#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SCFD2	152579	genome.wustl.edu	37	4	53822530	53822530	+	Intron	SNP	C	C	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr4:53822530C>A	ENST00000401642.3	-	6	1695				SCFD2_ENST00000388940.4_Intron|RP11-752D24.2_ENST00000508813.1_RNA	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2						protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			ctttttatggcaagtgacaga	0.502													ENSG00000248115																																					0																																										SO:0001627	intron_variant	0			-	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.1562-35493G>T	4.37:g.53822530C>A			Q8N5F3|Q8N8H0|Q96ED3	R	SNP	-	NULL	ENST00000401642.3	37	NULL	CCDS33984.1	4																																																																																			-	RP11-752D24.2	-	-		0.502	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248115	Clone_based_vega_gene	protein_coding	OTTHUMT00000361311.3	0	0		33	33		0.00		C	NM_152540		53822530	+1	3		17		tier1	no_errors	ENST00000508813	ensembl	human	known	74_37	rna	15.00		SNP	0.000	A	3	17
SEPT4	5414	genome.wustl.edu	37	17	56603938	56603938	+	Intron	SNP	C	C	A	rs3034932		TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr17:56603938C>A	ENST00000317268.3	-	2	534				SEPT4_ENST00000579371.1_Intron|SEPT4_ENST00000426861.1_Intron|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000317256.6_Intron|SEPT4_ENST00000580809.1_Intron|SEPT4_ENST00000580844.1_Intron|SEPT4_ENST00000583114.1_Intron|SEPT4_ENST00000393086.1_Intron|RP11-112H10.4_ENST00000578022.1_RNA|SEPT4_ENST00000412945.3_Intron|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000457347.2_Intron|SEPT4_ENST00000580791.1_Intron	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4						apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					cacacaaacacacacacacac	0.547													ENSG00000108387																																					0																																										SO:0001627	intron_variant	0			-	AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.357+104G>T	17.37:g.56603938C>A			B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	R	SNP	-	NULL	ENST00000317268.3	37	NULL	CCDS11610.1	17																																																																																			-	SEPT4	-	-		0.547	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEPT4	HGNC	protein_coding	OTTHUMT00000445420.1	0	0		21	21		0.00		C	NM_080417		56603938	-1	4		17		tier1	no_errors	ENST00000580740	ensembl	human	known	74_37	rna	19.05		SNP	0.000	A	4	17
CHL1	10752	genome.wustl.edu	37	3	432653	432653	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr3:432653A>G	ENST00000256509.2	+	22	3244	c.2602A>G	c.(2602-2604)Aca>Gca	p.T868A	CHL1_ENST00000397491.2_Missense_Mutation_p.T852A	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TTGGTGGAAAACAAAAAGTCT	0.348													ENSG00000134121																																					0													60.0	63.0	62.0					3																	432653		2203	4300	6503	SO:0001583	missense	0			-	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2602A>G	3.37:g.432653A>G	ENSP00000256509:p.Thr868Ala		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T868A	ENST00000256509.2	37	c.2602	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	A	9.031	0.987200	0.18889	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.56941	0.43;0.43	5.75	3.33	0.38152	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.378776	0.30890	N	0.008673	T	0.39009	0.1062	L	0.42245	1.32	0.30650	N	0.755574	B;B;B	0.27351	0.176;0.176;0.12	B;B;B	0.32289	0.122;0.122;0.143	T	0.34403	-0.9830	10	0.10902	T	0.67	.	6.0253	0.19652	0.7222:0.1388:0.139:0.0	.	852;852;868	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	A	868;852	ENSP00000256509:T868A;ENSP00000380628:T852A	ENSP00000256509:T868A	T	+	1	0	CHL1	407653	1.000000	0.71417	0.976000	0.42696	0.980000	0.70556	2.431000	0.44775	0.432000	0.26286	-0.313000	0.08912	ACA	-	CHL1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.348	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2	0	0		65	65		0.00		A	NM_006614		432653	+1	5		38		tier1	no_errors	ENST00000256509	ensembl	human	known	74_37	missense	11.63		SNP	0.996	G	5	38
OSTM1	28962	genome.wustl.edu	37	6	108395534	108395534	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr6:108395534G>T	ENST00000193322.3	-	1	407	c.322C>A	c.(322-324)Ccc>Acc	p.P108T		NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	108					ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		AGGCGCACGGGCCGGGCGCTG	0.667													ENSG00000081087																									Melanoma(162;1427 1909 3096 17430 21396)												0													18.0	21.0	20.0					6																	108395534		2201	4300	6501	SO:0001583	missense	0			-	AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.322C>A	6.37:g.108395534G>T	ENSP00000193322:p.Pro108Thr		E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	Missense_Mutation	SNP	pfam_Osteopetrosis-assoc_TM_1	p.P108T	ENST00000193322.3	37	c.322	CCDS5062.1	6	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412913	0.83449	.	.	ENSG00000081087	ENST00000193322	T	0.62498	0.02	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.74168	0.3681	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.78605	-0.2139	10	0.87932	D	0	-12.2761	11.2483	0.49010	0.086:0.0:0.914:0.0	.	108	Q86WC4	OSTM1_HUMAN	T	108	ENSP00000193322:P108T	ENSP00000193322:P108T	P	-	1	0	OSTM1	108502227	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.183000	0.58317	2.480000	0.83734	0.655000	0.94253	CCC	-	OSTM1	-	pfam_Osteopetrosis-assoc_TM_1		0.667	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSTM1	HGNC	protein_coding	OTTHUMT00000041709.3	0	0		15	15		0.00		G	NM_014028		108395534	-1	4		7		tier1	no_errors	ENST00000193322	ensembl	human	known	74_37	missense	36.36		SNP	1.000	T	4	7
SLC18A1	6570	genome.wustl.edu	37	8	20004811	20004811	+	Silent	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr8:20004811G>T	ENST00000276373.5	-	15	1688	c.1422C>A	c.(1420-1422)ctC>ctA	p.L474L	SLC18A1_ENST00000440926.1_Silent_p.L474L|SLC18A1_ENST00000519026.1_Silent_p.L442L|SLC18A1_ENST00000437980.1_Intron|SLC18A1_ENST00000381608.4_Intron|SLC18A1_ENST00000265808.7_Silent_p.L442L	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	474					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	GGTAGTAGCAGAGTGGAGCAT	0.522													ENSG00000036565																																					0													85.0	73.0	77.0					8																	20004811		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.1422C>A	8.37:g.20004811G>T			E9PDJ5|Q9BRE4	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Multidrug-R	p.L474	ENST00000276373.5	37	c.1422	CCDS6013.1	8																																																																																			-	SLC18A1	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.522	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A1	HGNC	protein_coding	OTTHUMT00000214106.1	0	0		60	60		0.00		G			20004811	-1	4		44		tier1	no_errors	ENST00000276373	ensembl	human	known	74_37	silent	8.33		SNP	1.000	T	4	44
WNT8A	7478	genome.wustl.edu	37	5	137426397	137426397	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr5:137426397G>T	ENST00000398754.1	+	6	696	c.691G>T	c.(691-693)Gcc>Tcc	p.A231S	WNT8A_ENST00000506684.1_Missense_Mutation_p.A249S	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	231					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGGGAACAGCGCCGAGGGCCA	0.547													ENSG00000061492																																					0													44.0	48.0	47.0					5																	137426397		1942	4148	6090	SO:0001583	missense	0			-	AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.691G>T	5.37:g.137426397G>T	ENSP00000381739:p.Ala231Ser		Q96S51	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt8	p.A231S	ENST00000398754.1	37	c.691	CCDS43368.1	5	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778171	0.90195	.	.	ENSG00000061492	ENST00000506684;ENST00000504809;ENST00000398754	T;T;T	0.75821	-0.97;-0.97;-0.97	4.85	4.85	0.62838	.	0.173757	0.51477	D	0.000094	D	0.84009	0.5378	L	0.58669	1.825	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.83507	0.0078	10	0.42905	T	0.14	.	18.1622	0.89712	0.0:0.0:1.0:0.0	.	249;249;231	D6RF47;D6RF94;Q9H1J5	.;.;WNT8A_HUMAN	S	249;249;231	ENSP00000426653:A249S;ENSP00000424809:A249S;ENSP00000381739:A231S	ENSP00000354726:A231S	A	+	1	0	WNT8A	137454296	1.000000	0.71417	0.961000	0.40146	0.936000	0.57629	9.657000	0.98554	2.527000	0.85204	0.557000	0.71058	GCC	-	WNT8A	-	pfam_Wnt,smart_Wnt,prints_Wnt8		0.547	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT8A	HGNC	protein_coding	OTTHUMT00000280395.1	0	0		53	53		0.00		G	NM_058244		137426397	+1	4		42		tier1	no_errors	ENST00000361560	ensembl	human	known	74_37	missense	8.70		SNP	1.000	T	4	42
