#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TMPRSS9	360200	genome.wustl.edu	37	19	2425956	2425956	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:2425956A>C	ENST00000332578.3	+	17	3050	c.3050A>C	c.(3049-3051)gAg>gCg	p.E1017A	TIMM13_ENST00000215570.3_3'UTR	NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	1017	Peptidase S1 3. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTGCAGGGAGCCCTCTGGA	0.652													ENSG00000178297																																					0													61.0	65.0	64.0					19																	2425956		2203	4300	6503	SO:0001583	missense	0			-	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.3050A>C	19.37:g.2425956A>C	ENSP00000330264:p.Glu1017Ala		Q6ZND6|Q7Z411	Missense_Mutation	SNP	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.E1017A	ENST00000332578.3	37	c.3050	CCDS12088.1	19	.	.	.	.	.	.	.	.	.	.	A	14.59	2.579642	0.46006	.	.	ENSG00000178297	ENST00000332578	D	0.88586	-2.4	4.66	3.65	0.41850	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.53938	D	0.000053	D	0.86209	0.5878	N	0.21545	0.675	0.80722	D	1	P	0.50943	0.94	P	0.55011	0.766	D	0.83805	0.0238	10	0.44086	T	0.13	.	9.2498	0.37549	0.9116:0.0:0.0884:0.0	.	1017	Q7Z410	TMPS9_HUMAN	A	1017	ENSP00000330264:E1017A	ENSP00000330264:E1017A	E	+	2	0	TMPRSS9	2376956	1.000000	0.71417	0.997000	0.53966	0.216000	0.24613	6.151000	0.71806	0.627000	0.30340	-0.411000	0.06167	GAG	-	TMPRSS9	-	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.652	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS9	HGNC	protein_coding	OTTHUMT00000451330.3	0	0	0	175	175	57	0.00	0.00	A	NM_182973		2425956	+1	40	14	63	31	tier1	no_errors	ENST00000332578	ensembl	human	known	74_37	missense	38.83	31.11	SNP	1.000	C	40	63
ABHD15	116236	genome.wustl.edu	37	17	27889595	27889595	+	Missense_Mutation	SNP	C	C	T	rs528380562		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:27889595C>T	ENST00000307201.4	-	2	1561	c.1391G>A	c.(1390-1392)cGa>cAa	p.R464Q	RP11-68I3.2_ENST00000581474.1_RNA	NM_198147.2	NP_937790.2	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15	464						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	10						TGTGTATGATCGCTTCCAGTT	0.567													ENSG00000168792	C|||	1	0.000199681	0.0	0.0	5008	,	,		16771	0.0		0.001	False		,,,				2504	0.0																0													81.0	89.0	86.0					17																	27889595		2203	4300	6503	SO:0001583	missense	0			-	AK056717	CCDS32602.1	17q11.2	2009-11-20			ENSG00000168792	ENSG00000168792		"""Abhydrolase domain containing"""	26971	protein-coding gene	gene with protein product						12975309	Standard	NM_198147		Approved		uc002hed.2	Q6UXT9		ENST00000307201.4:c.1391G>A	17.37:g.27889595C>T	ENSP00000302657:p.Arg464Gln		Q96EC5	Missense_Mutation	SNP	pirsf_AB-Hydro_YheT	p.R464Q	ENST00000307201.4	37	c.1391	CCDS32602.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.419589	0.96111	.	.	ENSG00000168792	ENST00000307201	T	0.39056	1.1	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000001	T	0.55940	0.1952	L	0.34521	1.04	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.57100	-0.7869	10	0.87932	D	0	-10.1909	17.4866	0.87691	0.0:1.0:0.0:0.0	.	464	Q6UXT9	ABH15_HUMAN	Q	464	ENSP00000302657:R464Q	ENSP00000302657:R464Q	R	-	2	0	ABHD15	24913721	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	6.412000	0.73303	2.745000	0.94114	0.655000	0.94253	CGA	-	ABHD15	-	NULL		0.567	ABHD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD15	HGNC	protein_coding	OTTHUMT00000447796.2	0	0	1	37	37	79	0.00	1.25	C	NM_198147		27889595	-1	18	31	20	42	tier1	no_errors	ENST00000307201	ensembl	human	known	74_37	missense	47.37	42.47	SNP	1.000	T	18	20
NRXN2	9379	genome.wustl.edu	37	11	64418820	64418820	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr11:64418820A>G	ENST00000377551.1	-	13	3036	c.2825T>C	c.(2824-2826)cTc>cCc	p.L942P	NRXN2_ENST00000377559.3_Missense_Mutation_p.L902P|NRXN2_ENST00000409571.1_Missense_Mutation_p.L935P|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000265459.6_Missense_Mutation_p.L942P			Q9P2S2	NRX2A_HUMAN	neurexin 2	942	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CTGGAAGAAGAGGTGCATGGA	0.587											OREG0021057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000110076																																					0													94.0	68.0	77.0					11																	64418820		2201	4297	6498	SO:0001583	missense	0			-		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2825T>C	11.37:g.64418820A>G	ENSP00000366774:p.Leu942Pro	1076	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.L942P	ENST00000377551.1	37	c.2825	CCDS8077.1	11	.	.	.	.	.	.	.	.	.	.	A	21.3	4.128272	0.77549	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56	4.17	4.17	0.49024	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.000000	0.38436	U	0.001686	D	0.92430	0.7597	M	0.93462	3.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.994	D;D;P	0.97110	1.0;0.99;0.832	D	0.93601	0.6930	10	0.87932	D	0	.	11.2627	0.49093	1.0:0.0:0.0:0.0	.	902;942;688	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	P	942;902;942;902;935	ENSP00000366774:L942P;ENSP00000366782:L902P;ENSP00000265459:L942P;ENSP00000386416:L935P	ENSP00000265459:L942P	L	-	2	0	NRXN2	64175396	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.089000	0.94137	1.760000	0.52011	0.454000	0.30748	CTC	-	NRXN2	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.587	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	0	0	0	39	39	71	0.00	0.00	A	NM_015080		64418820	-1	4	8	37	69	tier1	no_errors	ENST00000265459	ensembl	human	known	74_37	missense	9.76	10.39	SNP	1.000	G	4	37
WNT5A	7474	genome.wustl.edu	37	3	55514826	55514826	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:55514826C>T	ENST00000474267.1	-	3	648	c.127G>A	c.(127-129)Gcc>Acc	p.A43T	WNT5A_ENST00000497027.1_Missense_Mutation_p.A28T|WNT5A_ENST00000264634.4_Missense_Mutation_p.A43T			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	43					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		CAAGAATTGGCTTCAATTACA	0.413													ENSG00000114251																																					0													56.0	55.0	55.0					3																	55514826		1867	4106	5973	SO:0001583	missense	0			-	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.127G>A	3.37:g.55514826C>T	ENSP00000417310:p.Ala43Thr		A8K4A4|Q6P278	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt	p.A43T	ENST00000474267.1	37	c.127	CCDS46850.1	3	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494264	0.44352	.	.	ENSG00000114251	ENST00000474267;ENST00000264634;ENST00000497027;ENST00000442038;ENST00000482079	T;T;T;D	0.84660	-1.01;-1.01;-1.0;-1.88	5.91	5.91	0.95273	.	0.843002	0.10102	N	0.715819	D	0.84106	0.5399	L	0.43152	1.355	0.48087	D	0.999587	B	0.15141	0.012	B	0.14578	0.011	T	0.72516	-0.4269	10	0.45353	T	0.12	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	43	P41221	WNT5A_HUMAN	T	43;43;28;43;28	ENSP00000417310:A43T;ENSP00000264634:A43T;ENSP00000420104:A28T;ENSP00000418184:A28T	ENSP00000264634:A43T	A	-	1	0	WNT5A	55489866	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.109000	0.57824	2.793000	0.96121	0.655000	0.94253	GCC	-	WNT5A	-	NULL		0.413	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT5A	HGNC	protein_coding	OTTHUMT00000350793.3	0	0	0	46	46	106	0.00	0.00	C	NM_003392		55514826	-1	23	39	25	67	tier1	no_errors	ENST00000264634	ensembl	human	known	74_37	missense	46.94	36.79	SNP	1.000	T	23	25
B3GNT2	10678	genome.wustl.edu	37	2	62449968	62449968	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:62449968C>T	ENST00000301998.4	+	2	865	c.613C>T	c.(613-615)Cac>Tac	p.H205Y	B3GNT2_ENST00000405767.1_Missense_Mutation_p.H205Y	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	205					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)	p.H205Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			GAGTGAGAAGCACCAAGACAT	0.502													ENSG00000170340																																					1	Substitution - Missense(1)	pancreas(1)											66.0	61.0	63.0					2																	62449968		2203	4300	6503	SO:0001583	missense	0			-	AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.613C>T	2.37:g.62449968C>T	ENSP00000305595:p.His205Tyr		Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.H205Y	ENST00000301998.4	37	c.613	CCDS1870.1	2	.	.	.	.	.	.	.	.	.	.	C	9.941	1.217579	0.22373	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	T;T	0.30714	1.52;1.52	5.74	4.86	0.63082	.	0.044035	0.85682	D	0.000000	T	0.16471	0.0396	N	0.12853	0.265	0.80722	D	1	B	0.18013	0.025	B	0.22880	0.042	T	0.04708	-1.0932	10	0.02654	T	1	.	15.1674	0.72840	0.0:0.9314:0.0:0.0686	.	205	Q9NY97	B3GN2_HUMAN	Y	205	ENSP00000305595:H205Y;ENSP00000384692:H205Y	ENSP00000305595:H205Y	H	+	1	0	B3GNT2	62303472	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	3.894000	0.56250	2.712000	0.92718	0.650000	0.86243	CAC	-	B3GNT2	-	pfam_Glyco_trans_31		0.502	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT2	HGNC	protein_coding	OTTHUMT00000251606.2	0	0	0	29	29	75	0.00	0.00	C	NM_006577		62449968	+1	16	36	26	44	tier1	no_errors	ENST00000301998	ensembl	human	known	74_37	missense	38.10	45.00	SNP	1.000	T	16	26
PHF21B	112885	genome.wustl.edu	37	22	45312449	45312449	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr22:45312449G>T	ENST00000313237.5	-	4	425	c.275C>A	c.(274-276)cCc>cAc	p.P92H	PHF21B_ENST00000403565.1_5'UTR|PHF21B_ENST00000404079.2_Missense_Mutation_p.P80H|PHF21B_ENST00000396103.3_Missense_Mutation_p.P92H|PHF21B_ENST00000447824.3_Missense_Mutation_p.P80H	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	92							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GGGCTGCTTGGGTGGCCGGTC	0.637													ENSG00000056487																																					0													41.0	47.0	45.0					22																	45312449		2203	4300	6503	SO:0001583	missense	0			-	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.275C>A	22.37:g.45312449G>T	ENSP00000324403:p.Pro92His		B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P92H	ENST00000313237.5	37	c.275	CCDS14061.1	22	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382996	0.82792	.	.	ENSG00000056487	ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000420689	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01	5.06	5.06	0.68205	.	0.332745	0.25219	N	0.032248	T	0.36663	0.0975	L	0.40543	1.245	0.36206	D	0.851037	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;P;P	0.68621	0.919;0.959;0.903;0.885	T	0.22382	-1.0218	10	0.21540	T	0.41	-6.2259	18.4696	0.90767	0.0:0.0:1.0:0.0	.	80;92;80;92	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2	.;.;.;PF21B_HUMAN	H	92;92;80;80;80	ENSP00000324403:P92H;ENSP00000379410:P92H;ENSP00000385105:P80H;ENSP00000388619:P80H;ENSP00000401294:P80H	ENSP00000324403:P92H	P	-	2	0	PHF21B	43691113	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.575000	0.74018	2.346000	0.79739	0.655000	0.94253	CCC	-	PHF21B	-	NULL		0.637	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	HGNC	protein_coding	OTTHUMT00000321731.2	0	0	0	84	84	16	0.00	0.00	G	NM_138415		45312449	-1	41	13	85	27	tier1	no_errors	ENST00000313237	ensembl	human	known	74_37	missense	32.54	32.50	SNP	1.000	T	41	85
PTPRU	10076	genome.wustl.edu	37	1	29602104	29602104	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:29602104G>C	ENST00000345512.3	+	8	1418	c.1289G>C	c.(1288-1290)aGc>aCc	p.S430T	PTPRU_ENST00000323874.8_Missense_Mutation_p.S430T|PTPRU_ENST00000428026.2_Missense_Mutation_p.S430T|PTPRU_ENST00000356870.3_Missense_Mutation_p.S430T|PTPRU_ENST00000460170.2_Missense_Mutation_p.S430T|PTPRU_ENST00000373779.3_Missense_Mutation_p.S430T	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	430	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CTGGGCAGCAGCCACAACCAG	0.577													ENSG00000060656																																					0													147.0	124.0	132.0					1																	29602104		2203	4300	6503	SO:0001583	missense	0			-	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.1289G>C	1.37:g.29602104G>C	ENSP00000334941:p.Ser430Thr		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.S430T	ENST00000345512.3	37	c.1289	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882549	0.33255	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.33438	1.45;1.47;1.47;1.47;1.41;1.47	5.4	5.4	0.78164	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.057547	0.64402	D	0.000001	T	0.23611	0.0571	N	0.22421	0.69	0.40185	D	0.977337	B;B;B;B;B	0.13145	0.007;0.007;0.007;0.004;0.004	B;B;B;B;B	0.16289	0.015;0.015;0.015;0.007;0.007	T	0.05818	-1.0862	9	.	.	.	.	18.5309	0.90992	0.0:0.0:1.0:0.0	.	430;430;430;430;430	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	T	430	ENSP00000334941:S430T;ENSP00000362884:S430T;ENSP00000349333:S430T;ENSP00000314987:S430T;ENSP00000392332:S430T;ENSP00000432906:S430T	.	S	+	2	0	PTPRU	29474691	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.667000	0.68067	2.695000	0.91970	0.643000	0.83706	AGC	-	PTPRU	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.577	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	0	0	0	45	45	58	0.00	0.00	G			29602104	+1	46	30	14	30	tier1	no_errors	ENST00000345512	ensembl	human	known	74_37	missense	76.67	50.00	SNP	1.000	C	46	14
