#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SIPA1	6494	genome.wustl.edu	37	11	65413771	65413771	+	Missense_Mutation	SNP	C	C	T	rs370772263		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr11:65413771C>T	ENST00000394224.3	+	7	1639	c.1343C>T	c.(1342-1344)aCc>aTc	p.T448I	SIPA1_ENST00000394227.3_Missense_Mutation_p.T448I|MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000527525.1_Missense_Mutation_p.T448I|SIPA1_ENST00000534313.1_Missense_Mutation_p.T448I	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	448	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						TTCTGCCCCACCACCATCCGC	0.627													ENSG00000213445																																					0								C	ILE/THR,ILE/THR	1,4401	2.1+/-5.4	0,1,2200	126.0	115.0	119.0		1343,1343	1.9	1.0	11		119	0,8594		0,0,4297	no	missense,missense	SIPA1	NM_006747.3,NM_153253.29	89,89	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	448/1043,448/1043	65413771	1,12995	2201	4297	6498	SO:0001583	missense	0			-	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.1343C>T	11.37:g.65413771C>T	ENSP00000377771:p.Thr448Ile		O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.T448I	ENST00000394224.3	37	c.1343	CCDS8108.1	11	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111376	0.56398	2.27E-4	0.0	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31	4.03	1.87	0.25490	Rap/ran-GAP (2);	0.275689	0.22887	U	0.054426	D	0.82490	0.5048	N	0.05078	-0.115	0.21841	N	0.999513	B;B	0.27286	0.144;0.174	B;B	0.28139	0.069;0.086	T	0.74962	-0.3485	10	0.51188	T	0.08	-5.9137	6.7977	0.23734	0.1878:0.4462:0.366:0.0	.	448;448	F6RY50;Q96FS4	.;SIPA1_HUMAN	I	448	ENSP00000436269:T448I;ENSP00000433686:T448I;ENSP00000377771:T448I;ENSP00000377774:T448I	ENSP00000377771:T448I	T	+	2	0	SIPA1	65170347	0.000000	0.05858	0.956000	0.39512	0.823000	0.46562	0.688000	0.25422	0.995000	0.38917	0.462000	0.41574	ACC	-	SIPA1	-	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom		0.627	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SIPA1	HGNC	protein_coding	OTTHUMT00000390356.1	0	0	0	42	42	51	0.00	0.00	C	NM_006747		65413771	+1	5	8	29	38	tier1	no_errors	ENST00000394224	ensembl	human	known	74_37	missense	14.71	17.39	SNP	0.810	T	5	29
SLCO4A1	28231	genome.wustl.edu	37	20	61290029	61290029	+	Splice_Site	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr20:61290029C>T	ENST00000370507.1	+	2	893	c.797C>T	c.(796-798)gCc>gTc	p.A266V	SLCO4A1_ENST00000217159.1_Splice_Site_p.A266V			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	266					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TCTCTCGCAGCCATCTTCTAC	0.682													ENSG00000101187																									Pancreas(168;741 2006 10379 40139 45334)												0													25.0	23.0	24.0					20																	61290029		2200	4300	6500	SO:0001630	splice_region_variant	0			-	AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.797-1C>T	20.37:g.61290029C>T			Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.A266V	ENST00000370507.1	37	c.797	CCDS13501.1	20	.	.	.	.	.	.	.	.	.	.	C	14.54	2.565274	0.45694	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507	T;T	0.48201	0.82;0.82	4.42	3.44	0.39384	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.133866	0.47852	D	0.000210	T	0.71879	0.3392	M	0.90977	3.165	0.41003	D	0.984944	D	0.57257	0.979	D	0.66979	0.948	T	0.77970	-0.2387	9	.	.	.	.	12.3135	0.54942	0.0:0.829:0.171:0.0	.	266	Q96BD0	SO4A1_HUMAN	V	266	ENSP00000217159:A266V;ENSP00000359538:A266V	.	A	+	2	0	SLCO4A1	60760474	0.987000	0.35691	0.977000	0.42913	0.054000	0.15201	2.176000	0.42500	0.789000	0.33779	0.561000	0.74099	GCC	-	SLCO4A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.682	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4A1	HGNC	protein_coding	OTTHUMT00000080048.2	0	0	0	30	30	10	0.00	0.00	C	NM_016354	Missense_Mutation	61290029	+1	11	4	62	15	tier1	no_errors	ENST00000217159	ensembl	human	known	74_37	missense	15.07	21.05	SNP	0.995	T	11	62
RYR2	6262	genome.wustl.edu	37	1	237755055	237755055	+	Missense_Mutation	SNP	A	A	C			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr1:237755055A>C	ENST00000366574.2	+	32	4494	c.4177A>C	c.(4177-4179)Aca>Cca	p.T1393P	RYR2_ENST00000542537.1_Missense_Mutation_p.T1377P|RYR2_ENST00000360064.6_Missense_Mutation_p.T1391P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1393	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTTAGAAGAACAAAGCCAGA	0.378													ENSG00000198626																																					0													106.0	101.0	103.0					1																	237755055		1877	4115	5992	SO:0001583	missense	0			-	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4177A>C	1.37:g.237755055A>C	ENSP00000355533:p.Thr1393Pro		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.T1391P	ENST00000366574.2	37	c.4171	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	a	15.34	2.804480	0.50315	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96716	-4.1;-4.06;-4.09	5.52	5.52	0.82312	B30.2/SPRY domain (1);	0.234953	0.27311	N	0.019947	D	0.90215	0.6941	N	0.14661	0.345	0.80722	D	1	P	0.47350	0.894	B	0.35550	0.205	D	0.90369	0.4379	10	0.28530	T	0.3	-13.4296	15.8169	0.78608	1.0:0.0:0.0:0.0	.	1393	Q92736	RYR2_HUMAN	P	1393;1391;1377	ENSP00000355533:T1393P;ENSP00000353174:T1391P;ENSP00000443798:T1377P	ENSP00000353174:T1391P	T	+	1	0	RYR2	235821678	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.228000	0.72288	2.311000	0.77944	0.528000	0.53228	ACA	-	RYR2	-	pfscan_B30.2/SPRY		0.378	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	0	0	0	54	54	64	0.00	0.00	A	NM_001035		237755055	+1	8	10	25	59	tier1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	24.24	14.49	SNP	1.000	C	8	25
TTL	150465	genome.wustl.edu	37	2	113286955	113286955	+	3'UTR	SNP	G	G	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr2:113286955G>A	ENST00000233336.6	+	0	1908				TTL_ENST00000460450.1_3'UTR	NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase						cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)			breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		GTTTGTGCGGGTTGGGCCCCA	0.498			T	ETV6	ALL								ENSG00000114999																												Dom	yes		2	2q13	150465	tubulin tyrosine ligase		L	0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.*583G>A	2.37:g.113286955G>A			Q585T3|Q7Z302|Q8N426	R	SNP	-	NULL	ENST00000233336.6	37	NULL	CCDS2096.1	2																																																																																			-	TTL	-	-		0.498	TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTL	HGNC	protein_coding	OTTHUMT00000254085.2	0	0	0	33	33	107	0.00	0.00	G	NM_153712		113286955	+1	17	36	34	48	tier1	no_errors	ENST00000460450	ensembl	human	known	74_37	rna	33.33	42.86	SNP	0.000	A	17	34
CEACAM18	729767	genome.wustl.edu	37	19	51986521	51986521	+	Nonsense_Mutation	SNP	C	C	G			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr19:51986521C>G	ENST00000396477.4	+	4	945	c.924C>G	c.(922-924)taC>taG	p.Y308*	CEACAM18_ENST00000451626.1_Nonsense_Mutation_p.Y369*	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	308	Ig-like C2-type.									breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TGATCATGTACATGGACGTCA	0.582													ENSG00000213822																																					0													79.0	80.0	79.0					19																	51986521		2106	4232	6338	SO:0001587	stop_gained	0			-			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.924C>G	19.37:g.51986521C>G	ENSP00000379738:p.Tyr308*		C9JN24	Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Y369*	ENST00000396477.4	37	c.1107		19	.	.	.	.	.	.	.	.	.	.	.	10.53	1.376803	0.24857	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	.	.	.	2.53	1.48	0.22813	.	.	.	.	.	.	.	.	.	.	.	0.53005	D	0.999962	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	5.5634	0.17157	0.0:0.8393:0.0:0.1607	.	.	.	.	X	369;308;308	.	ENSP00000379738:Y308X	Y	+	3	2	CEACAM18	56678333	0.001000	0.12720	0.021000	0.16686	0.001000	0.01503	-0.139000	0.10358	0.670000	0.31165	-0.467000	0.05162	TAC	-	CEACAM18	-	smart_Ig_sub,pfscan_Ig-like_dom		0.582	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	HGNC	protein_coding	OTTHUMT00000323114.2	0	0	0	49	49	46	0.00	0.00	C			51986521	+1	17	22	61	45	tier1	no_errors	ENST00000451626	ensembl	human	known	74_37	nonsense	21.79	32.84	SNP	0.022	G	17	61
TRPM2	7226	genome.wustl.edu	37	21	45858991	45858991	+	Silent	SNP	G	G	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr21:45858991G>A	ENST00000397928.1	+	30	4654	c.4209G>A	c.(4207-4209)aaG>aaA	p.K1403K	TRPM2_ENST00000397932.2_Silent_p.K1453K|TRPM2_ENST00000300482.5_Silent_p.K1403K|snoZ6_ENST00000581669.1_RNA|TRPM2_ENST00000300481.9_Silent_p.K1349K|TRPM2_ENST00000498430.1_3'UTR|snoZ6_ENST00000583496.1_RNA	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	1403	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GGAAGCTGAAGCGGATCCTCC	0.617													ENSG00000142185																																					0													95.0	72.0	80.0					21																	45858991		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.4209G>A	21.37:g.45858991G>A			D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.K1403	ENST00000397928.1	37	c.4209	CCDS13710.1	21																																																																																			-	TRPM2	-	superfamily_NUDIX_hydrolase_dom-like		0.617	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	0	0	0	17	17	28	0.00	0.00	G	NM_003307		45858991	+1	6	11	3	13	tier1	no_errors	ENST00000300482	ensembl	human	known	74_37	silent	60.00	45.83	SNP	0.903	A	6	3
FRMPD4	9758	genome.wustl.edu	37	X	12736058	12736058	+	Missense_Mutation	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chrX:12736058C>T	ENST00000380682.1	+	16	3619	c.3113C>T	c.(3112-3114)gCa>gTa	p.A1038V		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1038					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GAGGGGAAGGCACCCCCTAAT	0.512													ENSG00000169933																																					0													98.0	80.0	86.0					X																	12736058		2203	4300	6503	SO:0001583	missense	0			-	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3113C>T	X.37:g.12736058C>T	ENSP00000370057:p.Ala1038Val		A8K0X9|O15032	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_dom	p.A1038V	ENST00000380682.1	37	c.3113	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	C	0.828	-0.746395	0.03065	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.05513	3.43	5.14	0.197	0.15164	.	1.212630	0.05473	N	0.553496	T	0.05318	0.0141	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.46652	-0.9176	10	0.15499	T	0.54	0.1566	5.8467	0.18669	0.0:0.4909:0.2263:0.2829	.	1030;1038	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	V	1038;1029;1027	ENSP00000370057:A1038V	ENSP00000304583:A1027V	A	+	2	0	FRMPD4	12645979	0.001000	0.12720	0.009000	0.14445	0.189000	0.23516	0.195000	0.17155	-0.137000	0.11455	0.513000	0.50165	GCA	-	FRMPD4	-	NULL		0.512	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1	0	0	0	15	15	65	0.00	0.00	C	XM_045712		12736058	+1	13	57	5	27	tier1	no_errors	ENST00000380682	ensembl	human	known	74_37	missense	72.22	67.86	SNP	0.003	T	13	5