OXCT2	64064	genome.wustl.edu	37	1	40235448	40235448	+	Missense_Mutation	SNP	C	C	T	rs150795467	byFrequency	TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr1:40235448C>T	ENST00000327582.5	-	1	1572	c.1480G>A	c.(1480-1482)Gac>Aac	p.D494N	BMP8B_ENST00000397360.2_Intron|BMP8B_ENST00000372827.3_Intron	NM_022120.1	NP_071403.1	Q9BYC2	SCOT2_HUMAN	3-oxoacid CoA transferase 2	494					ketone body catabolic process (GO:0046952)	mitochondrion (GO:0005739)|motile cilium (GO:0031514)	3-oxoacid CoA-transferase activity (GO:0008260)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|pancreas(1)|upper_aerodigestive_tract(1)	6	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		Succinic acid(DB00139)	TTTTTGATGTCGTCCACCGTC	0.632													ENSG00000198754																																					0													41.0	40.0	40.0					1																	40235448		2203	4299	6502	SO:0001583	missense	0			-	AB050193	CCDS445.1	1p34	2008-02-05			ENSG00000198754	ENSG00000198754			18606	protein-coding gene	gene with protein product		610289				11214971, 11756565	Standard	NM_022120		Approved	FKSG25, FLJ00030, SCOT-T	uc001ceb.1	Q9BYC2	OTTHUMG00000009249	ENST00000327582.5:c.1480G>A	1.37:g.40235448C>T	ENSP00000361914:p.Asp494Asn		B2RBB4|Q5QPK4|Q8NHR1|Q9H1I4	Missense_Mutation	SNP	pfam_CoA_trans_fam_I,smart_CoA_trans_fam_I,pirsf_3-oxoacid_CoA-transferase,tigrfam_3-oxoacid_CoA-transf_B,tigrfam_3-oxoacid_CoA-transf_A	p.D494N	ENST00000327582.5	37	c.1480	CCDS445.1	1	.	.	.	.	.	.	.	.	.	.	c	14.42	2.530386	0.45073	.	.	ENSG00000198754	ENST00000327582	D	0.93247	-3.19	2.51	2.51	0.30379	3-oxoacid CoA-transferase, subunit B (1);	0.052044	0.64402	U	0.000001	D	0.94202	0.8139	.	.	.	0.37421	P	0.086372	D;D	0.60575	0.988;0.988	P;P	0.55785	0.784;0.71	D	0.95837	0.8863	8	0.62326	D	0.03	.	11.1506	0.48455	0.0:1.0:0.0:0.0	.	494;494	B3KS89;Q9BYC2	.;SCOT2_HUMAN	N	494	ENSP00000361914:D494N	ENSP00000361914:D494N	D	-	1	0	OXCT2	40008035	0.937000	0.31787	0.010000	0.14722	0.096000	0.18686	3.036000	0.49767	1.698000	0.51180	0.556000	0.70494	GAC	rs150795467	OXCT2	-	pfam_CoA_trans_fam_I,smart_CoA_trans_fam_I,pirsf_3-oxoacid_CoA-transferase,tigrfam_3-oxoacid_CoA-transf_B		0.632	OXCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXCT2	HGNC	protein_coding	OTTHUMT00000025656.1	0	0		54	54		0.00		C	NM_022120		40235448	-1	8		74		tier1	no_errors	ENST00000327582	ensembl	human	known	74_37	missense	9.76		SNP	0.171	T	8	74
RAD18	56852	genome.wustl.edu	37	3	8944165	8944165	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr3:8944165delT	ENST00000264926.2	-	10	1183	c.1067delA	c.(1066-1068)cagfs	p.Q356fs		NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	356					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		TTTTCTAGCCTGATCCACCAG	0.338								Rad6 pathway					ENSG00000070950																																					0													148.0	138.0	142.0					3																	8944165		2203	4300	6503	SO:0001589	frameshift_variant	0					CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.1067delA	3.37:g.8944165delT	ENSP00000264926:p.Gln356fs		Q58F55|Q9NRT6	Frame_Shift_Del	DEL	pfam_SAP_dom,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_Rad18_put,smart_SAP_dom,pfscan_Znf_RING,pfscan_SAP_dom	p.Q356fs	ENST00000264926.2	37	c.1067	CCDS2571.1	3																																																																																				RAD18	-	NULL		0.338	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD18	HGNC	protein_coding	OTTHUMT00000207071.2	0	0		54	54		0.00		T	NM_020165		8944165	-1	2		15		tier1	no_errors	ENST00000264926	ensembl	human	known	74_37	frame_shift_del	11.76		DEL	1.000	-	2	15
AL136987.1	0	genome.wustl.edu	37	1	192460261	192460266	+	RNA	DEL	TGTGTG	TGTGTG	-			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	TGTGTG	TGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr1:192460261_192460266delTGTGTG	ENST00000408218.1	-	0	84_89																											TCTCTGAATAtgtgtgtgtgtgtgtg	0.335													ENSG00000221145																																					0																																												0																																1.37:g.192460267_192460272delTGTGTG				R	DEL	-	NULL	ENST00000408218.1	37	NULL		1																																																																																				AL136987.1	-	-		0.335	AL136987.1-201	NOVEL	basic	miRNA	ENSG00000221145	Clone_based_ensembl_gene	miRNA										TGTGTG			192460266	-1					tier1	no_errors	ENST00000408218	ensembl	human	novel	74_37	rna			DEL	0.001:0.002:0.002:0.001:0.002:0.001	-		
MYRFL	196446	genome.wustl.edu	37	12	70303752	70303752	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr12:70303752G>T	ENST00000552032.2	+	12	1601	c.1387G>T	c.(1387-1389)Gac>Tac	p.D463Y	RP11-611E13.2_ENST00000549419.1_RNA|MYRFL_ENST00000547771.2_Missense_Mutation_p.D463Y			Q96LU7	MRFL_HUMAN	myelin regulatory factor-like	463	Peptidase S74.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AAATTAGGTTGACACGAATGA	0.363													ENSG00000166268																																					0																																										SO:0001583	missense	0			-	AK057785		12q15	2012-12-19	2012-12-19	2012-12-19	ENSG00000166268	ENSG00000166268			26316	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 15"", ""chromosome 12 open reading frame 28"""	C12orf15, C12orf28			Standard	XM_006709961		Approved	FLJ25056, bcm1377		Q96LU7	OTTHUMG00000169438	ENST00000552032.2:c.1387G>T	12.37:g.70303752G>T	ENSP00000448753:p.Asp463Tyr			Missense_Mutation	SNP	pfam_NDT80_D-bd_dom,superfamily_p53-like_TF_D-bd	p.D463Y	ENST00000552032.2	37	c.1387		12	.	.	.	.	.	.	.	.	.	.	G	22.4	4.278366	0.80692	.	.	ENSG00000166268	ENST00000552032	.	.	.	5.58	4.69	0.59074	.	.	.	.	.	D	0.84284	0.5438	M	0.92268	3.29	0.80722	D	1	.	.	.	.	.	.	D	0.88366	0.2991	6	0.87932	D	0	.	14.5507	0.68065	0.0703:0.0:0.9297:0.0	.	.	.	.	Y	167	.	ENSP00000449598:D463Y	D	+	1	0	C12orf28	68590019	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.497000	0.60367	1.355000	0.45865	0.655000	0.94253	GAC	-	MYRFL	-	NULL		0.363	MYRFL-004	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	MYRFL	HGNC	protein_coding	OTTHUMT00000404016.2	0	0		52	52		0.00		G	NM_182530		70303752	+1	3		24		tier1	no_errors	ENST00000552032	ensembl	human	putative	74_37	missense	11.11		SNP	1.000	T	3	24
F13A1	2162	genome.wustl.edu	37	6	6152150	6152150	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr6:6152150C>T	ENST00000264870.3	-	14	2206	c.1941G>A	c.(1939-1941)atG>atA	p.M647I		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	647					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CTGTCACAGTCATGTCAGAAC	0.443													ENSG00000124491																																					0													81.0	72.0	75.0					6																	6152150		2203	4300	6503	SO:0001583	missense	0			-	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1941G>A	6.37:g.6152150C>T	ENSP00000264870:p.Met647Ile		Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.M647I	ENST00000264870.3	37	c.1941	CCDS4496.1	6	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983649	0.53827	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.66815	-0.23	5.37	5.37	0.77165	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	M	0.74647	2.275	0.58432	D	0.999999	P;P	0.49635	0.926;0.891	P;P	0.51415	0.518;0.669	T	0.70662	-0.4810	10	0.45353	T	0.12	.	16.6621	0.85243	0.0:1.0:0.0:0.0	.	584;647	F5H080;P00488	.;F13A_HUMAN	I	647;584	ENSP00000264870:M647I	ENSP00000264870:M647I	M	-	3	0	F13A1	6097149	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	2.035000	0.41155	2.788000	0.95919	0.650000	0.86243	ATG	-	F13A1	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C		0.443	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13A1	HGNC	protein_coding	OTTHUMT00000039756.3	0	0		51	51		0.00		C	NM_000129		6152150	-1	3		23		tier1	no_errors	ENST00000264870	ensembl	human	known	74_37	missense	11.54		SNP	1.000	T	3	23
TENM4	26011	genome.wustl.edu	37	11	78807960	78807961	+	Intron	INS	-	-	GC	rs376867043|rs66695606|rs369257696|rs398016808		TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr11:78807960_78807961insGC	ENST00000278550.7	-	5	398				CTD-2337I7.1_ENST00000526091.1_lincRNA	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4						cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TGcacgcacatgcgcgcgcgcg	0.485													ENSG00000255345																																					0																																										SO:0001627	intron_variant	0				AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.65-26906->GC	11.37:g.78807969_78807970dupGC			A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	R	INS	-	NULL	ENST00000278550.7	37	NULL	CCDS44688.1	11																																																																																				CTD-2337I7.1	-	-		0.485	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928921	Clone_based_vega_gene	protein_coding	OTTHUMT00000391406.2	0	0		14	14		0.00		-			78807961	+1	4		19		tier1	no_errors	ENST00000526091	ensembl	human	known	74_37	rna	17.39		INS	0.000:0.000	GC	4	19
CCDC184	387856	genome.wustl.edu	37	12	48577971	48577971	+	Silent	SNP	G	G	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr12:48577971G>A	ENST00000316554.3	+	1	606	c.66G>A	c.(64-66)gtG>gtA	p.V22V		NM_001013635.3	NP_001013657.3	Q52MB2	CC184_HUMAN		22						cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)	4						CCCTGGAGGTGTCCACCGTGC	0.647													ENSG00000177875																																					0													40.0	50.0	47.0					12																	48577971		2203	4298	6501	SO:0001819	synonymous_variant	0			-																												ENST00000316554.3:c.66G>A	12.37:g.48577971G>A			Q96MK5|Q96N39	Silent	SNP	NULL	p.V22	ENST00000316554.3	37	c.66	CCDS31785.1	12																																																																																			-	C12orf68	-	NULL		0.647	C12orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf68	HGNC	protein_coding	OTTHUMT00000406514.1	0	0		85	85		0.00		G			48577971	+1	23		56		tier1	no_errors	ENST00000316554	ensembl	human	known	74_37	silent	29.11		SNP	1.000	A	23	56
