#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
OR7D4	125958	genome.wustl.edu	37	19	9325401	9325401	+	Missense_Mutation	SNP	G	G	A	rs148654687	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:9325401G>A	ENST00000308682.2	-	1	141	c.113C>T	c.(112-114)aCg>aTg	p.T38M		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						CCCCAGCACCGTGACCAGGTA	0.522													ENSG00000174667	G|||	2	0.000399361	0.0008	0.0	5008	,	,		18844	0.001		0.0	False		,,,				2504	0.0																0								G	MET/THR	5,4401	9.9+/-24.2	0,5,2198	76.0	73.0	74.0		113	2.8	0.6	19	dbSNP_134	74	0,8600		0,0,4300	no	missense	OR7D4	NM_001005191.2	81	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	probably-damaging	38/313	9325401	5,13001	2203	4300	6503	SO:0001583	missense	0			-		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.113C>T	19.37:g.9325401G>A	ENSP00000310488:p.Thr38Met		A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T38M	ENST00000308682.2	37	c.113	CCDS32901.1	19	.	.	.	.	.	.	.	.	.	.	G	8.540	0.873143	0.17322	0.001135	0.0	ENSG00000174667	ENST00000308682	T	0.00504	6.94	3.92	2.84	0.33178	.	0.330554	0.26355	N	0.024852	T	0.00998	0.0033	H	0.96604	3.85	0.25703	N	0.985567	P	0.51653	0.947	B	0.39531	0.302	T	0.42361	-0.9456	10	0.87932	D	0	.	6.7623	0.23548	0.1002:0.1818:0.718:0.0	.	38	Q8NG98	OR7D4_HUMAN	M	38	ENSP00000310488:T38M	ENSP00000310488:T38M	T	-	2	0	OR7D4	9186401	0.004000	0.15560	0.577000	0.28562	0.010000	0.07245	1.564000	0.36375	0.979000	0.38497	0.436000	0.28706	ACG	rs148654687	OR7D4	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn		0.522	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	HGNC	protein_coding	OTTHUMT00000449004.1	0	0	0	80	80	18	0.00	0.00	G			9325401	-1	24	3	122	17	tier1	no_errors	ENST00000308682	ensembl	human	known	74_37	missense	16.44	15.00	SNP	0.586	A	24	122
VWF	7450	genome.wustl.edu	37	12	6143932	6143932	+	Silent	SNP	C	C	T			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr12:6143932C>T	ENST00000261405.5	-	20	2861	c.2607G>A	c.(2605-2607)acG>acA	p.T869T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	869	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CCATGCCGATCGTGGAGCACG	0.582													ENSG00000110799																																					0													186.0	147.0	160.0					12																	6143932		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2607G>A	12.37:g.6143932C>T			Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T869	ENST00000261405.5	37	c.2607	CCDS8539.1	12																																																																																			-	VWF	-	pirsf_VWF,pfam_VWF_type-D,smart_VWC_out,smart_VWF_C,smart_VWF_type-D		0.582	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	0	0	0	115	115	129	0.00	0.00	C	NM_000552		6143932	-1	45	31	171	98	tier1	no_errors	ENST00000261405	ensembl	human	known	74_37	silent	20.83	24.03	SNP	0.000	T	45	171
HAUS3	79441	genome.wustl.edu	37	4	2241964	2241964	+	Missense_Mutation	SNP	T	T	C	rs368361238	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr4:2241964T>C	ENST00000243706.4	-	2	939	c.710A>G	c.(709-711)aAt>aGt	p.N237S	POLN_ENST00000511885.2_Intron|HAUS3_ENST00000443786.2_Missense_Mutation_p.N237S|HAUS3_ENST00000506763.1_Missense_Mutation_p.N237S|POLN_ENST00000515357.1_Intron	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	237					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AAGTTGAAAATTGTCTTCATT	0.368													ENSG00000214367	T|||	2	0.000399361	0.0015	0.0	5008	,	,		21564	0.0		0.0	False		,,,				2504	0.0																0								T	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	61.0	60.0	60.0		710	5.3	1.0	4		60	0,8596		0,0,4298	no	missense	HAUS3	NM_024511.5	46	0,1,6500	CC,CT,TT		0.0,0.0227,0.0077	benign	237/604	2241964	1,13001	2203	4298	6501	SO:0001583	missense	0			-	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.710A>G	4.37:g.2241964T>C	ENSP00000243706:p.Asn237Ser		B4DF64|O43606|Q8TAZ5|Q9BTJ9	Missense_Mutation	SNP	NULL	p.N237S	ENST00000243706.4	37	c.710	CCDS33941.1	4	.	