NPAP1	23742	genome.wustl.edu	37	15	24923532	24923532	+	Missense_Mutation	SNP	T	T	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr15:24923532T>A	ENST00000329468.2	+	1	2992	c.2518T>A	c.(2518-2520)Ttt>Att	p.F840I		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	840					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GCAGTCTACCTTTGTCTCCAG	0.507													ENSG00000185823																																					0													116.0	105.0	109.0					15																	24923532		2203	4300	6503	SO:0001583	missense	0			-	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2518T>A	15.37:g.24923532T>A	ENSP00000333735:p.Phe840Ile			Missense_Mutation	SNP	NULL	p.F840I	ENST00000329468.2	37	c.2518	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	12.19	1.863291	0.32884	.	.	ENSG00000185823	ENST00000329468	T	0.06528	3.29	1.83	-0.557	0.11800	.	.	.	.	.	T	0.03651	0.0104	N	0.22421	0.69	0.09310	N	1	B	0.27823	0.19	B	0.17722	0.019	T	0.41998	-0.9477	9	0.38643	T	0.18	.	4.2576	0.10724	0.0:0.4931:0.0:0.5069	.	840	Q9NZP6	CO002_HUMAN	I	840	ENSP00000333735:F840I	ENSP00000333735:F840I	F	+	1	0	C15orf2	22474625	0.003000	0.15002	0.000000	0.03702	0.052000	0.14988	-0.192000	0.09587	-0.150000	0.11195	0.338000	0.21704	TTT	-	NPAP1	-	NULL		0.507	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	0	0	0	42	42	101	0.00	0.00	T	NM_018958		24923532	+1	10	24	37	61	tier1	no_errors	ENST00000329468	ensembl	human	known	74_37	missense	21.28	28.24	SNP	0.000	A	10	37
RYR1	6261	genome.wustl.edu	37	19	38959746	38959746	+	Silent	SNP	C	C	T	rs559858324		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr19:38959746C>T	ENST00000359596.3	+	26	3522	c.3522C>T	c.(3520-3522)tcC>tcT	p.S1174S	RYR1_ENST00000355481.4_Silent_p.S1174S|RYR1_ENST00000360985.3_Silent_p.S1174S			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1174	6 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACTCAGGCTCCGAAACAGCCT	0.562													ENSG00000196218																																					0													107.0	91.0	97.0					19																	38959746		2203	4300	6503	SO:0001819	synonymous_variant	0			-	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3522C>T	19.37:g.38959746C>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.S1174	ENST00000359596.3	37	c.3522	CCDS33011.1	19																																																																																			-	RYR1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.562	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	0	0	0	11	11	57	0.00	0.00	C			38959746	+1	8	16	26	140	tier1	no_errors	ENST00000359596	ensembl	human	known	74_37	silent	23.53	10.26	SNP	0.032	T	8	26
PYCRL	65263	genome.wustl.edu	37	8	144688241	144688241	+	Silent	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr8:144688241C>T	ENST00000220966.6	-	5	698	c.669G>A	c.(667-669)caG>caA	p.Q223Q	PYCRL_ENST00000377579.3_Silent_p.Q74Q|RP11-661A12.14_ENST00000606452.1_lincRNA|PYCRL_ENST00000495276.1_5'UTR	NM_023078.3	NP_075566.2	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like	211					L-proline biosynthetic process (GO:0055129)		pyrroline-5-carboxylate reductase activity (GO:0004735)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		L-Proline(DB00172)	CCAGCAGGGTCTGGGCAGCGA	0.662													ENSG00000104524																																					0													23.0	23.0	23.0					8																	144688241		2199	4295	6494	SO:0001819	synonymous_variant	0			-	AF086378	CCDS6407.2	8q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000104524	ENSG00000104524			25846	protein-coding gene	gene with protein product							Standard	NM_023078		Approved	FLJ13852	uc003yyy.3	Q53H96	OTTHUMG00000157010	ENST00000220966.6:c.669G>A	8.37:g.144688241C>T			B3KMB5|B4DVT6|H0Y6C3|Q8N3N9|Q96HX4|Q9H896	Silent	SNP	superfamily_6-PGluconate_DH_C-like,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase	p.Q223	ENST00000220966.6	37	c.669	CCDS6407.2	8																																																																																			-	PYCRL	-	superfamily_6-PGluconate_DH_C-like,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase		0.662	PYCRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYCRL	HGNC	protein_coding	OTTHUMT00000347081.2	0	0	0	37	37	18	0.00	0.00	C	NM_023078		144688241	-1	4	3	27	15	tier1	no_errors	ENST00000220966	ensembl	human	known	74_37	silent	12.50	16.67	SNP	1.000	T	4	27
SMARCAL1	50485	genome.wustl.edu	37	2	217332750	217332750	+	Missense_Mutation	SNP	C	C	T	rs2271336		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr2:217332750C>T	ENST00000357276.4	+	14	2555	c.2225C>T	c.(2224-2226)aCg>aTg	p.T742M	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.T742M	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	742	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.		T -> M (in dbSNP:rs2271336).		cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.T742M(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GACGCAATTACGCAAGAGCTT	0.443									Schimke Immuno-Osseous Dysplasia				ENSG00000138375	C|||	1	0.000199681	0.0008	0.0	5008	,	,		19778	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						C	MET/THR,MET/THR	0,4406		0,0,2203	142.0	135.0	137.0		2225,2225	3.0	0.3	2	dbSNP_100	137	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SMARCAL1	NM_001127207.1,NM_014140.3	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	742/955,742/955	217332750	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SIOD	GMAF=0.0005	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2225C>T	2.37:g.217332750C>T	ENSP00000349823:p.Thr742Met		A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	pfam_HARP_dom,pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T742M	ENST00000357276.4	37	c.2225	CCDS2403.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	1.202	-0.632212	0.03584	0.0	1.16E-4	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	T;T;T	0.80653	-1.4;-1.4;-0.98	4.85	2.98	0.34508	Helicase, C-terminal (2);	0.469252	0.24318	N	0.039572	T	0.59838	0.2223	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.14578	0.011	T	0.52426	-0.8577	10	0.46703	T	0.11	-10.6659	7.2786	0.26297	0.0:0.6103:0.2183:0.1714	rs2271336;rs2271336	742	Q9NZC9	SMAL1_HUMAN	M	742;742;584	ENSP00000349823:T742M;ENSP00000350940:T742M;ENSP00000375974:T584M	ENSP00000349823:T742M	T	+	2	0	SMARCAL1	217040995	0.004000	0.15560	0.266000	0.24541	0.040000	0.13550	0.654000	0.24918	1.283000	0.44513	-0.137000	0.14449	ACG	rs2271336	SMARCAL1	-	superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.443	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	HGNC	protein_coding	OTTHUMT00000256671.2	0	0	0	46	46	120	0.00	0.00	C			217332750	+1	7	21	33	48	tier1	no_errors	ENST00000357276	ensembl	human	known	74_37	missense	17.50	30.43	SNP	0.016	T	7	33
CDH12	1010	genome.wustl.edu	37	5	21854900	21854900	+	Splice_Site	SNP	C	C	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr5:21854900C>A	ENST00000382254.1	-	7	1613		c.e7-1		CDH12_ENST00000504376.2_Splice_Site|CDH12_ENST00000522262.1_Intron|CDH12_ENST00000521384.1_Splice_Site	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ACATATGCACCTGGAAAATAA	0.418										HNSCC(59;0.17)			ENSG00000154162																																					0													97.0	89.0	92.0					5																	21854900		2203	4299	6502	SO:0001630	splice_region_variant	0			-	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.527-1G>T	5.37:g.21854900C>A			B2RBT1|B7Z2U6|Q86UD2	Splice_Site	SNP	-	e3-1	ENST00000382254.1	37	c.527-1	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466369	0.84425	.	.	ENSG00000154162	ENST00000504376;ENST00000382254	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.937	0.92589	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDH12	21890657	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.726000	0.84824	2.547000	0.85894	0.650000	0.86243	.	-	CDH12	-	-		0.418	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	0	0	0	76	76	128	0.00	0.00	C	NM_004061	Intron	21854900	-1	23	33	56	76	tier1	no_errors	ENST00000382254	ensembl	human	known	74_37	splice_site	29.11	30.28	SNP	1.000	A	23	56
STRC	161497	genome.wustl.edu	37	15	43893109	43893109	+	Missense_Mutation	SNP	C	C	T	rs562392825		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr15:43893109C>T	ENST00000450892.2	-	25	4882	c.4805G>A	c.(4804-4806)cGg>cAg	p.R1602Q	STRC_ENST00000541030.1_Missense_Mutation_p.R829Q|RNU6-554P_ENST00000410466.1_RNA	NM_153700.2	NP_714544.1	Q7RTU9	STRC_HUMAN	stereocilin	1602					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)	kinocilium (GO:0060091)|stereocilium bundle tip (GO:0032426)				skin(4)	4		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		CTCCTCTGGCCGCAGTCCACA	0.562													ENSG00000242866	C|||	1	0.000199681	0.0	0.0	5008	,	,		17183	0.0		0.0	False		,,,				2504	0.001																0													53.0	73.0	67.0					15																	43893109		2199	4297	6496	SO:0001583	missense	0			-	BK000138	CCDS10098.1	15q15.3	2010-02-26			ENSG00000242866	ENSG00000242866			16035	protein-coding gene	gene with protein product		606440		DFNB16		11687802, 9429146	Standard	NM_153700		Approved		uc001zsf.3	Q7RTU9	OTTHUMG00000059899	ENST00000450892.2:c.4805G>A	15.37:g.43893109C>T	ENSP00000401513:p.Arg1602Gln			Missense_Mutation	SNP	NULL	p.R1602Q	ENST00000450892.2	37	c.4805	CCDS10098.1	15	.	.	.	.	.	.	.	.	.	.	C	19.38	3.817173	0.70912	.	.	ENSG00000242866	ENST00000450892;ENST00000299992;ENST00000541030	T;T	0.76578	-1.03;-1.03	4.37	4.37	0.52481	.	0.462268	0.19763	N	0.106634	T	0.77170	0.4091	N	0.24115	0.695	0.31524	N	0.661985	P;D	0.76494	0.588;0.999	B;D	0.63033	0.28;0.91	T	0.73319	-0.4020	10	0.18710	T	0.47	-23.9588	14.8562	0.70338	0.0:1.0:0.0:0.0	.	829;1602	F5GXA4;Q7RTU9	.;STRC_HUMAN	Q	1602;1602;829	ENSP00000401513:R1602Q;ENSP00000440413:R829Q	ENSP00000299992:R1602Q	R	-	2	0	STRC	41680401	0.113000	0.22115	1.000000	0.80357	0.890000	0.51754	1.428000	0.34892	2.453000	0.82957	0.306000	0.20318	CGG	-	STRC	-	NULL		0.562	STRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRC	HGNC	protein_coding	OTTHUMT00000133140.1	0	0	0	23	23	37	0.00	0.00	C	NM_153700		43893109	-1	7	14	31	37	tier1	no_errors	ENST00000450892	ensembl	human	known	74_37	missense	18.42	27.45	SNP	0.985	T	7	31