PLXNA3	55558	genome.wustl.edu	37	X	153696280	153696280	+	Silent	SNP	C	C	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chrX:153696280C>A	ENST00000369682.3	+	21	3931	c.3756C>A	c.(3754-3756)acC>acA	p.T1252T		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1252					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGGACCGTACCCTCAAGCGTC	0.672													ENSG00000130827																																					0													66.0	62.0	63.0					X																	153696280		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.3756C>A	X.37:g.153696280C>A			Q5HY36	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.T1252	ENST00000369682.3	37	c.3756	CCDS14752.1	X																																																																																			-	PLX3	-	NULL		0.672	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLX3	HGNC	protein_coding	OTTHUMT00000081634.1	0	0		26	26		0.00		C	NM_017514		153696280	+1	4		34		tier1	no_errors	ENST00000369682	ensembl	human	known	74_37	silent	10.53		SNP	0.579	A	4	34
CCKBR	887	genome.wustl.edu	37	11	6292496	6292496	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr11:6292496G>A	ENST00000334619.2	+	5	1260	c.1067G>A	c.(1066-1068)cGc>cAc	p.R356H	CCKBR_ENST00000532715.1_Missense_Mutation_p.R272H|CCKBR_ENST00000525462.1_Missense_Mutation_p.R425H	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	356					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	AACACGTGGCGCGCCTTTGAT	0.567													ENSG00000110148																																					0													158.0	124.0	136.0					11																	6292496		2201	4296	6497	SO:0001583	missense	0			-	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.1067G>A	11.37:g.6292496G>A	ENSP00000335544:p.Arg356His		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Gastrin_rcpt,prints_Cholcskin_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.R425H	ENST00000334619.2	37	c.1274	CCDS7761.1	11	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046067	0.75846	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.72505	-0.66;-0.66;-0.66	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.087235	0.53938	D	0.000052	D	0.83774	0.5327	M	0.74546	2.27	0.37378	D	0.911939	D;P;P	0.76494	0.999;0.916;0.932	D;P;P	0.72338	0.977;0.562;0.735	D	0.87432	0.2389	10	0.66056	D	0.02	.	17.3923	0.87435	0.0:0.0:1.0:0.0	.	425;290;356	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	H	356;272;425	ENSP00000335544:R356H;ENSP00000432079:R272H;ENSP00000435534:R425H	ENSP00000335544:R356H	R	+	2	0	CCKBR	6249072	0.999000	0.42202	1.000000	0.80357	0.962000	0.63368	2.833000	0.48159	2.425000	0.82216	0.557000	0.71058	CGC	-	CCKBR	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Cholcskin_rcpt		0.567	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCKBR	HGNC	protein_coding	OTTHUMT00000257230.2	0	0		29	29		0.00		G	NM_176875		6292496	+1	8		27		tier1	no_errors	ENST00000525462	ensembl	human	known	74_37	missense	22.86		SNP	1.000	A	8	27
CAPZA1	829	genome.wustl.edu	37	1	113202208	113202208	+	Intron	DEL	C	C	-	rs3013438|rs200009640|rs199887112	byFrequency	TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr1:113202208delC	ENST00000263168.3	+	7	1178				CAPZA1_ENST00000476936.1_Intron	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCTCTCTCTCTTTTTTTTTT	0.398													ENSG00000116489																																					0																																										SO:0001627	intron_variant	0				U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.507-115C>-	1.37:g.113202208delC			Q53FQ6|Q6FHD5	R	DEL	-	NULL	ENST00000263168.3	37	NULL	CCDS30805.1	1																																																																																				CAPZA1	-	-		0.398	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPZA1	HGNC	protein_coding	OTTHUMT00000032567.2	0	0		22	22		0.00		C	NM_006135		113202208	+1	3		27		tier1	no_errors	ENST00000466066	ensembl	human	known	74_37	rna	10.00		DEL	0.021	-	3	27
NUDT18	79873	genome.wustl.edu	37	8	21965275	21965275	+	Missense_Mutation	SNP	G	G	A	rs368870753		TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr8:21965275G>A	ENST00000309188.6	-	5	626	c.508C>T	c.(508-510)Cgc>Tgc	p.R170C	NUDT18_ENST00000522405.1_Missense_Mutation_p.R93C|NUDT18_ENST00000521807.2_3'UTR	NM_024815.3	NP_079091.3	Q6ZVK8	NUD18_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 18	170					dADP catabolic process (GO:0046057)|dGDP catabolic process (GO:0046067)|GDP catabolic process (GO:0046712)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	8-hydroxy-dADP phosphatase activity (GO:0044717)|8-oxo-dGDP phosphatase activity (GO:0044715)|8-oxo-GDP phosphatase activity (GO:0044716)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|lung(2)	4				Colorectal(74;0.00185)|COAD - Colon adenocarcinoma(73;0.0608)|READ - Rectum adenocarcinoma(5;0.0986)		GCTTGCTGGCGATACTGGGCG	0.637													ENSG00000173566																																					0								G	CYS/ARG	0,4324		0,0,2162	69.0	79.0	76.0		510	-2.1	0.1	8		76	2,8494		0,2,4246	no	missense	NUDT18	NM_024815.3	180	0,2,6408	AA,AG,GG		0.0235,0.0,0.0156	benign	170/324	21965275	2,12818	2162	4248	6410	SO:0001583	missense	0			-		CCDS75706.1	8p21.3	2012-07-31				ENSG00000275074		"""Nudix motif containing"""	26194	protein-coding gene	gene with protein product	"""mutT human homolog 3"""	615791				22556419	Standard	NM_024815		Approved	FLJ22494, MTH3	uc003xaq.1	Q6ZVK8		ENST00000309188.6:c.508C>T	8.37:g.21965275G>A	ENSP00000307852:p.Arg170Cys		Q8IZ75|Q9H687	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,prints_Nudix_hydrolase	p.R170C	ENST00000309188.6	37	c.508		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.36|11.36	1.616527|1.616527	0.28801|0.28801	0.0|0.0	2.35E-4|2.35E-4	ENSG00000173566|ENSG00000173566	ENST00000522405;ENST00000309188|ENST00000522379	T|.	0.43688|.	0.94|.	5.37|5.37	-2.11|-2.11	0.07187|0.07187	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);|.	0.550376|.	0.19052|.	N|.	0.124002|.	T|T	0.21347|0.21347	0.0514|0.0514	L|L	0.29908|0.29908	0.895|0.895	0.21445|0.21445	N|N	0.999685|0.999685	B|.	0.12013|.	0.005|.	B|.	0.04013|.	0.001|.	T|T	0.26883|0.26883	-1.0090|-1.0090	10|5	0.29301|.	T|.	0.29|.	1.2701|1.2701	2.2581|2.2581	0.04060|0.04060	0.3475:0.1257:0.4002:0.1266|0.3475:0.1257:0.4002:0.1266	.|.	170|.	Q6ZVK8|.	NUD18_HUMAN|.	C|L	93;170|205	ENSP00000430539:R93C|.	ENSP00000307852:R170C|.	R|S	-|-	1|2	0|0	NUDT18|NUDT18	22021220|22021220	0.000000|0.000000	0.05858|0.05858	0.092000|0.092000	0.20876|0.20876	0.850000|0.850000	0.48378|0.48378	0.038000|0.038000	0.13862|0.13862	-0.340000|-0.340000	0.08388|0.08388	0.655000|0.655000	0.94253|0.94253	CGC|TCG	-	NUDT18	-	superfamily_NUDIX_hydrolase_dom-like		0.637	NUDT18-201	KNOWN	basic|appris_principal	protein_coding	NUDT18	HGNC	protein_coding		0	0		26	26		0.00		G	NM_024815		21965275	-1	11		31		tier1	no_errors	ENST00000309188	ensembl	human	known	74_37	missense	26.19		SNP	0.007	A	11	31
NOL9	79707	genome.wustl.edu	37	1	6585914	6585914	+	Nonstop_Mutation	SNP	T	T	C			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr1:6585914T>C	ENST00000377705.5	-	12	2141	c.2109A>G	c.(2107-2109)tgA>tgG	p.*703W		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	0					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		AACGCGAGCATCACTTCATTT	0.433													ENSG00000162408																																					0													187.0	180.0	183.0					1																	6585914		2203	4300	6503	SO:0001578	stop_lost	0			-	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.2109A>G	1.37:g.6585914T>C	ENSP00000366934:p.*703Cysext*5		Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Nonstop_Mutation	SNP	pfam_Pre-mR_cleavage_cplxII_Clp1,superfamily_P-loop_NTPase	p.*703W	ENST00000377705.5	37	c.2109	CCDS80.1	1	.	.	.	.	.	.	.	.	.	.	T	2.411	-0.335241	0.05278	.	.	ENSG00000162408	ENST00000377705	.	.	.	3.43	2.25	0.28309	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.6706	0.17721	0.0:0.1422:0.0:0.8578	.	.	.	.	W	703	.	.	X	-	3	0	NOL9	6508501	0.001000	0.12720	0.144000	0.22314	0.034000	0.12701	0.012000	0.13287	1.343000	0.45638	0.460000	0.39030	TGA	-	NOL9	-	NULL		0.433	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL9	HGNC	protein_coding	OTTHUMT00000002625.1	0	0		74	74		0.00		T	NM_024654		6585914	-1	22		45		tier1	no_errors	ENST00000377705	ensembl	human	known	74_37	nonstop	32.84		SNP	0.126	C	22	45