.	.	.	.	.	.	.	.	.	T	12.54	1.969210	0.34754	2.27E-4	0.0	ENSG00000214367	ENST00000506763;ENST00000243706;ENST00000443786	T;T	0.39406	1.08;1.08	5.29	5.29	0.74685	.	0.203710	0.42964	U	0.000632	T	0.35970	0.0950	M	0.72118	2.19	0.29586	N	0.848777	P;P	0.35011	0.48;0.48	B;B	0.31495	0.131;0.131	T	0.36163	-0.9759	10	0.07175	T	0.84	-42.4448	10.7332	0.46109	0.0:0.0774:0.0:0.9226	.	237;237	B4DF64;Q68CZ6	.;HAUS3_HUMAN	S	237	ENSP00000243706:N237S;ENSP00000392903:N237S	ENSP00000243706:N237S	N	-	2	0	HAUS3	2211762	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	1.611000	0.36879	2.111000	0.64477	0.533000	0.62120	AAT	-	HAUS3	-	NULL		0.368	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS3	HGNC	protein_coding	OTTHUMT00000357446.1	0	0	0	84	84	78	0.00	0.00	T	NM_024511		2241964	-1	24	26	123	95	tier1	no_errors	ENST00000243706	ensembl	human	known	74_37	missense	16.33	21.49	SNP	1.000	C	24	123
IL1A	3552	genome.wustl.edu	37	2	113535602	113535602	+	Missense_Mutation	SNP	C	C	A	rs547288438	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr2:113535602C>A	ENST00000263339.3	-	6	732	c.577G>T	c.(577-579)Gtg>Ttg	p.V193L		NM_000575.3	NP_000566.3	P01583	IL1A_HUMAN	interleukin 1, alpha	193					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|cytokine-mediated signaling pathway (GO:0019221)|ectopic germ cell programmed cell death (GO:0035234)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fever generation (GO:0001660)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|response to copper ion (GO:0046688)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	copper ion binding (GO:0005507)|cytokine activity (GO:0005125)			breast(2)|large_intestine(1)|lung(9)	12					Rilonacept(DB06372)	TGGGCAGTCACATACAATTGA	0.388													ENSG00000115008																																					0													192.0	174.0	180.0					2																	113535602		2203	4300	6503	SO:0001583	missense	0			-	M28983	CCDS2101.1	2q14	2014-01-30			ENSG00000115008	ENSG00000115008		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5991	protein-coding gene	gene with protein product	"""preinterleukin 1 alpha"", ""hematopoietin-1"", ""pro-interleukin-1-alpha"""	147760		IL1		8188271, 2989698	Standard	NM_000575		Approved	IL1F1, IL-1A, IL1-ALPHA	uc002tig.3	P01583	OTTHUMG00000131315	ENST00000263339.3:c.577G>T	2.37:g.113535602C>A	ENSP00000263339:p.Val193Leu		Q53QF9|Q7RU02	Missense_Mutation	SNP	pfam_IL-1_propep,pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1_alpha,prints_IL-1_alpha/beta,prints_IL-1	p.V193L	ENST00000263339.3	37	c.577	CCDS2101.1	2	.	.	.	.	.	.	.	.	.	.	C	15.04	2.715957	0.48622	.	.	ENSG00000115008	ENST00000263339	T	0.09073	3.02	5.48	2.52	0.30459	.	0.132879	0.34460	N	0.003945	T	0.06142	0.0159	L	0.41079	1.255	0.09310	N	1	B	0.23058	0.079	B	0.28991	0.097	T	0.42783	-0.9431	10	0.02654	T	1	-17.9785	7.9375	0.29939	0.3259:0.5164:0.1577:0.0	.	193	P01583	IL1A_HUMAN	L	193	ENSP00000263339:V193L	ENSP00000263339:V193L	V	-	1	0	IL1A	113252073	0.731000	0.28111	0.220000	0.23810	0.514000	0.34195	0.352000	0.20113	0.781000	0.33589	0.655000	0.94253	GTG	-	IL1A	-	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1_alpha,prints_IL-1_alpha/beta,prints_IL-1		0.388	IL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1A	HGNC	protein_coding	OTTHUMT00000254084.1	0	0	0	52	52	81	0.00	0.00	C	NM_000575		113535602	-1	12	12	96	73	tier1	no_errors	ENST00000263339	ensembl	human	known	74_37	missense	11.11	14.12	SNP	0.048	A	12	96