ID3	3399	genome.wustl.edu	37	1	23885512	23885512	+	Splice_Site	SNP	T	T	C			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr1:23885512T>C	ENST00000374561.5	-	2	668		c.e2-2		ID3_ENST00000486541.1_Splice_Site	NM_002167.4	NP_002158.3	Q02535	ID3_HUMAN	inhibitor of DNA binding 3, dominant negative helix-loop-helix protein						central nervous system development (GO:0007417)|epithelial cell differentiation (GO:0030855)|heart development (GO:0007507)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|notochord development (GO:0030903)|odontogenesis (GO:0042476)|positive regulation of apoptotic process (GO:0043065)|regulation of cell cycle (GO:0051726)|regulation of DNA replication (GO:0006275)|response to wounding (GO:0009611)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|lung(3)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00314)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;8.83e-25)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;6.5e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		CTCGGCTGTCTGATTAGAGGA	0.577													ENSG00000117318																																					0													72.0	72.0	72.0					1																	23885512		2203	4300	6503	SO:0001630	splice_region_variant	0			-	X69111	CCDS237.1	1p36.13-p36.12	2013-05-21			ENSG00000117318	ENSG00000117318		"""Basic helix-loop-helix proteins"""	5362	protein-coding gene	gene with protein product		600277				1628620	Standard	NM_002167		Approved	HEIR-1, bHLHb25	uc001bhh.4	Q02535	OTTHUMG00000003229	ENST00000374561.5:c.301-2A>G	1.37:g.23885512T>C			A8K1T8|O75641	Splice_Site	SNP	-	e2-2	ENST00000374561.5	37	c.301-2	CCDS237.1	1	.	.	.	.	.	.	.	.	.	.	T	6.903	0.536113	0.13188	.	.	ENSG00000117318	ENST00000374561	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.205	0.54346	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ID3	23758099	1.000000	0.71417	0.987000	0.45799	0.039000	0.13416	3.621000	0.54210	2.206000	0.71126	0.482000	0.46254	.	-	ID3	-	-		0.577	ID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ID3	HGNC	protein_coding	OTTHUMT00000008904.1	0	0	0	53	53	50	0.00	0.00	T	NM_002167	Intron	23885512	-1	28	25	37	71	tier1	no_errors	ENST00000374561	ensembl	human	known	74_37	splice_site	43.08	25.77	SNP	0.997	C	28	37
NOTUM	147111	genome.wustl.edu	37	17	79916829	79916829	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr17:79916829C>T	ENST00000409678.3	-	4	898	c.515G>A	c.(514-516)tGg>tAg	p.W172*		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	172						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TGCGTTCCACCAGTAGGGGTT	0.617													ENSG00000185269																																					0													108.0	88.0	95.0					17																	79916829		2203	4300	6503	SO:0001587	stop_gained	0			-	BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.515G>A	17.37:g.79916829C>T	ENSP00000387310:p.Trp172*		Q8N410|Q8NI82	Nonsense_Mutation	SNP	pfam_NOTUM	p.W172*	ENST00000409678.3	37	c.515	CCDS32771.2	17	.	.	.	.	.	.	.	.	.	.	C	37	6.176990	0.97348	.	.	ENSG00000185269	ENST00000409678;ENST00000425009	.	.	.	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0749	0.89424	0.0:1.0:0.0:0.0	.	.	.	.	X	172	.	ENSP00000387310:W172X	W	-	2	0	NOTUM	77510119	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.210000	0.77924	2.266000	0.75297	0.561000	0.74099	TGG	-	NOTUM	-	pfam_NOTUM		0.617	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTUM	HGNC	protein_coding	OTTHUMT00000335123.2	0	0	0	46	46	60	0.00	0.00	C	NM_178493		79916829	-1	11	29	52	76	tier1	no_errors	ENST00000409678	ensembl	human	known	74_37	nonsense	17.46	27.36	SNP	1.000	T	11	52
MUC5B	727897	genome.wustl.edu	37	11	1270805	1270805	+	Missense_Mutation	SNP	C	C	T	rs373850484	byFrequency	TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr11:1270805C>T	ENST00000529681.1	+	31	12753	c.12695C>T	c.(12694-12696)cCg>cTg	p.P4232L	MUC5B_ENST00000447027.1_Missense_Mutation_p.P4235L|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4232	Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCAGCACCCCGGCCACCAGC	0.597													ENSG00000117983	C|||	7	0.00139776	0.003	0.0043	5008	,	,		18628	0.0		0.0	False		,,,				2504	0.0																0								C	LEU/PRO	2,3628		0,2,1813	43.0	48.0	46.0		12695	-6.7	0.0	11		46	0,8032		0,0,4016	no	missense	MUC5B	NM_002458.2	98	0,2,5829	TT,TC,CC		0.0,0.0551,0.0171	benign	4232/5763	1270805	2,11660	1815	4016	5831	SO:0001583	missense	0			-	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12695C>T	11.37:g.1270805C>T	ENSP00000436812:p.Pro4232Leu		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.P4235L	ENST00000529681.1	37	c.12704	CCDS44515.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	8.733|8.733	0.917092|0.917092	0.17907|0.17907	5.51E-4|5.51E-4	0.0|0.0	ENSG00000117983|ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844|ENST00000535652	T;T|.	0.17370|.	2.28;2.46|.	3.35|3.35	-6.71|-6.71	0.01760|0.01760	.|.	.|.	.|.	.|.	.|.	T|T	0.19087|0.19087	0.0458|0.0458	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|.	0.23854|.	0.034;0.092|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.29397|0.29397	-1.0013|-1.0013	9|6	0.87932|0.54805	D|T	0|0.06	.|.	3.2837|3.2837	0.06925|0.06925	0.1255:0.3584:0.3609:0.1552|0.1255:0.3584:0.3609:0.1552	.|.	4705;4235|.	A7Y9J9;E9PBJ0|.	.;.|.	L|W	4232;4235;4176;4082|12	ENSP00000436812:P4232L;ENSP00000415793:P4235L|.	ENSP00000343037:P4176L|ENSP00000439776:R12W	P|R	+|+	2|1	0|2	MUC5B|MUC5B	1227381|1227381	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.026000|0.026000	0.11368|0.11368	0.120000|0.120000	0.15647|0.15647	-1.963000|-1.963000	0.01013|0.01013	0.393000|0.393000	0.25936|0.25936	CCG|CGG	-	MUC5B	-	NULL		0.597	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	0	0	0	24	24	37	0.00	0.00	C	XM_001126093		1270805	+1	9	10	50	24	tier1	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	15.25	29.41	SNP	0.000	T	9	50
UBE2O	63893	genome.wustl.edu	37	17	74387533	74387533	+	Missense_Mutation	SNP	C	C	G			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr17:74387533C>G	ENST00000319380.7	-	18	3434	c.3370G>C	c.(3370-3372)Gag>Cag	p.E1124Q		NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	1124					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						ATCTCCTGCTCAAAGACCTCG	0.607													ENSG00000175931																																					0													56.0	56.0	56.0					17																	74387533		2203	4299	6502	SO:0001583	missense	0			-	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.3370G>C	17.37:g.74387533C>G	ENSP00000323687:p.Glu1124Gln		A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.E1124Q	ENST00000319380.7	37	c.3370	CCDS32742.1	17	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744932	0.49151	.	.	ENSG00000175931	ENST00000319380	T	0.74315	-0.83	4.58	4.58	0.56647	Ubiquitin-conjugating enzyme/RWD-like (1);	0.209849	0.41001	D	0.000965	T	0.66645	0.2810	L	0.36672	1.1	0.32234	N	0.573632	B	0.19073	0.033	B	0.12156	0.007	T	0.72104	-0.4391	10	0.62326	D	0.03	-14.6494	15.7469	0.77953	0.0:1.0:0.0:0.0	.	1124	Q9C0C9	UBE2O_HUMAN	Q	1124	ENSP00000323687:E1124Q	ENSP00000323687:E1124Q	E	-	1	0	UBE2O	71899128	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	3.401000	0.52601	2.373000	0.80994	0.556000	0.70494	GAG	-	UBE2O	-	NULL		0.607	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	HGNC	protein_coding	OTTHUMT00000450123.1	0	0	0	20	20	28	0.00	0.00	C	NM_022066		74387533	-1	5	10	14	22	tier1	no_errors	ENST00000319380	ensembl	human	known	74_37	missense	25.00	31.25	SNP	0.997	G	5	14
TMEM135	65084	genome.wustl.edu	37	11	87024468	87024468	+	Splice_Site	SNP	G	G	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr11:87024468G>A	ENST00000305494.5	+	11	977	c.938G>A	c.(937-939)gGt>gAt	p.G313D	TMEM135_ENST00000340353.7_Splice_Site_p.G291D|TMEM135_ENST00000532959.1_Splice_Site_p.G184D|TMEM135_ENST00000535167.1_Splice_Site_p.G174D	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	313					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CTTAACTAGGGTACTAGTTGC	0.284													ENSG00000166575																																					0													86.0	89.0	88.0					11																	87024468		2201	4295	6496	SO:0001630	splice_region_variant	0			-	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.937-1G>A	11.37:g.87024468G>A			Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	NULL	p.G313D	ENST00000305494.5	37	c.938	CCDS8280.1	11	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053275	0.75960	.	.	ENSG00000166575	ENST00000340353;ENST00000544294;ENST00000532959;ENST00000305494;ENST00000535167	T;T;T;T	0.37411	1.58;1.58;1.58;1.2	5.48	5.48	0.80851	.	0.046428	0.85682	D	0.000000	T	0.58807	0.2148	M	0.66939	2.045	0.58432	D	0.999996	D;D	0.76494	0.989;0.999	P;D	0.68943	0.663;0.961	T	0.56306	-0.8001	9	.	.	.	-14.2854	18.3398	0.90302	0.0:0.0:1.0:0.0	.	291;313	Q86UB9-2;Q86UB9	.;TM135_HUMAN	D	291;150;184;313;174	ENSP00000345513:G291D;ENSP00000436179:G184D;ENSP00000306344:G313D;ENSP00000439525:G174D	.	G	+	2	0	TMEM135	86702116	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.135000	0.77276	2.579000	0.87056	0.655000	0.94253	GGT	-	TMEM135	-	NULL		0.284	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM135	HGNC	protein_coding	OTTHUMT00000393875.1	0	0	0	92	92	80	0.00	0.00	G	NM_022918	Missense_Mutation	87024468	+1	25	14	44	43	tier1	no_errors	ENST00000305494	ensembl	human	known	74_37	missense	36.23	24.56	SNP	1.000	A	25	44
UNC79	57578	genome.wustl.edu	37	14	93995662	93995662	+	Silent	SNP	T	T	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr14:93995662T>A	ENST00000393151.2	+	10	1083	c.1083T>A	c.(1081-1083)ctT>ctA	p.L361L	UNC79_ENST00000553484.1_Silent_p.L361L|UNC79_ENST00000555664.1_Silent_p.L361L|UNC79_ENST00000256339.4_Silent_p.L184L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	361					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TTGATGTTCTTCTGCCACAAG	0.323													ENSG00000133958																																					0													127.0	116.0	120.0					14																	93995662		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1083T>A	14.37:g.93995662T>A			B5MDL6|Q6ZUT7	Silent	SNP	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.L361	ENST00000393151.2	37	c.1083		14																																																																																			-	UNC79	-	NULL		0.323	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	0	0	0	72	72	108	0.00	0.00	T	XM_028395		93995662	+1	20	23	36	52	tier1	no_errors	ENST00000553484	ensembl	human	known	74_37	silent	35.71	30.67	SNP	1.000	A	20	36