DBN1	1627	genome.wustl.edu	37	5	176887695	176887695	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:176887695G>A	ENST00000309007.5	-	9	1000	c.781C>T	c.(781-783)Cgg>Tgg	p.R261W	DBN1_ENST00000292385.5_Missense_Mutation_p.R263W|DBN1_ENST00000393563.4_5'UTR|DBN1_ENST00000393565.1_Missense_Mutation_p.R261W|DBN1_ENST00000512501.1_5'UTR	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	261					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCTCATCCCGATGGTCACCC	0.517													ENSG00000113758																																					0													125.0	101.0	109.0					5																	176887695		2203	4300	6503	SO:0001583	missense	0			-		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.781C>T	5.37:g.176887695G>A	ENSP00000308532:p.Arg261Trp		A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.R263W	ENST00000309007.5	37	c.787	CCDS4420.1	5	.	.	.	.	.	.	.	.	.	.	G	18.63	3.664979	0.67700	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000477391	T;T;T	0.44083	0.93;0.93;1.49	5.07	3.21	0.36854	.	0.844856	0.10589	N	0.657007	T	0.49864	0.1582	L	0.39898	1.24	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.991;0.995	P;P;P;P	0.56700	0.804;0.724;0.549;0.629	T	0.38650	-0.9651	10	0.87932	D	0	-4.6837	11.9559	0.52981	0.0:0.0:0.5455:0.4545	.	211;261;261;263	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	W	261;263;261;260	ENSP00000308532:R261W;ENSP00000292385:R263W;ENSP00000377195:R261W	ENSP00000292385:R263W	R	-	1	2	DBN1	176820301	0.090000	0.21635	0.995000	0.50966	0.982000	0.71751	0.891000	0.28309	0.483000	0.27608	0.561000	0.74099	CGG	-	DBN1	-	NULL		0.517	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	HGNC	protein_coding	OTTHUMT00000253429.2	0	0	0	67	67	156	0.00	0.00	G	NM_080881		176887695	-1	28	46	38	83	tier1	no_errors	ENST00000292385	ensembl	human	known	74_37	missense	42.42	35.66	SNP	0.985	A	28	38
LRG1	116844	genome.wustl.edu	37	19	4538518	4538518	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:4538518G>C	ENST00000306390.6	-	2	938	c.478C>G	c.(478-480)Cta>Gta	p.L160V	LRG1_ENST00000586883.1_5'UTR|CTB-50L17.14_ENST00000586020.1_Intron	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	160					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGCCGTGTAGCCACGAGACC	0.662													ENSG00000171236																																					0													53.0	59.0	57.0					19																	4538518		2203	4300	6503	SO:0001583	missense	0			-		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.478C>G	19.37:g.4538518G>C	ENSP00000302621:p.Leu160Val		Q8N4F5|Q96QZ4	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L160V	ENST00000306390.6	37	c.478	CCDS12130.1	19	.	.	.	.	.	.	.	.	.	.	.	11.24	1.579411	0.28180	.	.	ENSG00000171236	ENST00000306390;ENST00000538589	T	0.61742	0.08	4.71	4.71	0.59529	.	0.000000	0.32769	N	0.005663	T	0.73032	0.3535	M	0.73962	2.25	0.18873	N	0.999988	D	0.59767	0.986	D	0.66716	0.946	T	0.66073	-0.6014	10	0.66056	D	0.02	-18.1772	13.0078	0.58715	0.0:0.0:1.0:0.0	.	160	P02750	A2GL_HUMAN	V	160;143	ENSP00000302621:L160V	ENSP00000302621:L160V	L	-	1	2	LRG1	4489518	1.000000	0.71417	0.987000	0.45799	0.058000	0.15608	4.161000	0.58170	2.446000	0.82766	0.655000	0.94253	CTA	-	LRG1	-	NULL		0.662	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRG1	HGNC	protein_coding	OTTHUMT00000458654.2	0	0	0	60	60	96	0.00	0.00	G	NM_052972		4538518	-1	14	17	76	77	tier1	no_errors	ENST00000306390	ensembl	human	known	74_37	missense	15.56	18.09	SNP	0.324	C	14	76
WDFY3	23001	genome.wustl.edu	37	4	85731189	85731189	+	Silent	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr4:85731189G>A	ENST00000295888.4	-	14	2603	c.2196C>T	c.(2194-2196)agC>agT	p.S732S	WDFY3_ENST00000322366.6_Silent_p.S732S|WDFY3-AS1_ENST00000510449.1_RNA	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	732					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CATTCATGGCGCTTATTTTTC	0.423													ENSG00000163625																																					0													149.0	145.0	147.0					4																	85731189		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2196C>T	4.37:g.85731189G>A			Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S732	ENST00000295888.4	37	c.2196	CCDS3609.1	4																																																																																			-	WDFY3	-	superfamily_ARM-type_fold		0.423	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	0	0	0	65	65	81	0.00	0.00	G	NM_014991		85731189	-1	12	19	44	57	tier1	no_errors	ENST00000295888	ensembl	human	known	74_37	silent	21.43	25.00	SNP	0.999	A	12	44
UNC5D	137970	genome.wustl.edu	37	8	35650777	35650777	+	IGR	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:35650777C>T	ENST00000404895.2	+	0	3252				AC012215.1_ENST00000437887.1_Nonsense_Mutation_p.Q127*|UNC5D_ENST00000287272.2_3'UTR|UNC5D_ENST00000453357.2_3'UTR	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)						apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		ATTTACAGACCAAGGTGTGGT	0.358													ENSG00000233863																																					0																																										SO:0001628	intergenic_variant	0			-	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145		8.37:g.35650777C>T			Q8WYP7	Nonsense_Mutation	SNP	NULL	p.Q127*	ENST00000404895.2	37	c.379	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	C	43	9.924703	0.99297	.	.	ENSG00000233863	ENST00000437887	.	.	.	6.06	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.3636	0.32374	0.0:0.7626:0.1555:0.0819	.	.	.	.	X	127	.	ENSP00000409748:Q127X	Q	+	1	0	AC012215.1	35770319	0.000000	0.05858	0.013000	0.15412	0.018000	0.09664	-0.058000	0.11750	0.856000	0.35383	-0.142000	0.14014	CAA	-	AC012215.1	-	NULL		0.358	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000233863	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000347586.2	0	0	0	39	39	112	0.00	0.00	C			35650777	+1	11	26	42	106	tier1	no_errors	ENST00000437887	ensembl	human	known	74_37	nonsense	20.75	19.70	SNP	0.009	T	11	42
CLNK	116449	genome.wustl.edu	37	4	10542196	10542196	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr4:10542196G>T	ENST00000226951.6	-	11	763	c.524C>A	c.(523-525)cCc>cAc	p.P175H	CLNK_ENST00000442825.2_Missense_Mutation_p.P133H|CLNK_ENST00000507719.1_Missense_Mutation_p.P133H	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	175	Pro-rich.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						AGGGGGCAAGGGTTGGTACTT	0.537													ENSG00000109684																									GBM(87;402 1286 6949 13902 35851)												0													77.0	81.0	80.0					4																	10542196		2012	4187	6199	SO:0001583	missense	0			-	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.524C>A	4.37:g.10542196G>T	ENSP00000226951:p.Pro175His		Q05C27|Q9P2U9	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.P175H	ENST00000226951.6	37	c.524	CCDS47024.1	4	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024029	0.54683	.	.	ENSG00000109684	ENST00000226951;ENST00000442825;ENST00000507719	T;T;T	0.68624	1.29;-0.34;-0.34	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000007	T	0.74861	0.3772	L	0.36672	1.1	0.39121	D	0.961658	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.988	T	0.77760	-0.2467	10	0.72032	D	0.01	-16.7434	15.4761	0.75481	0.0:0.0:1.0:0.0	.	133;175	Q7Z7G1-2;Q7Z7G1	.;CLNK_HUMAN	H	175;133;133	ENSP00000226951:P175H;ENSP00000390744:P133H;ENSP00000427208:P133H	ENSP00000226951:P175H	P	-	2	0	CLNK	10151294	1.000000	0.71417	0.982000	0.44146	0.220000	0.24768	4.515000	0.60489	2.713000	0.92767	0.655000	0.94253	CCC	-	CLNK	-	NULL		0.537	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLNK	HGNC	protein_coding	OTTHUMT00000359047.1	0	0	0	82	82	70	0.00	0.00	G	NM_052964		10542196	-1	35	42	50	56	tier1	no_errors	ENST00000226951	ensembl	human	known	74_37	missense	41.18	42.42	SNP	0.993	T	35	50
PDE1C	5137	genome.wustl.edu	37	7	31855612	31855612	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr7:31855612C>A	ENST00000396191.1	-	15	2194	c.1739G>T	c.(1738-1740)cGg>cTg	p.R580L	PDE1C_ENST00000479980.1_5'UTR|PDE1C_ENST00000396193.1_Missense_Mutation_p.R640L|PDE1C_ENST00000396184.3_Missense_Mutation_p.R580L|PDE1C_ENST00000396182.2_Missense_Mutation_p.R580L|PDE1C_ENST00000321453.7_Missense_Mutation_p.R580L	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	580					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.R580Q(2)|p.R580L(2)|p.R640Q(1)|p.R640L(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TTTGTTTGCCCGTGTTCCATT	0.468													ENSG00000154678																																					6	Substitution - Missense(6)	lung(3)|kidney(3)											269.0	265.0	266.0					7																	31855612		2203	4300	6503	SO:0001583	missense	0			-	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1739G>T	7.37:g.31855612C>A	ENSP00000379494:p.Arg580Leu		B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.R580L	ENST00000396191.1	37	c.1739	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473893	0.26423	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.73363	-0.74;-0.73;-0.73;-0.66;-0.66	5.34	5.34	0.76211	.	1.317630	0.05318	N	0.526138	T	0.69033	0.3066	L	0.27053	0.805	0.09310	N	0.999994	B;B;B	0.22146	0.065;0.02;0.006	B;B;B	0.20577	0.03;0.008;0.005	T	0.55648	-0.8108	10	0.48119	T	0.1	.	15.8967	0.79341	0.0:1.0:0.0:0.0	.	580;640;580	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	L	640;580;580;580;580	ENSP00000379496:R640L;ENSP00000379494:R580L;ENSP00000318105:R580L;ENSP00000379487:R580L;ENSP00000379485:R580L	ENSP00000318105:R580L	R	-	2	0	PDE1C	31822137	0.000000	0.05858	0.029000	0.17559	0.005000	0.04900	0.208000	0.17415	2.779000	0.95612	0.655000	0.94253	CGG	-	PDE1C	-	NULL		0.468	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	0	0	0	87	87	78	0.00	0.00	C			31855612	-1	41	34	36	42	tier1	no_errors	ENST00000321453	ensembl	human	known	74_37	missense	53.25	44.74	SNP	0.122	A	41	36
PSPC1	55269	genome.wustl.edu	37	13	20325550	20325550	+	Silent	SNP	T	T	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr13:20325550T>C	ENST00000338910.4	-	4	987	c.828A>G	c.(826-828)gcA>gcG	p.A276A		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	276	Sufficient for paraspeckles localization.|Sufficient for perinucleolar caps localization and interaction with NONO.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		TCCATCGAGATGCATACTCAA	0.403													ENSG00000121390																																					0													132.0	119.0	123.0					13																	20325550		1900	4121	6021	SO:0001819	synonymous_variant	0			-	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.828A>G	13.37:g.20325550T>C			Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Silent	SNP	pfam_RRM_dom,pfam_NOPS,smart_RRM_dom,pfscan_RRM_dom	p.A276	ENST00000338910.4	37	c.828	CCDS41870.1	13																																																																																			-	PSPC1	-	pfam_NOPS		0.403	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSPC1	HGNC	protein_coding	OTTHUMT00000044037.2	0	0	0	68	68	50	0.00	0.00	T			20325550	-1	15	19	23	18	tier1	no_errors	ENST00000338910	ensembl	human	known	74_37	silent	39.47	51.35	SNP	0.983	C	15	23
DOK3	79930	genome.wustl.edu	37	5	176936610	176936610	+	Missense_Mutation	SNP	C	C	T	rs372299396		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:176936610C>T	ENST00000357198.4	-	2	104	c.100G>A	c.(100-102)Gag>Aag	p.E34K	DOK3_ENST00000501403.2_5'UTR|DOK3_ENST00000377112.4_5'UTR|DOK3_ENST00000312943.6_Intron	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	34					Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GACGGGAACTCCTCACACTTC	0.657													ENSG00000146094																																					0								C	,,LYS/GLU	0,4406		0,0,2203	68.0	72.0	71.0		,,100	1.7	1.0	5		71	1,8599		0,1,4299	no	intron,utr-5,missense	DOK3	NM_001144875.1,NM_001144876.1,NM_024872.2	,,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,possibly-damaging	,,34/497	176936610	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.100G>A	5.37:g.176936610C>T	ENSP00000349727:p.Glu34Lys		E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.E34K	ENST00000357198.4	37	c.100	CCDS4426.1	5	.	.	.	.	.	.	.	.	.	.	C	17.08	3.296787	0.60086	0.0	1.16E-4	ENSG00000146094	ENST00000357198	T	0.20069	2.1	4.18	1.67	0.24075	.	1.247490	0.06104	N	0.665998	T	0.15565	0.0375	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26883	-1.0090	10	0.87932	D	0	-16.2589	1.876	0.03218	0.1516:0.4511:0.2376:0.1597	.	34	Q7L591	DOK3_HUMAN	K	34	ENSP00000349727:E34K	ENSP00000349727:E34K	E	-	1	0	DOK3	176869216	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	0.256000	0.18351	0.173000	0.19788	0.491000	0.48974	GAG	-	DOK3	-	NULL		0.657	DOK3-001	KNOWN	basic|CCDS	protein_coding	DOK3	HGNC	protein_coding	OTTHUMT00000253420.4	0	0	0	51	51	72	0.00	0.00	C	NM_024872		176936610	-1	34	27	22	35	tier1	no_errors	ENST00000357198	ensembl	human	known	74_37	missense	60.71	43.55	SNP	1.000	T	34	22