PLPPR3	79948	genome.wustl.edu	37	19	814640	814640	+	Intron	SNP	C	C	G			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:814640C>G	ENST00000520876.3	-	7	736				LPPR3_ENST00000359894.2_Missense_Mutation_p.E237Q|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN								integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										AGGGAGGGCTCCCCACGGGTC	0.652													ENSG00000129951																																					0													52.0	54.0	53.0					19																	814640		2196	4299	6495	SO:0001627	intron_variant	0			-																												ENST00000520876.3:c.658-33G>C	19.37:g.814640C>G			Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.E237Q	ENST00000520876.3	37	c.709	CCDS58636.1	19	.	.	.	.	.	.	.	.	.	.	C	7.593	0.671074	0.14776	.	.	ENSG00000129951	ENST00000359894	T	0.22539	1.95	2.58	0.142	0.14816	.	15.374300	0.00424	U	0.000075	T	0.12050	0.0293	.	.	.	0.09310	N	0.999998	B	0.11235	0.004	B	0.06405	0.002	T	0.16778	-1.0391	8	.	.	.	.	3.5333	0.07785	0.0:0.5025:0.2083:0.2891	.	237	Q6T4P5-3	.	Q	237	ENSP00000352962:E237Q	.	E	-	1	0	AC006273.1	765640	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-3.086000	0.00611	0.057000	0.16193	0.305000	0.20034	GAG	-	LPPR3	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase		0.652	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR3	Uniprot_gn	protein_coding	OTTHUMT00000379096.3	0	0	0	77	77	33	0.00	0.00	C			814640	-1	26	5	138	16	tier1	no_errors	ENST00000359894	ensembl	human	known	74_37	missense	15.76	23.81	SNP	0.000	G	26	138
ABAT	18	genome.wustl.edu	37	16	8862051	8862051	+	Splice_Site	SNP	C	C	G			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr16:8862051C>G	ENST00000396600.2	+	10	1543	c.605C>G	c.(604-606)gCc>gGc	p.A202G	ABAT_ENST00000567812.1_Splice_Site_p.A217G|ABAT_ENST00000569156.1_Splice_Site_p.A202G|ABAT_ENST00000425191.2_Splice_Site_p.A202G|ABAT_ENST00000268251.8_Splice_Site_p.A202G	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	202					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	TGGTTTTAGGCCCCTGGCTGC	0.522													ENSG00000183044																																					0													100.0	93.0	95.0					16																	8862051		2197	4300	6497	SO:0001630	splice_region_variant	0			-	L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.604-1C>G	16.37:g.8862051C>G			A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_4NH2But_aminotransferase_euk	p.A202G	ENST00000396600.2	37	c.605	CCDS10534.1	16	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848145	0.32699	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	T;T;T	0.76839	-1.05;-1.05;-1.05	5.61	3.41	0.39046	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.647844	0.17199	N	0.183210	T	0.69842	0.3156	L	0.56124	1.755	0.26815	N	0.968928	B	0.14438	0.01	B	0.20767	0.031	T	0.60682	-0.7215	10	0.41790	T	0.15	-8.754	6.416	0.21717	0.1404:0.6545:0.1278:0.0773	.	202	P80404	GABT_HUMAN	G	202	ENSP00000268251:A202G;ENSP00000379845:A202G;ENSP00000411916:A202G	ENSP00000268251:A202G	A	+	2	0	ABAT	8769552	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	2.235000	0.43044	1.339000	0.45563	0.555000	0.69702	GCC	-	ABAT	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_4NH2But_aminotransferase_euk		0.522	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ABAT	HGNC	protein_coding	OTTHUMT00000433620.2	0	0	0	70	70	61	0.00	0.00	C	NM_020686	Missense_Mutation	8862051	+1	30	13	121	69	tier1	no_errors	ENST00000268251	ensembl	human	known	74_37	missense	19.87	15.85	SNP	0.989	G	30	121
GPT	2875	genome.wustl.edu	37	8	145730424	145730424	+	Silent	SNP	C	C	T			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr8:145730424C>T	ENST00000528431.1	+	5	562	c.405C>T	c.(403-405)gaC>gaT	p.D135D	GPT_ENST00000394955.2_Silent_p.D135D			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	135					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	TCCGGGAGGACGTGGCGCGGT	0.642													ENSG00000167701																																					0													79.0	80.0	80.0					8																	145730424		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	ENST00000528431.1:c.405C>T	8.37:g.145730424C>T			B0YJ18|D3DWM7|P78398|Q93076	Silent	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.D135	ENST00000528431.1	37	c.405	CCDS6430.1	8																																																																																			-	GPT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.642	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT	HGNC	protein_coding	OTTHUMT00000382471.1	0	0	0	63	63	46	0.00	0.00	C			145730424	+1	19	8	81	42	tier1	no_errors	ENST00000394955	ensembl	human	known	74_37	silent	19.00	16.00	SNP	0.985	T	19	81