XPO6	23214	genome.wustl.edu	37	16	28113177	28113177	+	Silent	SNP	C	C	G	rs370852236		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr16:28113177C>G	ENST00000304658.5	-	22	3536	c.3036G>C	c.(3034-3036)ctG>ctC	p.L1012L	XPO6_ENST00000565698.1_Silent_p.L998L	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	1012					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						CCTTGTGGTACAGCTTCTGCT	0.488													ENSG00000169180																																					0													64.0	65.0	65.0					16																	28113177		1897	4131	6028	SO:0001819	synonymous_variant	0			-	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.3036G>C	16.37:g.28113177C>G			A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Silent	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.L1012	ENST00000304658.5	37	c.3036	CCDS42135.1	16																																																																																			-	XPO6	-	superfamily_ARM-type_fold		0.488	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1	0	0	1	51	51	82	0.00	1.20	C	XM_055195		28113177	-1	12	17	52	57	tier1	no_errors	ENST00000304658	ensembl	human	known	74_37	silent	18.75	22.97	SNP	0.974	G	12	52
CDH8	1006	genome.wustl.edu	37	16	61687551	61687551	+	Silent	SNP	G	G	A	rs200638903		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr16:61687551G>A	ENST00000577390.1	-	12	3315	c.2361C>T	c.(2359-2361)ggC>ggT	p.G787G	CDH8_ENST00000577730.1_Intron|CDH8_ENST00000299345.6_Intron	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	787					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AGTAGAGTTCGCCCAGTCTCT	0.478													ENSG00000150394																																					0													57.0	60.0	59.0					16																	61687551		2202	4300	6502	SO:0001819	synonymous_variant	0			-	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.2361C>T	16.37:g.61687551G>A			B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G787	ENST00000577390.1	37	c.2361	CCDS10802.1	16																																																																																			-	CDH8	-	pfam_Cadherin_cytoplasmic-dom		0.478	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	0	0	0	35	35	71	0.00	0.00	G	NM_001796		61687551	-1	7	11	24	50	tier1	no_errors	ENST00000577390	ensembl	human	known	74_37	silent	22.58	18.03	SNP	0.524	A	7	24
PPFIA2	8499	genome.wustl.edu	37	12	81734962	81734962	+	Missense_Mutation	SNP	C	C	G			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr12:81734962C>G	ENST00000549396.1	-	20	2448	c.2288G>C	c.(2287-2289)cGa>cCa	p.R763P	PPFIA2_ENST00000443686.3_Missense_Mutation_p.R664P|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R763P|PPFIA2_ENST00000541570.2_Missense_Mutation_p.R330P|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R745P|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R745P|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R689P|PPFIA2_ENST00000550359.2_Missense_Mutation_p.R610P|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R763P|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R763P	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	763					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TTTGTCCTCTCGACCATCTTC	0.398													ENSG00000139220																																					0													268.0	261.0	263.0					12																	81734962		1919	4127	6046	SO:0001583	missense	0			-	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2288G>C	12.37:g.81734962C>G	ENSP00000450337:p.Arg763Pro		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R763P	ENST00000549396.1	37	c.2288	CCDS55857.1	12	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409545	0.83340	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T;T	0.25085	2.16;2.16;1.82;1.83;2.16;2.16;1.83;2.16	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.30696	0.0773	L	0.56769	1.78	0.80722	D	1	B	0.30937	0.301	B	0.35770	0.21	T	0.06373	-1.0830	10	0.54805	T	0.06	-11.7971	13.7857	0.63108	0.0:0.9262:0.0:0.0738	.	763	O75334	LIPA2_HUMAN	P	763;745;330;689;774;745;763;664;763	ENSP00000450337:R763P;ENSP00000450298:R745P;ENSP00000438337:R330P;ENSP00000385093:R689P;ENSP00000327416:R745P;ENSP00000449338:R763P;ENSP00000388373:R664P;ENSP00000447868:R763P	ENSP00000327416:R745P	R	-	2	0	PPFIA2	80259093	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.632000	0.61311	2.696000	0.92011	0.655000	0.94253	CGA	-	PPFIA2	-	NULL		0.398	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	0	0	0	66	66	127	0.00	0.00	C			81734962	-1	23	45	40	81	tier1	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	36.51	35.43	SNP	1.000	G	23	40
NDUFV1	4723	genome.wustl.edu	37	11	67378983	67378983	+	Silent	SNP	G	G	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr11:67378983G>A	ENST00000322776.6	+	7	1176	c.1023G>A	c.(1021-1023)gcG>gcA	p.A341A	DOC2GP_ENST00000495263.1_RNA|NDUFV1_ENST00000532303.1_Silent_p.A240A|NDUFV1_ENST00000415352.2_Silent_p.A334A|NDUFV1_ENST00000526169.1_Intron|NDUFV1_ENST00000529927.1_Silent_p.A332A	NM_001166102.1|NM_007103.3	NP_001159574.1|NP_009034.2	P49821	NDUV1_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa	341			A -> V (in MT-C1D). {ECO:0000269|PubMed:10080174}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(3)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	16						ACTTCGATGCGCTGGTGCAGG	0.637													ENSG00000167792																																					0													84.0	67.0	73.0					11																	67378983		2200	4294	6494	SO:0001819	synonymous_variant	0			-	AF092131	CCDS8173.1, CCDS53669.1	11q13	2011-07-04	2002-08-29		ENSG00000167792	ENSG00000167792	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7716	protein-coding gene	gene with protein product	"""complex I 51kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial"""	161015	"""NADH dehydrogenase (ubiquinone) flavoprotein 1 (51kD)"""			1478657	Standard	NM_007103		Approved	CI-51K	uc001omj.2	P49821	OTTHUMG00000166215	ENST00000322776.6:c.1023G>A	11.37:g.67378983G>A			O60924|O60940|Q16104|Q6IBR3|Q96BF8|Q96HS7	Silent	SNP	pfam_DH_UbQ_OxRdtase_51kDa_su,pfam_DH-UbQ_OxRdtase_Fsu_4Fe4S-bd,pfam_Soluble_ligand-bd,smart_DH-UbQ_OxRdtase_Fsu_4Fe4S-bd,tigrfam_DH-UbQ_OxRdtase_suF	p.A341	ENST00000322776.6	37	c.1023	CCDS8173.1	11																																																																																			-	NDUFV1	-	tigrfam_DH-UbQ_OxRdtase_suF		0.637	NDUFV1-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	NDUFV1	HGNC	protein_coding	OTTHUMT00000388406.1	0	0	0	43	43	55	0.00	0.00	G	NM_007103		67378983	+1	18	12	23	23	tier1	no_errors	ENST00000322776	ensembl	human	known	74_37	silent	43.90	34.29	SNP	0.111	A	18	23
TTC30B	150737	genome.wustl.edu	37	2	178417110	178417110	+	Missense_Mutation	SNP	C	C	T	rs560979378		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr2:178417110C>T	ENST00000408939.3	-	1	632	c.382G>A	c.(382-384)Gat>Aat	p.D128N		NM_152517.2	NP_689730.2	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	128					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			CCTGGCAGATCGCCCTCGCTG	0.632													ENSG00000196659																																					0													124.0	138.0	134.0					2																	178417110		2202	4299	6501	SO:0001583	missense	0			-	AK055552	CCDS42784.1	2q31.2	2014-02-21			ENSG00000196659	ENSG00000196659		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	26425	protein-coding gene	gene with protein product						12477932	Standard	NM_152517		Approved	FLJ30990, fleer, IFT70	uc002uln.3	Q8N4P2	OTTHUMG00000154166	ENST00000408939.3:c.382G>A	2.37:g.178417110C>T	ENSP00000386181:p.Asp128Asn		Q63HQ1|Q96NE6	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.D128N	ENST00000408939.3	37	c.382	CCDS42784.1	2	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742773	0.69418	.	.	ENSG00000196659	ENST00000500357;ENST00000408939	T	0.77750	-1.12	4.3	4.3	0.51218	.	0.086995	0.85682	D	0.000000	D	0.87265	0.6134	M	0.76938	2.355	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.88483	0.3070	10	0.56958	D	0.05	.	15.4721	0.75446	0.0:1.0:0.0:0.0	.	128	Q8N4P2	TT30B_HUMAN	N	81;128	ENSP00000386181:D128N	ENSP00000386181:D128N	D	-	1	0	TTC30B	178125356	1.000000	0.71417	0.884000	0.34674	0.942000	0.58702	4.202000	0.58446	2.376000	0.81061	0.655000	0.94253	GAT	-	TTC30B	-	NULL		0.632	TTC30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC30B	HGNC	protein_coding	OTTHUMT00000334193.2	0	0	0	22	22	40	0.00	0.00	C	NM_152517		178417110	-1	18	8	28	15	tier1	no_errors	ENST00000408939	ensembl	human	known	74_37	missense	39.13	34.78	SNP	0.989	T	18	28
RAPH1	65059	genome.wustl.edu	37	2	204304534	204304534	+	Missense_Mutation	SNP	G	G	A	rs144033630		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr2:204304534G>A	ENST00000319170.5	-	14	3678	c.3379C>T	c.(3379-3381)Cgg>Tgg	p.R1127W	RAPH1_ENST00000374493.3_Missense_Mutation_p.R1179W|RAPH1_ENST00000457812.1_Intron|ABI2_ENST00000295851.5_3'UTR	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	1127					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CTATCATTCCGTTTGGGTCGT	0.522													ENSG00000173166																																					0								G	TRP/ARG	1,4405		0,1,2202	116.0	104.0	108.0		3379	4.9	0.5	2	dbSNP_134	108	0,8600		0,0,4300	no	missense	RAPH1	NM_213589.1	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1127/1251	204304534	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.3379C>T	2.37:g.204304534G>A	ENSP00000316543:p.Arg1127Trp		Q96Q37|Q9C0I2	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,prints_Paxillin	p.R1179W	ENST00000319170.5	37	c.3535	CCDS2359.1	2	.	.	.	.	.	.	.	.	.	.	G	15.19	2.758805	0.49468	2.27E-4	0.0	ENSG00000173166	ENST00000319170;ENST00000374493	T;T	0.55760	0.5;0.53	4.94	4.94	0.65067	.	0.000000	0.33235	U	0.005126	T	0.63628	0.2527	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68511	-0.5389	10	0.87932	D	0	-1.6911	18.1554	0.89689	0.0:0.0:1.0:0.0	.	1127	Q70E73	RAPH1_HUMAN	W	1127;1179	ENSP00000316543:R1127W;ENSP00000363617:R1179W	ENSP00000316543:R1127W	R	-	1	2	RAPH1	204012779	1.000000	0.71417	0.492000	0.27490	0.361000	0.29550	4.442000	0.59988	2.288000	0.76882	0.563000	0.77884	CGG	rs144033630	RAPH1	-	NULL		0.522	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPH1	HGNC	protein_coding	OTTHUMT00000256363.2	0	0	0	19	19	103	0.00	0.00	G	NM_025252		204304534	-1	4	20	20	42	tier1	no_errors	ENST00000374493	ensembl	human	known	74_37	missense	16.67	32.26	SNP	1.000	A	4	20