SMARCAL1	50485	genome.wustl.edu	37	2	217343021	217343021	+	Splice_Site	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:217343021A>G	ENST00000357276.4	+	17	2954	c.2624A>G	c.(2623-2625)aAg>aGg	p.K875R	SMARCAL1_ENST00000358207.5_Splice_Site_p.K875R|AC098820.3_ENST00000453157.1_RNA	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	875					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		TACCTCTACAAGGTAATGCCA	0.483									Schimke Immuno-Osseous Dysplasia				ENSG00000138375																																					0													81.0	85.0	84.0					2																	217343021		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	SIOD	-	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2625+1A>G	2.37:g.217343021A>G			A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	pfam_HARP_dom,pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K875R	ENST00000357276.4	37	c.2624	CCDS2403.1	2	.	.	.	.	.	.	.	.	.	.	A	14.73	2.622589	0.46840	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;T	0.86366	-2.11;-2.11;-1.0	5.23	5.23	0.72850	.	0.193434	0.43747	D	0.000528	D	0.84902	0.5575	L	0.59436	1.845	0.43263	D	0.995201	B	0.24882	0.113	B	0.23018	0.043	T	0.82804	-0.0276	10	0.49607	T	0.09	-22.9374	14.4586	0.67433	1.0:0.0:0.0:0.0	.	875	Q9NZC9	SMAL1_HUMAN	R	875;875;717	ENSP00000349823:K875R;ENSP00000350940:K875R;ENSP00000375974:K717R	ENSP00000349823:K875R	K	+	2	0	SMARCAL1	217051266	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	5.737000	0.68606	2.194000	0.70268	0.533000	0.62120	AAG	-	SMARCAL1	-	superfamily_P-loop_NTPase		0.483	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	HGNC	protein_coding	OTTHUMT00000256671.2	0	0	1	40	40	85	0.00	1.16	A		Missense_Mutation	217343021	+1	24	18	14	45	tier1	no_errors	ENST00000357276	ensembl	human	known	74_37	missense	63.16	28.57	SNP	1.000	G	24	14
SPHKAP	80309	genome.wustl.edu	37	2	228855866	228855866	+	Missense_Mutation	SNP	G	G	T	rs16824283	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:228855866G>T	ENST00000392056.3	-	11	4855	c.4809C>A	c.(4807-4809)agC>agA	p.S1603R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S1574R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1603			S -> R (in dbSNP:rs16824283).			extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCCTCTGGGGGCTGGCTGTTC	0.577													ENSG00000153820																																					0													43.0	45.0	44.0					2																	228855866		2203	4300	6503	SO:0001583	missense	0			-		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4809C>A	2.37:g.228855866G>T	ENSP00000375909:p.Ser1603Arg		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.S1603R	ENST00000392056.3	37	c.4809	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759335	0.31137	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.06608	3.28;3.28	6.17	-2.19	0.07015	A-kinase anchor 110kDa, C-terminal (1);	0.300797	0.43919	D	0.000501	T	0.11965	0.0291	L	0.48362	1.52	0.80722	P	0.0	D;P	0.54397	0.966;0.935	P;P	0.55923	0.787;0.613	T	0.01657	-1.1302	9	0.59425	D	0.04	.	13.8991	0.63792	0.6506:0.0:0.3494:0.0	.	1603;1574	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	1603;1574	ENSP00000375909:S1603R;ENSP00000339886:S1574R	ENSP00000339886:S1574R	S	-	3	2	SPHKAP	228564110	0.088000	0.21588	0.000000	0.03702	0.090000	0.18270	0.210000	0.17455	-0.511000	0.06514	-0.137000	0.14449	AGC	-	SPHKAP	-	pfam_AKAP_110_C		0.577	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	0	0	0	33	33	117	0.00	0.00	G	NM_030623		228855866	-1	6	18	45	78	tier1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	11.76	18.75	SNP	0.000	T	6	45
CCR4	1233	genome.wustl.edu	37	3	32995907	32995907	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:32995907C>T	ENST00000330953.5	+	2	1161	c.993C>T	c.(991-993)taC>taT	p.Y331Y		NM_005508.4	NP_005499.1	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	331					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuron migration (GO:0001764)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of positive chemotaxis (GO:0050927)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)|tolerance induction (GO:0002507)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			NS(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)|stomach(1)	16						TCTGCCAATACTGTGGGCTCC	0.463													ENSG00000183813																																					0													53.0	55.0	54.0					3																	32995907		2200	4300	6500	SO:0001819	synonymous_variant	0			-	X85740	CCDS2656.1	3p24-p21.3	2012-08-08			ENSG00000183813	ENSG00000183813		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1605	protein-coding gene	gene with protein product		604836				7642634, 8884276	Standard	NM_005508		Approved	CC-CKR-4, CMKBR4, CKR4, k5-5, ChemR13, CD194	uc003cfg.1	P51679	OTTHUMG00000130752	ENST00000330953.5:c.993C>T	3.37:g.32995907C>T			Q9ULY6|Q9ULY7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR4,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_ATII_rcpt,prints_Duffy_chemokine_rcpt	p.Y331	ENST00000330953.5	37	c.993	CCDS2656.1	3																																																																																			-	CCR4	-	prints_Chemokine_CCR4		0.463	CCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR4	HGNC	protein_coding	OTTHUMT00000253252.2	0	0	0	29	29	86	0.00	0.00	C			32995907	+1	5	13	28	73	tier1	no_errors	ENST00000330953	ensembl	human	known	74_37	silent	15.15	15.12	SNP	0.627	T	5	28
CRNKL1	51340	genome.wustl.edu	37	20	20024254	20024254	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:20024254T>C	ENST00000377340.2	-	8	1368	c.1337A>G	c.(1336-1338)cAa>cGa	p.Q446R	CRNKL1_ENST00000536226.1_Missense_Mutation_p.Q285R|CRNKL1_ENST00000377327.4_Missense_Mutation_p.Q434R	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	446	Mediates interaction with HSP90. {ECO:0000250|UniProtKB:P63154}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						TTGGGCATCTTGTTTTGAAAT	0.378													ENSG00000101343																																					0													98.0	100.0	99.0					20																	20024254		2203	4300	6503	SO:0001583	missense	0			-	AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.1337A>G	20.37:g.20024254T>C	ENSP00000366557:p.Gln446Arg		A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	pfam_HAT,pfam_Suf,smart_HAT,pfscan_TPR-contain_dom	p.Q446R	ENST00000377340.2	37	c.1337	CCDS33446.1	20	.	.	.	.	.	.	.	.	.	.	T	17.39	3.376385	0.61735	.	.	ENSG00000101343	ENST00000377327;ENST00000377340;ENST00000536226	T;T;T	0.08984	3.03;3.03;3.03	6.07	6.07	0.98685	.	0.302356	0.39909	N	0.001229	T	0.10766	0.0263	L	0.43152	1.355	0.58432	D	0.999999	B	0.22480	0.07	B	0.25987	0.065	T	0.12630	-1.0540	10	0.30078	T	0.28	-11.7156	16.6288	0.85011	0.0:0.0:0.0:1.0	.	446	Q9BZJ0	CRNL1_HUMAN	R	434;446;285	ENSP00000366544:Q434R;ENSP00000366557:Q446R;ENSP00000440733:Q285R	ENSP00000366544:Q434R	Q	-	2	0	CRNKL1	19972254	1.000000	0.71417	0.963000	0.40424	0.996000	0.88848	6.177000	0.71961	2.326000	0.78906	0.533000	0.62120	CAA	-	CRNKL1	-	smart_HAT		0.378	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	HGNC	protein_coding	OTTHUMT00000127787.1	0	0	0	60	60	139	0.00	0.00	T			20024254	-1	20	58	27	58	tier1	no_errors	ENST00000377340	ensembl	human	known	74_37	missense	42.55	50.00	SNP	1.000	C	20	27
KIAA1244	57221	genome.wustl.edu	37	6	138645275	138645275	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr6:138645275G>A	ENST00000251691.4	+	31	5151	c.4985G>A	c.(4984-4986)cGa>cAa	p.R1662Q		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TGGCGCATCCGAGCCATGGCC	0.627													ENSG00000112379																																					0													36.0	40.0	38.0					6																	138645275		2203	4298	6501	SO:0001583	missense	0			-	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.4985G>A	6.37:g.138645275G>A	ENSP00000251691:p.Arg1662Gln			Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold,superfamily_Sec7_dom,smart_Sec7_dom	p.R1662Q	ENST00000251691.4	37	c.4985	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399651	0.62177	.	.	ENSG00000112379	ENST00000251691	T	0.18016	2.24	5.44	5.44	0.79542	.	0.064498	0.64402	D	0.000010	T	0.07503	0.0189	L	0.33485	1.01	0.39875	D	0.973551	D	0.52996	0.957	B	0.39068	0.289	T	0.27331	-1.0077	10	0.19147	T	0.46	-12.3311	19.6229	0.95667	0.0:0.0:1.0:0.0	.	1662	Q5TH69	BIG3_HUMAN	Q	1662	ENSP00000251691:R1662Q	ENSP00000251691:R1662Q	R	+	2	0	KIAA1244	138686968	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.324000	0.79115	2.708000	0.92522	0.650000	0.86243	CGA	-	KIAA1244	-	NULL		0.627	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4	0	0	0	34	34	31	0.00	0.00	G	NM_020340		138645275	+1	8	4	33	33	tier1	no_errors	ENST00000251691	ensembl	human	known	74_37	missense	19.51	10.81	SNP	1.000	A	8	33
ATP2B1	490	genome.wustl.edu	37	12	90028950	90028950	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:90028950G>C	ENST00000428670.3	-	4	941	c.485C>G	c.(484-486)tCt>tGt	p.S162C	ATP2B1_ENST00000359142.3_Missense_Mutation_p.S162C|ATP2B1_ENST00000261173.2_Missense_Mutation_p.S162C|ATP2B1_ENST00000348959.3_Missense_Mutation_p.S162C			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	162					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						ACACACTACAGACAAGAGGAT	0.413													ENSG00000070961																																					0													123.0	105.0	111.0					12																	90028950		2203	4300	6503	SO:0001583	missense	0			-	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.485C>G	12.37:g.90028950G>C	ENSP00000392043:p.Ser162Cys		Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.S162C	ENST00000428670.3	37	c.485	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828077	0.90955	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.94689	0.8287	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;0.964	D;D	0.85130	0.997;0.946	D	0.93736	0.7046	9	.	.	.	0.6682	20.1615	0.98135	0.0:0.0:1.0:0.0	.	162;162	P20020-3;P20020-2	.;.	C	162	ENSP00000261173:S162C;ENSP00000343599:S162C;ENSP00000352054:S162C;ENSP00000392043:S162C	.	S	-	2	0	ATP2B1	88553081	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.813000	0.99286	2.835000	0.97688	0.650000	0.86243	TCT	-	ATP2B1	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_Cation_transp_P_typ_ATPase		0.413	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406653.1	0	0	0	71	71	162	0.00	0.00	G	NM_001682		90028950	-1	17	20	68	166	tier1	no_errors	ENST00000261173	ensembl	human	known	74_37	missense	20.00	10.75	SNP	1.000	C	17	68
TC2N	123036	genome.wustl.edu	37	14	92251695	92251695	+	Silent	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr14:92251695C>A	ENST00000435962.2	-	11	1496	c.1173G>T	c.(1171-1173)gtG>gtT	p.V391V	TC2N_ENST00000360594.5_Silent_p.V391V|TC2N_ENST00000556018.1_Silent_p.V327V|TC2N_ENST00000340892.5_Silent_p.V391V	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	391	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		TTCCCACCTTCACGAAAAAAC	0.323													ENSG00000165929																																					0													110.0	123.0	118.0					14																	92251695		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.1173G>T	14.37:g.92251695C>A				Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.V391	ENST00000435962.2	37	c.1173	CCDS9897.1	14																																																																																			-	TC2N	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.323	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	HGNC	protein_coding	OTTHUMT00000411778.1	0	0	0	39	39	139	0.00	0.00	C	NM_152332		92251695	-1	10	29	38	133	tier1	no_errors	ENST00000340892	ensembl	human	known	74_37	silent	20.83	17.90	SNP	1.000	A	10	38