LARP1	23367	genome.wustl.edu	37	5	154191148	154191148	+	Missense_Mutation	SNP	A	A	T			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr5:154191148A>T	ENST00000336314.4	+	18	2822	c.2798A>T	c.(2797-2799)aAa>aTa	p.K933I		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	1010					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATTGACCCCAAACTGCAAGAA	0.443													ENSG00000155506																																					0													97.0	99.0	99.0					5																	154191148		2203	4300	6503	SO:0001583	missense	0			-	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.2798A>T	5.37:g.154191148A>T	ENSP00000336721:p.Lys933Ile		O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	pfam_Lupus_La_R-bd,smart_Lupus_La_R-bd,smart_DM15,pfscan_Lupus_La_R-bd	p.K933I	ENST00000336314.4	37	c.2798	CCDS4328.1	5	.	.	.	.	.	.	.	.	.	.	A	18.64	3.667303	0.67814	.	.	ENSG00000155506	ENST00000336314	T	0.27890	1.64	5.89	5.89	0.94794	.	0.046337	0.85682	D	0.000000	T	0.40498	0.1119	M	0.85041	2.73	0.58432	D	0.999996	B;B	0.26041	0.086;0.14	B;B	0.27170	0.035;0.077	T	0.41070	-0.9529	10	0.66056	D	0.02	-13.2127	11.4016	0.49873	0.8652:0.0:0.0:0.1348	.	1010;933	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	I	933	ENSP00000336721:K933I	ENSP00000336721:K933I	K	+	2	0	LARP1	154171341	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.264000	0.78432	2.254000	0.74563	0.459000	0.35465	AAA	-	LARP1	-	NULL		0.443	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	0	0	0	26	26	88	0.00	0.00	A	NM_033551		154191148	+1	9	31	29	85	tier1	no_errors	ENST00000336314	ensembl	human	known	74_37	missense	23.68	26.72	SNP	1.000	T	9	29
ZFR2	23217	genome.wustl.edu	37	19	3834851	3834851	+	Missense_Mutation	SNP	G	G	T			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:3834851G>T	ENST00000262961.4	-	2	194	c.184C>A	c.(184-186)Ccc>Acc	p.P62T	ZFR2_ENST00000591965.1_5'UTR	NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	62							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CCGGAGTGGGGCTGGTATCCA	0.657													ENSG00000105278																																					0													20.0	25.0	23.0					19																	3834851		1962	4142	6104	SO:0001583	missense	0			-	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.184C>A	19.37:g.3834851G>T	ENSP00000262961:p.Pro62Thr			Missense_Mutation	SNP	pfam_DZF,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.P62T	ENST00000262961.4	37	c.184	CCDS45921.1	19	.	.	.	.	.	.	.	.	.	.	G	7.981	0.751289	0.15778	.	.	ENSG00000105278	ENST00000262961;ENST00000438164	T;T	0.15139	3.24;2.45	3.39	2.25	0.28309	.	0.774714	0.11008	U	0.609817	T	0.08268	0.0206	L	0.34521	1.04	0.80722	D	1	P	0.39480	0.675	B	0.29176	0.099	T	0.20107	-1.0285	10	0.05351	T	0.99	-7.5765	7.6561	0.28375	0.0:0.2934:0.7066:0.0	.	62	Q9UPR6	ZFR2_HUMAN	T	62	ENSP00000262961:P62T;ENSP00000388974:P62T	ENSP00000262961:P62T	P	-	1	0	ZFR2	3785851	0.103000	0.21917	0.230000	0.23976	0.010000	0.07245	0.257000	0.18369	1.742000	0.51746	0.542000	0.68232	CCC	-	ZFR2	-	NULL		0.657	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	HGNC	protein_coding	OTTHUMT00000453648.2	0	0	0	89	89	25	0.00	0.00	G	NM_015174		3834851	-1	22	6	169	18	tier1	no_errors	ENST00000262961	ensembl	human	known	74_37	missense	11.52	25.00	SNP	0.956	T	22	169