RSPH4A	345895	genome.wustl.edu	37	6	116949368	116949368	+	Missense_Mutation	SNP	C	C	G			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr6:116949368C>G	ENST00000229554.5	+	3	1635	c.1498C>G	c.(1498-1500)Cta>Gta	p.L500V	RSPH4A_ENST00000368581.4_Missense_Mutation_p.L500V|RSPH4A_ENST00000368580.4_Intron	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	500					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)				breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						CGTCAGTCCTCTAGGATTTTA	0.468									Kartagener syndrome				ENSG00000111834																																					0													64.0	67.0	66.0					6																	116949368		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.1498C>G	6.37:g.116949368C>G	ENSP00000229554:p.Leu500Val		B4DSI1|Q3KP24|Q5TD95	Missense_Mutation	SNP	pfam_Radial_spoke	p.L500V	ENST00000229554.5	37	c.1498	CCDS34521.1	6	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940718	0.52972	.	.	ENSG00000111834	ENST00000368581;ENST00000229554;ENST00000447842	T;T	0.17370	2.28;2.28	5.74	3.04	0.35103	.	0.181102	0.41097	D	0.000941	T	0.17492	0.0420	M	0.69463	2.115	0.42037	D	0.991057	P;D	0.67145	0.754;0.996	P;D	0.65684	0.623;0.937	T	0.11591	-1.0581	10	0.13470	T	0.59	-13.5917	9.2521	0.37562	0.0:0.7648:0.0:0.2352	.	500;500	Q5TD94-3;Q5TD94	.;RSH4A_HUMAN	V	500;500;295	ENSP00000357570:L500V;ENSP00000229554:L500V	ENSP00000229554:L500V	L	+	1	2	RSPH4A	117056061	0.272000	0.24172	0.994000	0.49952	0.984000	0.73092	0.734000	0.26101	0.371000	0.24564	-0.140000	0.14226	CTA	-	RSPH4A	-	pfam_Radial_spoke		0.468	RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH4A	HGNC	protein_coding	OTTHUMT00000041960.1	0	0	0	15	15	78	0.00	0.00	C	NM_001010892		116949368	+1	11	26	17	38	tier1	no_errors	ENST00000229554	ensembl	human	known	74_37	missense	39.29	40.62	SNP	0.958	G	11	17
RNF150	57484	genome.wustl.edu	37	4	141888986	141888986	+	Missense_Mutation	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr4:141888986C>T	ENST00000515673.2	-	2	559	c.526G>A	c.(526-528)Ggg>Agg	p.G176R	RNF150_ENST00000420921.2_Missense_Mutation_p.G35R|RNF150_ENST00000515057.1_5'UTR|RNF150_ENST00000379512.2_Missense_Mutation_p.G35R|RNF150_ENST00000507500.1_Missense_Mutation_p.G176R|RNF150_ENST00000306799.3_Missense_Mutation_p.G176R			Q9ULK6	RN150_HUMAN	ring finger protein 150	176	PA.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					ATCTCCTTCCCTTTTGGCTCA	0.488													ENSG00000170153																																					0													241.0	206.0	218.0					4																	141888986		2203	4300	6503	SO:0001583	missense	0			-	AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.526G>A	4.37:g.141888986C>T	ENSP00000425840:p.Gly176Arg		Q3T1D0|Q6ZNW6	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.G176R	ENST00000515673.2	37	c.526	CCDS34065.1	4	.	.	.	.	.	.	.	.	.	.	C	34	5.335214	0.95758	.	.	ENSG00000170153	ENST00000379512;ENST00000420921;ENST00000306799;ENST00000515673;ENST00000507500;ENST00000506101	T;T;T;T;T;T	0.26518	1.87;1.87;2.89;2.89;2.89;1.73	5.88	5.88	0.94601	Protease-associated domain, PA (1);	0.000000	0.85682	D	0.000000	T	0.64994	0.2649	M	0.93375	3.41	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.73375	-0.4002	10	0.87932	D	0	.	20.2422	0.98381	0.0:1.0:0.0:0.0	.	176;176;176	Q9ULK6-2;Q9ULK6-3;Q9ULK6	.;.;RN150_HUMAN	R	35;35;176;176;176;7	ENSP00000368827:G35R;ENSP00000394581:G35R;ENSP00000304321:G176R;ENSP00000425840:G176R;ENSP00000425568:G176R;ENSP00000425947:G7R	ENSP00000304321:G176R	G	-	1	0	RNF150	142108436	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.818000	0.86416	2.788000	0.95919	0.650000	0.86243	GGG	-	RNF150	-	pfam_Protease-assoc_domain		0.488	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF150	HGNC	protein_coding	OTTHUMT00000364739.2	0	0	0	57	57	110	0.00	0.00	C	XM_291090		141888986	-1	19	27	59	78	tier1	no_errors	ENST00000515673	ensembl	human	known	74_37	missense	24.36	25.71	SNP	1.000	T	19	59
TP53	7157	genome.wustl.edu	37	17	7577556	7577556	+	Missense_Mutation	SNP	C	C	G	rs121912655|rs397516437		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr17:7577556C>G	ENST00000269305.4	-	7	914	c.725G>C	c.(724-726)tGc>tCc	p.C242S	TP53_ENST00000455263.2_Missense_Mutation_p.C242S|TP53_ENST00000359597.4_Missense_Mutation_p.C242S|TP53_ENST00000445888.2_Missense_Mutation_p.C242S|TP53_ENST00000420246.2_Missense_Mutation_p.C242S|TP53_ENST00000413465.2_Missense_Mutation_p.C242S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	242	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:16959974}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C242F(82)|p.C242Y(44)|p.C242S(16)|p.0?(8)|p.C149F(6)|p.?(5)|p.N239_C242delNSSC(3)|p.C149Y(2)|p.C238fs*21(1)|p.C242fs*20(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCGCCCATGCAGGAACTGTT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	175	Substitution - Missense(150)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(5)|Deletion - Frameshift(4)|Complex - deletion inframe(1)	lung(35)|upper_aerodigestive_tract(22)|liver(16)|oesophagus(15)|large_intestine(13)|breast(12)|central_nervous_system(11)|ovary(11)|urinary_tract(9)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(6)|stomach(5)|bone(5)|endometrium(3)|soft_tissue(1)|eye(1)|thymus(1)|kidney(1)|pancreas(1)|prostate(1)	GRCh37	CM910618	TP53	M	rs121912655						140.0	107.0	119.0					17																	7577556		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.725G>C	17.37:g.7577556C>G	ENSP00000269305:p.Cys242Ser		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C242S	ENST00000269305.4	37	c.725	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590284	0.86851	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99914	-7.98;-7.98;-7.98;-7.98;-7.98;-7.98;-7.98;-7.98	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99930	0.9968	M	0.92784	3.345	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.999	D	0.95727	0.8771	10	0.87932	D	0	-27.558	15.3618	0.74483	0.0:1.0:0.0:0.0	.	242;242;149;242;242;242	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	242;242;242;242;242;242;231;149;110;149	ENSP00000410739:C242S;ENSP00000352610:C242S;ENSP00000269305:C242S;ENSP00000398846:C242S;ENSP00000391127:C242S;ENSP00000391478:C242S;ENSP00000425104:C110S;ENSP00000423862:C149S	ENSP00000269305:C242S	C	-	2	0	TP53	7518281	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	TGC	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	52	52	67	0.00	0.00	C	NM_000546		7577556	-1	37	35	5	15	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	88.10	70.00	SNP	1.000	G	37	5
KIF17	57576	genome.wustl.edu	37	1	21042109	21042109	+	Silent	SNP	G	G	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr1:21042109G>A	ENST00000247986.2	-	2	565	c.255C>T	c.(253-255)ggC>ggT	p.G85G	KIF17_ENST00000400463.3_Silent_p.G85G|KIF17_ENST00000375044.1_5'UTR			Q9P2E2	KIF17_HUMAN	kinesin family member 17	85	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CAAAGATGGTGCCATTGTAGC	0.657													ENSG00000117245																																					0													98.0	83.0	88.0					1																	21042109		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.255C>T	1.37:g.21042109G>A			A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G85	ENST00000247986.2	37	c.255	CCDS213.1	1																																																																																			-	KIF17	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom		0.657	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	0	0	0	42	42	23	0.00	0.00	G	NM_020816		21042109	-1	10	2	37	16	tier1	no_errors	ENST00000247986	ensembl	human	known	74_37	silent	21.28	11.11	SNP	1.000	A	10	37
TLR3	7098	genome.wustl.edu	37	4	187004218	187004218	+	Missense_Mutation	SNP	G	G	A	rs144550375		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr4:187004218G>A	ENST00000296795.3	+	4	1482	c.1378G>A	c.(1378-1380)Gaa>Aaa	p.E460K	TLR3_ENST00000504367.1_Missense_Mutation_p.E183K	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	460					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		AAATATTTTCGAAATCTATCT	0.473													ENSG00000164342	G|||	1	0.000199681	0.0008	0.0	5008	,	,		19733	0.0		0.0	False		,,,				2504	0.0																0								G	LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	62.0	61.0	61.0		1378	5.6	1.0	4	dbSNP_134	61	0,8600		0,0,4300	no	missense	TLR3	NM_003265.2	56	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	460/905	187004218	2,13004	2203	4300	6503	SO:0001583	missense	0			-	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1378G>A	4.37:g.187004218G>A	ENSP00000296795:p.Glu460Lys		B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.E460K	ENST00000296795.3	37	c.1378	CCDS3846.1	4	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548680	0.65311	4.54E-4	0.0	ENSG00000164342	ENST00000296795;ENST00000542020;ENST00000504367	T;T	0.57907	0.37;0.37	5.57	5.57	0.84162	.	0.097492	0.64402	D	0.000001	T	0.55481	0.1923	L	0.49455	1.56	0.39586	D	0.96951	D	0.69078	0.997	P	0.57324	0.818	T	0.54906	-0.8223	10	0.25106	T	0.35	.	6.7469	0.23466	0.1434:0.0:0.7077:0.1489	.	460	O15455	TLR3_HUMAN	K	460;460;183	ENSP00000296795:E460K;ENSP00000423684:E183K	ENSP00000296795:E460K	E	+	1	0	TLR3	187241212	1.000000	0.71417	0.974000	0.42286	0.707000	0.40811	4.081000	0.57627	2.626000	0.88956	0.557000	0.71058	GAA	rs144550375	TLR3	-	NULL		0.473	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR3	HGNC	protein_coding	OTTHUMT00000360313.4	0	0	0	37	37	97	0.00	0.00	G			187004218	+1	21	50	4	24	tier1	no_errors	ENST00000296795	ensembl	human	known	74_37	missense	84.00	67.57	SNP	0.990	A	21	4