SLC22A7	10864	genome.wustl.edu	37	6	43269949	43269949	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr6:43269949A>T	ENST00000372585.5	+	8	1168	c.1073A>T	c.(1072-1074)aAc>aTc	p.N358I	SLC22A7_ENST00000372574.3_Missense_Mutation_p.N356I|SLC22A7_ENST00000372589.3_Missense_Mutation_p.N356I	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	358					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	TTCGGAGTGAACTTCTCCTAT	0.562													ENSG00000137204																																					0													128.0	120.0	122.0					6																	43269949		2203	4300	6503	SO:0001583	missense	0			-	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1073A>T	6.37:g.43269949A>T	ENSP00000361666:p.Asn358Ile		B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.N358I	ENST00000372585.5	37	c.1073	CCDS4893.2	6	.	.	.	.	.	.	.	.	.	.	A	19.98	3.926265	0.73327	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574;ENST00000436107	T;T;T;D	0.82526	0.31;0.31;0.31;-1.62	5.27	5.27	0.74061	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.186903	0.47093	D	0.000250	D	0.82430	0.5035	L	0.52266	1.64	0.80722	D	1	P;P;D	0.57899	0.947;0.935;0.981	P;P;P	0.61722	0.893;0.828;0.888	D	0.85399	0.1130	10	0.87932	D	0	.	9.4249	0.38574	0.8211:0.1789:0.0:0.0	.	358;356;356	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	I	356;358;356;51	ENSP00000361670:N356I;ENSP00000361666:N358I;ENSP00000361655:N356I;ENSP00000393836:N51I	ENSP00000361655:N356I	N	+	2	0	SLC22A7	43377927	0.690000	0.27699	1.000000	0.80357	0.990000	0.78478	0.812000	0.27211	1.997000	0.58415	0.379000	0.24179	AAC	-	SLC22A7	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.562	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	SLC22A7	HGNC	protein_coding	OTTHUMT00000040588.1	0	0	0	86	86	109	0.00	0.00	A			43269949	+1	20	26	57	69	tier1	no_errors	ENST00000372585	ensembl	human	known	74_37	missense	25.97	27.37	SNP	1.000	T	20	57
CES5A	221223	genome.wustl.edu	37	16	55909115	55909115	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr16:55909115G>T	ENST00000290567.9	-	1	140	c.19C>A	c.(19-21)Cac>Aac	p.H7N	CES5A_ENST00000319165.9_Missense_Mutation_p.H7N|CES5A_ENST00000521992.1_Intron|CES5A_ENST00000520435.1_Missense_Mutation_p.H7N|CES5A_ENST00000541580.1_Intron|CES5A_ENST00000518005.1_Intron	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	7						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TGGCCTGGGTGCACCCAATTC	0.567													ENSG00000159398																																					0													113.0	108.0	110.0					16																	55909115		2198	4300	6498	SO:0001583	missense	0			-	AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.19C>A	16.37:g.55909115G>T	ENSP00000290567:p.His7Asn		B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.H7N	ENST00000290567.9	37	c.19	CCDS45490.1	16	.	.	.	.	.	.	.	.	.	.	G	4.289	0.052877	0.08291	.	.	ENSG00000159398	ENST00000319165;ENST00000290567;ENST00000520435	T;T;T	0.67865	-0.29;-0.18;-0.29	4.31	0.19	0.15125	.	2.038100	0.02043	N	0.049443	T	0.49218	0.1544	N	0.19112	0.55	0.09310	N	1	B;P	0.36535	0.421;0.557	B;B	0.32864	0.107;0.154	T	0.39057	-0.9632	10	0.28530	T	0.3	.	6.6574	0.22994	0.3984:0.0:0.6016:0.0	.	7;7	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	N	7	ENSP00000324271:H7N;ENSP00000290567:H7N;ENSP00000428887:H7N	ENSP00000290567:H7N	H	-	1	0	CES5A	54466616	0.000000	0.05858	0.020000	0.16555	0.029000	0.11900	0.187000	0.16998	0.081000	0.16988	-0.157000	0.13467	CAC	-	CES5A	-	NULL		0.567	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CES5A	HGNC	protein_coding	OTTHUMT00000256975.3	0	0	0	52	52	88	0.00	0.00	G	NM_145024		55909115	-1	10	15	44	50	tier1	no_errors	ENST00000290567	ensembl	human	known	74_37	missense	18.52	23.08	SNP	0.021	T	10	44
KIF19	124602	genome.wustl.edu	37	17	72339230	72339230	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:72339230C>T	ENST00000389916.4	+	5	525	c.387C>T	c.(385-387)aaC>aaT	p.N129N		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	129	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						AGACCCTCAACGACCTCTTCC	0.592													ENSG00000196169																																					0													97.0	75.0	82.0					17																	72339230		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.387C>T	17.37:g.72339230C>T			A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.N129	ENST00000389916.4	37	c.387	CCDS32718.2	17																																																																																			-	KIF19	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.592	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2	0	0	0	46	46	47	0.00	0.00	C	NM_153209		72339230	+1	7	13	25	42	tier1	no_errors	ENST00000389916	ensembl	human	known	74_37	silent	21.88	23.64	SNP	0.903	T	7	25
MUC19	283463	genome.wustl.edu	37	12	40867002	40867002	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:40867002A>G	ENST00000454784.4	+	45	4742	c.4009A>G	c.(4009-4011)Aca>Gca	p.T1337A				Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	1337	Approximate repeats of G-V-T-G-T-T-G-P-S- A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CACAGCTGGAACATCAGGTAC	0.468													ENSG00000205592																																					0																																										SO:0001583	missense	0			-	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.4009A>G	12.37:g.40867002A>G	ENSP00000476404:p.Thr1337Ala		Q8NA85	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich	p.T1337A	ENST00000454784.4	37	c.4009		12	.	.	.	.	.	.	.	.	.	.	A	9.529	1.110452	0.20714	.	.	ENSG00000205592	ENST00000425730	.	.	.	2.43	-4.86	0.03132	.	.	.	.	.	T	0.12817	0.0311	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.28332	-1.0047	6	0.11485	T	0.65	.	6.0008	0.19519	0.2843:0.2187:0.4971:0.0	.	.	.	.	A	1566	.	ENSP00000395253:T1566A	T	+	1	0	MUC19	39153269	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.088000	0.01359	-1.748000	0.01332	0.338000	0.21704	ACA	-	MUC19	-	NULL		0.468	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	0	0	0	31	31	118	0.00	0.00	A	XM_003403524		40867002	+1	15	41	33	92	tier1	no_errors	ENST00000454784	ensembl	human	novel	74_37	missense	31.25	30.83	SNP	0.000	G	15	33
MKRN3	7681	genome.wustl.edu	37	15	23811912	23811912	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:23811912G>A	ENST00000314520.3	+	1	1459	c.983G>A	c.(982-984)cGc>cAc	p.R328H	MKRN3_ENST00000568945.1_Intron|MKRN3_ENST00000564592.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000568252.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	328					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		AATGACCGCCGCTTTGGCATT	0.493													ENSG00000179455																																					0													113.0	95.0	101.0					15																	23811912		2203	4300	6503	SO:0001583	missense	0			-	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.983G>A	15.37:g.23811912G>A	ENSP00000313881:p.Arg328His			Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.R328H	ENST00000314520.3	37	c.983	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399679	0.83120	.	.	ENSG00000179455	ENST00000314520	T	0.67698	-0.28	4.07	4.07	0.47477	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.82563	0.5064	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85421	0.1143	10	0.72032	D	0.01	.	14.5895	0.68354	0.0:0.0:1.0:0.0	.	328	Q13064	MKRN3_HUMAN	H	328	ENSP00000313881:R328H	ENSP00000313881:R328H	R	+	2	0	MKRN3	21363005	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	8.986000	0.93492	2.567000	0.86603	0.655000	0.94253	CGC	-	MKRN3	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.493	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	0	0	0	49	49	128	0.00	0.00	G	NM_005664		23811912	+1	18	39	32	68	tier1	no_errors	ENST00000314520	ensembl	human	known	74_37	missense	36.00	36.11	SNP	1.000	A	18	32
PAQR5	54852	genome.wustl.edu	37	15	69682069	69682069	+	Silent	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:69682069C>A	ENST00000340965.3	+	6	1130	c.462C>A	c.(460-462)gcC>gcA	p.A154A	PAQR5_ENST00000561027.1_3'UTR|PAQR5_ENST00000395407.2_Silent_p.A154A|PAQR5_ENST00000561153.1_Silent_p.A154A|RP11-253M7.6_ENST00000560870.1_RNA	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	154					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						ACTACGTGGCCCTGGCTGTAC	0.582													ENSG00000137819																																					0													166.0	122.0	137.0					15																	69682069		2199	4298	6497	SO:0001819	synonymous_variant	0			-		CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.462C>A	15.37:g.69682069C>A			Q8IXU2	Silent	SNP	pfam_HlyIII-related	p.A154	ENST00000340965.3	37	c.462	CCDS10232.1	15																																																																																			-	PAQR5	-	pfam_HlyIII-related		0.582	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR5	HGNC	protein_coding	OTTHUMT00000416671.1	0	0	0	53	53	92	0.00	0.00	C	NM_017705		69682069	+1	6	24	34	49	tier1	no_errors	ENST00000340965	ensembl	human	known	74_37	silent	15.00	32.88	SNP	0.213	A	6	34
UNC79	57578	genome.wustl.edu	37	14	94008839	94008839	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr14:94008839A>C	ENST00000393151.2	+	14	1552	c.1552A>C	c.(1552-1554)Acg>Ccg	p.T518P	UNC79_ENST00000256339.4_Missense_Mutation_p.T341P|UNC79_ENST00000555664.1_Missense_Mutation_p.T518P|UNC79_ENST00000553484.1_Missense_Mutation_p.T518P			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	518					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CAGTGAGAACACGCCTACAGA	0.468													ENSG00000133958																																					0													88.0	71.0	77.0					14																	94008839		2203	4300	6503	SO:0001583	missense	0			-	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1552A>C	14.37:g.94008839A>C	ENSP00000376858:p.Thr518Pro		B5MDL6|Q6ZUT7	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.T518P	ENST00000393151.2	37	c.1552		14	.	.	.	.	.	.	.	.	.	.	A	27.0	4.786510	0.90367	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.42539	0.1207	L	0.52573	1.65	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.25537	-1.0129	10	0.72032	D	0.01	-16.4124	16.1673	0.81777	1.0:0.0:0.0:0.0	.	518	C9JQL1	.	P	341;518;518;518;518	ENSP00000256339:T341P;ENSP00000450868:T518P;ENSP00000451360:T518P;ENSP00000376858:T518P	ENSP00000256339:T341P	T	+	1	0	KIAA1409	93078592	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.292000	0.96076	2.207000	0.71202	0.533000	0.62120	ACG	-	UNC79	-	NULL		0.468	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	0	0	0	69	69	76	0.00	0.00	A	XM_028395		94008839	+1	14	14	75	93	tier1	no_errors	ENST00000553484	ensembl	human	known	74_37	missense	15.73	12.96	SNP	1.000	C	14	75
ASRGL1	80150	genome.wustl.edu	37	11	62156674	62156674	+	Silent	SNP	C	C	T	rs150568119	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr11:62156674C>T	ENST00000415229.2	+	5	776	c.561C>T	c.(559-561)ggC>ggT	p.G187G	CTD-2531D15.5_ENST00000526045.1_RNA|ASRGL1_ENST00000301776.5_Silent_p.G187G|ASRGL1_ENST00000535727.1_Silent_p.G59G	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	187					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	CCTCCACAGGCGGTATCGTTA	0.542													ENSG00000162174																																					0								C	,	1,4403		0,1,2201	125.0	117.0	120.0		561,561	-1.4	0.1	11	dbSNP_134	120	6,8592		0,6,4293	no	coding-synonymous,coding-synonymous	ASRGL1	NM_001083926.1,NM_025080.3	,	0,7,6494	TT,TC,CC		0.0698,0.0227,0.0538	,	187/309,187/309	62156674	7,12995	2202	4299	6501	SO:0001819	synonymous_variant	0			-		CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.561C>T	11.37:g.62156674C>T			B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Silent	SNP	pfam_Peptidase_T2	p.G187	ENST00000415229.2	37	c.561	CCDS8019.1	11																																																																																			rs150568119	ASRGL1	-	pfam_Peptidase_T2		0.542	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASRGL1	HGNC	protein_coding	OTTHUMT00000394865.1	0	0	0	86	86	103	0.00	0.00	C	NM_001083926		62156674	+1	16	19	75	72	tier1	no_errors	ENST00000301776	ensembl	human	known	74_37	silent	17.58	20.88	SNP	0.965	T	16	75