TUBGCP5	114791	genome.wustl.edu	37	15	22867604	22867604	+	Missense_Mutation	SNP	G	G	T	rs147846294		TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr15:22867604G>T	ENST00000283645.4	+	19	2810	c.2680G>T	c.(2680-2682)Gtg>Ttg	p.V894L	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.V894L	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	894					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		CATGCATTTCGTGAACAGCTT	0.438													ENSG00000153575																																					0													218.0	173.0	188.0					15																	22867604		2203	4300	6503	SO:0001583	missense	0			-	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.2680G>T	15.37:g.22867604G>T	ENSP00000283645:p.Val894Leu		E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	pfam_TUBGCP	p.V894L	ENST00000283645.4	37	c.2680	CCDS10008.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.395493	0.96009	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.08634	3.07;3.07	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000001	T	0.27169	0.0666	L	0.60845	1.875	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.994	T	0.00104	-1.2058	10	0.46703	T	0.11	-22.5168	19.1338	0.93418	0.0:0.0:1.0:0.0	.	894;894	Q96RT8;E9PB12	GCP5_HUMAN;.	L	894	ENSP00000283645:V894L;ENSP00000409217:V894L	ENSP00000283645:V894L	V	+	1	0	TUBGCP5	20419045	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.085000	0.94083	2.752000	0.94435	0.655000	0.94253	GTG	-	TUBGCP5	-	pfam_TUBGCP		0.438	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	HGNC	protein_coding	OTTHUMT00000250998.2	0	0		35	35		0.00		G	NM_052903		22867604	+1	13		29		tier1	no_errors	ENST00000283645	ensembl	human	known	74_37	missense	30.95		SNP	1.000	T	13	29
RUNX2	860	genome.wustl.edu	37	6	45390499	45390499	+	Silent	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr6:45390499G>T	ENST00000371438.1	+	2	586	c.228G>T	c.(226-228)gcG>gcT	p.A76A	RUNX2_ENST00000465038.2_Silent_p.A76A|RUNX2_ENST00000371432.3_Silent_p.A62A|RUNX2_ENST00000359524.5_Silent_p.A62A|RUNX2_ENST00000576263.1_Silent_p.A76A|RUNX2_ENST00000352853.5_Silent_p.A144A|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000541979.1_Silent_p.A144A|RUNX2_ENST00000371436.6_Silent_p.A76A	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	76	Poly-Ala.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						cggcggcggcggctgcggcgg	0.731													ENSG00000124813																																					0													3.0	6.0	5.0					6																	45390499		1016	2371	3387	SO:0001819	synonymous_variant	0			-	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.228G>T	6.37:g.45390499G>T			O14614|O14615|O95181	Silent	SNP	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_D-bd,pfscan_Runt_dom,prints_AML1_Runt	p.A144	ENST00000371438.1	37	c.432	CCDS43467.2	6																																																																																			-	RUNX2	-	NULL		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	RUNX2	HGNC	protein_coding	OTTHUMT00000040755.2	0	0		36	36		0.00		G	NM_004348		45390499	+1	5		44		tier1	no_errors	ENST00000352853	ensembl	human	known	74_37	silent	10.20		SNP	1.000	T	5	44
PIAS1	8554	genome.wustl.edu	37	15	68446007	68446007	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr15:68446007G>T	ENST00000249636.6	+	7	1056	c.908G>T	c.(907-909)aGg>aTg	p.R303M	PIAS1_ENST00000545237.1_Missense_Mutation_p.R305M	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	303					androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						AAGGGAATAAGGAATCCGGAT	0.338													ENSG00000033800																																					0													97.0	91.0	93.0					15																	68446007		1831	4080	5911	SO:0001583	missense	0			-	AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.908G>T	15.37:g.68446007G>T	ENSP00000249636:p.Arg303Met		B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_dom,pfscan_Znf_MIZ,pfscan_SAP_dom	p.R303M	ENST00000249636.6	37	c.908	CCDS45290.1	15	.	.	.	.	.	.	.	.	.	.	G	31	5.089321	0.94100	.	.	ENSG00000033800	ENST00000249636;ENST00000545237	T;T	0.37058	1.22;1.22	5.6	5.6	0.85130	.	0.041486	0.85682	D	0.000000	T	0.61999	0.2392	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;0.972	D;P	0.72982	0.979;0.829	T	0.64114	-0.6483	10	0.87932	D	0	-10.4155	19.6107	0.95606	0.0:0.0:1.0:0.0	.	303;303	C5J4B4;O75925	.;PIAS1_HUMAN	M	303;305	ENSP00000249636:R303M;ENSP00000438574:R305M	ENSP00000249636:R303M	R	+	2	0	PIAS1	66233061	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.823000	0.99369	2.648000	0.89879	0.655000	0.94253	AGG	-	PIAS1	-	NULL		0.338	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS1	HGNC	protein_coding	OTTHUMT00000419642.2	0	0		92	92		0.00		G			68446007	+1	3		28		tier1	no_errors	ENST00000249636	ensembl	human	known	74_37	missense	9.68		SNP	1.000	T	3	28
HELZ2	85441	genome.wustl.edu	37	20	62203405	62203405	+	Intron	SNP	T	T	C	rs73622831	byFrequency	TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr20:62203405T>C	ENST00000467148.1	-	1	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GAACCTCTGGTTCTGCCTATG	0.637													ENSG00000130589																																					0																																										SO:0001627	intron_variant	0			-	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.278+55A>G	20.37:g.62203405T>C			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	R	SNP	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			rs73622831	HELZ2	-	-		0.637	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	0	0		45	45		0.00		T	NM_001037335		62203405	-1	12		85		tier1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	12.37		SNP	0.061	C	12	85
SEC63	11231	genome.wustl.edu	37	6	108243115	108243116	+	Splice_Site	INS	-	-	GGG	rs142388422	byFrequency	TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr6:108243115_108243116insGGG	ENST00000369002.4	-	4	519		c.e4-2			NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)						liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TGTGGCTCCCTGGGGAAAAACA	0.317													ENSG00000025796		1685	0.336462	0.2428	0.3703	5008	,	,		14450	0.3333		0.3499	False		,,,				2504	0.4284																0																																										SO:0001630	splice_region_variant	0				BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.340-2->CCC	6.37:g.108243116_108243118dupGGG			O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Splice_Site	INS	-	e4-2	ENST00000369002.4	37	c.340-3_340-2	CCDS5061.1	6																																																																																				SEC63	-	-		0.317	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC63	HGNC	protein_coding	OTTHUMT00000041705.4	0	0		44	44		0.00		-	NM_007214	Intron	108243116	-1	4		35		tier1	no_errors	ENST00000369002	ensembl	human	known	74_37	splice_site_ins	10.26		INS	1.000:0.980	GGG	4	35
CWH43	80157	genome.wustl.edu	37	4	49040171	49040171	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr4:49040171C>G	ENST00000226432.4	+	13	1960	c.1777C>G	c.(1777-1779)Cag>Gag	p.Q593E	CWH43_ENST00000513409.1_Missense_Mutation_p.Q566E	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	593					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						AGATTATCTACAGCTCACTGA	0.328													ENSG00000109182																																					0													126.0	135.0	132.0					4																	49040171		2203	4300	6503	SO:0001583	missense	0			-		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1777C>G	4.37:g.49040171C>G	ENSP00000226432:p.Gln593Glu		B2RPD7	Missense_Mutation	SNP	superfamily_Endo/exonuclease/phosphatase	p.Q593E	ENST00000226432.4	37	c.1777	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	C	2.233	-0.375715	0.05034	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.29142	1.58;1.58	3.99	3.11	0.35812	Endonuclease/exonuclease/phosphatase (1);	0.251565	0.28510	N	0.015084	T	0.12518	0.0304	N	0.04508	-0.205	0.24962	N	0.991724	B	0.14438	0.01	B	0.11329	0.006	T	0.24764	-1.0151	9	.	.	.	.	8.6329	0.33930	0.1707:0.6635:0.1658:0.0	.	593	Q9H720	PG2IP_HUMAN	E	593;566	ENSP00000226432:Q593E;ENSP00000422802:Q566E	.	Q	+	1	0	CWH43	48734928	0.886000	0.30341	0.746000	0.31095	0.960000	0.62799	1.426000	0.34870	1.230000	0.43646	0.555000	0.69702	CAG	-	CWH43	-	superfamily_Endo/exonuclease/phosphatase		0.328	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2	0	0		71	71		0.00		C	NM_025087		49040171	+1	4		43		tier1	no_errors	ENST00000226432	ensembl	human	known	74_37	missense	8.51		SNP	0.674	G	4	43
ALPK3	57538	genome.wustl.edu	37	15	85383263	85383263	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr15:85383263G>T	ENST00000258888.5	+	5	1526	c.1359G>T	c.(1357-1359)caG>caT	p.Q453H		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	453					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CGGCTTGGCAGGAGGGAGAGA	0.647													ENSG00000136383																																					0													37.0	34.0	35.0					15																	85383263		2203	4299	6502	SO:0001583	missense	0			-	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.1359G>T	15.37:g.85383263G>T	ENSP00000258888:p.Gln453His		Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.Q453H	ENST00000258888.5	37	c.1359	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216458	0.39201	.	.	ENSG00000136383	ENST00000258888	T	0.61274	0.12	4.96	0.557	0.17260	.	0.269957	0.27917	N	0.017339	T	0.35711	0.0941	L	0.32530	0.975	0.09310	N	1	B	0.22146	0.065	B	0.22753	0.041	T	0.07520	-1.0768	10	0.31617	T	0.26	-7.1682	0.8077	0.01087	0.1922:0.1461:0.3279:0.3338	.	453	Q96L96	ALPK3_HUMAN	H	453	ENSP00000258888:Q453H	ENSP00000258888:Q453H	Q	+	3	2	ALPK3	83184267	0.995000	0.38212	0.979000	0.43373	0.537000	0.34900	0.485000	0.22324	0.484000	0.27630	0.467000	0.42956	CAG	-	ALPK3	-	NULL		0.647	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	0	0		29	29		0.00		G	NM_020778		85383263	+1	5		39		tier1	no_errors	ENST00000258888	ensembl	human	known	74_37	missense	11.36		SNP	0.149	T	5	39