PCDH1	5097	genome.wustl.edu	37	5	141248186	141248186	+	Missense_Mutation	SNP	G	G	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr5:141248186G>A	ENST00000394536.3	-	2	990	c.851C>T	c.(850-852)tCc>tTc	p.S284F	PCDH1_ENST00000503492.1_Missense_Mutation_p.S284F|PCDH1_ENST00000536585.1_Missense_Mutation_p.S262F|PCDH1_ENST00000456271.1_Missense_Mutation_p.S272F|PCDH1_ENST00000511044.1_5'Flank|PCDH1_ENST00000287008.3_Missense_Mutation_p.S284F	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	284	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GGCCTCATAGGAGGGCCGCTC	0.607													ENSG00000156453																									Ovarian(132;1609 1739 4190 14731 45037)												0													39.0	41.0	40.0					5																	141248186		2203	4300	6503	SO:0001583	missense	0			-	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.851C>T	5.37:g.141248186G>A	ENSP00000378043:p.Ser284Phe		Q8IUP2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S284F	ENST00000394536.3	37	c.851	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	g	12.23	1.875511	0.33162	.	.	ENSG00000156453	ENST00000503492;ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T;T	0.61392	0.11;0.14;0.14;0.14;0.14;0.14	4.4	4.4	0.53042	Cadherin (2);Cadherin-like (1);	0.745648	0.11910	N	0.517728	T	0.46756	0.1409	L	0.31294	0.92	0.09310	N	0.999999	B;B	0.34103	0.437;0.419	B;B	0.32211	0.067;0.142	T	0.35549	-0.9784	10	0.33940	T	0.23	.	14.8482	0.70275	0.0:0.0:1.0:0.0	.	284;284	Q08174;Q08174-2	PCDH1_HUMAN;.	F	284;284;284;272;295;262	ENSP00000424667:S284F;ENSP00000287008:S284F;ENSP00000378043:S284F;ENSP00000403497:S272F;ENSP00000350122:S295F;ENSP00000438825:S262F	ENSP00000287008:S284F	S	-	2	0	PCDH1	141228370	0.000000	0.05858	0.987000	0.45799	0.989000	0.77384	0.886000	0.28241	2.443000	0.82685	0.556000	0.70494	TCC	-	PCDH1	-	superfamily_Cadherin-like,pfscan_Cadherin		0.607	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	0	0	0	28	28	24	0.00	0.00	G	NM_032420		141248186	-1	40	43	26	24	tier1	no_errors	ENST00000287008	ensembl	human	known	74_37	missense	60.61	64.18	SNP	0.228	A	40	26
DCAF4L2	138009	genome.wustl.edu	37	8	88885986	88885986	+	Missense_Mutation	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr8:88885986C>T	ENST00000319675.3	-	1	310	c.214G>A	c.(214-216)Gac>Aac	p.D72N		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	72										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TTAAATCGGTCGCTTGCCAAA	0.522													ENSG00000176566																																					0													145.0	134.0	138.0					8																	88885986		2203	4300	6503	SO:0001583	missense	0			-	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.214G>A	8.37:g.88885986C>T	ENSP00000316496:p.Asp72Asn			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D72N	ENST00000319675.3	37	c.214	CCDS6245.1	8	.	.	.	.	.	.	.	.	.	.	C	4.494	0.091657	0.08632	.	.	ENSG00000176566	ENST00000319675	T	0.69685	-0.42	1.92	-3.84	0.04256	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.182934	0.64402	D	0.000015	T	0.45836	0.1362	L	0.43152	1.355	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.18808	-1.0325	10	0.42905	T	0.14	.	1.37	0.02209	0.1622:0.3533:0.3033:0.1811	.	72	Q8NA75	DC4L2_HUMAN	N	72	ENSP00000316496:D72N	ENSP00000316496:D72N	D	-	1	0	DCAF4L2	88955102	0.991000	0.36638	0.000000	0.03702	0.001000	0.01503	-0.004000	0.12878	-1.880000	0.01125	-1.407000	0.01130	GAC	-	DCAF4L2	-	superfamily_WD40_repeat_dom		0.522	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	0	0	0	56	56	85	0.00	0.00	C	NM_152418		88885986	-1	18	31	39	28	tier1	no_errors	ENST00000319675	ensembl	human	known	74_37	missense	31.58	52.54	SNP	0.000	T	18	39
TRDN	10345	genome.wustl.edu	37	6	123892185	123892185	+	Missense_Mutation	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr6:123892185C>T	ENST00000398178.3	-	2	136	c.115G>A	c.(115-117)Gac>Aac	p.D39N	TRDN_ENST00000546248.1_Missense_Mutation_p.D39N|TRDN_ENST00000334268.4_Missense_Mutation_p.D39N|TRDN_ENST00000542443.1_Missense_Mutation_p.D39N	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	39					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)	p.D39Y(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		GTCACTATGTCTTCTGTGACT	0.473													ENSG00000186439																																					1	Substitution - Missense(1)	lung(1)											107.0	111.0	110.0					6																	123892185		2031	4188	6219	SO:0001583	missense	0			-	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.115G>A	6.37:g.123892185C>T	ENSP00000381240:p.Asp39Asn		A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom	p.D39N	ENST00000398178.3	37	c.115	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617026	0.87359	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000542443	T;T;T;T	0.74002	1.18;1.17;5.51;-0.8	5.82	5.82	0.92795	.	0.048178	0.85682	D	0.000000	D	0.83635	0.5297	M	0.63843	1.955	0.50813	D	0.999897	D;D;D;D;D	0.89917	0.998;0.998;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.995;0.995;0.996;0.996;0.996	D	0.84122	0.0407	10	0.87932	D	0	-17.7646	20.0966	0.97849	0.0:1.0:0.0:0.0	.	39;39;39;39;39	F5H6E3;F5H2W7;Q5SWK9;Q8IVK2;Q13061	.;.;.;.;TRDN_HUMAN	N	39	ENSP00000381240:D39N;ENSP00000333984:D39N;ENSP00000439281:D39N;ENSP00000437684:D39N	ENSP00000333984:D39N	D	-	1	0	TRDN	123933884	1.000000	0.71417	0.994000	0.49952	0.964000	0.63967	5.692000	0.68256	2.753000	0.94483	0.557000	0.71058	GAC	-	TRDN	-	NULL		0.473	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding		0	0	0	34	34	96	0.00	0.00	C			123892185	-1	45	69	43	70	tier1	no_errors	ENST00000398178	ensembl	human	known	74_37	missense	51.14	49.29	SNP	1.000	T	45	43
RABEP1	9135	genome.wustl.edu	37	17	5241402	5241413	+	In_Frame_Del	DEL	AAGACAAAATTA	AAGACAAAATTA	-	rs372672063		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	AAGACAAAATTA	AAGACAAAATTA	AAGACAAAATTA	-	AAGACAAAATTA	AAGACAAAATTA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr17:5241402_5241413delAAGACAAAATTA	ENST00000546142.2	+	5	804_815	c.617_628delAAGACAAAATTA	c.(616-630)gaagacaaaattaaa>gaa	p.DKIK207del	RABEP1_ENST00000262477.6_In_Frame_Del_p.DKIK207del|RABEP1_ENST00000341923.6_In_Frame_Del_p.DKIK207del|RABEP1_ENST00000408982.2_In_Frame_Del_p.DKIK207del|RABEP1_ENST00000537505.1_In_Frame_Del_p.DKIK164del			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	207					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						ACAGAGGCTGAAGACAAAATTAAAGAGCTGGA	0.406													ENSG00000029725																																					0																																										SO:0001651	inframe_deletion	0				AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.617_628delAAGACAAAATTA	17.37:g.5241402_5241413delAAGACAAAATTA	ENSP00000437701:p.Asp207_Lys210del		B2RAG7|O95369|Q8IVX3	In_Frame_Del	DEL	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.DKIK207in_frame_del	ENST00000546142.2	37	c.617_628	CCDS45592.1	17																																																																																				RABEP1	-	NULL		0.406	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEP1	HGNC	protein_coding	OTTHUMT00000439349.1	0	0	0	133	133	133	0.00	0.00	AAGACAAAATTA	NM_004703		5241413	+1	10	10	69	69	tier1	no_errors	ENST00000262477	ensembl	human	known	74_37	in_frame_del	12.66	12.66	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.997:0.974:0.997:1.000:0.998:1.000	-	10	69
CREBBP	1387	genome.wustl.edu	37	16	3819196	3819196	+	Frame_Shift_Del	DEL	G	G	-			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr16:3819196delG	ENST00000262367.5	-	15	3848	c.3039delC	c.(3037-3039)tccfs	p.S1013fs	CREBBP_ENST00000382070.3_Frame_Shift_Del_p.S975fs	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1013					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GCTCCCCTTTGGATTCACCAG	0.592			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome						ENSG00000005339																												Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													108.0	91.0	97.0					16																	3819196		2197	4300	6497	SO:0001589	frameshift_variant	0				U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3039delC	16.37:g.3819196delG	ENSP00000262367:p.Ser1013fs		D3DUC9|O00147|Q16376|Q4LE28	Frame_Shift_Del	DEL	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.E1016fs	ENST00000262367.5	37	c.3039	CCDS10509.1	16																																																																																				CREBBP	-	NULL		0.592	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	0	0	0	18	18	53	0.00	0.00	G	NM_004380		3819196	-1	8	25	42	69	tier1	no_errors	ENST00000262367	ensembl	human	known	74_37	frame_shift_del	16.00	26.60	DEL	0.279	-	8	42
RAB38	23682	genome.wustl.edu	37	11	87882881	87882881	+	Frame_Shift_Del	DEL	C	C	-	rs563421881	byFrequency	TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr11:87882881delC	ENST00000243662.6	-	2	527	c.445delG	c.(445-447)gagfs	p.E149fs		NM_022337.2	NP_071732.1	P57729	RAB38_HUMAN	RAB38, member RAS oncogene family	149					endosome to melanosome transport (GO:0035646)|GTP catabolic process (GO:0006184)|melanosome organization (GO:0032438)|phagosome acidification (GO:0090383)|platelet dense granule organization (GO:0060155)|protein localization to membrane (GO:0072657)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|early endosome (GO:0005769)|melanosome (GO:0042470)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	AP-1 adaptor complex binding (GO:0035650)|AP-3 adaptor complex binding (GO:0035651)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AAACCGTGCTCCTTGCAGAAC	0.413													ENSG00000123892																																					0													160.0	131.0	140.0					11																	87882881		2201	4299	6500	SO:0001589	frameshift_variant	0				AF235022	CCDS8281.1	11q14	2008-05-14			ENSG00000123892	ENSG00000123892		"""RAB, member RAS oncogene"""	9776	protein-coding gene	gene with protein product		606281				10910072	Standard	NM_022337		Approved	NY-MEL-1	uc001pcj.2	P57729	OTTHUMG00000167288	ENST00000243662.6:c.445delG	11.37:g.87882881delC	ENSP00000243662:p.Glu149fs		Q53XK7	Frame_Shift_Del	DEL	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E149fs	ENST00000243662.6	37	c.445	CCDS8281.1	11																																																																																				RAB38	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom		0.413	RAB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB38	HGNC	protein_coding	OTTHUMT00000394015.2	0	0	0	51	51	98	0.00	0.00	C			87882881	-1	10	11	46	62	tier1	no_errors	ENST00000243662	ensembl	human	known	74_37	frame_shift_del	17.86	15.07	DEL	1.000	-	10	46
TET2	54790	genome.wustl.edu	37	4	106196943	106196945	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	CTT	CTT	CTT	-	CTT	CTT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr4:106196943_106196945delCTT	ENST00000540549.1	+	11	6136_6138	c.5276_5278delCTT	c.(5275-5280)ccttct>cct	p.S1760del	TET2_ENST00000380013.4_In_Frame_Del_p.S1760del|TET2_ENST00000513237.1_In_Frame_Del_p.S1781del|TET2_ENST00000545826.1_3'UTR			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1760					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CATCATTCACCTTCTCACATAAT	0.458			"""Mis N, F"""		MDS								ENSG00000168769																												Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0																																										SO:0001651	inframe_deletion	0				AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5276_5278delCTT	4.37:g.106196943_106196945delCTT	ENSP00000442788:p.Ser1760del		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	In_Frame_Del	DEL	NULL	p.S1760in_frame_del	ENST00000540549.1	37	c.5276_5278	CCDS47120.1	4																																																																																				TET2	-	NULL		0.458	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	0	0	0	13	13	109	0.00	0.00	CTT	NM_017628		106196945	+1	2	13	11	69	tier1	no_errors	ENST00000380013	ensembl	human	known	74_37	in_frame_del	15.38	15.85	DEL	0.019:0.003:0.005	-	2	11