CHPF	79586	genome.wustl.edu	37	2	220405754	220405754	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:220405754G>A	ENST00000243776.6	-	3	1230	c.982C>T	c.(982-984)Cgt>Tgt	p.R328C	TMEM198_ENST00000344458.2_5'Flank|TMEM198_ENST00000373883.3_5'Flank|CHPF_ENST00000535926.1_Missense_Mutation_p.R166C	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	328					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		ACAGGGTCACGCACAGGGTGG	0.602													ENSG00000123989																																					0													87.0	70.0	76.0					2																	220405754		2203	4300	6503	SO:0001583	missense	0			-	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.982C>T	2.37:g.220405754G>A	ENSP00000243776:p.Arg328Cys		B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	pfam_Chond_Galc	p.R328C	ENST00000243776.6	37	c.982	CCDS2443.1	2	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883049	0.51908	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.15834	2.39;2.39	4.63	3.68	0.42216	.	0.802027	0.11649	N	0.542939	T	0.22551	0.0544	L	0.34521	1.04	0.09310	N	0.999995	P	0.42518	0.782	P	0.49140	0.601	T	0.09975	-1.0650	10	0.39692	T	0.17	0.0	14.8615	0.70384	0.0:0.0:0.8564:0.1436	.	328	Q8IZ52	CHSS2_HUMAN	C	328;166	ENSP00000243776:R328C;ENSP00000445571:R166C	ENSP00000243776:R328C	R	-	1	0	CHPF	220113998	0.113000	0.22115	0.687000	0.30102	0.943000	0.58893	1.335000	0.33839	2.575000	0.86900	0.655000	0.94253	CGT	-	CHPF	-	pfam_Chond_Galc		0.602	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	HGNC	protein_coding	OTTHUMT00000130268.1	0	0	0	72	72	72	0.00	0.00	G	NM_024536		220405754	-1	12	18	46	53	tier1	no_errors	ENST00000243776	ensembl	human	known	74_37	missense	20.69	25.00	SNP	0.078	A	12	46
ZNF536	9745	genome.wustl.edu	37	19	30935048	30935048	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:30935048C>T	ENST00000355537.3	+	2	726	c.579C>T	c.(577-579)cgC>cgT	p.R193R		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	193					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGCGTGTGCGCGAGGAGAACC	0.692													ENSG00000198597																																					0													17.0	13.0	15.0					19																	30935048		2193	4290	6483	SO:0001819	synonymous_variant	0			-		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.579C>T	19.37:g.30935048C>T			A2RU18	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R193	ENST00000355537.3	37	c.579	CCDS32984.1	19																																																																																			-	ZNF536	-	NULL		0.692	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	0	0	0	48	48	18	0.00	0.00	C	NM_014717		30935048	+1	6	2	55	13	tier1	no_errors	ENST00000355537	ensembl	human	known	74_37	silent	9.84	13.33	SNP	0.622	T	6	55
SNORD3B-1	26851	genome.wustl.edu	37	17	18967187	18967187	+	lincRNA	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:18967187G>A	ENST00000363359.1	+	0	432				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		GAAACGCCCCGGAGTTTACGA	0.547													ENSG00000262074																																					0													68.0	166.0	145.0					17																	18967187		506	1952	2458			0			-	AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18967187G>A				R	SNP	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			-	SNORD3B-2	-	-		0.547	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-2	HGNC	lincRNA		0	0	0	68	68	121	0.00	0.00	G	NR_003271		18967187	-1	15	24	133	146	tier1	no_errors	ENST00000571722	ensembl	human	known	74_37	rna	10.07	14.12	SNP	0.000	A	15	133
LRP1B	53353	genome.wustl.edu	37	2	141660728	141660728	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:141660728C>T	ENST00000389484.3	-	23	4498	c.3527G>A	c.(3526-3528)tGt>tAt	p.C1176Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1176	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTTCAGCGAACACTCATCTAT	0.398										TSP Lung(27;0.18)			ENSG00000168702																									Colon(99;50 2074 2507 20106)												0													73.0	64.0	67.0					2																	141660728		2203	4300	6503	SO:0001583	missense	0			-	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3527G>A	2.37:g.141660728C>T	ENSP00000374135:p.Cys1176Tyr		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.C1176Y	ENST00000389484.3	37	c.3527	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367376	0.61513	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.99966	-10.09;-10.09	5.43	5.43	0.79202	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.99984	0.9995	H	0.99261	4.49	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.996	D	0.99712	1.1007	10	0.59425	D	0.04	.	19.6188	0.95647	0.0:1.0:0.0:0.0	.	359;1176	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	Y	1176;1114;321	ENSP00000374135:C1176Y;ENSP00000413239:C321Y	ENSP00000374135:C1176Y	C	-	2	0	LRP1B	141377198	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	7.722000	0.84778	2.699000	0.92147	0.650000	0.86243	TGT	-	LRP1B	-	smart_EG-like_dom		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	0	0	0	20	20	83	0.00	0.00	C	NM_018557		141660728	-1	4	13	15	31	tier1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	21.05	29.55	SNP	1.000	T	4	15
BNC1	646	genome.wustl.edu	37	15	83926276	83926276	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:83926276G>A	ENST00000345382.2	-	5	2988	c.2903C>T	c.(2902-2904)tCg>tTg	p.S968L	BNC1_ENST00000569704.1_Missense_Mutation_p.S961L|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	968					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GCGAACAGACGAAAACATGGT	0.498													ENSG00000169594																																					0													154.0	148.0	150.0					15																	83926276		2203	4300	6503	SO:0001583	missense	0			-	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2903C>T	15.37:g.83926276G>A	ENSP00000307041:p.Ser968Leu		Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S968L	ENST00000345382.2	37	c.2903	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	G	35	5.571926	0.96553	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.52983	0.64	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.70727	0.3257	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	T	0.71464	-0.4585	10	0.87932	D	0	-14.6891	20.3398	0.98759	0.0:0.0:1.0:0.0	.	961;968	F5GY04;Q01954	.;BNC1_HUMAN	L	968;961	ENSP00000307041:S968L	ENSP00000307041:S968L	S	-	2	0	BNC1	81717280	1.000000	0.71417	0.983000	0.44433	0.993000	0.82548	9.787000	0.99055	2.811000	0.96726	0.557000	0.71058	TCG	-	BNC1	-	smart_Znf_C2H2-like		0.498	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	0	0	0	58	58	130	0.00	0.00	G	NM_001717		83926276	-1	32	55	24	37	tier1	no_errors	ENST00000345382	ensembl	human	known	74_37	missense	57.14	59.78	SNP	1.000	A	32	24
SORBS2	8470	genome.wustl.edu	37	4	186544971	186544971	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr4:186544971C>T	ENST00000284776.7	-	13	2109	c.1600G>A	c.(1600-1602)Gta>Ata	p.V534I	SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.V438I|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.V534I|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000355634.5_Missense_Mutation_p.V634I|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000393528.3_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	534					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TCTAGGGTTACGGGAGACAGC	0.542													ENSG00000154556																									Esophageal Squamous(153;41 2433 9491 36028)												0													76.0	69.0	72.0					4																	186544971		2203	4300	6503	SO:0001583	missense	0			-		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1600G>A	4.37:g.186544971C>T	ENSP00000284776:p.Val534Ile		A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.V534I	ENST00000284776.7	37	c.1600	CCDS3845.1	4	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.956246	0.00470	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.35421	1.41;1.41;1.31;1.41	5.88	-1.36	0.09085	.	0.477787	0.22867	N	0.054670	T	0.14830	0.0358	N	0.16478	0.41	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.06405	0.002;0.001;0.002	T	0.34527	-0.9825	10	0.02654	T	1	-2.105	7.5849	0.27987	0.097:0.4898:0.0:0.4132	.	438;634;534	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	I	534;534;438;634	ENSP00000284776:V534I;ENSP00000411764:V534I;ENSP00000397482:V438I;ENSP00000347852:V634I	ENSP00000284776:V534I	V	-	1	0	SORBS2	186781965	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.113000	0.15499	-0.704000	0.05042	0.561000	0.74099	GTA	-	SORBS2	-	NULL		0.542	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	0	0	0	18	18	85	0.00	0.00	C	NM_003603		186544971	-1	6	13	23	77	tier1	no_errors	ENST00000284776	ensembl	human	known	74_37	missense	20.69	14.44	SNP	0.000	T	6	23
FAM183B	340286	genome.wustl.edu	37	7	38725207	38725207	+	Silent	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr7:38725207G>T	ENST00000409072.3	-	2	1333	c.399C>A	c.(397-399)cgC>cgA	p.R133R				Q6ZVS7	F183B_HUMAN	family with sequence similarity 183, member B	133										endometrium(1)|lung(7)	8						GCTACTTGTGGCGATCATCTT	0.488													ENSG00000164556																																					0													185.0	184.0	184.0					7																	38725207		2048	4200	6248	SO:0001819	synonymous_variant	0			-	AK124132, BC045803		7p14.1	2008-08-11			ENSG00000164556	ENSG00000164556			34511	protein-coding gene	gene with protein product							Standard	NR_028347		Approved	LOC340286	uc011kbd.2	Q6ZVS7	OTTHUMG00000153653	ENST00000409072.3:c.399C>A	7.37:g.38725207G>T			A4D1Y1	Silent	SNP	NULL	p.R133	ENST00000409072.3	37	c.399		7																																																																																			-	FAM183B	-	NULL		0.488	FAM183B-001	NOVEL	basic|appris_principal	protein_coding	FAM183B	HGNC	protein_coding	OTTHUMT00000331972.1	0	0	0	38	38	86	0.00	0.00	G	NM_001105282		38725207	-1	6	9	27	59	tier1	no_errors	ENST00000409072	ensembl	human	novel	74_37	silent	18.18	13.24	SNP	0.019	T	6	27
RIMS2	9699	genome.wustl.edu	37	8	105106900	105106900	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:105106900A>G	ENST00000436393.2	+	22	3330	c.3089A>G	c.(3088-3090)gAa>gGa	p.E1030G	RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000507740.1_Intron|RIMS2_ENST00000262231.10_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CAAGGGAAAGAAAAAGAACAG	0.358										HNSCC(12;0.0054)			ENSG00000176406																																					0																																										SO:0001583	missense	0			-	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3089A>G	8.37:g.105106900A>G	ENSP00000390665:p.Glu1030Gly		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.E1030G	ENST00000436393.2	37	c.3089		8	.	.	.	.	.	.	.	.	.	.	A	15.34	2.804228	0.50315	.	.	ENSG00000176406	ENST00000436393	T	0.12774	2.65	5.66	4.51	0.55191	.	.	.	.	.	T	0.11239	0.0274	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.08597	-1.0714	8	0.30854	T	0.27	.	11.5755	0.50858	0.9303:0.0:0.0697:0.0	.	1030	D6RA03	.	G	1030	ENSP00000390665:E1030G	ENSP00000390665:E1030G	E	+	2	0	RIMS2	105176076	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.491000	0.60326	1.081000	0.41110	0.533000	0.62120	GAA	-	RIMS2	-	NULL		0.358	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	0	0	0	19	19	109	0.00	0.00	A	NM_001100117		105106900	+1	23	57	17	78	tier1	no_errors	ENST00000436393	ensembl	human	novel	74_37	missense	57.50	42.22	SNP	1.000	G	23	17
GAS2L3	283431	genome.wustl.edu	37	12	100994198	100994198	+	Silent	SNP	T	T	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:100994198T>C	ENST00000539410.1	+	3	443	c.57T>C	c.(55-57)agT>agC	p.S19S	GAS2L3_ENST00000266754.5_Silent_p.S19S|GAS2L3_ENST00000537247.1_5'UTR|GAS2L3_ENST00000547754.1_Silent_p.S19S			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	19					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						GTCCTCGGAGTCCTCTGACTC	0.423													ENSG00000139354																																					0													141.0	131.0	134.0					12																	100994198		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.57T>C	12.37:g.100994198T>C			B2RCN2	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.S19	ENST00000539410.1	37	c.57	CCDS9079.1	12																																																																																			-	GAS2L3	-	NULL		0.423	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L3	HGNC	protein_coding	OTTHUMT00000409143.1	0	0	0	52	52	51	0.00	0.00	T	NM_174942		100994198	+1	6	9	53	42	tier1	no_errors	ENST00000266754	ensembl	human	known	74_37	silent	10.17	17.65	SNP	1.000	C	6	53