DRAM2	128338	genome.wustl.edu	37	1	111667503	111667518	+	Splice_Site	DEL	CCTGGGAAAAGATAAT	CCTGGGAAAAGATAAT	-			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	CCTGGGAAAAGATAAT	CCTGGGAAAAGATAAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr1:111667503_111667518delCCTGGGAAAAGATAAT	ENST00000286692.4	-	5	817	c.200delATTATCTTTTCCCAGG	c.(199-201)tat>tt	p.Y67fs	DRAM2_ENST00000539140.1_Splice_Site_p.Y67fs|DRAM2_ENST00000484310.1_5'UTR			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	67					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)				endometrium(1)|large_intestine(5)|lung(3)	9						GGTAGCAATGCCTGGGAAAAGATAATCCAAAAAACA	0.343													ENSG00000156171																																					0																																										SO:0001630	splice_region_variant	0				AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.200-1ATTATCTTTTCCCAGG>-	1.37:g.111667503_111667518delCCTGGGAAAAGATAAT			B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Frame_Shift_Del	DEL	pfam_Frag1/DRAM/Sfk1	p.C67fs	ENST00000286692.4	37	c.200	CCDS30801.1	1																																																																																				DRAM2	-	pfam_Frag1/DRAM/Sfk1		0.343	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM2	HGNC	protein_coding	OTTHUMT00000032930.3									CCTGGGAAAAGATAAT	NM_178454	Frame_Shift_Del	111667518	-1					tier1	no_errors	ENST00000286692	ensembl	human	known	74_37	frame_shift_del			DEL	0.992	-		
SH3GLB1	51100	genome.wustl.edu	37	1	87208874	87208874	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr1:87208874C>A	ENST00000370558.4	+	9	1378	c.1054C>A	c.(1054-1056)Cag>Aag	p.Q352K	SH3GLB1_ENST00000535010.1_Missense_Mutation_p.Q252K|SH3GLB1_ENST00000482504.1_Missense_Mutation_p.Q373K	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1	352	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		AAGGGGAAACCAGAAGGGCAA	0.388													ENSG00000097033																																					0													156.0	157.0	157.0					1																	87208874		2203	4300	6503	SO:0001583	missense	0			-	AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.1054C>A	1.37:g.87208874C>A	ENSP00000473267:p.Gln352Lys		B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Missense_Mutation	SNP	pfam_BAR_dom,pfam_BAR_dom-cont,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain	p.Q373K	ENST00000370558.4	37	c.1117	CCDS710.1	1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.952912	0.53293	.	.	ENSG00000097033	ENST00000212369;ENST00000535010;ENST00000482504	T;T	0.44881	0.91;0.91	5.82	5.82	0.92795	Src homology-3 domain (4);	0.111022	0.64402	D	0.000006	T	0.40694	0.1127	N	0.20986	0.625	0.80722	D	1	D;D;B	0.69078	0.997;0.997;0.106	D;D;B	0.78314	0.991;0.984;0.05	T	0.08743	-1.0707	10	0.15499	T	0.54	-5.1617	20.104	0.97884	0.0:1.0:0.0:0.0	.	252;373;352	B4E182;Q9Y371-2;Q9Y371	.;.;SHLB1_HUMAN	K	352;252;373	ENSP00000441355:Q252K;ENSP00000418744:Q373K	ENSP00000212369:Q352K	Q	+	1	0	SH3GLB1	86981462	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.909000	0.69923	2.755000	0.94549	0.563000	0.77884	CAG	-	SH3GLB1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.388	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GLB1	HGNC	protein_coding	OTTHUMT00000028287.2	0	0		88	88		0.00		C	NM_016009		87208874	+1	4		44		tier1	no_errors	ENST00000482504	ensembl	human	known	74_37	missense	8.33		SNP	1.000	A	4	44
DNAH6	1768	genome.wustl.edu	37	2	84915647	84915647	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr2:84915647G>T	ENST00000237449.6	+	44	7230	c.7222G>T	c.(7222-7224)Gat>Tat	p.D2408Y	DNAH6_ENST00000398278.2_Missense_Mutation_p.D2359Y|DNAH6_ENST00000602588.1_Missense_Mutation_p.D380Y|DNAH6_ENST00000389394.3_Missense_Mutation_p.D2408Y			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2408	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTATCTTGATGATTATAATCT	0.368													ENSG00000115423																																					0													238.0	209.0	218.0					2																	84915647		692	1590	2282	SO:0001583	missense	0			-	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.7222G>T	2.37:g.84915647G>T	ENSP00000237449:p.Asp2408Tyr		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D2408Y	ENST00000237449.6	37	c.7222	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.296676	0.81025	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.26518	1.73;1.85;1.73	5.73	5.73	0.89815	.	.	.	.	.	T	0.64394	0.2594	H	0.94964	3.605	0.58432	D	0.999999	D;D	0.76494	0.996;0.999	P;D	0.75020	0.897;0.985	T	0.74595	-0.3613	9	0.87932	D	0	.	18.6717	0.91514	0.0:0.0:1.0:0.0	.	2408;2359	Q9C0G6;Q9C0G6-4	DYH6_HUMAN;.	Y	2408;2359;2408	ENSP00000374045:D2408Y;ENSP00000381326:D2359Y;ENSP00000237449:D2408Y	ENSP00000237449:D2408Y	D	+	1	0	DNAH6	84769158	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.953000	0.87836	2.709000	0.92574	0.655000	0.94253	GAT	-	DH6	-	superfamily_P-loop_NTPase		0.368	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH6	HGNC	protein_coding	OTTHUMT00000328537.2	0	0		44	44		0.00		G	NM_001370		84915647	+1	4		25		tier1	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	13.79		SNP	1.000	T	4	25
SECISBP2L	9728	genome.wustl.edu	37	15	49301541	49301541	+	Silent	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr15:49301541G>T	ENST00000559471.1	-	14	2162	c.1899C>A	c.(1897-1899)ctC>ctA	p.L633L	SECISBP2L_ENST00000261847.3_Silent_p.L588L	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	633							poly(A) RNA binding (GO:0044822)	p.L588L(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TTGCTGGAGAGAGTGAAGTAT	0.428													ENSG00000138593																																					1	Substitution - coding silent(1)	large_intestine(1)											166.0	150.0	156.0					15																	49301541		2197	4295	6492	SO:0001819	synonymous_variant	0			-	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1899C>A	15.37:g.49301541G>T			Q8N767	Silent	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.L633	ENST00000559471.1	37	c.1899	CCDS53942.1	15																																																																																			-	SECISBP2L	-	NULL		0.428	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SECISBP2L	HGNC	protein_coding	OTTHUMT00000417277.1	0	0		40	40		0.00		G	NM_014701		49301541	-1	3		23		tier1	no_errors	ENST00000559471	ensembl	human	known	74_37	silent	11.54		SNP	0.958	T	3	23
PPP1R3F	89801	genome.wustl.edu	37	X	49142965	49142965	+	Missense_Mutation	SNP	G	G	A	rs201784162		TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chrX:49142965G>A	ENST00000055335.6	+	4	1829	c.1813G>A	c.(1813-1815)Ggg>Agg	p.G605R	PPP1R3F_ENST00000495799.1_Missense_Mutation_p.G259R|PPP1R3F_ENST00000466508.1_Missense_Mutation_p.G259R|PPP1R3F_ENST00000376188.1_Missense_Mutation_p.G259R|PPP1R3F_ENST00000438316.1_Missense_Mutation_p.G276R	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	605					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					AATCCTCTCCGGGGCCCGTTC	0.612													ENSG00000049769	G|||	1	0.000264901	0.0	0.0	3775	,	,		11766	0.001		0.0	False		,,,				2504	0.0																0													29.0	23.0	25.0					X																	49142965		2201	4300	6501	SO:0001583	missense	0			GMAF=0		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1813G>A	X.37:g.49142965G>A	ENSP00000055335:p.Gly605Arg		A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.G605R	ENST00000055335.6	37	c.1813	CCDS35254.1	X	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	14.37	2.516490	0.44763	.	.	ENSG00000049769	ENST00000466508;ENST00000438316;ENST00000055335;ENST00000495799;ENST00000376188	T;T;T;T;T	0.72167	-0.18;-0.17;-0.63;-0.18;-0.18	5.55	4.63	0.57726	.	0.369124	0.23446	N	0.048086	T	0.73908	0.3647	L	0.29908	0.895	0.30959	N	0.723825	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.993;0.989	T	0.74306	-0.3708	10	0.87932	D	0	-10.6945	10.388	0.44152	0.0:0.1928:0.8071:0.0	.	276;290;605	F5H262;A2VDJ8;Q6ZSY5	.;.;PPR3F_HUMAN	R	259;276;605;259;259	ENSP00000420687:G259R;ENSP00000415548:G276R;ENSP00000055335:G605R;ENSP00000417535:G259R;ENSP00000365359:G259R	ENSP00000055335:G605R	G	+	1	0	PPP1R3F	49029909	0.999000	0.42202	0.991000	0.47740	0.486000	0.33341	4.664000	0.61540	2.318000	0.78349	0.509000	0.49947	GGG	rs201784162	PPP1R3F	-	NULL		0.612	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R3F	HGNC	protein_coding	OTTHUMT00000060819.2	0	0		47	47		0.00		G	NM_033215		49142965	+1	15		47		tier1	no_errors	ENST00000055335	ensembl	human	known	74_37	missense	23.81		SNP	0.878	A	15	47
EFCAB3	146779	genome.wustl.edu	37	17	60464715	60464715	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr17:60464715C>A	ENST00000305286.3	+	3	167	c.89C>A	c.(88-90)cCa>cAa	p.P30Q	EFCAB3_ENST00000450662.2_Missense_Mutation_p.P82Q	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	30							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			AGAGACTTACCAGGATCTCTT	0.368													ENSG00000172421																																					0													96.0	88.0	91.0					17																	60464715		2203	4300	6503	SO:0001583	missense	0			-	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.89C>A	17.37:g.60464715C>A	ENSP00000302649:p.Pro30Gln		J3KQM8	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.P82Q	ENST00000305286.3	37	c.245	CCDS11632.1	17	.	.	.	.	.	.	.	.	.	.	C	8.495	0.862865	0.17178	.	.	ENSG00000172421	ENST00000450662;ENST00000305286;ENST00000520404;ENST00000518576	T;T;T;T	0.57752	0.43;0.42;0.38;0.38	4.51	-0.225	0.13111	.	0.694331	0.13174	N	0.408044	T	0.34890	0.0913	L	0.46157	1.445	0.09310	N	1	B;B	0.21905	0.062;0.028	B;B	0.14023	0.01;0.01	T	0.15780	-1.0425	10	0.23891	T	0.37	.	1.0858	0.01652	0.1832:0.4321:0.1785:0.2063	.	30;30	E5RJB7;Q8N7B9	.;EFCB3_HUMAN	Q	82;30;30;30	ENSP00000403932:P82Q;ENSP00000302649:P30Q;ENSP00000429124:P30Q;ENSP00000428626:P30Q	ENSP00000302649:P30Q	P	+	2	0	EFCAB3	57818447	0.000000	0.05858	0.004000	0.12327	0.148000	0.21650	0.279000	0.18771	0.213000	0.20722	0.557000	0.71058	CCA	-	EFCAB3	-	NULL		0.368	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB3	HGNC	protein_coding	OTTHUMT00000379114.1	0	0		53	53		0.00		C	NM_173503		60464715	+1	14		26		tier1	no_errors	ENST00000450662	ensembl	human	known	74_37	missense	34.15		SNP	0.003	A	14	26
