.63877	0.689;0.919	D	0.88284	0.2938	8	0.87932	D	0	.	13.6483	0.62294	0.0:0.0:1.0:0.0	.	191;595	A7YIK0;A7YIJ8	.;.	C	595;595;248;191	ENSP00000432112:R595C;ENSP00000384136:R595C;ENSP00000433580:R248C;ENSP00000436277:R191C	ENSP00000384136:R595C	R	-	1	0	RDX	109575579	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.817000	0.55668	2.941000	0.99782	0.655000	0.94253	CGC	-	RDX	-	NULL		0.473	RDX-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	RDX	HGNC	protein_coding	OTTHUMT00000390531.1	0	0		43	43		0.00		G	NM_002906		110070369	-1	3		22		tier1	no_errors	ENST00000530749	ensembl	human	known	74_37	missense	12.00		SNP	1.000	A	3	22
TNS3	64759	genome.wustl.edu	37	7	47343111	47343111	+	Missense_Mutation	SNP	C	C	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr7:47343111C>A	ENST00000398879.1	-	22	3260	c.2894G>T	c.(2893-2895)cGg>cTg	p.R965L	TNS3_ENST00000355730.3_Missense_Mutation_p.R725L|TNS3_ENST00000311160.9_Missense_Mutation_p.R965L			Q68CZ2	TENS3_HUMAN	tensin 3	965					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						TCCGGTGGGCCGGCCGCTCCC	0.632													ENSG00000136205																																					0													16.0	21.0	19.0					7																	47343111		2001	4161	6162	SO:0001583	missense	0			-	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.2894G>T	7.37:g.47343111C>A	ENSP00000381854:p.Arg965Leu		B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.R965L	ENST00000398879.1	37	c.2894	CCDS5506.2	7	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289350	0.40494	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000545849;ENST00000457718	D;D;D;D	0.94537	-2.99;-2.99;-3.45;-3.22	5.69	2.62	0.31277	.	0.393093	0.20627	N	0.088666	D	0.86280	0.5895	L	0.34521	1.04	0.80722	D	1	P	0.37276	0.589	B	0.29524	0.103	T	0.79060	-0.1958	10	0.09590	T	0.72	-12.909	8.4002	0.32581	0.0:0.7292:0.0:0.2708	.	965	Q68CZ2	TENS3_HUMAN	L	965;1075;965;725;421;1068	ENSP00000312143:R965L;ENSP00000381854:R965L;ENSP00000347968:R725L;ENSP00000414358:R1068L	ENSP00000312143:R965L	R	-	2	0	TNS3	47309636	0.975000	0.34042	0.901000	0.35422	0.560000	0.35617	0.253000	0.18296	0.232000	0.21100	0.650000	0.86243	CGG	-	TNS3	-	NULL		0.632	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	HGNC	protein_coding	OTTHUMT00000157253.1	0	0		25	25		0.00		C	NM_022748		47343111	-1	6		9		tier1	no_errors	ENST00000311160	ensembl	human	known	74_37	missense	40.00		SNP	0.977	A	6	9
ABR	29	genome.wustl.edu	37	17	961175	961175	+	Intron	SNP	C	C	G			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr17:961175C>G	ENST00000302538.5	-	12	1528				ABR_ENST00000536794.2_Intron|ABR_ENST00000291107.2_Intron|ABR_ENST00000573895.1_Intron|ABR_ENST00000574437.1_Intron|ABR_ENST00000544583.2_Intron	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related						actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		atgccacggacatcattGGGG	0.512													ENSG00000159842																									Esophageal Squamous(197;2016 2115 4129 29033 46447)												0													171.0	125.0	140.0					17																	961175		2203	4300	6503	SO:0001627	intron_variant	0			-	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1381+34G>C	17.37:g.961175C>G			B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	R	SNP	-	NULL	ENST00000302538.5	37	NULL	CCDS10999.1	17																																																																																			-	ABR	-	-		0.512	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	HGNC	protein_coding	OTTHUMT00000206675.4	0	0		26	26		0.00		C			961175	-1	7		23		tier1	no_errors	ENST00000575770	ensembl	human	known	74_37	rna	23.33		SNP	0.000	G	7	23
FHL3	2275	genome.wustl.edu	37	1	38463098	38463098	+	Silent	SNP	G	G	A			TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr1:38463098G>A	ENST00000373016.3	-	6	990	c.822C>T	c.(820-822)ggC>ggT	p.G274G	FHL3_ENST00000485803.1_5'UTR	NM_001243878.1|NM_004468.4	NP_001230807.1|NP_004459.2	Q13643	FHL3_HUMAN	four and a half LIM domains 3	274	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|muscle organ development (GO:0007517)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)|Z disc (GO:0030018)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CCTGGCTACAGCCCTGGCAGA	0.637													ENSG00000183386																																					0													61.0	66.0	65.0					1																	38463098		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC011697	CCDS30678.1	1p34.3	2008-02-05			ENSG00000183386	ENSG00000183386			3704	protein-coding gene	gene with protein product		602790				8753811, 10226657	Standard	NM_004468		Approved	SLIM2	uc001cck.3	Q13643	OTTHUMG00000004434	ENST00000373016.3:c.822C>T	1.37:g.38463098G>A			D3DPT6|Q6I9T0|Q9BVA2	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.G274	ENST00000373016.3	37	c.822	CCDS30678.1	1																																																																																			-	FHL3	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.637	FHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHL3	HGNC	protein_coding	OTTHUMT00000012958.1	0	0		39	39		0.00		G	NM_004468		38463098	-1	4		20		tier1	no_errors	ENST00000373016	ensembl	human	known	74_37	silent	16.67		SNP	0.992	A	4	20
CTD-2311B13.7	0	genome.wustl.edu	37	14	19969313	19969313	+	lincRNA	SNP	T	T	A	rs201001641		TCGA-PT-A8TR-01A-11D-A37C-09	TCGA-PT-A8TR-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a50049df-aa30-4674-8d4b-59c52a4e6a72	cc16650a-701b-47d5-83f5-556b0619165a	g.chr14:19969313T>A	ENST00000547399.1	-	0	2979																											GTCTTCACCATTGTGTAGTTT	0.274													ENSG00000257931																																					0																																												0			-																													14.37:g.19969313T>A				R	SNP	-	NULL	ENST00000547399.1	37	NULL		14																																																																																			rs201001641	CTD-2311B13.7	-	-		0.274	CTD-2311B13.7-001	KNOWN	basic	lincRNA	ENSG00000257931	Clone_based_vega_gene	lincRNA	OTTHUMT00000409457.1	0	0		13	13		0.00		T			19969313	-1	4		8		tier1	no_errors	ENST00000547399	ensembl	human	known	74_37	rna	33.33		SNP	0.005	A	4	8