HMBOX1	79618	genome.wustl.edu	37	8	28908583	28908583	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:28908583G>A	ENST00000397358.3	+	11	1878	c.1174G>A	c.(1174-1176)Gtg>Atg	p.V392M	RNA5SP260_ENST00000363849.1_RNA|HMBOX1_ENST00000524238.1_Missense_Mutation_p.V415M|HMBOX1_ENST00000444075.1_Missense_Mutation_p.V415M|HMBOX1_ENST00000287701.10_Missense_Mutation_p.V392M|HMBOX1_ENST00000355231.5_Intron|HMBOX1_ENST00000519047.1_Intron	NM_024567.3	NP_078843.2	Q6NT76	HMBX1_HUMAN	homeobox containing 1	392					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	11		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		CTCATTAGCTGTGGAAATGGC	0.463													ENSG00000147421																																					0													176.0	144.0	155.0					8																	28908583		2203	4300	6503	SO:0001583	missense	0			-	AY522342	CCDS6071.1	8p12	2013-05-23			ENSG00000147421	ENSG00000147421		"""Homeoboxes / HNF class"""	26137	protein-coding gene	gene with protein product	"""homeobox telomere-binding protein 1"""					16825764	Standard	NM_024567		Approved	HNF1LA, PBHNF, FLJ21616, HOT1	uc003xhd.4	Q6NT76	OTTHUMG00000172138	ENST00000397358.3:c.1174G>A	8.37:g.28908583G>A	ENSP00000380516:p.Val392Met		A4K385|A8K3R8|B4DHY5|D3DSU0|Q3Y6P1|Q96GS5|Q9H701	Missense_Mutation	SNP	pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.V415M	ENST00000397358.3	37	c.1243	CCDS6071.1	8	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830482	0.71258	.	.	ENSG00000147421	ENST00000287701;ENST00000444075;ENST00000397358;ENST00000524238;ENST00000517340	D;D;D;D	0.99898	-7.54;-7.61;-7.54;-7.61	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.99718	0.9891	L	0.27053	0.805	0.80722	D	1	D;D;D	0.71674	0.994;0.998;0.99	D;D;D	0.70487	0.931;0.943;0.969	D	0.97247	0.9895	10	0.46703	T	0.11	-4.7992	19.6056	0.95580	0.0:0.0:1.0:0.0	.	415;390;392	Q6NT76-5;Q6NT76-3;Q6NT76	.;.;HMBX1_HUMAN	M	392;415;392;415;390	ENSP00000287701:V392M;ENSP00000401769:V415M;ENSP00000380516:V392M;ENSP00000430110:V415M	ENSP00000287701:V392M	V	+	1	0	HMBOX1	28964502	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.538000	0.90634	2.625000	0.88918	0.655000	0.94253	GTG	-	HMBOX1	-	NULL		0.463	HMBOX1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	HMBOX1	HGNC	protein_coding	OTTHUMT00000255267.4	0	0	0	41	41	52	0.00	0.00	G	NM_024567		28908583	+1	5	8	11	32	tier1	no_errors	ENST00000444075	ensembl	human	known	74_37	missense	31.25	20.00	SNP	1.000	A	5	11
PLXNA2	5362	genome.wustl.edu	37	1	208391096	208391097	+	Frame_Shift_Ins	INS	-	-	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:208391096_208391097insA	ENST00000367033.3	-	2	928_929	c.171_172insT	c.(169-174)caagggfs	p.G58fs		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	58	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GCCCCCGTCCCTTGGTGGACGG	0.599													ENSG00000076356																																					0																																										SO:0001589	frameshift_variant	0				X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.171_172insT	1.37:g.208391096_208391097insA	ENSP00000356000:p.Gly58fs		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Frame_Shift_Ins	INS	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G57fs	ENST00000367033.3	37	c.172_171	CCDS31013.1	1																																																																																				PLX2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.599	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLX2	HGNC	protein_coding	OTTHUMT00000088932.6	0	0	0	54	54	84	0.00	0.00	-	NM_025179		208391097	-1	15	14	51	50	tier1	no_errors	ENST00000367033	ensembl	human	known	74_37	frame_shift_ins	22.73	21.88	INS	0.302:0.070	A	15	51
GPC1	2817	genome.wustl.edu	37	2	241390284	241390284	+	Intron	DEL	C	C	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:241390284delC	ENST00000264039.2	+	2	414				AC110619.2_ENST00000404327.3_Frame_Shift_Del_p.G41fs|AC110619.2_ENST00000404891.1_3'UTR	NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1						axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		GGCAGAGGTTCCCTCTGGAAG	0.607													ENSG00000218416																																					0																																										SO:0001627	intron_variant	0				AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.167-8163C>-	2.37:g.241390284delC			B3KTD1|Q53QM4	Frame_Shift_Del	DEL	NULL	p.N42fs	ENST00000264039.2	37	c.123	CCDS2534.1	2																																																																																				AC110619.2	-	NULL		0.607	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000218416	Clone_based_vega_gene	protein_coding	OTTHUMT00000257179.3	0	0	0	56	56	71	0.00	0.00	C	NM_002081		241390284	-1	28	32	28	35	tier1	no_errors	ENST00000404327	ensembl	human	putative	74_37	frame_shift_del	50.00	47.76	DEL	0.001	-	28	28
KMT2C	58508	genome.wustl.edu	37	7	151842337	151842337	+	Frame_Shift_Del	DEL	C	C	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr7:151842337delC	ENST00000262189.6	-	54	14293	c.14075delG	c.(14074-14076)ggcfs	p.G4692fs	KMT2C_ENST00000485655.2_5'Flank|KMT2C_ENST00000355193.2_Frame_Shift_Del_p.G4749fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4692					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGGATTTCGGCCGTATCGGAA	0.473													ENSG00000055609																																					0													90.0	78.0	82.0					7																	151842337		2203	4300	6503	SO:0001589	frameshift_variant	0				AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14075delG	7.37:g.151842337delC	ENSP00000262189:p.Gly4692fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.G4749fs	ENST00000262189.6	37	c.14246	CCDS5931.1	7																																																																																				KMT2C	-	pfam_FYrich_C,smart_FYrich_C		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	0	0	0	88	88	134	0.00	0.00	C			151842337	-1	11	21	43	100	tier1	no_errors	ENST00000355193	ensembl	human	known	74_37	frame_shift_del	20.37	17.36	DEL	1.000	-	11	43
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Frame_Shift_Del	DEL	C	C	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:7577114delC	ENST00000269305.4	-	8	1013	c.824delG	c.(823-825)tgtfs	p.C275fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.C275fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	GRCh37	CM076568|CM951234	TP53	M							71.0	61.0	64.0					17																	7577114		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824delG	17.37:g.7577114delC	ENSP00000269305:p.Cys275fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C275fs	ENST00000269305.4	37	c.824	CCDS11118.1	17																																																																																				TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	32	32	110	0.00	0.00	C	NM_000546		7577114	-1	8	63	12	52	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	40.00	54.78	DEL	1.000	-	8	12
PRKDC	5591	genome.wustl.edu	37	8	48701570	48701570	+	Frame_Shift_Del	DEL	G	G	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:48701570delG	ENST00000314191.2	-	77	10852	c.10796delC	c.(10795-10797)cctfs	p.P3599fs	PRKDC_ENST00000338368.3_Frame_Shift_Del_p.P3599fs|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3600					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TTTATTTACAGGGGTTTTTGC	0.378								Non-homologous end-joining					ENSG00000253729																									Esophageal Squamous(79;1091 1253 12329 31680 40677)												0													82.0	74.0	76.0					8																	48701570		1791	4062	5853	SO:0001589	frameshift_variant	0					CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10796delC	8.37:g.48701570delG	ENSP00000313420:p.Pro3599fs		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Frame_Shift_Del	DEL	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.P3599fs	ENST00000314191.2	37	c.10796		8																																																																																				PRKDC	-	NULL		0.378	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		0	0	0	65	65	63	0.00	0.00	G	NM_001081640		48701570	-1	55	53	32	35	tier1	no_errors	ENST00000314191	ensembl	human	known	74_37	frame_shift_del	63.22	60.23	DEL	0.002	-	55	32
PCDHA2	56146	genome.wustl.edu	37	5	140175282	140175285	+	Frame_Shift_Del	DEL	TCAG	TCAG	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	TCAG	TCAG	TCAG	-	TCAG	TCAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:140175282_140175285delTCAG	ENST00000526136.1	+	1	733_736	c.733_736delTCAG	c.(733-738)tcagttfs	p.SV245fs	PCDHA2_ENST00000378132.1_Frame_Shift_Del_p.SV245fs|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Frame_Shift_Del_p.SV245fs	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	245	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTGCCCAATCAGTTTACAAAGT	0.417													ENSG00000204969																																					0																																										SO:0001589	frameshift_variant	0				AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.733_736delTCAG	5.37:g.140175282_140175285delTCAG	ENSP00000431748:p.Ser245fs		O75287|Q9BTV3	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S245fs	ENST00000526136.1	37	c.733_736	CCDS54914.1	5																																																																																				PCDHA2	-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.417	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	0	0	0	30	30	101	0.00	0.00	TCAG	NM_018905		140175285	+1	7	18	9	48	tier1	no_errors	ENST00000526136	ensembl	human	known	74_37	frame_shift_del	43.75	27.27	DEL	0.000:0.000:0.000:0.000	-	7	9
FBXO5	26271	genome.wustl.edu	37	6	153293556	153293556	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr6:153293556delT	ENST00000229758.3	-	4	1001	c.943delA	c.(943-945)accfs	p.T315fs	FBXO5_ENST00000477822.1_5'UTR|FBXO5_ENST00000367241.3_Frame_Shift_Del_p.T269fs	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	315					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		TATTCTCTGGTTGAAGCATGA	0.323													ENSG00000112029																									NSCLC(121;372 1757 17721 17977 29669)												0													98.0	96.0	97.0					6																	153293556		2203	4300	6503	SO:0001589	frameshift_variant	0				AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.943delA	6.37:g.153293556delT	ENSP00000229758:p.Thr315fs		B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Frame_Shift_Del	DEL	pfam_F-box_dom,superfamily_F-box_dom	p.T315fs	ENST00000229758.3	37	c.943	CCDS5242.1	6																																																																																				FBXO5	-	NULL		0.323	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	HGNC	protein_coding	OTTHUMT00000042757.1	0	0	0	48	48	98	0.00	0.00	T			153293556	-1	7	24	44	67	tier1	no_errors	ENST00000229758	ensembl	human	known	74_37	frame_shift_del	13.73	26.37	DEL	1.000	-	7	44
ZNF234	10780	genome.wustl.edu	37	19	44653051	44653051	+	Splice_Site	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:44653051G>A	ENST00000426739.2	+	4	400		c.e4+1		ZNF234_ENST00000592437.1_Splice_Site	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				CTGTCAGTGGGTGAGGACATG	0.498													ENSG00000263002																																					0													134.0	131.0	132.0					19																	44653051		2203	4300	6503	SO:0001630	splice_region_variant	0			-	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.142+1G>A	19.37:g.44653051G>A			A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Splice_Site	SNP	-	e2+1	ENST00000426739.2	37	c.142+1	CCDS46101.1	19	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253489	0.39797	.	.	ENSG00000167380	ENST00000426739	.	.	.	3.85	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0647	0.71983	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF226	49344891	1.000000	0.71417	0.997000	0.53966	0.455000	0.32408	3.745000	0.55119	2.122000	0.65172	0.561000	0.74099	.	-	ZNF234	-	-		0.498	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF234	HGNC	protein_coding	OTTHUMT00000460586.2	0	0	0	87	87	83	0.00	0.00	G		Intron	44653051	+1	13	7	83	91	tier1	no_errors	ENST00000426739	ensembl	human	known	74_37	splice_site	13.40	7.14	SNP	1.000	A	13	83