ITGAE	3682	genome.wustl.edu	37	17	3658410	3658410	+	Splice_Site	DEL	C	C	-	rs373382355|rs200636903		TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr17:3658410delC	ENST00000263087.4	-	12	1483		c.e12+1			NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)						cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CCCGCCCTCACCCAGGTAGCT	0.741													ENSG00000083457																									NSCLC(182;635 2928 8995 38788)												0										151,3425		5,141,1642	3.0	4.0	4.0			4.7	1.0	17	dbSNP_130	4	354,6796		17,320,3238	no	splice-5	ITGAE	NM_002208.4		22,461,4880	A1A1,A1R,RR		4.951,4.2226,4.7082			3658410	505,10221	1886	3777	5663	SO:0001630	splice_region_variant	0				L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.1384+1G>-	17.37:g.3658410delC			Q17RS6|Q9NZU9	Splice_Site	DEL	-	e12+1	ENST00000263087.4	37	c.1384+1	CCDS32531.1	17																																																																																				ITGAE	-	-		0.741	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ITGAE	HGNC	protein_coding	OTTHUMT00000438169.1	0	0		18	18		0.00		C	NM_002208	Intron	3658410	-1	6		15		tier1	no_errors	ENST00000263087	ensembl	human	known	74_37	splice_site_del	28.57		DEL	1.000	-	6	15
FASN	2194	genome.wustl.edu	37	17	80049467	80049467	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr17:80049467G>A	ENST00000306749.2	-	9	1341	c.1123C>T	c.(1123-1125)Cag>Tag	p.Q375*		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	375	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TCCACCACCTGCAGCCGCCCA	0.667													ENSG00000169710																									Colon(59;314 1043 11189 28578 32273)												0													18.0	16.0	17.0					17																	80049467		2162	4275	6437	SO:0001587	stop_gained	0			-	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.1123C>T	17.37:g.80049467G>A	ENSP00000304592:p.Gln375*		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Nonsense_Mutation	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.Q375*	ENST00000306749.2	37	c.1123	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.215128	0.95104	.	.	ENSG00000169710	ENST00000306749	.	.	.	5.11	5.11	0.69529	.	0.469540	0.22318	N	0.061641	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1603	11.5644	0.50796	0.0:0.1334:0.7284:0.1382	.	.	.	.	X	375	.	ENSP00000304592:Q375X	Q	-	1	0	FASN	77642756	0.217000	0.23597	0.996000	0.52242	0.076000	0.17211	2.892000	0.48625	2.386000	0.81285	0.491000	0.48974	CAG	-	FASN	-	superfamily_Thiolase-like,smart_PKS_Beta-ketoAc_synthase_dom		0.667	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	0	0		22	22		0.00		G	NM_004104		80049467	-1	4		19		tier1	no_errors	ENST00000306749	ensembl	human	known	74_37	nonsense	17.39		SNP	0.004	A	4	19
DST	667	genome.wustl.edu	37	6	56473578	56473578	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr6:56473578G>T	ENST00000361203.3	-	36	5222	c.5215C>A	c.(5215-5217)Cct>Act	p.P1739T	DST_ENST00000312431.6_Missense_Mutation_p.P1739T|DST_ENST00000244364.6_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000370769.4_Missense_Mutation_p.P1739T|DST_ENST00000446842.2_Missense_Mutation_p.P1413T|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.P1917T			Q03001	DYST_HUMAN	dystonin	1739					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GGTCTCACAGGTAGAAGCCAC	0.398													ENSG00000151914																																					0													73.0	72.0	73.0					6																	56473578		1861	4097	5958	SO:0001583	missense	0			-	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.5215C>A	6.37:g.56473578G>T	ENSP00000354508:p.Pro1739Thr		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.P1917T	ENST00000361203.3	37	c.5749		6	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695118	0.48202	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59;-0.59	5.64	5.64	0.86602	.	0.117965	0.38663	N	0.001618	T	0.56702	0.2003	.	.	.	0.28856	N	0.895768	P	0.38195	0.622	B	0.38056	0.264	T	0.67573	-0.5636	8	0.72032	D	0.01	.	14.2886	0.66263	0.0734:0.0:0.9266:0.0	.	1413	Q03001-9	.	T	1917;1739;1413;1739;1739;1413	ENSP00000359790:P1917T;ENSP00000359805:P1739T;ENSP00000393645:P1413T;ENSP00000307959:P1739T;ENSP00000354508:P1739T;ENSP00000404924:P1413T	ENSP00000307959:P1739T	P	-	1	0	DST	56581537	0.999000	0.42202	0.984000	0.44739	0.994000	0.84299	2.746000	0.47467	2.812000	0.96745	0.557000	0.71058	CCT	-	DST	-	superfamily_ABC1_TM_dom,smart_Plectin_repeat		0.398	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	0	0		37	37		0.00		G	NM_001723		56473578	-1	4		23		tier1	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	14.81		SNP	0.990	T	4	23
KIAA1958	158405	genome.wustl.edu	37	9	115421591	115421591	+	Missense_Mutation	SNP	G	G	A	rs141479985		TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr9:115421591G>A	ENST00000337530.6	+	4	1689	c.1393G>A	c.(1393-1395)Gtc>Atc	p.V465I	KIAA1958_ENST00000536272.1_Missense_Mutation_p.V493I	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	465								p.V465I(1)		endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						TTATGTCACCGTCAAGAAGAG	0.537													ENSG00000165185																																					1	Substitution - Missense(1)	large_intestine(1)						G	ILE/VAL	0,4406		0,0,2203	78.0	68.0	71.0		1393	5.1	1.0	9	dbSNP_134	71	2,8598	1.2+/-3.3	0,2,4298	no	missense	KIAA1958	NM_133465.2	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	465/717	115421591	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1393G>A	9.37:g.115421591G>A	ENSP00000336940:p.Val465Ile		B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	pfam_DUF3504,superfamily_Integrase_Lambda-type_N	p.V493I	ENST00000337530.6	37	c.1477	CCDS35108.1	9	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798139	0.50208	0.0	2.33E-4	ENSG00000165185	ENST00000337530;ENST00000536272	T	0.44083	0.93	5.1	5.1	0.69264	.	.	.	.	.	T	0.24928	0.0605	N	0.14661	0.345	0.23624	N	0.997262	P;P	0.44946	0.846;0.846	B;B	0.34242	0.178;0.125	T	0.11446	-1.0587	9	0.13853	T	0.58	.	18.1317	0.89604	0.0:0.0:1.0:0.0	.	493;465	B7ZKW6;Q8N8K9	.;K1958_HUMAN	I	465;493	ENSP00000336940:V465I	ENSP00000336940:V465I	V	+	1	0	KIAA1958	114461412	0.999000	0.42202	0.999000	0.59377	0.997000	0.91878	2.987000	0.49378	2.361000	0.80049	0.655000	0.94253	GTC	rs141479985	KIAA1958	-	NULL		0.537	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	KIAA1958	HGNC	protein_coding	OTTHUMT00000053690.1	0	0		36	36		0.00		G	NM_133465		115421591	+1	10		30		tier1	no_errors	ENST00000536272	ensembl	human	known	74_37	missense	25.00		SNP	1.000	A	10	30
SPATS1	221409	genome.wustl.edu	37	6	44328249	44328249	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr6:44328249G>T	ENST00000288390.2	+	3	701	c.354G>T	c.(352-354)ttG>ttT	p.L118F	RP11-444E17.6_ENST00000505802.1_3'UTR|SPATS1_ENST00000323108.8_Missense_Mutation_p.L118F			Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	118										NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(5)|skin(1)|urinary_tract(1)	14	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AAATGTCGTTGCCTGAAGTCC	0.483													ENSG00000249481																																					0													141.0	128.0	132.0					6																	44328249		2203	4300	6503	SO:0001583	missense	0			-	AK058171	CCDS4911.1	6p21.1	2003-08-08			ENSG00000249481	ENSG00000249481			22957	protein-coding gene	gene with protein product							Standard	NM_145026		Approved	SPATA8, FLJ25442, SRSP1	uc021yzz.1	Q496A3	OTTHUMG00000014764	ENST00000288390.2:c.354G>T	6.37:g.44328249G>T	ENSP00000424400:p.Leu118Phe		Q496A2|Q496A5|Q96LJ0	Missense_Mutation	SNP	NULL	p.L118F	ENST00000288390.2	37	c.354	CCDS4911.1	6	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735626	0.49045	.	.	ENSG00000249481	ENST00000323108;ENST00000288390	T;T	0.51071	0.72;0.72	5.41	1.57	0.23409	.	0.686315	0.12554	N	0.458774	T	0.22044	0.0531	M	0.62723	1.935	0.09310	N	1	B	0.26809	0.16	B	0.25291	0.059	T	0.26052	-1.0114	10	0.54805	T	0.06	.	5.5505	0.17087	0.2541:0.1469:0.599:0.0	.	118	Q496A3	SPAS1_HUMAN	F	118	ENSP00000437552:L118F;ENSP00000424400:L118F	ENSP00000424400:L118F	L	+	3	2	SPATS1	44436227	0.001000	0.12720	0.011000	0.14972	0.006000	0.05464	0.413000	0.21148	0.346000	0.23899	0.591000	0.81541	TTG	-	SPATS1	-	NULL		0.483	SPATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATS1	HGNC	protein_coding	OTTHUMT00000040738.2	0	0		38	38		0.00		G	NM_145026		44328249	+1	4		39		tier1	no_errors	ENST00000288390	ensembl	human	known	74_37	missense	9.30		SNP	0.001	T	4	39