KRTAP12-1	353332	genome.wustl.edu	37	21	46101928	46101928	+	Silent	SNP	G	G	A			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr21:46101928G>A	ENST00000391617.1	-	1	150	c.111C>T	c.(109-111)ccC>ccT	p.P37P	TSPEAR_ENST00000323084.4_Intron	NM_181686.1	NP_859014.1	P59990	KR121_HUMAN	keratin associated protein 12-1	37	14 X 5 AA approximate repeats.					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(1)|skin(2)	5						TGAAGCTCACGGGCACGCACA	0.692													ENSG00000187175																																					0													61.0	71.0	67.0					21																	46101928		2188	4274	6462	SO:0001819	synonymous_variant	0			-	AJ566388	CCDS42966.1	21q22.3	2006-03-13			ENSG00000187175	ENSG00000187175		"""Keratin associated proteins"""	20529	protein-coding gene	gene with protein product							Standard	NM_181686		Approved	KRTAP12.1, KAP12.1	uc002zfv.3	P59990	OTTHUMG00000057639	ENST00000391617.1:c.111C>T	21.37:g.46101928G>A			Q0VAS3	Silent	SNP	NULL	p.P37	ENST00000391617.1	37	c.111	CCDS42966.1	21																																																																																			-	KRTAP12-1	-	NULL		0.692	KRTAP12-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP12-1	HGNC	protein_coding	OTTHUMT00000128043.1	0	0	0	115	115	11	0.00	0.00	G	NM_181686		46101928	-1	33	3	118	10	tier1	no_errors	ENST00000391617	ensembl	human	known	74_37	silent	21.85	23.08	SNP	0.014	A	33	118
OLFM2	93145	genome.wustl.edu	37	19	9965243	9965243	+	Silent	SNP	G	G	A	rs200166801		TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:9965243G>A	ENST00000264833.4	-	6	1169	c.984C>T	c.(982-984)gaC>gaT	p.D328D	OLFM2_ENST00000590841.1_Silent_p.D250D	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	328	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GCCCGCTCTCGTCCACCATGA	0.657													ENSG00000105088																																					0								G		0,4406		0,0,2203	61.0	59.0	60.0		984	2.4	1.0	19		60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OLFM2	NM_058164.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		328/455	9965243	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.984C>T	19.37:g.9965243G>A			Q6IMJ3|Q96FC2	Silent	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like	p.D328	ENST00000264833.4	37	c.984	CCDS12221.1	19																																																																																			rs200166801	OLFM2	-	pfam_Olfac-like,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like		0.657	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM2	HGNC	protein_coding	OTTHUMT00000451119.1	0	0	0	64	64	28	0.00	0.00	G			9965243	-1	21	9	53	24	tier1	no_errors	ENST00000264833	ensembl	human	known	74_37	silent	28.38	27.27	SNP	1.000	A	21	53
SOX10	6663	genome.wustl.edu	37	22	38374051	38374052	+	In_Frame_Ins	INS	-	-	GTACTT			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	-	-	-	GTACTT	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr22:38374051_38374052insGTACTT	ENST00000396884.2	-	3	801_802	c.519_520insAAGTAC	c.(517-522)taccag>tacAAGTACcag	p.172_173insYK	SOX10_ENST00000360880.2_In_Frame_Ins_p.172_173insYK|POLR2F_ENST00000407936.1_Intron|SOX10_ENST00000470555.1_5'Flank|POLR2F_ENST00000405557.1_Intron	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	172					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					CGCCTGGGCTGGTACTTGTAGT	0.668													ENSG00000100146																									Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)												0																																										SO:0001652	inframe_insertion	0					CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.514_519dupAAGTAC	22.37:g.38374052_38374057dupGTACTT	ENSP00000380093:p.Tyr171_Lys172dup		B4DV62|Q6FHW7	In_Frame_Ins	INS	pfam_Sox_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.173in_frame_insKY	ENST00000396884.2	37	c.520_519	CCDS13964.1	22																																																																																				SOX10	-	superfamily_HMG_box_dom,smart_HMG_box_dom		0.668	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SOX10	HGNC	protein_coding	OTTHUMT00000313875.1	0	0	0	14	14	14	0.00	0.00	-	NM_006941		38374052	-1	10	10	10	10	tier1	no_errors	ENST00000360880	ensembl	human	known	74_37	in_frame_ins	50.00	50.00	INS	1.000:1.000	GTACTT	10	10