ANK1	286	genome.wustl.edu	37	8	41519417	41519417	+	Missense_Mutation	SNP	C	C	T	rs143987736		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:41519417C>T	ENST00000347528.4	-	41	5604	c.5521G>A	c.(5521-5523)Gat>Aat	p.D1841N	ANK1_ENST00000314214.8_Missense_Mutation_p.D116N|ANK1_ENST00000265709.8_Missense_Mutation_p.D1882N|ANK1_ENST00000396945.1_Intron|RP11-930P14.1_ENST00000520418.1_RNA|ANK1_ENST00000396942.1_Missense_Mutation_p.D1841N|ANK1_ENST00000522543.1_Missense_Mutation_p.D116N|RP11-930P14.1_ENST00000585088.1_RNA|ANK1_ENST00000522231.1_Missense_Mutation_p.D116N|ANK1_ENST00000379758.2_Intron|MIR486_ENST00000408108.1_RNA|ANK1_ENST00000457297.1_Intron|ANK1_ENST00000352337.4_Intron|ANK1_ENST00000289734.7_Missense_Mutation_p.D1841N|RP11-930P14.1_ENST00000522388.1_RNA	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1841	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGGGCGGCATCGGCGCTGGAC	0.572													ENSG00000029534																																					0								C	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,	0,4406		0,0,2203	50.0	54.0	53.0		5521,346,5644,5521,5521,5035,346,	2.6	0.0	8	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense,intron	ANK1	NM_000037.3,NM_001142445.1,NM_001142446.1,NM_020475.2,NM_020476.2,NM_020477.2,NM_020478.4,NM_020480.4	23,23,23,23,23,23,23,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,	1841/1881,116/157,1882/1898,1841/1857,1841/1882,1679/1720,116/156,	41519417	1,13005	2203	4300	6503	SO:0001583	missense	0			-	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5521G>A	8.37:g.41519417C>T	ENSP00000339620:p.Asp1841Asn		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.D1841N	ENST00000347528.4	37	c.5521	CCDS6119.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.964|2.964	-0.213985|-0.213985	0.06101|0.06101	0.0|0.0	1.16E-4|1.16E-4	ENSG00000029534|ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000396942;ENST00000522231;ENST00000522543;ENST00000314214;ENST00000265709|ENST00000520299	T;T;T;D;D;D;T|.	0.88201|.	-0.26;-0.29;-0.25;-1.82;-2.24;-2.35;-0.2|.	5.42|5.42	2.57|2.57	0.30868|0.30868	.|.	1.133750|.	0.06697|.	N|.	0.770743|.	T|T	0.32763|0.32763	0.0840|0.0840	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	D;P;B;B;B;B;B;P;P|.	0.54397|.	0.966;0.549;0.0;0.079;0.324;0.201;0.003;0.893;0.928|.	P;B;B;B;B;B;B;B;P|.	0.47603|.	0.481;0.073;0.001;0.015;0.038;0.057;0.001;0.386;0.551|.	T|T	0.20940|0.20940	-1.0260|-1.0260	10|5	0.17832|.	T|.	0.49|.	.|.	8.6354|8.6354	0.33945|0.33945	0.0:0.6801:0.0:0.3199|0.0:0.6801:0.0:0.3199	.|.	116;1882;1679;1841;1841;1841;995;116;116|.	Q6PK32;P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39;Q53ER1;E5RFL7|.	.;.;.;ANK1_HUMAN;.;.;.;.;.|.	N|Q	1841;1841;1841;116;116;116;1882|1000	ENSP00000339620:D1841N;ENSP00000289734:D1841N;ENSP00000380147:D1841N;ENSP00000428750:D116N;ENSP00000430368:D116N;ENSP00000319123:D116N;ENSP00000265709:D1882N|.	ENSP00000265709:D1882N|.	D|R	-|-	1|2	0|0	ANK1|ANK1	41638574|41638574	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.002000|0.002000	0.02628|0.02628	1.702000|1.702000	0.37836|0.37836	0.754000|0.754000	0.32968|0.32968	0.561000|0.561000	0.74099|0.74099	GAT|CGA	rs143987736	ANK1	-	NULL		0.572	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	0	0	0	49	49	88	0.00	0.00	C	NM_020475		41519417	-1	10	7	61	65	tier1	no_errors	ENST00000396942	ensembl	human	known	74_37	missense	14.08	9.72	SNP	0.000	T	10	61
SEC22B	9554	genome.wustl.edu	37	1	145112520	145112520	+	RNA	SNP	G	G	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:145112520G>C	ENST00000453618.1	+	0	820							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											GCACTCTCAGGTATCTAAAAG	0.403													ENSG00000223380																																					0													153.0	144.0	147.0					1																	145112520		2095	4238	6333			0			-	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145112520G>C			A8K1G0	Splice_Site	SNP	-	NULL	ENST00000453618.1	37	c.NULL		1																																																																																			-	SEC22B	-	-		0.403	SEC22B-001	KNOWN	basic	processed_transcript	SEC22B	HGNC	processed_transcript	OTTHUMT00000038523.5	0	0	0	176	176	284	0.00	0.00	G	NM_004892		145112520	+1	19	25	175	294	tier1	no_errors	ENST00000453618	ensembl	human	known	74_37	splice_site	9.79	7.79	SNP	1.000	C	19	175
CCR3	1232	genome.wustl.edu	37	3	46306890	46306890	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:46306890C>T	ENST00000357422.2	+	4	784	c.241C>T	c.(241-243)Ctg>Ttg	p.L81L	CCR3_ENST00000395942.2_Silent_p.L81L|CCR3_ENST00000545097.1_Silent_p.L102L|CCR3_ENST00000541018.1_Silent_p.L81L|CCR3_ENST00000395940.2_Silent_p.L81L			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	81				LL -> QG (in Ref. 7; AAL85630). {ECO:0000305}.	adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		CATTTCGGACCTGCTCTTCCT	0.507													ENSG00000183625																																					0													187.0	161.0	170.0					3																	46306890		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.241C>T	3.37:g.46306890C>T			B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR3,prints_Chemokine_CCR1	p.L102	ENST00000357422.2	37	c.304	CCDS2738.1	3																																																																																			-	CCR3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.507	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR3	HGNC	protein_coding	OTTHUMT00000257380.2	0	0	0	21	21	120	0.00	0.00	C			46306890	+1	3	5	15	115	tier1	no_errors	ENST00000545097	ensembl	human	known	74_37	silent	16.67	4.17	SNP	0.999	T	3	15
MYOM3	127294	genome.wustl.edu	37	1	24400760	24400760	+	Splice_Site	SNP	C	C	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:24400760C>G	ENST00000374434.3	-	23	3021		c.e23-1		RP11-293P20.4_ENST00000429191.1_RNA|RP11-293P20.2_ENST00000439239.2_RNA|MYOM3_ENST00000329601.7_Splice_Site|MYOM3_ENST00000330966.7_Splice_Site	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3							M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GACCTTGGACCTGGCAGAGAG	0.582													ENSG00000142661																																					0													60.0	62.0	62.0					1																	24400760		1989	4151	6140	SO:0001630	splice_region_variant	0			-	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.2859-1G>C	1.37:g.24400760C>G			A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Splice_Site	SNP	-	e22-1	ENST00000374434.3	37	c.2862-1	CCDS41281.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223985	0.79576	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.259	0.90028	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYOM3	24273347	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.120000	0.71596	2.736000	0.93811	0.655000	0.94253	.	-	MYOM3	-	-		0.582	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYOM3	HGNC	protein_coding	OTTHUMT00000008272.2	0	0	0	51	51	91	0.00	0.00	C	NM_152372	Intron	24400760	-1	7	4	32	77	tier1	no_errors	ENST00000330966	ensembl	human	known	74_37	splice_site	17.95	4.94	SNP	1.000	G	7	32
KMT2C	58508	genome.wustl.edu	37	7	151874147	151874148	+	Frame_Shift_Ins	INS	-	-	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr7:151874147_151874148insT	ENST00000262189.6	-	38	8608_8609	c.8390_8391insA	c.(8389-8391)aagfs	p.K2797fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.K2797fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2797				K -> R (in Ref. 1; AAK00583). {ECO:0000305}.	histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.K2797fs*26(20)									TTTCTTGTTCCTTTTTTTTTGG	0.347													ENSG00000055609																																					20	Deletion - Frameshift(20)	large_intestine(18)|liver(2)																																								SO:0001589	frameshift_variant	0				AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8391dupA	7.37:g.151874156_151874156dupT	ENSP00000262189:p.Lys2797fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E2798fs	ENST00000262189.6	37	c.8391_8390	CCDS5931.1	7																																																																																				KMT2C	-	NULL		0.347	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	0	0	0	35	35	95	0.00	0.00	-			151874148	-1	4	4	29	101	tier1	no_errors	ENST00000355193	ensembl	human	known	74_37	frame_shift_ins	12.12	3.81	INS	0.017:0.019	T	4	29
MYH7B	57644	genome.wustl.edu	37	20	33583296	33583296	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:33583296A>G	ENST00000262873.7	+	26	3076	c.2984A>G	c.(2983-2985)gAg>gGg	p.E995G		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	953						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CTGGAGGACGAGTGCACGGAG	0.617													ENSG00000078814																																					0													64.0	57.0	59.0					20																	33583296		2203	4300	6503	SO:0001583	missense	0			-	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.2984A>G	20.37:g.33583296A>G	ENSP00000262873:p.Glu995Gly		Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tR-bd_arm,superfamily_t-SRE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E995G	ENST00000262873.7	37	c.2984	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	A	29.4	5.006340	0.93287	.	.	ENSG00000078814	ENST00000262873	D	0.87029	-2.2	5.35	5.35	0.76521	.	0.000000	0.36338	N	0.002653	D	0.95890	0.8662	H	0.97564	4.03	0.58432	D	0.999999	D	0.76494	0.999	D	0.80764	0.994	D	0.97420	1.0008	10	0.87932	D	0	.	15.545	0.76090	1.0:0.0:0.0:0.0	.	953	A7E2Y1	MYH7B_HUMAN	G	995	ENSP00000262873:E995G	ENSP00000262873:E995G	E	+	2	0	MYH7B	33046957	1.000000	0.71417	0.993000	0.49108	0.865000	0.49528	9.135000	0.94478	2.266000	0.75297	0.529000	0.55759	GAG	-	MYH7B	-	superfamily_tR-bd_arm		0.617	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	0	0	0	48	48	9	0.00	0.00	A	NM_020884		33583296	+1	4	0	40	6	tier1	no_errors	ENST00000262873	ensembl	human	novel	74_37	missense	9.09	0.00	SNP	1.000	G	4	40
AKR7A2	8574	genome.wustl.edu	37	1	19638441	19638441	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:19638441C>A	ENST00000235835.3	-	1	199	c.178G>T	c.(178-180)Gtg>Ttg	p.V60L	PQLC2_ENST00000375155.3_5'Flank|PQLC2_ENST00000400548.2_5'Flank|PQLC2_ENST00000375153.3_5'Flank	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	60					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AAGGCGCGCACGGCCGCGGCG	0.746													ENSG00000053371																																					0													6.0	8.0	7.0					1																	19638441		2137	4202	6339	SO:0001583	missense	0			-	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.178G>T	1.37:g.19638441C>A	ENSP00000235835:p.Val60Leu		O75749|Q5TG63	Missense_Mutation	SNP	pfam_DP_OxRdtase_dom,superfamily_DP_OxRdtase_dom	p.V60L	ENST00000235835.3	37	c.178	CCDS194.1	1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135666	0.37728	.	.	ENSG00000053371	ENST00000235835;ENST00000330072	T;T	0.18338	2.22;2.22	4.38	4.38	0.52667	NADP-dependent oxidoreductase domain (3);	0.070993	0.56097	D	0.000034	T	0.07999	0.0200	N	0.11427	0.14	0.45607	D	0.99854	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.15052	0.009;0.009;0.012	T	0.10382	-1.0632	10	0.02654	T	1	.	12.6797	0.56914	0.0:0.8327:0.1673:0.0	.	31;31;60	C9JSL3;B4DZX4;O43488	.;.;ARK72_HUMAN	L	60;50	ENSP00000235835:V60L;ENSP00000339084:V50L	ENSP00000235835:V60L	V	-	1	0	AKR7A2	19511028	1.000000	0.71417	0.943000	0.38184	0.369000	0.29798	2.718000	0.47236	2.165000	0.68154	0.305000	0.20034	GTG	-	AKR7A2	-	pfam_DP_OxRdtase_dom,superfamily_DP_OxRdtase_dom		0.746	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR7A2	HGNC	protein_coding	OTTHUMT00000007165.2	0	0	0	12	12	0	0.00	0.00	C	NM_003689		19638441	-1	4	0	9	2	tier1	no_errors	ENST00000235835	ensembl	human	known	74_37	missense	30.77	0.00	SNP	0.994	A	4	9
DNM1P46	196968	genome.wustl.edu	37	15	100340186	100340186	+	RNA	SNP	C	C	A	rs200975818	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:100340186C>A	ENST00000341853.1	-	0	740					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										CTCGTTCCCACGCGAGTCTCG	0.627													ENSG00000182397																																					0													16.0	17.0	17.0					15																	100340186		1378	3412	4790			0			-	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340186C>A			Q3ZCN3	R	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			rs200975818	DNM1P46	-	-		0.627	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	0	0	0	29	29	0	0.00	0.00	C	NR_003260		100340186	-1	5	0	18	0	tier1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	21.74	0.00	SNP	0.981	A	5	18
NRXN1	9378	genome.wustl.edu	37	2	50923314	50923319	+	Intron	DEL	GTGTGT	GTGTGT	-	rs202071380|rs201534178|rs200473527		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	GTGTGT	GTGTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:50923314_50923319delGTGTGT	ENST00000406316.2	-	6	2309				AC009234.2_ENST00000401372.1_RNA|NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000401669.2_Intron|NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000404971.1_Intron|NRXN1_ENST00000405472.3_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			Gtacatatacgtgtgtgtgtgtgtgt	0.437													ENSG00000216191																																					0																																										SO:0001627	intron_variant	0				AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.833-72561ACACAC>-	2.37:g.50923320_50923325delGTGTGT			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	R	DEL	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																				AC009234.2	-	-		0.437	NRXN1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000216191	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000325291.2	0	0	0	0	0	0	0.00	0.00	GTGTGT			50923319	-1	0	0	0	0	tier1	no_errors	ENST00000401372	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.006:0.004:0.003:0.002:0.002:0.000	-	0	0