IKZF2	22807	genome.wustl.edu	37	2	214012404	214012405	+	Intron	DEL	AA	AA	-	rs550073377|rs6738070|rs547307585|rs112988286	byFrequency	TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr2:214012404_214012405delAA	ENST00000434687.1	-	4	449				IKZF2_ENST00000342002.2_Intron|IKZF2_ENST00000451136.2_Intron|IKZF2_ENST00000374327.4_Intron|IKZF2_ENST00000421754.2_Intron|IKZF2_ENST00000374319.4_Intron|IKZF2_ENST00000457361.1_Intron|IKZF2_ENST00000442445.1_Frame_Shift_Del_p.L62fs|IKZF2_ENST00000413091.3_Intron			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		ACACACACACAAAAAAAAATCA	0.411													ENSG00000030419																																					0																																										SO:0001627	intron_variant	0				AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.139+26TT>-	2.37:g.214012410_214012411delAA			Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Frame_Shift_Del	DEL	NULL	p.L62fs	ENST00000434687.1	37	c.185_184	CCDS2395.1	2																																																																																				IKZF2	-	NULL		0.411	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF2	HGNC	protein_coding	OTTHUMT00000256593.3	0	0		70	70		0.00		AA	NM_016260		214012405	-1	5		40		tier1	no_errors	ENST00000442445	ensembl	human	putative	74_37	frame_shift_del	11.11		DEL	0.011:0.017	-	5	40
TCF12	6938	genome.wustl.edu	37	15	57384044	57384044	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr15:57384044C>A	ENST00000267811.5	+	5	584	c.280C>A	c.(280-282)Cat>Aat	p.H94N	TCF12_ENST00000557843.1_Missense_Mutation_p.H94N|TCF12_ENST00000452095.2_Missense_Mutation_p.H90N|TCF12_ENST00000333725.5_Missense_Mutation_p.H94N|TCF12_ENST00000438423.2_Missense_Mutation_p.H94N	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	94					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		ATTAGGAGCCCATGAAGGCTT	0.423			T	TEC	extraskeletal myxoid chondrosarcoma								ENSG00000140262																												Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0													120.0	116.0	118.0					15																	57384044		2192	4292	6484	SO:0001583	missense	0			-	BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.280C>A	15.37:g.57384044C>A	ENSP00000267811:p.His94Asn		Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.H94N	ENST00000267811.5	37	c.280	CCDS10159.1	15	.	.	.	.	.	.	.	.	.	.	C	16.43	3.122383	0.56613	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.74	5.74	0.90152	.	0.053567	0.64402	D	0.000001	T	0.73628	0.3611	L	0.60455	1.87	0.47949	D	0.999552	P;B;B;B	0.50528	0.936;0.095;0.012;0.009	P;B;B;B	0.61201	0.885;0.061;0.006;0.006	T	0.71699	-0.4514	10	0.41790	T	0.15	-10.4148	15.5066	0.75745	0.1389:0.8611:0.0:0.0	.	90;146;94;94	E9PGY0;F5H6Z6;Q99081;Q99081-3	.;.;HTF4_HUMAN;.	N	146;94;94;90;94	ENSP00000267811:H94N;ENSP00000388940:H94N;ENSP00000396881:H90N;ENSP00000331057:H94N	ENSP00000267811:H94N	H	+	1	0	TCF12	55171336	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.137000	0.58010	2.714000	0.92807	0.585000	0.79938	CAT	-	TCF12	-	NULL		0.423	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	0	0		66	66		0.00		C	NM_003205		57384044	+1	4		41		tier1	no_errors	ENST00000438423	ensembl	human	known	74_37	missense	8.89		SNP	1.000	A	4	41
CC2D2B	387707	genome.wustl.edu	37	10	97779424	97779424	+	Intron	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr10:97779424G>T	ENST00000344386.3	+	8	821				ENTPD1-AS1_ENST00000452728.1_RNA|CC2D2B_ENST00000410012.2_Intron|ENTPD1-AS1_ENST00000454638.1_RNA|CC2D2B_ENST00000371198.2_Intron|ENTPD1-AS1_ENST00000449197.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000458228.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA|RP11-690P14.4_ENST00000475252.2_Intron	NM_001001732.3	NP_001001732.2	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B											large_intestine(1)|lung(7)|ovary(1)|urinary_tract(1)	10		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		GTGTTCCTATGGACCTACACT	0.378													ENSG00000226688																																					0													218.0	216.0	217.0					10																	97779424		1838	4087	5925	SO:0001627	intron_variant	0			-	BC075861	CCDS41555.1, CCDS53560.1	10q23.33	2008-11-06	2007-10-19	2007-10-19	ENSG00000188649	ENSG00000188649			31666	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 130"""	C10orf130			Standard	NM_001001732		Approved	bA248J23.4	uc010qop.2	Q6DHV5	OTTHUMG00000018820	ENST00000344386.3:c.658-35G>T	10.37:g.97779424G>T			A2A3E9|B4DYD4|E9PCC3|Q5VUS0	R	SNP	-	NULL	ENST00000344386.3	37	NULL	CCDS41555.1	10																																																																																			-	ENTPD1-AS1	-	-		0.378	CC2D2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENTPD1-AS1	HGNC	protein_coding	OTTHUMT00000049573.3	0	0		69	69		0.00		G	NM_001001732		97779424	-1	4		31		tier1	no_errors	ENST00000458228	ensembl	human	known	74_37	rna	11.43		SNP	0.024	T	4	31
DNAH5	1767	genome.wustl.edu	37	5	13770859	13770859	+	Splice_Site	SNP	T	T	G			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr5:13770859T>G	ENST00000265104.4	-	56	9708	c.9604A>C	c.(9604-9606)Aga>Cga	p.R3202R	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3202	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CACACTTACCTGTTGGCCAGG	0.463									Kartagener syndrome				ENSG00000039139																																					0													72.0	67.0	68.0					5																	13770859		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9605+1A>C	5.37:g.13770859T>G			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R3202	ENST00000265104.4	37	c.9604	CCDS3882.1	5																																																																																			-	DH5	-	superfamily_P-loop_NTPase		0.463	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0		35	35		0.00		T	NM_001369	Silent	13770859	-1	7		13		tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	silent	35.00		SNP	1.000	G	7	13
H3F3B	3021	genome.wustl.edu	37	17	73775137	73775137	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr17:73775137T>C	ENST00000254810.4	-	2	251	c.119A>G	c.(118-120)cAt>cGt	p.H40R	H3F3B_ENST00000592643.1_Missense_Mutation_p.H40R|H3F3B_ENST00000593254.1_Intron|H3F3B_ENST00000586607.1_Missense_Mutation_p.H40R|H3F3B_ENST00000591890.1_Missense_Mutation_p.H40R|H3F3B_ENST00000587560.1_Missense_Mutation_p.H40R|H3F3B_ENST00000589599.1_Missense_Mutation_p.H40R	NM_005324.3	NP_005315.1	P84243	H33_HUMAN	H3 histone, family 3B (H3.3B)	40					blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			large_intestine(1)|lung(4)|ovary(2)|skin(1)	8	all_cancers(13;1.5e-07)		all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTGTAGCGATGAGGCTTCTT	0.677											OREG0024740	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000132475																																					0													27.0	29.0	29.0					17																	73775137		2201	4300	6501	SO:0001583	missense	0			-	Z48950	CCDS11729.1	17q25.1	2011-06-01			ENSG00000132475	ENSG00000132475		"""Histones / Replication-independent"""	4765	protein-coding gene	gene with protein product		601058				8586426	Standard	NM_005324		Approved	H3.3B	uc002jpl.3	P84243		ENST00000254810.4:c.119A>G	17.37:g.73775137T>C	ENSP00000254810:p.His40Arg	1147	P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.H40R	ENST00000254810.4	37	c.119	CCDS11729.1	17	.	.	.	.	.	.	.	.	.	.	T	12.85	2.061375	0.36373	.	.	ENSG00000132475	ENST00000254810	T	0.38077	1.16	5.08	5.08	0.68730	.	0.000000	0.64402	U	0.000013	T	0.45597	0.1350	L	0.43757	1.38	0.50632	D	0.999884	.	.	.	.	.	.	T	0.44742	-0.9308	8	0.72032	D	0.01	.	15.0159	0.71584	0.0:0.0:0.0:1.0	.	.	.	.	R	40	ENSP00000254810:H40R	ENSP00000254810:H40R	H	-	2	0	H3F3B	71286732	1.000000	0.71417	0.916000	0.36221	0.986000	0.74619	7.467000	0.80930	2.132000	0.65825	0.533000	0.62120	CAT	-	H3F3B	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3		0.677	H3F3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H3F3B	HGNC	protein_coding	OTTHUMT00000448499.1	0	0		77	77		0.00		T	NM_005324		73775137	-1	32		83		tier1	no_errors	ENST00000254810	ensembl	human	known	74_37	missense	27.83		SNP	1.000	C	32	83
VEPH1	79674	genome.wustl.edu	37	3	157081226	157081227	+	Frame_Shift_Ins	INS	-	-	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr3:157081226_157081227insT	ENST00000362010.2	-	9	1968_1969	c.1661_1662insA	c.(1660-1662)aacfs	p.N554fs	RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392833.2_Frame_Shift_Ins_p.N554fs|VEPH1_ENST00000392832.2_Frame_Shift_Ins_p.N554fs|VEPH1_ENST00000543418.1_Frame_Shift_Ins_p.N554fs	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	554						plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CTTTGCTGAGGTTTTTTTTTAA	0.396													ENSG00000197415																																					0																																										SO:0001589	frameshift_variant	0				AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1662dupA	3.37:g.157081235_157081235dupT	ENSP00000354919:p.Asn554fs		D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Frame_Shift_Ins	INS	pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.N554fs	ENST00000362010.2	37	c.1662_1661	CCDS3179.1	3																																																																																				VEPH1	-	NULL		0.396	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEPH1	HGNC	protein_coding	OTTHUMT00000351845.3	0	0		54	54		0.00		-	NM_024621		157081227	-1	4		26		tier1	no_errors	ENST00000362010	ensembl	human	known	74_37	frame_shift_ins	13.33		INS	1.000:1.000	T	4	26