RNF25	64320	genome.wustl.edu	37	2	219529965	219529965	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr2:219529965delT	ENST00000295704.2	-	8	1019	c.579delA	c.(577-579)gcafs	p.A193fs		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	193					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCACACCGACTGCCTTCTAAA	0.537													ENSG00000163481																																					0													81.0	77.0	78.0					2																	219529965		2203	4300	6503	SO:0001589	frameshift_variant	0					CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.579delA	2.37:g.219529965delT	ENSP00000295704:p.Ala193fs		A8K0D6|Q53HQ5|Q9H874	Frame_Shift_Del	DEL	pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,smart_Znf_RING,pfscan_RWD-domain,pfscan_Znf_RING	p.V194fs	ENST00000295704.2	37	c.579	CCDS2420.1	2																																																																																				RNF25	-	smart_Znf_RING,pfscan_Znf_RING		0.537	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF25	HGNC	protein_coding	OTTHUMT00000256721.1	0	0	0	46	46	79	0.00	0.00	T	NM_022453		219529965	-1	3	10	22	32	tier1	no_errors	ENST00000295704	ensembl	human	known	74_37	frame_shift_del	12.00	23.81	DEL	0.233	-	3	22
SERBP1	26135	genome.wustl.edu	37	1	67891960	67891960	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr1:67891960G>A	ENST00000370995.2	-	2	407	c.322C>T	c.(322-324)Cga>Tga	p.R108*	SERBP1_ENST00000370994.4_Nonsense_Mutation_p.R108*|SERBP1_ENST00000370990.5_Nonsense_Mutation_p.R108*|SERBP1_ENST00000361219.6_Nonsense_Mutation_p.R108*|SERBP1_ENST00000484880.1_5'Flank			Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1	108					regulation of apoptotic process (GO:0042981)|regulation of mRNA stability (GO:0043488)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	13						CTTCCAACTCGTCTTATTCCT	0.408													ENSG00000142864																																					0													135.0	127.0	129.0					1																	67891960		2203	4300	6503	SO:0001587	stop_gained	0			-	AF151813	CCDS639.1, CCDS30746.1, CCDS30747.1, CCDS30748.1	1p31	2009-12-17			ENSG00000142864	ENSG00000142864			17860	protein-coding gene	gene with protein product		607378				11001948, 10810093, 18440126, 17698176	Standard	NM_001018067		Approved	PAI-RBP1, DKFZP564M2423, CGI-55, HABP4L, PAIRBP1, CHD3IP	uc001ddv.3	Q8NC51	OTTHUMG00000009372	ENST00000370995.2:c.322C>T	1.37:g.67891960G>A	ENSP00000360034:p.Arg108*		Q5VU19|Q5VU20|Q5VU22|Q8WUH0|Q96SE2|Q9BTY3|Q9BUM4|Q9Y367|Q9Y4S3	Nonsense_Mutation	SNP	pfam_HABP4_PAIRBP1-bd	p.R108*	ENST00000370995.2	37	c.322	CCDS30746.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.257297	0.97417	.	.	ENSG00000142864	ENST00000370994;ENST00000370995;ENST00000361219;ENST00000370990	.	.	.	5.06	5.06	0.68205	.	0.055969	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.4933	15.7079	0.77598	0.0:0.0:1.0:0.0	.	.	.	.	X	108	.	ENSP00000354591:R108X	R	-	1	2	SERBP1	67664548	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	3.693000	0.54735	2.528000	0.85240	0.467000	0.42956	CGA	-	SERBP1	-	NULL		0.408	SERBP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SERBP1	HGNC	protein_coding	OTTHUMT00000025984.2	0	0	1	39	39	59	0.00	1.67	G	NM_001018067		67891960	-1	27	30	5	8	tier1	no_errors	ENST00000370995	ensembl	human	known	74_37	nonsense	84.38	78.95	SNP	1.000	A	27	5
ITGA10	8515	genome.wustl.edu	37	1	145532554	145532554	+	Missense_Mutation	SNP	A	A	G			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr1:145532554A>G	ENST00000369304.3	+	9	1182	c.1007A>G	c.(1006-1008)aAt>aGt	p.N336S	ITGA10_ENST00000538811.1_Missense_Mutation_p.N205S|ITGA10_ENST00000539363.1_Missense_Mutation_p.N193S|ITGA10_ENST00000481236.1_3'UTR	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	336	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTCTTTTTCAATGTCACAGAT	0.493													ENSG00000143127																																					0													146.0	139.0	141.0					1																	145532554		2203	4300	6503	SO:0001583	missense	0			-	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1007A>G	1.37:g.145532554A>G	ENSP00000358310:p.Asn336Ser		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.N336S	ENST00000369304.3	37	c.1007	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.982439	0.74474	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.71461	-0.57;-0.57;-0.57	5.27	5.27	0.74061	von Willebrand factor, type A (3);	0.128994	0.49916	D	0.000136	T	0.68979	0.3060	L	0.31294	0.92	0.53005	D	0.999965	P;P;D;P	0.69078	0.911;0.851;0.997;0.927	P;P;D;P	0.78314	0.756;0.623;0.991;0.842	T	0.73515	-0.3958	10	0.52906	T	0.07	.	13.4487	0.61158	1.0:0.0:0.0:0.0	.	302;205;193;336	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	S	336;302;193;205	ENSP00000358310:N336S;ENSP00000439894:N193S;ENSP00000440011:N205S	ENSP00000358310:N336S	N	+	2	0	ITGA10	144243911	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.774000	0.91767	2.143000	0.66587	0.459000	0.35465	AAT	-	ITGA10	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.493	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	0	0	0	24	24	32	0.00	0.00	A	NM_003637		145532554	+1	30	76	5	9	tier1	no_errors	ENST00000369304	ensembl	human	known	74_37	missense	85.71	88.37	SNP	1.000	G	30	5
TJP2	9414	genome.wustl.edu	37	9	71836181	71836181	+	Missense_Mutation	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr9:71836181C>T	ENST00000377245.4	+	5	929	c.721C>T	c.(721-723)Cgc>Tgc	p.R241C	TJP2_ENST00000265384.7_Missense_Mutation_p.R241C|TJP2_ENST00000453658.2_Missense_Mutation_p.R218C|TJP2_ENST00000348208.4_Missense_Mutation_p.R241C|TJP2_ENST00000535702.1_Missense_Mutation_p.R245C|TJP2_ENST00000539225.1_Missense_Mutation_p.R272C	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	241					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						TGACCGCAGCCGCGGCCGGAG	0.721													ENSG00000119139																																					0													15.0	20.0	18.0					9																	71836181		2187	4287	6474	SO:0001583	missense	0			-	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.721C>T	9.37:g.71836181C>T	ENSP00000366453:p.Arg241Cys		A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_SH3_2,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS2,prints_ZonOcculdens	p.R272C	ENST00000377245.4	37	c.814	CCDS6627.1	9	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150024	0.37923	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000265384;ENST00000535702;ENST00000539225	T;T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1;0.1	4.4	2.46	0.29980	.	0.379077	0.26812	N	0.022363	T	0.54078	0.1836	L	0.46157	1.445	0.36033	D	0.83955	D;D;D;D;P	0.71674	0.998;0.987;0.987;0.978;0.935	P;P;P;B;B	0.53224	0.721;0.629;0.629;0.328;0.258	T	0.57991	-0.7715	9	.	.	.	.	4.4944	0.11830	0.2765:0.5171:0.1275:0.0789	.	272;245;241;241;241	F5H301;F5H886;Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;.;.;ZO2_HUMAN;.	C	218;241;241;241;245;272	ENSP00000392178:R218C;ENSP00000366453:R241C;ENSP00000345893:R241C;ENSP00000265384:R241C;ENSP00000442090:R245C;ENSP00000438262:R272C	.	R	+	1	0	TJP2	71026001	0.501000	0.26099	0.016000	0.15963	0.129000	0.20672	1.176000	0.31957	0.383000	0.24910	0.655000	0.94253	CGC	-	TJP2	-	NULL		0.721	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	HGNC	protein_coding	OTTHUMT00000052572.2	0	0	0	8	8	13	0.00	0.00	C	NM_201629		71836181	+1	5	8	18	8	tier1	no_errors	ENST00000539225	ensembl	human	known	74_37	missense	21.74	50.00	SNP	0.404	T	5	18
TPTEP1	387590	genome.wustl.edu	37	22	17178996	17178996	+	IGR	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr22:17178996C>T								KB-7G2.8 (3458 upstream) : AC005301.8 (48762 downstream)																							TACCACCAGGCCTCCCGGCTC	0.547													ENSG00000100181																																					0																																										SO:0001628	intergenic_variant	0			-																													22.37:g.17178996C>T				R	SNP	-	NULL		37	NULL		22																																																																																			-	TPTEP1	-	-	0	0.547					TPTEP1	HGNC			0	0	0	68	68	13	0.00	0.00	C			17178996	+1	48	7	44	5	tier1	no_errors	ENST00000558085	ensembl	human	known	74_37	rna	51.06	58.33	SNP	0.001	T	48	44
GPR149	344758	genome.wustl.edu	37	3	154055871	154055871	+	Missense_Mutation	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr3:154055871C>T	ENST00000389740.2	-	4	1912	c.1813G>A	c.(1813-1815)Gat>Aat	p.D605N		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	605					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GATGAAGAATCTTCTGAGTTT	0.408													ENSG00000174948																																					0													123.0	118.0	120.0					3																	154055871		1853	4097	5950	SO:0001583	missense	0			-	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1813G>A	3.37:g.154055871C>T	ENSP00000374390:p.Asp605Asn			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.D605N	ENST00000389740.2	37	c.1813	CCDS43162.1	3	.	.	.	.	.	.	.	.	.	.	C	18.66	3.670917	0.67814	.	.	ENSG00000174948	ENST00000389740	.	.	.	5.56	4.68	0.58851	.	0.250743	0.38492	N	0.001664	T	0.42359	0.1199	N	0.14661	0.345	0.45464	D	0.998438	B	0.20887	0.049	B	0.17433	0.018	T	0.36648	-0.9739	9	0.87932	D	0	-9.6711	14.2764	0.66181	0.0:0.9282:0.0:0.0718	.	605	Q86SP6	GP149_HUMAN	N	605	.	ENSP00000374390:D605N	D	-	1	0	GPR149	155538565	1.000000	0.71417	0.802000	0.32245	0.959000	0.62525	5.670000	0.68088	1.337000	0.45525	0.650000	0.86243	GAT	-	GPR149	-	NULL		0.408	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	0	0	0	51	51	93	0.00	0.00	C	XM_293580		154055871	-1	6	6	44	64	tier1	no_errors	ENST00000389740	ensembl	human	known	74_37	missense	12.00	8.57	SNP	1.000	T	6	44