TAOK3	51347	genome.wustl.edu	37	12	118604619	118604619	+	Intron	SNP	G	G	A	rs370989080|rs535817182		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:118604619G>A	ENST00000392533.3	-	18	2390				AC026366.1_ENST00000408353.1_RNA|TAOK3_ENST00000419821.2_Intron|TAOK3_ENST00000537952.1_Intron	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGTGTGTGTGTATATATATA	0.378													ENSG00000221280																																					0																																										SO:0001627	intron_variant	0			-	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4787C>T	12.37:g.118604619G>A			Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	R	SNP	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																			-	AC026366.1	-	-		0.378	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000401456.2	0	0	0	29	29	0	0.00	0.00	G	NM_016281		118604619	+1	5	0	22	0	tier1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	18.52	0.00	SNP	0.000	A	5	22
RP11-420N3.2	0	genome.wustl.edu	37	16	5290016	5290016	+	RNA	SNP	C	C	G	rs4047657		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr16:5290016C>G	ENST00000569895.1	+	0	214																											AGGGGGGAAGCGCACAGCCCG	0.721													ENSG00000260411																																					0																																												0			-																													16.37:g.5290016C>G				R	SNP	-	NULL	ENST00000569895.1	37	NULL		16																																																																																			-	RP11-420N3.2	-	-		0.721	RP11-420N3.2-001	KNOWN	basic	processed_transcript	ENSG00000260411	Clone_based_vega_gene	processed_transcript	OTTHUMT00000435404.2	0	0	0	21	21	0	0.00	0.00	C			5290016	+1	7	0	19	0	tier1	no_errors	ENST00000569895	ensembl	human	known	74_37	rna	26.92	0.00	SNP	0.007	G	7	19
FER1L4	80307	genome.wustl.edu	37	20	34171885	34171885	+	RNA	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:34171885A>G	ENST00000430275.2	-	0	2923							A9Z1Z3	FR1L4_HUMAN	fer-1-like family member 4, pseudogene (functional)							integral component of membrane (GO:0016021)											GCTGGAGGGCAGCCCGGCTGA	0.682													ENSG00000088340																																					0																																												0			-	AL121586		20q11.23	2014-09-11	2014-06-27		ENSG00000088340	ENSG00000088340		"""-"""	15801	pseudogene	pseudogene			"""fer-1-like 4 (C. elegans)"", ""fer-1-like 4 (C. elegans), pseudogene (functional)"""	C20orf124		24063685, 24961353	Standard	XR_425236		Approved	bA563A22B.1, dJ309K20.1	uc002xcx.3	A9Z1Z3	OTTHUMG00000032354		20.37:g.34171885A>G			Q9GZQ9|Q9H646|Q9H8L7	R	SNP	-	NULL	ENST00000430275.2	37	NULL		20																																																																																			-	FER1L4	-	-		0.682	FER1L4-016	KNOWN	basic	processed_transcript	FER1L4	HGNC	pseudogene	OTTHUMT00000443297.1	0	0	0	47	47	4	0.00	0.00	A	NR_024377		34171885	-1	7	1	34	7	tier1	no_errors	ENST00000430275	ensembl	human	known	74_37	rna	17.07	12.50	SNP	0.482	G	7	34
KRTAP10-9	386676	genome.wustl.edu	37	21	46048138	46048138	+	3'UTR	SNP	C	C	G	rs112351109		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr21:46048138C>G	ENST00000397911.3	+	0	1099				KRTAP10-9_ENST00000484861.1_3'UTR|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						ACCTCCCCCCCGGGCAGGCGA	0.697													ENSG00000221837																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*171C>G	21.37:g.46048138C>G			A2RRG1|A6NIR9|Q70LJ1	R	SNP	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																			rs112351109	KRTAP10-9	-	-		0.697	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	0	0	0	55	55	1	0.00	0.00	C			46048138	+1	5	0	28	4	tier1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	15.15	0.00	SNP	0.000	G	5	28
KRTAP4-7	100132476	genome.wustl.edu	37	17	39240828	39240828	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:39240828G>A	ENST00000391417.4	+	1	370	c.370G>A	c.(370-372)Gtc>Atc	p.V124I		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	179	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cCTGCGTCCAGTCTGTGGCCG	0.657													ENSG00000240871																																					0													36.0	36.0	36.0					17																	39240828		692	1591	2283	SO:0001583	missense	0			-	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.370G>A	17.37:g.39240828G>A	ENSP00000375236:p.Val124Ile		A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	pfam_Keratin-assoc	p.V124I	ENST00000391417.4	37	c.370	CCDS45673.1	17	.	.	.	.	.	.	.	.	.	.	.	13.10	2.136137	0.37728	.	.	ENSG00000240871	ENST00000391417	T	0.00605	6.27	3.17	2.15	0.27550	.	.	.	.	.	T	0.00637	0.0021	.	.	.	0.25808	N	0.98443	P	0.38280	0.625	B	0.38156	0.266	T	0.51309	-0.8722	8	0.72032	D	0.01	.	7.4682	0.27334	0.0:0.0:0.7416:0.2584	.	179	Q9BYR0	KRA47_HUMAN	I	124	ENSP00000375236:V124I	ENSP00000375236:V124I	V	+	1	0	KRTAP4-7	36494354	0.141000	0.22595	0.919000	0.36401	0.874000	0.50279	-0.503000	0.06383	0.610000	0.30035	0.305000	0.20034	GTC	-	KRTAP4-7	-	NULL		0.657	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-7	HGNC	protein_coding	OTTHUMT00000257686.1	0	0	0	104	104	3	0.00	0.00	G			39240828	+1	37	0	28	3	tier1	no_errors	ENST00000391417	ensembl	human	known	74_37	missense	56.06	0.00	SNP	0.993	A	37	28
RPS26	6231	genome.wustl.edu	37	12	56436288	56436288	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:56436288G>T	ENST00000356464.5	+	2	397	c.83G>T	c.(82-84)cGa>cTa	p.R28L	RPS26_ENST00000552361.1_Missense_Mutation_p.R28L|RP11-603J24.4_ENST00000551846.1_RNA			P62854	RS26_HUMAN	ribosomal protein S26	28					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|small ribosomal subunit (GO:0015935)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	7			OV - Ovarian serous cystadenocarcinoma(18;0.123)			AACTGTGCCCGATGCGTGCCC	0.527													ENSG00000197728																																					0													40.0	41.0	41.0					12																	56436288		2202	4274	6476	SO:0001583	missense	0			-	AB007160	CCDS31832.1	12q13	2011-04-06				ENSG00000197728		"""S ribosomal proteins"""	10414	protein-coding gene	gene with protein product	"""40S ribosomal protein S26"""	603701				9582194, 8670309	Standard	NM_001029		Approved	S26	uc001sjf.3	P62854	OTTHUMG00000170139	ENST00000356464.5:c.83G>T	12.37:g.56436288G>T	ENSP00000348849:p.Arg28Leu		P02383|P70394|Q06722|Q3MHD8|Q6IRY4	Missense_Mutation	SNP	pfam_Ribosomal_S26e	p.R28L	ENST00000356464.5	37	c.83	CCDS31832.1	12	.	.	.	.	.	.	.	.	.	.	G	19.91	3.913742	0.72983	.	.	ENSG00000197728	ENST00000356464;ENST00000552361	D;D	0.92099	-2.97;-2.97	4.43	3.51	0.40186	.	0.000000	0.64402	U	0.000002	D	0.93943	0.8061	M	0.91459	3.21	0.58432	D	0.999999	B	0.29805	0.257	B	0.37304	0.246	D	0.93559	0.6893	10	0.59425	D	0.04	.	12.7216	0.57146	0.0:0.0:0.8336:0.1664	.	28	P62854	RS26_HUMAN	L	28	ENSP00000348849:R28L;ENSP00000450339:R28L	ENSP00000348849:R28L	R	+	2	0	RPS26	54722555	1.000000	0.71417	0.969000	0.41365	0.875000	0.50365	9.235000	0.95353	1.156000	0.42514	0.563000	0.77884	CGA	-	RPS26	-	pfam_Ribosomal_S26e		0.527	RPS26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS26	HGNC	protein_coding	OTTHUMT00000407616.1	0	0	0	70	70	0	0.00	0.00	G	NM_001029		56436288	+1	11	0	74	0	tier1	no_errors	ENST00000356464	ensembl	human	known	74_37	missense	12.79	0.00	SNP	1.000	T	11	74
RASA3	22821	genome.wustl.edu	37	13	114762103	114762103	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr13:114762103C>T	ENST00000334062.7	-	21	2166	c.2045G>A	c.(2044-2046)cGc>cAc	p.R682H	RASA3_ENST00000389544.4_Missense_Mutation_p.R650H	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	682					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			GACGGTGAGGCGCTTCTGGTT	0.637													ENSG00000185989																																					0													169.0	125.0	140.0					13																	114762103		2203	4300	6503	SO:0001583	missense	0			-		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.2045G>A	13.37:g.114762103C>T	ENSP00000335029:p.Arg682His		A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_dom,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_C2_dom,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.R682H	ENST00000334062.7	37	c.2045	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669587	0.67814	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	D;D	0.93763	-3.28;-3.28	5.37	5.37	0.77165	Pleckstrin homology-type (1);Zinc finger, Btk motif (3);	0.000000	0.85682	D	0.000000	D	0.97068	0.9042	M	0.85710	2.77	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97125	0.9814	9	.	.	.	.	19.0948	0.93246	0.0:1.0:0.0:0.0	.	682	Q14644	RASA3_HUMAN	H	682;650	ENSP00000335029:R682H;ENSP00000374195:R650H	.	R	-	2	0	RASA3	113780205	1.000000	0.71417	0.041000	0.18516	0.045000	0.14185	5.426000	0.66476	2.499000	0.84300	0.561000	0.74099	CGC	-	RASA3	-	smart_Znf_Btk_motif,pfscan_Znf_Btk_motif,prints_Znf_Btk_motif		0.637	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	0	0	0	44	44	74	0.00	0.00	C	NM_007368		114762103	-1	11	3	38	51	tier1	no_errors	ENST00000334062	ensembl	human	known	74_37	missense	22.45	5.56	SNP	1.000	T	11	38
SYNDIG1L	646658	genome.wustl.edu	37	14	74876371	74876371	+	Missense_Mutation	SNP	G	G	A	rs367970781		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr14:74876371G>A	ENST00000554823.1	-	1	138	c.77C>T	c.(76-78)cCg>cTg	p.P26L	SYNDIG1L_ENST00000331628.3_Missense_Mutation_p.P26L			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	26					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						TGGGGTCTCCGGGTAGGGATA	0.657													ENSG00000183379																																					0								G	LEU/PRO	0,3876		0,0,1938	37.0	42.0	40.0		77	2.4	0.5	14		40	1,8275		0,1,4137	no	missense	SYNDIG1L	NM_001105579.1	98	0,1,6075	AA,AG,GG		0.0121,0.0,0.0082	benign	26/239	74876371	1,12151	1938	4138	6076	SO:0001583	missense	0			-		CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.77C>T	14.37:g.74876371G>A	ENSP00000450439:p.Pro26Leu			Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.P26L	ENST00000554823.1	37	c.77	CCDS41970.1	14	.	.	.	.	.	.	.	.	.	.	G	1.701	-0.501463	0.04261	0.0	1.21E-4	ENSG00000183379	ENST00000331628;ENST00000554823;ENST00000554953	D;D	0.95001	-3.58;-3.58	4.44	2.42	0.29668	.	0.438428	0.23197	N	0.050839	D	0.84138	0.5406	N	0.22421	0.69	0.18873	N	0.999983	P	0.38745	0.645	B	0.22880	0.042	T	0.75722	-0.3218	10	0.28530	T	0.3	-12.0407	6.6672	0.23047	0.0:0.2835:0.4563:0.2603	.	26	A6NDD5	SYN1L_HUMAN	L	26	ENSP00000331474:P26L;ENSP00000450439:P26L	ENSP00000331474:P26L	P	-	2	0	SYNDIG1L	73946124	0.489000	0.26004	0.456000	0.27044	0.001000	0.01503	0.788000	0.26872	1.082000	0.41137	-0.463000	0.05309	CCG	-	SYNDIG1L	-	NULL		0.657	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYNDIG1L	HGNC	protein_coding	OTTHUMT00000412341.1	0	0	0	36	36	40	0.00	0.00	G	XM_938515		74876371	-1	11	3	54	50	tier1	no_errors	ENST00000331628	ensembl	human	known	74_37	missense	16.92	5.56	SNP	0.047	A	11	54
SLC6A19	340024	genome.wustl.edu	37	5	1217031	1217031	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:1217031A>G	ENST00000304460.10	+	8	1200	c.1144A>G	c.(1144-1146)Acc>Gcc	p.T382A		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	382					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGTGTTCCAGACCTGCGACAT	0.647													ENSG00000174358																																					0													135.0	129.0	131.0					5																	1217031		2203	4300	6503	SO:0001583	missense	0			-	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1144A>G	5.37:g.1217031A>G	ENSP00000305302:p.Thr382Ala		A8K446	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.T382A	ENST00000304460.10	37	c.1144	CCDS34130.1	5	.	.	.	.	.	.	.	.	.	.	A	11.73	1.724646	0.30593	.	.	ENSG00000174358	ENST00000304460	T	0.73152	-0.72	4.85	4.85	0.62838	.	0.578057	0.19119	N	0.122232	T	0.63271	0.2497	L	0.48877	1.53	0.41849	D	0.990161	B	0.16166	0.016	B	0.25405	0.06	T	0.57441	-0.7811	10	0.14656	T	0.56	.	12.982	0.58570	1.0:0.0:0.0:0.0	.	382	Q695T7	S6A19_HUMAN	A	382	ENSP00000305302:T382A	ENSP00000305302:T382A	T	+	1	0	SLC6A19	1270031	0.977000	0.34250	1.000000	0.80357	0.687000	0.40016	1.493000	0.35605	1.817000	0.53016	0.402000	0.26972	ACC	-	SLC6A19	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.647	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1	0	0	0	37	37	25	0.00	0.00	A	XM_291120		1217031	+1	4	2	43	33	tier1	no_errors	ENST00000304460	ensembl	human	known	74_37	missense	8.51	5.71	SNP	1.000	G	4	43