PTCHD4	442213	genome.wustl.edu	37	6	47847150	47847150	+	Frame_Shift_Del	DEL	A	A	-			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr6:47847150delA	ENST00000339488.4	-	3	1463	c.1430delT	c.(1429-1431)ttcfs	p.F477fs		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	477						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										CATGAAGGAGAAGGAGGCATA	0.423													ENSG00000244694																																					0													90.0	83.0	86.0					6																	47847150		2203	4300	6503	SO:0001589	frameshift_variant	0					CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1430delT	6.37:g.47847150delA	ENSP00000341914:p.Phe477fs		B0QZ29|B4DRK3|Q5T884	Frame_Shift_Del	DEL	pfam_Patched,pfscan_SSD	p.F477fs	ENST00000339488.4	37	c.1430	CCDS34473.2	6																																																																																				PTCHD4	-	pfam_Patched		0.423	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	0	0		72	72		0.00		A	NM_001013732		47847150	-1	2		14		tier1	no_errors	ENST00000339488	ensembl	human	known	74_37	frame_shift_del	12.50		DEL	1.000	-	2	14
SEZ6L2	26470	genome.wustl.edu	37	16	29891249	29891249	+	Silent	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr16:29891249G>T	ENST00000308713.5	-	9	2036	c.1509C>A	c.(1507-1509)ccC>ccA	p.P503P	SEZ6L2_ENST00000537485.1_Silent_p.P459P|SEZ6L2_ENST00000346932.5_Silent_p.P389P|SEZ6L2_ENST00000350527.3_Silent_p.P433P	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	503	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGATGGCATTGGGGGGCCCAG	0.607													ENSG00000174938																																					0													125.0	125.0	125.0					16																	29891249		2197	4300	6497	SO:0001819	synonymous_variant	0			-	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1509C>A	16.37:g.29891249G>T			B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P503	ENST00000308713.5	37	c.1509	CCDS10659.1	16																																																																																			-	SEZ6L2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.607	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	0	0		28	28		0.00		G	NM_012410		29891249	-1	5		41		tier1	no_errors	ENST00000308713	ensembl	human	known	74_37	silent	10.87		SNP	0.998	T	5	41
C3	718	genome.wustl.edu	37	19	6712613	6712613	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr19:6712613T>C	ENST00000245907.6	-	10	1117	c.1025A>G	c.(1024-1026)gAg>gGg	p.E342G		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	342					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CCCGCTGCGCTCTGCCTGCAC	0.572													ENSG00000125730																																					0													207.0	179.0	188.0					19																	6712613		2203	4300	6503	SO:0001583	missense	0			-	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1025A>G	19.37:g.6712613T>C	ENSP00000245907:p.Glu342Gly		A7E236	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.E342G	ENST00000245907.6	37	c.1025	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	T	16.45	3.127495	0.56721	.	.	ENSG00000125730	ENST00000245907	T	0.35789	1.29	5.2	5.2	0.72013	.	0.326189	0.35708	N	0.003039	T	0.61299	0.2336	M	0.92923	3.36	0.39438	D	0.967193	D	0.54601	0.967	P	0.56127	0.792	T	0.69331	-0.5173	10	0.28530	T	0.3	.	14.0386	0.64660	0.0:0.0:0.0:1.0	.	342	P01024	CO3_HUMAN	G	342	ENSP00000245907:E342G	ENSP00000245907:E342G	E	-	2	0	C3	6663613	1.000000	0.71417	0.107000	0.21349	0.601000	0.36947	5.421000	0.66447	1.965000	0.57142	0.459000	0.35465	GAG	-	C3	-	NULL		0.572	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2	0	0		38	38		0.00		T	NM_000064		6712613	-1	5		38		tier1	no_errors	ENST00000245907	ensembl	human	known	74_37	missense	11.63		SNP	0.880	C	5	38
H3F3B	3021	genome.wustl.edu	37	17	73775152	73775152	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr17:73775152C>A	ENST00000254810.4	-	2	236	c.104G>T	c.(103-105)gGg>gTg	p.G35V	H3F3B_ENST00000592643.1_Missense_Mutation_p.G35V|H3F3B_ENST00000593254.1_Intron|H3F3B_ENST00000586607.1_Missense_Mutation_p.G35V|H3F3B_ENST00000591890.1_Missense_Mutation_p.G35V|H3F3B_ENST00000587560.1_Missense_Mutation_p.G35V|H3F3B_ENST00000589599.1_Missense_Mutation_p.G35V	NM_005324.3	NP_005315.1	P84243	H33_HUMAN	H3 histone, family 3B (H3.3B)	35					blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			large_intestine(1)|lung(4)|ovary(2)|skin(1)	8	all_cancers(13;1.5e-07)		all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTTCTTCACCCCGCCGGTAGA	0.667											OREG0024740	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000132475																																					0													26.0	28.0	27.0					17																	73775152		2202	4300	6502	SO:0001583	missense	0			-	Z48950	CCDS11729.1	17q25.1	2011-06-01			ENSG00000132475	ENSG00000132475		"""Histones / Replication-independent"""	4765	protein-coding gene	gene with protein product		601058				8586426	Standard	NM_005324		Approved	H3.3B	uc002jpl.3	P84243		ENST00000254810.4:c.104G>T	17.37:g.73775152C>A	ENSP00000254810:p.Gly35Val	1147	P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.G35V	ENST00000254810.4	37	c.104	CCDS11729.1	17	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458810	0.63401	.	.	ENSG00000132475	ENST00000254810	T	0.46819	0.86	5.08	5.08	0.68730	.	0.000000	0.64402	U	0.000017	T	0.76104	0.3941	M	0.91717	3.235	0.80722	D	1	.	.	.	.	.	.	T	0.82055	-0.0647	8	0.87932	D	0	.	18.6647	0.91485	0.0:1.0:0.0:0.0	.	.	.	.	V	35	ENSP00000254810:G35V	ENSP00000254810:G35V	G	-	2	0	H3F3B	71286747	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.262000	0.78410	2.639000	0.89480	0.655000	0.94253	GGG	-	H3F3B	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3		0.667	H3F3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H3F3B	HGNC	protein_coding	OTTHUMT00000448499.1	0	0		89	89		0.00		C	NM_005324		73775152	-1	36		87		tier1	no_errors	ENST00000254810	ensembl	human	known	74_37	missense	29.27		SNP	1.000	A	36	87
GCG	2641	genome.wustl.edu	37	2	163000587	163000587	+	Frame_Shift_Del	DEL	A	A	-			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr2:163000587delA	ENST00000418842.2	-	5	740	c.486delT	c.(484-486)cttfs	p.L162fs	GCG_ENST00000375497.3_Frame_Shift_Del_p.L162fs	NM_002054.4	NP_002045.1	P01275	GLUC_HUMAN	glucagon	162					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|protein kinase A signaling (GO:0010737)|regulation of insulin secretion (GO:0050796)|response to starvation (GO:0042594)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)	glucagon receptor binding (GO:0031769)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|large_intestine(3)|lung(9)	14						CCCTGGCGGCAAGATTATCAA	0.403													ENSG00000115263																																					0													90.0	86.0	87.0					2																	163000587		1873	4114	5987	SO:0001589	frameshift_variant	0					CCDS46439.1	2q36-q37	2013-02-26			ENSG00000115263	ENSG00000115263		"""Endogenous ligands"""	4191	protein-coding gene	gene with protein product	"""glicentin-related polypeptide"", ""glucagon-like peptide 1"", ""glucagon-like peptide 2"", ""preproglucagon"""	138030				2753890, 3725587	Standard	NM_002054		Approved	GLP1, GLP2, GRPP	uc002ucc.4	P01275	OTTHUMG00000153892	ENST00000418842.2:c.486delT	2.37:g.163000587delA	ENSP00000387662:p.Leu162fs		A6NN65|Q53TP6	Frame_Shift_Del	DEL	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP,prints_Glucagon_GIP_secretin_VIP	p.A163fs	ENST00000418842.2	37	c.486	CCDS46439.1	2																																																																																				GCG	-	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP		0.403	GCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCG	HGNC	protein_coding	OTTHUMT00000332860.1	0	0		53	53		0.00		A	NM_002054		163000587	-1	2		12		tier1	no_errors	ENST00000375497	ensembl	human	known	74_37	frame_shift_del	14.29		DEL	0.979	-	2	12
CCDC7	79741	genome.wustl.edu	37	10	32912685	32912685	+	Nonsense_Mutation	SNP	G	G	T			TCGA-QQ-A5V2-01A-11D-A32I-09	TCGA-QQ-A5V2-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	81047441-778a-4acd-b691-d038469dbb2d	4a347717-46ed-4584-868e-1f38b3d08a09	g.chr10:32912685G>T	ENST00000375028.3	+	2	95	c.25G>T	c.(25-27)Gag>Tag	p.E9*	C10orf68_ENST00000375030.2_Intron|C10orf68_ENST00000375025.4_Intron			Q9H943	CJ068_HUMAN		0										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						tgcttctggcgagggcctcag	0.488													ENSG00000150076																																					0																																										SO:0001587	stop_gained	0			-																												ENST00000375028.3:c.25G>T	10.37:g.32912685G>T	ENSP00000364168:p.Glu9*		B0QZ71|Q08AN7|Q8N7T7	Nonsense_Mutation	SNP	NULL	p.E9*	ENST00000375028.3	37	c.25		10	.	.	.	.	.	.	.	.	.	.	.	13.71	2.318560	0.40996	.	.	ENSG00000150076	ENST00000375028	.	.	.	0.225	-0.451	0.12214	.	.	.	.	.	.	.	.	.	.	.	0.20403	N	0.999903	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	9	.	ENSP00000364168:E9X	E	+	1	0	C10orf68	32952691	0.177000	0.23109	0.283000	0.24790	0.295000	0.27426	-1.592000	0.02098	-0.849000	0.04158	-0.856000	0.03024	GAG	-	C10orf68	-	NULL		0.488	C10orf68-002	PUTATIVE	basic|appris_candidate	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000314000.2	0	0		43	43		0.00		G			32912685	+1	3		14		tier1	no_errors	ENST00000375028	ensembl	human	putative	74_37	nonsense	17.65		SNP	0.368	T	3	14