KRT16P6	353194	genome.wustl.edu	37	17	16722293	16722293	+	RNA	SNP	C	C	G	rs377503279	byFrequency	TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr17:16722293C>G	ENST00000602730.1	+	0	6486				AC022596.6_ENST00000417510.1_RNA																							CGGTAGGTGGCGATCTCCTGT	0.622													ENSG00000226145																																					0																																												0			-																													17.37:g.16722293C>G				R	SNP	-	NULL	ENST00000602730.1	37	NULL		17																																																																																			-	AC022596.6	-	-		0.622	RP11-219A15.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226145	Clone_based_vega_gene	processed_transcript	OTTHUMT00000468034.1	0	0	0	105	105	54	0.00	0.00	C			16722293	-1	14	7	118	87	tier1	no_errors	ENST00000417510	ensembl	human	known	74_37	rna	10.61	7.45	SNP	1.000	G	14	118
LOC642426	642426	genome.wustl.edu	37	14	19412607	19412607	+	lincRNA	SNP	C	C	T	rs542387489	byFrequency	TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr14:19412607C>T	ENST00000548050.1	-	0	0				RP11-536C10.16_ENST00000550928.1_lincRNA	NR_046104.1																						GGAGATATGGCGGGAGGGGAA	0.547													ENSG00000258364	.|||	3	0.000599042	0.0	0.0014	5008	,	,		30750	0.0		0.001	False		,,,				2504	0.001																0																																												0			-																													14.37:g.19412607C>T				R	SNP	-	NULL	ENST00000548050.1	37	NULL		14																																																																																			-	RP11-536C10.16	-	-		0.547	RP11-536C10.7-001	KNOWN	basic	lincRNA	ENSG00000258364	Clone_based_vega_gene	lincRNA	OTTHUMT00000408404.1	0	0	0	45	45	48	0.00	0.00	C			19412607	+1	21	7	58	73	tier1	no_errors	ENST00000550928	ensembl	human	known	74_37	rna	26.58	8.75	SNP	0.035	T	21	58
SUPT16H	11198	genome.wustl.edu	37	14	21830470	21830470	+	Missense_Mutation	SNP	G	G	A			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr14:21830470G>A	ENST00000216297.2	-	15	2017	c.1679C>T	c.(1678-1680)tCc>tTc	p.S560F		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	560					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TCCTTCCACGGACATACTTAT	0.373													ENSG00000092201																																					0													54.0	50.0	52.0					14																	21830470		2203	4300	6503	SO:0001583	missense	0			-	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.1679C>T	14.37:g.21830470G>A	ENSP00000216297:p.Ser560Phe		Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.S560F	ENST00000216297.2	37	c.1679	CCDS9569.1	14	.	.	.	.	.	.	.	.	.	.	G	27.9	4.877396	0.91664	.	.	ENSG00000092201	ENST00000216297	.	.	.	5.72	5.72	0.89469	FACT complex subunit Spt16p/Cdc68p (1);	0.000000	0.85682	D	0.000000	D	0.85784	0.5777	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88125	0.2834	9	0.87932	D	0	-12.0032	18.6573	0.91459	0.0:0.0:1.0:0.0	.	560	Q9Y5B9	SP16H_HUMAN	F	560	.	ENSP00000216297:S560F	S	-	2	0	SUPT16H	20900310	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	8.730000	0.91510	2.694000	0.91930	0.650000	0.86243	TCC	-	SUPT16H	-	pfam_FACT_Spt16p		0.373	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	0	0	0	40	40	46	0.00	0.00	G			21830470	-1	8	4	64	78	tier1	no_errors	ENST00000216297	ensembl	human	known	74_37	missense	11.11	4.88	SNP	1.000	A	8	64
ATF4P4	100127952	genome.wustl.edu	37	11	113660099	113660099	+	RNA	SNP	G	G	A	rs527303673		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr11:113660099G>A	ENST00000393544.2	+	0	147									activating transcription factor 4 pseudogene 4																		AAGAGATGGCGATGTCATCAG	0.582													ENSG00000256167	G|||	1	0.000199681	0.0	0.0	5008	,	,		17128	0.001		0.0	False		,,,				2504	0.0																0																																												0			-			11q23.2	2011-09-02	2010-12-16	2010-12-16	ENSG00000256167	ENSG00000256167			787	pseudogene	pseudogene			"""activating transcription factor 4B"""	ATF4B		10610718	Standard	NG_021835		Approved				OTTHUMG00000168194		11.37:g.113660099G>A				R	SNP	-	NULL	ENST00000393544.2	37	NULL		11																																																																																			-	ATF4P4	-	-		0.582	ATF4P4-002	KNOWN	basic	processed_transcript	ATF4P4	HGNC	pseudogene	OTTHUMT00000398707.1	0	0	0	30	30	4	0.00	0.00	G	NG_021835		113660099	+1	7	0	23	2	tier1	no_errors	ENST00000393544	ensembl	human	known	74_37	rna	23.33	0.00	SNP	1.000	A	7	23
AC026320.1	0	genome.wustl.edu	37	3	191693768	191693773	+	RNA	DEL	GTGTGC	GTGTGC	-	rs5014295	byFrequency	TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	GTGTGC	GTGTGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr3:191693768_191693773delGTGTGC	ENST00000401201.1	+	0	26_31																											gtgtgtgtgtgtgtgcgcgcgtgcgt	0.471													ENSG00000216020																																					0																																												0																																3.37:g.191693768_191693773delGTGTGC				R	DEL	-	NULL	ENST00000401201.1	37	NULL		3																																																																																				AC026320.1	-	-		0.471	AC026320.1-201	NOVEL	basic	miRNA	ENSG00000216020	Clone_based_ensembl_gene	miRNA		0	0	0	0	0	0	0.00	0.00	GTGTGC			191693773	+1	0	0	0	0	tier1	no_errors	ENST00000401201	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.008:0.009:0.008:0.008:0.006:0.005	-	0	0
LHCGR	3973	genome.wustl.edu	37	2	48982775	48982777	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr2:48982775_48982777delCTT	ENST00000294954.7	-	1	55_57	c.34_36delAAG	c.(34-36)aagdel	p.K12del	STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_In_Frame_Del_p.K12del|LHCGR_ENST00000403273.1_In_Frame_Del_p.K12del|LHCGR_ENST00000405626.1_In_Frame_Del_p.K12del|LHCGR_ENST00000344775.3_In_Frame_Del_p.K12del	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	12					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	gcagcagcagcttcagcagctgc	0.724													ENSG00000138039																																					0									,	73,1487		30,13,737					,	-7.5	0.0		dbSNP_130	2	150,3028		37,76,1476	no	intron,coding	LHCGR,STON1-GTF2A1L	NM_001198593.1,NM_000233.3	,	67,89,2213	A1A1,A1R,RR		4.7199,4.6795,4.7066	,	,		223,4515				SO:0001651	inframe_deletion	0					CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.34_36delAAG	2.37:g.48982775_48982777delCTT	ENSP00000294954:p.Lys12del		Q14751|Q15996|Q9UEW9	In_Frame_Del	DEL	pfam_GPCR_Rhodpsn,prints_LSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.K12in_frame_del	ENST00000294954.7	37	c.36_34	CCDS1842.1	2																																																																																				LHCGR	-	prints_TSH_rcpt		0.724	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	0	0	0	11	11	2	0.00	0.00	CTT	NM_000233.3		48982777	-1	6	0	12	3	tier1	no_errors	ENST00000294954	ensembl	human	known	74_37	in_frame_del	33.33	0.00	DEL	0.000:0.000:0.000	-	6	12
MAGEL2	54551	genome.wustl.edu	37	15	23890952	23890952	+	Silent	SNP	C	C	T			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr15:23890952C>T	ENST00000532292.1	-	1	223	c.129G>A	c.(127-129)gaG>gaA	p.E43E		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GAAAGGGCTGCTCCAGCTGGA	0.701													ENSG00000254585																																					0													5.0	5.0	5.0					15																	23890952		1709	3753	5462	SO:0001819	synonymous_variant	0			-	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.129G>A	15.37:g.23890952C>T				Silent	SNP	pfam_MAGE,pfscan_MAGE	p.E43	ENST00000532292.1	37	c.129		15	.	.	.	.	.	.	.	.	.	.	C	6.219	0.408523	0.11812	.	.	ENSG00000254585	ENST00000532292	.	.	.	3.43	2.5	0.30297	.	.	.	.	.	T	0.60274	0.2256	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57608	-0.7782	4	.	.	.	.	11.0872	0.48093	0.0:0.8105:0.1895:0.0	.	.	.	.	N	75	.	.	S	-	2	0	MAGEL2	21442045	0.015000	0.18098	1.000000	0.80357	0.189000	0.23516	0.308000	0.19314	0.990000	0.38787	0.197000	0.17608	AGC	-	MAGEL2	-	NULL		0.701	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	0	0	0	22	22	0	0.00	0.00	C	NM_019066		23890952	-1	15	1	5	0	tier1	no_errors	ENST00000532292	ensembl	human	known	74_37	silent	75.00	100.00	SNP	1.000	T	15	5
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147845	+	3'UTR	DEL	GTGTGTGTGT	GTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs200969250|rs66612444		TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	GTGTGTGTGT	GTGTGTGTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr2:50147836_50147845delGTGTGTGTGT	ENST00000406316.2	-	0	7147_7156				NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000401710.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgt	0.395													ENSG00000179915																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACAC>-	2.37:g.50147846_50147855delGTGTGTGTGT			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	R	DEL	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																				NRXN1	-	-		0.395	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	0	0	0	0	0	0	0.00	0.00	GTGTGTGTGT			50147845	-1	0	0	0	0	tier1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096	-	0	0
ZNF257	113835	genome.wustl.edu	37	19	22271217	22271217	+	Missense_Mutation	SNP	C	C	G			TCGA-QC-A6FX-01A-11D-A32I-09	TCGA-QC-A6FX-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fcd49624-3dbe-45eb-8820-7e13da9cdcaa	2cdf6c47-3638-4511-8a87-1247ddcbaccb	g.chr19:22271217C>G	ENST00000594947.1	+	4	809	c.665C>G	c.(664-666)aCt>aGt	p.T222S		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				CATAAGATGACTCATACTGGA	0.388													ENSG00000197134																																					0													39.0	42.0	41.0					19																	22271217		2180	4289	6469	SO:0001583	missense	0			-	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.665C>G	19.37:g.22271217C>G	ENSP00000470209:p.Thr222Ser		B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T222S	ENST00000594947.1	37	c.665	CCDS46030.1	19	.	.	.	.	.	.	.	.	.	.	C	3.903	-0.021596	0.07634	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	0.926	-1.85	0.07784	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18964	0.0455	N	0.17764	0.52	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.20371	-1.0277	8	0.72032	D	0.01	.	2.5925	0.04846	0.2341:0.4161:0.0:0.3498	.	222	Q9Y2Q1	ZN257_HUMAN	S	222;194	.	ENSP00000380312:T194S	T	+	2	0	ZNF257	22063057	0.000000	0.05858	0.018000	0.16275	0.090000	0.18270	-1.142000	0.03203	-0.671000	0.05274	-0.657000	0.03884	ACT	-	ZNF257	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.388	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF257	HGNC	protein_coding	OTTHUMT00000464382.1	0	0	0	35	35	4	0.00	0.00	C			22271217	+1	16	1	46	0	tier1	no_errors	ENST00000594947	ensembl	human	known	74_37	missense	25.81	100.00	SNP	0.007	G	16	46
